article
stringlengths 0
826k
| abstract
stringlengths 174
4.34k
|
|---|---|
neuroendocrine ( ne ) tumors arise from cells of the endocrine and nervous systems , including those occurring in the intestine , pancreas , lung , and elsewhere .
they share common features such as similar structural and morphological appearance and presence of secretory granules containing various peptides and hormones 1 , 2 .
ne features are seen in approximately 25% of lung cancers including small cell lung carcinoma ( sclc , comprising 20% ) , the commonest ne cancer of the lung 3 .
sclc is aggressively metastatic , and poorly differentiated ne features may contribute to the virulent behavior of this tumor .
ne cells in the normal lung airway lining include scattered individual pulmonary neuroendocrine cells ( pnecs ) and well - defined cell clusters called neuroepithelial bodies ( nebs ) ; a neb is often overlaid by a
cap of non - ciliated epithelial cells similar to club cells ( formerly clara cells ) 5 . among gene products characteristically expressed by nebs is achaete - scute homologue-1 or ascl1 ( mash1 , hash1 ) , a basic helix - loop - helix transcription factor , conserved from the drosophila achaete - scute complex . in mammals ,
ascl1 gene operates in fetal nervous system development 6 ; during neurogenesis , ascl1 gene expression is largely restricted to mitotically active precursor cells and is silenced before terminal differentiation 7 , 8 .
ascl1 plays a pivotal role in normal as well as neoplastic pulmonary ne cell differentiation 9 , 10 .
ascl1-null mice had no detectable pulmonary neuroendocrine cells 9 , while constitutive expression of ascl1 gene in transgenic mouse lung enhanced sv40-induced tumorigenesis and ne differentiation in transformed epithelial cells 11 .
inhibition of ascl1 expression by rna interference suppressed growth of lung cancer cells through cell cycle arrest and induced apoptosis in ascl1 expression - dependent manner 12 .
ascl1 was suggested to be involved in lineage - specific survival and growth of lung cancers with ne features 12 , 13 and to play a critical role in regulating tumor - initiating capacity of sclc 14 .
ascl1 is expressed in greater than 50% of sclc and large - cell neuroendocrine lung carcinomas 15 .
in addition to ascl1 , pulmonary cgrp ( calcitonin gene - related peptide ) is of particular interest .
cgrp is a 37 amino acid neuropeptide occurring in two closely - related forms , and , differing by only three amino acid residues .
cgrp and cgrp are products derived from different splice combinations of exons of calc1 and calc2 genes on human chromosome 11 16 .
cgrp is the main form expressed in both central and peripheral nervous systems , while cgrp is usually expressed in enteric tissues 17 .
these two forms , antigenically very close , are thought to possess similar biological activities .
cgrp is recognized as a biomarker for sensory nerve endings and pulmonary ne cells 4 . among 16 sclc cell lines ,
and cgrp mrnas were expressed in 8 and 13 cell lines respectively , while 12 cell lines expressed cgrp protein by radioimmunoassay 16 .
cgrp has mitogenic properties and stimulated proliferation of guinea pig tracheal epithelial cells in vitro 18 .
cultured a549 human lung carcinoma cells showed enhanced proliferation when exposed to cgrp , and rats intratracheally exposed to recombinant adenovirus expressing nuclear - targeted cgrp exhibited proliferation of lung alveolar cells 19 .
further , when lewis lung carcinoma cells were implanted in cgrp(-/- ) and wild - type mice , tumor neovascularization and growth were depressed in knockout mice compared with wild - type mice , demonstrating that endogenous host - derived cgrp may stimulate angiogenesis 20 .
thus , cgrp could play a significant role in pulmonary epithelial hyperplasia and tumor growth .
nnk ( 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone ) exposure has been associated with lung tumors in mice 21 and distinct pulmonary ne cell hyperplasia and tumors in hamsters 22 . in the current study , we employed a nnk carcinogenesis animal model with an aim to understand the adult expression pattern of ascl1 with relation to other relevant biomarkers under these conditions .
in particular , we wished to assess effects , if any , of nnk - induced hyperplasia on expression within nebs of cgrp , a recognized ne marker possessing the interesting biological properties remarked above .
other antigens examined were scgb1a1 ( club cell [ clara cell ] specific 10-kd protein , cc10 , ccsp ) , syp ( synaptophysin , another ne marker ) , and pcna ( proliferating cell nuclear antigen ) , the last included to assay the extent of hyperplastic proliferation .
syrian golden hamsters ( male , 8 - 9 weeks , n=59 , 6 - 10 animals / group ) were given three subcutaneous injections per week of either 25 mg / kg nnk or solvent alone ( trioctanoin ) as control .
the animals comprised 8 treatment groups : 6 weeks nnk exposure ; 6 weeks ' solvent - only control ; 6 weeks nnk exposure with 6 weeks ' recovery ; 6 weeks ' solvent - only control with 6 weeks ' recovery ; 24 weeks nnk exposure ; 24 weeks ' solvent - only control ; 24 weeks nnk exposure with 6 weeks ' recovery ; 24 weeks ' solvent - only control with 6 weeks ' recovery .
the number of animals was determined to obtain statistically meaningful results . at the end of each treatment period ,
the animals were killed by lethal injection , and two lung lobes from each animal were fixed in neutral buffered 4% formaldehyde , paraffin embedded , and serially sectioned ( 5 m ) .
all animals were housed in a temperature and humidity controlled specific pathogen - free facility under a 12-hour light / dark cycle with free access to water and food , and handled in a humane manner in an aaalac - accredited facility in accordance with the standards established in the nih guideline .
animal studies were carried out under protocols approval by the national cancer institute animal care and use committee .
sections were deparaffinized , rehydrated , and microwaved for 10 min in 0.05 m citrate buffer , ph 6 , for antigen retrieval .
sections were then incubated with primary antibody overnight at 4c ; primary antibodies and dilutions used are summarized in supplementary table 1 . for brightfield
single visualization of ascl1 , cgrp , pcna , or syp , biotinylated secondary antibody was applied and its localization was detected by an avidin - biotin complex ( abc ) staining method , using peroxidase and dab ( diaminobenzidine , vector laboratories , burlingame , ca ) .
nickel intensification was achieved by immersing the slides in a substrate solution containing 0.075% dab , 0.007% hydrogen peroxide , and 2% nickel sulfate in 0.1 m acetate buffer , ph 6 , for 10 min at room temperature 23 .
double staining , sections were first incubated with mouse primary antibody against ascl1 , followed by biotinylated secondary antibody , abc peroxidase and dab ( without intensification ) .
sections were then incubated with rabbit primary antibody against cgrp , followed by biotinylated secondary antibody , abc alkaline phosphatase and vector red ( vector laboratories ) , with no subsequent counterstaining . for fluorescence studies , alexa fluor
488 coupled goat anti - rabbit igg and alexa fluor 594 coupled goat anti - mouse igg ( molecular probes , eugene , or ) were used as secondary antibodies ( 1:250 ) applied in solution together for 45 min at room temperature .
sections were evaluated visually by brightfield or epi - fluorescence microscopy , and digital images were captured using metamorph software ( universal imaging corporation , downingtown , pa ) .
the number of immunopositive cells was compared within a group by unpaired t - test for statistical differences .
syrian golden hamsters ( male , 8 - 9 weeks , n=59 , 6 - 10 animals / group ) were given three subcutaneous injections per week of either 25 mg / kg nnk or solvent alone ( trioctanoin ) as control .
the animals comprised 8 treatment groups : 6 weeks nnk exposure ; 6 weeks ' solvent - only control ; 6 weeks nnk exposure with 6 weeks ' recovery ; 6 weeks ' solvent - only control with 6 weeks ' recovery ; 24 weeks nnk exposure ; 24 weeks ' solvent - only control ; 24 weeks nnk exposure with 6 weeks ' recovery ; 24 weeks ' solvent - only control with 6 weeks ' recovery .
the number of animals was determined to obtain statistically meaningful results . at the end of each treatment period ,
the animals were killed by lethal injection , and two lung lobes from each animal were fixed in neutral buffered 4% formaldehyde , paraffin embedded , and serially sectioned ( 5 m ) .
all animals were housed in a temperature and humidity controlled specific pathogen - free facility under a 12-hour light / dark cycle with free access to water and food , and handled in a humane manner in an aaalac - accredited facility in accordance with the standards established in the nih guideline .
animal studies were carried out under protocols approval by the national cancer institute animal care and use committee .
sections were deparaffinized , rehydrated , and microwaved for 10 min in 0.05 m citrate buffer , ph 6 , for antigen retrieval .
sections were then incubated with primary antibody overnight at 4c ; primary antibodies and dilutions used are summarized in supplementary table 1 .
for brightfield single visualization of ascl1 , cgrp , pcna , or syp , biotinylated secondary antibody was applied and its localization was detected by an avidin - biotin complex ( abc ) staining method , using peroxidase and dab ( diaminobenzidine , vector laboratories , burlingame , ca ) .
nickel intensification was achieved by immersing the slides in a substrate solution containing 0.075% dab , 0.007% hydrogen peroxide , and 2% nickel sulfate in 0.1 m acetate buffer , ph 6 , for 10 min at room temperature 23 .
double staining , sections were first incubated with mouse primary antibody against ascl1 , followed by biotinylated secondary antibody , abc peroxidase and dab ( without intensification ) .
sections were then incubated with rabbit primary antibody against cgrp , followed by biotinylated secondary antibody , abc alkaline phosphatase and vector red ( vector laboratories ) , with no subsequent counterstaining . for fluorescence studies , alexa fluor 488 coupled goat anti - rabbit igg and alexa fluor 594 coupled goat anti - mouse igg ( molecular probes , eugene , or )
were used as secondary antibodies ( 1:250 ) applied in solution together for 45 min at room temperature .
sections were evaluated visually by brightfield or epi - fluorescence microscopy , and digital images were captured using metamorph software ( universal imaging corporation , downingtown , pa ) .
the number of immunopositive cells was compared within a group by unpaired t - test for statistical differences .
the pulmonary ne cell population , as defined by immunoreactivity to cgrp , is represented by foci of both solitary cells and cell clusters 5 ; foci of three or more cells are described as neuroepithelial bodies ( nebs ) . in the case of normal control hamster airways ,
the great majority of nebs had a typical size of about five cells , although some nebs had appreciably more while some had fewer . both small and large nebs found in control and nnk - exposed hamsters also demonstrated positive immunostaining for syp and ascl1 ( fig .
the number of solitary ne cells ( pnecs ) was relatively small , representing only 6% of the total ne cell population in control animals , while in nnk - treated animals they numbered less than 1% .
for this reason , data presented here mainly reflect foci of the multiple - cell type .
however , even though small , solitary pnecs were recognizable by their positive cgrp or ascl1 staining .
ne hyperplasia following nnk exposure was evidenced by both an increased ratio of foci per airway ( fig .
2a ) and an increased number of ascl1-immunoreactive cells per foci , the latter considered to define foci size ( fig .
the mean number of ne foci per airway expressing ascl1 increased from 0.8 in control hamsters to 1.6 and 2.0 in hamsters exposed to nnk for 6 and 24 weeks , respectively ( fig .
this was associated with significant increases in numbers of ascl1-positive cells per foci , and the effect was more profound for the groups exposed to nnk for 24 weeks with and without 6 weeks ' recovery .
the number of ascl1-positive cells per foci in the 24wk+6wk rec group was more than 2.8 times that observed in the respective control ( fig .
such increases mainly reflected larger sizes of nebs seen in nnk - exposed animals ( fig .
2b ) . the number of cgrp - expressing cells per foci tended to be lower than ascl1-expressing cells in all groups ; in particular ,
control groups showed statistically significantly lower numbers of cgrp - expressing cells per foci than ascl1-expressing cells , while no statistically significant differences were found in respective nnk - treated groups .
this suggests that some cells were immunoreactive for ascl1 only , and nnk exposure caused a distinct decrease of this fraction .
thus , nnk exposure resulted in a larger proportion of cells co - expressing cgrp and ascl1 .
localization of cgrp was usually strongest in the basal cytoplasm of cells expressing this antigen ( fig .
expression of scgb1a1 was observed fairly consistently within nebs of both control and nnk - exposed hamsters ( fig .
3a , middle panel ) ; scgb1a1 often assumed an apical position near the airway lumen .
many ascl1-positive cells of nebs in nnk - exposed animals were also positive for scgb1a1 . as expected , scgb1a1 was widely present in normal airway club cell epithelium as well . in control animals , within ne foci ( defined by cgrp staining ) , pcna was infrequently detectable , and cell nuclei often appeared completely unlabeled ( fig .
in contrast to controls , pcna was clearly evident in many ne cell nuclei of hamsters exposed to nnk .
brightfield studies of adjacent serial sections separately stained for ascl1 , pcna , and cgrp further substantiated these observations ; pcna reactivity was much more prominent in foci of nnk - treated animals ( fig .
same cell nuclear co - localization of ascl1 with pcna appeared demonstrable in nebs of nnk - treated animals , but much less often in normal controls .
counts of pcna - positive foci ( containing one or more positive cells ) versus negative foci , using fluorescence images as shown in fig .
3a , showed that nnk - treated animals had twice as many pcna - positive foci compared to controls ( overall , 67% and 34% , respectively ; fig .
control lung sections examined did not have any tumors , and no tumors were found in hamsters after 6 weeks nnk exposure ( data not shown ) .
however , a spectrum of tumors which appeared to be nsclcs ( non - small cell lung cancers ) were seen following 24 weeks nnk exposure plus 6 weeks ' recovery ( fig .
no immunohistochemical staining of ne markers such as syp and ascl1 was detected in tumor areas , and there was no morphological evidence that the tumors were related to ne foci .
the concordance between ascl1 and the recognized ne markers cgrp and syp establishes ascl1 as an excellent marker for pulmonary ne cells .
its nuclear expression , as seen in this study , is consistent with the fact that ascl1 is a transcription factor .
unlike the situation in central nervous system development , ascl1 continues to be expressed in normal adult ne cells of the lung .
however , nnk exposure resulted in the emergence and/or proliferation of increased numbers of ascl1-positive cells ; these cells were mostly confined to foci ( nebs ) , which increased in number and size during exposure . whether the apparent ne hyperplasia was due to proliferation or simply to differentiation of preexisting silent precursor cells
is unclear ; however , prominent pcna immunoreactivity of many cells within nebs following nnk stimulation ( compared with the frequent pcna negativity of small normal nebs in unexposed controls ) suggests that such cells had entered s phase and would proliferate .
examples of same - cell nuclear co - expression of ascl1 and pcna were observed in adjacent serial sections of nebs from nnk - exposed animals , suggesting that some ascl1-expressing cells were actively proliferating .
nevertheless , while it is often observed that pcna levels rise during late g1 and s phases 24 , the role of pcna in relation to cell cycle and dna synthesis is complex 25 . often , 5-bromodeoxyuridine incorporation and pcna immunoreactivity do not correlate well 26 .
those considerations aside , however , it does seem likely that proliferation had occurred , because many nebs were physically much larger in nnk - exposed animals , as compared to typical nebs in controls .
cellular co - localization of ascl1 and cgrp was unmistakable , with the majority of cells expressing both markers , suggesting a mature ne phenotype .
the focal pattern of ascl1 immunoreactivity , mainly associated with nebs , may suggest the presence of a stem or progenitor population in this location that , especially when stimulated , matures into cgrp - expressing cells . with adult lung tissue injury ,
ne cells also possess the capacity to produce club cells and ciliated cells , with occasional co - expression of cgrp and scgb1a1 4 . in this study , we noted ascl1-positive cells , particularly following nnk stimulation , that were also immunoreactive for scgb1a1 , the club cell specific protein .
this is suggestive of bidirectional differentiation 5 of neb cells after nnk exposure along either ne or epithelial pathways ( i.e. , toward expression of cgrp or scgb1a1 , respectively ) .
possibly , the uncommitted progenitor stage of this development is an ascl1-expressing cell of fundamental ne lineage . in this study ,
consistent with previous work 22 , nnk induced both ne hyperplasia and non - ne neoplasia . of numerous and varied tumors seen in the present study ,
also , there was no morphological evidence for a direct developmental relationship between hyperplastic neb tissue and nearby tumors .
it would appear that the nnk dosage regimen applied in these experiments is hyperplasia - inducing for ne cells but insufficient to induce their neoplasia .
however , insight might be gained from electron microscope studies 27 - 29 of lungs in hamsters treated with various nitrosamines ( n - diethylnitrosamine , n - dibutylnitrosamine , n - nitrosomorpholine , nitrosoheptamethyleneimine ) .
those studies demonstrated nitrosamine - induced hyperplasia in both airway ne cells ( described as apud cells ) and club ( clara ) cells . under prolonged treatment ,
on the other hand , ne cells tended toward squamous metaplasia while progressively losing their characteristic dense - cored neurosecretory granules ( their ultrastructural hallmark ) which sometimes became so scarce that ne - derived cells were difficult to identify .
therefore , in our present study , ne - negative tumors may have contained some ne - derived cells with neurosecretory markers too reduced to be detectable by immunohistochemistry . that hyperplastic areas were often scgb1a1 positive ( see figure 3a , nnk middle frame ) also suggests contribution from a club cell lineage .
possibly the neoplastic origins of nnk - induced tumors included both club cells and ne cells , even though the resulting tumors appeared to be ne - immunonegative .
whether and how the increased nebs might relate to development of nnk - induced nsclc - type tumors remains to be determined .
ascl1 and cgrp expressed in the lung , both by nebs and by solitary pnecs , may play roles in supporting carcinogenesis , regardless what the actual cellular origin of a tumor might be . among solitary pnecs ,
abundantly scattered within the airway epithelium , some co - express cgrp and the ne marker pgp9.5 30 .
regulation of cgrp synthesis is poorly understood , but it was suggested that ascl1 may act as a transactivation factor for the calcitonin / cgrp gene complex 31 , 32 .
neb hypertrophy and proliferation occur following experimental exposure to bleomycin 33 , naphthalene 34 , or nnk as in the present study ; these all induce damage and/or inflammation .
cgrp is a mitogen and a pro - angiogenesis agent ; it is also the most powerful microvascular dilator known 17 .
these biological activities suggest that cgrp could play a role in promoting and supporting epithelial repair and/or pathological hypertrophy in damaged lung epithelium . with coincidental cancer - initiating gene mutations in lung epithelial cells , or perhaps even in ne cells themselves , ascl1 and cgrp working in concert along with other cellular factors which doubtless may be present , such as vegf ( vascular endothelial growth factor ) 20 , might sustain and encourage a neoplastic growth .
the actions of cgrp through stimulating cell proliferation , promoting angiogenesis , and enabling increased local nutritional supply through microvascular dilation might be ways in which this could occur .
the influence of ascl1 toward increasing the expressions of both cgrp and the anti - apoptotic regulator bcl2 35 may also contribute to survival of a neoplasm and favor its growth , once initiated . in conclusion
, this study demonstrated a consistent close association between expressions of ascl1 and the ne marker cgrp in pulmonary nebs .
individual neb cells co - express these two biomarkers , and some cells express scgb1a1 also .
nnk exposure in a chemical carcinogenesis hamster model induces hyperplastic increases both in size and number of airway nebs , presumably enhancing net pulmonary expressions of both ascl1 and cgrp . that actual cell proliferation is responsible for these increases is supported by nuclear co - expression of ascl1 and pcna . in the current experiments , nnk induced a variety of lung tumors , all nsclc types , which did not express detectable ne markers .
whether higher levels of nnk or a longer latency time is required to induce actual ne tumors , and to what extent ascl1-expressing cells might proliferate and play a developmental role in such a process , remain to be seen .
a tentative hypothesis is offered in which , regardless of the cellular origin of a lung neoplasm , both ascl1 and cgrp may contribute to the survival and growth of an established tumor .
| achaete - scute homologue-1 or ascl1 ( mash1 , hash1 ) plays roles in neural development and pulmonary neuroendocrine ( ne ) differentiation , and it is expressed in certain lung cancers .
this study was aimed to assess whether and/or how ascl1 plays a role in 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone ( nnk)-induced pulmonary ne hyperplasia and carcinogenesis in hamsters .
hamsters were injected 3 times weekly with either nnk or solvent alone ( control ) for treatment periods of 6 and 24 weeks , both without and with 6-week recovery .
immunohistochemical analysis was carried out to examine the expressions of ascl1 , cgrp ( calcitonin gene - related peptide ) , secretoglobin scgb1a1 ( club [ clara ] cell specific 10 kd protein , cc10 , ccsp ) , synaptophysin ( syp ) , and pcna ( proliferating cell nuclear antigen ) .
the number of ascl1-expressing ne foci per airway increased from 0.8 in controls to 1.6 and 2.0 during nnk exposure for 6 and 24 weeks , respectively , and the number of cells per foci doubled after nnk exposure .
most ascl1-expressing cells in nebs ( neuroepithelial bodies ) were also cgrp immunoreactive ; nnk enhanced this co - expression with cgrp , a ne marker with known proliferation - promoting properties .
nnk also increased pcna expression within ne foci .
nnk - induced tumors showed no immunoreactivity for ne markers .
this study confirms ascl1 as an excellent marker for pulmonary ne cells and demonstrates cgrp co - expression in ascl1-positive neb cells participating in nnk - induced ne hyperplasia . |
monoamine oxidases are widely distributed enzymes that contain a flavin adenine dinucleotide ( fad ) covalently bounded to a cysteine residue ( 1 ) .
many living organisms possess maos and in mammals two isoforms are present , mao - a and mao - b , located in the outer membrane of the mitochondria .
these two isoforms are involved in the oxidative deamination of exogenous and endogenous amines , including neurotransmitters , thus modulating their concentrations in the brain and peripheral tissues .
physiologically , maos oxidize biogenic neurotransmitters such as dopamine , norepinephrine , 5-hydroxytryptamine ( 5-ht , serotonin ) and -phenethylamine , dietary , and xenobiotic amines such as tyramine and benzylamine ( 2 , 3 ) .
mao - a inhibitors are frequently used as antidepressants and anti - anxiety agents while mao - b inhibitors , alone or combined with l - dopa , are relevant tools in the therapy of alzheimer s and parkinson s diseases ( 4 ) .
development of mao inhibitors is important not only from the standpoint of symptomatic treatment , but also with regard to the neuroprotective effects ( 5 ) .
jun za in traditional chinese - tibetan medicine , have been used as medicament of astriction , choleplania and pyrexia in tibet , china for thousands of years ( 6 ) . in the searching for naturally occurring mao inhibitors from plant
, we found that the extract of rheum palmatum showed potential mao inhibition with ic50 of 10.49 g / ml ( 7 ) .
further bioactivity - guided fractionation resulted in the isolation of seven stilbenes and one catechin .
herein the report , isolation , structure elucidation and mao inhibitory property of these compounds is demonstrated .
general experimental procedures
nmr spectra were recorded with a varian mercury-400bb nmr spectrometer .
semi preparative hplc system consisted of a jasco pu-2086 plus , uv -2075 plus detector and ymc - pack ods - a column ( 5m , 250 10 mm , ymc co. ltd . ) .
silica gel 200 - 300 mesh for column chromatography and silica gf254 for tlc were supplied by the qingdao marine chemical inc . , china .
mci - gel chp20 ( 75 - 150m ) were from mitsubishi chemical holdings corp .
macroporous resin ( hpd-100 ) were purchased from cangzhou baoen chemical inc . , china .
polyamide 100 - 200 mesh for column chromatography was purchased from taizhou luqiao sijia biochemical plastic factory , china .
rhizomes of rheum palmatum were purchased from bayi herb market in xining , china , which were identified by associate professor , lin yang who majored in plant classification , school of life science and engineering , lanzhou university of technology , lanzhou , china . a voucher specimen ( no .
2011071719 ) is deposited at the school of life science and engineering , lanzhou university of technology .
extraction and isolation
dried rhizomes of rheum palmatum ( 2.4 kg ) were powdered and refluxed with etoh ( 15 l2 ) for 2 h. the etoh extract was evaporated in vacuo , yielding a extractum . to remove alkaline constituent ,
the extractum was suspended with distilled water ( 2 l ) and adjusted ph to 10 - 11 , then filtered .
the filtrate was adjusted ph to 2 - 3 , and extracted with the etoac 3 times .
the etoac extract liquor was evaporated in vacuo , yielding a extractum ( 80 g ) .
the extractum was suffered on pre - fractionation using macroporous resin ( hpd-100 , cangzhou bon absorber technology co. ltd . ,
china ) ( 5 kg ) with a step gradient of etoh - h2o solvent system ( 0:100 , 30:70 , 50:50 , 70:30 , 100:0 , v / v ) as an eluent to yield 6 fractions ( a1~a6 ) .
a3 ( 16 g ) was chromatographed on polyamide ( 100 - 200 mesh , 300 g ) using a step gradient of meoh - h2o solvent system ( 0:100 , 30:70 , 50:50 , 70:30 , 100:0 , v / v ) as an eluent to yield 6 fractions ( a3 - 1~a3 - 6 ) .
a3 - 5 ( 2 g ) was re - chromatographed on mci gel ( 200 g ) with a stepwise gradient of meoh - h2o solvent system ( 0:100 , 30:70 , 50:50 , 70:30 , 100:0 , v / v ) as an eluent to yield 6 fractions ( a3 - 5 - 1~a3 - 5 - 6 ) .
a3 - 5 - 4 ( 350 mg ) was separated successively on silica gel ( 200 - 400 mesh , 350 g ) with a stepwise gradient of chcl3 and meoh ( 20:1 , 15:1 , 10:1 , 5:1 , 1:1 , v / v ) to produce compounds 4 ( 130 mg ) and 2 ( 10 mg ) .
a3 - 5 - 3 ( 50 mg ) was purified by polyamide ( 100 - 200 mesh , 50 g ) using meoh - h2o ( 50:50 , v / v ) as a solvent system to give 6 ( 15 mg ) .
a3 - 5 - 6 ( 30 mg ) was re - crystallized with meoh to yield 1 ( 20 mg ) .
a5 ( 15 g ) was purified by silica gel ( 200 - 400 mesh,150 g ) with a stepwise gradient of chcl3 and meoh ( 20:1 , 15:1 , 10:1 , 5:1 , 1:1 , v / v ) as an eluent to yield 5 fractions ( a5 - 1~a5 - 5 ) , a5 - 5 ( 1 g ) was purified by silica gel(200 - 400 mesh , 150 g ) with a stepwise gradient of petroleum ether - acetone(10:1 - 1:1 , v / v ) to produce 8 ( 30 mg ) .
a1(2 g ) was chromatographed on silica gel ( 200 - 400 mesh , 200 g ) with a stepwise gradient of chcl3 and meoh ( 10:1 , 8:1 , 5:1 , 1:1 , v / v ) to produce 7 ( 10 mg ) .
a1 - 1 ( 40 mg ) and a1 - 2 ( 100 mg ) were separated successively by semi - preparative hplc ( ymc - pack ods - a , 250 10 mm , 5 m , flow rate 2 ml / min ) eluting with meoh - h2o ( 40:60 , v / v ) to produce 5 ( 15 mg , tr 28 min ) and 3 ( 10 mg , tr 43 min ) , respectively .
h - nmr ( 400 mhz , cd3cocd3 ) : ppm 7.07 ( 1h , d , j = 2.0 hz , h-2 ' ) , 6.95 ( 1h , d , j = 16.0 hz , h- ) , 6.90 ( 1h , dd , j = 8.0 , 1.2 hz , h-6 ' ) , 6.80 ( 2h , m , h- , 5 ' ) , 6.53(2h , s , h-2,6 ) , 6.26 ( 1h , s , h-4 ) .
c - nmr ( 100 mhz , cd3cocd3 ) : 159.8 ( c-3 , 5 ) , 146.6 ( c-3 ' ) , 141.4 ( c-1 ) , 131.2 ( c-1 ' ) , 129.8 ( c- ) , 127.1 ( c- ) , 120.3 ( c-6 ' ) , 120.3 ( c-6 ' ) , 116.6 ( c-5 ' ) , 114.0 ( c-2 ' ) , 105.9 ( c-2,6 ) , 102.8 ( c-4 ) .
( 8) white powder , c14h12o3.h - nmr ( 400 mhz , cd3cocd3 ) : ppm7.42 ( 2h , d , j = 8.4hz , h-2 ' , 6 ' ) , 7.02 ( 1h , d , j = 16.6 hz , h- ) , 6.88 ( 1h , d , j = 16.6 hz , h- ) , 6.84 ( 2h , d , j = 8.3 hz , h-3 ' , 5 ' ) , 6.54 ( 2h , d , j = 2.0 hz , h-2 , 6 ) , 6.27 ( 1h , d , j = 2.0 hz , h-4 ) .
ppm 159.6 ( c-3 , 5 ) , 158.2 ( c-4 ' ) , 141.0 ( c-1 ) , 130.0 ( c-1 ' ) , 129.2 ( c- ) , 128.8 ( c-2 ' , 6 ' ) , 126.9 ( c- ) , 116.5 ( c-3 ' , 5 ' ) , 105.8 ( c-2 , 6 ) , 102.7 ( c-4 ) ( 9 ) .
h - nmr ( 400 mhz , cd3od ) : ppm 7.35 ( 2h , d , j = 8.0 hz , h-2 ' , 6 ' ) , 7.02 ( 1h , d , j = 16.0 hz , h- ) , 6.83 ( 1h , d , j = 16.0 hz , h- ) , 6.78 ( 3h , m , h-2 , 3 ' , 5 ' ) , 6.60 ( 1h , brs , h-6 ) , 6.43 ( 1h , brs , h-4 ) , 4.90 ( 1h , d , j = 7.2 hz , h-1 '' ) , 3.303.47 ( 4h , m , h-2 '' , 3 '' , 4 '' and 5 '' ) , 3.70 ( 1h , dd , j = 11.0 , 5.4 hz , h-6b '' ) , 3.90 ( 1h , dd , j = 11.0 , 1.5 hz , h-6a '' ) ( 10 ) .
yellow amorphous powder , c20h22o9.h - nmr ( 400 mhz , cd3cocd3 ) : ppm 7.09 ( 1h , brs , h-2 ' ) , 6.86 - 6.99 ( 4h , m , h-5 ' , h-6 ' , h- , h- ) , 6.55 ( 2h , brs , h-2 , 6 ) , 6.27 ( 1h , brs , h-4 ) , 3.84 ( 3h , s , 4'-och3 ) .
c - nmr ( 100 mhz , cd3cocd3 ) : ppm 159.5 ( c-3 , 5 ) , 148.3 ( c-3 ' ) , 147.6 ( c-4 ' ) , 140.7 ( c-1 ) , 131.7 ( c-1 ' ) , 129.1 ( c- ) , 127.6 ( c- ) , 119.7 ( c-2 ' ) , 113.2 ( c-5 ' ) , 112.3 ( c-6 ' ) , 105.7 ( c-2 , 6 ) , 102.7 ( c-4 ) , 56.2 ( 4'-och3 ) ( 11 ) .
h - nmr ( 400 mhz , cd3od ) : ppm 7.46 ( 1h , d , brs , h-2 ' ) , 7.05 ( 1h , dd , j = 2.0 , 8.6 hz , h-6 ' ) , 6.92 ( 1h , d , j = 16.4 hz , h- ) , 6.81 ( 2h , m , h- , 5 ' ) , 6.45 ( 2h , d , brs , h-2 , 6 ) , 6.16 ( 1h , brs , h-4 ) , 4.80 ( 1h , d , j = 7.6 hz , h-1 '' ) , 3.94 ( 1h , j = 11.0 , 1.5 hz , h-6a '' ) , 3.72 ( 1h , dd , j = 11.0 , 5.4 hz , h-6b '' ) , 3.30 - 3.52 ( 4h , m , h-2 '' toh-5 '' ) .
c - nmr ( 400 mhz , cd3od ) ppm : 159.6 ( c-3 , 5 ) , 148.4 ( c-3 ' ) , 147.1 ( c-4 ' ) , 141.1 ( c-1 ) , 131.2 ( c-1 ' ) , 129.2 ( c-),127.7 ( c- ) , 123.6 ( c-6 ' ) , 117.2 ( c-5 ' ) , 116.6 ( c-2 ' ) , 105.8(c-2 , 6 ) , 104.5 ( c-4 ) , 102.7 ( c-1 '' ) , 78.6 ( c-5 '' ) , 77.8 ( c-2 '' ) , 75.1 ( c-3 '' ) , 71.6 ( c-4 '' ) , 62.7 ( c-6 '' ) ( 8) . light yellow amorphous powder , c15h14o4 .
h - nmr ( 400 mhz , cd3od ) : ppm 7.00 ( 1h , d , brs , h-2 ' ) , 6.81 - 6.98 ( 5h , m , h-2 , 5 ' , 6 ' , , ) , 6.61 ( 1h , brs , h-2 ) , 6.45 ( 1h , brs , h-4 ) , 3.82 ( 3h , s , 4'-och3 ) , 4.88 ( 1h , d , j = 7.6 hz , h-1 '' ) , 3.92(1h , j = 11.0 , 2.0 hz , glc h-6a '' ) , 3.70 ( 1h , dd , j = 11.0 , 5.6 hz , glc h-6b '' ) , 3.35 - 3.50 ( 4h , m , h-2 '' toh-5 '' ) .
c - nmr ( 100 mhz , cd3od ) : ppm 160.4(c-5 ) , 159.6 ( c-3 ) , 149.1 ( c-4 ' ) , 147.9 ( c-3 ' ) , 141.3 ( c-1 ) , 132.4 ( c-1'),129.5 ( c- ) , 128.0 ( c- ) , 120.2 ( c-6 ' ) , 113.8 ( c-2 ' ) , 112.9(c-5 ' ) , 108.3 ( c-6 ) , 107.0 ( c-2 ) , 104.1 ( c-4 ) , 102.4 ( c-1 '' ) , 78.2 ( c-5 '' ) , 78.0 ( c-3 '' ) , 74.9 ( c-2 '' ) , 71.5 ( c-4 '' ) , 62.6 ( c-6 '' ) , 56.5 ( 4'-och3 ) ( 11 ) .
h - nmr ( cd3od , 400 mhz ) : ppm 6.83 ( 1h , d , j = 1.8 hz , h-2 ' ) , 6.75 ( 1h , d , j = 8.2 hz , h-5 ' ) , 6.71 ( 1h , dd , j = 8.1,1.8 hz , h-60 ) , 5.92 ( 1h , br s , h-8 ) , 5.85 ( 1h , d , j = 2.2 hz , h-6 ) , 4.56 ( 1h , d , j = 7.4 hz , h-2 ) , 3.97 ( 1h , m , h-3 ) , 2.84 ( 1h , dd , j = 16.0 , 5.2 hz , h-4a ) , 2.50 ( 1h , dd , j = 16.1 , 8.1 hz , h-4b ) ( 12 ) .
h - nmr ( cd3od,400 mhz ) : ppm 7.41 ( 2h , d , j = 8.8 hz , h-2 ' , 6 ' ) , 6.97 ( 1h , d , j = 16.0 hz , h- ) , 6.81 - 6.88 ( 3h , m , h-3 ' , 5 ' , ) , 6.46 ( 2h , brs , h-2 , 6 ) , 6.16 ( 1h , brs , h-4 ) , 3.77 ( 3h , s , 4'-och3 ) .
c - nmr ( 100 mhz , cd3od ) : ppm : 160.9 ( c-4 ' ) , 159.8 ( c-3 , 5 ) , 141.3 ( c-1 ) , 131.6 ( c-1 ' ) , 129.2 ( c- ) , 128.8 ( c-2 ' , 6 ' ) , 127.9 ( c- ) , 115.2 ( c-3 ' , 5 ' ) , 105.9 ( c-2 , 6 ) 102.9 ( c-4 ) , 55.8 ( 4'-och3 ) ( 9 ) .
in - vitro monoamine oxidase inhibition assay
preparation of rat liver homogenates
mao was partially purified by isolation of mitochondria from rat liver homogenates by a slightly modied with holt s method ( 13 ) . briefly , male wistar rats ( 280300 g )
were euthanised by cervical dislocation and livers dissected out , washed in ice - cold sodium phosphate buffer ( 0.2 m , ph 7.6 ) , liver tissue was homogenized 1:10 ( w / v ) in 0.3 m sucrose .
the homogenate was centrifugated at 1000 g for 10 min , the supernatant was draw off , the pellet was centrifugated at 1200 g for 15 min after washed with 20 ml 0.3 m sucrose .
supernatants were combined and further centrifuged at 10,000 g for 30 min to obtain mitochondrial pellet .
the pellet was resuspended in 4 ml of phosphate buffer ( 0.2 m ; ph 7.6 ) and stored at 4 c .
suspensions of mao were diluted eight times before use , and it must be used up in 7 days .
monoamine oxidase assay
monoamine oxidase inhibition activity was measured in the 96-well microplates according to the method reported by holt et al . with some modifications ( holt et al . , 1997 ) .
briey , 40 l enzyme and 40 l sample solution were placed in 96-well microplates and pre - incubated at 37 c for 20 min .
the reaction was started by adding 120 l amino substrate ( 2.5 mm tyramine in sodium phosphate buffer ) , 40 l chromogenic solution ( 1 mm vanillic acid , 0.5 mm 4-aminoantipyrine , 4 u / ml peroxidase in sodium phosphate buffer ) , and the total solution was incubated at 37 c for 60 min .
blanks were set up by adding 40 l buffer solutions instead of 40 l sample solution .
blank negative controls were set up by adding 160 l buffer solutions instead of 40 l sample solution and 120 l substrate solution .
sample controls were set up by adding 120 l buffer solution instead of 120 l substrate solution aiming to deduct sample background .
the inhibition rate ( % ) was calculated by the following equation : inhibition rate% = 100% inhibitory activity was expressed as the mean of 50% inhibitory concentration ( ic50 ) , obtained by interpolation of concentration - inhibition curves .
the selectivity of sample against mao - a and mao - b were also evaluated in this assay . to test specific mao - a activity ,
the rat liver homogenate was pre - incubated ( 37 c ; 30 min ) with 500 nm pargyline ( a selective inhibitor of mao - b ) to entirely inhibit mao - b . to test specific mao - b activity ,
the rat liver homogenate was pre - incubated ( 37 c ; 30 min ) with 500 nm clorgyline ( a selective inhibitor of mao - a ) to entirely inhibit mao - a .
after the enzyme was pre - incubated , the ic50 values of sample against mao - a and mao - b were determined respectively according above method . in order to further study of structure activity relationship
, we have docked three representative compounds 2 , 4 , 8 into the active site of mao .
the representative crystal structures of mao - a with harmine ( pdb code : 2z5x ) and mao - b with safinamide ( pdb code : 2v5z ) were obtained from the protein data bank .
protein preparation wizard panel tool was used to prepare the protein which include removing crystallographic water molecules , adding hydrogen atoms , assigning partial charges with the opls-2005 force field , assigning protonation states and minimizing the structures .
three dimensional structures of compounds 2 , 4 , 8 were built in chembio3d ultra 11.0 and the geometry was optimized with mm2 force field .
then the ligprep module ( ligprep , version 2.5 , schrdinger , llc , new york , ny , 2012 ) was used to assign protonation states at a target ph value of 7.0 2.0 .
docking grid boxes of mao - a and mao - b were defined by centering on the ligand in 2z5x and 2v5z respectively . the molecular docking was performed using the glide ( glide , version 5.8 , schrdinger , llc , new york , ny , 2012 ) in standard precision ( sp ) mode . as a result ,
highest scoring docking poses of compound 2 , 4 , 8 in two kinds of protein receptors were selected for further analysis .
repeated column chromatography resulted in the isolation of eight compounds 1 - 8 ( figure 1 ) . by comparing nmr data with those published in the literature ,
1 - 8 were identified as piceatannol 1 , resveratrol 2 , piceid 3 , rhapontigenin 4 , piceatannol-3'-o--d - glucopyranoside 5 , rhapontigenin 6 , catechin 7 and desoxyrhapontigenin 8 .
the inhibitory effects of the isolated compounds 1 - 8 on mao , were showed in table 1 . as shown in table 1 .
compounds 2 , 3 , 6 and 7 exhibited weak inhibitory activity against mixed type mao ; compounds 4 , 5 exhibited moderate inhibitory activity ; whereas , compounds 1 and 8 displayed significant inhibitory activity with the ic50 values 16.4 and 11.5 m , respectively , which were close to those of positive control ( ( + ) iproniazid phosphate ic50 = 7.0 m ) . the selectivity of compounds 1 - 8 against mao - a and mao - b were also evaluated . the results ( table 1 . ) showed that compounds 468 preferred to inhibit mao - a rather than mao - b with selectivity values ( [ ic50 of mao - b]/ [ ic50 of mao - a ] ) of 4.74 , 10.01 and 9.42 respectively .
the preliminary structure - activity relationships ( sars ) could be drawn from the data of table 1 . as follows : ( 1 ) the activity of stilbenes ( compounds 1 - 6 , 8) was better than that of flavanol ( compound 7 ) .
( 2 ) the methoxyl at the c-4 position of stilbenes plays an important role for mao - a selectivity .
for example , compounds 4 , 6 , 8 which all have a methoxyl at the c-4 position exhibited relatively strong inhibition potencies towards mao - a compared to mao - b .
( 3 ) only one methoxyl group at c-4 position and no other substituent groups on b - ring , were favorable for mao ( mixed - type mao , mao - a and mao - b ) inhibition .
for example , compound 8 , with only one methoxyl group at c-4 position showed the best inhibitory activity , and the activity of compound 2 ( a demethylated product of 8) decreased almost 8 times for mixed type mao , 20 times for mao - a , 4 times for mao - a , compared to that of 8 .
this influence was also reflected between 4 and 8 , 4 with an extra hydroxyl at c-3 position having weaker activity than 8 . the fact that compounds 1 , 3 , 5 with no methoxyl group at c-4 and compound 6 with methoxyl group at c-4 but also with an extra groups at c-3 , showed weaker activity than 8 , further supported the conclusion that only one methoxyl at c-4 position were important for mao inhibition .
( 4 ) the influences of the glycosyls at a - ring on activity have no rules .
for example , the activity of 6 ( the glucoside of 4 ) against mixed - type mao and mao - b have a little decrease compared to 4 , but the activity of 3 ( the glucoside of 2 ) against mao - a and mao - b have a little increase compared to 2 .
the predicted binding mode of compounds 2 , 4 , 8 to mao - a and mao - b .
the side chains of the active site residues ( green or blue sticks ) and compounds 2 , 4 , 8 ( magenta sticks ) were represented as stick model the superimposition of the ligand in mao - a ( orange ) and mao - b ( magentas ) .
values are the mean sd of triplicate experiments . the calculated binding free energy of 2 , 4 , 8with mao .
compound 2 , 4 , 8 were selected to explore the possible interaction mode between ligand and the active site of mao - a and mao - b .
figure 2 . showed the interaction mode of 2 , 4 , 8 with mao - a and mao - b . among the three compounds , 8 had the best binding affinity with both mao - a and mao - b .
the two hydroxyl on the ring a of 8 formed hydrogen bonds with thr336 and phe208 residues of mao - a , respectively ( figure 2a ) .
the methoxyl on the ring b of 8 had a strong van der waals interaction with fad in mao - a ( figure 2a ) .
for the interaction mode between 8 and mao - b , one hydrogen bond formed by the hydroxyl group of the ring a with pro102 was observed , and the amino acid residues ile199leu71tyr326 and phe168 showed relatively strong hydrophobic interaction with compound 8 . compound 4 adopted the same conformation as 8 , as seen in figure 2c .
2d . however , the affinity of 4 with mao - a and mao - b were weaker than those of 8 . in terms of mao - a ,
the hydroxyl at c-3 position of 4 produce strong steric repulsion with tyr444 which caused some degree of twist of the ring b and also reduced the van der waals interaction between the 4-och3 and fad . for mao - b ,
the ring a of 4 had some degree of twist which led to - stacking interaction of phe168 and phe103 with ligand decrease .
above results indicated the introduction of -oh in ortho position of -och3 would result in decrease of interaction of active pocket of enzyme and ligand .
figure 2e and 2f . showed the interaction mode of 2 with mao - a and mao - b .
the location of ring a and ring b of compound 2 caused the loss of hydrogen bond interaction with specific residues and decrease of the van der waals interaction with fad .
as a result , the activity of 2 against mao - a and mao - b decreased remarkably .
the docking results above , revealed that the removal of -och3 at c-4 was disadvantageous to activity .
to explain the reason that the methoxyl at the c-4 position of stilbenes plays an important role for mao - a selectivity , we aligned the conformations of compound 2 and 8 in mao - a to those in mao - b . figure 3 .
is the superimposition of the location of compound 2 and 8 in mao - a and mao - b binding pocket ( orange is for mao - a and magentas is for mao - b ) . although the structures of mao - a and mao - b have some similarity , there are still some key amino acids different in binding pocket ( mao - a : phe208 , ile335 ; mao - b : ile199 , tyr326 ) which cause ligands are closer to fad in mao - a than in mao - b when binding to the active site . since compound 2 with no -och3 at c-4 only has relatively weak van der waals interaction with fad in mao - a or mao - b , the distance of 2 and fad less affected the mao inhibitory activity .
thus , the selectivity of 2 against mao - a and mao - b is weak .
however , for compound 8 , due to the presence of a -och3 at c-4 , the van der waals interactions between -och3 and fad tend to play a key role in the interaction of ligand and active pocket .
because the distance between 8 and the fad in mao - a pocket is shorter than that in mao - b , the hydrophobic interactions of 8 with mao - a will be stronger than that of 8 with mao - b .
this explain the reason that 8 prefer to inhibit mao - a rather than mao - b .
in addition , the binding free energy of 2 , 4 and 8 were also calculated which were found to correlate well with experimental results , as shown in table 2 . up to now , many pant extracts have been reported with potential mao inhibitory activity which suggested that plant is a good source for finding new maois .
( 14 ) screened 905 natural extracts for their human mao - b inhibitory activity .
the data showed some extracts showed strong inhibitory activity and few of that inhibited mao - b within therapeutic range .
in conclusion , seven mao inhibitors with stilbene skeleton ( compound 1 - 6 , 8) have been obtained and their preliminary structure activity relationships ( sars ) were also discussed .
the result shows that : ( 1 ) the 4-och3 of stilbenes were important for mao inhibitory activity and selectivity .
( 2 ) except for 4-och3 , the presences of other substituent group at ring b were disadvantageous to mao inhibition .
| seven stilbenes and one catechin were bioactivity - guidedly isolated from the rhizomes of rheum palmatem .
their structures were identified as piceatannol ( 1 ) , resveratrol ( 2 ) , piceid ( 3 ) , rhapontigenin ( 4 ) , piceatannol-3-o--d - glucopyranoside ( 5 ) , rhaponticin ( 6 ) , catechin ( 7 ) and desoxyrhapontigenin ( 8) .
anti - monoamine oxidase ( mao ) activities of compounds 18 were tested .
compounds 1 and 8 showed significant mao inhibitory activities with ic50 values 16.4 1.5 m and 11.5 1.1 , respectively , when the ic50 value of iproniazid as a standard was 6.5 0.5 m . the selectivity of compounds 1 - 8 against mao - a and mao - b were also evaluated .
the results showed that compounds 468 preferred to inhibit mao - a rather than mao - b with selectivity values ( [ ic50 of mao - b]/ [ ic50 of mao - a ] ) of 4.74 , 10.01 and 9.42 , respectively .
the preliminary structure activity relationships ( sars ) of these compounds were discussed and the molecular modeling was also performed to explore the binding mode of inhibitors at the active site of mao - a and mao - b . |
azathioprine is a prodrug purine analog thought to exert its immunosuppressive effect through reduction in the proliferation of immune cells by interfering with lymphocyte dna replication and rna synthesis , and via downregulation of the antiapoptotic protein bcl - xl leading to premature apoptosis .
increased use of azathioprine in inflammatory bowel disease ( ibd ) is a consequence of studies confirming its effect in maintenance of remission and reduction in episodes of disease relapse .
serious adverse effects of azathioprine include pancreatitis , bone marrow suppression , sepsis , allergic reactions , and drug - induced hepatitis .
of more recent concern is the long - term risks of thiopurine - mediated malignancy .
it has been shown that patients with sustained leukopenia during 6-mercaptopurine ( a metabolite of azathioprine ) therapy had an increased risk of hematologic malignancies compared with control patients .
an emerging concern centers on the synergistic risk of malignancy in ibd when azathioprine or 6-mercaptopurine is combined with biologic anti - tumor necrosis factor agents .
knowledge of how azathioprine interacts with bone marrow stem cells over time is necessary to understand the balance between the benefits of disease control and reducing the risk of future malignancy and other adverse events .
fraser et al . showed that lower white blood cell ( wbc ) count , lower neutrophil count , and independently higher mean corpuscular volume ( mcv ) , but not lymphocyte count , were good predictors of achieving and maintaining remission .
. found that mcv could be used as a surrogate marker for 6-thioguanine nucleotide concentration .
however , their study was unable to link changes in mcv with toxicity or to identify a significant relationship with leukocyte counts .
there are no studies that have defined the temporal and dose - response relationships in hematologic parameters in children treated with azathioprine . in order to further understand how these parameters change in children with ibd treated with azathioprine ,
this study specifically aimed to ( i ) statistically describe the relationship between mcv and differential wbc count over time in children with ibd treated with azathioprine ; and ( ii ) determine the effect of age , sex , diagnosis , azathioprine dose per kg of bodyweight , thiopurine methyltransferase ( tpmt ) level , and additional therapy on this relationship .
patients attending the sheffield children s hospital ( sheffield , uk ) who were prescribed azathioprine from april 2002 to april 2007 were identified from the hospital pharmacy database .
case notes and laboratory data were reviewed to determine patient demographics , hematologic indices , azathioprine dosage , bodyweight , and additional treatment modalities over predefined time intervals .
these time intervals were defined as t1 ( baseline values within 6 months prior to commencing azathioprine ) , t2 ( 23 months after commencement of azathioprine ) , t3 ( 56 months after commencement of azathioprine ) , t4 ( 1112 months after commencement of azathioprine ) , and t5 ( 2324 months after commencement of azathioprine ) . where multiple values for laboratory results were present in the predefined time windows , an average value was taken of those readings qualifying for study inclusion .
comparison of summary values was via mann - whitney u test for non - parametric data and paired t - test for parametric data ( changes from baseline analysis ) .
trends were tested for significance by anova and more complex interactions between hematological parameters , sex , age , tpmt , and diagnosis by multiple regression analysis .
sixteen patients were excluded from the analysis on the basis of the following predefined criteria : ( i ) six children had incomplete or unobtainable data for the first 3 months of commencing azathioprine ; ( ii ) seven patients were transferred to adult services within 3 months of commencing azathioprine ; and ( iii ) three children discontinued azathioprine in the first 3 months as a consequence of adverse reactions ( two with hyperamylasemia and one with neutropenia ) .
mcv was notably lower in the group of patients with crohn s disease ( 74.7 fl [ sd 7.5 ] vs 79.1 fl [ sd 6.2 ] ; p < 0.05 ) when compared with the second largest group , namely indeterminate colitis .
the patient numbers at each successive time interval , which are presented in table ii , demonstrate that the majority of patients were within 12 months of commencing azathioprine therapy .
patient characteristics mean timepoint at each analysis ( standard deviation given in parentheses ) total wbc and neutrophil count fell steadily within the first 6 months of treatment then reached a plateau between 6 and 24 months ( figure 1 ) .
the mean values at t3t5 were approximately 25% lower than the values at baseline ( mean minimum total wbc count of 7.6 10/l [ sd 0.4 ] p < 0.05 occurring at 5.8 months [ sd 0.2 ] p < 0.05 .
conversely , mcv increased steadily within the first 6 months of treatment , with a plateau between 12 and 24 months ( figure 2 ) .
this equates to a mean maximum mcv of 87.9 fl ( sd 1.8 ) [ p < 0.05 ] , which occurred at a mean time of 9.7 months ( sd 2.8 ) [ p < 0.05 ] , i.e. 3.9 months after wbc count plateaued .
the plateau occurred despite a steady increase in the cumulative dose of azathioprine per kg of bodyweight at each time interval ( from 1.75 mg / kg [ sd 0.75 ] at baseline to 2.44 mg / kg [ sd 0.77 ] at t5 ) , as shown in figure 3 .
these children were noted to have a significantly greater mcv at baseline ( 80.5 fl [ sd 3.9 ] vs 70.5 fl [ sd 4.3 ] ; p = 0.006 ) than children who had normocytic red blood cells at 24 months . the relationship between mcv and wbc values ( or change in mcv and change in wbc ) across the study period
was not influenced by age , sex , azathioprine dose per kg of bodyweight , concomitant infliximab use , elemental diet , or corticosteroid use being factored into a multifactorial regression .
furthermore , tpmt was noted to be a weak predictor of the relationship between mcv and wbc ( p < 0.05 ; r=15% ) in a multifactorial regression analysis .
however , the association between mcv and wbc count was significantly strengthened by including a diagnosis of crohn s disease in the regression ( p < 0.05 ; r = 17% ) .
opinion that elevated mcv could predict leukopenia secondary to azathioprine toxicity is commonplace ; however , our data do not support this notion .
in fact , since leukopenia generally precedes macrocytosis , this is unlikely to be the case .
we therefore suggest that although macrocytosis may indicate toxicity , it is less likely to be able to predict it in a timely manner . since the majority of the reduction in wbc , lymphocyte , and neutrophil counts occurs in the first 6 months , it is more likely that regular blood monitoring in the first 6 months of azathioprine therapy will detect drug - induced bone marrow suppression , although this can occur at any stage of therapy . since indices stabilize by 12 months , the frequency of monitoring can be reduced thereafter .
our findings identified that the patients who were macrocytic at 24 months were also noted to have an elevated mcv at baseline .
it is possible that this group had a greater baseline mcv due to , as yet , unidentified genetic factors or disease - related factors such as vitamin b12 or folate deficiency .
our study did not include assessments of b12 levels or folate as potential causes of macrocytosis .
although mcv levels reached a plateau , they never returned to baseline , indicating a likely sustained effect of azathioprine rather than a confounding factor .
if vitamin b12 or folate deficiency were presumed to be the confounding factor , one would expect mcv to return to baseline as the clinical status of the disease improved .
therefore , it is more likely that pretreatment factors that are , as yet , unknown may predispose some children to a greater degree of drug - induced macrocytosis .
it is postulated that azathioprine - induced macrocytosis is due to inhibition of dna synthesis in bone marrow precursor cells , leaving both rna and protein synthesis ongoing and leading to cellular accumulation of nucleic acids .
the difference in individual toxicity may be explained by genetic polymorphisms of the genes encoding enzymes in thiopurine metabolism .
further studies will be necessary to determine if this cohort of patients is at increased risk of malignancies .
trends could be assessed by a prospective review , where each patient is monitored over a full 24-month period . in this study , through a cohort effect , there was a gradual reduction in subject numbers analyzed at each time interval
. a prospective review would allow assessment of the paediatric crohn s disease activity index , so that trends in hematologic and biochemical parameters could also be correlated with clinical response .
in addition , our graphical analysis gives cumulative data , which might have masked extremes of leukopenia and macrocytosis .
pretreatment factors that are , as yet , unrecognized may predispose some children to drug - induced macrocytosis .
this could also represent a cohort of children who are at risk of malignancies , necessitating further study . | azathioprine leads to changes in mean corpuscular volume ( mcv ) and white blood cell ( wbc ) indices reflecting efficacy or toxicity .
understanding the interactions between bone marrow stem cells and azathioprine could highlight abnormal response patterns as forerunners for hematologic malignancies .
this study gives a statistical description of factors influencing the relationship between mcv and wbc in children with inflammatory bowel disease treated with azathioprine .
we found that leukopenia preceded macrocytosis .
macrocytosis is therefore not a good predictor of leukopenia .
further studies will be necessary to determine the subgroup of patients at increased risk of malignancies based on bone marrow response . |
in contrast to all the other mammals , human sustains bipedal stance and gait as means of their normal posture and locomotion . as a consequence , humans are required to balance against multiple segments with a center of mass ( com ) of high position over a narrow base of support ( taube et al . , 2008 ) .
thus bipedal walking which give less impact and stress against whole body has been used as a means of rehabilitation , prescription and therapy for normal or patient of obesity , diabetics , old - age and pulmonary ( choi et al . , 2010 ; kim , 2007 ; lee and kim , 2010 ) .
locomotion was performed on not only level but also various situations of ground of which jeju s oreum is suitable for trekking course due to low level of altitude and no hard work of shuttle distance . particularly environmental condition of ground surface of oreum was made up various of conditions , irregular pattern like scoria , soils , grass land , rock , valley , stair - way , inclined load , etc .
also participants of oreum trekking can observe various kinds of animal and botany and experience unstable ground condition .
effect of walking exercise show somewhat difference according to ground conditions , but adaptability of balancing factors on the ground enhanced a sense of proprioceptor and reduction of falling injuries by condition of unstable ground ( eisen et al .
balancing training of posture on the unstable ground condition has been used as purpose of rehabilitation for improvement of posture control ability on the injuries of ankle and knee joint ( taube et al . , 2008 ) , and reported positive effect on the posture control against direction of medial and lateral and anterior - posterior ( ap ) for normal adult ( hoffman and payne , 1995 ) .
that is , the function of postural control was depended on the somatic sense from foot - part which contact with supporting plane ( shumway - cook and woollacott , 2007 ) , which is necessary more enhanced interaction function in terms of central nerve and various muscles for stable movement ( sadeghi et al . , 2000 ) .
but it was reported that walking on rough or descending supporting surface can cause higher possibility of injury by irregular walking due to increase of strength and moment ( knapik et al . , 1996 ; kuster et al . , 1995 ) .
when summarization of the previous studies , the conclusions on movement effects from unstable supporting surface was different each other and particularly was performed during mostly short period .
oreum trekking , which was performed for long period , is necessary to analyze the effect of exercise quantitatively .
therefore the aim of the study was to provide quantitative materials for exercise and rehabilitation with analysis of the effects on the kinetic variables and postural stability between bilateral in lower limbs with asymmetric index .
subjects participated was consisted of total 14 of adult male and female ( mean age , 21.642.37 yr ; mean heights , 168.60 9.04 cm ; mean weights , 62.889.61 kg ) .
they was lectured about the aim of study explained before experiment and recruited subjects agreed voluntarily on participation of oreum trekking exercise program and experiment .
the oreum trekking was performed with ascending and descending courses with alternative stair or incline lane continuously but its height and incline angle of stair was composed of irregular pattern . when consideration of these conditions of courses , the experiment was performed with the drop landing which can evaluate postural stability and kinetic variables between bilateral of lower limbs .
each subject , after enough warm - up exercise , performed on the order of bilateral , right and left drop landing on the height of 30-cm wooden platform .
oreum trekking during total 5 day included the first day performed the drop landing was performed with distance of 1520 km/3.5 hr a day ( 10-min rest/50-min trekking , respectively ) .
then , mean altitude of oreums ( semiyangoreum , hallaecoforest and jeolmuloreum , saryeoniforest and redoreum , jeolmuloreum and geochinoreum , saraoreum ) was 756.68321.22 m and 45 km / hr of moved velocity ( moved distance divided with total elapsed time ) . like this ,
after performed for 5 days of oreum trekking , performed the experiment of drop landing at the 8th day after individual rest for 2 days with consideration of subject s fatigue . the dynamic postural stability index ( dpsi : ml , medial lateral
; ap , anterior posterior ; si , stability index ; v , vertical ) was determined by the procedures described by wikstrom et al .
required coefficient of friction ( rcof ) was defined as value of ml ground reaction force ( grf ) and ap grf divided by peak vertical force ( pvf ) , rcof in ml direction and rcof in ap direction was in the same line with ( asaka et al . , 2002 ; burnfield and powers , 2007 ; cooper et al . , 2008 ) .
two - way analysis of variance was performed on variance of experiment of oreum trekking ( pre , post ) and bilateral ( right , left ) , then , when showing the effect of interaction , interpreted with one - way analysis of variance on significance level of p<0.05 .
subjects participated was consisted of total 14 of adult male and female ( mean age , 21.642.37 yr ; mean heights , 168.60 9.04 cm ; mean weights , 62.889.61 kg ) .
they was lectured about the aim of study explained before experiment and recruited subjects agreed voluntarily on participation of oreum trekking exercise program and experiment .
the oreum trekking was performed with ascending and descending courses with alternative stair or incline lane continuously but its height and incline angle of stair was composed of irregular pattern . when consideration of these conditions of courses , the experiment was performed with the drop landing which can evaluate postural stability and kinetic variables between bilateral of lower limbs .
each subject , after enough warm - up exercise , performed on the order of bilateral , right and left drop landing on the height of 30-cm wooden platform .
oreum trekking during total 5 day included the first day performed the drop landing was performed with distance of 1520 km/3.5 hr a day ( 10-min rest/50-min trekking , respectively ) .
then , mean altitude of oreums ( semiyangoreum , hallaecoforest and jeolmuloreum , saryeoniforest and redoreum , jeolmuloreum and geochinoreum , saraoreum ) was 756.68321.22 m and 45 km / hr of moved velocity ( moved distance divided with total elapsed time ) . like this ,
after performed for 5 days of oreum trekking , performed the experiment of drop landing at the 8th day after individual rest for 2 days with consideration of subject s fatigue .
the dynamic postural stability index ( dpsi : ml , medial lateral ; ap , anterior posterior ; si , stability index ; v , vertical ) was determined by the procedures described by wikstrom et al .
required coefficient of friction ( rcof ) was defined as value of ml ground reaction force ( grf ) and ap grf divided by peak vertical force ( pvf ) , rcof in ml direction and rcof in ap direction was in the same line with ( asaka et al . , 2002 ; burnfield and powers , 2007 ; cooper et al . , 2008 ) .
two - way analysis of variance was performed on variance of experiment of oreum trekking ( pre , post ) and bilateral ( right , left ) , then , when showing the effect of interaction , interpreted with one - way analysis of variance on significance level of p<0.05 .
as shown in table 1 , pvf value showed significant difference with the less in case of post than before participation of oreum trekking exercise program ( p<0.05 ) .
also , pvf of bilateral in lower limbs did not showed significant difference ( p>0.05 ) , and too the effect of interaction ( p>0.05 ) .
vsi and dpsi showed significant difference with improvement of postural stability by oreum trekking ( p<0.05 ) , but did not between bilateral in the limbs ( p>0.05 ) .
particularly the result of one - way analysis of variance due to vsi s effect of interaction , showed the more influence on the improvement of postural stability of left leg after participation of oreum trekking exercise ( f=4.094 , p<0.05 ) . the analysis result on asymmetric index of bilateral in lower limbs showed more symmetric pattern in post than that in before participation of oreum trekking exercise program .
nowadays , participants for climbing or walking for recreation and exercise rehabilitation show increasing trend gradually ( jensen et al . , 2011 ) . in the right of this trend ,
analysis range of this study focused on variables of postural stability and grf as an effect of oreum trekking exercise program .
that is , oreum trekking exercise was performed on the various conditions of ground , of which stair and incline lane needs more muscle strength of lower leg and delays the supporting time of either leg ( kuster et al . , 1995 ;
leroux et al . , 1999 ) . whereas it was reported that magnitude of impact absorption and breaking force to the ap direction at the initial touch - down on descending lane showed increasing but decreasing trend in propulsive force ( lay et al . , 2006 ) .
the environmental characteristics of oreum trekking lane consist of lower various altitude , inclined lane , irregular condition of course than those of other mountains .
therefore it was considered that these conditions of oreum trekking lane induced increased mechanism of impact absorption .
dynamic stability index in all direction ( frontal , sagittal , and horizontal ) showed significant results after oreum trekking exercise program .
dynamic stability index during locomotion is the control of the com within a changing base of support and requires effective proactive and reactive recovery response strategies when exposed to perturbations ( franklin et al . ,
also it is considered that locomotion on the more unstable ground of oreum trekking than those of level ground can induce improved sensory and motor control system and sense of regular position due to increased external sway motion of com ( shumway - cook and horak , 1986 ) .
rcof did not show significant difference , but rather decreased after participation of oreum trekking exercise program .
that is , it was reported that modified and adapted strategy against slippery surface individually when confronted by slippery surface of ground during gait ( cham and redfern , 2002 ; myung and smith , 1997 ) .
it was considered that characteristics of oreum s surface consisting of lawn , sand , various soils and slippery prevention facilities can induce stable posture , confrontation strategies instantly .
asymmetric index to postural stability and variables of grf between bilateral limbs showed more stable symmetric pattern after participation of oreum trekking exercise program .
that is it was considered that oreum trekking could induce the improved control ability of grf in bilateral limbs and could facilitate stabilization of limb s joint related with motor performance by increasing the coordination between muscular - nervous system ( sannicandro et al . , 2014 ) . when consideration the above , oreum trekking can be helpful exercise program for prevention of injuries ( sannicandro et al . , 2014 ) and
rehabilitation program for the handicapped with imbalanced function between bilateral limbs ( behm and colado , 2012 ; behm et al . , 2010 ) . | this study aimed to analyze an effect of the kinetic variables and postural stability between bilateral in lower limbs by participation of oreum trekking exercise program and subjects participated were composed of adult male and female subjects ( n=14 ) of 20s .
experiment was performed with the drop landing which can evaluate postural stability and kinetic variables between bilateral in lower limbs .
peak vertical force ( pvf ) value showed significant difference with the less in case of post than before participation of oreum trekking exercise .
also pvf of bilateral in lower limbs did not showed significant difference , and too the effect of interaction . vertical stability index ( vsi ) and
dynamic postural stability index ( dpsi ) showed significant difference with improvement of postural stability by oreum trekking , but did not between bilateral in the limbs .
particularly the result of one - way analysis of variance due to vsi s effect of interaction , showed the more influence on the improvement of postural stability in left leg after participation of oreum trekking exercise .
when consideration the above , the analysis result on asymmetric index of bilateral in lower limbs showed more symmetric pattern in post than before participation of oreum trekking exercise program . |
a highschool musical group of 53 hawke s bay residents toured california during the week in which the world health organization announced detection of human infections with the novel influenza a ( h1n1 ) 09 virus in the usa and mexico .
the group stayed at culver city ( 20 april ) before they were billeted with local families in palm springs ( 2122 april ) and long beach ( 2326 april ) .
their shared itinerary during the week of 2026 april included a public concert , visits to disneyland and universal studios , and travel within california . on 26 april 2009 ( united states time ) , they departed from los angeles to auckland , new zealand , sitting together in the same area of the aircraft for the twelve hour flight .
some members of the group were mildly unwell with symptoms of respiratory illness during the tour .
on arrival at auckland airport , on the morning of 28 april 2009 ( new zealand time , 21 hours ahead of los angeles ) , four tour members had symptoms , which did not meet the criteria for further investigation at the airport ( see table 1 ) .
they were cleared to rejoin the tour group and travel together by bus for six hours to hawke s bay before disbanding .
results for tour members with reported respiratory illness hi , haemagglutination inhibition ; mn , microneutralisation ; nps , nasopharyngeal swab .
suspect cases were defined as having recent onset of respiratory illness and travel in the last 7 days to an area of concern ( mexico , usa or canada ) .
respiratory illness was defined as recent onset of at least two of the following : rhinorrhoea or nasal congestion , sore throat , cough , fever 38c .
* seroconverted is defined as a fourfold rise in antibody titre by either hi assay or mn assay against pandemic a ( h1n1 ) 09 between the paired serum samples , or as a higher antibody titre by either hi assay or mn assay compared to background levels generally found in the age group for the single serum samples . *
* took several days to develop symptoms , which met the case definition . * * * serum samples were taken less than 7 days from symptom onset , and this may not be sufficient time for a serological response to be detected .
not a suspect case : had one respiratory symptom and other flulike symptoms not included in case definition .
suspect case notifications for novel influenza a ( h1n1 ) 09 infection initiated a public health unit assessment of the whole tour group .
tour members with respiratory symptoms were offered diagnostic viral pcr , treated with oseltamivir , and advised to remain in isolation within a quarantined household .
asymptomatic tour members were monitored for symptoms by daily telephone call , offered oseltamivir prophylaxis and recommended to undergo household quarantine .
one tour member had novel influenza a virus ( h1n1 ) 09 infection confirmed by pcr assay from a nasopharyngeal swab ( nps ) taken on the day of arrival in new zealand .
thus , the infectious period for this case is likely to have included the twelve hour return flight and the six hour bus journey .
a single confirmed case of novel influenza a ( h1n1 ) 09 infection was unexpected given the tour group s close contact during the case s infectious period .
thus , we set out to determine whether serology could identify any cases of novel influenza a ( h1n1 ) 09 that had not been detected by pcr .
twelve tour members with respiratory illness in the week following return to new zealand were offered acute and convalescent serological testing for novel influenza virus ( h1n1 ) 09 antibodies .
all serological samples were frozen and transported to the who collaborating centre for reference and research on influenza in melbourne .
reactivity of sera against pandemic ( h1n1 ) 2009 and seasonal a ( h1n1 ) influenza viruses was measured using haemagglutination inhibition ( hi ) assays
and microneutralisation ( mn ) assays .
briefly , for the hi assay , sera were pretreated with receptor destroying enzyme [ rde ( ii ) ; deka seiken co. ltd . , tokyo , japan ] , 1:5 ( v : v ) , at 37c overnight , then the enzyme inactivated by incubation with an equal volume ( 1:1 ) 544 mm trisodium citrate ( ajax chemicals , taren point , new south wales , australia ) at 56c for 30 minutes .
intrazonal pool preparation of inactivated a / california/7/2009 virus ( a gift of csl limited , parkville , victoria , australia ) was incubated with rdetreated serum ( 1:1 ) .
sera were titrated in twofold dilutions in pbs ( 1:10 to 1:1280 ) , in duplicate .
titres were expressed as the reciprocal of the highest dilution of serum where haemagglutination was prevented .
heattreated serum ( twofold dilutions from 1:10 ) and 100 tissue culture infective dose ( tcid)50 a / auckland/1/2009 ( novel h1n1 09 ) or a / fukushima/141/2006 ( a / h1n1 ) ( 1:1 ) were incubated at 35c for 1 hour , in duplicate .
the virus / serum mix was incubated on washed confluent ( 90% ) monolayers of madindarby canine kidney cells in 96well plates at 35c , 5% co2 for 2 hours .
the virus / serum mix was replaced with foetal calf serum ( fcs)free tissue culture medium supplemented with 4 g / ml trypsin and the cells were incubated at 35c , 5% co2 .
four days later , supernatant from each well was assayed for virus by haemagglutination assay with 1% turkey rbc .
titres were expressed as the reciprocal of the highest dilution of serum where haemagglutination was prevented .
results were interpreted in conjunction with seasonal influenza vaccination history , the clinical history and the timing of collection of nps for pcr analysis .
twelve members of the 53 person tour group ( 23% ) reported illness with respiratory symptoms in the week following return from california . ten tour members met the suspect case definition of two symptoms , whilst the remaining two ( tour members 6 and 12 ) only showed one respiratory symptom and other flulike symptoms not included in the case definition ( eg : myalgia , headache , abdominal pain ) ( table 1 )
there was no history of contact with suspected or confirmed cases of influenza a ( h1n1 ) 09 infection .
the median age of affected tour members was 15 years ( range 1354 years ) .
oseltamivir treatment was given to eleven of the twelve symptomatic tour members , ten of whom completed treatment .
they were asymptomatic members of the tour group or household contacts of symptomatic tour group members .
four other people were offered prophylaxis but declined and were placed in 7 days isolation .
monitoring of all these contacts in new zealand did not identify any other suspect cases .
two tour members were not tested by pcr because they had already taken oseltamivir prophylaxis prior to developing symptoms , which met the case definition ( table 1 ) .
all other nps taken from suspect cases , upon presentation of symptoms , tested negative for the novel influenza virus .
this testing was limited however , as nps were taken up to 1 week after symptom onset when viral shedding may no longer be detectable .
a total of 19 serum samples were obtained from the twelve tour members reporting illness ( table 1 ) .
sera from seven members were paired acute and convalescent bleeds , whilst only one serum sample was collected from the remaining five tour members : three acute and two convalescent samples .
seroconversion was defined as a fourfold increase in antibody titre by either hi or mn assay , with a minimum titre of 40 in the convalescent bleed in both assays , similar to other studies .
,
where only one serum sample was available , an indicated estimate of infection was made by comparing the single titre with historical background titres for this age group . of the seven sets of paired sera , only tour member 1 , the index case , met this definition of seroconversion to the novel a ( h1n1 ) 09 virus , demonstrating infection with this strain .
no significant change in hi or mn titre to a ( h1n1 ) 09 was detected in tour member 2 .
of the tour members who provided a single serum sample , moderate levels of antibodies to a ( h1n1 ) 09 were also detected by hi and mn assay for tour member 3 .
five tour members ( 3 , 5 , 7 , 8 , 12 ) had high neutralising antibody titres to seasonal influenza a ( h1n1 ) virus .
two of these tour members ( 3 and 12 ) had recent history of influenza vaccination , whilst the remaining three ( 5 , 7 and 8) had no recent history of influenza vaccination and are likely to have had recent infections with seasonal influenza a ( h1n1 ) .
the confirmed case developed symptoms one hour after arrival in auckland on 28 april 2009 , suggesting infection in california .
symptoms on the day of onset included a significant cough , fever , coryza , sore throat , headache and myalgia .
no special measures were taken during the bus trip to reduce aerosol transmission of respiratory secretions . upon arriving in hawke s bay ,
the case proceeded immediately to a consultation in primary care where npss were taken and oseltamivir was prescribed .
the confirmed case completed 5 days of oseltamivir treatment and 7 days of isolation / household quarantine .
household contacts were prescribed postexposure prophylaxis and placed in quarantine . the possible case developed rhinorrhoea / nasal congestion and headache on 27 april 2009 , 1 day prior to arrival in new zealand .
these symptoms did not meet the case definition , and as a contact of a suspect case , prophylactic oseltamivir was delivered on 30 april 2009 . on day 4 of prophylactic treatment , the possible case developed fever , coryza , sore throat and vomiting .
novel influenza virus ( h1n1 ) 09 infection among tour group members could easily have led to rapid transmission of disease within the group and the wider school community .
an estimated 196 secondary cases were generated from each primary case early in new zealand s first pandemic wave ( the reproduction estimate ) .
reproduction estimates in other countries range from 12 to 24 ,
,
,
,
,
,
and reached 28 for a subanalysis of persons under 20 years of age .
certainly rapid transmission amongst students was commonly observed internationally .
,
,
,
,
,
,
,
,
the risk of interstudent transmission was also elevated by close contact during extended travel with newly symptomatic cases .
this is the period when viral load in aerosolised respiratory secretions should be highest .
remarkably , no evidence of transmission within the student group during return travel to new zealand or after arrival has been identified after close monitoring and serological investigation of those with respiratory symptoms , although transmission may have occurred to asymptomatic tour party members who did not receive serological testing . karpurkayastha and ingram et al
.
also found no evidence of transmission during bus travel in their extensive investigation of a schoolbased outbreak in england .
the period of travel in their investigation was however significantly shorter ( 30 minutes ) than the travel reported here .
our findings suggest that the combined interventions of isolation , household quarantine , active monitoring and oseltamivir treatment and prophylaxis have successfully contributed towards preventing an outbreak in the community upon the tour members return .
this is consistent with the report by kimberlin et al .
of effective novel influenza a ( h1n1 ) 09 infection containment at a summer camp
. limitations of the study include the possibility that some tour members did not disclose illness and that asymptomatic infection occurred .
we also can not exclude the possibility that other passengers on the flight were infected and then travelled to destinations other than hawke s bay .
in addition , nps collection was delayed after symptom onset in almost half of the patients , which may reduce virus detection , yet the absence of seroconversion in these patients suggests that infection with influenza a ( h1n1 ) 09 did not occur .
furthermore , it has been demonstrated that approximately 90% patients with known influenza a ( h1n1 ) 09 infection had seroconverted at least 3 weeks after symptom onset .
however , it has been suggested that oseltamivir treatment may suppress serological responses , especially in mild or asymptomatic cases ;
thus , an underestimate of h1n1 09 infection in this tour group can not be discounted .
the absence of further confirmed cases in hawke s bay until midjune does , however , add weight to the suggestion that an outbreak was prevented .
this study describes limited novel influenza a ( h1n1 ) 09 infection among a large highschool tour group .
effective public health intervention is likely to have played a role in preventing an outbreak in the community . | please cite this paper as : mardani et al .
( 2011 ) limited novel influenza a ( h1n1 ) 09 infection in travelling highschool tour group .
influenza and other respiratory viruses 5(1 ) , 4751 .
background a single case of novel influenza a ( h1n1 ) 09 infection was identified by pcr among a new zealand highschool group that toured california in april 2009 .
close monitoring of the tour group and their new zealand contacts identified 11 other tour members with respiratory symptoms who were investigated . in all nine instances where nasopharyngeal swabs were indicated ,
tests were negative for novel influenza a ( h1n1 ) 09 by pcr .
objective to determine whether serology could identify any cases of novel influenza a ( h1n1 ) 09 that had not been detected by pcr .
methods acute and convalescent serological testing for antibodies against pandemic ( h1n1 ) 2009 and seasonal a ( h1n1 ) influenza viruses using haemagglutination inhibition assays and microneutralisation assays .
results serological analysis of symptomatic tour members identified a further possible case of novel influenza a ( h1n1 ) 09 infection .
the possible case had not been tested by pcr because he or she had already received prophylaxis with oseltamivir .
conclusions these findings suggest infection among tour group members was limited despite prolonged periods of close contact during travel .
furthermore , multiple public health interventions are likely to have effectively prevented an outbreak following the tour group s return . |
preparation of go : initially , graphite powder ( 0.5 g ) and nano3 ( 0.5 g ) were dissolved in concentrated h2so4 ( 23 ml ) with continuous stirring for 20 min , and the mixture was cooled in an ice bath for 2 h. then , the reaction mixture was heated and stirred at 40 c , and kmno4 ( 6 g ) crystalline powder was added slowly with continuous stirring for 70 min . next , distilled water ( 50 ml ) was added to the mixture and stirred for further 20 min , followed by h2o2 ( 30 % ) dropwise until the color of the solution changed from dark brown to yellow . upon the color change , water ( 50 ml ) was added , and the resulting solution was sonicated for 2 h. the solution was centrifuged , separated , filtered , and washed several times with doubledistilled water .
the product was dried in a vacuum oven at 100 c overnight to obtain go .
preparation of aminefunctionalized go : go ( 1 g ) was dissolved in toluene ( 50 ml ) in a conical flask and sonicated for 2 h. [ 3(2aminoethylamino ) propyl ] trimethoxysilane ( diamine ) ( 1.68 mmol ) ( aldrich ) was added to the solution and sonicated further for 1 h. then , the solution was centrifuged and dried in a vacuum oven at 100 c overnight to obtain diamine@go .
characterization of catalysts : ftir spectra of the samples were recorded using a perkinelmer ftir spectrum 100 series with universal atr accessory ( waltham , usa ) .
raman spectra were collected on a deltanu advantage 532 raman spectrometer ( 100 mw nd : yag laser with an excitation wavelength of 532 nm ) ( laramie , usa ) .
the tem images were viewed on a jeol jem1010 electron microscope ( tokyo , japan ) .
the images were captured and analyzed by using item software ( soft imaging system gmbh , 5.0 , build 1089 , 19862005 ) , and the sem measurements were carried out using a jeol jsm6100 microscope . to a solution of hydrazine hydrate
( 55 mg , 1 mol ) in etoh ( 5 ml ) in a twoneck roundbottom flask , ethyl acetoacetate ( 156 mg , 1 mol ) was added .
then , aldehyde ( 100 mg , 1 mol ) and 1 , 3 dimethylbarbaric acid ( 115 mg , 1 mol ) were added to the mixture , followed by the required amount of catalyst ( 30 mg )
. then , the total mixture was heated at reflux for the completion of the reaction .
after completion of the reaction ( as monitored by thinlayer chromatography ) , the mixture was cooled to room temperature and filtered .
the precipitate was separated and characterized as follows :
3,6,8trimethyl4(4bromophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 a ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.09 ( s , 3 h , ch3 ) , 3.10 ( s , 6 h , n(ch3)2 ) , 5.43 ( s , 1 h , ch ) , 6.99 ( d , j=8.24 hz , 1 h , arh ) , 7.06 ( d , j=8.32 hz , 1 h , arh),7.32 ( d , j=8.36 hz , 1 h , arh ) , 7.40 ( d , j=8.36 hz , 1 h , arh ) , 14.57 ppm ( s , 1h nh ) ; c nmr ( 100 mhz , cdcl3 ) : =161.1 , 158.6 , 151.3 , 137.2 , 132.1 , 129.1 , 128.2 , 45.7 , 27.68 , 8.60 ppm ; ir ( kbr ) : =2952 , 2872 , 1667 , 1582 , 1482 cm ; anal .
calcd for c17h15brn4o3 : c 50.62 , h 3.78 , n 13.91 , found : c 50.64 , h 3.75 , n 13.89 .
3,6,8trimethyl4(4chlorophenyl)6,8ihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 b ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.25 ( s , 3 h , ch3 ) , 3.12 ( s , 6 h , n(ch3)2 ) , 5.53 ( s , 1 h , ch ) , 7.05 ( d , j=8.12 hz , 2 h , arh ) , 7.24 ( d , j=8.36 hz , 2 h , arh ) , 16.30 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =160.6 , 158.8 , 151.5 , 141.6 129.8 , 128.5 , 127.6 , 27.6 , 9.9 ppm ; ir ( kbr ) : =3436 , 2898 , 1670 , 1556 , 1488 cm ; anal .
calcd for c17h15cln4o3 : c 56.87 , h 4.19 , n 15.65 , found : c 56.91 , h 4.21 , n 15.62 .
3,6,8trimethyl4(4methoxyphenyl)6,8dihydropyrazolo[4,3:5,6 ]
pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione(5 c ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.22 ( s , 3h ch3 ) , 3.10 ( s , 3 h , nch3 ) , 3.68 ( s , 3 h , nch3 ) , 3.82 ( s , 3 h , och3 ) , 5.48 ( s , 1 h , ch ) , 7.04 ( d , j=8.64 hz , 2 h , arh ) , 7.80 ( d , j=8.64 hz , 2 h , arh ) , 15.99 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =161.6 , 160.4 , 159.1 , 156.9 , 151.6 , 129.9 , 128.1 , 127.6 , 126.5 , 114.3 , 113.2 , 113.1 , 55.3 , 27.6 , 9.9 ppm ; ir ( kbr ) : =2939 , 2836 , 1668 , 1508 , 1442 cm ; anal .
calcd for c18h18n4o4 : c 60.97 , h 5.17 , n 15.83 , found : c 61.01 , h 5.12 , n 15.80 .
3,6,8trimethyl4(2chlorophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 d ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.19 ( s , 3 h , ch3 ) , 3.10 ( s , 6 h , n(ch3)2 ) , 5.61 ( s , 1 h , ch ) , 7.207.12 ( m , 2 h , arh ) , 7.26 ( d , j=7.68 hz , 1 h , arh ) , 7.50 ( d , j=7.60 hz , 1 h , arh ) , 12.32 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =162.9 , 159.3 , 151.7 , 141.1 , 140.6 , 132.5 , 130.5 , 129.1 , 127 , 125.9 , 45.7 , 27.5 , 10.1 ppm ; ir ( kbr ) : =3746 , 2954 , 1666 , 1578 , 1439 cm ; anal .
calcd for c17h15cln4o3 : c 56.88 , h 4.19 , n 15.65 , found : c 56.91 , h 4.21 , n 15.62 .
3,6,8trimethyl4(2bromophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 e ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.18 ( s , 3 h , ch3 ) , 3.08 ( s , 6 h , n(ch3)2 ) , 5.49 ( s , 1 h , ch ) , 7.04 ( t , j=7.02 hz , 1 h , arh ) , 7.22 ( t , j=7.80 hz , 1 h , arh ) , 7.44 ( d , j=7.72 hz , 1 h , arh ) , 7.50 ( d , j=7.02 hz , 1 h , arh ) , 14.29 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =159.8 , 151.3 , 138.4 , 132.7 , 129.1 , 128.9 , 127.4 , 124.2 , 45.7 , 27.5 , 8.6 ppm ; ir ( kbr ) : =3484 , 2948 , 1667 , 1561 , 1430 cm ; anal .
calcd for c17h15brn4o3 : c 50.61 , h 3.77 , n 13.92 , found : c 50.64 , h 3.75 , n 13.88 .
3,6,8trimethyl4(2methoxyphenyl)6,8dihydropyrazolo[4,3:5,6
] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 f ) : h nmr ( 400 mhz , [ d6]dmso ) : =1.03 ( s , 3 h , ch3 ) , 2.10 ( s , 6 h , n(ch3)2 ) , 3.79 ( s , 3 h , och3 ) , 5.11 ( s , 1 h , ch ) , 6.85 ( t , j=7.42 hz , 1 h , arh ) , 6.91 ( d , j=8.00 hz , 1 h , arh ) , 7.13 ( t , j=7.48 hz , 1 h , arh ) , 7.60 ( d , j=7.36 hz , 1 h , arh ) , 11.41 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =161.3 , 155.8 , 139.9 , 132 , 129 , 126.5 , 11.6 , 110.3 , 103.7 , 55.2 , 45.6 , 26.8 , 11 , 10.5 ppm ; ir ( kbr ) : =3215 , 2999 , 1650 , 1568 , 1489 cm ; anal .
calcd for c18h18n4o4 : c 60.98 , h 5.16 , n 15.84 , found : c 61.01 , h 5.12 , n 15.81 .
3,6,8trimethyl4(2nitrophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 g ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.08 ( s , 3h ch3 ) , 3.03 ( s , 6 h , n(ch3)2 ) , 5.81 ( s , 1 h. ch ) , 7.25 ( t , j=7.60 hz , 1 h , arh ) , 7.35 ( d , j=7.68 hz , 1 h , arh ) , 7.41 ( t , j=7.64 hz , 2h arh ) , 10.99 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =160.6 , 157.2 , 152.2 , 138 , 130.3 , 125.8 , 122.9 , 117.5 , 114.6 , 113.7 , 45.7 , 27.2 , 8.6 ppm ; ir ( kbr ) : =3190 , 2980 , 1618 , 1519 , 1431 cm ; anal .
calcd for c17h15n5o5 : c 55.31 , h 4.12 , n 18.64 , found : c 55.28 , h 4.09 , n 18.69 .
3,6,8trimethyl4(2,3dimethoxyphenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 h ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.19 ( s , 3 h , ch3 ) , 3.11 ( s , 6 h , n(ch3)2 ) , 3.47 ( s , 3 h , och3 ) , 3.73 ( s , 3 h , och3 ) , 5.73 ( s , 1 h , ch ) , 6.80 ( d , j=7.25 hz , 1 h , arh ) , 6.86 ( t , j=8.04 hz , 1 h , arh ) , 6.97 ( d , j=7.60 hz , 1 h , arh ) , 15.59 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : 159.5 , 152.1 , 151.6 , 146.1 , 128.2 , 127.7 , 127 , 122.3 , 59.1 , 55.9 , 27.6 , 18.5 , 10.1 ppm ; ir ( kbr ) : =33663 , 2963 , 1682 , 1571 , 1431 cm ; anal .
calcd for c19h20n4o5 : c 59.35 , h 5.26 , n 14.56 , found : c 59.37 , h 5.24 , n 14.58 .
3,6,8trimethyl4(2,5dimethoxyphenyl)6,8dihydropyrazolo[4,3:5,6
] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 i ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.05 ( s , 6 h , n(ch3)2 ) , 3.62 ( s , 3 h , ch3 ) , 3.67 ( s , 3 h , och3 ) , 3.83 ( s , 3 h , och3 ) , 5.02 ( s , 1 h , ch ) , 6.77 ( d , j=8.00 hz , 1 h , arh ) , 7.10 ( s , 1 h , arh ) , 7.18 ( d , j=2.20 hz , 1 h , arh ) , 11.50 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =156.4 , 153.3 , 153.1 , 152.6 , 150.1 , 133.2 , 122 , 119.4 , 116.3 , 113.6 , 111.1 , 110 , 109.7 , 55.8 , 55 , 44.4 , 27 , 10.3 ppm ; ir ( kbr ) : =3333 , 2831 , 1658 , 1588 , 1463 cm ; anal .
calcd for c19h20n4o5 : c 59.35 , h 5.27 , n 14.56 , found : c 59.37 , h 5.24 , n 14.58 .
to a solution of hydrazine hydrate ( 55 mg , 1 mol ) in etoh ( 5 ml ) in a twoneck roundbottom flask , ethyl acetoacetate ( 156 mg , 1 mol ) was added .
then , aldehyde ( 100 mg , 1 mol ) and 1 , 3 dimethylbarbaric acid ( 115 mg , 1 mol ) were added to the mixture , followed by the required amount of catalyst ( 30 mg ) . then , the total mixture was heated at reflux for the completion of the reaction .
after completion of the reaction ( as monitored by thinlayer chromatography ) , the mixture was cooled to room temperature and filtered .
the precipitate was separated and characterized as follows :
3,6,8trimethyl4(4bromophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 a ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.09 ( s , 3 h , ch3 ) , 3.10 ( s , 6 h , n(ch3)2 ) , 5.43 ( s , 1 h , ch ) , 6.99 ( d , j=8.24 hz , 1 h , arh ) , 7.06 ( d , j=8.32 hz , 1 h , arh),7.32 ( d , j=8.36 hz , 1 h , arh ) , 7.40 ( d , j=8.36 hz , 1 h , arh ) , 14.57 ppm ( s , 1h nh ) ; c nmr ( 100 mhz , cdcl3 ) : =161.1 , 158.6 , 151.3 , 137.2 , 132.1 , 129.1 , 128.2 , 45.7 , 27.68 , 8.60 ppm ; ir ( kbr ) : =2952 , 2872 , 1667 , 1582 , 1482 cm ; anal .
calcd for c17h15brn4o3 : c 50.62 , h 3.78 , n 13.91 , found : c 50.64 , h 3.75 , n 13.89 .
3,6,8trimethyl4(4chlorophenyl)6,8ihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 b ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.25 ( s , 3 h , ch3 ) , 3.12 ( s , 6 h , n(ch3)2 ) , 5.53 ( s , 1 h , ch ) , 7.05 ( d , j=8.12 hz , 2 h , arh ) , 7.24 ( d , j=8.36 hz , 2 h , arh ) , 16.30 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =160.6 , 158.8 , 151.5 , 141.6 129.8 , 128.5 , 127.6 , 27.6 , 9.9 ppm ; ir ( kbr ) : =3436 , 2898 , 1670 , 1556 , 1488 cm ; anal .
calcd for c17h15cln4o3 : c 56.87 , h 4.19 , n 15.65 , found : c 56.91 , h 4.21 , n 15.62 .
3,6,8trimethyl4(4methoxyphenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione(5 c ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.22 ( s , 3h ch3 ) , 3.10 ( s , 3 h , nch3 ) , 3.68 ( s , 3 h , nch3 ) , 3.82 ( s , 3 h , och3 ) , 5.48 ( s , 1 h , ch ) , 7.04 ( d , j=8.64 hz , 2 h , arh ) , 7.80 ( d , j=8.64 hz , 2 h , arh ) , 15.99 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =161.6 , 160.4 , 159.1 , 156.9 , 151.6 , 129.9 , 128.1 , 127.6 , 126.5 , 114.3 , 113.2 , 113.1 , 55.3 , 27.6 , 9.9 ppm ; ir ( kbr ) : =2939 , 2836 , 1668 , 1508 , 1442 cm ; anal .
calcd for c18h18n4o4 : c 60.97 , h 5.17 , n 15.83 , found : c 61.01 , h 5.12 , n 15.80 .
3,6,8trimethyl4(2chlorophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 d ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.19 ( s , 3 h , ch3 ) , 3.10 ( s , 6 h , n(ch3)2 ) , 5.61 ( s , 1 h , ch ) , 7.207.12 ( m , 2 h , arh ) , 7.26 ( d , j=7.68 hz , 1 h , arh ) , 7.50 ( d , j=7.60 hz , 1 h , arh ) , 12.32 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =162.9 , 159.3 , 151.7 , 141.1 , 140.6 , 132.5 , 130.5 , 129.1 , 127 , 125.9 , 45.7 , 27.5 , 10.1 ppm ; ir ( kbr ) : =3746 , 2954 , 1666 , 1578 , 1439 cm ; anal .
calcd for c17h15cln4o3 : c 56.88 , h 4.19 , n 15.65 , found : c 56.91 , h 4.21 , n 15.62 .
3,6,8trimethyl4(2bromophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 e ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.18 ( s , 3 h , ch3 ) , 3.08 ( s , 6 h , n(ch3)2 ) , 5.49 ( s , 1 h , ch ) , 7.04 ( t , j=7.02 hz , 1 h , arh ) , 7.22 ( t , j=7.80 hz , 1 h , arh ) , 7.44 ( d , j=7.72 hz , 1 h , arh ) , 7.50 ( d , j=7.02 hz , 1 h , arh ) , 14.29 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =159.8 , 151.3 , 138.4 , 132.7 , 129.1 , 128.9 , 127.4 , 124.2 , 45.7 , 27.5 , 8.6 ppm ; ir ( kbr ) : =3484 , 2948 , 1667 , 1561 , 1430 cm ; anal .
calcd for c17h15brn4o3 : c 50.61 , h 3.77 , n 13.92 , found : c 50.64 , h 3.75 , n 13.88 .
3,6,8trimethyl4(2methoxyphenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 f ) : h nmr ( 400 mhz , [ d6]dmso ) : =1.03 ( s , 3 h , ch3 ) , 2.10 ( s , 6 h , n(ch3)2 ) , 3.79 ( s , 3 h , och3 ) , 5.11 ( s , 1 h , ch ) , 6.85 ( t , j=7.42 hz , 1 h , arh ) , 6.91 ( d , j=8.00 hz , 1 h , arh ) , 7.13 ( t , j=7.48 hz , 1 h , arh ) , 7.60 ( d , j=7.36 hz , 1 h , arh ) , 11.41 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =161.3 , 155.8 , 139.9 , 132 , 129 , 126.5 , 11.6 , 110.3 , 103.7 , 55.2 , 45.6 , 26.8 , 11 , 10.5 ppm ; ir ( kbr ) : =3215 , 2999 , 1650 , 1568 , 1489 cm ; anal .
calcd for c18h18n4o4 : c 60.98 , h 5.16 , n 15.84 , found : c 61.01 , h 5.12 , n 15.81 .
3,6,8trimethyl4(2nitrophenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 g ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.08 ( s , 3h ch3 ) , 3.03 ( s , 6 h , n(ch3)2 ) , 5.81 ( s , 1 h. ch ) , 7.25 ( t , j=7.60 hz , 1 h , arh ) , 7.35 ( d , j=7.68 hz , 1 h , arh ) , 7.41 ( t , j=7.64 hz , 2h arh ) , 10.99 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =160.6 , 157.2 , 152.2 , 138 , 130.3 , 125.8 , 122.9 , 117.5 , 114.6 , 113.7 , 45.7 , 27.2 , 8.6 ppm ; ir ( kbr ) : =3190 , 2980 , 1618 , 1519 , 1431 cm ; anal .
calcd for c17h15n5o5 : c 55.31 , h 4.12 , n 18.64 , found : c 55.28 , h 4.09 , n 18.69 .
3,6,8trimethyl4(2,3dimethoxyphenyl)6,8dihydropyrazolo[4,3:5,6 ]
pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 h ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.19 ( s , 3 h , ch3 ) , 3.11 ( s , 6 h , n(ch3)2 ) , 3.47 ( s , 3 h , och3 ) , 3.73 ( s , 3 h , och3 ) , 5.73 ( s , 1 h , ch ) , 6.80 ( d , j=7.25 hz , 1 h , arh ) , 6.86 ( t , j=8.04 hz , 1 h , arh ) , 6.97 ( d , j=7.60 hz , 1 h , arh ) , 15.59 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : 159.5 , 152.1 , 151.6 , 146.1 , 128.2 , 127.7 , 127 , 122.3 , 59.1 , 55.9 , 27.6 , 18.5 , 10.1 ppm ; ir ( kbr ) : =33663 , 2963 , 1682 , 1571 , 1431 cm ; anal .
calcd for c19h20n4o5 : c 59.35 , h 5.26 , n 14.56 , found : c 59.37 , h 5.24 , n 14.58 .
3,6,8trimethyl4(2,5dimethoxyphenyl)6,8dihydropyrazolo[4,3:5,6 ] pyrano[2,3d]pyrimidine5,7(1 h,4 h)dione ( 5 i ) : h nmr ( 400 mhz , [ d6]dmso ) : =2.05 ( s , 6 h , n(ch3)2 ) , 3.62 ( s , 3 h , ch3 ) , 3.67 ( s , 3 h , och3 ) , 3.83 ( s , 3 h , och3 ) , 5.02 ( s , 1 h , ch ) , 6.77 ( d , j=8.00 hz , 1 h , arh ) , 7.10 ( s , 1 h , arh ) , 7.18 ( d , j=2.20 hz , 1 h , arh ) , 11.50 ppm ( s , 1 h , nh ) ; c nmr ( 100 mhz , cdcl3 ) : =156.4 , 153.3 , 153.1 , 152.6 , 150.1 , 133.2 , 122 , 119.4 , 116.3 , 113.6 , 111.1 , 110 , 109.7 , 55.8 , 55 , 44.4 , 27 , 10.3 ppm ; ir ( kbr ) : =3333 , 2831 , 1658 , 1588 , 1463 cm ; anal .
calcd for c19h20n4o5 : c 59.35 , h 5.27 , n 14.56 , found : c 59.37 , h 5.24 , n 14.58 .
as a service to our authors and readers , this journal provides supporting information supplied by the authors .
such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset .
technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors . | abstractthe surface of graphene oxide ( go ) was modified using [ 3(2aminoethylamino)propyl]trimethoxysilane ( diamine ) , which exhibited excellent catalytic activity for onepot multicomponent reactions .
the newly synthesized material was fully characterized by various instrumental techniques including fouriertransfer infrared ( ftir ) and raman spectroscopy , scanning electron microscopy ( sem ) , and transmission electron microscopy ( tem ) .
the instrumental analysis confirmed the successful grafting of organic amine functional groups onto the graphene oxide surface .
the diaminefunctionalized go proved to be an excellent catalyst for the synthesis of pyrazolopyranopyrimidine derivatives with 93 % yield and high selectivity .
the catalytic activity almost remained unaltered up to three cycles .
the newly synthesized pyrazolopyranopyrimidine derivatives have potential use as scaffolds in designing new pharmaceutical products . |
an eighteen - month - old boy was referred to the emergency department with a sudden onset of nausea and bilious vomiting which progressed into dehydration and confusion .
he had low body temperature ( 36.4c ) and blood pressure ( 80/40 mm hg ) and increased heart rate ( 160180/min ) .
the past medical history revealed that he had undergone a ladd 's procedure and appendectomy for intestinal malrotation at the age of 20 days , and he had been hospitalized because of bowel obstruction which resolved with supportive treatment for three times . on admission
1 ) , massive intraperitoneal fluid and multiple enlarged mesenteric lymph nodes . after insertion of a central venous line and a nasogastric tube , broad spectrum antibiotics and a two - hour aggressive fluid therapy were initiated .
the patient underwent emergency surgery . at laparotomy , there was massive chylous fluid in addition to a 540 counter clock - wise rotation of the small intestine .
the small bowel mesentery was narrow , thickened and there were multiple lymph nodes at the mesentery , but no lymph leakage was observed .
the postoperative period was uneventful ; resumption of bowel function was on the sixth postoperative day .
malrotation is a common name for a spectrum of abnormalities resulting from failure of rotation and fixation of the intestinal tract . in the most common type encountered in children ,
the process of rotation is incomplete and the attachment of the mesentery of the midgut to the posterior abdominal wall is narrow , so it is at risk for later twisting called volvulus .
the tighter the twist , the more the midgut suffers from obstruction of the lumen , obstruction of the venous and lymphatic return and obstruction of arterial inflow , thus threatening midgut viability .
most patients with malrotation develop volvulus within the first weeks of life [ 2 , 3 ] .
sudden onset of bilious vomiting in newborns or infants usually reflects duodenal obstruction or midgut volvulus due to malrotation .
we present an eighteen - month - old boy who had undergone a ladd 's procedure and appendectomy for intestinal malrotation at the age of twenty days .
the patient had a two - day history of bilious vomiting at that age and had undergone an elective operation .
he had been hospitalized with recurrent attacks of intestinal obstruction which responded to nonoperative treatment . before admission to our hospital
intravenous fluid replacement had been initiated at the previous hospital from which the patient had been referred . although the patient had the symptoms of dehydration , the serum electrolytes were normal .
the palpable mass in the midabdomen and bloody stool in rectal examination made us think of intussusception as an initial diagnosis .
abdominal ultrasound demonstrated a whirl pool of intestines in the mid abdomen and massive abdominal fluid .
there was a midgut volvulus , the bowel was edematous and ischemic but no necrosis was observed .
we observed that the duodeno - colic bands were incised but mesenteric base was not adequately broadened .
the massive chylous ascites without a current leakage pointed out the chronicity of recurrent volvulus .
malrotation of the intestine is usually observed in the neonatal period with signs of intestinal obstruction due to ladd band 's obstructing duodenum or midgut volvulus .
children with malrotation can present with acute or chronic symptoms or they may be completely asymptomatic .
it has been emphasized that patients older than 2 years are still at risk of volvulus and rotation anomalies must be corrected surgically when they are found incidentally , even when the patients are asymptomatic [ 4 , 5 ] .
factors suggested to increase mortality are the increased percentage of necrotic bowel , the percentage of associated serious disease and younger age of the patient at operation .
the diagnosis is aided by the awareness of the condition and recognition of the abnormalities during radiological workup .
plain films may be normal or may show a double bubble sign , air - fluid levels or paucity of gas in the abdomen [ 2 , 3 ] .
an upper gastrointestinal contrast study is considered the gold standard for making the diagnosis of volvulus .
small bowel is located to the right side of the abdomen with contrast narrowing at the site of obstruction causing
ultrasound and computed tomography may show a distended , fluid filled duodenum , increased peritoneal fluid , dilated small bowel loops to the right of the spine or a whirl - like pattern of bowel loops encircling the superior mesenteric artery [ 2 , 3 ] .
computed tomography as well as angiography can show the abnormal anatomy of the superior mesenteric artery .
midgut volvulus is a generally acute and progressive condition which requires emergency intervention and operation .
ladd 's procedure , which was described in 1932 , forms the basis of the surgical treatment .
the adhesions and bands between colon and duodenum and the lateral abdominal wall are divided , duodenum and small intestines are freed from rotation and left to the right of abdomen while cecum and ascending colon are placed in the left .
most authors report the permanent cure of infants and children who have undergone operations for the correction of malrotation .
although laparoscopic approach has the advantage of decreased scarring and adhesions , this technique is not adequate to examine the entire intestine .
after ladd 's procedure , bowel obstruction due to adhesion formation is a recognized risk factor .
adhesion - related obstruction is mostly happening within the first postoperative year but can occur at any time .
these obstructions may respond to non - operative treatment but may require operative treatment with serious morbidity as well . while the risk of recurrent midgut volvulus is extremely low , it must be considered in patients who have undergone a ladd 's procedure formerly and have recurrent gastrointestinal symptoms . there have been discussions whether additional intestinal fixation should be carried out in patients who have undergone ladd 's procedure .
it was claimed that duodenopexy and right side fixation of cecum and ascending colon would prevent a secondary volvulus .
stauffer and herrmann reported that one patient out of 28 with intestinal fixation and one out of 49 without intestinal fixation was reoperated upon for recurrent volvulus .
mazeh et al . recommended abrasion of the parietal and visceral peritoneal surfaces when recurrence of malrotation occurs . in another series reported by feitz and vos , of 57 patients who were operated upon for intestinal malrotation , one patient developed recurrent midgut volvulus .
the presence of midgut volvulus and intestinal dysmotility were suggested to be factors that cause delay of postoperative return of bowel function . according to our experience , continuous gastric drip feedings with small daily increases would help the patient tolerate enteral feeding and overcome the intestinal dysmotility problem .
symptoms such as vomiting , obstipation , diarrhea , abdominal pain and cramps have been observed in those patients for more than 6 months .
congenital anomalies of rotation and fixation were reported to be among the most frequent causes of chylous ascites in children [ 10 , 11 ] .
intermittent volvulus results in an increase of pressure and disruption of the lymphatics at the root of mesentery .
although the most common postoperative complication of corrected malrotation requiring surgery is bowel obstruction caused by adhesions , recurrence of the midgut volvulus should not be underestimated .
ultrasound is a non - invasive diagnostic tool for acute cases suggestive of midgut volvulus , but upper gastrointestinal barium investigation should be the conclusive diagnostic test for malrotation with or without volvulus . despite the fact that ladd 's procedure is a satisfactory operation for correction of rotation and fixation anomalies ,
there is still a small but significant risk for the development of recurrent midgut volvulus which may end up with considerable risk of morbidity and mortality . | an eighteen - month - old boy who had undergone a ladd 's procedure for malrotation in the newborn period presented with acute onset of nausea , vomiting , rectal bleeding , and confusion .
laparotomy revealed midgut volvulus , mesenteric lymphadenopathy and massive chylous ascites .
recurrent midgut volvulus following ladd 's procedure is extremely rare but should be borne in mind in cases of persistent or recurrent gastrointestinal symptoms .
timely surgery is necessary to avoid intestinal gangrene and decrease morbidity and mortality related to consequences of midgut volvulus . |
rna surveillance pathways scan for errors arising during transcription and splicing , targeting aberrant rnas for degradation .
nonsense - mediated decay ( nmd ) is one such pathway , detecting mrnas that harbor premature termination or
it has been estimated that nmd regulates approximately 10% of all human mrnas , and that approximately 30% of all disease - associated mutations generate ptcs .
the core machinery comprises three trans - acting factors called up - frameshift ( upf ) proteins .
upf1 is an rna helicase recruited to mrnas upon recognition of stop codons by the translation apparatus .
a key event linking recognition of ptcs to nmd is phosphorylation of upf1 by the smg1 kinase and recruitment of the translational termination release factors erf1 and erf3 ( to form the surf complex ) , which promotes transcriptional repression and recruitment of mrna degradation proteins . in yeast and invertebrates , abnormally long 3 untranslated regions ( utrs ) downstream of stop codons
can act as signals for nmd , while in mammalian cells it is primarily the location of the exon junction complex ( ejc ) .
this multiprotein complex is deposited 20 - 24 nucleotides upstream of exon - exon junctions after pre - mrna splicing . by marking the location of introns relative to the stop codon
, the ejc can signal the presence of a ptc and recruit nmd factors that target the transcript for decay . until recently ,
plant nmd was poorly understood , although many of the protein factors involved in nmd in other eukaryotes were known to be present .
surprisingly , proteomic analysis of purified arabidopsis nucleoli placed six components of the ejc within this subnuclear organelle .
the nucleolus , best known as the site of ribosome biogenesis , has recently been implicated in a much wider range of functions , including regulation of mitosis , stress response , biogenesis of ribonucleoprotein particles , rna editing , and processing of non - coding rnas .
the presence of ejc proteins in both the arabidopsis and human nucleolar proteome suggests that this structure may have additional functions in mrna export and nmd - mediated mrna surveillance .
yeast nucleoli have long been implicated in processing and transport of poly(a)+ mrna . as illustrated in figure 1 ,
plant nucleoli and nucleolar - associated cajal and d - bodies have also been implicated as sites of small interfering rna and microrna biogenesis [ 11 - 15 ] , and several recent studies have detected microrna - like small non - coding rnas derived from small nucleolar rnas in mammals , protozoans , and viruses [ 16 - 19 ] .
it is not that far - reaching to suggest that , once the nucleolus evolved as a site enriched in rrna processing proteins , the cell subsequently exploited it as a convenient site to carry out other rna processing functions .
in addition to its role in transcribing and processing rrna into ribosomal subunits for export to the cytoplasm , the arabidopsis nucleolus has also been implicated in other pathways , including nonsense - mediated decay ( nmd ) .
both exon - joining complex ( ejc ) members and nmd effector proteins were identified by proteomic analysis and shown to localize to this subnuclear organelle , and aberrant mrnas were shown to be more abundant in nucleolar fractions than in nucleoplasmic fractions .
the mechanism of this nucleolar targeting of aberrant mrna is unclear , and may take place in the nucleus , cytoplasm , or both . equally unclear
is whether nmd takes place in the nucleolus and/or nucleus , or whether transcripts are prepared here for export to the cytoplasm , where upf1 is recruited to activated degradation .
both pathways may exist , with the latter primarily handling premature termination codon ( ptc)+ mrnas .
a similar combination of nuclear and cytoplasmic pathways has been proposed for small interfering rna ( sirna ) and microrna ( mirna ) processing in arabidopsis , which take place in nucleolar - associated bodies ( cajal bodies and d - bodies ) .
ago , argonaute ; dcl , dicer - like ; eif4a - iii , eukaryotic initiation factor 4aiii ; hyl1 , hyponastic leaves 1 ; p - body , processing body ; pol iva , rna polymerase iva ; rdr2 , rna - dependent rna polymerase 2 ; risc , rna - induced silencing complex ; rnps1 , rna binding protein s1 , serine - rich domain ; se , serrate ; upf , up - frameshift .
when plant nmd was first analyzed to determine whether it uses a system more like that found in yeast or in mammalian cells , the unexpected answer was
recently , kernyi et al . undertook a functional dissection of these pathways in nicotiana benthamiana and identified several of the trans factors involved .
they verified the co - existence of two nmd pathways : one that eliminates mrnas with long 3 utrs in a manner similar to yeast nmd and a second , distinct pathway that degrades mrnas harboring 3 utr - located introns .
the ejc factors mago and y14 were shown to only be required for this intron - based pathway , suggesting that it is similar to mammalian nmd .
in addition , a protein involved in both pathways , smg7 , was found to be subject to feedback regulation , suggesting the evolutionary conservation of nmd autoregulation throughout all eukaryotes . with the exact location(s ) of nmd in mammalian cells still under debate , particularly with regard to the identification and labeling of ptc+ transcripts , recent results from arabidopsis studies raise the intriguing possibility that certain steps in the plant nmd pathway may occur , at least in part , within the nucleus .
having previously shown the association of ejc and nmd proteins with the plant nucleolus using a proteomic approach , kim et al .
next compared the distribution of mrna classes in whole cell , nuclear , and nucleolar libraries .
not only did they show that mrnas are present in nucleoli , they demonstrated a clear abundance of aberrantly - spliced mrnas in this structure compared with the nucleoplasm .
further examination of these transcripts revealed that most contain ptcs and are putative or known targets of nmd , and several were shown to accumulate in nmd - mutant plants , suggesting a correlation between the enrichment of aberrant mrnas in nucleoli and their turnover by nmd .
in addition to ejc proteins and aberrant mrnas , nmd factors upf2 and upf3 were also shown to localize to the plant nucleolus . however , while plant upf3 shows a clear accumulation in nucleoli , human upf3 , although detected in the nucleolar proteome , is predominantly nucleoplasmic .
this difference is surprising , and may indicate a unique function for the nucleolus in plant nmd .
one possibility put forth by the authors is that plants identify intron - containing transcripts and prepare them for degradation by the nmd pathway in the nucleus and nucleolus , while other ptc+ transcripts without intron fragments are identified upon export by a pioneer round of translation .
when plant nmd was first analyzed to determine whether it uses a system more like that found in yeast or in mammalian cells , the unexpected answer was
recently , kernyi et al . undertook a functional dissection of these pathways in nicotiana benthamiana and identified several of the trans factors involved .
they verified the co - existence of two nmd pathways : one that eliminates mrnas with long 3 utrs in a manner similar to yeast nmd and a second , distinct pathway that degrades mrnas harboring 3 utr - located introns .
the ejc factors mago and y14 were shown to only be required for this intron - based pathway , suggesting that it is similar to mammalian nmd .
in addition , a protein involved in both pathways , smg7 , was found to be subject to feedback regulation , suggesting the evolutionary conservation of nmd autoregulation throughout all eukaryotes .
with the exact location(s ) of nmd in mammalian cells still under debate , particularly with regard to the identification and labeling of ptc+ transcripts , recent results from arabidopsis studies raise the intriguing possibility that certain steps in the plant nmd pathway may occur , at least in part , within the nucleus .
having previously shown the association of ejc and nmd proteins with the plant nucleolus using a proteomic approach , kim et al .
next compared the distribution of mrna classes in whole cell , nuclear , and nucleolar libraries .
not only did they show that mrnas are present in nucleoli , they demonstrated a clear abundance of aberrantly - spliced mrnas in this structure compared with the nucleoplasm .
further examination of these transcripts revealed that most contain ptcs and are putative or known targets of nmd , and several were shown to accumulate in nmd - mutant plants , suggesting a correlation between the enrichment of aberrant mrnas in nucleoli and their turnover by nmd .
in addition to ejc proteins and aberrant mrnas , nmd factors upf2 and upf3 were also shown to localize to the plant nucleolus . however , while plant upf3 shows a clear accumulation in nucleoli , human upf3 , although detected in the nucleolar proteome , is predominantly nucleoplasmic .
this difference is surprising , and may indicate a unique function for the nucleolus in plant nmd .
one possibility put forth by the authors is that plants identify intron - containing transcripts and prepare them for degradation by the nmd pathway in the nucleus and nucleolus , while other ptc+ transcripts without intron fragments are identified upon export by a pioneer round of translation .
the two nmd pathways described here to identify and target specific classes of aberrant mrna for degradation in plant cells bear striking similarities to counterpart systems in yeast and mammals . at the same time , the obligatory role of splicing and the ejc in initiating nmd in mammalian cells is being questioned , with alternative or complementary ejc - independent pathways proposed . taken together ,
the results suggest that these rna surveillance pathways may be more evolutionarily conserved than previously thought , despite the apparent simplification in certain lineages .
although the presence of nmd factors in the nucleolus suggests a role in this pathway , several questions remain .
for example , it is still unclear how aberrant transcripts are recognized and targeted to the nucleolus , and whether nmd can occur in the nucleus or relies on the transfer of aberrant mrnps to the cytoplasm .
indeed , controversy still exists over the location of ejc - mediated nmd in mammalian cells .
while it is generally agreed that a pioneering round of translation is required to detect a ptc , and the current consensus is that this initial round of translation occurs in the cytoplasm , in close proximity to the nucleus , the possibility of some sort of proofreading or downstream processing step in the nucleus can not be ruled out .
it is likely that dissection of nmd pathways in eukaryotic systems will continue to throw up surprises .
| nobody 's perfect , and even the cell turns out a certain fraction of erroneous mrna transcripts .
one of the key quality control mechanisms put in place to recognize and eliminate these transcripts before they can be translated into faulty proteins is nonsense - mediated decay .
proteins involved in nonsense - mediated decay are highly conserved across species from plants to humans , and recent studies in arabidopsis thaliana reveal both intriguing similarities and differences in the mechanisms employed to carry it out . |
cancer accounts for over 10% of all deaths and colorectal cancer ( crc ) is one of the leading causes of cancer - related deaths worldwide .
crc is one of the most frequent malignancies in the world , and despite significantly improved treatment modalities , crc remains a major cause of cancer mortality .
the prognosis of crc was currently quite poor due to the high incidence and lack of effective diagnosis and treatment methods .
worldwide , a significant increase in the crc incidence rate has been detected over the last decade , especially in developing countries .
the tumor node and metastasis ( tnm ) staging system can provide certain clues regarding the prognosis of crc .
recent studies indicated that the discovery and application of sensitive and specific biomarkers could improve the outcome of crc patients .
although relevant studies have been conducted , very few useful biomarkers have been identified for early diagnosis or predication of outcome .
although many studies have been conducted on the etiology of crc , it remains poorly understood .
several in vivo and in vitro studies have been conducted to detect potential biologically plausible pathways in the development of crc , but the detailed physiopathological mechanisms of crc are still quite unclear . it has been reported that reduced apoptosis , abnormal proliferation , and angiogenesis are common pathways for some cancers , including crc .
thus , research on crc angiogenesis would help to explain its development and metastasis , as well as predicting crc patient prognosis .
recently , high mobility group box-1 ( hmgb1 ) , which is an angiogenesis - related gene , was reported to be associated with the development of crc .
it has also been proved that hmgb1 is a potent cytokine that involved in crc angiogenesis .
hmgb1 has long been recognized as a pro - angiogenesis factor leading to the generation of vascular endothelial growth factor ( vegf ) in colon cancer .
since vegf is known as one of the key regulators of crc , this indirect association indicates that hmgb1 may induce angiogenesis in crc .
the signaling pathways related with cell proliferation for hmgb1 in cancer development may be involved downstream .
polymorphisms can potentially influence the expression of hundreds of genes and can influence various kinds of gene function [ 1719 ] .
a variety of snps in different genes were reported to be related to cancer development and are regarded as useful cancer biomarkers , and the use of snp in cancer diagnosis has been widely reported .
for instance , in a recent meta - analysis , the data suggested that the snps in adiponectin gene ( including adipoq rs2241766 t > g , rs1501299 g > t , and rs266729 c > g snps ) are correlated with an increased risk of crc .
snps in hmgb1 regions have been reported to be associated with differential expression of hmgb1 and may be functionally important . recently increasing evidence suggests that genetic alterations in hmgb1 could modify biological pathways and may be associated with cancer development and progression . considering the feasibility and stability of snps detection , it may be a better strategy to use hmgb1 snps in the early diagnosis of crc . however , there is currently no direct evidence of hmgb1 gene polymorphisms as biomarkers for crc .
the aim of this study was to evaluate the association between the different hmgb1 snps and the risk of crc and to determine the clinicopathological characteristics of crc patients with different genotypes .
this research was approved by the institutional review board of shandong university and the informed consent form was also approved by the ethics committee of shandong university . all participation was voluntary and subjects provided written informed consent prior to taking part in this study .
this was a hospital - based case - control study . from 2010 to 2014 , 240 patients diagnosed with crc in the department of anoproctology , the second hospital of shandong university were recruited .
the cases were inpatients newly diagnosed with histologically confirmed crc , without any familial history of cancer .
detailed clinical features , including the age at diagnosis , sex , body mass index , alcohol intake , tobacco smoking , and tumor characteristics were obtained from the medical records and interview of patients .
a structured questionnaire on demographics and environmental exposure was used by trained interviewers through face - to - face interviews with the patients .
a total of 480 age- ( 5 years ) and sex - matched controls were included from the cancer - free population in a 1:2 ratio .
control subjects with any previous history of cancer or severe digestive , endocrinic and cardiovascular diseases were excluded .
5 ml of venous blood was collected from each participant for genomic dna extraction performed as soon as possible after withdrawal .
genomic dna from each sample was extracted using a commercial extraction kit ( bioteke corporation , beijing , china ) according to the manufacturer s directions .
the extracted dna was stored in 70c freezer at the department of anoproctology , the second hospital of shandong university until use .
the distributions of snps of hmgb1 were determined by polymerase chain reaction restriction fragment length polymorphism ( pcr - rflp ) assay .
all pcr and sequencing primers were synthesized by dna - technology a / s ( aarhus , denmark ) .
the dna sequence and polymorphism detection primers were : forward : atgattagtagagggaagcaga gg , reverse : -acagacttcccttttttttcactc ; forward : tgtctgattttacggaggttgat ; reverse : gtttgcacaaaaaatgcatatgat ; forward : atggaagtgggaggcaatttag ; reverse : cattttaaaagttggcccaatt .
the pcr assays were performed on an abi 9600 device ( applied biosystems , usa ) following the manufacturer s directions .
the final relational volume was 5 ml and it contained 0.25 ml primer , 0.125 ml probe , 2 ml pcr mixture reagent , and 25 ng dna .
the cycling condition for hmgb1 snp rs1045411 g consisted of an initial denaturing step at 94c for 5 min followed by 30 cycles of 94c 1 min , 62c 1 min , 72c 1 min , and a final 5-min extension at 72c .
cycling condition for ( rs2249825 and rs1412125 ) consisted of an initial denaturing step at 94c for 5 min followed by 30 cycles of 94c 1 min , 62c 1 min , 72c 1 min , and a final 5-min extension at 72c .
the cycling condition for rs11614913 consisted of an initial denaturing step at 94c for 5 min followed by 35 cycles of 94c for 1 min , 63c for 1 min , 72c for 1 min , and a final 5-min extension at 72c .
representative pcr products were subjected to direct dna sequencing in an abi prism 310 sequence ( applied biosystems , usa ) to confirm the accuracy of this method .
goodness - of - fit test was used to assess the hardy - weinberg equilibrium in this study .
the significance of the differences of genotypes and allelic frequencies in the crc cases and healthy controls was determined using 22 tables and a standard test .
odds ratios ( or ) and 95% confidence intervals ( 95% ci ) were used in the calculation of the corresponding distribution test .
the test was used to assess the association of clinicopathologic characteristics and hmgb1 genotypes and allelic frequencies among crc patients and healthy cases .
all statistical tests were two - sided , and a probability level of p<0.05 was considered to be statistically significant .
this research was approved by the institutional review board of shandong university and the informed consent form was also approved by the ethics committee of shandong university . all participation was voluntary and subjects provided written informed consent prior to taking part in this study .
this was a hospital - based case - control study . from 2010 to 2014 , 240 patients diagnosed with crc in the department of anoproctology , the second hospital of shandong university were recruited .
the cases were inpatients newly diagnosed with histologically confirmed crc , without any familial history of cancer .
detailed clinical features , including the age at diagnosis , sex , body mass index , alcohol intake , tobacco smoking , and tumor characteristics were obtained from the medical records and interview of patients .
a structured questionnaire on demographics and environmental exposure was used by trained interviewers through face - to - face interviews with the patients .
a total of 480 age- ( 5 years ) and sex - matched controls were included from the cancer - free population in a 1:2 ratio .
control subjects with any previous history of cancer or severe digestive , endocrinic and cardiovascular diseases were excluded .
all subjects were genetically unrelated ethnic han chinese . in general , 5 ml of venous blood was collected from each participant for genomic dna extraction performed as soon as possible after withdrawal .
genomic dna from each sample was extracted using a commercial extraction kit ( bioteke corporation , beijing , china ) according to the manufacturer s directions .
the extracted dna was stored in 70c freezer at the department of anoproctology , the second hospital of shandong university until use .
the distributions of snps of hmgb1 were determined by polymerase chain reaction restriction fragment length polymorphism ( pcr - rflp ) assay .
all pcr and sequencing primers were synthesized by dna - technology a / s ( aarhus , denmark ) . the dna sequence and polymorphism detection primers were : forward : atgattagtagagggaagcaga gg , reverse : -acagacttcccttttttttcactc ; forward : tgtctgattttacggaggttgat ; reverse : gtttgcacaaaaaatgcatatgat ; forward : atggaagtgggaggcaatttag ; reverse : cattttaaaagttggcccaatt .
the pcr assays were performed on an abi 9600 device ( applied biosystems , usa ) following the manufacturer s directions .
the final relational volume was 5 ml and it contained 0.25 ml primer , 0.125 ml probe , 2 ml pcr mixture reagent , and 25 ng dna .
the cycling condition for hmgb1 snp rs1045411 g consisted of an initial denaturing step at 94c for 5 min followed by 30 cycles of 94c 1 min , 62c 1 min , 72c 1 min , and a final 5-min extension at 72c .
cycling condition for ( rs2249825 and rs1412125 ) consisted of an initial denaturing step at 94c for 5 min followed by 30 cycles of 94c 1 min , 62c 1 min , 72c 1 min , and a final 5-min extension at 72c .
the cycling condition for rs11614913 consisted of an initial denaturing step at 94c for 5 min followed by 35 cycles of 94c for 1 min , 63c for 1 min , 72c for 1 min , and a final 5-min extension at 72c .
representative pcr products were subjected to direct dna sequencing in an abi prism 310 sequence ( applied biosystems , usa ) to confirm the accuracy of this method .
goodness - of - fit test was used to assess the hardy - weinberg equilibrium in this study .
the significance of the differences of genotypes and allelic frequencies in the crc cases and healthy controls was determined using 22 tables and a standard test .
odds ratios ( or ) and 95% confidence intervals ( 95% ci ) were used in the calculation of the corresponding distribution test .
the test was used to assess the association of clinicopathologic characteristics and hmgb1 genotypes and allelic frequencies among crc patients and healthy cases .
all statistical tests were two - sided , and a probability level of p<0.05 was considered to be statistically significant .
a total of 720 participants ( 346 males and 374 females ) were included in this study , with the mean age of 52.310.7 in crc group and 53.611.4 in the control group . compared with the control group ,
no significant differences were detected in body mass index , alcohol consumption , vegetable intake , or meat intake .
when the tnm stage of the crc cases were considered , 18 cases ( 7.50% ) were in stage i , 21 cases ( 8.87% ) were in stage ii , 172 cases ( 71.67% ) were in stage iii , and a total of 29 cases ( 12.08% ) were in stage iv .
the genotypic and allelic distributions of all 3 hmgb1 snps in crc cases and healthy controls are summarized in table 2 .
the observed genotype frequencies for the snp agreed with those expected from hardy - weinberg equilibrium in crc cases ( p=0.26 ) and controls ( p=0.51 .
in general , participants carrying both rs2249825 cg ( or , 2.67 ; 95% ci , 1.89 to 3.78 ) and rs2249825 gg genotypes ( or , 2.32 ; 95% ci , 1.13 to 4.73 ) had a significantly increased risk of developing crc compared to gg genotype , after adjusting for age and sex . in the dominant model , we found that cg + gg cases have a significantly increased risk of crc compared with the cc cases ( or , 2.61 ; 95% ci , 1.88 to 3.63 ) . in the recessive model
no significant difference was detected ( or , 1.71 ; 95% ci=0.85 to 3.46 ) .
for rs1412125 , compared with the tt genotype , tc genotype and cc genotype demonstrated no significant association ( or=1.57 , 95 ci=0.70 to 3.52 , p=0.248 and or=1.16 , 95% ci=0.85 to 1.58 , p=0.185 , respectively ) .
for rs1045411 , compared with the gg genotype , ga genotype and aa genotype demonstrated no significant association ( or=0.79 , 95 ci=0.57 to 1.09 , p=0.088 and or=1.45 , 95% ci=0.70 to 3.30 , p=208 , respectively ) .
similarly , the genotype distributions of rs1412125 and rs1045411 were not significantly different between cases and controls in either the dominant or recessive models . taken together , these data suggest that rs2249825 , but not rs1412125 or rs1045411 , polymorphism was associated with the risk of crc ( table 2 ) . the number and distribution of hmgb1 snps
the number of rs2249825 g alleles showed a significant dose - response relationship with the risk of crc ( or=2.14 , 95% ci=1.63 to 2.82 , p<0.001 ) , but the c allele in rs1412125 and a allele in rs1045411 showed no significant association with the risk of crc ( table 3 ) .
a total of 720 participants ( 346 males and 374 females ) were included in this study , with the mean age of 52.310.7 in crc group and 53.611.4 in the control group . compared with the control group ,
no significant differences were detected in body mass index , alcohol consumption , vegetable intake , or meat intake .
when the tnm stage of the crc cases were considered , 18 cases ( 7.50% ) were in stage i , 21 cases ( 8.87% ) were in stage ii , 172 cases ( 71.67% ) were in stage iii , and a total of 29 cases ( 12.08% ) were in stage iv .
the genotypic and allelic distributions of all 3 hmgb1 snps in crc cases and healthy controls are summarized in table 2 .
the observed genotype frequencies for the snp agreed with those expected from hardy - weinberg equilibrium in crc cases ( p=0.26 ) and controls ( p=0.51 .
in general , participants carrying both rs2249825 cg ( or , 2.67 ; 95% ci , 1.89 to 3.78 ) and rs2249825 gg genotypes ( or , 2.32 ; 95% ci , 1.13 to 4.73 ) had a significantly increased risk of developing crc compared to gg genotype , after adjusting for age and sex . in the dominant model
, we found that cg + gg cases have a significantly increased risk of crc compared with the cc cases ( or , 2.61 ; 95% ci , 1.88 to 3.63 ) . in the recessive model
no significant difference was detected ( or , 1.71 ; 95% ci=0.85 to 3.46 ) .
for rs1412125 , compared with the tt genotype , tc genotype and cc genotype demonstrated no significant association ( or=1.57 , 95 ci=0.70 to 3.52 , p=0.248 and or=1.16 , 95% ci=0.85 to 1.58 , p=0.185 , respectively ) .
for rs1045411 , compared with the gg genotype , ga genotype and aa genotype demonstrated no significant association ( or=0.79 , 95 ci=0.57 to 1.09 , p=0.088 and or=1.45 , 95% ci=0.70 to 3.30 , p=208 , respectively ) .
similarly , the genotype distributions of rs1412125 and rs1045411 were not significantly different between cases and controls in either the dominant or recessive models
. taken together , these data suggest that rs2249825 , but not rs1412125 or rs1045411 , polymorphism was associated with the risk of crc ( table 2 ) .
the number of rs2249825 g alleles showed a significant dose - response relationship with the risk of crc ( or=2.14 , 95% ci=1.63 to 2.82 , p<0.001 ) , but the c allele in rs1412125 and a allele in rs1045411 showed no significant association with the risk of crc ( table 3 ) .
crc is one of the most common gastrointestinal carcinomas worldwide . over the past decades ,
although the effect of hmgb1 on the development of crc has been widely studied , the distribution hmgb1 snps in crc cases and controls has not received much attention . in this case - control study
, we observed a significant association between overall crc risk and snp rs2249825 ( cg vs. cc and gg vs. cc ) .
participants carrying both rs2249825 cg ( or , 2.67 ; 95% ci , 1.89 to 3.78 ) and rs2249825 gg genotypes ( or , 2.32 ; 95% ci , 1.13 to 4.73 ) had a significantly increased risk of developing crc compared to those with gg genotype .
rs2249825 was associated with the risk of crc in the dominant model but not in the recessive model .
however , we found that no significant differences were detected in the rs1412125 or rs1045411 polymorphisms in hmgb1 . to further explore the potential association of allele distribution of hmgb1 snps and risk of crc
, we performed an advanced analysis and found that the rs2249825 g allele showed a significant dose - response relationship with the risk of crc ( or=2.14 , 95% ci=1.63 to 2.82 , p<0.001 ) .
these results indicate that among all the hmgb1 snps , rs2249825 , but not other snp sites , was associated with crc risk .
hmgb1 plays a critical role in various diseases and disorders , especially in inflammatory , immune responses , and hypoxia in the cancer microenvironment . however , there are conflicting reports about the roles of hmgb1 acting as both a tumor suppressor and an oncogenic factor in cancer
. more knowledge is required about the role of hmgb1 in crc tumorigenesis . in a recent study
, genomic alterations of these genes were investigated through using the cancer genome atlas ( tcga ) database , utilizing 195 published crc specimens . by utilizing a cancer array , containing 440 oncogenes and tumor suppressors to profile mrna expression , rpn2 and hmgb1 displayed a higher genomic alteration frequency in crc compared to 8 other major solid cancers . in another study based immunohistochemical method with 86 colorectal cancer patients and 32 normal controls ,
it was found that hmgb1 expression in colorectal cancer is high , and its positive rate increases with lower differentiation , invasion , and metastasis .
another study was conducted to investigate the in vitro effects of ulinastatin ( uti ) on the proliferation , invasion , apoptosis , expression , and distribution of high mobility group box 1 ( hmgb1 ) and the expression of nuclear factor b ( nf-b ) in human colon carcinoma lovo cells .
it was found that uti inhibited the expression of hmgb1 and nf-b , and decreased the cytoplasmic distribution of hmgb1 .
it was reported that high hmgb1expression was associated with larger tumor volumes , higher rates of lymphatic invasion , more frequent lymph node metastases , and poorer prognoses for overall survival .
because the endothelium plays a pivotal role in the progression of solid tumors , it is important to study the effect hmgb1 , which is an angiogenesis factor , on the tumor angiogenesis of crc cells . in general
, hmgb1 stimulates the expression of vascular endothelial growth factor and platelet - derived growth factor signaling , both in vitro and in vivo .
importantly , it was also shown that hmgb1 triggers and helps to sustain this proangiogenic gene expression program in ecs , additionally characterized by increased activity of matrix metalloproteinases , integrins , and nuclear factor-b .
another study was conducted to identify the specific enzyme and important sites for hmgb1 phosphorylation . through screening the protein kinase c ( pkc ) family in a colon cancer cell line ,
strong interactions between atypical pkcs and cytoplasm were detected . by using pkc inhibitors and sirna experiments , it was found that the most critical pkc isotype that regulates hmgb1 secretion is pkc- .
autophagy plays a key role in the effect of anti - cancer drugs , and it was found that hmgb1-mediated autophagy modulates sensitivity of colorectal cancer cells to oxaliplatin via the mek / erk signaling pathway .
previous studies have demonstrated that polymorphisms of certain genes can influence gene expression and biological functions .
a total of 3 frequently used snps within the human hmgb1 gene have been obtained in this current study .
a previous study examined the snps in hmgb1 gene in patients with oral squamous cell carcinoma ( oscc ) and oral lichen planus ( olp ) . the data from 93 patients with oscc , 53 patients with olp , and 100 controls showed that hmgb1 polymorphism 1177g / c is be associated with tumor progression and recurrence - free survival in patients with oscc .
another study was conducted to detect hmgb1 production in response to ex vivo lipopolysaccharide ( lps ) stimulation .
it was reported that rs2249825 snp and the haplotype tcg were significantly associated with lps - induced hmgb1 production by peripheral blood leukocytes .
thus , it was important for the evolution of hmgb1 snps as diagnostic biomarker of crc and it is of interest for the detection of the value of hmgb1 snps for predicting the prognosis of crc patients .
however , how the snps in the hmgb1 gene influenced the progression of disorders is unclear . a study based on clinical samples reported that patients with rs2249825 gg genotype had significantly elevated levels of hmgb1 in chorionic villi compared to those with cg or cc genotype . in the present study , we found that only snp rs2249825 was associated with crc incidence . given that rs2249825 is associated with the expression of hmgb1 , which would promote the development of crc , it was natural to think that rs2249825 influences crc development through modifying the expression of hmgb1 .
our results show an association between hmgb1 rs2249825 snp and crc incidence in the chinese han population .
however , no significant association of the 2 other ( rs1412125 and rs1045411 polymorphisms ) snps and risk of crc was detected .
advanced analyses showed that the number of rs2249825 g alleles showed a significant relationship with the risk of crc .
however , population - based studies with large numbers of subjects and prognostic effects are needed to verify the association of hmgb1 snps and crc susceptibility , severity , and long - term prognosis . | backgroundcolorectal cancer ( crc ) is one of the leading causes of cancer - related deaths worldwide .
more advanced work is required in the detection of biomarkers for crc susceptibility and prognosis .
high - mobility group box-1 ( hmgb1 ) is an angiogenesis - related gene reported to be associated with the development of crc .
the direct evidence of hmgb1 gene polymorphisms as biomarkers for crc has not been reported previously.material/methodsa total of 240 crc patients and 480 healthy controls were periodically enrolled .
dna was extracted from blood specimens .
the distributions of snps of hmgb1 were determined by using the polymerase chain reaction restriction fragment length polymorphism ( pcr - rflp ) assay.resultsin this case - control study , we observed a significant association between overall crc risk and snp rs2249825 ( cg vs. cc and gg vs. cc ) .
participants carrying both rs2249825 cg ( or , 2.67 ; 95% ci , 1.89 to 3.78 ) and rs2249825 gg genotypes ( or , 2.32 ; 95% ci , 1.13 to 4.73 ) had a significantly increased risk of developing crc compared to those carrying gg genotype .
rs2249825 was associated with the risk of crc in the dominant model but not in the recessive model .
however , we found no significant differences in the rs1412125 or rs1045411 polymorphisms in the hmgb1 .
advanced analyses showed that the number of rs2249825 g alleles showed a significant relationship with risk of crc.conclusionsour results show an association between hmgb1 rs2249825 snp and crc incidence in the chinese han population .
however , population - based studies with more subjects and prognostic effects are needed to verify the association of hmgb1 snps with crc susceptibility , severity , and long - term prognosis . |
coercion is one of the most controversial aspects in the treatment and management of psychiatric disorders .
coercion is the negative subjective experience of loss of autonomy caused by an involuntary action , in this case from the mental health services toward a patient .
further perceived coercion of psychiatric patients would have a strong negative impact on treatment adherence . in india , like in any other developing countries coerced hospital admissions are acceptable for any person who suffers from a psychiatric disorder and poses danger to oneself or others .
however , coercive measures are widely regarded as an important human rights issue according to the united nations convention on the rights of persons with disabilities and mental health users . a recent literature review on the prevalence of perceived coercion of psychiatric patients revealed that the prevalence of perceived coercion ranged from 16% to 90% .
coercion becomes inevitable in psychiatry , considering the nature of illness ( psychotic ) and when they become dangerous to self and/or others .
in addition , studies on coercion in psychiatric admission have reported that involuntary admission presented more coercive feelings .
nonetheless , coerced hospital admissions are influenced by various factors such as economical , cultural and religious beliefs , diagnosis , knowledge about illness , insight , available resources , and social and family support .
furthermore , research on the issue of coercion in psychiatry is an urgent concern as it has greater impact on treatment adherence and it is important to gain more insight into the perceptions of patients regarding the experience of the admission process , which is crucial in reviewing and implementing mental health care bill , 2013 ( mhc bill , 2013 ) .
for these reasons , the present study was aimed to investigate the perceived coercion of psychiatric patients during admission into a psychiatric hospital keeping the current mental health act 1987 and mhc bill , 2013 , in perspective .
all the patients those were admitted in a tertiary hospital during the year 2015 were included in the present study .
the study population was selected randomly from admission register . among them , those who met the inclusion criteria were included in the study .
the inclusion criterion includes : ( a ) patients admitted with psychiatric illnesses as international classification of diseases-10 criteria , ( b ) all individuals 18 years and above , and ( c ) willing to participate and were able to give the informed consent .
patients with acutely symptomatic ( dangerous to self and/or others ) , organic diagnoses including mental retardation , substance abuse dementia , delirium , or organic brain diseases were excluded from the study . in total , 325 patients were approached [ flow chart 1 ] . among them , 120 ( 36.9% ) could not to participate due to severe symptoms and could not be enrolled in the study .
hence , the final sample for the study comprised 205 patients with 63% response rate.[inline:1 ] sociodemographic data sheet sociodemographic details include age , gender , educational status , marital status , employment , residence , religion , monthly income , diagnosis , types of admission , reasons for admission according to patient and family , history of past hospitalization , living situation , history of substance abuse , insight into mental illness , need for hospitalization , and whether first consultation was with psychiatrist or others .
macarthur admission experience survey this scale was developed by macarthur research network on mental health and the law to assess patients perceptions of coercion during their admission to psychiatric hospital .
this was a 20-point self - rating scale with four subscales to capture specific dimensions of perceived coercion as follows : perceived coercion subscale ( items 1 , 4 , 7 , 14 , and 15 ) - the influence , control , choice , and freedom that patients had in their admission ( e.g. i chose to come into the hospital ) , negative pressure subscale ( items 2 , 6 , 8 , 10 , 11 , and 12 ) - the amount of persuasion , threat , inducements , and force used on patients to get them into the hospital ( e.g. people tried to force me to come into the hospital ) , voice subscale ( items 3 , 5 and 13 ) , and affective reaction subscale ( item 16 with its 6 affective components such as angry , sad , pleased , relieved , confused , and frightened ) .
this questionnaire was used because the items were simple and easy to understand and answer .
further studies indicate high level of consistency between the subscales and the total score of the macarthur admission experience survey ( maes ) .
a pilot study was conducted among a small group of participants , and it was that the tool was feasible to conduct the study . before data collection , all the researchers discussed the items in the questionnaire .
the participants those who met the inclusion criteria were explained by the researchers about the aims and objectives of the study . after obtaining
the written informed consent from the participants , the data were collected using face - to - face interview using the structured questionnaire . the research protocol was reviewed and approved by the institute ethics committee .
participation in this study was voluntary , and each participant was informed that their decision to participate or not , would in no way not affect his or her treatment .
written informed consent was obtained from all the participants , and they were given freedom to withdraw from the study at any time .
all responses to the questionnaire remained confidential , and a code was used so participants could not be identified from their responses .
descriptive ( frequency and percentage ) and inferential statistics ( t - test ) were used to interpret the data . statistical significance was assumed at p > 0.05 .
all the patients those were admitted in a tertiary hospital during the year 2015 were included in the present study .
the study population was selected randomly from admission register . among them , those who met the inclusion criteria were included in the study .
the inclusion criterion includes : ( a ) patients admitted with psychiatric illnesses as international classification of diseases-10 criteria , ( b ) all individuals 18 years and above , and ( c ) willing to participate and were able to give the informed consent .
patients with acutely symptomatic ( dangerous to self and/or others ) , organic diagnoses including mental retardation , substance abuse dementia , delirium , or organic brain diseases were excluded from the study . in total , 325 patients were approached [ flow chart 1 ] . among them , 120 ( 36.9% ) could not to participate due to severe symptoms and could not be enrolled in the study .
hence , the final sample for the study comprised 205 patients with 63% response rate.[inline:1 ]
sociodemographic data sheet sociodemographic details include age , gender , educational status , marital status , employment , residence , religion , monthly income , diagnosis , types of admission , reasons for admission according to patient and family , history of past hospitalization , living situation , history of substance abuse , insight into mental illness , need for hospitalization , and whether first consultation was with psychiatrist or others .
macarthur admission experience survey this scale was developed by macarthur research network on mental health and the law to assess patients perceptions of coercion during their admission to psychiatric hospital .
this was a 20-point self - rating scale with four subscales to capture specific dimensions of perceived coercion as follows : perceived coercion subscale ( items 1 , 4 , 7 , 14 , and 15 ) - the influence , control , choice , and freedom that patients had in their admission ( e.g. i chose to come into the hospital ) , negative pressure subscale ( items 2 , 6 , 8 , 10 , 11 , and 12 ) - the amount of persuasion , threat , inducements , and force used on patients to get them into the hospital ( e.g. people tried to force me to come into the hospital ) , voice subscale ( items 3 , 5 and 13 ) , and affective reaction subscale ( item 16 with its 6 affective components such as angry , sad , pleased , relieved , confused , and frightened ) .
this questionnaire was used because the items were simple and easy to understand and answer .
further studies indicate high level of consistency between the subscales and the total score of the macarthur admission experience survey ( maes ) .
sociodemographic data sheet sociodemographic details include age , gender , educational status , marital status , employment , residence , religion , monthly income , diagnosis , types of admission , reasons for admission according to patient and family , history of past hospitalization , living situation , history of substance abuse , insight into mental illness , need for hospitalization , and whether first consultation was with psychiatrist or others .
macarthur admission experience survey this scale was developed by macarthur research network on mental health and the law to assess patients perceptions of coercion during their admission to psychiatric hospital .
this was a 20-point self - rating scale with four subscales to capture specific dimensions of perceived coercion as follows : perceived coercion subscale ( items 1 , 4 , 7 , 14 , and 15 ) - the influence , control , choice , and freedom that patients had in their admission ( e.g. i chose to come into the hospital ) , negative pressure subscale ( items 2 , 6 , 8 , 10 , 11 , and 12 ) - the amount of persuasion , threat , inducements , and force used on patients to get them into the hospital ( e.g. people tried to force me to come into the hospital ) , voice subscale ( items 3 , 5 and 13 ) , and affective reaction subscale ( item 16 with its 6 affective components such as angry , sad , pleased , relieved , confused , and frightened ) .
this questionnaire was used because the items were simple and easy to understand and answer .
further studies indicate high level of consistency between the subscales and the total score of the macarthur admission experience survey ( maes ) .
a pilot study was conducted among a small group of participants , and it was that the tool was feasible to conduct the study . before data collection , all the researchers discussed the items in the questionnaire .
the participants those who met the inclusion criteria were explained by the researchers about the aims and objectives of the study . after obtaining
the written informed consent from the participants , the data were collected using face - to - face interview using the structured questionnaire .
participation in this study was voluntary , and each participant was informed that their decision to participate or not , would in no way not affect his or her treatment .
written informed consent was obtained from all the participants , and they were given freedom to withdraw from the study at any time .
all responses to the questionnaire remained confidential , and a code was used so participants could not be identified from their responses .
descriptive ( frequency and percentage ) and inferential statistics ( t - test ) were used to interpret the data .
a total of 205 mental health consumers participated in the present study of whom , a majority was women ( 64.4% ) .
participants were predominantly young to middle - aged adults ( mean age , 35 years ) , a majority of them were hindus ( 82% ) , married ( 60% ) , and were from urban background ( 53.2% ) .
more number of ( 86.3% ) participants was diagnosed as psychotic disorders such as psychosis , bipolar affective disorders , and paranoid schizophrenia and admitted to the psychiatric hospital involuntarily .
, more than three - fourth of the participants had insight about their illness and agreed that they were in need of hospitalization .
although majority of the participants first consulted psychiatrists ( 62.4% ) , 27.3% met the religious practitioners and traditional healers [ table 1 ] .
characteristics of the sample table 2 summarizes the mental health consumers admission experiences into the psychiatric hospital . with regard to perceived coercion
domain , majority of the participants felt free to do what they wanted about coming into the hospital ( 61.5% ) and they had more influence than anyone else on whether they came into the hospital ( 51.2% ) .
however , majority of them were contradicted with the items such as i chose to come into the hospital ( 56.1% ) , it was my idea to come into the hospital ( 64.9% ) and i had a lot of control over whether i went into the hospital ( 50.7% ) . although most of the sample agreed that people did not force ( 62% ) , threatened ( 68.8% ) , and physically tried ( 70.2% ) them to come to the hospital , a majority of them were threatened with commitment ( 71.7% ) .
the mean score for negative pressure subscale was mean standard deviation , 3.76 2.12 , which indicates a higher level of coercion in this domain .
participants responded positively to the items in voice scale domain as they had enough of a chance ( 58.5% ) and got to say whether they wanted to come to the hospital ( 57.1% ) .
however , more than half of them accorded that their opinion about coming into the hospital did not matter . with regard to the participants affective reactions to hospitalization , majority of them were sad ( 67.8% ) , unpleased ( 69.7% ) , unrelieved ( 48.8% ) , confused ( 73.2% ) , and frightened ( 71.2% ) .
participants responses to macarthur 's admission experience survey scale table 3 depicts comparative responses on maes of the participants from the type of admission ( voluntary vs. involuntary admission ) .
participants those were admitted involuntarily reported to have significantly more on perceived coercion subscale ( t = 5.141 , p > 0.0001 ) and voluntarily admitted participants reported significantly more on negative pressure subscale ( t = 3.445 , p > 0.001 ) ; however , there was no significant difference between the group with regard to voice subscale .
to the best of our knowledge , this is the first study that investigated admission experiences of psychiatric patients from india using internationally standardized questionnaire with random sampling .
however , the present study has certain limitations such as cross - sectional survey and sample was limited to a single setting .
persons with acutely symptomatic were excluded from the study ; hence , this limits the generalization of findings .
excluding extremely symptomatic ( dangerous to self and/or others ) patient plays important bias as these patients would likely to experience high levels of coercion on one hand , but at the same time , capturing the qualitative information during the interview is nearly impossible and validity of such information from such patients are questionable because of loss of reasoning power .
however , the present study was carried out at a tertiary care center among randomly selected sample and who were in a position to give consent .
hence , our sample is likely to be representative of the study site population who were willing to participate and cooperative .
this study is not applicable to those patients who are acutely symptomatic and/or difficult to interview . in india , the majority of the family members provide care to these acutely symptomatic patients , and they use all possible measures so that their family member is treated and becomes normal , which in turns he / she regains liberty . in the present study , participants perceived lower levels of coercion
. however , most of the sample expressed informal coercion that included negative pressures such as persuasion , threat , and force to come into the hospital . in the current study ,
most of the sample was women and married . while these findings were dissimilar to other studies on coerced admission into psychiatric hospital , similar in terms of unemployment as more number of the participants were unemployed . in line with previous research ,
these findings could be due to more number of the patients were diagnosed with psychotic disorders .
however , studies indicate that mental health service users views about their involuntary admission have been shown to change over time . in support of published research
earlier research indicates that seeking religious help for mental disorders is often a first step in the management of mental disorders as a result of cultural explanations for the illness .
similar to these findings , nearly one - fourth of the participants in this study visited religious practitioners for the treatment of mental illness .
these findings could be due to widely prevalent magic - religious beliefs that were related with mental illness and also were culturally and socially accepted in india .
further , low literacy , low economic status , and stigma associated with mental illness were the obstacles in seeking help from mental health services .
several studies showed that mental health service users report high levels of perceived coercion during the admission process and over the course of their admission .
dissimilar to these findings , most of the sample expressed low levels of coercion during their admission into psychiatric hospital .
however , our findings were consistent with studies that indicate significant relation between maes and legal status of admission .
the involuntarily admitted patients perceived significantly higher levels of formal coercion than the participants with volunteer admission .
similarly , participants with psychotic disorders such as psychosis , schizophrenia , and unmarried patients experienced higher levels of coercion .
the possible explanation for these findings could be due to the presence of psychotic symptoms among the participants .
earlier published research indicates that perceived coercion could be a barrier to mental health service use and a more sensitive approach to informal coercion might be beneficial for long - time adherence .
the present study also observed informal coercion of the voluntarily admitted patients ( p = 0.001 ) .
family members and the general public are willing to accept the coerciveness of people with mental illness to improve treatment adherence .
hence , they influence the people with mental illness with negative pressures such as threat or physical force to admit them into the psychiatric hospital .
further , in support of previous research , participants with the presence of insight into illness encountered informal coercion during their admission process . on the other hand , psychiatric patients with lack of insight into mental illness perceived high levels of coercion .
similarly , participants those diagnosed with neurotic disorders and married felt high levels informal coercion to admit into the psychiatric hospitals .
however , gender , background , and experience of past hospitalization did not found any statistically significant difference with maes scale .
this study was done in a tertiary care center and had 80% involuntary admission under mental health act , 1987 .
the main reasons quoted by the admitting physician for involuntary admissions were as follows 25% harm to others , 22% unable to care for themselves , 14% harm to self , and 32% combination of the above factors .
although 325 patients were approached for the study , only 205 were able to be enrolled . among them , 120 of them could not to participate due to severe symptoms and could not be enrolled in the study .
almost more than 50% of the study population were excluded because of their severe symptoms and could not be included in the study [ flow chart 1 ] .
an important significant finding was that 192 ( 93.7% ) patients were living with family members and they were the primary caregivers . as per the family members , 30% harm to others ,
28% unable to care for themselves , 18% harm to self , and 18% combination of the above factors .
role of family members in providing mental health care is an important asset in our society and needs to be fostered .
if family members are not empowered and supported , in no time , these patients will be disowned and subsequently , a large number of patients will be wandering mentally ill at large .
recruitment of the participants the draft mhc bill , 2013 , is rights - based and gives enormous amount of power to the patient but disengages family members .
the best example is clause 4 of the bill ( capacity to consent for treatment ) discusses the patient 's capacity - every person shall be deemed to have capacity to make decisions regarding his mental health care or treatment , if such person has ability to ( a ) understand information , ( b ) retain information , ( c ) use or weigh information , and ( d ) communicate his decision .
for example , a person with mental illness symptoms may fulfill all the above four criteria , yet he may refuse to acknowledge that he / she is suffering from illness and may refuse treatment ( absent insight patient ) . similarly , patient 's paranoid symptoms may also come in his way of decision - making process .
hence , there is a need to add one more criteria stating that if a person is suffering from such a mental disorder in which his / her symptoms interfere his / her decision - making process , and then his / her decisions need to be considered incompetent .
otherwise , family members providing care will face the consequences of the patient 's illness if he refuses to take treatment .
mhc bill , 2013 , gives clear dictates about the procedure for involuntary admission procedure but does not discusse the involuntary or compulsory treatment for involuntary admission patients or treatment in community . to treat a patient against his will , one has to approach the mental health commission to get the approval
however , this process of mental health treatment , is a litigation based and cost the family members a enormously as well delays in initiating the treatment .
there is no mention about the huge resource - mobilization that is required to realize various promises that the bill is holding out .
hence , the mhc bill needs to facilitate in providing adequate resources before implementing the planned bill .
adequate resources in terms of a number of mental hospitals beds , general hospitals beds for persons with mental illness , psychiatrist , clinical psychologist , psychiatric social worker , psychiatric nursing , and adequate budget for providing mental health care .
the present study clearly establishes that coercion is present , and it is part of providing psychiatric services . there is an urgent need to increase the workforce phenomenally so that counseling and treatment can be given at doorsteps and coercion can be decreased . if not the bill will be disaster for both family members and persons with mental illness with regard to providing care .
this study was done in a tertiary care center and had 80% involuntary admission under mental health act , 1987 .
the main reasons quoted by the admitting physician for involuntary admissions were as follows 25% harm to others , 22% unable to care for themselves , 14% harm to self , and 32% combination of the above factors .
although 325 patients were approached for the study , only 205 were able to be enrolled . among them , 120 of them could not to participate due to severe symptoms and could not be enrolled in the study .
almost more than 50% of the study population were excluded because of their severe symptoms and could not be included in the study [ flow chart 1 ] .
an important significant finding was that 192 ( 93.7% ) patients were living with family members and they were the primary caregivers .
as per the family members , 30% harm to others , 28% unable to care for themselves , 18% harm to self , and 18% combination of the above factors . role of family members in providing mental health care is an important asset in our society and needs to be fostered .
if family members are not empowered and supported , in no time , these patients will be disowned and subsequently , a large number of patients will be wandering mentally ill at large .
recruitment of the participants the draft mhc bill , 2013 , is rights - based and gives enormous amount of power to the patient but disengages family members .
the best example is clause 4 of the bill ( capacity to consent for treatment ) discusses the patient 's capacity - every person shall be deemed to have capacity to make decisions regarding his mental health care or treatment , if such person has ability to ( a ) understand information , ( b ) retain information , ( c ) use or weigh information , and ( d ) communicate his decision .
for example , a person with mental illness symptoms may fulfill all the above four criteria , yet he may refuse to acknowledge that he / she is suffering from illness and may refuse treatment ( absent insight patient ) . similarly , patient 's paranoid symptoms may also come in his way of decision - making process .
hence , there is a need to add one more criteria stating that if a person is suffering from such a mental disorder in which his / her symptoms interfere his / her decision - making process , and then his / her decisions need to be considered incompetent .
otherwise , family members providing care will face the consequences of the patient 's illness if he refuses to take treatment .
mhc bill , 2013 , gives clear dictates about the procedure for involuntary admission procedure but does not discusse the involuntary or compulsory treatment for involuntary admission patients or treatment in community . to treat a patient against his will , one has to approach the mental health commission to get the approval
however , this process of mental health treatment , is a litigation based and cost the family members a enormously as well delays in initiating the treatment .
there is no mention about the huge resource - mobilization that is required to realize various promises that the bill is holding out .
hence , the mhc bill needs to facilitate in providing adequate resources before implementing the planned bill .
adequate resources in terms of a number of mental hospitals beds , general hospitals beds for persons with mental illness , psychiatrist , clinical psychologist , psychiatric social worker , psychiatric nursing , and adequate budget for providing mental health care .
the present study clearly establishes that coercion is present , and it is part of providing psychiatric services .
there is an urgent need to increase the workforce phenomenally so that counseling and treatment can be given at doorsteps and coercion can be decreased . if not the bill will be disaster for both family members and persons with mental illness with regard to providing care .
the present study showed that more formal coercion was experienced by the patients those got admitted involuntarily . on the contrary ,
however , there is an urgent need to educate the caregivers of persons with mental illness to respect the rights of psychiatric patients .
there is an urgent need to modify the mhc bill so that treatment of persons with mental illness is facilitated .
family member plays an important role in providing mental health care ; hence , they need to be empowered .
future research should focus on interventional studies that reduce the perception of coercion including involvement of psychiatric patients in the treatment and management of illness .
| background : coercion is not uncommon phenomenon among mental health service users during their admission into psychiatric hospital
. research on perceived coercion of psychiatric patients is limited from india.aim:to investigate perceived coercion of psychiatric patients during admission into a tertiary care psychiatric hospital.materials and methods : this was a cross - sectional descriptive survey carried out among randomly selected psychiatric patients ( n = 205 ) at a tertiary care center .
data were collected through face - to - face interviews using structured questionnaire.results:our findings revealed that participants experienced low levels of coercion during their admission process . however , a majority of the participants were threatened with commitment ( 71.7% ) as well as they were sad ( 67.8% ) , unpleased ( 69.7% ) , confused ( 73.2% ) , and frightened ( 71.2% ) with regard to hospitalization into a psychiatric hospital .
in addition , the participants expressed higher levels of negative pressures ( mean standard deviation , 3.76 2.12 ) .
participants those were admitted involuntarily ( p > 0.001 ) , diagnosed to be having psychotic disorders ( p > 0.003 ) , and unmarried ( p > 0.04 ) perceived higher levels of coercion.conclusion:the present study showed that more formal coercion was experienced by the patients those got admitted involuntarily . on the contrary , participants with voluntary admission encountered informal coercion ( negative pressures ) .
there is an urgent need to modify the mental health care ( mhc ) bill so that treatment of persons with mental illness is facilitated .
family member plays an important role in providing mhc ; hence , they need to be empowered . |
the eye is not immuned from developing cancers ; it has its own share of primary and secondary cancers .
tumors refer to new growths and are quite dreadful to both careers and patients alike especially when malignant . yet , the safety of benign ones is not absolute .
this notwithstanding , the world appeared to be more aware of certain cancers particularly cancers of the breast , prostate , cervix , and leukemia among others .
unlike aforesaid other cancers , ocular cancers ( oc ) have not received the required attention especially in a resource - limited economy .
nevertheless , medical experts are not unaware of potential danger of cancers , irrespective of the involved organ .
aside the apparent societal informal low prioritization ranking , especially in a resource - limited economy , oc are faced by many challenges .
its awareness and knowledge among the populace are below what they should be , especially with low literacy levels and absent public ocular cancer health education messages .
this can be seen in the patients attitude of presenting late with oc , expected quick resolution even when the cancer is advanced , patient discharging self from the hospital against medical advice to seek alternative traditional treatment among others
. moreover , the available medical management options for oc in a resource - limited economy are not abreast of what is currently available in advanced economies .
this deficiency of ocular oncologists may be so as the available few ophthalmologists are more involved with the albeit not necessarily fatal , backlog of avoidable causes of blindness coupled with the lack of training and diagnostic facilities in eye care institutions .
ocular oncology needs to be developed in resource - limited economies alongside other subspecialties of eye care .
achieving this requires particular attention to these challenges which will be an invaluable benefit in preventing blindness and loss of lives consequent to oc .
almost all studies on ocular tumors in nigeria , a resource - limited economy , are hospital based and are concerned with the pattern especially , clinicopathological reports of oculo - orbital tumors[39 ] .
efforts towards improving the care of oc in a resource - limited economy will be enhanced by some base line data on the perception of the populace on oc .
this paper reports on the awareness and knowledge of oc in a resource - limited economy
. the findings would be fundamental to developing oc advocacy programs including public awareness campaigns towards early detection and treatment .
moreover , creating awareness would generate good political will towards the care of patients with oc .
this study was undertaken in abuja , the federal capital territory ( fct ) , nigeria between june and september , 2009 following the guidelines in the declaration of helsinki .
ethical approval for the study was obtained from university of abuja teaching hospital health research ethics committee and informed consent to participate was obtained from individual respondents .
a pre - tested semi - structured questionnaire was administered to determine the awareness , knowledge , attitudes , beliefs and practices on ocular cancers ( oc ) .
all respondents who participated in the pilot study were not included in this analysis . a sample size of 1,536 respondents
was determined using the equation n = zpq / d where n is the desired sample size ( since the population of nigerians living in fct is more than 10 , 000 ) .
the expected prevalence of awareness of oc amongst nigerians ( p ) was estimated to be 40% as extrapolated from a related study in india .
other parameters were standard normal deviation ( z ) of 1.96 , a confidence level of 95% and desired precision due to random sampling error ( d ) of 2.5% .
the fct is divided into 6 administrative units - area councils . by a stratified cluster random sampling technique ,
three area councils - abuja municipal , kuje and gwagwalada - were selected for this study .
data collection was done by the authors and five trained field assistants who were fluent in nigerian languages and english .
inclusion criteria were being nigerians , 18 years and older , and living in the fct during the study period .
the data was collated , entered and analyzed using spss 16 ( spss inc , usa ) .
the test of significance was performed using the chi - square test for some parameters including the respondents level of awareness of cancers ( in general ) and ocular cancers ; the respondents awareness and their level of education , gender , marital status and faith practiced .
the data was collated , entered and analyzed using spss 16 ( spss inc , usa ) .
the test of significance was performed using the chi - square test for some parameters including the respondents level of awareness of cancers ( in general ) and ocular cancers ; the respondents awareness and their level of education , gender , marital status and faith practiced .
the data was collated , entered and analyzed using spss 16 ( spss inc , usa ) .
the test of significance was performed using the chi - square test for some parameters including the respondents level of awareness of cancers ( in general ) and ocular cancers ; the respondents awareness and their level of education , gender , marital status and faith practiced .
there were 1,887 respondents comprising of 1,050 ( 55.6% ) males and 837 ( 44.4% ) females ( m : f=1.3:1 ) with an age range of 18 to 80 years , and a mean of 30 years , sd 9.5 .
the respondents cut across all the 36 states of nigeria and the fct , and are from over one hundred ethnic groups of nigeria .
demographic data of respondents , n = 1,887 only ( 57.1% ) respondents were aware of ocular cancers compared to ( 73.7% ) respondents who were aware of cancers in general ( fig . 1 ) and was statistically significant ( = 101.618 , p<.001 ) .
though the male respondents predominated there were no significant associations between gender and awareness of oc ( = 3.212 , p=0.07 ) and cancers in general ( = 0.036 , p=0.85 ) .
however , the level of education was significantly associated with awareness of oc ( = 50.414 , p=.001 ) in particular and cancers in general ( = 416.926 , p=.001 ) .
the awareness of oc is not associated with the respondents marital status ( p=0.50 ) and the faith practiced by the respondents ( p=0.37 ) .
respondents awareness of cancers of 1,887 respondents 1,871 responded to query on awareness of cancers ( in general ) and 1,378 ( 73.7% ) were affirmative .
also , 1,521 responded to query on awareness of ocular cancers and 869 ( 57.1% ) were affirmative .
the respondents had varied beliefs on the causes of oc including witchcraft / spirits 164 ( 8.7% ) ( table 2 ) . gender and literacy distribution of respondents beliefs on causes of eye cancers , n=1,887 many respondents , 115 ( 41.1% ) based their knowledge of patients having oc on sources other than hospital diagnosis ( table 3 ) . gender and literacy distribution of sources of respondents knowledge of
patients with ocular cancers the relationship between the respondents and the patients they knew had ocular cancer is as shown in ( table 4 ) .
most respondents 124/148 ( 83.8% ) had no family link with ocular cancer patients ( ocp ) .
patients they knew had ocular cancer the challenges to accessing orthodox eye care services by ophthalmic patients including ones having oc are as shown in figure 2 .
there were 1,887 respondents comprising of 1,050 ( 55.6% ) males and 837 ( 44.4% ) females ( m : f=1.3:1 ) with an age range of 18 to 80 years , and a mean of 30 years , sd 9.5 .
the respondents cut across all the 36 states of nigeria and the fct , and are from over one hundred ethnic groups of nigeria .
demographic data of respondents , n = 1,887 only ( 57.1% ) respondents were aware of ocular cancers compared to ( 73.7% ) respondents who were aware of cancers in general ( fig . 1 ) and was statistically significant ( = 101.618 , p<.001 ) .
though the male respondents predominated there were no significant associations between gender and awareness of oc ( = 3.212 , p=0.07 ) and cancers in general ( = 0.036 , p=0.85 ) .
however , the level of education was significantly associated with awareness of oc ( = 50.414 , p=.001 ) in particular and cancers in general ( = 416.926 , p=.001 ) .
the awareness of oc is not associated with the respondents marital status ( p=0.50 ) and the faith practiced by the respondents ( p=0.37 ) .
respondents awareness of cancers of 1,887 respondents 1,871 responded to query on awareness of cancers ( in general ) and 1,378 ( 73.7% ) were affirmative .
also , 1,521 responded to query on awareness of ocular cancers and 869 ( 57.1% ) were affirmative .
the respondents had varied beliefs on the causes of oc including witchcraft / spirits 164 ( 8.7% ) ( table 2 ) . gender and literacy distribution of respondents beliefs on causes of eye cancers , n=1,887 many respondents , 115 ( 41.1% ) based their knowledge of patients having oc on sources other than hospital diagnosis ( table 3 ) . gender and literacy distribution of sources of respondents knowledge of
patients with ocular cancers the relationship between the respondents and the patients they knew had ocular cancer is as shown in ( table 4 ) .
most respondents 124/148 ( 83.8% ) had no family link with ocular cancer patients ( ocp ) .
patients they knew had ocular cancer the challenges to accessing orthodox eye care services by ophthalmic patients including ones having oc are as shown in figure 2 .
there were 1,887 respondents comprising of 1,050 ( 55.6% ) males and 837 ( 44.4% ) females ( m : f=1.3:1 ) with an age range of 18 to 80 years , and a mean of 30 years , sd 9.5 .
the respondents cut across all the 36 states of nigeria and the fct , and are from over one hundred ethnic groups of nigeria .
only ( 57.1% ) respondents were aware of ocular cancers compared to ( 73.7% ) respondents who were aware of cancers in general ( fig . 1 ) and was statistically significant ( = 101.618 , p<.001 ) .
though the male respondents predominated there were no significant associations between gender and awareness of oc ( = 3.212 , p=0.07 ) and cancers in general ( = 0.036 , p=0.85 ) .
however , the level of education was significantly associated with awareness of oc ( = 50.414 , p=.001 ) in particular and cancers in general ( = 416.926 , p=.001 ) .
the awareness of oc is not associated with the respondents marital status ( p=0.50 ) and the faith practiced by the respondents ( p=0.37 ) .
respondents awareness of cancers of 1,887 respondents 1,871 responded to query on awareness of cancers ( in general ) and 1,378 ( 73.7% ) were affirmative .
also , 1,521 responded to query on awareness of ocular cancers and 869 ( 57.1% ) were affirmative .
the respondents had varied beliefs on the causes of oc including witchcraft / spirits 164 ( 8.7% ) ( table 2 ) . gender and literacy distribution of respondents beliefs on causes of eye cancers , n=1,887 many respondents , 115 ( 41.1% ) based their knowledge of patients having oc on sources other than hospital diagnosis ( table 3 ) . gender and literacy distribution of sources of respondents knowledge of
patients with ocular cancers the relationship between the respondents and the patients they knew had ocular cancer is as shown in ( table 4 ) .
most respondents 124/148 ( 83.8% ) had no family link with ocular cancer patients ( ocp ) .
the challenges to accessing orthodox eye care services by ophthalmic patients including ones having oc are as shown in figure 2 .
this study is on awareness and knowledge of ocular cancers ( oc ) in a resource - limited economy , nigeria as a reference community .
nigeria is a sub - saharan african country with over 140 million people , the gross domestic product per capital is usd 1,128 and 60% of nigerians are below poverty line , earning less than usd1 per day .
the study was conducted in abuja , a nigerian federal capital city where all nigerian ethnic nationalities are represented .
gender had no association with awareness of cancers in this study , the male preponderance notwithstanding .
there was high literacy among the study population as ; 90.6% had at least primary education .
this was so as the catchment population was representative ; more than one hundred ethnic groupings of nigeria were interviewed .
remarkably , fewer respondents were aware of eye cancers ( 57.1% ) compared to cancers in general ( 73.7% ) and this difference was significant ( p<.001 ) .
there is disproportionate public enlightenment program and financing of activities in favor of cancers involving other parts of the body especially breasts , prostate , lungs , liver among others .
the sheer differential in the magnitude of mortality from various cancers especially the aforementioned cancers notwithstanding , public awareness should be intensified in all cancers as the best management for all is prevention and/or early detection and treatment .
similar to many previous studies indicating positive influence of education on awareness of health conditions[1416 ] , education was significantly associated with awareness of oc ( p<.001 ) in particular and of cancers in general ( p<.001 ) in this study .
on the other hand , this study brought to fore the age long misconceptions on oc .
, there is no direct causal relationship between trauma and cancers , despite the koebner phenomenon . also , the role of corrosives in oc is uncertain .
these misconceptions need to be corrected through public enlightenment campaigns as negative beliefs can lead to negative attitudes and even practice .
chronic exposure to ultraviolet radiation ( sunlight ) is a risk factor for squamous carcinoma of the lids , and radiation therapy in retinoblastoma can induce second cancers .
moreover , kaposis sarcoma virus ( ksv ) ( human herpesvirus 8 ( hhv-8 ) ) is implicated in conjunctival or eyelid kaposis sarcoma and is aggravated by human immunodeficiency virus ( hiv ) infection .
we found that more than 40% of 280 respondents based their knowledge of eye cancer
this was not a surprise as over 90% of patients were distant family members and non - family relations which respondents might not actually have had contact with .
the challenges to accessing orthodox eye care services by ophthalmic patients including those having eye cancers have been referred to as barriers to eye care services in many reports[2123 ] and are serious hindrances to accessing eye care services in resource limited - economies . among these challenges ,
high cost of eye care was the most identified challenge to accessing eye care services in this study .
health care workers should have positive attitude to patients care to avoid being barriers to patients uptake of health care services .
patients are the reason for health care profession and they deserve health care with sympathy and empathy .
in conclusion , the awareness of oc lags behind awareness of other cancers . education enhances awareness of cancers including oc among the population .
misconceptions on causes of oc deserving correction exist in the population and societal diagnosis of oc may not necessarily be hospital based .
also , there is urgent need to address the identified barriers to accessing eye care in resource - limited economies particularly , nigeria . | aims : to determine awareness and knowledge of ocular cancers in a resource - limited setting.material and methods : a descriptive cross - sectional survey ( 2009 ) of 1,887 nigerians using interviewer - administered questionnaire.results:respondents were 55.6% males , and mean age was 30 years , sd 9.5 .
most respondents ( 77.8% ) had at least secondary education .
fewer respondents were aware of eye cancers ( 57.1% ) compared to cancers in general ( 73.7% ) ( p<.001 ) . despite the male preponderance
there were no associations between gender and awareness of ocular cancers ( p=0.07 ) and cancers in general ( p=0.85 ) .
however , education was associated with awareness of ocular cancers ( p<.001 ) and cancers in general ( p<.001 ) .
ocular cancers were thought to be caused by corrosives 33.2% , trauma 21.4% , witchcraft 18.6% , genetic transmission 15.7% , sunlight 8.0% , radiations 2.5% and infections 0.6% ( n = 883 ) . of 280 respondents ,
41.1% based their knowledge of patients having ocular cancers on sources other than hospital diagnosis .
of 148 respondents , 16.2% were related to patients they knew had ocular cancers . there were 202 respondents who indicated challenges to accessing orthodox medical eye care services by ocular cancer patients as high cost 55.5% , long waiting period 23.3% , long distance 15.4% and poor attitude of health workers 5.9%.conclusion : awareness of ocular cancers compared to other cancers is low .
misconceptions on the causes of ocular cancers exist .
public ocular cancers health education can enhance awareness .
the need to address barriers to accessing eye care is underscored . |
polylactide ( pla ) ,
prepared from -hydroxy
acids , is considered
to be one of the most promising polymer - based biomaterials because
of its demonstrated excellent biocompatibility and biodegradability .
applications of pla in the biomedical field include
drug delivery vehicles , surgical sutures , tissue engineering scaffolds , and implants for bone fixation .
while
pla has drawn increasing interests as a great biodegradable material ,
it is limited in scope due to its highly hydrophobic nature .
the lack
of functionality in backbones and side chains of pla makes further
tailoring of its physical and chemical properties very difficult .
therefore , to further modulate physical and chemical properties of
pla , such as hydrophilicity , via introducing a wide variety of functional
groups to pla is highly desirable .
numerous ,-chain - end
functionalized plas have been
prepared via ring - opening polymerization ( rop ) of lactides by judicious
choice of initiating alcohols and further postpolymerization modification
of -chain - end hydroxyl groups .
pendent functionalities
along pla backbones for functionalization of polymers provide great
opportunities to tailor their physical and chemical properties .
plas with appending terminal alkyne , azido , allyl , oligo(ethylene glycol ) ( oeg)/poly(ethylene glycol ) ( peg ) , hydroxyl , and carboxyl functionalities have been prepared and functionalized by
polymerization of functional lactide monomers and postpolymerization
modification . among various appending functionalities ,
terminal alkyne - functionalized
pla polymers have drawn increasing interests in scientific fields , since it allows facilely placing a broad range of pendant functional
molecules onto polymers via convenient click
chemistry utilizing cu(i)-catalyzed huisgen 1,3-dipolar cycloaddition
between azide and terminal alkyne is a highly reliable synthetic strategy
because of its high selectivity , ease to perform , and broad functional
group and reaction condition tolerance .
functionalization , such as hydrophilic pla material , temperature responsive biodegradable pla , a novel grafted pla - drug conjugate , and novel redox - responsive pla micelles . besides its broad applications via alkyne - azide click
reaction , terminal alkyne - functionalized pla has recently found promising
applications in radical - mediated thiol - yne click reaction .
thiol - yne click reaction incorporates
two thiol units into one alkyne unit along the pla backbone in one
step at room temperature with high efficiency , selectivity and no
need of potentially toxic catalysts .
these studies clearly indicate
that terminal alkyne - functionalized plas are of great importance in
formation of novel biomaterials with unique physical or chemical properties
via alkyne - azide or thiol - yne click reaction . with continuous interest in the development of novel clickable
pla biomaterials and exploration of their promising biomedical applications ,
we designed a library of propargylated and pegylated -hydroxy
acids ( 1 , poly(ethylene glycol ) monopropargyl ether lactic
acids , figure 1 ) , essential precursors toward
clickable plas .
peg or oeg is a biologically inert
polymer that has been extensively used as spacers and linkers for
targeted drug delivery systems .
pegylation
plays an important role in the delivery of certain therapeutic agents
and confers many beneficial properties , such as increased solubility ,
reduced interaction with serum and proteins , and thus significantly
prolonged circulation times in the bloodstream .
pegylation also reduces or even eliminates antigenicity
and immunogenicity . the biological effect
of pegylation
we envision that
pegylation of terminal alkyne - functionalized -hydroxy acids
would benefit the ultimate plas with not only the click
function but also the advantages of pegylation , such as increased
hydrophilicity , faster degradation rate , and protein fouling resistance .
in addition , terminal alkyne functionality may endow this family
of -hydroxy acids many other advantages .
the terminal alkyne
group may polymerize to provide polyacetylene polymers with unique
physical properties , including electrical conductivity , nonlinear
optical properties , and magnetic properties . furthermore
, hyperbranched polymers , highly cross - linked
polymer networks , and novel linear or comblike polymers may be readily
prepared from these propargylated -hydroxy acids via thiol - yne
click polymerization .
structure of propargylated and pegylated
-hydroxy acids
( poly(ethylene glycol ) monopropargyl ether lactic acids , 1a
synthesis of alkyne - functionalized lactide monomers has always
been a limiting step in the preparation of clickable
plas via rop of corresponding lactide monomers .
it mainly relies on
dimerization of highly diluted terminal alkyne - functionalized -hydroxy
acids , which typically results in poor yield ( scheme 1 ) .
three synthetic routes have been reported in the synthesis of terminal
alkyne - functionalized -hydroxy acids .
however , they require using either specially
prepared reagents via passerini - type condensation or expensive and unstable compounds ( propargyl bromide ,
ethyl glyoxylate , and boc - l - tyrosine ) via reformatsky - type
reaction or substitution reaction / deamination .
in addition , column chromatography was also required to purify intermediates
in the synthesis , which further limits their scalability and practicality .
hence , it is highly desirable to develop a simple protocol for rapid
access to a library of terminal alkyne - functionalized -hydroxy
acids from convenient starting materials in high yield with no need
of column chromatographic separation .
this would allow for a sufficient
supply of functional monomers for the ultimate preparation of clickable
biodegradable plas .
herein , we report a novel and
general approach for the synthesis
of a new library of propargylated and pegylated -hydroxy acids 1 , which features the facile monofunctionalization and chain - elongation
of oegs and the convenient hydrolysis of easily accessible cyanohydrin
derivatives .
the key step involved in hydrolysis of a terminal alkyne - functionalized
cyanohydrin to its corresponding -hydroxy acids is rare in
the literatures . by judicious choice of acid - catalyzed hydrolysis
conditions , the developed process to propargylated and pegylated -hydroxy
acids is easily and economically operational starting from propargyl
alcohol , bromoacetaldehyde diethyl acetal ( 2 ) , and oegs / pegs ,
since these starting materials are widely used in industry and can
be supplied in large quantities at low prices .
the synthesis was column
chromatography free , which renders a scale - friendly process .
propargyl alcohol contains two
functional groups , a terminal alkyne and a hydroxy group .
it is possible
to employ its hydroxy group as a nucleophile under weak basic conditions
without affecting the terminal alkyne group .
bromoacetaldehyde diethyl
acetal ( 2 ) has a good leaving group ( bromo group ) and
the protected aldehyde functionality , which can be later converted
to a cyanohydrin .
as shown in scheme 2 , an
excess of propargyl alcohol was deprotonated by nah in thf , and the
resulting alkoxide nucleophilically attacked the bromo group of 2 to afford highly pure propargyloxyacetaldehyde
diethyl acetal ( 3 ) as a pale red liquid in 91.8% yield
without affecting the terminal alkyne group .
the excess of propargyl
alcohol was simply removed by washing a solution of 3 in ch2cl2 with water because of its highly
hydrophilic nature .
further purification of 3 via vacuum
distillation can be completed , but is not necessary . the hydrolysis
condition for converting diethyl acetal 3 to aldehyde 4
was optimized to be using a biphasic mixture of trifluoroacetic
acid ( tfa ) , water , and ch2cl2 ( 1:1:4 ) , which
requires vigorous stirring to achieve quantitative conversion ( table 1 , entry 8) . however , p - toluenesulfonic
acid ( tsoh ) , hcl , h2so4 , and acetic acid ( acoh ) were
not effective in the deprotection of diethyl acetal 3 ( table 1 , entries 16 ) .
the resulting
aldehyde 4 was not isolated and directly used for the
subsequent reaction .
the cyanation of aldehyde 4 was performed
under acidic
conditions , and the resulting aqueous solution of 5 was
extracted continuously with ch2cl2 to provide
a mixture of cyanohydrin 5 and acetic acid in 91.0% yield .
cyanohydrin 5 was subjected to acid - catalyzed hydrolysis
without further purification to generate its -hydroxy acid 1a ( table 2 ) .
the attempted hydrolysis
of cyanohydrin 5 in aqueous hcl solution ( 2 , 6 , and 11
m ) resulted in either nonhydrolyzed or decomposed starting materials .
it is known that
the terminal alkyne functionality can survive in refluxing 2 m h2so4 , so hydrolysis
of 5 at various concentrations of h2so4 and temperatures in a mixture of methanol and water was optimized
( table 2 ) .
the results showed that hydrolysis
of 5 can proceed much faster at higher reaction temperature
and higher concentration of h2so4 .
however ,
high temperatures also resulted in slightly lower yields ( table 2 , entries 58 ) .
the solvent ratio of meoh
and h2o did not affect the yields ( table 2 , entries 7 and 8) .
the optimized conditions for hydrolysis
of 5 were with 56 m h2so4 for 24 h at 70 c ( table 2 , entries
3 and 4 ) .
the product consisting of a mixture of -hydroxy acid
( 1a ) and its methyl ester was continuously extracted
with ether and hydrolyzed by aqueous naoh ( 2 m ) at room temperature .
since the sodium salt of 1a is not soluble in ch2cl2 and can not be extracted with ch2cl2 from aqueous solution , all organic impurities , such
as mineral oil from the first step , were simply removed via extracting
the basic aqueous solution of 1a with ch2cl2 in this step .
after
acidifying the basic aqueous solution to ph < 1 , the desired -hydroxy
acid 1a was obtained via continuous extraction as a slightly
yellow solid with an overall yield of 71.2% ( 4 steps ) .
the structure
of propargylated -hydroxy acid was verified by its 500 mhz h nmr spectrum ( figure s3 , supporting
information ) .
the terminal alkyne segment of 1a was characterized by the triplet resonance for the terminal alkyne
proton at 2.47 ppm and the doublet resonance for methylene
protons at 4.22 ppm .
the characteristic triplet resonance
for the methine proton at 4.41 ppm clearly supports the -hydroxy
acid structure of 1a .
it is worth to note that this
procedure does not involve purification with column chromatography ,
which enables readily scaling up the synthesis of the desired library
of propargylated and pegylated -hydroxy acids .
overall , it
represents a simple and general process to provide sufficient quantities
of terminal alkyne - functionalized -hydroxy acid 1a with low cost and easily operational reaction conditions .
yield of 1a was measured
by h nmr using an internal standard triphenylmethane after
basic and acidic workup .
isolated yield after basic and acidic
workup , followed by continuous extraction with ether .
the synthesis of oligo(ethylene glycol ) monopropargyl
ether lactic acids ( 1b e ) starts
from their corresponding oegs with 14 glycol units , all of
which are inexpensive and commercially available .
the synthetic strategy
is based on the h2so4-catalyzed hydrolysis of
propargylated and pegylated cyanohydrin derivatives prepared from
efficient coupling of monotritylated oegs , propargyl alcohol , and 2 .
as shown in scheme 3 , oegs 6b e were desymmetrized and monoprotected
with trityl chloride to afford a mixture of monotritylated oegs 7b e and ditritylated oegs as white solids
( 7b and 7c ) or pale red viscous liquids
( 7d and 7e ) in high yields ( > 92% ) without
further purification .
byproducts ditritylated oegs
in 7b e were not removed , and they
or their derivatives were carried over until final purification of 1b e , since it was anticipated that they
could be easily removed in their derivatized forms ( oeg dipropargyl
ethers ) while purifying final -hydroxy acids 1b e .
direct incorporation of a propargyl
group to 7b e is not plausible due
to the fact that deprotection of the
trityl group will employ a pd - catalyzed hydrogenolysis and due to
possible side reactions of terminal alkyne when excess nah is used
in subsequent steps .
thus , 7c e were
first coupled with 2 quantitatively to provide 9c e without further purification .
however ,
the coupling between monotrityl ether ( 7b ) and 2 only proceeded with 66% conversion after refluxing for 48
h , probably due to the low solubility of alkoxide of 7b , and this would dramatically lower the yield of 1b and
complicate the purification process .
this problem was solved by using
commerically available ethylene glycol monobenzyl ether ( 8) as starting material to afford pure 9b .
it is worth
to note that the excess of 2 could be simply removed
while drying 9c
e under vacuum at
40 c , which simplifies the following purification step and enables
column - free isolation .
the selective deprotection of trityl and benzyl
groups of 9b e via pd - catalyzed hydrogenolysis
in both thf and ch2cl2 was not effective or
required very high catalyst loading ( 10 mol % of pd / c ) and long reaction
time to achieve high conversion . to bypass
this problem ,
ethanol was selected as the solvent for selective hydrogenolysis with 2 mol % of pd / c catalyst
with 100% conversion without affecting the protected aldehyde .
notably ,
the recycled catalyst pd / c is still active and can be reused after
hydrogenolysis in ethanol .
the resulting alcohols were then carefully tosylated with tosyl chloride to provide
intermediates 10b e quantitatively , which were nucleophilically substituted
with propargyl alcohol to afford terminal alkyne - functionalized acetals 11b e .
the desired propargylated cyanohydrins 12b e were obtained via deprotection and
cyanation of intermediates 11b e ,
followed by continuous extraction .
cyanohydrins 12b e were hydrolyzed in methanolic h2so4 ( 6 m ) , and all organic compounds including the desired -hydroxy
acids 1b e were extracted with ch2cl2 and treated with aqueous naoh ( 2 m ) to hydrolyze
methyl esters of 1b e .
the resulting
basic aqueous solution was diluted and extracted with ch2cl2 to remove all nonionic organic impurities , such as
oligo(ethylene glycol ) dipropargyl ethers from ditrityl protected
oegs and mineral oil from nah . after being acidified with 4 m hcl ,
pure propargylated and pegylated -hydroxy acids 1b
e were obtained via continuous extraction with
ch2cl2 as dark red viscous liquids in 4060%
yields .
oegs with up to four glycol units
are available commerically in large quantities with low prices , and
thus , one can afford to waste these inexpensive diols during the desymmetrization
and monofunctionalization . however , when extending the number of repeating
units of oegs to greater than four , it is not acceptable to start
with oegs ( n > 4 ) in the synthesis of the corresponding
-hydroxy acid due to their extremely high cost
. therefore ,
it is highly desirable to synthesize these extended bifunctional oegs
( n
> 4 ) with an efficient route not involving
complicated
purifications , such as column chromatographic separations . using an
inexpensive thp protection / deprotection strategy , we have developed
a simple procedure to produce longer well - defined bifunctional octa(ethylene
glycol ) ( n = 8) . introducing orthogonal protecting / functional
groups to two shorter oligo(ethylene glycol)s and then coupling of
the two building blocks furnished the facile synthesis of propargylated
and pegylated -hydroxy acid 1f .
the synthesis of building block monobenzylated tetraethylene
glycol ( 13 ) started from inexpensive and commercially
available tetraethylene glycol ( 6e ) ( scheme 4 ) .
oeg 6e was monoprotected with dihydropyran ( dhp ) to afford a mixture of
mono - thp ether 14 and bis - thp ether 15 ( 8:1 ) .
this mixture was benzylated with benzyl bromide to provide a mixture
of 15 and heterobifunctional 16 ( 1:8 )
in 92.8% yield .
thp protection of 15 and 16 was completely cleaved via acetal exchange in meoh under acidic
conditions , and the resulting thp ether of methanol was readily removed
in vacuo because of their low boiling points . the highly hydrophilic oeg 6e from thp deprotection
of 15
was simply removed by washing a solution of crude
product 13 in ch2cl2 with aqueous
nacl solution to afford pure building block 13 in 92.0%
yield .
the overall procedure described here allows for scalable monofunctionalization
of oegs and the synthesis of pure building block 13 in
a simple and efficient manner .
similar to the synthesis of 13 , building
block monotetrahydropyranyl
tetraethylene glycol monotosylate ( 17 ) was prepared as
shown in scheme 5 .
a mixture of mono - thp ether 14 and bis - thp ether 15 ( 8:1 ) was tosylated with
tosyl chloride to give a mixture of 15 and heterobifunctional 17 ( 1:8 ) in quantitative yield .
after removal of the
thp protecting group and side products , pure monotosylate 18 was obtained and further protected with dhp in anhydrous thf to
provide pure heterobifunctional 17 in 98.3% yield .
the synthesis of -hydroxy acid 1f via
efficient
oeg chain extension using two short building blocks 13 and 17 is illustrated in scheme 6 .
monobenzylated tetraethylene glycol ( 13 ) was deprotonated
by nah and coupled with 17 ( 1.1 equiv ) via williamson
ether synthesis under optimized conditions to provide chain - extended
heterobifunctional 19 , which can be easily purified because
of negligible side products .
analytically pure octa(ethylene glycol )
monobenzyl ether ( 20 ) was obtained in 90% yield after
deprotection of the thp group in meoh .
the coupling of 20 with 2 and subsequent hydrogenolysis and tosylation
provided compound 21 , which was coupled with propargyl
alcohol to afford propargylated intermediate 22 in 90%
yield .
after deprotection of diethyl acetal , cyanation , and hydrolysis ,
intermediate 22 was converted to the desired -hydroxy
acid 1f in 65% yield . the thp protection / deprotection method
( schemes 4 and 5 ) used
in preparing building blocks 13 and 17 makes
it ideal for the synthesis of propargylated and pegylated -hydroxy
acids because of the inexpensive dhp source , easy installation , facile
deprotection , and ready removal from the reaction mixture after thp
deprotection . as shown in scheme 7 , peg 24 ( n 23 ) was monoprotected with
dhp to give a mixture of mono - thp ether 25 and bis - thp
ether 26 ( 7:1 ) in 85% yield after washing with
water to remove excess 24 .
the minor bis - thp ether 26 was intended to be carried over during the synthesis and
removed as its derivative 30 at the end .
coupling of 25 with 2 , followed by deprotection of thp ethers
and tosylation of the resulting alcohols , provided monotosylate intermediate 27 with 28 as a minor product ( 92% total yield ) .
the monotosylate 27 was propargylated with propargyl
alcohol via williamson ether synthesis to give 29 in
86% yield , which was converted to cyanohydrin 31 ( 95%
yield ) via acetal hydrolysis and cyanation .
similar to the preparation
of 1f , intermediate 31 was hydrolyzed in
6 m h2so4 , and the resulting mixture was extracted
with ch2cl2 continuously and concentrated .
after
treatment with aqueous 2 m naoh solution , the resulting mixture was
extracted with hexane / ch2cl2 ( 1:1 ) twice to
remove nonionic impurities , such as mineral oil and derivative 30 .
the use of ch2cl2 as extraction
solvent in this step would result in dramatic loss of 1 g because of the increased solubility of the sodium salt of 1 g in ch2cl2 .
-hydroxy acid 1 g was obtained as a white waxlike solid in 74% yield via
acidification of the above basic solution , continuous extraction with
ch2cl2 , and washing the ch2cl2 solution of 1 g with 1 m hcl .
the successful
synthesis of 1 g was confirmed by h nmr ( figure
s28 , supporting information ) and further
with hrms ( figure s29 and table s1 , supporting
information ) .
nmr spectroscopy shows the incorporation of both
-hydroxy acid and terminal alkyne segments as end groups of 1 g .
monomodal molecular weight distribution in hrms indicates
that there is only one set of end groups for polymeric 1 g , and all detected mass peaks ( [ m h ] )
separated by one ethylene glycol unit of m / z 44 match well with the calculated exact mass of 1 g ( [ m h ] ) ( table s1 ) .
these results
present a simple and practical procedure to prepare propargylated
and pegylated -hydroxy acids .
the convenience of the thp protection / deprotection
strategy to selective monofunctionalize peg and no need of precious
pd catalyst and pressurized reaction vessels make it superior to the
trityl / benzyl - involved process ( 1b e ) in the synthesis of pegylated -hydroxy acids .
alkene - functionalized polymers have also attracted
much attention due to their wide applications via efficient thiol - ene
click reaction .
we are delighted to find
that our synthetic route to propargylated and pegylated -hydroxy
acids described above could also be applied successfully to the preparation
of allyloxy lactic acid ( 1h ) . as outlined in scheme 8 , the synthesis of allyloxy lactic acid ( 1h ) was prepared following a similar procedure to propargyloxy lactic
acid ( 1a , scheme 2 ) using allyl
alcohol and bromoacetaldehyde 2 as starting materials .
the coupling of 2 and allyl alcohol gave 32 in 76.1% yield after vacuum distillation .
after hydrolysis of aldehyde 32 under acidic conditions , cyanohydrin 33 was
obtained quantitatively as a pale red liquid ( containing some acetic
acid ) and used directly for subsequent reaction without further purification .
following hydrolysis under acidic conditions , basic treatment with
aqueous naoh solution , and removal of organic impurities , allyloxy
lactic acid ( 1h ) was extracted from the acidic aqueous
solution in 71.8% yield .
these results indicate that the sensitive
alkene functionality is well tolerated under the reaction conditions
and the developed process can be extended to prepare alkene - functionalized
-hydroxy acids as well .
we have developed a convenient and practical
protocol for scalable
synthesis of a new library of propargylated and pegylated -hydroxy
acids toward
starting from readily available
propargyl alcohol and bromoacetaldehyde diethyl acetal , terminal alkyne - functionalized
cyanohydrin 5 was prepared and hydrolyzed to afford propargylated
-hydroxy acid 1a in good overall yield .
the terminal
alkyne is compatible with h2so4-catalyzed hydrolysis
of cyanohydrin during the synthesis .
the incorporation of oegs or
pegs as spacers between terminal alkyne and -hydroxy acid units
resulted in a library of propargylated and pegylated -hydroxy
acids 1b g . the facile synthesis
of propargylated and pegylated -hydroxy acids 1b
g features efficient desymmetrization , monofunctionalization ,
and chain - elongation of oegs or pegs with no need of column chromatographic
separation .
the alkene functionality is also well tolerated under
the reaction conditions in the synthesis of allyloxy lactic acid .
the overall synthesis requires inexpensive chemicals and does not
involve column chromatography , which indicates its high efficiency
and low cost in supplying large quantities of propargylated and pegylated
-hydroxy acids to prepare clickable plas .
propargyl alcohol , allyl alcohol ,
bromoacetaldehyde diethyl acetal , oilgo(ethylene glycol ) ( oeg 6b e , n = 1 , 2 , 3 , 4 ) ,
poly(ethylene glycol ) ( peg 24 , average mn = 1000 ) , ethylene glycol monobenzyl ether ( 8) , dihydropyran , sodium hydride , trityl chloride , and palladium on
activated charcoal ( 10% ) were purchased from commercial sources and
used as received .
thf was refluxed over sodium / benzophenone and distilled
before use . all other reagents and solvents were acs grade and used
as received unless specified .
high - resolution mass spectra ( hrms ) were taken on an esi - tof mass
spectrometer .
h nmr and c nmr were recorded
on a 300 , 500 , or 600 mhz instrument in cdcl3 unless otherwise
noted .
cdcl3 was used as the internal standard for both h nmr ( = 7.24 ) and c nmr ( = 77.0 ) .
data for h nmr are reported as follows : chemical shift
( ppm ) , multiplicity ( s = singlet , d = doublet , t = triplet ,
q = quartet , m = multiplet , bs = broad signal , bs m = broad signal
multiplet ) , integration , and coupling constant .
data for c nmr are reported in terms of chemical shift ( ppm ) .
propargyl alcohol ( 134 ml , 2.25 mol )
in thf ( 200 ml ) was added to nah ( 97 g , 60% dispersion in mineral
oil , 2.4 mol ) in thf ( 1.1 l ) dropwise over 1 h at 0 c , and the
resulting reaction mixture was stirred for another 1 h at rt .
bromoacetaldehyde
( 2 ) ( 234 ml , 1.50 mol ) and nai ( 2.0 g , 13 mmol ) in thf
( 100 ml ) was added to the mixture prepared above , and the resulting
suspension was refluxed for 4 days to achieve 96% conversion .
the
suspension was filtered , and the resultant filtrate was concentrated
and redissolved in ch2cl2 ( 500 ml ) .
the ch2cl2 layer was washed with aqueous nacl solution
( 1 200 ml ) , dried over anhydrous sodium sulfate , concentrated ,
and dried under vacuum to afford 3 as a pale red liquid
( 237 g , 91.80% ) .
h nmr ( 500 mhz , cdcl3 )
4.62 ( t , 1h , j = 5 hz ) , 4.19 ( d , 2h , j = 2.5 hz ) , 3.623.72 ( m , 2h ) , 3.503.58 ( m , 4h ) , 2.40
( t , 1h , j = 2.5 hz ) , 1.19 ( t , 6h , j = 10 hz ) ; c nmr ( 125 mhz , cdcl3 )
100.8 , 79.5 , 74.6 , 70.1 , 62.2 , 58.6 , 15.3 ; hrms ( esi - tof ) m / z : [ m + h ] calcd for c9h17o3 173.1178 ; found 173.1174 .
diethyl acetal 3 ( 222 g , 1.29 mol ) was added to a mixture
of tfa ( 230 ml ) , water ( 230 ml ) , and ch2cl2 ( 920
ml ) dropwise , and the mixture was stirred vigorously for 3 days until
full conversion of diethyl acetal 3 to aldehyde 4 .
the resulting mixture was cooled in an ice bath ,
followed by dropwise addition of kcn ( 256 g , 3.90 mol ) in water ( 420
ml ) , and the resultant mixture was stirred for 18 h until h nmr showed no aldehyde left .
the resulting aqueous solution was
extracted continuously with ch2cl2 , and the
organic layer was concentrated in vacuo to provide a mixture of acetic
acid and propargylated cyanohydrin 5 ( 644 g , 91.0% yield
estimated from h nmr ) , which was used for the subsequent
step without further purification , h nmr ( 500 mhz , cdcl3 ) 4.62 ( t , 1h , j = 5 hz ) , 4.27 ( d ,
2h , j = 2.5 hz ) , 3.763.84 ( m , 2h ) , 2.50 ( t ,
1h , j = 2.5
this mixture was cooled in an ice
bath , followed by the addition of concentrated h2so4 ( 450 ml ) , methanol ( 150 ml ) , and h2o ( 100 ml )
( final concentration of h2so4 was 6
m ) .
the resulting solution was stirred for 24 h in a 70 c oil
bath and was continuously extracted with ether to give a dark red
liquid after removal of acetic acid .
this dark red liquid was treated
with aqueous naoh solution ( 2 m ) for 24 h and extracted with ch2cl2 to remove all organic impurities , such as mineral
oil .
the basic solution was acidified with 4 m h2so4 and continuously extracted with ether to afford the desired
-hydroxy acid ( 1a ) as a slight yellow solid ( 144
g , 85.2% ) .
h nmr ( 500 mhz , cdcl3 ) 4.41 ( t , 1h , j = 4 hz ) , 4.22 ( d ,
2h , j = 2.5 hz ) , 3.833.92 ( m , 2h ) , 2.47 ( t ,
1h , j = 2.5 hz ) ; c nmr ( 125 mhz , cdcl3 ) 176.12 , 78.6 , 75.4 , 70.6 , 70.2 , 58.9 ; ir 3286 , 2933 ,
2122 , 1735 , 1358 , 1203 , 1129 , 1104 , 1044 ; hrms ( esi - tof ) m / z : [ m h ] calcd for
c6h7o4 143.0343 ; found 143.0344 .
a 500 ml three - neck
round - bottom flask was charged with oligo(ethylene glycol ) ( 6b e , 3.0 mol ) and pyridine ( 30 ml ) , and
the resulting mixture was heated to 55 c .
powdered trityl chloride
( 42 g , 0.15 mol ) was added , and the reaction mixture was vigorously
stirred for 18 h at 55 c .
the suspension was mixed with water
( 1000 ml ) and extracted with toluene ( 5 100 ml ) .
the combined
organic layer was washed with 0.3 m hcl ( 2 600 ml ) , aqueous
naoh ( 1 600 ml ) , and water ( 3 600 ml ) , dried over anhydrous
sodium sulfate , and concentrated to give 7b e as white solids or viscous liquids containing their corresponding
ditrityl ethers as minor byproducts .
these mixtures were used directly
for the next reaction without further purification . a white solid ( 5%
ditrityl ether ) , 42 g , 92% , mp 9598 c . h
nmr ( 300 mhz , cdcl3 ) 7.477.54
( m , 6h ) , 7.187.40 ( m , 9h ) , 3.763.86 ( bs m , 2h ) , 3.283.35
( m , 2h ) , 2.03 ( bs , 1h , oh ) .
a white solid ( 8%
ditrityl ether ) , 48 g , 92% , mp 108110 c .
h nmr ( 500 mhz , cdcl3 ) 7.487.55
( m , 6h ) , 7.30 ( m , 9h ) , 3.623.81 ( m , 6h ) , 3.283.34
( m , 2h ) , 2.06 ( bs , 1h , oh ) . a viscous liquid
( 4% ditrityl ether ) , 57 g , 97% .
h nmr
( 300 mhz , cdcl3 ) 7.477.55 ( m , 6h ) , 7.197.38
( m , 9h ) , 3.643.82 ( m , 10h ) , 3.273.34 ( m , 2h ) . a viscous liquid
( 9% ditrityl ether ) , 62 g , 95% .
h nmr
( 300 mhz , cdcl3 ) 7.477.55 ( m , 6h ) , 7.187.40
( m , 9h ) , 3.603.80 ( m , 14h ) , 3.29 ( t , 2h , j = 6 hz ) , 2.50 ( bs , 1h , oh ) .
( containing
their corresponding ditrityl ethers ) and ethylene
glycol monobenzyl ether ( 8) ( 1.00 equiv ) were deprotonated
by nah ( 1.35 equiv ) in thf at 0 c .
the resulting reaction mixtures
were stirred for 12 h at room temperature , followed by dropwise addition
of a solution of 2 ( 1.25 equiv ) in thf at 0 c .
the reaction mixtures were refluxed for 36 days until all
alcohol intermediates were consumed ( monitored by h nmr ) .
the resulting suspensions were filtered , and the filtrates were concentrated ,
redissolved in ch2cl2 , and washed with aqueous
nacl solution .
the organic layer was dried over anhydrous sodium sulfate ,
concentrated , and dried at 55 c in vacuo to afford the desired
products 9b e
( containing the corresponding
ditrityl ethers ) . from 8 ( 60.8 g , 0.400
mol ) . a pale red liquid ( 96 g , 91% ) .
h nmr ( 600 mhz , cdcl3 ) 7.207.27 ( m , 5h ) , 4.62 ( t , 1h , j = 6 hz ) , 4.54 ( s , 2h ) , 3.713.63 ( m , 4h ) , 3.583.63
( m , 2h ) , 3.503.57 ( m , 4h ) , 1.19 ( t , 6h , j = 6 hz ) ; c nmr ( 150 mhz , cdcl3 )
138.2 , 128.2 , 127.6 , 127.4 , 101.1 , 73.1 , 71.88 , 70.86 , 69.4 , 62.2 ,
15.3 . from 7c ( 138 g , containing
0.350 mol of 7c ) .
h nmr ( 500 mhz , cdcl3 ) 7.467.54
( m , 6h ) , 7.207.36 ( m , 9h ) , 4.67 ( t , 1h , j = 5 hz ) , 3.543.80 ( m , 12h ) , 3.27 ( t , 2h , j = 5 hz ) , 1.23 ( t , 6h , j = 7 hz ) . from 7d ( 190 g , containing
0.440 mol of 7d ) . a dark red liquid , 229 g , 90.8% .
h nmr ( 500 mhz , cdcl3 ) 7.457.55
( m , 6h ) , 7.207.37 ( m , 9h ) , 4.66 ( t , 1h , j = 5 hz ) , 3.543.79 ( m , 16h ) , 3.25 ( t , 2h , j = 5 hz ) , 1.24 ( t , 6h , j = 7 hz ) . from 7e ( 236 g , containing
0.420 mol of 7d ) . a light brown liquid , 276 g , 96.5% .
h nmr ( 500 mhz , cdcl3 ) 7.477.54
( m , 6h ) , 7.217.36 ( m , 9h ) , 4.68 ( t , 1h , j = 5 hz ) , 3.523.79 ( m , 20h ) , 3.30 ( t , 2h , j = 5 hz ) , 1.28 ( t , 6h , j = 7 hz ) .
a high - pressure autoclave
reactor with a glass insert was charged with benzylate 9b or tritylates 9c e , 10% pd / c ( 2
mol % ) , and absolute ethanol ( 150 ml ) .
hydrogenolysis was carried
out with effective stirring for 48 h at room temperature under 1400
psi of h2 .
the
filtrate was concentrated in vacuo carefully to give a mixture of
desired alcohols , triphenylmethane or toluene and ethanol ( < 5% ) ,
which were used without further purification .
these alcohol mixtures
prepared above and tscl ( 1.5 equiv ) were dissolved in thf , and the
resulting solutions were cooled in an ice bath , followed by addition
of aqueous koh solution ( 4 equiv ) to provide the desired tosylates 10b e
the propargylation of 10b e with propargyl alcohol was carried
out as described for 3 to afford propargylated intermediates 11b e with high yields ( containing byproducts
from impurities ) , and these propargylated intermediates were used
directly for the next step without purification a light yellow liquid , 35 g , 95% .
h nmr ( 600 mhz , cdcl3 ) 4.62 ( t , 1h , j = 6 hz ) , 4.18 ( d , 2h , j = 2.4 hz ) , 3.653.71
( m , 6h ) , 3.503.58 ( m , 4h ) , 2.40 ( t , 1h , j = 2.4 hz ) , 1.19 ( t , 6h , j = 6 hz ) .
h nmr ( 600 mhz , cdcl3 ) 4.59
( t , 1h , j = 6 hz ) , 4.16 ( d , 2h , j = 2.4 hz ) , 3.573.68
( m , 10h ) , 3.423.56 ( m , 4h ) , 2.38 ( t , 1h , j = 2.4 hz ) , 1.17 ( t , 6h , j = 6 hz ) . a pale red liquid ,
62 g , 94% .
h nmr ( 600 mhz , cdcl3 ) 4.62
( t , 1h , j = 6 hz ) , 4.19 ( d , 2h , j = 2.4 hz ) , 3.603.73
( m , 14h ) , 3.483.58 ( m , 4h ) , 2.41 ( t , 1h , j = 2.4 hz ) , 1.20 ( t , 6h , j = 6 hz ) . a light brown liquid ,
81 g , 90% .
h nmr ( 600 mhz , cdcl3 ) 4.64
( t , 1h , j = 6 hz ) , 4.20 ( d , 2h , j = 2.4 hz ) , 3.623.74
( m , 18h ) , 3.523.61 ( m , 4h ) , 2.43 ( t , 1h , j = 2.4 hz ) , 1.22 ( t , 6h , j = 6 hz ) . propargylated and pegylated -hydroxy acids ( 1b
e ) were prepared following a similar procedure
as that described in the synthesis of 1a from diethyl
acetal 3 , except for the continuous extraction of intermediates
or desired products with ch2cl2 .
the resulting
dark solutions of 1b e were continuously
extracted with ch2cl2 , and the obtained organic
layer was concentrated in vacuo to remove acetic acid .
the resultant
acid mixtures were treated with aqueous 2 m naoh solution for 24 h
at room temperature , followed by dilution with 1 m naoh solution .
the resulting solution was extracted with ch2cl2 to remove all organic impurities , such as oligo(ethylene glycol )
dipropargyl ethers , propargyl ethyl ether , and mineral oil .
after
the resulting solution was acidified with 4 m hcl , the desired -hydroxy
acids 1b e were obtained via continuous
extraction with ch2cl2 and concentrated under
vacuum as dark red liquids .
-hydroxy acids ( 1d and 1e ) were further purified by washing their solutions
in ch2cl2 with 1 m hcl ( 2 100 ml ) . a dark red liquid ,
20 g , 66% .
h nmr ( 500 mhz , cdcl3 ) 4.35
( t , 1h , j = 5 hz ) , 4.19 ( d , 2h , j = 2.5 hz ) , 3.773.89
( dq , 2h , j = 4.5 and 10.5 hz ) , 3.673.75 ( m ,
4h ) , 2.44 ( t , 1h , j = 2.5 hz ) ; c nmr
( 125 mhz , cdcl3 ) 174.5 , 79.1 , 75.01 , 72.1 , 70.8 ,
70.1 , 68.9 , 58.4 ; ir 3286 , 2922 , 2878 , 2122 , 1746 , 1446 , 1355 , 1248 ,
1203 , 1110 , 1038 ; hrms ( esi - tof ) m / z : [ m + h ] calcd for c8h13o5 189.0763 ; found 189.0754 .
h nmr ( 500 mhz , cdcl3 ) 4.34 ( t , 1h , j = 5 hz ) , 4.19 ( d , 2h , j = 2.5 hz ) , 3.773.88
( dq , 2h , j = 4.5 and 10.5 hz ) , 3.603.73 ( m ,
8h ) , 2.44 ( t , 1h , j = 2.5 hz ) ;
c nmr
( 125 mhz , cdcl3 ) 174.1 , 79.3 , 74.9 , 72.3 , 71.0 ,
70.4 , 70.3 , 70.2 , 69.0 , 58.4 ; ir 3269 , 2916 , 2878 , 2117 , 1746 , 1460 ,
1352 , 1253 , 1201 , 1104 , 1035 ; hrms ( esi - tof ) m / z : [ m h ] calcd for c10h15o6 231.0869 ; found 231.0868 .
h nmr ( 500 mhz , cdcl3 ) 4.3
( t , 1h , j = 5 hz ) , 4.17 ( d , 2h , j = 2.5 hz ) , 3.783.89
( dq , 2h , j = 4.5 and 10.5 hz ) , 3.583.70 ( m ,
12h ) , 2.41 ( t , 1h , j = 2.5 hz ) ; c nmr
( 125 mhz , cdcl3 ) 174.3 , 79.3 , 74.75 , 72.3 , 70.9 ,
70.43 , 70.40 , 70.3 , 70.1 , 68.9 , 58.2 ; ir 3264 , 2911 , 2878 , 2117 , 1746 ,
1457 , 1358 , 1250 , 1203 , 1104 ;
hrms ( esi - tof ) m / z : [ m h ] calcd for c12h19o7 275.1131 ; found 275.1129 .
h nmr ( 500 mhz , cdcl3 ) 4.34
( t , 1h , j = 5 hz ) , 4.20 ( d , 2h , j = 2.5 hz ) , 3.793.90
( dq , , 2h , j = 4.5 and 10.5 hz ) , 3.603.79
( m , 16h ) , 2.44 ( t , 1h , j = 2.5 hz ) ; c nmr ( 125 mhz , cdcl3 ) 173.9 , 79.4 , 74.6 , 72.3 ,
71.0 , 70.52 , 70.47 , 70.46 , 70.45 , 70.24 , 70.22 , 70.1 , 68.9 , 58.3 ;
ir 3258 , 2916 , 2878 , 2122 , 1749 , 1457 , 1355 , 1297 , 1250 , 1107 ; hrms
( esi - tof ) m / z : [ m h ] calcd for c14h23o8 319.1393 ; found 319.1390 .
intermediates monobenzylated
tetraethylene glycol ( 13 ) , tetraethylene glycol monotosylate
( 18 ) , and monotetrahydropyranyl tetraethylene glycol
monotosylate ( 17 ) were prepared according to our previous
report .
h nmr ( 500 mhz ,
cdcl3 ) 7.227.38
( m , 5h ) , 4.55 ( s , 2h ) , 3.613.71 ( m , 14h ) , 3.573.60
( m , 2h ) , 2.3468 ( bs , 1h , oh ) ; c nmr ( 125 mhz , cdcl3 ) 138.2 , 128.3 , 127.7 ,
127.5 , 73.2 , 72.4 , 70.63 ( bs and tall peak ) , 70.60 , 70.58 , 70.4 , 69.4 ,
61.7 .
h nmr ( 500 mhz , cdcl3 ) 7.80 ( d , 2h , j = 10 hz ) , 7.36 ( d , 2h , j = 10 hz ) , 4.16
( t , 2h , j = 5 hz ) , 3.533.75 ( m , 14h ) , 2.49
( br . , 1h , oh ) , 2.45 ( s , 3h ) ; c nmr ( 125 mhz , cdcl3 ) 144.8 , 132.9 , 129.9 , 127.9 ,
72.4 , 70.7 , 70.6 , 70.4 , 70.3 , 69.2 , 68.7 , 61.7 , 21.6 . a dark red liquid , 244
g , 79.8% ( 4 steps ) .
h nmr ( 500 mhz , cdcl3 )
7.77 ( d , 2h , j = 8 hz ) , 7.31 ( d , 2h , j = 8 hz ) , 4.60 ( t , 1h , j = 3.5 hz ) , 4.14
( t , 2h , j = 5 hz ) , 3.793.88 ( m , 2h ) , 3.523.70
( m , 13h ) , 3.433.51 ( m , 1h ) , 2.42 ( s , 3h ) , 1.741.86
( m , 1h ) , 1.641.73 ( m , 1h ) , 1.421.61 ( m , 4h ) ; c nmr ( 125 mhz , cdcl3 ) 144.7 , 133.1 , 129.8 ,
128.0 , 99.0 , 70.8 , 70.7 , 70.6 , 70.5 ( bs and tall peak ) , 69.2 , 68.7 ,
66.6 , 62.2 , 30.6 , 25.4 , 21.6 , 19.5 .
intermediates monotetrahydropyranyl
octa(ethylene glycol ) monobenzyl ether ( 19 ) and monobenzylated
octa(ethylene glycol ) ( 20 ) were prepared according to
our previous report .
h nmr ( 500 mhz , cdcl3 ) 7.207.37
( m , 5h ) , 4.60 ( t , 1h , j = 3.5 hz ) , 4.53 ( s , 2h ) ,
3.793.87 ( m , 2h ) , 3.543.70 ( m , 31h ) , 3.423.50
( m , 1h ) , 1.741.86 ( m , 1h ) , 1.641.73 ( m , 1h ) , 1.431.61
( m , 4h ) ; c nmr ( 125 mhz , cdcl3 ) 138.3 ,
128.3 , 127.7 , 127.5 , 98.9 , 73.2 , 70.570.6 ( bs m and tall peaks ) ,
69.4 , 66.6 , 62.1 , 30.5 , 25.4 , 19.4 .
h nmr ( 500 mhz , cdcl3 ) 7.227.38
( m , 5h ) , 4.54 ( s , 2h ) , 3.523.72 ( m , 32h ) , 2.55 ( t , 1h , j = 5 hz , oh ) ; c nmr
( 125 mhz , cdcl3 ) 138.3 , 128.3 , 127.7 , 127.5 , 73.2 ,
72.5 , 70.570.6 ( bs and tall peaks . ) , 70.3 , 69.4 , 61.7 .
propargylated intermediate 22 was synthesized from 20 following the procedure for the synthesis of 11b e from 9b e ; an amber liquid , 101 g , 74.0% ( 4 steps ) .
h nmr ( 600
mhz , cdcl3 ) 4.60 ( t , 1h , j = 6
hz ) , 4.17 ( d , 2h , j = 2.4 hz ) , 3.593.68 ( m ,
34h ) , 3.473.57 ( m , 4h ) , 2.41 ( t , 1h , j =
2.4 hz ) , 1.18 ( t , 6h , j = 2.4 hz ) ; c
nmr ( 150 mhz , cdcl3 ) 101.2 , 79.7 , 74.5 , 71.9 , 70.9 ,
70.570.6 ( bs m and tall peaks ) , 70.4 , 69.1 , 62.3 , 58.4 , 15.3 .
hrms ( esi - tof ) m / z : [ m + na ] calcd for c25h48nao11 547.3094 ;
found 547.3112 .
octa(ethylene glycol ) monopropargyl ether lactic
acid ( 1f ) was synthesized following the procedure for
the synthesis of 1d e from 11d e . a light yellow viscous liquid ,
58 g , 65% .
h
nmr ( 500 mhz , cdcl3 ) 4.29 ( t , 1h , j = 5 hz ) , 4.17 ( d , 2h , j = 2.5 hz ) , 3.793.91
( dq , 2h , j = 4 and 10.5 hz ) , 3.533.70 ( m ,
32h ) , 2.41 ( t , 1h , j = 2.5 hz ) ; c nmr
( 125 mhz , cdcl3 ) 173.6 , 79.6 , 74.5 , 72.4 , 71.0 ,
70.370.6 ( bs m and tall peaks ) , 70.2 , 69.1 , 58.4 ; ir 3241 ,
2878 , 2117 , 1746 , 1457 , 1352 , 1297 , 1250 , 1107 ; hrms
( esi - tof ) m / z : [ m h ] calcd
for c22h39o12 495.2442 ; found 495.2437 .
peg 24 ( mn 1000 , n 23 , 250 g , 0.250 mol ) and tsoh ( 1.0 g ,
5.0 mmol ) were dissolved in ch2cl2 ( 3 l ) , followed
by dropwise addition of dhp ( 11.5 ml , 0.125 mol ) at room temeprature .
half of
the solvent was evaporated , and the resulting mixture was washed with
h2o ( 60 500 ml ) , dried over anhydrous sodium sulfate ,
and concentrated to afford a mixture of 25 and 26 ( 7:1 ) as a white solid , 106 g , 84.8% .
h nmr ( 500 mhz , cdcl3 ) 4.59 ( t , 2h , j = 4 hz ) , 3.783.86 ( m , 2h ) , 3.403.76 ( m , 90h ) , 1.731.84
( m , 1h ) , 1.631.71 ( m , 1h ) , 1.401.60 ( m , 4h ) .
this
mixture ( 106 g , 0.100 mol ) was converted to intermediate 29 with 30 as minor byproduct via alkylation
with 2 , transacetalization with ethanol , tosylation , and propargylation as described for the synthesis
of 22 .
h nmr ( 600 mhz , cdcl3 ) 4.55 ( t , 1h , j = 5.4 hz ) , 4.12 ( d , 2h , j = 2.4 hz ) ,
3.433.70 ( m , 101h ) , 2.38 ( t , 1h , j = 2.4
hz ) , 1.13 ( t , 6h , j = 7.2 hz ) .
poly(ethylene
glycol ) monopropargyl ether lactic acid ( 1 g , n 23 ) was prepared using a modified procedure for
the synthesis of 1f from 22 as discussed
above .
a solvent mixture of ch2cl2 and hexane
( 1:1 , 2 100 ml ) was used to extract a basic solution of 1 g to remove organic impurities . product 1 g was
obtained as a white wax solid , 63.2 g , 74.4% ( 3 steps ) .
h nmr ( 500 mhz , cdcl3 ) 4.29 ( t , 1h , j = 4 hz ) , 4.18 ( d , 2h , j = 2.5 hz ) , 3.743.86
( dq , 2h , j = 4 and 10 hz ) , 3.563.72 ( m , 113h ) ,
2.41 ( t , 1h , j = 2.5 hz ) ; c nmr ( 125
mhz , cdcl3 ) 173.4 , 79.7 , 74.5 , 72.4 , 71.1 , 70.570.6
( bs m and tall peaks ) , 70.44 , 70.41 , 70.3 , 70.2 , 69.1 , 58.4 ; ir 3252 ,
2872 , 2111 , 1749 , 1463 , 1355 , 1300 , 1248 , 1112 .
-hydroxy acid 1h was prepared using the same
procedure as described for the synthesis of propargyloxy lactic acid
( 1a ) .
h nmr ( 600 mhz , cdcl3 ) 5.805.89
( m , 1h ) ,
5.185.25 ( m , 1h ) , 5.085.14 ( m , 1h ) , 4.58 ( t , 1h , j = 6 hz ) , 3.98 ( d , 2h , j = 6 hz ) , 3.6068
( m , 2h ) , 3.473.55 ( m , 2h ) , 3.42 ( d , 2h , j = 6 hz ) , 1.16 ( t , 6h , j = 6 hz ) ; c
nmr ( 150 mhz , cdcl3 ) 134.5 , 117.2 , 101.1 , 72.3 ,
70.6 , 62.1 , 15.2 ; hrms ( esi - tof ) m / z : [ m + h ] calcd for c9h19o3 175.1334 ; found 175.1329 .
h nmr ( 500
mhz , cdcl3 ) 5.825.93 ( m , 1h ) , 5.215.33
( m , 2h ) , 4.56 ( t , 1h , j = 5 hz ) , 4.10 ( dt , 2h , j = 1.5 and 5 hz ) , 3.643.72 ( m , 2h ) ; c nmr ( 125 mhz , cdcl3 ) 133.3 , 118.5 , 118.2 , 72.7 ,
70.4 , 60.7 .
h nmr ( 500 mhz , cdcl3 ) 5.805.91 ( m , 1h ) , 5.165.32 ( m , 2h ) 4.37
( t , 1h , j = 5 hz ) , 4.004.09 ( m , 2h ) , 3.703.81
( dq , 2h , j = 5 and 10 hz ) ; c nmr ( 125
mhz , cdcl3 ) 176.0 , 133.7 , 118.7 , 118.0 , 72.6 , 70.8 ,
70.2 ; ir 3407 , 3093 , 2977 , 2933 , 2872 , 25003500 ( br . ) , 1744 ,
1424 , 1352 , 1206 , 1123 , 1041 ; hrms ( esi - tof )
m / z : [ m h ] calcd for c6h9o4 145.0511 ; found 145.0499 . | a new
simple and practical protocol for scalable synthesis of a
novel library of propargylated and pegylated -hydroxy acids
toward the preparation of clickable polylactides was
described .
the overall synthesis starting from readily available propargyl
alcohol , bromoacetaldehyde diethyl acetal , and oegs or pegs was developed
as a convenient procedure with low cost and no need of column chromatographic
purification .
the terminal alkyne functionality survives from hydrolysis
of the corresponding easily accessible cyanohydrin derivatives in
methanolic sulfuric acid .
facile desymmetrization , monofunctionalization ,
and efficient chain - elongation coupling of oegs further enable the
incorporation of oegs to -hydroxy acids in a simple and efficient
manner . at the end ,
synthesis of allyloxy lactic acid indicates that
an alkene group is also compatible with the developed method . |
over the past 25 years , human papillomaviruses
( hpvs ) have been
discovered to cause approximately 5% of all human cancer .
they are etiologically associated with nearly
all cervical carcinomas , and significant
data has emerged revealing the importance of hpvs in other anogenital
cancers as well as head and neck squamous
cell carcinomas ( hnsccs ) .
although hpv can be detected in numerous
aerodigestive cancers of the head and neck , it is most prevalent in
oropharyngeal squamous cell carcinoma ( opscc ) . the
discovery of hpv as a causative agent in hnscc represents an important
shift in the epidemiology of this cancer .
historically , patients with
hnscc were older and had extensive tobacco and alcohol use histories .
in contrast , patients with hpv+ hnscc tend to be younger and have
risk factors classically associated with cervical cancer , including
a high number of sexual partners , an early age of first sexual encounter ,
and prior sexually transmitted infections .
hnscc serves as a major cause of morbidity and mortality in the
united states , representing the sixth most common cancer .
the standard of care ( soc ) for patients with
hnscc includes a combination of chemotherapy , radiation , and surgery ,
all of which can lead to significant acute and long - term consequences .
in clinical trials ,
patients with hpv+ tumors have consistently demonstrated
improved response to treatment compared to patients with hpv
cancers .
thus , hpv status represents an independent and important prognostic
factor in opscc . moreover , numerous studies have demonstrated distinct
molecular differences between hpv+ and hpv hnsccs , which likely
underlie their differential response to treatment .
currently ,
the soc treatment for hnscc is the same regardless of hpv status . because hpv+ hnscc is now recognized to be a distinct disease from
hpv hnscc , there is a move within clinical oncology to tailor
treatment on the basis of the hpv status of the patient s cancer .
to evaluate the rationale underlying the drive to stratify hnscc
treatment by hpv status , it is prudent to investigate the emergence
of hpv as an etiological factor in hnscc .
first described
hpv presence in the head and neck region in 1982 when they noted hpv
dna in patients with laryngeal papillomas .
syrjanen et al . then detected hpv antigens in oral squamous cell
lesions in 1983 .
the first mention of
hpv in the oropharynx , specifically the palatine tonsils , was documented
in 1989 when brandsma and abramson showed the presence of hpv16 dna
in two of seven tonsillar squamous cell carcinomas . since that time
, an abundance of data has surfaced implicating
hpvs in the oncogenesis of hnscc , predominantly opscc . one large meta - analysis examined worldwide publications through
2004 employing pcr - based methods for the detection of hpv , and it
showed a hpv prevalence of 35.6% in the oropharynx and 23.5% at other
oral cavity sites . however , this study
did not determine if the prevalence of hpv+ cancers was static or
changed over time .
evaluated the incidence of head and neck cancer
between 1973 and 2004 from nine seer databases .
they did not carry out any molecular analyses to identify
patients with hpv+ cancers , but they instead stratified patients into
either hpv - related or -unrelated groups on the basis of the anatomic
site of their cancer ( oropharynx versus all other sites , respectively ) .
their study revealed a statistically significant increase in hpv - related
cancers and a decrease in hpv - unrelated cases . in another study , they evaluated 271 oropharyngeal cancer
cases from three seer databases for the presence of hpv dna and found
that hpv prevalence increased from 16.3% during 19841989 to
72.7% for 20002004 . similarly ,
ernster et al . assessed incidence data for oropharyngeal cancer from
1980 to 1990
compared to 19912001 for colorado and the united
states via the colorado central cancer registry and the seer program ,
respectively .
they showed an increased
incidence of oropharyngeal cancers in both colorado and the united
states between the two time periods .
furthermore , they analyzed oropharyngeal
cancer specimens from 72 patients in one county in colorado and demonstrated
a rise in hpv prevalence from 20% in 198084 to 82% in 200004 .
simard et al . revealed a similar trend of increasing
incidence for oropharyngeal cancer in white men and women of 4.4 and
1.9% per year , respectively , between 1999 and 2008 on the basis of
data from the north american association of central cancer registries .
thus , on the basis of the current literature ,
it is evident that
opscc is on the rise in the united states .
interestingly , chaturvedi
et al . revealed the number of opscc cases in men and women combined
has surpassed the number of cervical cancer cases in women in recent
years .
it is imperative to understand
the driving force behind the increasing incidence of opscc .
the current
belief is that a steadily rising rate of hpv - associated malignancies
is driving the incidence of opscc , but the majority of studies solely
examine a cross section of individuals at one time and a single location
in the united states .
therefore , we undertook this meta - analysis to
evaluate changes in the prevalence of hpv in opscc across the united
states over the last several decades .
our results demonstrate a highly
statistically significant increase in the prevalence of hpv+ opsccs
across the three time periods analyzed : pre-1990 , 19901999 ,
and 2000present .
this analysis provides further evidence for
the hypothesis that the rising incidence of opscc in the united states
is a result of hpv - associated malignancies .
thus , it is important
moving forward to consider hpv status in clinical trials for hnscc ,
particularly opscc .
the nih pubmed search engine was
used to identify publications via the following keyword searches :
hpv prevalence in oropharyngeal cancer , hpv
and tonsillar cancer , and
titles and abstracts were examined to identify articles
through august 2013 that presented data on the prevalence of hpv in
opscc by polymerase chain reaction ( pcr ) , in situ hybridization ( ish ) , p16 immunohistochemistry ( ihc ) , or other methods
for hpv detection .
any articles that fit within the scope of these
broad criteria were selected for the assessment of the entire study .
additional relevant papers were identified by methodically evaluating
the reference sections of other review articles and
meta - analyses . in a similar manner to the process described above , abstracts were
screened to identify articles reporting on the prevalence of hpv in
opscc based on molecular detection methods .
articles meeting these
criteria were then subjected to a more complete and thorough review .
studies were initially excluded
for the following reasons : review articles , papers in which molecular
methods to detect hpv were not employed , failure to distinguish oropharyngeal
cancers from other oral cavity sites , and patient populations outside
the united states . to be evaluated in the context of our meta - analysis ,
articles required a minimum amount of data .
this included a description
of the type of samples analyzed , detection method , time period of
sample collection , number of hpv+ opsccs , and total number of opsccs
analyzed ( table s1 ) .
however , five articles
did not report the sample collection time period , and two did not describe
the number of hpv+ opsccs detected .
therefore ,
we e - mailed authors from these seven articles to glean this information
( if available ) , which allowed us to increase the number of articles
included in our analysis .
furthermore , four other articles reported hpv positivity at some sites in the oropharynx
such as the tonsil , but they then provided information for broader
anatomic areas ( tongue , pharynx , and palate ) that could have included
additional oropharyngeal samples .
we e - mailed these authors to ask
them to breakdown tongue into base of tongue ( oropharynx ) versus oral
tongue , pharynx into lateral / posterior pharyngeal walls ( oropharynx )
versus other pharynx , and palate into soft palate ( oropharynx ) versus
hard palate .
if they provided us with this information , then we could
increase the sample size for that article .
however , if the authors
did not reply or could not breakdown these anatomic areas further ,
then we still included data from these articles by utilizing information
for samples in their study that definitively arose from the oropharynx
or anatomic subsites within the oropharynx and not including samples
from broader anatomic regions .
overall , we received responses related
to eight of the 11 articles , and the insight gained from these correspondences
is detailed in the footnotes of table s1 .
lastly , additional articles were excluded because of redundant
patient populations ( here , we included the articles reporting on the
larger number of patients ) , failure to provide the time period for
their sample collection , and failure to report the number of hpv+
opsccs detected ( figure 1 ) .
flow diagram depicting
the exclusion and inclusion of articles
used in our meta - analysis .
data collected from all articles included
title , authors , journal , year published , country , description of patients ,
anatomical sites of cancers analyzed , type of sample ( formalin - fixed ,
paraffin - embedded versus fresh frozen ) , hpv detection method , sample
collection period , overall number of head and neck cancers analyzed ,
and number of cancers that were hpv+ .
we stratified the head and neck
cancers from these studies into oropharyngeal ( tonsil , base of tongue ,
soft palate , lateral , and posterior pharyngeal walls ) and nonoropharyngeal
( all other sites ) .
our final data included the overall number of hpv+
opsccs out of the total number of opsccs analyzed by a specific article
and stratified by the time period from which the samples originated .
the statistical analyses were
performed with the goal of estimating the prevalence of hpv in opscc
in the united states from 1980 through august 2013 .
hpv prevalence
was defined as the number of patients with opscc whose tumors demonstrated
the presence of hpv divided by the total number of opsccs analyzed .
linear regression was used on the basis of log - transformed prevalence
values and was weighted by the number of opsccs assessed in each study .
hpv prevalence was subsequently stratified by year on the basis of
the midpoint of the first and last years of the study collection period . as shown in table s1 , three articles separated their samples into multiple time periods .
in this manner , we had a total of 38 data points from the 30 studies
included in our analysis ( figure 2a ) .
the midpoint
year was used in the model as a categorical variable grouped as pre-1990 ,
19901999 , and 2000present .
in addition , we evaluated
the prevalence of hpv based on the method employed for hpv detection .
only studies with a midpoint year of 1997 or later that used pcr-
or ish - based methods were included in this analysis . to evaluate whether
hpv prevalence differed by time period or method of detection , two - sided
95% confidence intervals were calculated and adjusted using the bonferroni
method .
all analyses were performed using the procedure proc glm from
sas / stat software ( version 9.3 ) .
( a )
scatterplot demonstrating the prevalence of hpv in opscc reported
by each article included in our analysis .
the median year for the
study s sample collection period was used as the time point .
( b ) boxplots of the hpv prevalence in opscc stratified into three
time periods : pre-1990 , 19901999 , and 2000present .
in all , 643 articles
were identified from our broad pubmed searches . after examining titles
and abstracts to select articles that reported on the prevalence of
hpv in opscc or at anatomic subsites in the oropharynx , 512 were excluded .
an additional 10 studies assessing patients from the united states
were identified by evaluating the reference sections of other articles . of the 141
articles that underwent full review ,
42 were excluded because they
were either review articles , did not employ molecular techniques to
detect hpv , or did not distinguish anatomical sites of the oropharynx
from other areas within the head and neck .
subsequently , 63 articles
were excluded because they reported on patient populations outside
the united states .
next , as detailed
in the experimental procedures , we contacted
authors from 11 studies to gather further information about their
work ( if available ) that allowed us to either ( a ) include articles
that initially would have met exclusion criteria ( specifically , did
not report sample collection time period ( n = 5 )
or number of hpv+ opsccs detected ( n = 2 ) ) or ( b )
increase the sample size for a particular article by further stratifying
specific anatomic areas : tongue , pharynx , and palate ( n = 4 ) .
we received responses related to four of five articles in
which the authors were queried regarding the time period for their
sample collection , two of two articles in which the authors
were queried regarding the number of hpv+ opsccs detected ( only one had the requested data ) ,
and two of four in which the authors were queried regarding stratification
of anatomic sites ( again , only one group could
provide this information ) .
more detailed
descriptions of the data gathered from these authors are described
in the footnotes of table s1 .
importantly ,
this correspondence led to the identification of additional articles
that needed to be excluded because of redundant patient populations
( n = 4 ) ( here , we included the articles
reporting on the larger number of patients ) .
lastly , two more articles
were excluded : one for failing to provide the time period for their
sample collection and another that did
not report the number of hpv+ opsccs detected .
ultimately , we included 30 articles in this meta - analysis
( figure 1 and table s1 ) .
the 30 articles in our study reported on the hpv prevalence
in 3428 patients with hnscc .
there were 2099 patients with opscc .
on average , each article presented on the hpv status for 70 ( range
7323 ) patients with opscc .
twenty - three studies analyzed formalin - fixed ,
paraffin - embedded ( ffpe ) tumors , five used fresh frozen tissue , and
two used a combination of ffpe and fresh frozen samples .
a variety
of molecular methods were utilized for the detection of hpv . in some
studies ,
multiple methods were employed to compare their efficacy .
for our analysis , we collected data on the basis of the method utilized
to make the final decision on hpv status . in this context , 18 studies
used pcr - based methods , eight , ish , two , pcr with flight mass spectroscopy
( attosense hpv test ) , one , southern blot , and one , a combination of
p16 ihc followed by ish and pcr .
importantly , these
studies reported on patients from across the united states including
california , colorado , connecticut , hawaii , iowa , louisiana , maryland ,
massachusetts , michigan , minnesota , missouri , new york , north carolina ,
pennsylvania , vermont , and washington .
the prevalence
of hpv in opscc ( hpv prevalence ) in each study group is displayed
in figure 2a as a function of the median year
of the sample collection period . to assess the relationship between
hpv+ opsccs and time in greater detail , we divided the articles into
three time periods on the basis of the median year of the sample collection
period : pre-1990 , 19901999 , and 2000-present
. figure 2b displays the raw data for the prevalence of hpv
in opscc across the three time periods . on the basis of our statistical
analysis ,
the mean prevalence of hpv was 20.9% ( 95% ci : ( 11.8 , 37.0% ) )
in pre-1990 , 51.4% ( 95% ci : ( 45.4 , 58.2% ) ) from 1990 to 1999 , and
65.4% ( 95% ci : ( 60.5 , 70.7% ) ) for 2000present ( table 1 ) . the differences in hpv prevalence values across
the three time periods , pre-1990 , 19901999 , and 2000present ,
were found to be highly statistically significant , with p values of 0.004 ( pre-1990 vs 19901999 ) , 0.002 ( 19901999
vs 2000present ) , and < 0.001 ( pre-1990 vs 2000present ) .
next , we investigated whether the detection
method utilized led
to a difference in hpv prevalence . because the majority of studies
employed either hpv dna pcr- or ish - based methods , we compared hpv
prevalence between these two categories
therefore , we restricted our evaluation
to studies from 1997 to the present because , had we included studies
prior to 1997 , we would have artificially lowered the prevalence of
hpv detected by pcr because hpv prevalence was lower in earlier populations .
overall , we compared eight articles reporting on 718 opscc specimens
via ish and nine articles evaluating 501 opscc samples by pcr ( table 2 ) .
the observed hpv prevalence value from each article
is displayed in figure 3 , with the relative
size of the data point representing the number of opsccs analyzed .
by weighting the studies on the basis of the number of opsccs analyzed ,
the estimated hpv prevalence was 63.1% ( 95% ci : ( 55.7 , 71.6% ) ) and
63.3% ( 95% ci : ( 54.4 , 73.6% ) ) for ish and pcr , respectively .
thus ,
there was no statistically significant difference between the mean
hpv prevalence detected by ish compared to pcr ( p value = 0.98 ) .
frequency of hpv+ opscc detected by pcr versus ish . the
prevalence
of hpv in opscc for articles with a median sample collection year
from 1997 to the present employing ish- or pcr - based methods for hpv
detection .
the relative size of the data point circle is dependent
on the number of opsccs analyzed in the article .
numerous groups have noted a steady rise in the incidence of opscc
in the united states .
it is now well - accepted that hpv represents an etiologic agent in
a proportion of opsccs , and it has been
hypothesized that the driving force behind the rising incidence of
opscc in the united states is an increase in hpv - related malignancies .
to date , there has not been a meta - analysis focusing on the trend
of hpv prevalence in opscc across the united states over time . by
analyzing all of the published literature reporting on patient populations
in the united states on this topic ,
we have demonstrated a clear increase
in the proportion of hpv - positive opsccs since 1980 until present
day . separating the samples into three discrete time periods , pre-1990 ,
19901999 , and 2000present , the mean prevalence of
hpv detected in opscc rose from 20.9 to 51.4 to 65.4% ( table 1 ) , respectively .
this analysis provides further
evidence that hpv represents the likely culprit underlying the increasing
incidence of opscc in the united states .
moreover , our results are
in agreement with another meta - analysis that assessed the global prevalence
of hpv across time , although that article did not distinguish the
united states from north america .
first , we
made a strong and concerted effort to exclude any articles with redundant
patient populations .
this was accomplished by correspondence with
authors who published multiple articles on this subject .
we discovered
this was a relatively common occurrence , and it would have been difficult
to recognize this problem without direct discussions with the authors .
in addition , we gathered new information from multiple authors , which
allowed us to expand the number of articles included in our study
( table s1 )
. furthermore , we did not exclude
articles on the basis of sample size , but instead , we employed statistical
models to weight studies on the basis of the number of opscc specimens
analyzed . despite these efforts ,
first , we focused on the published literature and did not
delve into unpublished data . in this manner , it is possible we have
introduced publication bias into this work .
another potential area
for concern is that the articles examined a wide range of specimens
from varying years and therefore the less frequent detection of hpv
in earlier time periods could simply be a consequence of reduced quality
of those samples .
however , most of the studies ( 13 out of 18 ) that
included specimens from more than 10 years prior to the publication
date carried out quality - control analyses on all of their samples
using pcr amplification of beta - globin , beta - actin , or another housekeeping
gene to determine whether the tissue was of high enough quality to
undergo further analysis . likewise , six of the seven articles with samples from 15 years or
greater before the year of publication carried out similar quality - control
measurements .
thus , poor quality of
older samples should not have significantly affected our data because
a high proportion of these articles verified the integrity of their
tissue prior to hpv detection .
along the same line , it is possible
that changes in the sensitivity of hpv detection methods over time
could have influenced this analysis .
two recently published articles
( 2011 and 2007 ) evaluated samples from the 1980s through early 2000s .
they divided
their specimens into four or five consecutive time periods on the
basis of the year that the samples originated in order to assess for
any changes in hpv prevalence across time .
importantly , they performed
quality - control evaluations , as described above , to ensure that degradation
of tissue did not influence their results . utilizing present - day hpv detection methods ,
both articles revealed
a rising prevalence of hpv+ opsccs across the different time periods ,
consistent with the pattern seen in our meta - analysis .
therefore ,
it is unlikely that changes in the sensitivity of hpv detection methods
over the time period in which the included studies were performed
confound the interpretation of our meta - analysis .
lastly , the data
was collected in a retrospective fashion , and the studies were carried
out by numerous groups utilizing a variety of criteria for patient
inclusion / exclusion , gold standards for determining hpv - positivity ,
and many different assays for hpv detection .
the majority of
studies in this analysis used hpv dna ish- or pcr - based
methods for hpv detection .
although there was not a statistically
significant difference in the prevalence of hpv detected by ish or
pcr ( table 2 ) , it is important to assess the
commonly utilized methods for hpv detection ( reviewed in ref ( 53 ) ) . for pcr ,
there a number
of primer sets available that target degenerate sequences common in
multiple hpv genotypes or gene regions specific to certain hpv genotypes
such as hpv 16 ( implicated in almost 90% of hpv - associated opsccs ) , 18 , 31 , 33 , and others .
pcr assays are highly
sensitive and can detect a small quantity of hpv dna . however , pcr
can not distinguish whether the hpv originated within tumor or adjacent
nontumor cells , leading to the concern that pcr alone could lead to
false positive results .
similar to pcr , there are numerous molecular
probes available for hpv dna ish .
one advantage to ish is that it
demonstrates the cellular location of the hpv .
however , a key pitfall
to both hpv dna pcr- and ish - based methods is that they determine
solely the presence of hpv dna in the sample , but this does not indicate
if the virus is transcriptionally active .
p16 ihc has been used in
the clinical realm as a surrogate for transcriptionally active hpv
infections .
briefly , e7 , a vital hpv oncogene , leads to downregulation
of the tumor suppressor retinoblastoma ( rb ) .
overexpression
of p16 has been demonstrated to be consistent with hpv infection in
opscc .
however , this assay lacks specificity for
hpv , and there exists a subset of p16-positive / hpv dna - negative tumors .
for this reason , multiple studies have examined
using a multistep process of p16 ihc ( highly sensitive ) followed by
hpv dna ish ( highly specific ) to demonstrate both the presence and
activity hpv .
this two - step process compared
well to hpv e6/e7 rt - pcr , which was utilized as the gold standard
in these studies .
lastly , a novel e6/e7 rna ish assay was evaluated
in two studies , and both indicate that it is very sensitive and specific
to the presence of transcriptionally active hpv .
given the wide array of available assays , there is a clear need
to establish standards for hpv detection .
the increasing burden of hpv+ opscc raises an important public
health issue : will vaccinating against hpv decrease the incidence
of opscc in the future ?
currently , the u.s . food and drug administration
( fda ) has approved the use of two vaccines against hpv : gardasil ( targets
hpv subtypes 6 , 11 , 16 , and 18 ) and cervarix ( targets hpv subtypes
16 and 18 ) .
both vaccines have demonstrated the ability to decrease
rates of cervical intraepithelial neoplasia in large , randomized clinical
trials in women .
however , vaccine efficacy specifically
against oropharyngeal cancer is not clear and has yet to be examined
in the literature . considering that more than 90% of opsccs are caused
by hpv-16 and 18 ,
this is an especially
important issue for males because they bear the greater burden of
this disease .
the advisory committee on immunization
practices ( acip ) recommends routine vaccination of males at age 11
or 12 ( can be started at 9 ) , with additional recommendations for unvaccinated
males aged 1321 and 2226 .
a national survey of 1317 year old males in 2010 found the
vaccination rate was quite low , with less than 2% receiving at least
one dose of the vaccine .
clearly , further
efforts are needed to increase the vaccination rate among males . in the mean time
, we expect the role of hpv
in opscc to continue its upward trend for at least the next few decades
because there is a long lag time between infection and cancer development .
thus , it is important to continue investigating
the molecular mechanisms underlying this cancer as well as different
treatment options for patients .
indeed an important value of
assessing opsccs for the presence
or absence of hpv is the prognostic information that this carries
for patients .
patients with hpv+ opscc have significantly improved outcomes compared
to those with hpv opscc .
on the basis of the improved survival outcomes seen in patients
with hpv+ opscc , the major cooperative groups that enroll hnscc patients
have embarked on a series of studies specifically targeting these
patients . however , pending these results , there is currently no difference
in the soc treatment for patients on the basis of the hpv status of
their cancer .
many of these ongoing trials attempt to maintain the
improved survival outcomes for patients with hpv+ cancers while minimizing
treatment - related morbidity .
currently , these trials are focusing
on using relatively standard treatments for patients with hpv+ opscc
( reviewed in ref ( 68 ) ) , but in the future , we predict that treatments targeting either
the viral oncogenes or critical molecular pathways may play a role
in therapy .
in addition to these important clinical trials ,
a number of groups
are attempting to understand the biology of hpv+ cancers better using
both in vitro and in vivo model
systems .
our own groups have developed transgenic models of hpv+ oral
cancer in mice as well as a patient - derived xenograft system for studying
human tumors .
these preclinical animal models
as well as established cell lines derived from human head and neck
cancers can be used to evaluate the efficacy
of novel therapies , to test unique combinations of treatment , and
to identify informative biomarkers that can be validated in prospective
clinical trials .
testing for and identifying patients with hpv+ cancers
will play a critical role in the care of patients with opscc , and
this should be considered a standard part of the multidisciplinary
care for patients with head and neck cancer . | human
papillomaviruses ( hpvs ) are involved in approximately 5%
of all human cancer .
although initially recognized for causing nearly
all cases of cervical carcinoma , much data has now emerged implicating
hpvs as a causal factor in other anogenital cancers as well as a subset
of head and neck squamous cell carcinomas ( hnsccs ) , most commonly
oropharyngeal cancers .
numerous clinical trials have demonstrated
that patients with hpv+ oropharyngeal squamous cell carcinoma ( opscc )
have improved survival compared to patients with hpv cancers .
furthermore , epidemiological evidence shows the incidence of opscc
has been steadily rising over time in the united states .
it has been
proposed that an increase in hpv - related opsccs is the driving force
behind the increasing rate of opscc .
although some studies have revealed
an increase in hpv+ head and neck malignancies over time in specific
regions of the united states , there has not been a comprehensive study
validating this trend across the entire country .
therefore , we undertook
this meta - analysis to assess all literature through august 2013 that
reported on the prevalence of hpv in opscc for patient populations
within the united states .
the results show an increase in the prevalence
of hpv+ opscc from 20.9% in the pre-1990 time period to 51.4% in 19901999
and finally to 65.4% for 2000present . in this manner ,
our
study provides further evidence to support the hypothesis that hpv - associated
opsccs are driving the increasing incidence of opscc over time in
the united states . |
odontogenic tumors represent a spectrum of lesions ranging from benign and malignant neoplasms to dental hamartomas , all arising from odontogenic residues such as odontogenic epithelia and/or ectomesenchyme with variable amounts of dental hard tissues .
odontogenic epithelium is responsible for tooth development under physiologic conditions and can give rise to tumors or cysts in the jaws in pathologic conditions .
of all the lesions of head and neck area that affect the maxillary and mandibular bones , the highly prevalent odontogenic tumors have been the focus of several studies that adopted different analytic approaches .
the interest in these lesions is high because of their similar radiographic and histopathologic features but different clinical behaviors .
apoptosis , also known as programed cell death or physiologic cell death , plays a diverse role in embryogenesis , the development and maintenance of normal homeostasis as well as in oncogenesis within all multicellular organisms and is associated with the pathogenesis of various tumors .
an imbalance among the antiapoptotic proteins such as bcl-2 family members could induce dysregulation of apoptosis , which would contribute to oncogenesis and tumor development .
recent reports have documented the expression of bcl-2 gene products in tooth germs and ameloblastomas by an immunohistochemical method , suggesting that these proteins have important roles in odontogenesis and tumor growth .
other bcl-2 family proteins have not yet been examined extensively in odontogenic epithelium until recently .
one such specific marker to identify proliferative activity and tumor aggressiveness by immunohistochemistry ( ihc ) is bcl - x , a 20 kda protein .
very little data exist on the expression of bcl - x , a newly discovered member of the bcl-2 antiapoptotic protein family in odontogenic tumors , and a very minimal amount of information is available in the literature to study and compare the bcl - x expression between various odontogenic tumors and to correlate the expression to their diverse biological behavior and aggressive nature inherent in them .
this study , therefore , aimed to investigate whether the newly discovered bcl - x protein is expressed by these epithelial odontogenic tumors , and if so whether or not there exists a significant difference in bcl - x expression between ameloblastoma , keratocystic odontogenic tumor ( kcot ) and adenomatoid odontogenic tumor ( aot ) so as to reveal its possible role in progression and determination of the growth profile of these tumors and in an attempt to elucidate its influence on their biological behavior .
the samples for this study involved the use of formalin - fixed paraffin - embedded tissues of histopathologically diagnosed 45 cases of epithelial odontogenic tumors retrieved from the department of oral pathology and microbiology , yenepoya dental college , mangalore , india .
these 45 cases which included ameloblastoma ( 15 cases ) , kcot ( 15 cases ) and aot ( 15 cases ) were confirmed and taken for ihc evaluation . for ihc detection of bcl - x ,
serial sections of 4-m thickness were cut and mounted on poly - l - lysine coated slides and were dried for 24 h at 37c .
then , the sections were deparaffinized and rehydrated in xylene and descending grades of alcohol , respectively .
antigen heat retrieval was done by keeping the slides in a pressure cooker filled with boiling trisodium citrate buffer ( ph 6.0 ) for 20 min .
monoclonal anti - bcl - x antibody ( ready - to - use vial , biogenex ) was used . the super sensitive polymer - hrp ihc detection system ( biogenex life sciences pvt . ltd . )
was used for the application of the biotinylated link antibody and peroxidase - labeled streptavidin , according to the manufacturer 's instructions for the procedure .
the slides were then counterstained with mayor 's hematoxylin stain . for each batch of staining , a negative control where the primary antibody was replaced by tris buffer saline , and a positive control of normal tonsil tissue was used .
the slides were viewed in a bright field microscope at a magnification of 20 for analyzing intensity , localization and pattern of staining .
all the slides were methodically evaluated by two different observers to remove the inter- and intraobserver bias .
the photomicrographs for assessing the percentage of positive cells were taken at 20 magnification using olympus camera sp-350 attached to microscope olympus cx-41 .
one dense area of cells with maximum bcl - x expression was randomly selected for analysis . in ameloblastoma slides ,
areas for positive cell counting were selected from peripheral ameloblasts such as cells and stellate reticulum - like cells ; in kcot slides , areas for positive cell counting were selected from basal cell layers , intermediate cell layers and superficial cell layers , whereas in aot slides , areas for positive cell counting were selected from duct - like structures and polyhedral sheets of cells .
the cells were counted manually using imagej software ( 1.42q , nih , usa ) . the percentage of bcl - x expression was quantified by determining the number of positive cells expressing cytoplasmic bcl - x staining among the total number of cells in a selected area .
the qualitative , quantitative and semi - quantitative analysis of the stained sections was done by light microscopy and according to the immunoreactive score ( irs ) given by remmele and stegner . in irs scale , the intensity of staining ( grades : 03 ) and percentage of positive cells ( grades : 04 ) were taken into account .
irs was evaluated by obtaining the product of intensity grade and percentage of positivity grade for each case .
the irs represented a product of points given for the evaluated characters , and it ranged from 0 to 12 .
the irs points were categorized into four groups based on expression , i.e. , 01 negative expression , 23 positive weak expression , 48 positive mild expression and 912 positive strong expression [ table 1 ] .
comparison of immunoreactive score between ameloblastoma , keratocystic odontogenic tumor and adenomatoid odontogenic tumor data were entered and analyzed using spss software version 10.05 ( spss inc . ,
chi - square test and anova with post hoc least significant difference test were used to validate the comparison and correlation of bcl - x expression between ameloblastomas , kcots and aots .
for ihc detection of bcl - x , serial sections of 4-m thickness were cut and mounted on poly - l - lysine coated slides and were dried for 24 h at 37c .
then , the sections were deparaffinized and rehydrated in xylene and descending grades of alcohol , respectively .
antigen heat retrieval was done by keeping the slides in a pressure cooker filled with boiling trisodium citrate buffer ( ph 6.0 ) for 20 min .
monoclonal anti - bcl - x antibody ( ready - to - use vial , biogenex ) was used . the super sensitive polymer - hrp ihc detection system ( biogenex life sciences pvt . ltd . )
was used for the application of the biotinylated link antibody and peroxidase - labeled streptavidin , according to the manufacturer 's instructions for the procedure .
the slides were then counterstained with mayor 's hematoxylin stain . for each batch of staining ,
a negative control where the primary antibody was replaced by tris buffer saline , and a positive control of normal tonsil tissue was used .
the slides were viewed in a bright field microscope at a magnification of 20 for analyzing intensity , localization and pattern of staining .
all the slides were methodically evaluated by two different observers to remove the inter- and intraobserver bias .
the photomicrographs for assessing the percentage of positive cells were taken at 20 magnification using olympus camera sp-350 attached to microscope olympus cx-41 .
one dense area of cells with maximum bcl - x expression was randomly selected for analysis . in ameloblastoma slides ,
areas for positive cell counting were selected from peripheral ameloblasts such as cells and stellate reticulum - like cells ; in kcot slides , areas for positive cell counting were selected from basal cell layers , intermediate cell layers and superficial cell layers , whereas in aot slides , areas for positive cell counting were selected from duct - like structures and polyhedral sheets of cells .
the cells were counted manually using imagej software ( 1.42q , nih , usa ) . the percentage of bcl - x expression was quantified by determining the number of positive cells expressing cytoplasmic bcl - x staining among the total number of cells in a selected area .
the qualitative , quantitative and semi - quantitative analysis of the stained sections was done by light microscopy and according to the immunoreactive score ( irs ) given by remmele and stegner . in irs scale , the intensity of staining ( grades : 03 ) and percentage of positive cells ( grades : 04 ) were taken into account .
irs was evaluated by obtaining the product of intensity grade and percentage of positivity grade for each case .
the irs represented a product of points given for the evaluated characters , and it ranged from 0 to 12 .
the irs points were categorized into four groups based on expression , i.e. , 01 negative expression , 23 positive weak expression , 48 positive mild expression and 912 positive strong expression [ table 1 ] .
data were entered and analyzed using spss software version 10.05 ( spss inc . , chcago , illinois , usa ) .
chi - square test and anova with post hoc least significant difference test were used to validate the comparison and correlation of bcl - x expression between ameloblastomas , kcots and aots .
bcl - x expression was detected in all the three groups , and intensity of the staining varied from weak to strong in the studied sections .
ihc results of the qualitative , quantitative and semi - quantitative analysis for bcl - x expression in studied groups are summarized in tables 24 , and microscopic findings of them have been shown in figures 14 .
total staining results in ameloblastoma , keratocystic odontogenic tumor and adenomatoid odontogenic tumor intensity grades in ameloblastoma , keratocystic odontogenic tumor and adenomatoid odontogenic tumor comparison of percentage of positive cells in ameloblastoma , keratocystic odontogenic tumor and adenomatoid odontogenic tumor photomicrograph showing bcl - x expression in plexiform ameloblastoma tissue ( 200 ) photomicrograph showing bcl - x expression in unicystic ameloblastoma tissue ( 200 ) photomicrograph showing bcl - x expression in keratocystic odontogenic tumor tissue ( 200 ) photomicrograph showing bcl - x expression in adenomatoid odontogenic tumor tissue ( 200 ) when the expression of bcl - x was analyzed , 39 cases out of 45 showed positive staining ( 86.7% ) and six cases ( 13.3% ) showed the complete absence of staining . among the different groups analyzed , ameloblastoma cases showed 93.3% of positivity . in kcot ,
about 86.7% of positive staining and aot showed 80% of positive staining results [ table 2 ] .
the intensity grade was analyzed between the three groups ; in ameloblastoma , out of 15 cases , four cases ( 26.7% ) showed moderate intensity , whereas eight cases ( 53.3% ) showed intense staining and only two cases ( 13.3% ) cases showed mild staining .
when the intensity grades of kcot were analyzed , only one case ( 6.7% ) had intense staining and six cases each ( 40% ) showed moderate and mild staining , whereas in aot , about nine cases ( 60% ) of them showed mild staining and only three cases ( 30% ) showed moderate staining [ table 3 ] .
the percentage value of cells positive for bcl - x staining was calculated out of total epithelial cells from each area .
the mean values of percentage of positive cells from each group were statistically analyzed for comparison .
the percentage of positivity value of ameloblastoma has a mean value of 63.33 and standard deviation ( sd ) - 22.077 , kcot has a mean value of 40.73 and sd - 21.855 and aot has a mean value of 28.60 and sd - 21.033 [ table 4 ] .
when the irs was compared in between ameloblastoma and kcot , most of the ameloblastoma cases , i.e. , 40.0% of cases showed score 9 with positive strong expression of bcl - x and maximum number of kcot cases , i.e. , 40% of them showed score 2 with positive weak expression of bcl - x and 20% of cases showed score 4 and score 6 each with positive mild expression and maximum number of aot cases , i.e. , 60% of them showed score 2 with positive weak expression of bcl - x [ table 1 ] .
odontogenic tumors constitute a group of heterogeneous lesions that range from hamartomatous or nonneoplastic tissue proliferations to malignant neoplasms with metastatic capabilities .
odontogenic cysts are encountered relatively commonly in dental practice and odontogenic tumors , by contrast , are lesions of varying rarity within odontogenic tissues and constitute an important aspect of oral and maxillofacial pathology .
proliferation activity is an important predictor of biologic behavior of pathologic condition and as a potential guide for therapy .
a series of genetic and molecular alterations appear to promote the development and progression of tumors through multiple steps , and recent studies have identified various molecular alterations responsible for their development and progression .
determination of the factors responsible for this epithelial proliferation , using ihc , helps in investigating the differences between biological behavior of various tumors .
current studies of tumor biology suggest several basic mechanisms that may be used by neoplastic cells to provide a growth advantage over normal tissue .
neoplastic cells may show an increased rate of cell division and/or a decreased rate of programed cell death .
it is believed that tumor cells show a normal level of cell division and an increased expression of antiapoptotic proteins . in the current study
, an effort has been made to compare and correlate the growth potential of these different odontogenic tumors to assess the aggressiveness with the help of molecular studies that have offered interesting findings regarding their pathogenesis .
there are a number of genetic and molecular changes that appear to promote the development and multistage progression of odontogenic tumors .
the mechanisms by which these tumors grow and evolve include overexpression of antiapoptotic proteins such as bcl-2 and bcl - x .
ameloblastoma was selected for this study as it is considered as enigmatic with unknown etiology and though benign , deserves special attention because of particular biological behavior exhibiting greater infiltrative potential , high recurrence rate and capacity to metastasize or undergo malignant transformation when compared to its other epithelial counterpart aot , which is now believed to be a result of metaplastic process rather than an epithelial - ectomesenchymal interaction .
in addition , a large size aot supports the classification of the tumor as a benign neoplasm and not a hamartoma which has triggered a long - term debate whether it should be categorized as a hamartomatous malformation or a true benign tumor , and kcot has been compared in this study with ameloblastoma and aot as it is now regarded as a benign neoplasm rather than a conventional cyst by toller in 1967 ; based on its aggressive biological behavior , prone to recurrence and the genetics involved , it is reclassified as a tumor by philipsen in 2005 .
therefore , a more detailed molecular study of these tumors can put some insight into the biological behavior and their aggressive nature .
it has been substantiated that apoptosis is a critical step in cell differentiation , cell turnover and in the maintenance of tissue homeostasis .
recent advances on cancer biology have shown that the process of tumorigenesis may involve not only increased cell proliferation but also decreased cell death or increased cell survival .
mutations of any of the genes encoding antiapoptotic proteins or any changes in the levels of their expression can lead to increased cell survival and contribute to growth advantage of the affected tissues compared to the neighboring ones .
extensive search in the literature revealed very few studies evaluating bcl-2 and bcl - x expression in odontogenic tumors and only one in odontogenic myxomas by bast et al .
these investigators noted an increase in expression of bcl-2 and bcl - x and therefore suggested the production of these antiapoptotic proteins by the tumor cells to be a possible mechanism of disease progression providing a growth advantage . a similar observation in our study points to the likely role of the same mechanism even in ameloblastoma , kcot and aot .
dysregulated bcl - x expression further induces dna damage , affecting the cellular activity and allows the cell to remain in an antiapoptotic state and thus contributes to continuous growth .
therefore , bcl - x dysregulation can be an important early event in the progression of odontogenic tumors , and the intensity of expression can be directly correlated with aggressiveness of the tumor . in our study
, the bcl - x expression was seen more in ameloblastomas [ table 2 ] than kcot and least in aot cases .
this observation of a decrease in bcl - x - positive cells with a decrease in proliferative growth of tumors possibly reveals that bcl - x is expressed more in epithelial cells that have an increased capacity for survival that could be more in ameloblastoma which was in compliance from studies by chen et al . and
that showed an increase in bcl-2 expression in poorly differentiated oral squamous cell carcinoma ( oscc ) than in well - differentiated oscc reflecting a possibility that bcl-2 was expressed more in keratinocytes that have an increased capacity for survival . in the present study ,
bcl - x immunoreactivity was expressed higher by the columnar cells ( 70.8% ) in the periphery of tumor islands when compared to stellate reticulum cells ( 55.8% ) [ figures 1 and 2 ] , which is consistent with the findings of florescu et al . and
sindura et al . with the bcl-2 protein that was also seen by de vicente et al .
similar studies in literature communicate that around 90% of ameloblastomas are positive for bcl-2 in the peripheral layers of tumor islands found by mitsuyasu et al . and sandra et al . , which indicates that bcl-2 and bcl - x expression may be related to differentiation and proliferation of odontogenic epithelium , and their overexpression may be associated with the ameloblastomas development maintaining stem cell population in peripheral layers of tumor islands .
however , our study findings were compatible with several other studies on ameloblastomas using various proliferative markers such as proliferating cell nuclear antigen by kim and yook and ki-67 by sandra et al . and meer et al . , which was higher in peripheral cells of ameloblastomas asserting that proliferative activity is higher in peripheral neoplastic cells compared to central neoplastic cells .
in cases of kcot , expression of bcl - x was found in the whole thickness of the epithelium in our study [ figure 3 ] which was in harmony with the study of tekkesin et al . with bcl-2 protein , and the authors suggested that their results supported the notion of odontogenic keratocyst having a neoplastic nature and redefinition and reclassification as a tumor .
this study clearly demonstrates that kcot - like ameloblastoma demonstrates equivalent aggressive clinical and noticeable invasive behavior .
therefore , it is now considered as no longer a developmental cyst but as an odontogenic tumor . in the present study ,
the bcl - x expression in aot cases showed mild - to - moderate positivity , and a varied expression was found in all these cases [ table 3 ] .
it was reflected in his study that expression was present in most of the epithelial cells of aot [ figure 4 ] , and it behaves more aggressively in most cases that rules out aot as a cyst .
the whole concept of aot behaving more aggressive regulating apoptosis and facilitating cell survival by expressing bcl - x protein from this study could correlate to its biological behavior and could be considered as a benign neoplasm rather than a hamartoma or a cyst and progresses in a similar pathway indicative of a true neoplasm rather than a developmental anomaly .
another distinctive and interesting finding of the present study is the localization of bcl - x immunoreactive cells in these tumors .
the detailed observation and analysis of the sample slides exhibited the presence of more immunoreactive cells in peripheral ameloblast - like cells when compared to stellate reticulum - like cells in ameloblastoma which was in agreement with many studies in the literature .
in kcot , it was more seen in basal cell layer compared to intermediate and superficial cell layer , and in aot cases , duct - like cells displayed more immunoreactive cells compared to polyhedral epithelial cells . these observations could substantiate that all the cells which were positive for bcl - x did not show uniform staining localization within a tissue and contribute to the fact that there are different levels of cellular differentiation and activity - inactivity within group of cells which do not directly correspond to localization , and the overall bcl - x expression within a tissue sample rather depends on individual nature of the tumors . after reviewing the literature
, this appears to be the first study on comparison of bcl - x expression in a group of epithelial odontogenic tumors .
this study identifies the presence of bcl - x protein in odontogenic epithelium with significant differences found between ameloblastoma , kcot and other clinically indolent odontogenic tumor such as aot . as this oncoprotein
bcl - x regulates programed cell death by allowing the tumor cells to escape apoptosis , thereby promoting the cell survival and facilitating the growth advantage over the surrounding tissues and consequently resisting the therapeutic approach to radiation or chemotherapy , so we suggest a definite role of bcl - x in the progression of these tumors .
the treatment modalities for the odontogenic lesions should target the neoplastic epithelium which could result in reduction of the extent of lesion and thus minimizing the significant functional , esthetic and psychological damage caused by these aggressive odontogenic lesions .
the results show variability and heterogeneous expression for bcl - x protein in odontogenic tumors of epithelial origin .
the bcl - x expression had a significant difference between ameloblastoma , kcot and aot which could be suggestive of a difference in the growth profile , aggressiveness and increased cell survival ability of these odontogenic tumors .
further correlative studies using a panel of markers for other members of the bcl-2 family are necessary to elucidate the specific molecular defects critical to the biology of these odontogenic tumors , which will have an impact on diagnosis and treatment .
| objectives : since its recognition as a physiologic process associated with tumor , among molecular mechanisms involved in tumor progression , defects in regulation of apoptosis have generated an accelerating volume of research that has sought to elucidate the role of programed cell death in pathogenesis and treatment of various tumors .
therefore , this study was performed to understand better the diverse biological profile of epithelial odontogenic tumors with the help of immunohistochemical expression of bcl - x protein.materials and methods : we studied bcl - x protein expression in 45 cases of epithelial odontogenic tumors which included 15 cases each of ameloblastomas , keratocystic odontogenic tumor ( kcot ) and adenomatoid odontogenic tumor ( aot ) and correlated the expression with their growth pattern.results:cytoplasmic staining of bcl - x revealed overexpression in ameloblastoma when compared to kcot and aot .
percentage of positive cells showed a statistically significant difference , p = 0.007 between ameloblastoma and kcot , whereas p < 0.001 between ameloblastoma and aot .
however , no significance was observed between kcot and aot ( p = 0.132).conclusion : the present study supports the fact that epithelial odontogenic tumors show diverse growth profiles .
an increased bcl - x expression was seen in ameloblastoma compared to kcot and least expression in case of aot which could be indicative of more aggressive biological behavior and increased cell survival activity of ameloblastoma than kcot and aot .
this signifies the diagnostic relevance of this biomarker and also could be a possible regulator of the proliferative compartment by contributing in tumor progression and cytodifferentiation of epithelial odontogenic tumors . |
the benefits of achieving a low target intraocular pressure ( iop ) in primary open - angle glaucoma ( poag ) and ocular hypertension are well recognized . when acceptable iop levels are not achieved with a single drug , adjunctive therapy with complementary mechanisms of action
the ocular hypertension treatment study ( ohts ) found that , in eyes without significant optic nerve damage and at risk of developing glaucoma , more than 40% of patients needed additional medication within 5 years after starting treatment to reach a modest reduction in iop of 20% or more long - term.1
as many as 75% of patients with poag may require adjunctive therapy within 24 months of starting glaucoma therapy in order to achieve the target pressure.2 the advanced glaucoma intervention study ( agis ) found that , in patients with glaucoma , the number of patients requiring more than one drug might be as high as 80% when the disease is more severe.3 the introduction of adjunctive therapies to a treatment regimen multiplies the negative influences on adherence ( ie , complexity of regimen , likelihood of adverse events , increased preservative load).411 initial therapy for poag and ocular hypertension is typically with a prostaglandin analog in the us .
outside the us , a beta - blocker is still frequently used as first - line therapy due to cost.12 when a prostaglandin analog is insufficient to control pressure , there are many types of adjunctive therapies to add , including selective and nonselective beta - blockers , alpha - agonists , and carbonic anhydrase inhibitors ( cais ) , as well as lesser - used therapies , such as miotics . there are also fixed combinations available that include a nonselective beta - blocker when more than one adjunctive therapy is needed to control iop .
a fixed combination of an alpha - agonist and cai is also now available for patients with a contraindication to a nonselective beta - blocker .
the use of a fixed - combination drug provides the opportunity to maximize pressure reduction by combining two complementary mechanisms of action in one bottle while minimizing the complexity of the treatment regimen .
there is published evidence that multiple drops can be challenging to administer without assistance and there is also the increased risk of contamination from patients inadvertently touching multiple bottles to the eye.1315 additionally , as topical medications are applied frequently and over a long period of time , preservative toxicity to the ocular surface becomes an important factor for a chronic disease such as glaucoma.1618 previous studies suggest that the use of fixed - combination products for control of iop has increased significantly over the past decade.79 this current study adds to this body of evidence by looking at more recent trends in glaucoma prescription use and , in particular , at the use of fixed - combination products in the treatment regimen .
the patients included in this retrospective cohort analysis were receiving medical and prescription benefits and were included in the 20072012 marketscan commercial claims and encounters and medicare supplemental databases .
the commercial claims and encounters database covers more than 300 million lives and includes 12 health plans and approximately 100 employers and includes both employees and dependents ( personal communication february 2013 ) .
the medicare supplemental and coordination of benefits database covers more than 2.5 million lives and includes patients 65 years and older with employer - paid or medicare part c coverage . only services covered 100% by medicare part a or b are excluded .
all data were de - identified in accordance with protected health information standards under the health information portability and accountability act so that no individually identifiable information was included in the study database . therefore , review by an institutional review board was not required .
the study cohort included patients who first initiated therapy with one of three ophthalmic prostaglandin analogs ( bimatoprost , latanoprost , or benzalkonium chloride ( bak)-free travoprost ) between april 1 , 2007 and april 30 , 2011 . to qualify , patients had to have 4 months of prior claims data in which there were no glaucoma therapy claims of any class and no claims for poag ( international classification of diseases , ninth revision , clinical modification [ icd-9-cm ] code 365.11).19 the index date was defined as the first date on which a prostaglandin analog was filled .
glaucoma therapy claims were defined unique product identifiers for human drugs required as part of the food and drug administration s listing process .
patients with two prostaglandin scripts , whether the same or different medications , on the index date were excluded , as it is unclear whether these were errors or drug trials .
the study population was further defined by requiring patients to have at least 24 months of use of prostaglandin analogs following the index date ( initial prostaglandin fill ) .
this was operationalized as having at least one prescription for an ophthalmic prostaglandin analog during months 2024 of the follow - up period ; this could be the same medication as at the index date or a different prostaglandin .
patients were also required to be enrolled for 12 months following the first prescription for an adjunctive therapy . in some cases , where patients began adjunctive therapy more than 12 months after the index date ,
this extended beyond the original 24 months of continuous enrollment required ; these patients were required to have additional follow - up beyond the 24 months .
patients with two adjunctive therapy prescriptions on their first date of adjunctive therapy were also excluded , as it was unclear how to classify these patients .
patients who did not meet these requirements ( sufficient prior claims data , repeat use of a prostaglandin , use of one or more adjunctive therapies , sufficient follow - up after initiating adjunctive therapy ) were excluded from the study database .
adjunctive medications were described by type ( fixed combinations , beta - blockers , alpha - agonists , cais , plus other ) .
participants were characterized in terms of available demographic characteristics ( age and sex ) . given previous evidence of patterns of discontinuation with nonselective beta - blockers,20 patients were categorized by whether their initial adjunctive therapy was a nonselective beta - blocker ( as part of a fixed combination or as a single agent ) or another treatment ( alpha - agonist , cai , or other ) .
further , patients were classified based on whether they exhibited short - term use of the initial adjunctive therapy , defined as one or two prescriptions filled versus three or more .
the adjunctive therapies , if any , following discontinuation of the first adjunctive agent were identified .
mean number of days to initiation of adjunctive therapy was calculated for each cohort ; the proportion of patients with an initial adjunctive therapy in prespecified time periods was also calculated .
the annual rate of surgical procedures for glaucoma ( identified by current procedural terminology ( cpt ) codes 68566 , 66170 , 66172 , 66180 , 66185 , 66625 , 66630 , 66710 , 66711 , 66761 , and 66762 ) was also calculated .
statistical comparisons were conducted using stata software ( v 12.1 ; statacorp lp , college station , tx , usa ) .
a review of the literature79 demonstrates a trend toward increased use of fixed - combination therapies as the first - line adjunctive therapy over time , with a corresponding decrease in the use of most single - agent drugs .
these previously published studies used the same inclusion criteria and identified patients with a prescription for a topical prostaglandin analog who had no glaucoma therapy claims in the 6 months prior and had at least 12 months of data available after the initial prostaglandin analog claim .
thus , these analyses are comparable to each other and the present study , as shown in figure 1 .
, there were 16,486 beneficiaries with at least one prostaglandin analog prescription who met all requirements for eligibility .
table 1 shows that 5,933 ( 36% ) had one or more pre - specified adjunctive therapies within 24 months from the start of the prostaglandin analog and had 12 months of follow - up available after the start of adjunctive therapy . for two - thirds of these patients ( n=3,927 ) ,
their initial adjunctive therapy was a nonselective beta - blocker , either alone ( n=2,277 ) or as part of a fixed combination ( n=1,650 ) .
the average age in all groups was just less than 70 years , and 51% of the patients were women . among patients who required adjunctive therapy ,
of these patients , 74% did not have additional prescriptions for adjunctive therapies during the observation year , ie , for 12 months following the start of their adjunctive therapy ( see table 2 ) .
this ranged from 69% of patients with one or two prescriptions for an alpha - agonist to 82% of patients starting with a fixed - combination beta - blocker .
two of the largest shifts observed were patients who had one or two prescriptions for a fixed - combination beta - blocker switching to a single - agent beta - blocker , and vice versa ( 48.1% and 62.7% , respectively ) . among patients who had three or more prescriptions of their initial adjunctive therapy ( 75% ) ,
the vast majority ( overall 93% , ranging from 89%94% of patients by adjunctive therapy ) continued long - term use of their initial therapy .
for the 6%11% who had a different adjunctive therapy for the fourth prescription , there was a wide range of agents used , with no clear pattern to suggest what was used next .
time to first adjunctive therapy was highest for patients starting adjunctive therapy with cais ( mean 190 days ) and lowest for those starting with an other medication ( mean 63 days ) .
these are further broken down into categories that represent both data - driven and clinically meaningful time points .
first , the proportions of patients who had a prescription for an adjunctive therapy on the same day ( day 0 ) as their index prostaglandin analog prescription are shown .
this varies from 25% for alpha - agonists to 44% for other medications . across all therapies
the rate of starting adjunctive therapies on days 130 is much lower , at 12% , and the total for the first month is a notable 42% .
the next category captures adjunctive therapies filled in months 26 after the index prostaglandin analog and includes 28% of adjunctive therapy start dates .
the remaining categories for initiating adjunctive therapy are 712 months and greater than 12 months , and ranged from 12%18% of adjunctive therapy start dates . the rate of surgical procedures for glaucoma , not shown here ,
was extremely low ( ie , less than 0.001 annually per person during the observation period ) .
thus , the rate of surgeries was not a significant factor in this study , nor were there enough observations to compare across adjunctive therapy groups .
in this analysis , treatment patterns were examined for patients based on their first adjunctive therapy initiated within 24 months after receiving an initial prescription for a prostaglandin analog for glaucoma .
as shown in figure 1 , fixed combinations are being increasingly used as the first - line adjunctive therapy , in nearly 30% of glaucoma cases .
this suggests a trend by providers toward earlier , more aggressive use of drug therapy to control pressure and prevent disease progression .
additionally , close to one - third of all adjunctive therapy prescriptions were filled on the same date as their first prostaglandin analog prescription .
same - day intervention of a fixed combination with a prostaglandin analog would be indicative of later - stage disease diagnosis as the patient s first diagnosis .
the decision to provide a fixed - combination therapy initially versus an unfixed combination has been explored , with a recent meta - analysis suggesting lower rates of hyperemia with fixed combinations compared to either unfixed combinations or prostaglandin analog monotherapy.21 visual - field loss may already be present and be the reason for the patient seeking diagnostic services and treatment from a provider .
. we did not compare rate of surgical procedures by time to initiating adjunctive therapy ; had the counts been higher , we would have considered such an analysis to identify whether starting adjunctive therapy earlier was indicative of more advanced disease . in table 2 , we show that 25% of the patients had only one or two fills of their initial adjunctive therapy and often discontinued therapy altogether ; only 26% of these patients continued therapy with a different agent . of note , in the group of patients with only one or two fills of their initial adjunctive prescription , 76% of those patients that started with a nonselective beta - blocker ( either single agent or fixed combination ) discontinued all adjunctive therapy .
use of a nonselective beta - blocker is contraindicated for patients with a diagnosis of cardiovascular and/or respiratory disease.2225 we found that 15% of the patients in the present study had a diagnosis for cardiovascular disease and 10% had a diagnosis for respiratory disease , but this could not be attributed directly to their discontinuation of adjunctive therapy . although discontinuation of nonselective beta - blockers did not appear to be linked to cardiovascular or respiratory care , patients could have described subclinical conditions to their ophthalmologists , which might have altered treatment patterns and possibly have led someone to switch from a fixed - combination or single - agent nonselective beta - blocker to adjunctive therapy without a nonselective beta - blocker . still , the high rate of discontinuation of the adjunctive therapy rather than a switch to a different therapy can not be explained given that these patients continued to use their primary prostaglandin analog therapy . as with any claims database analysis , there are certain limitations that must be acknowledged .
the use of a large claims database offers an important strength in terms of sample size but shortcomings remain .
we can not tell to what extent days to supply guidelines , which may differ across patients and are not documented in the database , may influence refill patterns .
also , the patient population in any given database may not match the general population of patients with the condition in question , although , in this analysis , the age and sex of the population reflect that of the general glaucoma population.26 other characteristics , such as race , educational status , central corneal thickness , or self - reported health status , among others , are unknown .
although glaucoma is typically bilateral , the american academy of ophthalmology s guidelines suggest that eyes may respond to different medications.27 therefore , we can not rule out the possibility that what we identify as adjunctive therapy might not , instead be a different treatment for the fellow eye .
the population of prescribers may not accurately reflect national patterns , which could affect generalizability .
most claims databases have little or no data on the characteristics of prescribers , but as the data were from a large managed care organization , it is likely that there is a wide distribution of prescribers and practices . by their nature , claims databases only provide information on people with some type of insurance coverage , and those with coverage may be more likely to seek out and adhere to treatment . finally , claims databases may contain coding biases or errors , although there is no reason to believe that these errors would be different across treatments ; in addition , the claims in this database were reviewed and adjudicated before the database was prepared for this analysis .
the study attempted to identify only patients who were new to therapy by requiring 4 months of glaucoma - free claims prior to the first prostaglandin analog prescription .
however , there is no way to account for product samples , which one study identified as being received by 20% of patients,6 and which could translate into patients who were already taking prostaglandin analogs before our study identified them or continuing on adjunctive therapies while appearing not to have refilled them . however , since we also required that patients had no glaucoma diagnosis in the four months prior to the index date , the likelihood of them having received glaucoma therapies prior to their index date is low .
also , based on this study methodology , patients could have had poor adherence but still have been included ; patients in the cohort analysis were required to have a minimum of two prostaglandin analog prescriptions filled during the 24-month follow - up period , but no attempt was made to assess medication possession ratio .
interestingly , research suggests that patients who use both an adjunctive therapy and a prostaglandin analog may be more compliant than those without adjunctive therapy , although compliance at 12 months was still only about 60% in the relevant study.28 however , other studies report that dosing errors are more common with adjunctive therapy29 and that time between refills increases when adjunctive therapy is initiated.30 this leaves the question as to why so many patients with glaucoma maintain prostaglandin use but discontinue adjunctive therapies when there is no obvious evidence of adverse events or surgical intervention contributing to the answer .
many studies3137 have evaluated compliance with glaucoma medications , which consistently report , much like in other therapeutic areas , that compliance decreases as regimens become more complicated .
patients may decide that their adjunctive therapies are not important enough to use regularly and physicians may not realize that patients are not using them as prescribed .
future studies that include analysis of a full electronic medical record so that physician notes can be reviewed may answer some of these questions .
this analysis of adjunctive therapy use patterns in poag patients shows that these drugs are being prescribed early in the timeline of the patient s treatment . in light of trends across multiple studies , this suggests a prescribing trend towards earlier , more aggressive drug therapy for poag .
related topics , such as the high rate of discontinuation from adjunctive therapies , could be explored through further analysis given additional robust data . | purposeto analyze patterns of use of adjunctive therapies among new initiators of topical prostaglandin analogs ( pgas ) in a managed care population.methodsthe study cohort included patients in a claims database who initiated pga therapy between june 2007 and april 2011 .
patients who had one or more adjunctive therapy prescriptions during 24 months of follow - up were included .
patterns of adjunctive therapy use were identified and compared between patients who had one or two fills of the initial adjunctive therapy and those who had three or more.resultsthere were 16,486 eligible beneficiaries . of these , 5,933 ( 36% ) had one or more adjunctive therapies within 24 months from the start of the pga , 82% of whom started adjunctive therapy within 12 months .
about 28% of patients started adjunctive therapy with a fixed - combination product ; 45% of these patients started within the first 30 days .
overall , a large number of patients ( 42% ) required adjunctive therapy within 30 days .
twenty - five percent of patients had only one or two prescriptions of their initial adjunctive therapy ; of these patients , 74% discontinued adjunctive therapy altogether.conclusionapproximately 30% of patients starting glaucoma therapy will require adjunctive therapy within 1 year , and many receive a fixed - combination product as initial adjunctive therapy shortly after starting glaucoma therapy .
this suggests a prescribing trend toward earlier , more aggressive drug therapy to control pressure and minimize disease progression .
we found that compliance with adjunctive therapy continues to be a problem for patients , which could be attributed to a number of treatment burden and economic factors . |
type 2 diabetes mellitus ( t2 dm ) is a hyperglycemic endocrine and metabolic disorder caused by insulin resistance and pancreatic -cell dysfunction .
it is a complicated , multifaceted disease induced by the combined actions of both genetic and environmental factors . with rapid changes in lifestyle , such as overnutrition and lack of exercise , and aging of the population , the prevalence of diabetes for all age groups worldwide estimated to be 2.8% in 2000
recent human epidemiological data show over 92 million diabetes patients in china , 90% of which suffer from t2 dm . as a polygenic hereditary disease ,
first , there is usually more than one gene involved in the onset and development of t2 dm with each of the genes exerting different functions and intrinsic interactions .
second , t2 dm susceptibility genes vary within the population and individuals . a group of people without diabetes might carry the disease susceptibility genes but with a tiny amount .
third , each susceptibility gene plays a role in various metabolic processes of t2 dm .
fourth , environmental factors also play an important role in the pathogenesis of t2 dm , which suggests that diabetes cases not only demonstrate erratic gene patterns but also show defects in gene expression and post - gene - expressive modification .
additional information is required to fully understand the etiology of t2 dm . in recent years
, there has been significant research on the relationship between protein kinase c isoforms ( protein kinase c epsilon zeta , prkcz , or pkc ) and diabetes .
these studies have shown that prkcz is a significant contributing factor to t2 dm as it is involved in the pathogenesis of t2 dm by participating in the impulse transmission of insulin , which is closely related to the function of the pancreas in excreting insulin .
the incidence of t2 dm involves many factors , such as heredity , environment , and diet .
thus , it is important to study the correlation between methylation of the prkcz gene promoter and the pathogenesis and treatment of t2 dm .
the t2md group : utilizing the 1999 who diagnostic standard , 152 patients , 63 males and 89 females , were diagnosed with t2 dm . the cases were excluded from other types of diabetes or endocrine disorders based on clinical examination and family history . the normal control ( nc )
group : the control group consisted of 120 healthy unrelated to one another individuals , 55 males and 65 females , with a fasting blood glucose ( fbg ) <
5.6 mmol / l and a postprandial blood glucose ( pbg ) < 7.7 mmol / l .
analysis by genome - wide methylation chip was conducted on the extracted dna ( completed by capital bio - corporation co. , ltd . ) .
the entire chromosomal gene sequences of the t2 dm and the nc groups were analyzed by medip ; the analysis included 22532 gene promoters , fragments from upstream 2.44 kb to downstream 610 bp , and methylation detection of 27728 cpg islands .
based on the chip analysis results , the prkcz gene , the susceptibility gene of t2 dm , was identified as the candidate gene as well as the object of study for this research .
the bisulfite sequencing pcr ( bsp ) primer was designed according to the cpg islands of the prkcz gene promoter using meth primer online software and was synthesized by shanghai sangon biological technology services co. ltd .
a 204-bp target fragment was amplified in 35 pcr cycles and sequenced by shanghai invitrogen biotechnology co. ltd . primer sequence : forward primer ,
5-tttttgtttaggttggagtgtagtg-3 reverse primer , 5-ccacttaaaatcaaaaatttaaaacc-3. forward primer , 5-tttttgtttaggttggagtgtagtg-3 reverse primer , 5-ccacttaaaatcaaaaatttaaaacc-3. the serum from the t2 dm and nc groups was collected .
serum of t2 dm and normal control were collected , and the serum proteins with sds page electrophoresis were separated ; electrophoresis result was shifted to nitrocellulose membrane ( nc ) ; nc membrane was soaked the first anti-(1 : 500 ) of rabbit anti - human prkcz antibody which was directly diluted with 5% nonfat dry milk , shaked in room temperature 4 hours or 4c slow foster overnight , and washed membrane three times with tbst . added hrp secondary antibody ( l : 1000 ) , slowly shaked at room temperature for 2 hours , washed the membrane with tbst four times , each time 8 min .
the relevant hypermethylated , disease - causing gene of t2 dm was determined using medip .
the hypermethylated gene was found to be located on chromosome 1:2036289 - 2036725 . this gene had a log ratio of 0.215 and a peak score of 2.21 ;
log - ratio is the value of the probe and peak score refers to the significance of methylation ( figure 1 ) .
the prkcz gene promoter is situated at this same site ; therefore , the prkcz gene promoter was hypothesized to be the hypermethylated gene in t2 dm patients .
in contrast , the prkcz gene promoter showed no obvious methylation in the nc group .
a cpg island - intensive area of 204 bp , a gc content > 50% , and an obs / exp value > 0.6 were found , and this fragment was chosen as the target fragment of bsp .
target fragments of the prkcz gene promoter from 272 subjects were amplified by bsp to study the promoter 's methylation status .
the working principle of bsp is that sodium bisulfite can effectively transform cytosine ( c ) into uracil ( u ) in a single strand of dna .
after pcr amplification , uracil ( u ) in the template is further transformed into thymine ( t ) , while methyl cytosine ( c ) is not affected by the sodium bisulfite and exists in the unchanged form of deoxidized cytosine ( c ) .
when the differences have been amplified by bsp , target fragments can then be obtained . finally , the pcr products are subjected to sequencing and sequence comparisons after modification with sodium hydrogen sulfite , and the methylated cpg sites can be determined .
the bsp products from both groups were sent to shanghai yingjun corporation to be sequenced .
the data from the two groups were then analyzed to compare the primary gene sequence with the sequence generated after modification by sodium bisulfite .
the target fragment of the prkcz gene promoter was found to be 204 bp in a length and contain 9 cpg sites ( figure 2 ) .
when the detected base sequence of the methylation cpg site remained in the state of c , the site was methylated .
after comparing the differences between the base sequences , the degree of methylation could be calculated by c / cpg .
the comparison between the base sequences in the t2 dm and nc groups showed that seven cpg sites were methylated in the t2 dm group ( 7/9 100% = 77.7% ) .
cpg sites 2 , 3 , 6 , and 7 showed a high probability of methylation in t2 dm patients , whereas only one cpg site ( cpg site 4 ) was methylated in the nc patients ( 1/9 100% = 11.1% ) ( table 1 ) .
the protein expression levels of prkcz in the serum of the t2 dm and nc groups were analyzed by western blotting .
the expression level of prkcz in t2 dm patients decreased significantly when compared with the level in the nc group ( p < 0.05 ) , suggesting that the prkcz gene plays a major role in the initiation of t2 dm .
it plays an essential role in the maintenance of chromosome structure , x chromosome inactivation , and the expression of genomic imprinting and tumor disease .
dna methylation occurs when a dna methytransferase ( dnmit ) catalyzes the conversion of cytosine into 5-methyl cytosine with s - adenosylmethionine acting as a methyl donor [ 7 , 8 ] .
the modification occurs mainly at the cytosine residue in the two - nucleotide cpg islands .
some research has already shown that dna methylation is one of the pathogenic factors of t2 dm , and it is assumed that dna methylation plays a role in the initiation and progression of t2 dm .
prkcz is also an important regulatory molecule that affects the signaling pathway of insulin through epigenetic changes . in t2
dm patients , there is a disruption of the glucose transport stimulated by insulin , which regulates the transport of blood glucose through interaction with the insulin substrate receptor protein ( isr-1/2 ) , and prkcz participates in the occurrence and development of t2 dm through insulin signaling pathway mechanisms .
recent studies have identified prkcz as a susceptibility gene of t2 dm using human genome scanning and fine localization .
the hypermethylated genes of t2 dm patients were determined in this study through high - flux screening of the methylated chip .
after screening and analysis , prkcz was chosen as the target gene for the study . there was no indication of prkcz methylation in the normal control group .
our findings demonstrate that methylation can be observed in peripheral blood leukocyte dna from both the t2 dm and normal control groups but that the prevalence of methylation of the prkcz promoter in peripheral blood leukocytes is significantly higher in the t2 dm group ( 77% ) than in the normal control group ( 7% ) ( = 36.42 , p < 0.01 ) .
the fact that methylation has also been detected in the normal control group might indicate that gene methylation not only exists in the development of t2 dm but is also an early event of t2 dm .
based on previous studies , it was generally hypothesized that the hypermethylation of dna was correlated with gene silencing , whereas low methylation or demethylation was generally related to gene activation .
currently , a collection of research [ 11 , 12 ] indicates that the variation in epigenetics plays a vital role in the initiation and progression of t2 dm . research by fujiki et al
. revealed that high methylation of peroxisome proliferator - activated receptor gamma ( ppar- ) inhibited the gene expression of t2 dm , which was regulated by the methylation of its promoter .
research by ling et al . reported the involvement of methylated peroxisome proliferator activated receptor gamma , coactivator 1 , alpha ( ppargcia ) promoter in the development of t2 dm . the research showed that the methylation of ppargcia promoter in patients with t2 dm was twice as much as that in the normal group with the mrna expression of reduced by 39% and the secretion of islet declined by 34% , which contributed to the reduction of the gene expression , functional disorder of islet and the declined secretion of islet .
the methylation of ppargcia was closely correlated with t2 dm . the expression of ppargcia displayed a positive correlation with the secretion of human insulin stimulated by glucose .
the above - mentioned studies demonstrate how epigenetic mechanisms might regulate gene expression , such as insulin secretion in human beings .
moreover , the research suggests that hypermethylation of the glucose transporter protein 2 ( glut2 ) promoter suppresses its gene expression and thus leads to the reduced consumption of glucose .
expression of the insulin gene is closely related to the level of methylation at its promoter .
these studies indicate that dna methylation correlates with gene silencing and highly consistent with our study in prkcz gene . in our study
, the prkcz gene promoter in t2 dm patients was hypermethylated while prkcz protein expression level in the serum was decreased , suggesting a negative correlation between prkcz gene expression and methylation level of the cpg islands .
hypermethylation of the prkcz genetic promoter may lead to the reduction of prkcz gene expression , which in turn induces the incidence of t2 dm via insulin signaling pathways .
first , methylation leads to structural changes in the genome , such as changes in repetitive sequences and thus suppresses the expression of certain genes .
second , methylation may affect chromosomal structure by shrinking the nucleosome and denying access to the transcription factor , thus leading to instability of the chromosomal structure .
sequencing results demonstrated that the methylation frequency varied by site ; the methylation frequencies for the 9 sites were different .
the results suggest that the methylation of these sites is probably related to the incidence of t2 dm , especially as the frequency of methylation at cpg sites 2 , 3 , 6 , and 7 is equal to or greater than 65% .
the findings suggest that the nearby sites might play a role in the regulation of prkcz gene expression .
the study indicates that methylation can serve as a potential diagnostic index of t2 dm .
as a certain positive rate also occurs in normal tissues , the index could be used as an accessory examination .
higher specificity genes might include some non - detected genes or other genes related to t2 dm .
therefore , analysis of these genes could be conducted together with tests of the biopsy samples and peripheral blood of patients , and the occurrence of methylation could be a useful omnidirectional reference for the early diagnosis , prognosis , and clinical therapy of t2 dm .
it is of great significance in theory and in practice for the primary prevention of t2 dm and the screening of a high - risk population . | objectives . to study the correlation between the methylation of protein kinase c epsilon zeta ( prkcz ) gene promoters and type 2 diabetes mellitus ( t2 dm ) . methods .
the case - control method was implemented in 272 unrelated to one another cases in shiyan people 's hospital . of those ,
152 were diagnosed as t2 dm cases , and the other 120 cases were healthy individuals visiting the hospital for a physical examination .
the subjects were first divided into two groups : the t2 dm group and the normal control ( nc ) group .
next , methylated dna immunoprecipitation chip ( medip - chip ) was used for detection .
bisulfite sequencing pcr ( bsp ) and gene sequencing were then performed to detect and analyze the correlation between prkcz gene promoter methylation and t2 dm .
finally , western blotting was applied to determine the serum level of prkcz .
the data were then analyzed with the statistics analyzing software spss 17.0 .
results .
in contrast with cases in nc , t2 dm patients showed a high level of methylation , with 7 of 9 cpg sites were shown to be methylated , whereas , in the control group , only one cpg site was found to be methylated .
the methylated cpg sites for the two groups showed marked differences ( p < 0.01 ) .
additionally , the level of prkcz was decreased in t2 dm subjects , and the difference between the two groups was statistically significant ( p < 0.05 ) .
discussion .
this study suggests that the prkcz gene is the hypermethylated gene of t2 dm and the hypermethylation prkcz gene may be involved in the pathogenesis of t2 dm . |
the us department of defense ( dod ) invests considerable resources in global efforts to detect , analyze and prevent the spread of influenza and other respiratory infections within hostcountry and dod beneficiary populations .
physical crowding , rapid mass movement , physical stress and immunological navet render military populations especially susceptible to outbreaks of respiratory illness .
,
,
,
,
,
,
this is especially true of basic recruit and trainee groups in whom rates of acute respiratory infections have been traditionally higher than in older , seasoned troops .
simultaneously , the dod seeks to limit the potential for spreading influenza , given the role of militaries in 1918 and other notable pandemics .
the dod global emerging infections surveillance and response system ( dodgeis ) , a division of the armed forces health surveillance center ( afhsc ) since early 2008 , centralized dod influenza and other respiratory disease surveillance efforts in 1998 and subsequently expanded worldwide surveillance and response initiatives starting in 2006 .
,
,
the goal of the dod influenza surveillance system is to identify and characterize antigenically diverse strains that threaten military beneficiary populations and global public health , and to work in collaboration with the us centers for disease control and prevention ( cdc ) , the food and drug administration ( fda ) , the world health organization ( who ) , and other relevant organizations to develop vaccines and other effective responses .
the system is built around a network of hub and satellite laboratories , with many joint ventures with host countries . in january 2005 , the us congress passed h.r .
1815 , sec . 748 : pandemic avian flu preparedness , providing dod the opportunity to expand and strengthen its system .
the role of afhsc / geis was further delineated in national and dod influenza strategy documents .
,
,
with the third year of expanded operations concluded ( 20062008 ) , and with the onset of the first pandemic of the 21st century due to a novel ( h1n1 ) 2009 virus , this study endeavors to supplement previously published system description and achievements in 19982005 ,
and outline subsequent added system value , summarizes its expansion and growth , and outlines areas for further development .
this study will not only focus on laboratorybased surveillance , the backbone of afhsc / geis influenza surveillance efforts , but also highlight complementary training and preparedness initiatives .
all dod surveillance sites track influenzalike illness ( ili ) or febrile respiratory illness ( fri ) and adhere to a standard case definition for enrolling participants and obtaining samples : oral temperature 38c and a cough , sore throat or difficulty in breathing for 72 h. because many participants are seen in a clinical setting , the system is multilayered , working to provide accurate and timely results to stakeholders while rapidly identifying the epidemiologically relevant characteristics of the virus and feeding this information , and sometimes the original specimen or isolate , into the who s global influenza surveillance network ( gisn ) via the us cdc or other who collaborating centers .
the system can be roughly divided into hostcountry population surveillance and global dod beneficiary population the armed forces and their families surveillance .
hostcountry surveillance is coordinated by the dod s five overseas medical research laboratories ( table 1 ) as well as by the us army public health command ( provisional ) [ usaphc ( prov ) ] and its satellite activities in san antonio , texas , public health regionsouth ( phrsouth ) , in landstuhl , germany ( phreurope ) , and in camp zama , japan ( phrjapan ) .
each laboratory coordinates surveillance , and complementary training and infrastructure enhancement , in a cluster of regional countries .
efforts in each country are governed by bilateral agreements with a hostgovernment agency , often the ministry of health or ministry of defense .
these partnerships focus on enhancing the domestic hostcountry capacity to conduct national influenza surveillance and contribute unique respiratory samples to the global system .
department of defense overseas medical research laboratories of the involved dod overseas laboratories , the us army medical research unit kenya ( usamruk , in nairobi ) , the armed forces research institute of the medical sciences ( afrims , in bangkok , thailand ) and usaphc ( prov ) satellite activities all utilize the us air force school of aerospace medicine ( usafsam ) , in brooks city base , texas , as a reference laboratory , with samples of interest joining the pool from dod beneficiary populations .
in contrast , the us naval medical research center detachment ( nmrcd , in lima , peru ) , the us naval medical research unit no . 2 ( namru2 , in jakarta , indonesia ) and the us naval medical research unit no .
3 ( namru3 , in cairo , egypt , a who h5 regional reference laboratory for influenza ) interact directly with the cdc and who .
all laboratories and activities provide the us cdc , the who and genbank , with isolates or actual specimens as well as necessary sequencing information upon request .
following initial characterization , a subset of samples or influenza isolates is sent on to the cdc at its request for further characterization and antigenic analysis , and for possible inclusion in an annual panel of global reference viruses .
surveillance within dod beneficiary populations is coordinated through usafsam and the department of respiratory disease research at the us naval health research center ( nhrc ) in san diego , california .
samples , accompanied by an epidemiologic questionnaire and the results of an influenza rapid test when available , are tested for a battery of likely respiratory pathogens ( including influenza , parainfluenza , adenovirus , respiratory syncitial virus , rhinovirus and human metapneumovirus ) .
in addition to samples from the overseas laboratories , usafsam also receives routine samples from a network of sentinel sites at dod healthcare facilities and tracks the active duty and dependent population outpatient visits through weekly review of 11 ilirelated international classification of diseases9 codes in the military s standard ambulatory data record system . moreover , any us air force medical facility experiencing elevated ili rates ( > 2 standard deviations of expected ) is engaged and encouraged to submit samples as part of the surveillance system for the duration of this increased activity .
nhrc conducts populationbased fri surveillance among trainees at the eight largest domestic recruit training facilities for the four us armed services and the coast guard .
recruits constitute a highrisk population , combining immunological navet , high degree of physical and mental exertion , and crowding , and often receive their first influenza vaccine at the commencement of training .
,
,
,
surveillance is also carried out on at least 20 us navy ships from three fleets based in norfolk , va , san diego , ca , and yokosuka , japan .
deployments often expose sailors to farreaching influenza and other respiratory viruses across the world , especially at portsofcall .
afhsc / geis also supports ili surveillance at six civilian clinics straddling the californiamexico border as part of the border infectious diseases surveillance project , a joint nhrc and cdc engagement .
a specimen from the second recognized us case of the novel ( h1n1 ) 2009 pandemic influenza virus was obtained in this surveillance study .
,
in addition to the us mexico bordermonitoring effort , the afhsc / geis also supports three dod research laboratories in monitoring influenza among us foreign service personnel and their dependents at over 80 us embassies worldwide .
activeduty us service members , who are highly immunized and whose dependents are welldocumented , also provide a valuable population for studies of annual influenza vaccine effectiveness ( ve ) .
nhrc conducts populationbased ve studies at its eight recruit training fri surveillance locations
,
and usafsam derives its ve estimates based on a fieldexpedient method involving a cohort from the immediate family members of activeduty personnel and influenzapositive index cases in the us air force .
additionally , populationbased , active duty component , nonrecruit military service members are routinely included in periodic assessments conducted by afhsc epidemiology staff looking at vaccinespecific ve estimates to better inform military vaccination policy .
,
annual results from studies of global strain diversity and subtypespecific ve are presented to the fda s vaccine and related biologic products advisory committee for influenza vaccine strain selection and also assist the dod in evaluating the effectiveness of its annual influenza vaccination efforts .
the expansion focused on enhancing pandemic preparedness , both within the dod and globally via support of hostcountry detection and reporting capabilities required by the revised international health regulations 2005 ( ihr 2005 ) .
the enhancement strategy identified a set of priorities , including : ( i ) expanding the geographic breadth and diversity of ili and fri surveillance ; ( ii ) increasing the number of ili and fri samples ; ( iii ) enhancing the diagnostic capabilities of dod laboratories , with a focus on highthroughput h5 screening and increased biosecurity ; ( iv ) enhancing the surveillance and laboratory capabilities of hostcountry collaborators , through training and infrastructure enhancement ; ( v ) investing in novel surveillance and diagnostic techniques and studies ; and ( vi ) enhancing the preparedness of dod combatant and regional medical commands through trainings and exercises . between 2005 and 2008 ,
the network tripled the number of countries routinely submitting specimens [ table 2 ] .
this included an expansion in south america from 2 countries to 10 , as well as significant expansions in africa , the middle east and asia .
many of these represent the only sites where influenza isolates were submitted to the gisn from these countries , and have significantly improved hostcountry compliance with the revised reporting requirements of the ihr 2005 .
selected indicators of department of defense influenza surveillance program growth , all sites , 20052008 ili , influenzalike illness .
* dod fiscal year : october 1 through september 30 . * * by pcr test , culture or both .
* * * influenza isolates or original samples requested by the who collaborating centre at the cdc , atlanta , ga , usa , following initial characterization .
the number of ili specimens tested in the laboratory for influenza also more than doubled during the 20052008 period in question .
this growth reflects expansion in the number of countries , the number of sites within each country and the capacity of the principle partner laboratories .
in addition , further enhancements in the year 2009 have resulted in influenza surveillance being implemented at 491 sites in 75 countries ( figure 1 ) .
the actual number of isolates submitted to the cdc declined slightly during the period in question . however ,
this likely represents improved efficiency , as the characterization capabilities at partner laboratories have grown , and most partners have the capability to submit full or partial hemagglutinin sequence information to cdc along with specimen typing and subtyping information .
this enables cdc to request a smaller , better targeted subset of isolates and original samples .
additionally , challenges by the indonesian government to the who s practice of influenza virus sharing hindered work within indonesia after january 2007 .
department of defense global emerging infections surveillance and response system global influenza surveillance presence worldwide , as of june 2009 .
because of the geographically unique areas represented by the dod surveillance system , the isolates and original specimens that it submits are often valuable in assisting the fda and the who to construct their recommendations for influenza vaccine composition .
table 3 describes influenza virus strains identified by the dod network , which have been included as seed strains in , or have directly influenced the composition of , several northern and southern hemisphere influenza vaccines in the past decade . of note ,
three wildtype isolates of the novel ( h1n1 ) 2009 influenza viruses isolated by nhrc and usafsam investigators are currently in use as vaccine strains in support of largescale production of h1n1based pandemic vaccines ( strains a / california/04/2009 , a / california/07/2009 and a / texas/05/2009 ) .
,
,
recent significant department of defense influenza isolate contributions to seasonal and pandemic influenza vaccine constitution afhsc / geis has also invested heavily in increasing the biosecurity and diagnostic capabilities of network laboratories . as more regional network laboratories are upgraded to biosafety level 3 ( bsl3 ) status , potential novel influenza strains can be diagnosed locally in a more timely fashion than under the previous , highly centralized model , further supporting ihr 2005 reporting compliance . since 2006 , afhsc / geis has funded the upgrade of six network laboratories to bsl3 status , to bring the network total to nine .
three upgrades are complete , and the remaining three are ontrack to be operational by the conclusion of 2010 .
additionally , afhsc / geis has supported the construction or renovation of bsl2 laboratories in more than 13 countries . at these laboratories ,
afhsc / geis has funded the expanded use of pcrbased screening platforms ( including the fdaapproved human influenza virus realtime rtpcr detection and characterization panel developed by the cdc ) in order to identify highly pathogenic strains prior to growing them in culture . as a consequence
, all laboratories have increased their specimen testing capacity in the event they are forced to operate 24/7 during a pandemic .
the afhsc / geis influenza surveillance system has also been at the vanguard of highly pathogenic avian influenza h5n1 diagnostic support in resourcelimited settings , including the laboratory diagnosis of 184 cases of influenza a/(h5n1 ) in six countries . in 2008 ,
the afhsc / geis network was involved in the diagnosis of eight human h5n1 cases , which represents 18% of the global total for the calendar year , and as of middecember 2009 , 38 cases ( 37 in egypt , 1 in cambodia ) out of 51 ( 75% ) ( ref .
furthermore , afhsc / geis projects in hostcountries have funded laboratory equipment , supplies and training to increase the surveillance and diagnostic capabilities of these collaborative endeavors .
all contributing laboratories and clinical surveillance sites are provided with the equipment needed to obtain , store and ship quality respiratory specimens .
training programs have focused on laboratory diagnostic and isolation techniques , outbreak responses , and institution review board and human use protocols .
partner organizations are carrying out community and householdbased cohort studies to examine the transmission of influenza from birds , pigs and horses to humans in highexposure settings in southeast asia ( thailand and cambodia ) , central asia ( mongolia ) , west africa ( nigeria ) and eastern europe ( romania ) . in south
america , afhsc / geis has also supported the expansion of alerta , a realtime electronic disease reporting system in four countries that is optimized for resourcelimited settings .
,
afhsc / geis has established the capability through partners to perform routine serologic studies of influenza exposure and seroconversion utilizing the dod s serum repository the largest in the world .
afhsc / geis is also working to reduce the dod s reliance on influenza rapid tests in austere settings through a joint venture with the cdc and fda to add an influenza a / h5 and novel a / h1specific realtime pcr assay to a ruggedized fielddeployable jbaids ( joint biological agent identification and diagnostic system ) package already in use at over 300 us military clinics and hospitals worldwide .
furthermore , future expansion and inclusion is being sought to add the cdc influenza pana , panb , a / h1 , a / h3 and a / h7 assays .
afhsc / geis has additionally sponsored regional training seminars for dod pandemic planners and public health professionals around the world to accelerate the implementation of dodwide and international pandemic preparedness efforts . since 2006 ,
afhsc / geis has supported over 46 training seminars , reaching over 2900 public health practitioners from 53 countries . in the fall of 2007 ,
the institute of medicine ( iom ) published a comprehensive review of the first year of activities funded by hr 1815 .
the full report suggested improving domestic and international coordination of surveillance efforts and improving the bidirectional communication with field surveillance sites . to that end
, afhsc / geis has established closer working relations with other domestic agencies , most notably the cdc , department of health and human services ( dhhs ) , and department of state through meetings that align missions and surveillance efforts .
the afhsc / geis program is also actively seeking to improve coordination with the who and other international agencies to enable its network to most effectively contribute to global influenza surveillance efforts .
the dod global influenza surveillance system strives to be a valuable asset to the dod and the global public health community .
its specimen catchment area includes regions noted for their regular contribution to global strain circulation , such as southeast asia and regions from which strain circulation information is limited , including south america , africa and the middle east .
since the system s initial expansion in 1998 , samples from the dod network have contributed significantly to the annual and pandemic vaccine composition , three times being selected as seed viruses .
the detection of the first four cases of a pandemic ( h1n1 ) 2009 influenza virus in the usa has led to an additional contribution in pandemic vaccine development .
,
,
,
,
as a contributor to the who s gisn , the dod system is unparalleled in scope .
a key feature of this surveillance system is that it is laboratorybased ( e.g. providing pathogenspecific laboratory testing and confirmatory data ) and encompasses a large network of military and civilian health facilities , research laboratories , and field locations that accrue specimens from nearly 500 participating sites in 75 countries around the world .
this extensive network is positioned to detect the emergence of significant mutations in the pandemic ( h1n1 ) 2009 influenza virus as they emerge . with the responsibility of conducting surveillance in many regions across the world ,
paramount among these is the issue regarding the ownership of viruses sent to the who at the request of the indonesian ministry of health and the development and sharing of vaccines from these viruses .
as a who partner in this emerging debate regarding domestic sovereignty of viruses ,
the dod is committed to a constructive resolution that balances domestic rights with global public health needs .
recent congressional supplemental funding has enabled a significant expansion in capability , geographic coverage and in the commencement of new initiatives .
the iom review
recognized the afhsc / geis program for contributing to the development of laboratory and communications infrastructure within partner countries as well as for building dod and hostcountry laboratory and human resource capacity that resulted in expanded information about avian influenza and acute respiratory diseases .
major new undertakings have included the expansion of hostcountry civilian and military laboratory diagnostic and training capacity , the propagation of multipathogen screening technologies , development of new , highthroughput , diagnostic detection platforms , and significant expansion into austere , lowresource settings previously underrepresented by global surveillance efforts .
the opinions and assertions contained herein are solely those of the authors and do not reflect the official policy or position of the us department of defense ( dod ) or of its subordinate services ( army , navy or air force ) medical authorities .
this study was supported by the us military s defense health program funding of the dod global emerging surveillance and response system ( dodgeis ) and the armed forces health surveillance center ( afhsc ) .
us naval health research center ( nhrc ) : anthony hawksworth , cdr dennis faix , dr .
christopher meyers ; us air force shool of aerospace medicine ( usafsam ) : col william courtney , dr .
elizabeth macias , major thomas gibbons ; us naval medical research unit no . 3 ( namru3 ) : dr . moustafa mansour , capt kenneth earhart ; us naval medical research center detachment ( nmrcd ) : lcdr tadeusz kochel , ms .
gloria chauca , dr . alberto lagunatorres ; armed forces medical research institute of the medical sciences ( afrims ) : col rodney coldren , maj richard jarman ltc robert gibbons ; us army medical research unitkenya ( usamruk ) : dr .
2 ( namru2 ) : lcdr gary brice , cdr timothy burgess , cdr shannon putnam ; us naval and environmental preventive medicine unit no .
2 ( nepmu2 ) : cdr danny shiau , cdr eric kasowski , lcdr timothy styles : pacific air forces / us pacific command ( pacaf / pacom ) : major wesley palmer ; us army public health command , public health regioneurope ( phreurope ) : ltc john maza , lcdr michael cooper ; landstuhl regional medical center ( lrmc ) : maj thomas palys ; us army public health command , public health regionsouth ( phr ? south ) : ms . | please cite this paper as : jeremy sueker et al .
( 2010 ) influenza and respiratory disease surveillance : the us military s global laboratorybased network .
influenza and other respiratory viruses 4(3 ) , 155161.the us department of defense influenza surveillance system now spans nearly 500 sites in 75 countries , including active duty us military and dependent populations as well as hostcountry civilian and military personnel .
this system represents a major part of the us government s contributions to the world health organization s global influenza surveillance network and addresses presidential directive nstc7 to expand global surveillance , training , research and response to emerging infectious disease threats . since 2006 , the system has expanded significantly in response to rising pandemic influenza concerns . the expanded system has played a critical role in the detection and monitoring of ongoing h5n1 outbreaks worldwide as well as in the initial detection of , and response to , the current ( h1n1 ) 2009 influenza pandemic .
this article describes the system , details its contributions and the critical gaps that it is filling , and discusses future plans . |
the decrease in anti - oxidant mechanisms , together with excessive accumulation of reactive oxygen species ( ros ) , including superoxide radical anions , hydroxyl radicals , singlet oxygen , and hydrogen peroxide ( h2o2 ) , are causally linked to various health problems [ 1 , 2 ] . within healthy muscle cells , ros are generated both as by - products of metabolism and as critical effectors of signaling cascades . however , ros also have genotoxicological effects , causing damage to major cellular components , including proteins , lipids , and nucleic acids [ 4 , 5 ] .
excessive generation of ros in skeletal muscles can influence the contractile function of skeletal muscles by causing fatigue and increasing cell oxidative damages , which is implicated in the development of multiple diseases , including muscular dystrophy and sarcopenia [ 6 , 7 ] .
therefore , increasing the anti - oxidant capacity of skeletal muscles can play a role in preventing disease , improving muscle performance , and enhancing quality of life .
the fruiting body of ganoderma lucidum ( g. lucidum ; polyporaceae ) has been used as a traditional oriental medicine in tonics for promoting longevity and health for more than 2000 years in china , korea , japan and other asian countries [ 8 , 9 ] .
accumulating evidence indicates that this mushroom possesses diverse and potentially significant pharmacological effects , including anti - cancer , anti - inflammatory , anti - diabetic , and anti - bacterial effects , in addition to hepatoprotective , neuroprotective , and immunoenhancing activities [ 8 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 ] .
studies also suggest that g. lucidum possesses strong anti - oxidant properties , which protect cells against oxidative - induced damage through the induction of phase ii enzymes , such as heme oxygenase-1 ( ho-1 ) , quinone reductase , glutathione s - transferase ( gst ) , and glutathione reductase [ 20 - 25 ] .
g. lucidum was reported to protect macrophages against inflammatory stress via the activation of the nuclear factor erythroid 2-related factor 2 ( nrf2 ) , mediated by the expression of ho-1 . however , to date , the mechanisms underlying the inhibition of oxidative stress by g. lucidum have not been well characterized .
nrf2 , a basic leucine zipper transcription factor ubiquitously expressed in most tissues , is a master cellular sensor of oxidative stress and represents the primary response to changes in the cellular redox state [ 26 , 27 ] . under normal conditions ,
nrf2 is bound to kelch - like ech - associated protein 1 ( keap1 ) in the cytoplasm .
phase ii enzyme inducers can disrupt the nrf2/keap1 complex , resulting in the release of nrf2 and its subsequent translocation to the nucleus [ 28 , 29 ] . in the nucleus , nrf2 binds with and activates the anti - oxidant response element ( are ) , a cis - acting enhancer present in the promoter region of a large and distinct set of target genes , with the aim of restoring redox homeostasis [ 27 , 30 ] .
ho-1 was reported to be active in protecting cells exposed to oxidizing agents by catalyzing the oxidation of heme to biologically active products , including carbon monoxide , biliverdin , and ferrous iron .
the final products of heme catabolism exert antioxidant effects by neutralizing intracellular ros [ 32 , 33 ] . moreover , enhanced ho-1 expression , which is mainly regulated by the nrf2-are pathway , is associated with protection against stress , such as oxidative stress [ 26 , 34 , 35 ] .
recent studies reported that the stabilization or phosphorylation of the nrf2 protein increased the activation of the nrf2/ho-1 pathway .
several signaling molecules have been shown to participate in this process in response to a variety of phase ii gene inducers [ 36 , 37 ] . therefore , pharmacological activation of nrf2/ho-1 signaling is critical for the protection of cells exposed to oxidative stress .
the present study investigated the ability of an ethanol extract of g. lucidum ( egl ) to protect cells from h2o2-induced cell damage and to elucidate the mechanism underlying those protective effects by using a mouse myoblast c2c12 cell line .
egl was supplied by the department of acupuncture and moxibustion , dongeui university college of korean medicine ( busan , korea ) . for the preparation of egl , freezedried and milled g. lucidum fruiting bodies ( 200 g ) were extracted with 25% ethanol ( 4 l ) at room temperature for 10 hours by using a blender .
the extracts were filtered through a whatman no . 2 filter ( pore size : 0.22 m , whatman , maidstone , uk ) , concentrated to 500 ml under vacuum conditions and then stored at 20c .
the egl solution was directly diluted in culture medium to the desired concentration prior to use .
the c2c12 mouse myoblast cell line was obtained from the american type culture collection ( manassas , va , usa ) .
the cells were grown in dulbecco s modified eagle s medium ( gibcobrl , gaithersburg , md , usa ) and supplemented with 10% heat - inactivated fetal bovine serum ( gibcobrl ) and 100 g / ml of penicillin / streptomycin antibiotics in a humidified 5% co2 atmosphere at 37c . nrf2 small interfering ribonucleic acid ( sirna ) and control sirna were purchased from santa cruz biotechnology , inc .
lipofectamine rnaimax transfection reagent ( invitrogen , carlsbad , ca , usa ) was used according to the manufacturer s instructions to transfect the sirna into the cells . for transfection ,
the cells were seeded in 6-well culture plates and incubated with the control sirna or nrf2 sirna at 50 nm for 6 hours in serum - free opti - mem media ( invitrogen ) .
after incubation , the transfected cells were subjected to the treatment described in the fig . 6 .
for the cell viability assay , c2c12 cells were seeded in 6-well plates at a density of 1 10 cells per well .
after incubation for 24 hours , the cells were treated with egl at different concentrations in the presence or absence of h2o2 ( sigma - aldrich chemical co. , st .
louis , mo , usa ) , zinc protoporphyrin ix ( znpp ; sigma - aldrich chemical co. ) or n - acetyl - l - cysteine ( nac , sigma - aldrich chemical co. ) .
after incubation for 24 hours , the medium was discarded , and the cells were incubated with 0.5 mg / ml of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide ( mtt , sigma - aldrich chemical co. ) solution for 3 hours at 37c . the supernatant was discarded , and the formazan blue that formed in the cells was dissolved in dimethyl sulfoxide ( dmso , sigma - aldrich chemical co. ) .
the optical density was then measured at 540 nm by using an enzyme - linked immunosorbent assay ( elisa ) plate reader ( dynatech mr-7000 ; dynatech laboratories , chantilly , va , usa ) .
the measurement of the ros was performed using ros - sensitive 2,7-dichlorodihydrofluorescein diacetate ( dcf - da , molecular probes , eugene , or , usa ) reagent , a fluorescent dye that visualizes ros .
briefly , the cells were incubated with 10-m dcf - da for 30 minutes at room temperature in the dark .
spectrofluorimetry analysis using an elisa plate reader was performed to quantify the intracellular ros at excitation and emission wavelengths of 488 and 525 nm , respectively . to assess deoxyribonucleic acid ( dna ) damage ,
we mixed the cell suspension with 0.5% low - melting agarose ( lma ) at 37c , and we spread the mixture on a fully - frosted microscopic slide , which had been pre - coated with 1% normal - melting agarose . after the solidification of the agarose , the slide was covered with 0.5% lma and was subsequently immersed in a lysis solution [ 2.5-m sodium chloride ( nacl ) , 100-mm na - ethylenediaminetetraacetic acid ( edta ) , 10-mm tris , 1% triton x100 , and 10% dmso ( ph 10 ) ] for 1 hour at 4c .
the slides were placed in a gel electrophoresis apparatus containing 300-mm sodium hydroxide ( naoh ) and 10-mm na - edta ( ph 13 ) for 40 minutes to allow for the unwinding of the dna and for the expression of alkali - labile damage .
an electrical field was then applied ( 300 ma , 25 v ) for 20 minutes at 4c to draw the negatively - charged dna toward the anode .
after electrophoresis , the slides were washed three times for 5 minutes each time at 4c in a neutralizing buffer ( 0.4-m tris , ph 7.5 ) , followed by staining with 20 g / ml of propidium iodide ( sigma - aldrich chemical co. ) .
the slides were washed twice with phosphate buffer saline ( pbs ) , and images were then captured using a fluorescence microscope ( carl zeiss , oberkochen , germany ) .
the images were also analyzed using an image analysis system ( komet 5.5 , kinetic imaging , liverpool , uk ) to evaluate the degree of dna damage .
the tail length and moment were used as measures of the extent of the dna damage .
one hundred cells were randomly selected and measured ( two slides made for one sample , 50 randomly - selected cells per slide ) from one sample .
the values of the mean tail length per sample and the percentages of cells with different tail lengths ( i.e. , undamaged cells without a tail , cells with a tiny tail , cells with a dim tail , cells with a clear tail , and cells with only a tail ) were calculated . to prepare the whole - cell proteins , we collected and lysed cells with lysis buffer ( 25 mm of tris - cl ( ph 7.5 ) , 250 mm of nacl , 5 mm of edta , 1% nonidet p-40 , 0.1 mm of sodium orthovanadate , 2 g / ml of leupeptin , and 100 g/ ml of phenylmethylsulfonyl fluoride ) containing protease inhibitor cocktail tablets for 30 minutes at 4c . in a parallel experiment
, nuclear and cytosolic proteins were prepared using nuclear extraction reagents ( pierce biotechnology , rockford , il , usa ) according to the manufacturer s protocol .
the cell debris was discarded following centrifugation at 13,000 g for 15 minutes , and the supernatants were collected .
the protein content was determined using a biorad protein assay reagent ( biorad , hercules , ca , usa ) according to the manufacturer s instructions . for western blot analyses ,
equal amounts of protein extracts were subjected to electrophoresis on sodium dodecyl sulfate ( sds)-polyacrylamide gels and subsequently transferred onto nitrocellulose membranes ( schleicher & schuell bioscience , inc .
the membranes were blocked with 5% skimmed milk for 1 hour at room temperature and incubated overnight with primary anti - bodies ( cell signaling technology , inc . , boston , ma , usa ; santa cruz biotechnology , santa cruz , ca , usa ; abcam , inc . , cambridge , uk ) , followed by incubation for 1 hour with horseradish peroxidase - conjugated donkey anti - rabbit and sheep anti - mouse immunoglobulin ( amersham biosciences , arlington heights , il , usa ) .
the immunoreactive bands were revealed by using enhanced chemiluminescence ( ecl ) with a commercially - available ecl kit ( amersham biosciences ) according to the recommended procedure .
actin and poly [ adenosine diphosphate ( adp)- ribose ] polymerase ( parp ) were used as internal controls for total cellular and nuclear proteins , respectively .
data from at least three independent experiments were expressed as the mean standard deviation ( sd ) .
statistical comparisons between the different groups were performed using a one - way analysis of variance ( anova ) , followed by student s t - tests , after comparing each treated group to the negative control .
to evaluate the protective effect of egl on h2o2-induced cytotoxicity , we treated the c2c12 cells with various concentrations of egl for 24 hours , and the optimal dose ( i.e. , the dose that had the least effect on cell viability ) was selected by determining the percentage of mtt reduction .
1a , treatment of the cell cultures with 5 50 g / ml of egl for 24 hours had no effect on the cell viability .
however , 100 g / ml egl induced a partial reduction in the cell viability .
thus , 50 g / ml of egl was chosen as the highest optimal dose for studying the cytoprotective effect of egl against h2o2-induced cell damage . to determine the protective effects of egl against h2o2-induced cytotoxicity in the c2c12 cells , we pretreated the cells with egl for 1 hour and exposed them to h2o2 for an additional 24 hours .
the viability of the c2c12 cells when exposed to h2o2 at a concentration of 1 mm for 6 hours decreased significantly as compared with that of the control group , and the survival rate was approximately 58.70% that of the control .
however , when the c2c12 cells were pretreated with 25 and 50 g / ml of egl , the cell viability significantly increased as compared with that of the h2o2 group , and the survival rates were 71.20% and 81.70% that of the control , respectively ( fig .
to examine the inhibitory effect of egl on h2o2-induced ros production , we stimulated the c2c12 cells with 1-mm h2o2 for 30 minutes in the presence or absence of 50 g / ml of egl ; then , we determined the intracellular levels of ros . compared to the non - treated control cells , the c2c12 cells treated with 1-mm h2o2 for 30 minutes showed levels of intracellular ros that were markedly increased , as indicated by an increase in the dcf - liberated fluorescent signal ( fig .
1c ) . however , pretreatment with egl significantly reduced h2o2-induced ros production as compared with that of the control .
as a positive control , 10-mm nac , a specific ros scavenger , also markedly attenuated h2o2-induced generation of ros .
the results indicate that egl possesses scavenging activity , preventing the accumulation of ros generated by h2o2 in c2c12 myoblasts .
oxidative stress - induced dna damage produces lesions that lead to a loss of cell viability .
h2o2-mediated dna damage in the c2c12 cells was detected using an alkaline comet assay ( single - cell gel electrophoresis ) and a western blot analysis .
the comet assay revealed that the treatment with h2o2 alone significantly increased the number of dna breaks , enhancing the fluorescence intensity in the tails of the comet - like structures associated with an increase in the tail length and moment ( fig .
an immunoblot image revealed that the levels of phosphorylation of nuclear histone h2ax ( p-h2ax ) at serine 139 , a sensitive marker of dna double - strand break formation , were markedly increased in the h2o2-treated c2c12 cells ( fig .
in contrast , the expression of p-h2ax decreased significantly in the egl - pretreated cells , indicating that egl helped to protect against dna damage induced by oxidative stress .
as regulation by nrf2 signaling of the cellular anti - oxidant response has been well documented [ 27 , 30 ] , we next examined whether egl protected cells from oxidative stress by activating the nrf2 signaling pathway .
the immunoblotting results indicated that the egl treatment effectively induced the expression of the nrf2 protein in a concentration- and time - dependent manner in the c2c12 cells ( fig .
3 ) the results also showed that the egl treatment induced the expression of the ho-1 protein , an nrf2 target gene , in the c2c12 cells ( fig .
3 ) . however , the egl treatment had no effect on other anti - oxidant enzymes , such as nicotinamide adenine dinucleotide phosphate ( nadph)-quinone oxidoreductase 1 ( nqo-1 ) and thioredoxin reductase 1 ( trxr1 ) ( fig .
3 ) . to investigate the role of ho-1 induction in egl - mediated protective effects against oxidative stress in the c2c12 cells , we applied znpp , a selective inhibitor of ho-1 , in the present study .
4a , znpp significantly reversed the inhibition of ros generation by egl in the h2o2-stimulated c2c12 cells .
in addition , the results of the mtt assay showed that the addition of znpp significantly attenuated the protective effect of egl against h2o2-induced cytotoxicity ( fig .
4b ) , suggesting that the cytoprotective effect of egl was partly mediated by ho-1 induction .
as the phosphorylation of nrf2 at ser40 by several kinases is a critical process in its stabilization and nuclear translocation [ 30 , 36 , 37 ] , the phosphorylation of nrf2 in the egl - treated cells was examined to confirm whether nrf2 was induced by egl . as shown in fig . 5a and fig .
5b , the egl treatment caused concentration- and time - dependent increases in the levels of phosphorylated nrf2 expression . additionally , a western blot analysis was carried out using the nuclear and the cytosolic fractions of the c2c12 cells to determine whether egl promoted the nuclear translocation of nrf2 . as shown in fig . 5c and fig .
5d , the amounts of total and phosphorylated nrf2 proteins in the nucleus were markedly increased following exposure to egl , indicating that egl induced the translocation of nrf2 from the cytosol to the nucleus .
we next developed an nrf2 gene knockdown model by using sirna transfection to demonstrate the contribution of nrf2 signaling to the negative effects of egl on h2o2-induced cytotoxicity .
the results of a western blot analysis indicated that the silencing of nrf2 by using specific sirna greatly reduced the egl - induced expression of nrf2 compared with that of the untransfected control cells and the control sirna - transfected cells ( fig .
therefore , we investigated whether nrf2 sirna transfection blocked egl - induced up - regulation of ho-1 and found that nrf2 sirna attenuated these effects , providing evidence that nrf2 mediated egl - induced augmentation of ho-1 .
furthermore , nrf2 sirna significantly cancelled the protective effect of egl against the h2o2-induced reduction of cell viability ( fig .
although few studies have investigated how oxidative stress quantitatively affects the load - carrying capacity of muscle cells [ 6 , 7 ] , oxidative stress is known to accompany muscle dysfunction [ 3 , 7 ] .
ros belong to a class of endogenous signaling molecules , the functions of which depend on their subcellular localization , local concentration , and duration of production .
moderate levels of ros transiently oxidize cysteine sulphydryl , which contributes to the active sites of most proteins [ 4 , 5 ]
. however , when the accumulation of ros exceeds a certain threshold , ros have adverse effects on cellular functions [ 1 , 4 ] , leading to cellular dysfunction and cell death in skeletal muscles [ 6 , 7 ] .
the mitochondrial electron transport system is a major source of intracellular ros generation [ 3 - 5 ] , with mitochondria playing a pivotal role in the ros - mediated cell - death process .
h2o2 directly induces mitochondrial dysfunction , followed by a rapid efflux of intracellular ros , which increases the permeabilization and depolarization of the mitochondrial membrane [ 1 , 4 ] .
therefore , the discovery of a reagent that could reduce the levels of ros would be valuable in the treatment of muscle- related diseases .
this study , which is part of a research program to derive new anti - oxidant agents from medicinal mushrooms , used a c2c12 myoblast cell model to discover whether egl conferred protection against oxidative stress - induced cytotoxicity .
the results indicated that h2o2 treatment of c2c12 cells caused marked intracellular accumulations of ros and inhibited cell survival . however , pretreatment of the c2c12 cells with egl significantly attenuated the h2o2-induced generation of ros and inhibition of cell viability .
thus , we conjectured that egl might improve the mitochondrial function by eliminating the h2o2-induced overproduction of ros .
in addition , the present study showed that h2o2 treatment increased the dna tail moment and length on a comet assay and the expression of p-h2ax , both of which are widely - used markers for the detection of dna damage .
the egl treatment markedly reduced these increases , indicating that egl provided protection against h2o2-induced apoptosis by reducing dna damage caused by oxidative stress in c2c12 myoblasts .
recent studies have suggested that nrf2 plays an indispensable role in protecting a variety of tissues from a wide array of toxic insults , including oxidative stress [ 27 , 29 ] .
although the role of nrf2 signaling has not been previously characterized in skeletal muscles , coordinated regulation of nrf2 redox signaling is believed to preserve the redox state and protect the structure and the function of skeletal muscles [ 2 , 27 ] .
previous studies demonstrated increased nrf2 levels in active skeletal muscles and subsequent activation of its major target anti - oxidant enzymes , including ho-1 [ 1 , 2 ] .
they also showed that the loss of nrf2 was strongly coupled with dysregulation of anti - oxidant pathways and progression of muscle dysfunction [ 2 , 3 , 6 ] .
therefore , nrf2/ho-1 signaling may represent a potential therapeutic target in the management of oxidative stress - related diseases .
studies have proposed that the induction of phosphorylation plays a key role in the regulation of the transcriptional activity of nrf2 [ 36 , 37 ] .
a number of protein kinases have been implicated in the regulation of nrf2 activity , with upstream signals facilitating the translocation of nrf2 into the nucleus , whereupon it binds to are in promoter regions [ 2 - 30 ] . in the present study , we found that egl increased the expression of the nrf2 protein in c2c12 myoblasts in a concentration- and duration - dependent manner .
subsequently , we found that egl triggered the induction of ho-1 expression and led to nrf2 phosphorylation , along with concomitant translocation of nrf2 into the nuclei .
however , znpp - induced inhibition of the expression of ho-1 significantly weakened the inhibitory effects of egl on h2o2-induced inhibition of cell growth by blocking the generation of ros .
in addition , the knockdown of nrf2 by nrf2-targeted sirna completely abrogated egl - induced ho-1 expression .
this finding suggests that nrf2 is a critical upstream regulator of egl - mediated induction of ho-1 in c2c12 myoblasts .
furthermore , the knockdown of nrf2 halted the ability of egl to restore the growth of c2c12 cells inhibited by h2o2 .
these results suggest that the nrf2-dependent induction of ho-1 by egl may participate , at least partly , in the protection against oxidative stress in c2c12 myoblasts .
in summary , the results of this study clearly demonstrate that egl provided protection against h2o2-induced cytotoxicity and dna damage in c2c12 myoblasts through suppression of intracellular ros generation .
overall , the results imply that egl may activate nrf2 signaling and contribute to the induction of the phase ii anti - oxidant ho-1 in c2c12 cells , thereby contributing , at least partly , to a cellular defense mechanism against oxidative stress - induced genotoxic events .
these findings suggest that egl may be a potential anti - oxidant agent in c2c12 myoblasts .
egl , extract of ganoderma lucidum ; h2o2 , hydrogen peroxide ; dna , deoxyribonucleic acid ; sd , standard deviation .
the cells were ( a ) treated with various concentrations of egl for 24 hours or ( b ) pretreated with the indicated concentrations of egl for 1 hour and then incubated for 24 hours in the presence and absence of 1.0-mm h2o2 .
( c ) the cells were pretreated with 50 g / ml of egl or 5-mm nac for 1 hour and then stimulated for 30 minutes with or without 1.0-mm h2o2 .
the cells were incubated at 37c in the dark for 20 minutes with culture medium containing 10-m dcf - da to monitor ros production .
the results are the mean sd values obtained from three independent experiments ( p < 0.05 compared with the untreated control group ; p < 0.05 compared with the h2o2-treated group ) .
egl , extract of ganoderma lucidum ; h2o2 , hydrogen peroxide ; ros , reactive oxygen species ; mtt , 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide ; nac , n - acetyl - l - cysteine ; dcf - da , 2,7-dichlorodihydrofluorescein diacetate ; sd , standard deviation .
( a ) the cells were pretreated with egl for 1 hour and then incubated in the presence or absence of 1.0-mm h2o2 for 24 hours .
a comet assay was performed to detect cellular dna damage , and representative photographs of the comets were taken using a fluorescence microscope ( 200 original magnification ) .
( b ) cellular proteins and isolated cells grown under the same conditions as ( a ) were separated on sds - polyacrylamide gels and transferred to nitrocellulose membranes .
egl , extract of ganoderma lucidum ; h2o2 , hydrogen peroxide ; dna , deoxyribonucleic acid ; p-h2ax , phosphorylation of histone h2ax at serine 139 ; sds , sodium dodecyl sulfate .
the cells were incubated either ( a ) with various concentrations of egl for 6 hours or ( b ) with 50 g / ml of egl for the indicated periods .
egl , extract of ganoderma lucidum ; nrf2 , nuclear factor erythroid 2-related factor 2 ; ho-1 , heme oxygenase-1 ; nqo-1 , nicotinamide quinone oxidoreductase 1 ; trxr1 , thioredoxin reductase 1 ; sds , sodium dodecyl sulfate .
the cells were pretreated for 1 hour with 50 g / ml of egl and then treated for ( a ) 30 minutes or ( b ) 24 hours with or without 1.0-mm h2o2 in the absence or presence of 10-m znpp .
( a ) after incubation with 10-m jc-1 for 20 minutes , jc-1 fluorescence intensity was detected using a flow cytometer .
the results are the mean sd values obtained from three independent experiments ( p < 0.05 compared with the untreated group ; p < 0.05 compared with the h2o2-treated group ; p < 0.05 compared with the h2o2- and egl - treated groups ) .
ho-1 , heme oxygenase-1 ; egl , extract of ganoderma lucidum ; h2o2 , hydrogen peroxide ; ros , reactive oxygen species ; znpp , zinc protoporphyrin ix ; jc-1 , 5,5,6,6-tetrachloro-1,1,3,3-tetraethylbenzimidazolylcarbocyanine iodide ; mtt , 3-[4,5-dimethylthiazol- 2-yl]-2,5-diphenyltetrazolium bromide ; sd , standard deviation .
the cells were incubated ( a ) with various concentrations of egl for 6 hours or ( b - d ) with 50 g / ml of egl for the indicated periods .
total ( a and b ) , cytosolic ( c ) , or nuclear ( c ) proteins were separated on sds - polyacrylamide gels and then transferred onto nitrocellulose membranes .
the membranes were probed with anti - nrf2 and anti - p - nrf2 antibodies .
actin and parp were used as the internal controls of cytosolic and nuclear proteins , respectively .
egl , extract of ganoderma lucidum ; nrf2 , nuclear factor erythroid 2-related factor 2 ; sds , sodium dodecyl sulfate ; ecl , enhanced chemiluminescence ; parp , polymerase .
( a ) the cells were transfected with control ( con sirna , as a negative control for the rna interference ) and nrf2 sirna .
after 24 hours , the cells were treated for 6 hours with or without 50 g / ml of egl .
the proteins were separated on sds - polyacrylamide gels and then transferred onto nitrocellulose membranes .
( b ) the cells were transfected with control and nrf2 sirna . after 24 hours
, the cells were treated with 50 g / ml of egl for 24 hours or pretreated with 50 g / ml of egl for 1 hour .
they were then incubated in the presence or absence of 1.0-mm h2o2 for 24 hours .
the results are the mean sd values obtained from three independent experiments ( p < 0.05 compared with the untreated group ; p < 0.05 compared with the h2o2-treated group ; p < 0.05 compared with the h2o2- and egl - treated groups ) .
nrf2 , nuclear factor erythroid 2-related factor 2 ; ho-1 , heme oxygenase-1 ; egl , extract of ganoderma lucidum ; sirna . small interfering ribonucleic acid ; sds , sodium dodecyl sulfate
; ecl , enhanced chemiluminescence ; h2o2 , hydrogen peroxide ; mtt , 3-[4,5-dimethylthiazol- 2-yl]-2,5-diphenyltetrazolium bromide ; sd , standard deviation . | objectives : the mushroom ganoderma lucidum has been widely used as a traditional herbal medicine for many years .
although several studies have focused on the anti - oxidative activity of this mushroom , the molecular mechanisms underlying its activity have not yet been clearly established .
the present study investigated the cytoprotective effect of ethanol extract of ganoderma lucidum ( egl ) against oxidative stress ( hydrogen peroxide , h2o2 ) and elucidated the underlying mechanisms in a c2c12 myoblast cell line.methods:oxidative stress markers were determined by using the comet assay to measure reactive oxygen species ( ros ) generation and deoxyribonucleic acid ( dna ) damage .
cell viability and western blotting analyses were employed to evaluate the cellular response to egl and h2o2 in c2c12 cells .
transfection with nuclear factor erythroid 2-related factor 2 ( nrf2)-specific small interfering ribonucleic acid ( sirna ) was conducted to understand the relationship between nrf2 expression and h2o2-induced growth inhibition.results:the results showed that egl effectively inhibited h2o2-induced growth and the generation of ros .
egl markedly suppressed h2o2-induced comet - like dna formation and phosphorylation of histone h2ax at serine 139 ( p-h2ax ) , a widely used marker of dna damage , suggesting that egl prevented h2o2-induced dna damage .
furthermore , the egl treatment effectively induced the expression of nrf2 , as well as heme oxygenase-1 ( ho-1 ) , with parallel phosphorylation and nuclear translocation of nrf2 in the c2c12 myoblasts .
however , zinc protoporphyrin ix , a ho-1 inhibitor , significantly abolished the protective effects of egl against h2o2-induced accumulation of ros and reduced cell growth .
notably , transient transfection with nrf2-specific sirna attenuated the cytoprotective effects and ho-1 induction by egl , indicating that egl induced the expression of ho-1 in an nrf2-dependent manner.conclusion:collectively , these results demonstrate that egl augments the cellular anti - oxidant defense capacity through activation of nrf2/ho-1 , thereby protecting c2c12 myoblasts from h2o2-induced oxidative cytotoxicity . |
bacterial strains - we reviewed the microbiological features of 15 c. striatum strains recovered from representative clinical sites of 14 hospitalised patients ( 50% male ; 50% with fatal outcomes ) with signs and symptoms of bacterial infection .
the patients were hospitalised between august 2009-april 2010 in seven different wards of a 600-bed teaching hospital in rio de janeiro ( rj ) , brazil ( table ) .
all c. striatum isolates from the patients included in the study were detected using routine diagnostic cultures .
tablecharacteristics of 15 corynebacterium striatum strains isolated from infected patients within nosocomial environmentfirst experimentsecond experimentctstctstareas tested ( n)101099areas positive [ n ( % ) ] 5 ( 50)2 ( 20)5 ( 56)2 ( 22.2)false negative [ n ( % ) ] 0 ( 0)3 ( 30)0 ( 0)3 ( 33.3)threshold of detection express for the ct and cfu / swab for the st ( cfu.g)0.05.10
0.12.10
0.05.10
0.56.10
mean sd detection express for the ct and cfu / swab for the st ( cfu.g)18.4 24.0510 16.49364.6 79899.5 61.52coefficients of variation ( % ) 130.69164.92218.87157.24
a : c. striatum strains identified by 16s rrna and rpob gene amplification and sequencing ; b : patients submitted to endotracheal intubation procedure ; bal : bronchoalveolar lavage ; cfu : colony - forming units ; csf : cerebrospinal fluid ; f : female ; icu : intensive care unit ; m : male ; mdr : multidrug resistant ; mds : multidrug susceptible ; ni : not informed ; nit : nitrate reductase ; pyz : pyrazinamide ; pfge : pulsed - field gel electrophoresis ; suc : sucrose fermentation ; - : negative reaction ; + : positive reaction .
a : c. striatum strains identified by 16s rrna and rpob gene amplification and sequencing ; b : patients submitted to endotracheal intubation procedure ; bal : bronchoalveolar lavage ; cfu : colony - forming units ; csf : cerebrospinal fluid ; f : female ; icu : intensive care unit ; m : male ; mdr : multidrug resistant ; mds : multidrug susceptible ; ni : not informed ; nit : nitrate reductase ; pyz : pyrazinamide ; pfge : pulsed - field gel electrophoresis ; suc : sucrose fermentation ; - : negative reaction ; + : positive reaction .
bacterial phenotypic characterisation - corynebacterium - like colonies were selected for further identification when they were grown in any quantity from normally sterile body fluid or when they were isolated in significant numbers or in pure culture from other specimens obtained at clinical sites where infection was suspected ( funke & bernard 2007 ) .
all clinical samples yielding more than three organisms were regarded as contaminated and discarded ( thomson & miller 2007 ) .
for quantitative bronchoalveolar lavage ( bal ) fluid cultures , a colony count > 10 colony - forming units ( cfu ) ml of potential pathogens was considered positive .
isolation of three species of microorganisms was classified as a polymicrobial infection of the lower respiratory tract .
microorganisms were identified from the urine cultures in cystine lactose electrolyte - deficient agar ( merck , darmstadt , germany ) and were considered potential pathogens when the growth exceeded 10 cfu ml as the only isolate or > 10 cfu ml as the predominant isolate ; in cases of nephropathies , > 10 cfu ml was also considered a potential pathogenic level .
blood cultures were always obtained in pairs , wherein at least one of the samples was collected through the central venous catheter , if present .
blood specimens were inoculated in bactec plus anaerobicaerobic vials and processed in a bactec 9240 continuous - monitoring system ( becton - dickinson microbiology system , cockeysville , md , usa ) .
other clinical specimens were inoculated onto a columbia agar base with the addition of 5% sheep 's blood and incubated at 37c in a 3 - 5% co2 atmosphere and monitored for 72 h ( camello et al .
positive bacterial cultures for irregular gram - positive rods were preliminarily characterised by colonial morphology , pigmentation , haemolysis , dnase activity and camp reaction with staphylococcus aureus ( camello et al .
phenotypic characterisation was also performed using the semi - automated api coryne system 3.0 ( biomrieux ) with the api web decoding system ( apiweb.biomerieux.com ) ( almuzara et al .
susceptibility testing - antimicrobial susceptibility profiles were determined by the disk diffusion method in cation - adjusted mueller - hinton agar supplemented with 5% sheep blood .
breakpoints for the susceptible strains were used as suggested by the clinical laboratory standards institute ( clsi ) for bacteria excluded from tables 2a - k . as there is not
yet a defined standard for interpreting these results , the standard proposed in clsi document m45-a ( isbn 1 - 56238 - 607 - 7 ) was used ( clsi 2007 ) .
the breakpoints for s. aureus were considered in the cases of penicillin , oxacillin and ampicillin .
for the other antimicrobial agents , we used the breakpoints for other microorganisms , but not haemophilus spp or neisseria gonorrhoeae , which had been validated by previous studies .
intermediate results were considered resistant ( camello et al . 2003 , martins et al . 2009 ) .
the antibiotics ( oxoid sa , spain ) tested included penicillin ( 10 u ) , ampicillin ( 30 g ) , methicillin ( 5 g ) , cefotaxime ( 30 g ) , cefepime ( 30 g ) , ceftriaxone ( 30 g ) , imipenem ( 10 g ) , erythromycin ( 15 g ) , clindamycin ( 2 g ) , linezolid ( 30 g ) , ciprofloxacin ( 5 g ) , moxifloxocin ( 5 g ) , tetracycline ( 30 g ) , gentamicin ( 10 g ) , rifampin ( 5 g ) , fosfomycin ( 200 g ) , vancomycin ( 30 g ) , mupirocin ( 200 g ) , tobramycin ( 10 g ) , nitrofurantoin ( 300 g ) and ticarcillin / clavulanate ( 75 g/10 g ) .
gene amplification and sequencing - c. striatum identification was confirmed by 16s rrna and rpob gene sequencing .
each strain was grown in brain heart infusion broth by incubation for 24/48 h at 30c and centrifuged for 5 min at 3,000 rpm .
the pelleted bacteria were suspended in 500 l of sterile water and subsequently boiled for 15 min for dna extraction .
cell extracts were then immediately stored at -20c for use in polymerase chain reaction ( pcr ) reactions .
16s rrna gene was amplified using universal primers pa ( 5'-agagtttgatcctggctcag ) and ph ( 5'-aaggaggtgatccagccgca ) , as described by watts et al .
the purified pcr product was sequenced by primer walking with the oligonucleotides using the following primers for sequencing : 1831 ( 5'-gaggaac - accgatggcgaaggc ) , 1832 ( 5'-gcccccgtca - attcctttgagtt ) ( watts et al .
2000 ) and 519r ( 5'-g(at)attaccgcggc(gt)gctg ) and 1242f ( 5'-cacacgtgctacaatgg ) ( johnson 1994 ) .
the rpob gene was amplified and sequenced using primers following procedures described previously ( khamis et al .
the sequencing reactions were performed using a bigdye terminator v 3.1 cycle sequencing kit ( applied biosystems ) on an abi-3730 automated dna sequencer ( applied biosystems ) following standard protocols .
the 16s rrna gene sequences were compared to those available in the national center for biotechnology information ( ncbi.nlm.nih.gov ) using the blast algorithm and the ribosomal database project ii ( rdp.cme.msu.edu/html ) .
phylogenetic analysis - the 16s rrna gene sequences were aligned by clustalx ( thompson et al . 1997 ) .
the phylogenetic trees were constructed by using the neighbour - joining ( nj ) genetic distance method and were made using the program mega 4.0 package with the option of complete deletion of gaps ( tamura et al .
pulsed - field gel electrophoresis ( pfge ) - genomic dna was prepared following a method described previously ( garca - crespo et al .
the dna was cleaved with swai ( new england biolabs ) according to the manufacturer 's instructions .
pfge was carried out in 0.5x tris - borate - edta-1.2% agarose gels at 13c with a chef drii system ( bio - rad ) .
the pulse times were 1 - 30 s over 22 h. a lambda dna concatemer ( new england biolabs ) was used as a molecular size marker .
similarities among macrorestriction patterns were identified according to the criteria established by tenover et al .
ethics - this study was developed in compliance with the brazilian government 's ethical guidelines for research involving human beings ( resolution of the national health council / ministry of health ) and approved by the ethical research committee ( inca - cep 008/06 ) .
epidemiological aspects - all 15 c. striatum clinical samples and the patients ' ages , genders , hospital wards , outcomes , sites of isolation and associated microorganisms are displayed in chronological order in the table . with the exception of four patients for whom age was not available , c. striatum strains were isolated only from adults ( 7 males and 7 females ; half of whom were 50 years of age or older ) .
most of the strains were grown in pure culture ( n = 13 ) and from tracheal aspirates ( n = 9 ) .
numerically predominant colonies of c. striatum were observed in two polymicrobial cultures from tracheal samples : one co - infected with klebsiella pneumoniae and another with pseudomonas sp . and
staphylococcus sp . c. striatum strains were also isolated from blood ( n = 1 ) , cerebrospinal fluid ( csf ) ( n = 1 ) , bal ( n = 1 ) , surgical wounds ( n = 2 ) and urine ( n = 2 ) samples . from the deceased patient , number 14 , c. striatum strains were isolated from both the tracheal aspirate and the csf ( table ) .
when considering bacterial growth in pure culture and the proximity between microbiological diagnosis and death of the patients , the possibility of a causal link between death and c. striatum infection was observed in five cases ( 3 , 9 , 11 , 12 and 14 ) ( table ) .
at least half of the patients previously infected with c. striatum died , indicating a high severity of illness and/or immune deficiency .
all seven deaths during the period of study occurred in patients from whom c. striatum was isolated in a pure culture ( 3 in december 2009 ) .
1 presents the epidemic curve of the infections caused by c. striatum , suggestive of a nosocomial outbreak .
most of the c. striatum strains ( n = 6 ) were isolated in december 2009 from patients from various hospital wards .
the pathogen was found circulating mostly among inpatients admitted to the icu and surgical wards ( n = 10 ) from august 2009-april 2010 ( table ) . c.
striatum infections were observed in the general icu ( n = 4 ) , cardiac icu ( n = 1 ) , icu ii ( n = 2 ) , thoracic surgery ( n = 3 ) ,
nursery 18 ( n = 2 ) , infectious diseases ( n = 2 ) and urology ( n = 1 ) wards .
antimicrobial susceptibility , phenotypic and genotypic properties of c. striatum clinical isolates - mdr profiles for 21 of the antimicrobial agents tested were observed in 87% of the c. striatum strains that were susceptible only to vancomycin , linezolid and tetracycline .
two strains ( 1954br - rj surgical wound isolate and 1961br - rj urine isolate ) were susceptible to most of the tested drugs ( mds ) except mupirocin , fosfomycin and ticarcillin / clavulanate .
deaths occurred only in patients from whom mdr c. striatum strains were isolated in the blood , cfs , bal and/or tracheal aspirate .
the phenotypic analysis of c. striatum strains revealed variability in the results of nitrate reductase and pyrazinamide ( pyz ) activities and/or sucrose fermentation ( table ) . to genotypically confirm the suspected c. striatum isolates , we performed 16s rrna and rpob gene sequencing .
genbank accessions for the 16s rrna and rpob genes sequences were deposited : jf342692-jf342700 and jf342701-jf342709 , respectively .
the 16s rrna sequences from the clinical isolates exhibited the highest similarity values to the type strain of c. striatum ( atcc 6940 ) , ranging from 99.32 - 99.84% .
the phylogenetic ana - lysis , based on the 16s rrna sequences , unambiguously demonstrated that the clinical isolates belonged to the c. striatum species , as illustrated in fig .
2 . a comparative analysis of the partial rpob sequences for the clinical isolates revealed sequence similarities in the ranges of 97.08 - 97.15% with the type strain c. striatum ( atcc 6940 ) .
pfge analysis - the restriction endonuclease swai revealed four distinct pfge profiles among the c. striatum isolates , which were designated i , ii , iii and iv .
the pfge profile i was the most frequently observed among the 15 strains ( 78.57% ) isolated from the 14 patients ( 71.42% ) included in this study ( fig .
3 ) . pfge analysis confirmed the isolation of a single clone of c. striatum ( pfge i ) from the respiratory tract and csf of the patient of case 14 .
profiles ii , iii and iv differed by more than three bands from pfge profile i by visual inspection .
( 1995 ) , mdr clinical isolates belonging to profile ii exhibited six bands of difference from the outbreak mdr strain and were considered potentially related to the outbreak .
the mds isolates belonging to profiles iii and iv exhibited more than six bands of difference , indicating that they were unrelated to the outbreak strain ( fig .
lane 1 : dna ladder pfge marker ; 2 - 5 , 7 : profile i ( isolates 1958 , 1959 , 1987 , 1974 and 2539 , respectively ) ; 6 : profile ii ( isolate 2369 ) ; 8 , 9 : profile iii ( isolate 1961 ) ; 10 : profile iv ( isolate 1954 ) .
in brazil , previous investigations revealed that 1.9% of samples isolated from varied clinical sources of cancer patients treated in a reference centre in rj during a one - year period were positive for c. striatum , corresponding to one case of upper and three of lower respiratory tract infections and two cases of surgical wounds ( martins et al .
, we documented a nosocomial outbreak that includes a fatal case of systemic infection caused by c. striatum in a 600-bed teaching hospital in rj .
pfge analyses of 15 c. striatum strains indicated the presence of four pfge profiles , including two related clones of mdr strains ( pfge i and ii ) .
our data demonstrated the predominance of pfge type i comprising 11 mdr isolates that were mostly isolated from the icu and surgical wards .
the tracheal aspirate specimens obtained from patients with ventilator - associated respiratory tract colonisation or pneumonia were mostly ( 6 out of 7 ) pfge type i. the possibility of a causal link between death and c. striatum ( pfge types i and ii ) infection was observed on five occasions .
similar to our findings , previous studies also revealed ventilator support as a relevant risk factor for acquiring c. striatum infection ( brandenburg et al .
jude children 's research hospital ( tennessee , usa ) indicated that most bacteraemia cases were due to c. striatum .
these patients had complications related to their infections , including infection relapse and septic arthritis ( adderson et al .
2008 ) . in the present study , c. striatum strains were not isolated from infants and new - borns and/or cancer patients .
the pathogen was isolated from adults , with half of the patients ( n = 7 ) 50 years of age or older .
the isolation of pure , heavy - growth c. striatum in the absence of other pathogens together with clinical deterioration provided strong evidence for its pathogenic role in our patients .
however , we could not ascertain how many of the fatalities could be attributed to c. striatum infection rather than to underlying conditions .
except for the unvarying activity of vancomycin against corynebacteria , the variability in resistance to other classes of antimicrobial agents emphasises the need for the continuous surveillance of their resistance patterns .
although most reported c. striatum isolates have been susceptible to a wide range of antibiotics ( martnez - martnez et al .
1996 ) , it has been suggested that the selective pressure exerted by prior antimicrobial treatment favours the overgrowth of c. striatum as a secondary coloniser in immunocompromised hosts . in this context , the emergence of mdr strains is of particular concern ( leonard et al .
herein , the mdr phenotype of c. striatum strains was immediately observed and was responsible for the alarm that led to the subsequent laboratory surveillance of these strains .
most ( 87% ) c. striatum strains were only susceptible to vancomycin , linezolid and tetracycline . in japan , otsuka et al .
( 2006 ) reported variable rates of the susceptibility of c. striatum to -lactams and aminoglycosides , with high levels of resistance to erythromycin , tetracycline , rifampin and ciprofloxacin , although all strains were sensitive to vancomycin .
pfge procedures identified 14 patterns of c. striatum , with types a , d and e associated with nosocomial outbreaks of respiratory origin and with subtypes a1 , a2 , d2 and e associated with resistance to a broad range of antibiotics .
( 2007 ) observed in their samples that the criterion of multidrug resistance ( resistance to 3 or more antibiotics of different families ) applied to 100% of the strains isolated in nosocomial outbreaks , of which 65% were resistant to four or five different antibiotic groups , 6.9% were sensitive only to imipenem and vancomycin and 11% were sensitive only to vancomycin . according to the sensitivity patterns obtained by otsuka et al .
( 2006 ) , we observed in our samples that the criterion of multidrug resistance ( resistance to 3 or more antibiotics of different families ) applies to 87% of c. striatum ( pfge types i and ii ) strains isolated in the present nosocomial outbreak . for c. striatum , no publically available database exists , such as pulsenet ( cdc.gov/pulsenet ) , to enable the comparison of pfge patterns observed in the different nosocomial outbreaks .
( 2009 ) observed that the swai - pfge profiles of c. striatum exhibit bands ranging in size from 48.5 - 533.5 kb . in our study , we obtained swai - pfge profiles with bands ranging in size from over 97.0 - 533.5 kb .
the absence of bands ranging in size from 48.5 - 97.0 kb suggested that the mdr c. striatum strains isolated in this nosocomial outbreak in brazil were different from those isolated in italy by campanile et al .
moreover , the analysis of the phenotypic profiles of c. striatum indicated that the brazilian strains were different from those isolated in the netherlands ( biotype : nitrate / pyz - positive and sucrose - negative ; api code 3100104 ) ( brandenburg et al . 1996 ) . to our knowledge
, this is the first brazilian nosocomial outbreak caused by mdr c. striatum described in the literature . with the support of pfge techniques , the clonal nature of the outbreak isolates was established , although a common source and the mode of transmission could not be determined .
the present findings also highlight the importance of c. striatum as an emerging mdr nosocomial pathogen worldwide and the fact that different clones may be responsible for these nosocomial outbreaks . | corynebacterium striatum is a potentially pathogenic microorganism with the ability to produce outbreaks of nosocomial infections . here
, we document a nosocomial outbreak caused by multidrug - resistant ( mdr ) c. striatum in rio de janeiro , brazil .
c. striatum identification was confirmed by 16s rrna and rpob gene sequencing .
fifteen c. striatum strains were isolated from adults ( half of whom were 50 years of age and older ) . c. striatum was mostly isolated in pure culture from tracheal aspirates of patients undergoing endotracheal intubation procedures .
the analysis by pulsed - field gel electrophoresis ( pfge ) indicated the presence of four pfge profiles , including two related clones of mdr strains ( pfge i and ii ) .
the data demonstrated the predominance of pfge type i , comprising 11 mdr isolates that were mostly isolated from intensive care units and surgical wards . a potential causal link between death and mdr c. striatum
( pfge types i and ii ) infection was observed in five cases . |
radioisotopes and radiopharmaceuticals for use in nuclear medicine constitute one of the most prominent applications of nuclear energy .
radionuclides were quickly incorporated to biologically active chemical compounds , producing a specific class of drugs known as radiopharmaceuticals .
nuclear medicine is nowadays well established and recognized by the medical community , and the use of radiopharmaceuticals for diagnose and therapy became regular procedures .
the concept of nuclear pharmacy arose in the usa in 1960 , when for the first time were defined the services pertinent to the nuclear pharmacy or radiopharmacy , particularly the role of the radiopharmacist in the development , preparation , quality control , and dispensation of radiopharmaceuticals .
currently , the usa , european union , and japan consider radiopharmacy as a regular branch of pharmacy , and the radiopharmacists as recognized members of the multidisciplinary staffs working in nuclear medicine . due to the lack of specific regulation , these professionals are not yet rightfully acknowledged in brazil . in brazil , radiopharmaceuticals are produced both by the public and private initiatives . since 2006 , when constitutional amendment 49 was passed , the production of radioisotopes by the private initiative is being steadily increasing .
there are 20 cyclotron facilities in the process of being licensed , in the cities of rio de janeiro , so paulo , belo horizonte , braslia , and salvador .
the public sector contribution comes from the comisso nacional de energia nuclear ( national commission of nuclear energy ) cnen and its research institutes . presently , the instituto de engenharia nuclear ( nuclear engineering institute )
ien , the instituto de pesquisas energticas nucleares ( nuclear and energy research institute ) ipen , and the centro de desenvolvimento de tecnologias nucleares ( nuclear technologies development center ) cdtn , are the country 's most productive radioisotope and radiopharmaceutical centers . according to gonalves et al . , nuclear medicine services ( hospitals , clinics , and imaging centers ) throughout the country had an increasing growth following the trend of the local productive sectors .
santos - oliveira et al . estimate that more than 3 million medical procedures using radiopharmaceuticals are performed in brazil per year .
the aim of this study was to evaluate hospitals and clinics ( hereby named hospitals ) which have nuclear medicines services at the city of rio de janeiro from august to november 2010 .
a longitudinal research was conducted within the municipality of rio de janeiro from august 2010 up to november 2010 , including 30 clinics / hospitals ( public and private ) with nuclear medicine services .
taking into account the totality of clinics and hospitals in the state of rio de janeiro ( 32 ) , the facilities included in the research corresponded to 93.75% of all the clinics and hospitals offering nuclear medicine services in this municipality .
this study used a preprepared questionnaire ( annexure 1 ) , covering the monthly number of patients treated at the clinics , the professionals involved in the manipulation and administration of radiopharmaceuticals , the academic qualification of the radioprotection supervisors , of those in charge of the radiopharmaceuticals manipulation , and the existence of secondary and elementary educational level personnel in the staff , among other informations .
in terms of the number of people using radiopharmaceuticals , the results show a very strong demand for these substances , mainly in diagnostics , as shown in table 1 .
number of patients using adiopharmaceuticals in terms of professionals acting as radioprotection supervisors , the study showed that 53% of them are physicists , 41% are physicians , and only 6% are pharmacists [ figure 1 ] .
distribution of responsible for nuclear pharmacy in all hospital analyzed by this study the results revealed that regarding the professionals responsible for manipulating the radiopharmaceuticals , just only 10% were made by pharmacists [ figure 2 ] .
distribution of professionals responsible by the manipulation and quality control of radiopharmaceuticals in the hospitals analyzed during the study although the manipulation of drugs ( as radiopharmaceuticals ) and their derivatives is private from pharmacists the study showed that this activity is developed mainly by physicians ( 30% ) and biologists ( 60% ) .
although they may be very capable , both physicians and biologists do not have suitable academic skills ( education ) .
distribution of professionals responsible for the dose calculating in the the hospitals analyzed in this study though this practice is not private of pharmacist the dose calculating is intrinsically linked to the quality control as the manipulation of radiopharmaceuticals and for that should be supervised by a pharmacist .
the results showed that both physicians and biologist have their importance well established in a hospital nuclear pharmacy ( hospital radiopharmacy ) in a multidisciplinary team .
however the same can not be said by the pharmacists , which as observed , in most of the cases , are even included in the team .
the answers collected from the questionnaire also revealed that from all hospitals studied 100% of the nuclear medicine services considered that keep a pharmacist is not essential and would raise the cost for the hospitals . also , the research found that the dose administrations of radiopharmaceuticals were made by the nursing technician without any specific training in the nuclear pharmacy field .
the results demonstrated that a paradigm shift should be made urgently in nuclear pharmacies around the rio de janeiro and brazil .
the concept of hospital nuclear pharmacy without a pharmacist is absolutely wrong and may cause damages to the patient . in this case
indeed an action from the surveillance system of brazil integrated with the federal council of pharmacy is necessary in order to avoid this type of practice . | radiopharmaceuticals are special drugs that in the composition preserve one or more radionuclides which can be used as diagnostic or therapeutic tools in nuclear medicine units .
this study evaluated hospitals and clinics which have nuclear medicines services at the city of rio de janeiro from august to november 2010 .
the data were obtained through a longitudinal research .
the results showed that most of the hospitals ( > 80% ) did not have pharmacist and all them ( 100% ) considered that a pharmacist in the nuclear pharmacy is not required . |
we enrolled children < 12 years of age who were hospitalized for ili from june 18 , 2009 , through march 1 , 2010 , and for whom pandemic ( h1n1 ) 2009 infection was confirmed by real - time reverse transcription pcr .
1,362 children were hospitalized for ili . the first case was diagnosed and confirmed as pandemic ( h1n1 ) 2009 during the third week of june 2009 ; the number of cases peaked at week 33 and declined until week 43 of 2009 and weeks 19 of 2010 ( figure ) .
the rapid decline of cases after week 33 may have resulted from a change in hospitalization criteria recommendations . from june 18 through july 2009 , hospitalization rates among children < 12 years , < 5 years , and < 2 years of age were 1.4 , 1.0 , and 1.1 per 100,000 children in each age group , respectively . from august 2009 through february 2010 ,
corresponding hospitalization rates were 15.9 , 23.8 , and 33 per 100,000 children , respectively .
distribution of laboratory - confirmed cases of pandemic ( h1n1 ) 2009 and deaths in 1,362 hospitalized children , malaysia , june 18 , 2009march 1 , 2010 .
overall median age of the hospitalized children was 3 years ( interquartile range [ iqr ] 16 years ) ; 861 ( 63.2% ) were < 5 years and 536 ( 39.4% ) were < 2 years of age . among those who died ,
other demographic characteristics of the cohort are shown in table 1 . * kadazan / dusun , melanau , bajau , bidayuh , iban , orang ulu , lundayeh , kayan , kedayan , sabahan , kadayan , suluk , tidung , bisaya .
a total of 602 ( 44.2% ) children were admitted to hospital within 48 hours of onset of clinical signs .
median interval from onset of signs to hospitalization was 3 days ( iqr 15 days ) for the overall cohort , 3 days ( iqr 15 days ) for those who survived , and 4 days ( iqr 26 days ) for those who died . among 120 ( 8.8% )
children whose clinical condition worsened during hospitalization , deterioration occurred within the first 24 hours after admission for 67 ( 55.9% ) . among 657 ( 48.2% ) patients for whom blood cultures were performed , results were positive for only 29 ( 4.4% ) .
the most common pathogen isolated was streptococcus pneumoniae ( n = 6 ) , followed by coagulase - negative staphylococcus spp .
( n = 5 ) , burkholderia cepacia ( n = 4 ) , klebsiella pneumoniae ( n = 2 ) , and pseudomonas spp .
s. pneumoniae isolates , 5 were documented within 48 hours of admission , including 2 from children who died .
laboratory parameters at time of admission did not differ significantly between those who survived and those who died , except for hemoglobin ( odds ratio [ or ] 0.71 , 95% confidence interval [ ci ] 0.590.87 , p = 0.001 ) , arterial bicarbonate ( or 0.81 , 95% ci 0.720.91 , p<0.001 ) , and serum albumin ( or 0.90 , 95% ci 0.870.94 , p<0.001 ) . among 1,049 children for whom
chest radiographs were taken at time of admission , infiltrates were noted for 643 ( 61.3% ) , consolidation for 254 ( 24.2% ) , and pleural effusion for 4 ( 0.4% ) .
antiviral drugs had been given to 78 ( 5.7% ) children before admission and to 1,306 ( 95.6% ) children after admission .
the most common antiviral drug used was oseltamivir , followed by zanamivir ( received by 2 [ 0.2% ] children ) .
an antiviral drug was given within 48 hours of onset of signs for 388 ( 28.5% ) children , including 382 ( 29.1% ) who survived and 6 ( 11.7% ) who died .
an antiviral drug was given > 48 hours after onset of signs for 783 ( 57.5% ) children , including 748 ( 57.1% ) who survived and 35 ( 68.6% ) who died .
administration of an antiviral drug within 48 hours of onset of signs was associated with a lower risk for death ( or 0.4 , 95% ci 0.20.9 ; p = 0.02 ) .
median duration of oseltamivir administration was 5 days ( iqr 47 days ) . among 1,306 children for whom
data were available , 982 ( 75.2% ) also received antibacterial drugs . among the same 1,306 children for whom data were available , 461 ( 35.3% ) had a concurrent illness ( table 2 ) ; 416 ( 31.9% ) had 1 concurrent illness and 65 ( 4.9% ) had 2 .
presence of > 1 concurrent conditions was associated with a 4-fold increased risk for death ( or 4.4 , 95% ci 2.48.1 ; p<0.001 ) .
risk for death was higher for those with chronic lung disease ( or 2.5 , 95% ci 1.15.6 ; p<0.02 ) than for those with other concurrent conditions . among the 64 ( 4.7% ) children who required inotropic support , 23 ( 34.3% ) survived . among all 1,362 hospitalized children ,
51 ( 3.7% ) died , including 46 ( 90.2% ) in intensive care units and 25 ( 49% ) who were < 2 years of age ( or 1.51 , 95% ci 0.862.64 ) , p = 0.15 ) . among the 101 children who required mechanical ventilation , 49 ( 48.5% ) died . among the 1,352 children for whom follow - up data were available , 1,285 ( 95% ) recovered fully and had no sequelae at time of hospital discharge , and 12 ( 0.9% ) recovered but had sequalae ( 5 pulmonary , 4 neurologic , 2 renal , and 1 pulmonary and neurologic ) .
the mortality rate for children who were < 12 , < 5 , and < 2 years of age during june
corresponding rates for august 2009february 2010 were 0.6 , 0.9 , and 1.3 per 100,000 children , respectively . * or , odds ratio ; ci , confidence interval ; , numbers too small to infer from study sample .
in the tropics , pandemic ( h1n1 ) 2009 is a relatively mild illness in children who have no concurrent condition .
serious complications such as shock and acute respiratory distress syndrome were relatively rare . however , among the small proportion for whom disease was severe , progression was rapid and death occurred within a short period .
the case - fatality rate for the hospitalized cohort reported here was 3.7% , comparable to the rates of 0.1%5.1% documented by others ( 4,9,14 ) .
hospitalization and mortality rates were proportionally higher for children < 2 years of age than for children in other age groups .
severe disease leading to death was more likely for patients who had > 1 concurrent condition .
data on concurrent conditions can help identify and prioritize patients who need prompt antiviral drug therapy and vaccination in countries with limited resources .
our finding that early administration of an antiviral drug was associated with a lower risk for death concurs with findings of other studies ( 3 ) .
study limitations include the facts that patients with mild cases may not seek ( or be brought for ) medical attention and that not all cases of ili were laboratory confirmed as pandemic ( h1n1 ) 2009 .
early initiation of antiviral therapy , especially for children with concurrent conditions , may improve outcomes . | to determine effects of pandemic ( h1n1 ) 2009 on children in the tropics , we examined characteristics of children hospitalized for this disease in malaysia .
of 1,362 children , 51 ( 3.7% ) died , 46 of whom were in an intensive care unit .
although disease was usually mild , > 1 concurrent conditions were associated with higher death rates . |
with limited resources and an increasing need for speed in the health - care system , the advent of cheaper and more user friendly miniaturized ultrasound scanners is appealing .
pocket - sized scanners can now easily be brought to the patient , so - called point - of - care ultrasonography .
the recently published recommendations for the use of pocket - sized echocardiography ( pocket ) by the european association of echocardiography states that pocket may serve as a tool for fast initial screening and as complement to the physical examination . further , pocket may be used for the triage of the patient in need of a complete echocardiographic examination and has the potential to rearrange inpatient workflow and diagnostics .
recent studies have shown good correlation between pocket and high - end echocardiography ( high ) in both outpatient cardiac clinics and echo - labs , which offer optimal conditions for echocardiography . even though the pocket - sized ultrasound devices are designed for point - of - care ultrasonography , it is not known whether bedside examinations with inferior conditions for echocardiography are feasible and reliable .
thus , we aimed to study the feasibility and reliability of pocket as a bedside cardiovascular screening tool and adjunct to the physical examination in routine clinical ward rounds in patients admitted to a medical department .
one hundred and ninety - six patients admitted to the medical department at levanger hospital , norway between march and september 2010 were scanned with pocket ( vscan ; ge vingmed , horten , norway ) by one of the three experienced cardiologists on their regular on - call ward rounds .
the specialist on call for general medicine at this hospital is either 1 of 3 cardiologists experienced in echocardiography or one of the 10 other specialists in internal medicine .
patients were only available for inclusion if one of the three cardiologists were on call the day the patients were admitted to hospital .
patients admitted to the departments ' cardiac unit ( 119 patients ) were automatically referred to a subsequent high examination .
in addition , all patients from the non - cardiac units with standard indications for echocardiography were also referred and included in the analyses .
patients were specifically not excluded due to poor image quality , previous illness or any other unspecified attribute . in total , 90 patients from the cardiac unit and 18 patients from the non - cardiac units underwent both pocket and high and these 108 patients are included in the analyses . written informed consent was obtained .
the study was approved by the regional committee for medical and health research ethics and conducted according to the declaration of helsinki .
the ultrasound screening was performed at the bedside with a pocket - sized ultrasound device , vscan ( ge vingmed ultrasound , horten , norway ) .
the device weighs 390 g , including the phased - arrayed probe , which measures 135 73 28 mm .
the image sector for echocardiographic imaging is 75. the bandwidth ranges from 1.7 to 3.8 mhz and is automatically adjusted .
patient identification was performed by voice recording and the automatically assigned examination number . all images and recordings
were saved on the device 's micro - sd card and later transferred to a computer by commercial software ( gateway ; ge vingmed ultrasound ) .
the cardiovascular screening by pocket was performed at the bedside with patients in a left - lateral decubitus and supine position .
assessment of left ventricular ( lv ) global and regional function , right ventricular ( rv ) size and function , valvular anatomy and function , and the pericardium were done from parasternal long- and short - axis and apical four - chamber , two - chamber and long - axis views .
global lv and rv functions were classified online by visual assessment as : normal / near normal , moderate dysfunctional or severe dysfunctional , while regional lv function was classified as regional dysfunction present or not .
valvular pathology and dysfunction were classified as mild , moderate or severe by visual assessment from grey - scale and colour doppler imaging .
the area and intensity of the regurgitation jets assessed by colour doppler were the most important for grading valvular regurgitations , while the grading of aortic stenosis was based on the degree of calcification and the movement of the cusps .
the size of the left atrium was measured online on grey - scale parasternal long - axis images .
an attempt was made in order to do the measurement at end systole . from the subxiphoid position ,
the abdominal aorta ( aa ) and inferior vena cava were assessed by grey - scale imaging .
the aa was assessed distally to the bifurcation and classified as : no abdominal aortic aneurysm present or abdominal aortic aneurysm present , depending on whether the diameter exceeded 35 mm or not . in case of doubt by visual assessment , measurement was done by the device 's calliper mode .
the inferior vena cava diameter was measured end - expiratory within 2 cm from the right atrium orifice .
all measurements of size were done on the pocket . with patients in a supine position ,
the pleura was assessed by grey - scale imaging from left and right lateral views , and the amount of pleural effusion was classified as : no pleural effusion , small - to - moderate amounts of pleural effusion or significant pleural effusion .
all recordings were saved on the pocket and the time used for the screening was calculated as the time from start to end of the examination .
high was performed in the hospital 's echo - lab , under optimal conditions , with a vivid 7 scanner ( ge vingmed ultrasound , horten , norway ) using a 2.0-mhz phased - array transducer ( m3s ) with bandwidth 1.53.6 mhz .
second harmonic imaging was used and the sector angle set to 90 as default , but was adjusted when appropriate .
high examinations were performed independently by one of four experienced cardiologists blinded to the results of pocket with a median time delay of 17.3 h. the same cardiovascular structures as described above were measured and classified according to the guidelines of the european association of echocardiography ( eae ) .
ejection fraction was measured by simpson 's rule from apical four - chamber and two - chamber views .
additionally , imaging techniques such as computer tomography , magnetic resonance imaging or ultrasound were ordered according to standard care and performed at the department of radiology . for the analyses in the patients who underwent both echocardiographic and radiologic examinations ,
the radiologists ' grading of pleural effusion and size of the aa was preferred compared with the echocardiography . in a randomized subset of 20 study participants
, the high - end echocardiographic recordings were reanalysed by a second cardiologist blinded to the original measurements in order to test inter - analyser variability .
the basic characteristics are presented as mean standard deviation ( sd ) and range .
the spearman 's rho ( r ) was used for comparison of the grading of pathology between the pocket and the high or radiologic examinations .
data are presented as r [ 95% confidence interval ( ci ) ] with ci computed using bootstrapping . for comparison of continuous variables between the pocket and the high examinations ,
the reliability of high is expressed by the coefficient of variation and was calculated as the within subjects sd of the two sets of observations , divided by the mean of the observations .
all statistical analyses were performed using spss for windows ( version 18.0 , spss inc . ,
one hundred and ninety - six patients admitted to the medical department at levanger hospital , norway between march and september 2010 were scanned with pocket ( vscan ; ge vingmed , horten , norway ) by one of the three experienced cardiologists on their regular on - call ward rounds .
the specialist on call for general medicine at this hospital is either 1 of 3 cardiologists experienced in echocardiography or one of the 10 other specialists in internal medicine .
patients were only available for inclusion if one of the three cardiologists were on call the day the patients were admitted to hospital .
patients admitted to the departments ' cardiac unit ( 119 patients ) were automatically referred to a subsequent high examination .
in addition , all patients from the non - cardiac units with standard indications for echocardiography were also referred and included in the analyses .
patients were specifically not excluded due to poor image quality , previous illness or any other unspecified attribute . in total , 90 patients from the cardiac unit and 18 patients from the non - cardiac units underwent both pocket and high and these 108 patients are included in the analyses . written informed consent was obtained .
the study was approved by the regional committee for medical and health research ethics and conducted according to the declaration of helsinki .
the ultrasound screening was performed at the bedside with a pocket - sized ultrasound device , vscan ( ge vingmed ultrasound , horten , norway ) .
the device weighs 390 g , including the phased - arrayed probe , which measures 135 73 28 mm .
the image sector for echocardiographic imaging is 75. the bandwidth ranges from 1.7 to 3.8 mhz and is automatically adjusted .
patient identification was performed by voice recording and the automatically assigned examination number . all images and recordings
were saved on the device 's micro - sd card and later transferred to a computer by commercial software ( gateway ; ge vingmed ultrasound ) .
the cardiovascular screening by pocket was performed at the bedside with patients in a left - lateral decubitus and supine position .
assessment of left ventricular ( lv ) global and regional function , right ventricular ( rv ) size and function , valvular anatomy and function , and the pericardium were done from parasternal long- and short - axis and apical four - chamber , two - chamber and long - axis views .
global lv and rv functions were classified online by visual assessment as : normal / near normal , moderate dysfunctional or severe dysfunctional , while regional lv function was classified as regional dysfunction present or not .
valvular pathology and dysfunction were classified as mild , moderate or severe by visual assessment from grey - scale and colour doppler imaging .
the area and intensity of the regurgitation jets assessed by colour doppler were the most important for grading valvular regurgitations , while the grading of aortic stenosis was based on the degree of calcification and the movement of the cusps .
the size of the left atrium was measured online on grey - scale parasternal long - axis images .
an attempt was made in order to do the measurement at end systole . from the subxiphoid position ,
the abdominal aorta ( aa ) and inferior vena cava were assessed by grey - scale imaging .
the aa was assessed distally to the bifurcation and classified as : no abdominal aortic aneurysm present or abdominal aortic aneurysm present , depending on whether the diameter exceeded 35 mm or not . in case of doubt by visual assessment ,
the inferior vena cava diameter was measured end - expiratory within 2 cm from the right atrium orifice .
all measurements of size were done on the pocket . with patients in a supine position ,
the pleura was assessed by grey - scale imaging from left and right lateral views , and the amount of pleural effusion was classified as : no pleural effusion , small - to - moderate amounts of pleural effusion or significant pleural effusion .
all recordings were saved on the pocket and the time used for the screening was calculated as the time from start to end of the examination .
high was performed in the hospital 's echo - lab , under optimal conditions , with a vivid 7 scanner ( ge vingmed ultrasound , horten , norway ) using a 2.0-mhz phased - array transducer ( m3s ) with bandwidth 1.53.6 mhz .
second harmonic imaging was used and the sector angle set to 90 as default , but was adjusted when appropriate .
high examinations were performed independently by one of four experienced cardiologists blinded to the results of pocket with a median time delay of 17.3 h. the same cardiovascular structures as described above were measured and classified according to the guidelines of the european association of echocardiography ( eae ) .
ejection fraction was measured by simpson 's rule from apical four - chamber and two - chamber views .
additionally , imaging techniques such as computer tomography , magnetic resonance imaging or ultrasound were ordered according to standard care and performed at the department of radiology . for the analyses in the patients who underwent both echocardiographic and radiologic examinations ,
the radiologists ' grading of pleural effusion and size of the aa was preferred compared with the echocardiography . in a randomized subset of 20 study participants
, the high - end echocardiographic recordings were reanalysed by a second cardiologist blinded to the original measurements in order to test inter - analyser variability .
the basic characteristics are presented as mean standard deviation ( sd ) and range .
the spearman 's rho ( r ) was used for comparison of the grading of pathology between the pocket and the high or radiologic examinations .
data are presented as r [ 95% confidence interval ( ci ) ] with ci computed using bootstrapping . for comparison of continuous variables between the pocket and the high examinations ,
the reliability of high is expressed by the coefficient of variation and was calculated as the within subjects sd of the two sets of observations , divided by the mean of the observations .
all statistical analyses were performed using spss for windows ( version 18.0 , spss inc . ,
age was mean sd ( range ) 69.1 13.7 ( 2092 ) years and 36% were female .
mean bmi was 27 5 ( 1744 ) kg / m and lv ejection fraction was 60 15 ( 1986)% , respectively .
table 1basic characteristics of the 108 study participantsvariablemean sd ( range)age , years69.1 13.7 ( 2092)women , n ( % ) 39 ( 36%)height ( cm)172 9 ( 146189)body mass index ( kg / m)27 5 ( 1744)systolic blood pressure ( mm hg)146 32 ( 58250)diastolic blood pressure ( mm hg)81.5 20 ( 32161)heart rate ( bpm)78.7 24 ( 29145)atrial fibrillation , n ( % ) 22 ( 20%)prior hypertension , n ( % ) 39 ( 36%)prior diabetes , n ( % ) 18 ( 17%)prior myocardial infarction , n ( % ) 33 ( 31%)prior angina , n ( % ) 27 ( 25%)prior heart failure , n ( % ) 12 ( 11%)prior peripheral vessel disease , n ( % ) 13 ( 12%)prior stroke , n ( % ) 12 ( 11%)data are presented as mean sd ( range ) unless otherwise specified .
basic characteristics of the 108 study participants data are presented as mean sd ( range ) unless otherwise specified .
median time used for pocket was 4.2 min ( range : 2.313.0 ) . image quality and interpretation were generally good ( table 2 ) .
specifically a high feasibility ( 98% ) for cardiac structures was seen , whilst it was somewhat lower for non - cardiac structures such as the intra - abdominal vessels ( 71% ) .
table 2feasibility of point - of - care pocket - sized echocardiographystructureassessed to satisfaction , n ( % ) left ventricle108 ( 100)right ventricle106 ( 98)pericardial space108 ( 100)left atrium105 ( 97)heart valves106 ( 98)pleural space102 ( 94)aa77 ( 71)inferior vena cava85 ( 79)aortic , mitral , tricuspid and the pulmonary valves .
feasibility of point - of - care pocket - sized echocardiography aortic , mitral , tricuspid and the pulmonary valves .
the correlations of semi - quantitative assessment of cardiovascular structures and function indices between pocket and high are shown in tables 3 and 4 .
lv regional and global function and rv size and function showed almost perfect correlation with r ( 95% ci ) : 0.92 ( 0.830.99 ) , 0.95 ( 0.900.99 ) and 0.85 ( 0.651.0 ) , respectively .
classification of valvular function indices between pocket and high correlated well for aortic , mitral and tricuspid regurgitations ( r 0.81 ) .
grading of aortic valve calcification or stenosis showed substantial correlation with r ( 95% ci ) : 0.62 ( 0.420.79 ) .
table 4 and figure 1 illustrate the agreement of pocket with high regarding the assessments of valvular function .
severe pulmonary regurgitation and mitral stenosis was only present in one patient each and no pulmonary stenosis was detected ( data not tabulated ) .
table 3correlations of semi - quantitative echocardiographic indices between pocket - sized echocardiography and reference methodgrading of : ntotalnpathologyr ( 95% ci)global lv function108350.95 ( 0.900.99)apparent lv regional dysfunction108350.92 ( 0.830.98)rv function106100.85 ( 0.651.0)size of the left atrium107690.65 ( 0.510.76)aa6771.0 ( 1.0)pleural effusion85140.89 ( 0.741.0)inferior vena cava760.68 ( 0.530.80 ) correlations of semi - quantitative echocardiographic indices between pocket - sized echocardiography and reference method ntotal , total number in the analyses ; npathology , total number with the described pathology .
reference method was radiologic examinations and high - end echocardiography . in case of doubt ,
agreement between point - of - care pocket - sized echocardiography and reference echocardiography of different cardiac indices lv , left ventricle ; rv , right ventricle ; la , left atrium .
pocket 2/1/0/+1/+2 refer to underestimation ( ) and overestimation ( + ) by pocket of the described indices compared with reference echocardiography .
all indices of valvular function graded as normal , or mild , moderate , and severe pathology .
the number of patients with any ; aortic valve calcification / stenosis , aortic regurgitation , mitral regurgitation , or tricuspid regurgitation by high - end echocardiography was 24 , 31 , 54 , and 34 , respectively . pocket 2 , 1 , + 1 and + 2 refer to grades of underestimation ( ) and overestimation ( + ) of the described pathology compared with reference echocardiography .
abbreviations : regurg , regurgitation . visual estimation of the size of the aa had perfect correlation ( 1.0 ) with respect to detecting aneurysms 35 mm . seven ( 10% ) patients had abdominal aortic aneurysms .
the degree of la dilatation and end - expiratory ivc diameter showed a less robust correlation , both r= 0.65 ( ivc , r = 0.42 ) .
pericardial effusion was detected in nine ( 8% ) patients and in one patient with insignificant pericardial effusion this was missed by pocket .
detection of pleural effusions had an overall correlation of r = 0.82 ( 0.791.0 ) .
table 5 shows the high sensitivity , specificity , positive , and negative predictive values of pocket with respect to detecting at least moderate pathology of the cardiovascular indices .
table 5sensitivity , specificity , positive , and negative predictive value of point - of - care pocket - sized echocardiography to detect pathology compared with reference methodto detect : npathology ( ntotal)sensitivity ( % ) specificity ( % ) ppv ( % ) npv ( % ) at least moderate lv dysfunction35 ( 108)97999799any lv regional dysfunction35 ( 108)97999296any rv dysfunction10 ( 106)90998298any dilatation of the left atrium69 ( 107)81688573any abdominal aortic aneurysms7 ( 67)100100100100any pleural effusion14 ( 85)93988797any pericardial effusion9 ( 108)8999100100at least moderate aortic stenosis8 ( 106)6310010097at least moderate aortic regurgitation6 ( 106)83998399at least moderate mitral regurgitation14 ( 107)93999399at least moderate tricuspid regurgitation8 ( 108)88987898abbreviations and explanations as in table 3 .
sensitivity , specificity , positive , and negative predictive value of point - of - care pocket - sized echocardiography to detect pathology compared with reference method abbreviations and explanations as in table 3 .
the coefficients of variation for all presented echocardiographic indices were 6.0% , indicating low interanalyser variability of the reference method .
mean sd ( range ) time used for reference echocardiography , excluding post - processing beyond calculation of ejection fraction was 17.2 3.8 ( 1232 ) min .
age was mean sd ( range ) 69.1 13.7 ( 2092 ) years and 36% were female .
mean bmi was 27 5 ( 1744 ) kg / m and lv ejection fraction was 60 15 ( 1986)% , respectively .
table 1basic characteristics of the 108 study participantsvariablemean sd ( range)age , years69.1 13.7 ( 2092)women , n ( % ) 39 ( 36%)height ( cm)172 9 ( 146189)body mass index ( kg / m)27 5 ( 1744)systolic blood pressure ( mm hg)146 32 ( 58250)diastolic blood pressure ( mm hg)81.5 20 ( 32161)heart rate ( bpm)78.7 24 ( 29145)atrial fibrillation , n ( % ) 22 ( 20%)prior hypertension , n ( % ) 39 ( 36%)prior diabetes , n ( % ) 18 ( 17%)prior myocardial infarction , n ( % ) 33 ( 31%)prior angina , n ( % ) 27 ( 25%)prior heart failure , n ( % ) 12 ( 11%)prior peripheral vessel disease , n ( % ) 13 ( 12%)prior stroke , n ( % ) 12 ( 11%)data are presented as mean sd ( range ) unless otherwise specified .
basic characteristics of the 108 study participants data are presented as mean sd ( range ) unless otherwise specified .
median time used for pocket was 4.2 min ( range : 2.313.0 ) . image quality and interpretation were generally good ( table 2 ) .
specifically a high feasibility ( 98% ) for cardiac structures was seen , whilst it was somewhat lower for non - cardiac structures such as the intra - abdominal vessels ( 71% ) .
table 2feasibility of point - of - care pocket - sized echocardiographystructureassessed to satisfaction , n ( % ) left ventricle108 ( 100)right ventricle106 ( 98)pericardial space108 ( 100)left atrium105 ( 97)heart valves106 ( 98)pleural space102 ( 94)aa77 ( 71)inferior vena cava85 ( 79)aortic , mitral , tricuspid and the pulmonary valves . feasibility of point - of - care pocket - sized echocardiography aortic , mitral , tricuspid and the pulmonary valves . the correlations of semi - quantitative assessment of cardiovascular structures and function indices between pocket and high are shown in tables 3 and 4 .
lv regional and global function and rv size and function showed almost perfect correlation with r ( 95% ci ) : 0.92 ( 0.830.99 ) , 0.95 ( 0.900.99 ) and 0.85 ( 0.651.0 ) , respectively .
classification of valvular function indices between pocket and high correlated well for aortic , mitral and tricuspid regurgitations ( r 0.81 ) .
grading of aortic valve calcification or stenosis showed substantial correlation with r ( 95% ci ) : 0.62 ( 0.420.79 ) .
table 4 and figure 1 illustrate the agreement of pocket with high regarding the assessments of valvular function .
severe pulmonary regurgitation and mitral stenosis was only present in one patient each and no pulmonary stenosis was detected ( data not tabulated ) .
table 3correlations of semi - quantitative echocardiographic indices between pocket - sized echocardiography and reference methodgrading of : ntotalnpathologyr ( 95% ci)global lv function108350.95 ( 0.900.99)apparent lv regional dysfunction108350.92 ( 0.830.98)rv function106100.85 ( 0.651.0)size of the left atrium107690.65 ( 0.510.76)aa6771.0 ( 1.0)pleural effusion85140.89 ( 0.741.0)inferior vena cava760.68 ( 0.530.80 ) correlations of semi - quantitative echocardiographic indices between pocket - sized echocardiography and reference method ntotal , total number in the analyses ; npathology , total number with the described pathology .
reference method was radiologic examinations and high - end echocardiography . in case of doubt ,
agreement between point - of - care pocket - sized echocardiography and reference echocardiography of different cardiac indices lv , left ventricle ; rv , right ventricle ; la , left atrium .
pocket 2/1/0/+1/+2 refer to underestimation ( ) and overestimation ( + ) by pocket of the described indices compared with reference echocardiography .
all indices of valvular function graded as normal , or mild , moderate , and severe pathology .
the number of patients with any ; aortic valve calcification / stenosis , aortic regurgitation , mitral regurgitation , or tricuspid regurgitation by high - end echocardiography was 24 , 31 , 54 , and 34 , respectively . pocket 2 , 1 , + 1 and + 2 refer to grades of underestimation ( ) and overestimation ( + ) of the described pathology compared with reference echocardiography .
visual estimation of the size of the aa had perfect correlation ( 1.0 ) with respect to detecting aneurysms 35 mm .
the degree of la dilatation and end - expiratory ivc diameter showed a less robust correlation , both r= 0.65 ( ivc , r = 0.42 ) .
pericardial effusion was detected in nine ( 8% ) patients and in one patient with insignificant pericardial effusion this was missed by pocket .
detection of pleural effusions had an overall correlation of r = 0.82 ( 0.791.0 ) .
table 5 shows the high sensitivity , specificity , positive , and negative predictive values of pocket with respect to detecting at least moderate pathology of the cardiovascular indices .
table 5sensitivity , specificity , positive , and negative predictive value of point - of - care pocket - sized echocardiography to detect pathology compared with reference methodto detect : npathology ( ntotal)sensitivity ( % ) specificity ( % ) ppv ( % ) npv ( % ) at least moderate lv dysfunction35 ( 108)97999799any lv regional dysfunction35 ( 108)97999296any rv dysfunction10 ( 106)90998298any dilatation of the left atrium69 ( 107)81688573any abdominal aortic aneurysms7 ( 67)100100100100any pleural effusion14 ( 85)93988797any pericardial effusion9 ( 108)8999100100at least moderate aortic stenosis8 ( 106)6310010097at least moderate aortic regurgitation6 ( 106)83998399at least moderate mitral regurgitation14 ( 107)93999399at least moderate tricuspid regurgitation8 ( 108)88987898abbreviations and explanations as in table 3 .
sensitivity , specificity , positive , and negative predictive value of point - of - care pocket - sized echocardiography to detect pathology compared with reference method abbreviations and explanations as in table 3 .
the coefficients of variation for all presented echocardiographic indices were 6.0% , indicating low interanalyser variability of the reference method .
mean sd ( range ) time used for reference echocardiography , excluding post - processing beyond calculation of ejection fraction was 17.2 3.8 ( 1232 ) min .
this study of 108 patients admitted to a medical department shows that bedside , limited , semi - quantitative point - of - care ultrasound examination with a pocket - sized device can offer high - quality assessment of cardiac structures , cardiac function indices , abdominal great vessels and the pleural space .
the pocket - sized ultrasound examinations were highly feasible and the agreement with reference methods was excellent for most indices .
the presented findings are in line with recent publications from echo lab 's and outpatient clinics with respect to feasibility and reliability . however , direct comparisons between studies are difficult due to different populations and exclusion criteria .
we excluded only patients who did not consent to participate or remain long enough in - hospital to have a reference echocardiography for comparison .
furthermore , our study was conducted at the bedside by cardiologists , in sub - optimal examination conditions , on call during busy working hours , in a department where most admissions are on an emergency basis .
as shown by supplementary material online , figures s1 and s2 there was a modest underestimation of valvular pathology by pocket compared with high .
this may be explained by the lack of spectral doppler and the lower resolution ( 240 320 pixels ) on the vscan with inferior visualization of the valvular cusps .
however , there was no misclassification of valvular dysfunction in those with severe aortic stenosis .
colour - coded images are limited by a low frame rate , but this is compensated for by the vendor by a high sensitivity . very small or insignificant leakages may be bloomed and this may account for some of the overestimated pathology presented in supplementary material online , figures s1 and s2 . there were no misclassifications of severe aortic , mitral and tricuspid regurgitations .
thus , it does not seem to be any limitation for the clinical use of the colour mode .
the size of the left atrium and the inferior vena cava showed only substantial agreement between pocket and high .
this may primarily be related to timing of the measurements in the cardiac or respiratory cycles and the time delay of median 17 h between pocket and high .
as the pocket device is not able to show the cyclicity of the cardiac or respiratory phases , timing of measurements is done by visual assessment only .
as the dimension of the inferior vena cava is an indirect measure of right atrial filling pressure , the delay from pocket to high may bias the analyses of reliability , related both to physiologic conditions and any given treatment .
the lack of m - mode and ecg timing on the pocket device may lead to inaccurate measurements .
the clinical implication of our study is that pocket - sized device can safely be implemented as a bedside screening device during ward rounds when operated by experienced users .
further work should address whether point - of - care pocket influences workflow in hospitals and if our findings are reproducible by less - experienced users .
the applicability of this study may be limited in that all pocket examinations were performed by experienced cardiologists with a special interest in echocardiography .
how feasible and reliable the use of pocket by non - experts is in similar situations remains uncertain .
thus , the pocket and the high examinations were performed under different conditions and this may influence both feasibility and reliability .
however , the aim of this study was to assess the feasibility and reliability of pocket used as a bedside screening device and therefore this was necessary . the time delay ( median 17.3 h ) between pocket and high examinations may bias the analyses of reliability , related both to physiologic conditions , disease progression or regression and any given treatment .
lack of spectral doppler capability makes assessment of valvular pathology according to recommended guidelines difficult . instead
the quantification of pathology was assessed based on colour doppler , grey - scale images of leaflet thickening , calcification and mobility .
however , the high sensitivity , specificity , and positive and negative predictive values of pocket with respect to detecting at least moderate pathology shows that pocket may serve as an efficient tool for triage of the patient in need of a complete echocardiographic examination . although pocket quickly performs a limited semi - quantitative assessment well , it is not as accurate or reliable as the gold standard techniques .
pocket - sized echocardiography is as an adjunct to physical examination and a general screening tool . in settings where referral to formal imaging techniques is warranted pocket is no substitute .
the applicability of this study may be limited in that all pocket examinations were performed by experienced cardiologists with a special interest in echocardiography .
how feasible and reliable the use of pocket by non - experts is in similar situations remains uncertain .
thus , the pocket and the high examinations were performed under different conditions and this may influence both feasibility and reliability . however , the aim of this study was to assess the feasibility and reliability of pocket used as a bedside screening device and therefore this was necessary . the time delay ( median 17.3 h ) between pocket and high examinations may bias the analyses of reliability , related both to physiologic conditions , disease progression or regression and any given treatment .
lack of spectral doppler capability makes assessment of valvular pathology according to recommended guidelines difficult . instead the quantification of pathology was assessed based on colour doppler , grey - scale images of leaflet thickening , calcification and mobility .
however , the high sensitivity , specificity , and positive and negative predictive values of pocket with respect to detecting at least moderate pathology shows that pocket may serve as an efficient tool for triage of the patient in need of a complete echocardiographic examination . although pocket quickly performs a limited semi - quantitative assessment well , it is not as accurate or reliable as the gold standard techniques .
pocket - sized echocardiography is as an adjunct to physical examination and a general screening tool . in settings where referral to formal imaging techniques is warranted pocket is no substitute .
focused point - of - care ultrasound examinations of 4 min duration with a pocket - sized device can offer high - quality semi - quantitative assessment of cardiac structures and function , as well as abdominal great vessels and the pleural space .
the pocket - sized device can safely be implemented as a bedside screening device in the routine clinical practice of experienced operators .
this study is funded by the nord - trndelag health trust , norway and the norwegian university of science and technology , norway .
| aimsto study the reliability and feasibility of point - of - care pocket - sized echocardiography ( pocket ) at the bedside in patients admitted to a medical department at a non - university hospital.methods and resultsone hundred and eight patients were randomized to bedside pocket examination shortly after admission and later high - end echocardiography ( high ) in the echo - lab .
the pocket examinations were done by cardiologists on their ward rounds .
assessments of global and regional left ventricular ( lv ) function , right ventricular ( rv ) function , valvular function , left atrial ( la ) size , the pericardium and pleura were done with respect to effusion and measurements of inferior vena cava ( ivc ) and abdominal aorta ( aa ) were performed .
correlations between pocket and high / appropriate radiological technique for lv function , aa size and presence of pericardial effusion were almost perfect , with r 0.92 . strong correlation
( r 0.81 ) was shown for rv and valvular function , except for grading of aortic stenosis ( r = 0.62 ) .
the correlations were substantial for ivc and la dimensions .
median time used for bedside screening with pocket was 4.2 min ( range : 2.313.0 ) .
there was excellent feasibility for cardiac structures and pleura , which was assessed to satisfaction in 94% of patients .
lower feasibility ( 7179% ) was seen for the abdominal great vessels.conclusionpoint-of-care semi - quantitative evaluation of cardiac anatomy and function showed high feasibility and correlation with the reference method for most indices .
pocket - sized echocardiographic examinations of 4 min length , performed at the bedside by experts , offers reliable assessment of cardiac structures , the pleural space and the large abdominal vessels.clinical trial registration : http://www.clinicaltrials.gov ; unique i d : nct01081210 . |
nasopharynx is the part of the pharynx that lies behind the nasal cavity and above the soft palate .
masses in the nasopharynx form a heterogeneous group of lesions with a broad spectrum of histopathological features . in other words , a variety of benign and malignant pathologies can be seen in this anatomical area . the nasopharynx is not easily available , and the initial presentation of nasopharyngeal lesions varies widely , with malignant lesions rarely remaining localized to the nasopharynx .
neck mass , nasal obstruction , epistaxis , and diplopia are the common presenting symptoms .
although the presenting aspect and advanced imaging methods help in reaching an assumptive diagnosis , histopathological examination remains the mainstay of determining the final diagnosis .
thus , a careful histological workup is essential for a correct diagnosis and proper intervention .
the absence of differentiation of benign and malignant lesions at initial exhibition leads to significant lag in the initial diagnosis and therapy .
as one reviews the literature , it is clear that there are some studies regarding the clinical features , treatment , and outcome of nasopharyngeal tumors ( 24 ) .
our pathology ward is a referral center in yazd province and also for the south and southeast areas of the country . as a result , although this study is an institutional base research , it has epidemiological value . as stated earlier , it is important to know the range of non - neoplastic lesions in this region and to differentiate them from neoplastic lesions .
however , to the best of our knowledge , no definitive study on clinico - pathology and outcome of nasopharyngeal lesions from this region of iran has been reported to date .
so , the aim of this study was to define the ascertained clinicopathological features and treatment results of these lesions in a major tertiary care hospital located in central iran .
in this cross sectional , retrospective project , the medical records of the patients from 2005 to 2014 were reviewed at shahid sadoughi hospital and shahid ramazanzadeh radiotherapy center in yazd , iran .
, we recorded the patient s hospital registration number ; date of admission ; and personal information , including age , gender , address , anatomical site , clinical complaint , histological diagnosis , stage of disease , therapeutic approach , and survival .
we should add that histopathological diagnosis was based on hematoxylin & eosin - stained slides , and the immunohistochemistry ( ihc ) method was used in cases in which it was necessary .
this study was approved by the ethics committee of islamic azad university of medical sciences , central yazd branch ( ref no .
: 10510101921015 , june 2014 ) , after which the forms for recording demographic data were completed .
overall survival ( os ) was calculated from date of diagnosis until death or the date of the last follow - up .
the patients were staged according to the tumor , node , and metastasis ( tnm ) staging system .
survival data were analyzed using kaplan - meier estimates , and multivariate analysis was performed using the cox regression method .
statistical analyses were performed using ibm spss statistics , version 22 ( ibm corp . , armonk
in this cross sectional , retrospective project , the medical records of the patients from 2005 to 2014 were reviewed at shahid sadoughi hospital and shahid ramazanzadeh radiotherapy center in yazd , iran .
, we recorded the patient s hospital registration number ; date of admission ; and personal information , including age , gender , address , anatomical site , clinical complaint , histological diagnosis , stage of disease , therapeutic approach , and survival .
we should add that histopathological diagnosis was based on hematoxylin & eosin - stained slides , and the immunohistochemistry ( ihc ) method was used in cases in which it was necessary .
this study was approved by the ethics committee of islamic azad university of medical sciences , central yazd branch ( ref no .
: 10510101921015 , june 2014 ) , after which the forms for recording demographic data were completed .
overall survival ( os ) was calculated from date of diagnosis until death or the date of the last follow - up .
the patients were staged according to the tumor , node , and metastasis ( tnm ) staging system .
survival data were analyzed using kaplan - meier estimates , and multivariate analysis was performed using the cox regression method .
statistical analyses were performed using ibm spss statistics , version 22 ( ibm corp . , armonk , ny , usa ) .
we reviewed the records of approximately 110,000 patients who were referred to the shahid sadoughi pathology department in yazd , iran , over a 10-year period .
there were 85 males and 38 females ( m : f ratio = 2.2:1 ) .
of the 123 cases , there were 83 patients with malignant neoplasms and 40 patients with non - malignant lesions .
the frequencies of the different types of lesions and presenting symptoms are listed in table 1 .
the most common malignant tumor was nasopharyngeal carcinoma , and the most common benign lesion was angiofibroma ( figure 1 ) .
the most common presenting symptoms were neck swelling ( 36.6% ) hearing loss ( 33.3% ) , nasal obstruction ( 30.1% ) , and epistaxis ( 23.6% ) . among the patients ,
9.5% were in stage i , 28.6% were in stage ii , 40.5% were in stage iii , and 21.4% were in stage iv . on initial diagnosis , 24.4% of the patients underwent surgery alone , while 3.3% of the patients received chemotherapy alone , 0.8% received radiotherapy alone , and 0.85% received both chemotherapy and surgery .
among the patients , 47.2% received both chemotherapy and radiotherapy , and 15.4% received a combination of radiotherapy , chemotherapy , and surgery .
some of the patients , i.e. , 8.1% , elected to have no treatment at all .
the most common type of treatment in malignant tumor was combined chemotherapy and radiotherapy , while surgery was the most common therapeutic modality for benign lesions . at the end of the study ,
there were 22 deaths due to malignant tumor and two deaths due to unrelated causes .
the average survival for our patients was 94.5 4.32 months ( 95% ci : 86.03102.97 months ) .
figure 2 shows that , during the period from 0 to 85 months , the os had decreased and then was constant . according to this study ,
most patients who were diagnosed with nasopharyngeal lesions were referred to the center in 2009 , 2012 , and 2013 .
male patients had a lower os rate than female patients , although this difference failed to reach statistical significance ( p = 0.38 ) .
younger patients ( ages 029 ) survived longer than the older patients ( age > 50 ) .
survival was worse in patients who presented with a cervical mass , hearing loss , and without nasal obstruction , but , again , the differences failed to reach statistical significance ( p = 0.33 , 0.95 , and 0.013 , respectively ) .
the best os was observed in patients with benign lesions ( all of them were alive ) , lower stages ( stage ii ) , and those who underwent surgery alone ( p = 0.001 , 0.02 , and 0.003 , respectively ) ( figure 3 ) .
there was an association between age and epistaxis ( more common in younger patients ) , nasal obstruction ( more common in younger patients ) , and hearing loss ( observed more often in older patients ) ( p = 0.00 , 0.018 , and 0.026 , respectively ) .
in addition , we noted an association between the type of tumor and the frequency of a mass in the neck ( more common in malignant tumor ) , epistaxis ( observed more often in benign lesions ) , and hearing loss ( more common in malignant tumors ) ( p = 0.00 , 0.001 , and 0.07 , respectively ) .
nasopharyngeal masses in adults present a bewildering problem because of the fear of malignancy . the purpose of this study was to analyze the clinicopathological pattern and survival of patients who had nasopharyngeal lesions in yazd , iran .
the mean age of the patients at the time of diagnosis was 41.51 20.33 years .
for example , in tondon s study , a younger peak age of presentation was recorded ( 2029 ) than in our study ( 5 ) . in another study ,
the age range in one recent study was similar to that in our study ( less than 1 to 76 ) ( 3 ) . in the present study ,
there were 85 males and 38 females . in khan s study , presentations among males outnumbered those among females by 2.3 to 1 ( 6 ) . in another study , these masses had predilection for males with a male to female ratio of 1.98:1 , similar to a study by zafar et al .
however , a nigerian study and a study in nepal indicated female preponderance ( 7 , 8) . in our study , the common presentation of nasopharyngeal masses were neck swelling ( 36.6% ) , aural difficulties ( 33.3% ) , nasal obstruction ( 30.1% ) , and epistaxis ( 23.6% ) , which was in agreement with other studies ( 2 , 7 ) .
mention should be made that serous otitis media resulting in deafness is an accepted index of nasopharyngeal obstruction , and the possibility of a nasopharyngeal malignancy must be considered in patients , especially adults .
careful evaluation under anesthesia and biopsy of the nasopharynx is routinely undertaken in many centers to rule out nasopharyngeal malignancy in these patients . in one study ( 9 ) , 4.7% of the adults with conductive hearing loss secondary to serous otitis media were found to have a malignancy on nasopharyngeal biopsy .
thus , these authors suggested a high index of suspicion of a nasopharyngeal malignancy in adults presenting with serous otitis media . in the current study , there were 83 patients with malignant neoplasms and 40 patients with non - malignant lesions .
however , in one study , non - neoplastic lesions made up 81.6% of the total cases of nasal cavity , paranasal sinuses , and nasopharynx ( 3 ) .
similarly , a high portion of non - neoplastic lesions also was noted in the study by zafar et al .
( 4 ) , showing 89% of non - neoplastic lesions . in another research , benign disease was detected in 97.4% of the cases ( 2 ) .
in addition , in one research , the histology of nasopharyngeal masses of hiv positive and hiv negative patients were compared .
malignancies were significantly more common in the hiv negative group than in the hiv positive group ( 10 ) . on the contrary , maruyama et al . ( 11 ) believed that most tumors that occur in the nasopharynx are malignant , which was in concordance with our results .
we encountered only one case of osteosarcoma and adenoid cystic carcinoma and two cases of chordoma , which are uncommon tumors . in the present study ,
eight cases of non - hodgkin s lymphoma were reported , accounting for 6.5% of all of the tumors , confirmed by ihc .
olfactory neuroblastoma is a rare neuroectodermal tumor that arises from the olfactory sensory epithelium in the upper nose .
we found a single case of olfactory neuroblastoma , in agreement with parajuli et al .
fibroma , neurofibroma , and papilloma are the most commonly encountered benign tumors in the nasopharynx .
juvenile nasopharyngeal angiofibroma is the most common benign tumor of the nasopharynx ( 12 ) .
the tumors peak in the second decade of life , and they are observed more commonly in male adolescents ( 12 ) . in dinesh
garq s study ( 3 ) , most of nasopharyngeal masses were of adenotonsillar hypertrophy , in disagreement with biswas et al .
( 13 ) , who found that antrochoanal polyp to be the most common nasopharyngeal masses . in another study
( 2 ) , reactive lymphoid hyperplasia was the most common lesion ; it was detected in 92.71% of benign cases .
in khan s study , the histopathological examination of 240 cases presenting with a mass in the nasal cavity , para - nasal sinuses , and nasopharynx indicated that there were 144 cases ( 60% ) of tumor - like lesions , and tumors constituted 96 cases ( 40% ) .
of 56 cases of benign masses , the most common type was angiofibroma , followed by inverted papilloma ( 6 ) . in another study , non - tumoral nasopharyngeal lesions were more common than neoplastic masses ( 94.6% versus 5.4% ) ( 3 )
we observed nine cases of non - specific inflammation , but there were no cases of tuberculosis or fungal infection .
this difference might be due to higher prevalence of tuberculosis in some parts of the world . in the current study ,
it is said that squamous cell carcinoma is the most common type of nasopharyngeal tumors .
nasopharyngeal carcinoma has a propensity to affect relatively young people ; the loss of working life due to nasopharyngeal carcinoma is serious .
the geographical differences in its incidence and mortality are indicative of the universal differences in the prevalence of risk factors . genetic vigilance , early - age exposure to some carcinogens , and latent ebv infection
are suggested to be three major etiological factors ( 15 ) . in one research ,
undifferentiated nasopharyngeal cancer was the most common malignant disease , being diagnosed in 82.95% of all nasopharyngeal malignancies and in 4.43% of all nasopharyngeal lesions ( 2 ) .
( 6 ) included 40 malignant cases , and the most common lesion was squamous cell carcinoma , followed by nasopharyngeal carcinoma . among our patients ,
9.5% were in stage i , 28.6% in stage ii , 40.5% in stage iii , and 21.4% in stage iv .
the nasopharynx is not easily attainable , and , at the time of diagnosis , the disease is in an advanced stage .
commonly , patients present with advanced disease that has metastasized to the lymph nodes in the neck .
therefore , there is an obvious need for early diagnosis and treatment method to reduce the fatality of nasopharyngeal carcinoma .
abdullah et al . ( 16 ) reported the feasible agents of late presentation of nasopharyngeal carcinoma include lag in searching medical consultation , perplexing character of presenting symptoms , bothersome nature of clinical evaluation , and quiet spread of the tumor .
surgical excision is the principal manner of treatment in most of non - neoplastic and benign neoplastic lesions and wide surgical cutting , radiotherapy or chemotherapy in malignant tumors .
since complete surgical excision is impossible owing to close vicinity to base of skull , radiation therapy has been the principal method of treatment , and chemoradiation is the preferable procedure for advanced stages . in our study ,
the most common type of treatment in malignant tumor was combined chemotherapy and radiotherapy , and surgery was the most common therapeutic modality that was applied in benign lesions .
the average survival for our patients was 94.5 4.32 months ( 95% ci : 86.03102.97 months ) .
the median survival time of nasopharyngeal carcinoma varies between 12.9 and 26.8 months ( 17 , 18 ) . but a variable survival outcome is frequently discovered in clinical practice .
the overall survival in a study conducted in malaysia was 31.30 months ( 19 ) , and the reasons for different survivals in patients with nasopharyngeal carcinoma in different studies are described diversely ( 20 ) .
it seems that different therapeutic approaches , heterogeneous environmental and genetic risk factors , and the dynamic nature of the applied staging system are effective . among these
, the advanced stage of the disease at the time of diagnosis is an important cause of lower survival in much of the research . in a study conducted by chee eephua et al .
( 21 ) , it was shown that patients in stage i had the best survival ( 81.8% ) and those in stage iv had the worst ( 25.9% ) .
radiation therapy has been the mainstay of treatment , and chemoradiation is the preferred method for advanced stages .
although in the current study , stage iii was the most common stage , the relatively high survival in our patients might be due to the higher number of patients in our study who received concurrent chemo - radiation compared to other studies . in the current study ,
survival was worse in patients presenting with cervical mass , hearing loss , and without nasal obstruction .
in addition , we noted an association between the type of tumor and the frequency of neck mass ( more common in malignant tumor ) , epistaxis ( more seen in benign lesions ) , and hearing loss ( more common in malignant tumors ) .
our study and other similar studies showed that complete clinical and histopathological connection helps the physician to classify the nasopharyngeal lesions into various non - neoplastic and neoplastic types . but
our experience suggests that hearing loss or cervical mass are uncommon in patients with benign nasopharyngeal lesions and medical practitioners should be vigilant concerning the possibility of malignancy .
malignant diseases of the nasopharynx were more common than benign pathology in our patients with a nasopharyngeal mass .
regular follow up is necessary for early detection , recurrence , or metastases of malignant tumors . in the presence of clinician - based competence and despite the technical limitations in iran , malignant nasopharyngeal tumors are being treated optimally with the need for development of a better knowledge among the public concerning the importance of the early diagnosis of malignant tumors . | introductionalthough there are some studies regarding the clinical characteristics and outcome of nasopharyngeal tumors , one such study from iran has not been reported to date .
this study aimed to evaluate the clinical features , treatment , and consequences of nasopharyngeal lesions.methodsin this cross sectional study , we conducted a retrospective review of patients who were diagnosed with nasopharyngeal pathologies and treated at shahid sadoughi hospital and shahid ramazanzadeh radiotherapy center in yazd , iran , over a period of 10 years ( from 2005 to 2014 ) .
the variables in the study were the patient s hospital registration number , date , name , age , gender , address , topography , clinical symptoms , morphology , stage , types of treatment , and survival for each subject .
survival data were analyzed using kaplan - meier estimates , and multivariate analysis was performed using the cox regression method .
statistical analyses were performed using ibm - spss , version 22.resultsin the study , there were 123 patients , 85 males and 38 females , who had nasopharyngeal lesions .
the mean age at diagnosis was 41.51 20.33 years .
there were 83 patients with malignant neoplasms and 40 patients with non - malignant lesions .
the most common malignant tumor was nasopharyngeal carcinoma , and the most common benign lesion was angiofibroma .
survival analysis was performed for the 83 patients who had malignant neoplasms , and survival was found to be 94.5 4.32 months .
there were significant differences in survival based on the stage of the disease , histological type , and the type of treatment ( p = 0.001 , 0.02 , and 0.003 , respectively).conclusionin our institutional study , malignant tumors were more common than benign lesions .
patients with nasopharyngeal carcinoma presented relatively late and at an advanced stage .
regular follow - up is necessary for early detection , recurrence , or metastases of malignant tumors . |
periodontal diseases , surgeries , trauma , ridge resorption , and traumatic tooth extraction can result in open interdental spaces , elongated clinical crowns , and altered labiodental / linguoalveolar consonant sound production .
the first step in the management of these problems is surgical correction of the defect .
surgical procedures are invasive , irreversible , technique sensitive , and expensive , with results that are often unpredictable .
gingival prostheses have historically been used to replace lost tissue when other methods ( e.g. , surgery or regenerative procedures ) were considered unpredictable or impossible .
the following case report describes a technique to replace gingival tissue with a comfortable and accurately fitting gingival veneer .
a 42 year - old female patient reported to the department of periodontics , kle v. k. institute of dental sciences , belgaum , with the complaint of receding gums , sensitivity and food lodgement in the maxillary anterior region .
miller 's class iv recession was seen with 14 - 24 , periodontal pockets with 14 - 24 , missing 32 - 42 , and cervical abrasions with 14 , 15 and 24 [ figure 1 ] .
the treatment plan was to first eliminate the periodontal pockets , and restorethe cervical abrasion defects ; this was to be followed by rehabilitation by removable denture for the mandibular anteriors and a gingival prosthesis for the maxillary anteriors .
the patient first received phase - i therapy , which included oral - hygiene instructions , scaling , and root planning by ultrasonic and hand instruments .
she was instructed to use a desensitizing tooth paste and a modified stillman brushing technique and to avoid techniques that could cause damage to the marginal tissues ( e.g. , a scrub technique or bass technique ) .
after 1 week of phase i therapy she was referred to the department of conservative dentistry and endodontics for restoration of the cervical abrasions .
one month after initiation of phase - i therapy , the patient underwent the surgical procedure .
the underlying bony architecture was irregular and was re - contoured using round bur # -3 and copious irrigation [ figure 2 ] .
the flaps were repositioned and sutured using interrupted non - resorbable 4 - 0 silk suture , after which the operated site was covered with a non - eugenol periodontal dressing for protection [ figure 3 ] .
postoperative instructions included advise not to brush the operated area for 2 weeks , and to rinse the oral cavity with chlorhexidine ( 0.2% ) mouthwash twice daily for 2 weeks .
after 1 week , the periodontal dressing and sutures were removed , and the surgical area was flushed with antimicrobial solution [ figure 4 ] .
flap elevated and bone recontouring done flaps sutured and peridontal pack placed postoperative , after 2 weeks the patient was referred to the department of prosthodontics for replacement of 32 - 42 with a removable partial denture . for the gingival veneer ,
a buccal approach was used to create the master impression with a complete interproximal detail .
a custom tray was used to make a final impression using polyether impression material [ figure 5 ] .
[ figure 6 ] , and a gingival prosthesis was waxed up [ figure 7 ] and processed in heat - cured acrylic resin [ figure 8 ] .
the prosthesis was made extremely thin and flexible so as to engage the undercuts [ figure 9 ] .
sectional impression made on custom tray cast prepared with type iv die stone veneer prepared with heat - cure acrylic postoperative , with gingival veneer and removable denture in the lower anterior region
periodontal disease progression , pocket elimination procedures , and resective osseous surgeries often lead to creation of recession and the potential for a compromised esthetic outcome , especially in the maxillary anterior region gingival defects may be treated with surgical or prosthetic approaches . with successful surgical treatment
such treatments include minor procedures to rebuild papillae and grafting procedures that may involve not only soft - tissue manipulation , but also bone augmentation to support the soft tissue .
it is possible to create esthetically pleasing and anatomically correct tissue contours when small volumes of tissue are being reconstructed , but this method is unpredictable when a large volume of tissue is missing . currently , there is no predictable surgical method for correcting esthetic deformities that result from generalized attachment loss . in such situations ,
gingival prosthesis can be used and various authors have described their uses and methods of construction.[69 ] in the present case the patient had a compromised periodontal condition in the maxillary anterior region .
after phase i , the gingiva remained soft , with an average probing pocket depth of 6 mm .
transgingival probing revealed an uneven bony architecture in the maxillary anterior teeth and hence pocket elimination and re - contouring of the underlying bone was carried out with flap surgery .
two months after the surgery , the gingival was firm and resilient , the probing pocket depth was 3 mm , and a uniform bony contour was achieved , thereby creating a suitable environment for gingival prosthesis .
the gingival prosthesis can replace a large volume of tissue that has been lost to the disease process or its treatment .
the advantage of the prosthesis is that it can be easily cleaned , creates an ideal contour with removable prosthodontic materials , and does not disturb the other dental units . in the present case the prosthesis provided an esthetic result ,
gingival veneer is also known as gingival mask , gingival slip , and party gums .
the periodontal attachment loss , loss of interdental papilla , and gingival recession in the maxillary anterior region can often lead to esthetic and functional clinical problems . in such cases , it becomes a challenge for the dentist to maintain hygiene and at the same time provide an esthetic solution for the missing gingival tissue .
removable gingival prosthesis are a good treatment option in advanced tissue loss , achieving esthetic results and patient satisfaction .
such prostheses , in the hands of a trained and experienced clinician , offer predictable and satisfactory results in the management of esthetic problems . | periodontal diseases result in damage and destruction of the supporting structures of the teeth , including the bone and periodontal ligament . in some cases , there is loss of gingival coverage of the teeth in esthetic regions , with gingival recession and loss of interdental papilla .
the surgical treatment in such situations is costly , requires prolonged healing time , and the results are often unpredictable ; this makes it an unpopular choice .
the reconstruction of these areas with prosthesis like gingival veneer can be useful to correct the deformities remaining after the control of periodontal diseases , especially in the maxillary anterior region .
dental practitioners can provide comfortable and accurately fitting gingival veneers , that are very stable and esthetically restore the interdental papilla and gingival recession defects .
this method is an innovative treatment option for dealing with esthetic challenges and long - term dental health . |
it is a well - known fact that controversy still exists as to whether the condyle needs an open treatment or closed treatment to regain its maximum functionality .
closed reduction is often associated with reduced mouth opening , decreased patient compliance , and potential for ankylosis , internal derangement of joint and delayed restoration of function . owing to these factors surgeons today prefer open reduction and internal fixation of displaced condylar fractures in adults , as this permits good anatomic repositioning and immediate restoration of function .
advocates of closed reduction feel that condyle can be fixed in unphysiological position with open reduction leading to severe postoperative ( post op ) degenerative joint changes and injury to the facial nerve . in spite of these drawbacks , open reduction and internal fixation of condylar fractures ,
if performed as per standardised surgical procedures ( access through a retromandibular / preauricular approach and fixation of condyle respecting champy 's principles of osteosynthesis ) have been reported to give good , predictable and reproducible results . with recent advances in the imaging techniques with computed tomography ( ct ) and availability of three - dimensional visualisation of the fractured condyle
, there is a tremendous improvement in the understanding of the nature , degree of displacement , dislocation and other minute details of these fractures .
these findings were not possible with conventional radiography , which provided the images in two - dimensions .
in this prospective study , 10 patients attending the department of oral and maxillofacial surgery with unilateral subcondylar fracture confirmed with panoramic radiograph were included after ethical committee approval was obtained from institutional review board and structured informed consent was taken after explaining the possible hazards of radiation with ct .
the mean age of the patient was 22.5 with an age range of 15 - 30 years .
patients with unilateral subcondylar fracture of the mandible with displacement , deviation and dislocation of the condyle , age below 60 years and young patients with a full set of permanent teeth were included in this study .
bilateral condylar fractures , patients not willing for open reduction and opting for conservative management and medically compromised patients were excluded from the study .
all the patients underwent a routine surgical workup , which included surgical profile , chest x - ray , electrocardiograph and pre anaesthetic evaluation .
all the patients were treated by the same surgeon , underwent open reduction and rigid fixation using a retromandibular transparotid approach and fractures fixed with two holed 2 mm stainless steel double miniplate osteosynthesis .
a 3 - 4 cm incision was placed inferior to pinna of the ear and 1 cm posterior to the angle of the mandible [ figure 1 ] .
the incision was placed through the skin and subcutaneous tissue and dissection carried out until the subplatysmal layer was reached .
blunt dissection was done in retromandibular region , through the parotid gland and fibres of the masseter were identified and incised .
the condyle and posterior border of the ramus were exposed by subperiosteal dissection in a postero lateral direction .
a firm downward pressure was applied intraorally to the ipsilateral third molar to depress the mandible , thereby facilitating reduction of the displaced condylar fragment .
fixation was achieved with a 2 mm , two holed stainless steel osteosynthesis system [ figure 2 ] .
watertight closure of the masseter and parotid capsule was achieved with resorbable sutures , and the skin was approximated with nonresorbable sutures .
exposure of fracture site through a retromandibular approach fixation of fracture with 2 mm double miniplate patients were evaluated by ct imaging pre operatively and 1 week post operatively .
a siemens six emotions scanner was used for the ct examination with the following scan parameters : slice thickness 2 mm ; scan time 20 s ; 70 kv ; and 250 mas .
transverse , coronal and sagittal projections were made to allow both condylar processes to be observed .
the measurements were done on standard anatomical landmarks as suggested by choi et al . in the transverse plane [ figure 3a c ]
a reference paramedian line was drawn to pass through the nasal septum and the centre of the occipital foramen .
the following parameters were then measured : condylar distance ( distance between the condyle and the paramedian reference line ) ; condylar length ( cl : longest diameter of the condyle ) ; and condylar angulation ( ca : angulation between the long axis of the condyle and the transverse posterior line ) . in the coronal plane
[ figure 4a c ] the parameter measured was proximal distal stump angulation ( pdsa ) .
in the sagittal plane [ figure 5a c ] the following parameters were measured : the superior joint space ( s1 : distance between the roof of the temporal fossa and the top of the condylar head ) ; the closest anterior joint space ( s2 ) ; and the closest posterior joint space ( s3 ) and ramus height ( rh ) : distance from the posterior most point on the angle and superior most position on the condylar head .
the data obtained were tabulated as preoperative ( pre op ) master chart and post op master chart for all the parameters .
all measurements were done directly in the computer using syngo samiro , siemens emotions six software .
measurements were done by four different persons and mean of the four values were taken .
all parameters measured on the pre op ct and post op ct were statistically compared for three variables : ( a ) line diagram showing measurement made in axial plane , ( b ) preoperative computed tomography ( ct ) showing measurements in axial plane , ( c ) postoperative ct measurements in axial plane ( a ) line diagram showing measurement in sagittal plane , ( b ) preoperative computed tomography showing measurement in sagittal plane ( c ) postoperative measurements in sagittal plane ( a ) line diagram showing measurement in coronal plane , ( b ) computed tomography ( ct ) slice showing measurement in coronal plane , ( c ) postoperative ct measurement in coronal plane
pre op fracture and nonfracture side.post op fracture and nonfracture side.pre op fracture and post op fracture side .
pre op fracture and nonfracture side .
the results obtained for each parameter were statistically analysed for the three variables using a wilcoxson 's signed rank test for paired samples .
all the patients underwent a routine surgical workup , which included surgical profile , chest x - ray , electrocardiograph and pre anaesthetic evaluation .
all the patients were treated by the same surgeon , underwent open reduction and rigid fixation using a retromandibular transparotid approach and fractures fixed with two holed 2 mm stainless steel double miniplate osteosynthesis .
a 3 - 4 cm incision was placed inferior to pinna of the ear and 1 cm posterior to the angle of the mandible [ figure 1 ] .
the incision was placed through the skin and subcutaneous tissue and dissection carried out until the subplatysmal layer was reached .
blunt dissection was done in retromandibular region , through the parotid gland and fibres of the masseter were identified and incised .
the condyle and posterior border of the ramus were exposed by subperiosteal dissection in a postero lateral direction .
a firm downward pressure was applied intraorally to the ipsilateral third molar to depress the mandible , thereby facilitating reduction of the displaced condylar fragment .
fixation was achieved with a 2 mm , two holed stainless steel osteosynthesis system [ figure 2 ] .
watertight closure of the masseter and parotid capsule was achieved with resorbable sutures , and the skin was approximated with nonresorbable sutures .
exposure of fracture site through a retromandibular approach fixation of fracture with 2 mm double miniplate patients were evaluated by ct imaging pre operatively and 1 week post operatively .
a siemens six emotions scanner was used for the ct examination with the following scan parameters : slice thickness 2 mm ; scan time 20 s ; 70 kv ; and 250 mas .
transverse , coronal and sagittal projections were made to allow both condylar processes to be observed .
the measurements were done on standard anatomical landmarks as suggested by choi et al . in the transverse plane [ figure 3a c ]
a reference paramedian line was drawn to pass through the nasal septum and the centre of the occipital foramen .
the following parameters were then measured : condylar distance ( distance between the condyle and the paramedian reference line ) ; condylar length ( cl : longest diameter of the condyle ) ; and condylar angulation ( ca : angulation between the long axis of the condyle and the transverse posterior line ) . in the coronal plane
[ figure 4a c ] the parameter measured was proximal distal stump angulation ( pdsa ) . in the sagittal plane [ figure 5a c ]
the following parameters were measured : the superior joint space ( s1 : distance between the roof of the temporal fossa and the top of the condylar head ) ; the closest anterior joint space ( s2 ) ; and the closest posterior joint space ( s3 ) and ramus height ( rh ) : distance from the posterior most point on the angle and superior most position on the condylar head .
the data obtained were tabulated as preoperative ( pre op ) master chart and post op master chart for all the parameters .
all measurements were done directly in the computer using syngo samiro , siemens emotions six software .
measurements were done by four different persons and mean of the four values were taken .
all parameters measured on the pre op ct and post op ct were statistically compared for three variables : ( a ) line diagram showing measurement made in axial plane , ( b ) preoperative computed tomography ( ct ) showing measurements in axial plane , ( c ) postoperative ct measurements in axial plane ( a ) line diagram showing measurement in sagittal plane , ( b ) preoperative computed tomography showing measurement in sagittal plane ( c ) postoperative measurements in sagittal plane ( a ) line diagram showing measurement in coronal plane , ( b ) computed tomography ( ct ) slice showing measurement in coronal plane , ( c ) postoperative ct measurement in coronal plane
pre op fracture and nonfracture side.post op fracture and nonfracture side.pre op fracture and post op fracture side .
the results obtained for each parameter were statistically analysed for the three variables using a wilcoxson 's signed rank test for paired samples .
the statistical analysis of each parameter in three variables revealed that there was a gross change in the dimensions of the parameters obtained in pre op non fractured and fractured side [ table 1 ] .
statistical analysis of preoperative fracture and nonfracture side when these parameters were assessed in post op ct for the three variables there was no statistical difference between the post op fractured side and nonfractured side [ table 2 ] .
this result indicates that condyle can be fixed to its pre fracture conformal position by open method .
statistical analysis of post op fracture and nonfracture side the same parameters were statistically analysed for the three variables in pre op fractured and post op fractured side and found considerable change in the dimensions of the fractured side post operatively suggesting a good achievement of anatomic reduction [ table 3 ]
whether the fractured condyle needs an open treatment or closed treatment to regain its maximum functionality still remains hotly debated .
advocates of closed reduction emphasise that even if condyle is fixed by open method one can not assure reduction close to its pre fracture position and avoid the post op degenerative joint changes . moreover the complex anatomy of the temporomandibular joint ( tmj ) and potential damage to the facial nerve has always added to the problems of access to these joints . with the improved surgical approaches like retromandibular approach for subcondyle and parotidectomy approach for high condyle it is possible to minimise these complications and maximize efficacy of reduction and fixation .
conventional radiographs are generally imprecise in the condylar region due to complicated anatomic bone structure in the area , lack of sharpness and image distortion .
these limitations have been largely overcome by ct which enables the assessment of the joint morphology and condylar position in the mandibular fossa three - dimensionally along with three - dimensional reconstruction of the condyle , which can delineate the minute physiological , mechanical and biological changes in the tmj in the absence of superimposed interfering structure .
there are many long - term studies conducted and published comparing the merits and demerits of closed and open reduction .
however , very few studies have been conducted to show the accuracy achieved by the open method .
this study was basically aimed to assess the accuracy of the open method of treatment with the help of ct and it found very little difference in the anatomical position of the condyle in pre op fracture and post op fracture side . in cases of condylar fractures
the concern is that intraoperative repositioning of fracture borders along the condylar neck will not guarantee a correct three - dimensional physiologic positioning of the condyle in the fossa .
even an intraoperatively correct adjustment of the fracture borders along the buccal aspect will often result in a slight inclination that leads to a significant medial angulation of the condyle .
the ability to perform anatomic reductions is based largely on the access and visibility provided by the chosen surgical approach which in this study is retromandibular approach .
coronal view of ct is the most suitable method of diagnosing high condylar process fractures and other facial fractures as it allows visualization of anatomical structures e.g. , cortical bone loss , sclerosis , and changes in joint morphology and condyle position in the mandibular fossa free of superimposition , providing the viewer with three - dimensional information if sequential images are reconstructed .
coronal slices provides better diagnostic images than axial or sagittal plane because first , coronal plane is perpendicular to both the sagittal and horizontal struts and less slices are required for evaluation of face so less radiation exposure .
in which he did a study in operated cases of condylar fractures after 3 months and compared the fractured side with nonfractured side and found no major difference between the two sides and minimal post op joint changes .
computed tomography images in sagittal plane helps to evaluate the spatial localisation of the fragments and may contribute to determine the choice of better treatment of condylar fractures .
in fact , the three - dimensional reconstruction of ct images allows a more accurate and complete assessment of the articular space .
the reconstruction method provides a complete anatomical picture and directly shows static and functional interactions .
it also helps to assess most important parameters like loss of the vertical rh that is a predictor for the possible malocclusion , asymmetry , decreased posterior facial height , occlusal ca nt and neoarthrosis with the articular eminence . a greater fragment dislocation is the result of a stronger traumatic impact leading to capsular rupture and scar formation . it is thought that mobility of tmj does not depend exclusively from the osseous traumatic alteration but also from muscular and ligament damage with scar formation .
the open reduction can significantly reduce the complication associated with the closed reduction like shorter posterior facial height , rh , occlusal ca nt and post op joint changes .
all the parameters were statistically significant between pre op fracture side and nonfracture side in space 1 , space 2 , and space 3 .
these results revealed that even minute changes in the joint spaces were corrected by open method of treatment and for assessment of this small space ct is the best tool .
if relationship of the condylar head and articular fossa is not maintained it may lead to severe stretching of the articular ligaments and muscles and may have long - term complications of pain , occlusal instability and degenerative joint changes . with open reduction and
ct scan it was possible to achieve almost the same static and functional position to that of the contralateral side .
axial view of ct shows a fractured condylar head , amount of displacement of the fractured segments , deviation , displacement , dislocation and dicapitular fractures of condylar head .
it also gives the clear picture of continuity of the fractured condylar head with distal part of mandibular segment and also medio lateral rotation of the fractured condylar stump .
statistical analysis for cl was insignificant in all the three variables . for cl to increase in length there
needs to be direct fracture of the condylar head or the so - called dicapitular fractures . pertaining to this study
no cases were associated with any fracture of the condylar head and no major changes were seen . even if these fractures were present in any of the cases it is unlikely that these can be picked up by the conventional radiographs .
these fractures can only be diagnosed with the help of the ct scans with three - dimensional reconstruction .
condylar distance is a valuable measurement method as most of the subcondylar fractures tend to displace the head of the condyle medially rather than laterally , anteriorly or posteriorly due to the pull of the lateral pterygoid muscles medially .
two cases in this study had severe rotation of the proximal stump , which were aligned in anatomically stable position .
the lateral pterygoid was left attached to the proximal segment , but has to be detached from the capsule to achieve access to the displaced condylar segment and prevent resorption of the displaced segment .
these findings are in accordance with pereira et al . and suuronen et al . who showed with the help of ct that if these fractures are not treated the relationship of the condyle and fossa does nt improve , instead the reestablishment of occlusion and function appear to occur not as a result of anatomic restitution of condylar height , but as a result of adaptation of the masticatory muscles
the ca is the most frequently evaluated parameter in which changes on the condylar twist formed by the angle between a line from posterior condylar base and condylar head major axis in the axial projection is seen .
this parameter allows a quantitative assessment of the degree of mobility of a fractured condyle in the follow - up after open reduction .
statistical analysis of the ca lead to the conclusion that with open reduction it is possible to fix the condyle in its pre op conformal state and can be assessed successfully with the help of the ct without any interferences and with maximum accuracy .
advantages of rigid internal fixation are accurate fixation , rigidity of bone fragments , primary healing of bone and reduced periods of intermaxillary fixation and allow immediate function .
post op mandibular function was significantly greater in patients treated with miniplates rigid fixation method over other methods .
disadvantages include condylar resorption and osteoarthrosis in cases treated by rigid fixation than in cases using a transosseous wiring .
as no surgical procedures are without complications , along with minor complications of post op oedema , trismus , mild facial nerve weakness in 1 case ( 10% ) there were no major complication associated with any of the procedures except in one case where there was over riding of the proximal and distal stump post operatively , which lead to difference in rh as against the height of the contralateral side post operatively .
as occlusion was stable and displacement was minimal no further operative procedure was done . patient was kept on intermaxillary fixation for a period of 21 days .
the different parameters analysed in this study ( superior joint space , closest anterior joint space , closest posterior joint space , and fossa distance ) proved to be adequate , having a low inter - observer variation and the greatest concordance .
similar study was done in 10 patients with unilateral condylar fractures in which only post op ct scans were taken where as in the present study both pre op and post op ct scans were taken and analysed .
we were able to achieve good anatomical reduction and function post operatively as shown in figure 6a and b. based on this clinical , radiological and statistical analysis it can be said that with open reduction and internal fixation it is possible to fix the condyle in its pre fracture position and computer assisted scans are the ideal imaging tools available at present for evaluation .
this study through its radiological analysis with a pre op and post op ct and statistical analysis of measurements of the anatomical parameters favours the fact that open reduction and internal fixation is a viable choice for three - dimensional anatomical reduction and fixation of the fractured condyle with immediate restoration of form , function and appearance , minimal disability and would lead to minimal post op degenerative joint changes .
there are very few studies in literature which report the immediate assessment of the reduced condyle by open method , so that any inadequacies pertaining to the positioning of the condyle can be addressed rather than waiting for the post op degenerative joint changes to take place .
studies with longer period of follow - up and larger samples can give better understanding of post traumatic changes associated with mandibular condyle . | objective : the aim was to assess the accuracy of three - dimensional anatomical reductions achieved by open method of treatment in cases of displaced unilateral mandibular subcondylar fractures using preoperative ( pre op ) and postoperative ( post op ) computed tomography ( ct ) scans.materials and methods : in this prospective study , 10 patients with unilateral sub condylar fractures confirmed by an orthopantomogram were included . a pre op and post op ct after 1 week of surgical procedure was taken in axial , coronal and sagittal plane along with three - dimensional reconstruction .
standard anatomical parameters , which undergo changes due to fractures of the mandibular condyle were measured in pre and post op ct scans in three planes and statistically analysed for the accuracy of the reduction comparing the following variables : ( a ) pre op fractured and nonfractured side ( b ) post op fractured and nonfractured side ( c ) pre op fractured and post op fractured side .
p < 0.05 was considered as significant.results:three-dimensional anatomical reduction was possible in 9 out of 10 cases ( 90% ) . the statistical analysis of each parameter in three variables revealed ( p < 0.05 ) that there was a gross change in the dimensions of the parameters obtained in pre op fractured and nonfractured side .
when these parameters were assessed in post op ct for the three variables there was no statistical difference between the post op fractured side and non fractured side .
the same parameters were analysed for the three variables in pre op fractured and post op fractured side and found significant statistical difference suggesting a considerable change in the dimensions of the fractured side post operatively.conclusion:the statistical and clinical results in our study emphasised that it is possible to fix the condyle in three - dimensional anatomical positions with open method of treatment and avoid post op degenerative joint changes .
ct is the ideal imaging tool and should be used on a regular basis for cases of condylar fractures . |
however , for surgeons , problems include limited observation of the fixed two - dimensional ( 2d ) monitor in an unnatural posture and loss of instrumental freedom .
sunnyvale , ca ) is a master - slave system and is more suitable than endoscopic surgery from an ergonomic perspective .
the surgeon controls the da vinci surgical system by means of computer interface , and creates an intuitive environment under stereoscopic three - dimensional ( 3d ) imaging .
furthermore , the robotic instrument is designed so that the working tips function like a human wrist .
the da vinci surgical system was used in assessing performance of simple suturing tasks . to evaluate the da vinci s ability to display in both a 2d and 3d mode and intuitive handling of the controller ,
30-cm ti - cron ( sherwood davis & geck , mo ) suture was used .
the robotic instruments remained the same ; the endowist large needle driver ( intuitive surgical inc . ) was used for tests of the dominant hand , and the endowist debakey forceps for the non - dominant hand , and a 0 scope of ten times magnification was used on all tasks .
each surgeon had to thread the needle through all ten holes on the model by the robotic instrument ( fig . 1 ) .
1model for this study three types of suturing task were carried out , as follows : in task 1 , by the dominant hand under 3d - imaging ; in task 2 , by the dominant hand under 2d - imaging ; in task 3 , by the non - dominant hand under 3d imaging . each surgeon placed three sutures for each task .
each surgeon was permitted a 5-min practice maneuver with the robotic system on the console . in task 2 ,
2d imaging was obtained with a 5-mm optic camera ( one side view ) of the da vinci surgical system . to avoid bias related to the type of the task
, procedures were started with task 1 followed by task 2 then task 3 , and these were repeated three times each .
the time to successful completion , accuracy , and the opinion of the level of difficulty were recorded .
the times required for suture ( mean sd ) were as follows : task 1 , 211.7 53.6 s ; task 2 , 331.1 121.2 s ; and task 3 , 237.1 95.2 s. comparing task 1 and task 2 , task 1 took slightly less time ( p = 0.02 ) , and robotic suturing under 3d imaging was significantly faster than under 2d imaging . comparing task 1 and task 3 , there is no difference ( p = 0.19 ) , and robotic suturing with the non - dominant hand does not need significantly more time than with using the non - dominant hand ( fig . 2 ) .
2comparison of times for task 1 , task 2 and task 3 comparison of times for task 1 , task 2 and task 3
suturing and knot - tying during endoscopic surgery cause some frustration and are time consuming .
however , the surgical robot offers the advantages of allowing accurate suturing and in - depth perception during suturing .
we performed this study to evaluate enhanced dexterity related to two intuitive master handles at the remote console and the 3d - imaging afforded by the da vinci surgical system .
we have developed a three - dimensional monitor unit that integrates the operator and the use of 3d- and 2d - monitoring systems was evaluated .
we concluded that the 3d monitor system was preferable to the 2d - system for advanced endoscopic surgery [ 3 , 4 ] . in robotic surgery , badani et al .
the main disadvantage of the surgical robot is the lack of tactile feed back , and the console surgeon must perform suturing relying on visual feedback only . in this study ,
3d imaging enables to recognize the real distance to the holes , and the surgeon could pass a surgical needle through small holes following a pre - indicated direction . a high - resolution , binocular , three - dimensional , magnified imaging of the da vinci surgical system gives the console surgeon feeling of operating in an open surgical technique , and our study shows that the console surgeon can benefit from 3d imaging .
the development of robotic instruments added two more degrees of freedom than conventional endoscopic instruments to seven degrees of freedom .
the presence of the wrist - like joint is particularly useful in procedures like suture and knot - tying , which need high maneuverability and flexibility .
the da vinci surgical system is based on computer - assisted telemanipulation technology and computer technology , such as tremor filtration and motion scaling enhancement , which facilitate maneuverability .
moreover , not only the interface of the master console , but also finger tip controllers make wrist motion feasible and practical . we suggest that that these advantages could increase the manipulative abilities of the surgeon irrespective of the dominant or non - dominant hand . in some procedures , such as coronary artery anastomosis , the surgeon sometimes has to handle the surgical needle with the non - dominant hand , but the advanced robotic system enables the maneuver . | there has been great progress in robotic surgical technology in recent years .
the aim of this study was to objectively quantify robot - enhanced dexterity . to evaluate three - dimensional monitoring and non - dominant hand maneuverability using the da vinci surgical system ,
five surgeons were asked to thread the needle through all 11 holes on the model with handling robotic instrument .
three types of suturing were carried out . in task 1 , sutures were placed using the dominant hand under 3d imaging ; in task 2 , suturing was performed using the dominant hand under 2d imaging ; and in task 3 , suturing was done with the non - dominant hand under 3d imaging .
each surgeon placed three sutures in completing each task . the time to successful completion , accuracy , and
the opinion of the level of difficulty were recorded .
all 45 tasks were completed .
the time required to place each suture ( mean sd ) was as follows : 211.7 50.5 s for task 1 , 331.1 121.2 s for task 2 , and 237.1 95.7 s for task 3 .
task 1 took less time than task 2 ( p = 0.02 ) .
there were no differences in the times between task 1 and task 3 ( p = 0.19 ) .
robotic suturing under 3d imaging is significantly faster than under 2d imaging , and robotic suturing using the non - dominant hand does not need significantly more time than with the non - dominant hand .
technology for robotic surgery could increase the manipulative abilities . |
a 50-year - old woman sought evaluation in our clinic with a complaint of pain in the right elbow joint .
six months earlier , the patient had pain in the right elbow and tenderness in the lateral epicondyle , so the patient received a trigger point injection ( tpi ) two times and intramuscular stimulation ( ims ) under the impression of lateral epicondylitis . following this treatments ,
the patient also received an anterior cervical discectomy and fusion 4 weeks prior to the outpatient visit , due to pain in the right neck and shoulder originating from an intervertebral disc herniation at c6/7 .
there was no history of trauma or underlying diseases . at the time of the outpatient visit ,
a physical examination revealed tenderness in the lateral epicondyle and a positive finding on cozen 's test . in a systemic review
, there were no respiratory symptoms , such as cough , sputum , and dyspnea or systemic symptoms , such as fever , chills , and weight loss . in our patient ,
a tpi , ims , and physical therapy were administered again , which led to an improvement in symptoms . despite the improvement in symptoms ,
however , on physical examination there was a persistent presence of findings , such as tenderness in the lateral epicondyle , limitations in the extension and flexion of the elbow joint , and limitations in the extension of the shoulder joint .
the treatment response , however , was not typical . to make a differential diagnosis , a plain radiograph of the elbow joint and a hematologic examination were performed . on plain radiography
1 ) . on the hematologic testing , the erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp )
the wbc count , rheumatoid factor ( rf ) , and fluorescent anti - nuclear antibody ( fana ) were all normal .
we assumed that the elevated level of esr and crp represented seronegative rheumatoid arthritis , or less probable , non - specific findings following the cervical herniation of nucleus pulposus ( hnp ) procedure .
we then administered drug treatments using meloxicam ( 15 mg / day ) and prednisolone ( 10 mg / day ) .
following the initiation of drug treatments , the symptoms , such as the limitation in range of motion ( rom ) , were greatly improved .
approximately 1 month later , the patient voluntarily discontinued the drug treatment , and had an abrupt aggravation of symptoms .
severe pain arose during ambulation as well as during rest . especially during the night , the pain was further aggravated .
on physical examination , she had tenderness in the medial and lateral epicondyles . during extension of the elbow joint , there was a restriction in the motor area which was further aggravated .
when meloxicam ( 15 mg / day ) and prednisolone ( 20 mg / day ) were re - administered , the symptoms improved .
three weeks after the drug treatments resumed , methotrexate ( 2.5 mg / week ) and sulfasalazine ( 1 g / day ) were added .
three months later , the symptoms became severe and the patient re - visited the clinic . on physical examination , there was severe limitation in elbow flexion and extension , and local warmth and swelling in the right elbow . under the impression of septic lateral epicondylitis
on the plain radiograph , there was a massive intra - articular effusion , multiple bone erosions around the joint , osteopenia , and an overall decrease in the articular cavity ( fig .
, there were also findings , such as osteomyelitis , involing the distal part of the radius , ulna , or humerus , periarticular myositis , and subcutaneous cellulitis ( fig .
this led to the diagnosis of septic arthritis , which was followed by synovectomy and massive irrigation in an emergency setting . the tuberculosis polymerase chain reaction ( pcr ) of the synovial fluid , there were positive findings of m. tuberculosis .
a tissue biopsy of the synovial membrane or synovium was suggestive of a chronic caseating granulomatous inflammation , consistent with tuberculosis .
acid - fast bacilli ( afb ) were identified on specimen staining . for the treatment of tuberculosis following surgery
, four - agent drug treatments were performed using isoniazid , rifampin , pyrazinamide , and ethambutol . at present ,
musculoskeletal tuberculosis is a rare disease entity , accounting for 1 - 5% of tuberculous infections .
tuberculous arthritis occurring in the elbow joint is rare , and accounts for 1 - 5% of musculoskeletal tuberculosis cases . similar to others
infectious arthritides , tuberculous arthritis affects a single joint . in 10% of cases , however , more than one joint can be affected .
musculoskeletal involvement is caused by hematogenous , lymphatic , or direct local spread of tubercle bacilli from other lesions , such as a quiescent pulmonary primary or another extraosseous focus .
symptoms of tuberculous arthritis are both unclear and obscure , which are clinically manifested as local swelling and chronic pain of a single joint accompanied by gradually decreased rom .
because of the indolent disease process and the subtle nature of symptoms , diagnostic evaluations are often not undertaken until the disease has progressed . in the early stage of diseases , tuberculous arthritis may be easily mistaken for trauma or rheumatoid arthritis and septic arthritis . a significant delay between the onset of symptoms and the definitive diagnosis commonly ranges from 5 - 47 months .
systemic symptoms may include a low fever , fatigue , decreased appetite , decreased weight , night chills , tachycardia , and anemia , but these symptoms are not common . in the case
presented herein , the patient complained of the pain present in the right elbow joint . under the impression of lateral epicondylitis
, the treatment was initiated , however , the patient had an atypical responses to these treatments and then underwent additional laboratory tests .
this showed that such parameters as esr and crp were elevated to 100 mm / hr and 25.5 mg / l .
based on the elevation of the esr and crp to 100 mm / hr and 25.5 mg / l , we speculate that rheumatoid arthritis , or less likely , non - specific findings following the cervical hnp procedure which was performed 4 weeks prior to the outpatient visit , were possible diagnoses . in studies
in which serial crp and esr levele were determined following surgical procedures without complications , the crp level reaches a maximum level 2 - 3 days post - operatively .
thereafter , the crp level decreases in a biphasic pattern . on post - operative days 3 - 5
esr is less sensitive than crp to surgical intervention and its level reaches a maximum level between post - operative days 5 and 6 .
thereafter , it gradually decreases . in the current case , based on the persistent elevation of the crp and esr levels
, we assumed that these findings were a reflection of rheumatoid arthritis . considering that there were no systemic or local signs of infection
although cases in which rf and fana were negative and unilateral elbow and shoulder joint were invaded are untypical , rheumatoid arthritis has a great number of clinical variants . considering that a diagnosis can be made , even in cases in which diagnostic criteria could not be met based on the guidelines proposed by the american academy of rheumatoid arthritis , a tentative diagnosis of seronegative rheumatoid arthritis was made . to manage this , non - steroidal anti - inflammatory agents , steroids , and other drugs , such as methotrexate and sulfasalazine ,
three months later , however , the patient presented with symptoms suggestive of septic arthritis . on admission
generally , in cases of septic arthritis , an acute onset over several hours to 2 days with fever and chills is typical . a prodromal phase lasting several day 's , with malaise , arthralgias , and low - grade fevers ,
pain , tenderness , erythema , heat , and soft tissue swelling in the involved joint are common .
the diseases can develop by various types of organisms , most of which occur due to pyogenic bacteria . in addition , although rare , the disease can also occur due to such pathogens as m. tuberculosis , viruses , and fungi . in cases of tuberculous and fungal arthritis ,
the diseases slowly progresses . in the current case , in typical cases of septic arthritis , a diagnosis is mostly made within 1 - 2 weeks .
by contrast , the progression of the clinical course is atypically obscure and it occurs in a systematic manner .
therefore , it takes approximately 6 months for the current case to be suspected to be septic arthritis based on the initial symptoms .
after several months following the onset of symptoms , there can be symptoms such as periarticular osteopenia and soft tissue swelling .
on further progression of the disease , there can also be such findings as bone erosion and joint space narrowing .
mri scans can visualize such findings as soft tissue swelling or joint effusion on earlier occasions . because these radiologic findings are also seen in cases of chronic septic arthritis , however , from a diagnostic perspective
on afb staining of the synovial fluid , positive findings are observed in 20 - 25% of samples . a culture test of the synovial fluid can identify m.tuberculosis in 60 - 80% of samples .
although m. tuberculosis was not identified , anti - tuberculosis treatment can be initiated in cases in which there are granulomatous inflammatory findings . also ,
in the current case , a diagnosis of tuberculous arthritis was made based on the post - operative biopsy of the synovial membrane and afb staining .
as shown herein , due to a lower incidence of tuberculous arthritis occurring in the elbow joint and the clinical characteristics which are obscure and gradual , a rule - out diagnosis of tuberculous arthritis could not be made in the early stage . in recent years , however , the prevalence of tuberculosis has been increasing .
considering that korea is one of the endemic areas for tuberculosis , in cases of chronic arthralgia in which there is a local swelling of the soft tissue and the rom is gradually restricted , although rare , the possibility for tuberculous arthritis can not be completely ruled out . | elbow tuberculosis is a rare disease which accounts for 1 - 3% of all cases of osteoarticular tuberculosis .
the diagnosis of tuberculous arthritis is very difficult in most clinical situations because of the insidious onset , indolent process , and mild and non - specific local or systemic symptoms .
thus , the confirmatory diagnosis and effective treatment for tuberculous arthritis are delayed until the disease progresses to an advanced stage in many clinical settings .
herein we report a case of septic arthritis of the elbow due to mycobacterium tuberculosis as a result of misdiagnosis and delayed treatments . |
extra - articular hip arthroscopy has been recently used for the treatment of various conditions such as subspine impingement , gluteus medius / minimus tears , ischiofemoral impingement , sciatic entrapment and proximal hamstring repair .
many of these procedures involve the peritrochanteric or subgluteal space . as potential indications for extra - articular hip
arthroscopy expand , some of the major knowledge gaps include minimally invasive approaches for the treatment of hip dysplasia , acetabular retroversion with posterior insufficiency , severe femoral anteversion and retroversion , and osteitis pubis ( arguably the most common form of athletic pubalgia ) . in general ,
all of these procedures offer less invasive approaches to more established open surgeries ( i.e. open peri - acetabular osteotomy ( pao ) , open proximal femoral osteotomy ( pfo ) , open pubic symphysis curettage ) , thereby enabling potential outpatient or short - stay hospitalization , quicker rehabilitation , less blood loss and improved cosmesis .
these are advanced endoscopic surgical procedures meriting familiarity with the surgical anatomy and significant experience with hip arthroscopy .
the indications for these procedures are the same as for their open equivalent surgeries and are described in each corresponding section , as are the complications .
the purpose of this instructional course lecture is to introduce endoscopy - assisted pao ( eapao ) , closed derotational pfo ( cpfo ) and endoscopic pubic symphysectomy ( eps ) as potential options for the less invasive treatment of these conditions .
endoscopy - assisted peri - acetabular osteotomy eapao has significant potential to improve outcomes and safety in patients with dysplasia ( retroverting pao ) or acetabular retroversion with posterior insufficiency ( anteverting pao ) .
pao is associated with a significant complication rate [ 6 , 7 ] and endoscopic visualization of the posterior column and ischial osteotomies may reduce the incidence of iatrogenic direct sciatic nerve injury ( including neurotmesis ) , intra - articular fracture or osteotomy , posterior column fracture or discontinuity and acetabular osteonecrosis .
although an endoscopic triple osteotomy has been developed , we endeavor to enhance the bernese pao which preserves posterior column functional integrity , thereby facilitating early ambulation with minimal osteosynthesis of the reoriented acetabular fragment .
development of this procedure is at the cadaveric stage and uses a mini - open [ 911 ] rather than standard ilioinguinal approach .
concurrent arthroscopy ( in contrast to endoscopy ) can diagnose and treat a majority of central compartment pathology ( e.g. chondral flaps , labral tears ) in dysplasia [ 12 , 13 ] and may prevent unwarranted pao in cases of worse than anticipated chondral injury or osteoarthosis via staged or immediate total hip arthroplasty .
peripheral compartment arthroscopy permits assessment of dynamic interaction between the reoriented acetabular rim and the proximal femur , often after concurrent arthroscopic femoroplasty , as many patients with dysplasia ( and retroversion ) have associated cam femoroacetabular impingement ( fai ) .
this may improve the accuracy of 3d intra - operative acetabular reorientation ( minimizing under- or over - correction ) and facilitate confirmation of sufficient stabilization ( typically with percutaneous screw fixation ) .
perhaps most significant , patients with developmental dysplasia of the hip ( ddh ) or acetabular retroversion with posterior insufficiency that desire hip arthroscopy as a minimally invasive surgery may now have a more biomechanically appropriate yet less invasive option ( eapao ) , that may reduce the number of failed hip arthroscopies [ 15 , 16 ] .
furthermore , we envision eapao as a logical progression toward fully endoscopic pao ( epao ) .
supine hip arthroscopy under general anesthesia is performed as an initial diagnostic and therapeutic step , followed by mini - open eapao ( fig . 1 ) and concluding with arthroscopic dynamic testing . in the supine position ,
any intra - articular pathology is either treated or a determination may be made that the severity and/or extent of chondral damage exceeds that that can reasonably expected to benefit from acetabular reorientation , perhaps opting for hip arthroplasty .
note the completed iliac osteotomy and a portion of the arthroscope ( lower right ) which provides endoscopic guidance for the posterior column osteotomy .
note the completed iliac osteotomy and a portion of the arthroscope ( lower right ) which provides endoscopic guidance for the posterior column osteotomy .
a mini - open modified heuter approach permits muscle - sparing dissection of the interval between sartorius and tensor fascia lata ( tfl ) . avoiding the lateral femoral cutaneous nerve ,
the fascia lata is incised in line with the skin incision followed by blunt dissection around the medial aspect of the tfl within its incised aponeurotic sheath .
medial retraction of the sartorius and deeper rectus femoris reveals the reflected head of the rectus femoris as it overlays the hip capsule .
ischial osteotomy is performed with a straight osteotome positioned in the infracotyloid fossa . during this osteotomy
, the sharp tip of the osteotome is endoscopically visualized with a 70 standard length arthroscope from the anterolateral portal ( fig .
endoscopy of the posterior peritrochanteric region ( subgluteal space ) without any hip distraction enables visualization , neurolysis and mobilization of the sciatic nerve , which may be followed proximally and distally with blunt dissection via a switching stick from the posterolateral portal .
if more proximal neurolysis or mobilization is required , endoscopic ligation and transection of the crossing vessels from the inferior gluteal artery may be performed .
monopolar rf with intermittent activation times of < 10 s in a setting of sufficient fluid flow permits safe soft tissue dissection .
if endoscopy reveals the osteotome tip approaching the sciatic nerve , the ostetome may be redirected and/or the sciatic nerve may be gently retracted .
fig .
2.supine endoscopic view from anterolateral portal of the right sub - gluteal space of cadaveric specimen during ischial osteotomy during eapao .
note the sharp tip of the osteotome in proximity to the gently retracted sciatic nerve .
supine endoscopic view from anterolateral portal of the right sub - gluteal space of cadaveric specimen during ischial osteotomy during eapao .
note the sharp tip of the osteotome in proximity to the gently retracted sciatic nerve .
the pubic and iliac osteotomies are then performed , followed by the posterior column osteotomy made with endoscopic assistance . without changing portals , arthroscopic inflow
the visualized sciatic nerve may again be gently retracted to avoid inadvertent injury ( fig .
3 ) . sometimes osteoclasis of a small bony bridge is performed between adjacent ends of the ischial and posterior column osteotomies permitting mobilization of the acetabular fragment .
the pubic osteotomy is made close to the acetabulum to avoid bony obstruction to desired medial acetabular translation ( shown fluoroscopically as a medial shift of the teardrop ) . during the pubic or posterior column cuts ,
arthroscopic visualization of the central compartment under moderate hip traction permits detection / prevention of this complication .
3.supine endoscopic view from anterolateral portal during posterior column osteotomy demonstrating the sharp tip of the osteotome in proximity to the sciatic nerve .
sciatic nerve retraction is being performed with a switching stick via the posterolateral portal .
supine endoscopic view from anterolateral portal during posterior column osteotomy demonstrating the sharp tip of the osteotome in proximity to the sciatic nerve .
desired acetabular reorientation is confirmed via fluoroscopy and/or intra - operative ap pelvic radiograph followed by percutaneous screw fixation .
care is taken to avoid inadvertent retroversion from over - correction , under - correction or insufficient medialization of the acetabular fragment .
repositioning of the acetabular fragment may be performed if indicated or small regions of anterior pincer fai may be seamlessly treated with rim trimming .
we have no outcomes on this evolving procedure as it has only been performed on cadaveric specimens to date .
proximal femoral osteotomy has been useful in the treatment of axial ( derotation ) and longitudinal deformities ( varus / valgus , flexion / extension ) .
closed osteotomy using an intramedullary saw permits derotation osteotomies for severe proximal femoral retroversion ( which may cause cam fai that persists despite femoroplasty ) and severe anteversion ( which may cause anterior hip instability or posterior fai . ) .
internal fixation via intramedullary locked nailing provides a load - sharing device for early weight - bearing .
moreover , recent work suggests that there is potential for some degree of angulatory correction .
adjunctive hip arthroscopy aids pre- and post - osteotomy assessment of altered hip dynamics while permitting detection / treatment of intra - articular pathology .
hip arthroscopy under general anesthesia is performed via an anterolateral viewing portal with a 70 arthroscope and a modified mid - anterior working portal . under hip distraction ,
diagnostic and therapeutic hip arthroscopy is performed , followed by arthroscopic dynamic testing to assess the amount of secondary cam fai from pathologic femoral retroversion ( fig .
4.supine arthroscopic image of left hip immediately prior to cpfo confirming ongoing cam impingement on arthroscopic anterior impingement testing despite significant previous femoroplasty .
supine arthroscopic image of left hip immediately prior to cpfo confirming ongoing cam impingement on arthroscopic anterior impingement testing despite significant previous femoroplasty .
a fluoroscopic c - arm device is positioned between the legs so as to enable anteroposterior and lateral projections of the entire operative femur .
parallel lateral - based steinmann pins are placed on each side of the proposed osteotomy .
the proximal pin is placed through the anterolateral portal into the anterior aspect of the greater trochanter ( to avoid intramedullary nail obstruction ) and the distal pin in the transcondylar region .
the anteroposterior location of the latter is not critical because the rod does not extend to this level .
a 3-cm vertical incision is made proximal to the greater trochanter with subsequent dissection to its apex .
apical trochanteric pin placement and proximal femoral entry are established under bi - plane fluoroscopic guidance .
an intramedullary saw ( winquist saw ; biomet , warsaw , in ) is selected to match the anticipated maximal external diameter of cortical bone at a level 56 cm distal to the lesser trochanter . with the saw blade retracted behind the protective cam - shaped tip , antegrade intramedullary insertion is achieved .
once confirmed in the desired intramedullary position , the saw blade is progressively protracted by clockwise rotation of a proximal - based external dial and axial saw rotation performed in incremental fashion until the closed transverse osteotomy is completed ( fig .
clean transverse osteotomy without significant cortical spikes that might impede desired derotation or bony apposition .
the saw blade is then fully retracted behind the protective cam by continuing to dial in the same clockwise direction ( until the dial reads
5.fluoroscopic images of intramedullary saw ( red arrow ) before ( left ) and after ( right ) saw blade deployment and completion of transverse subtrochaneric osteotomy .
fluoroscopic images of intramedullary saw ( red arrow ) before ( left ) and after ( right ) saw blade deployment and completion of transverse subtrochaneric osteotomy .
a reamed intramedullary rod is then partially inserted across the osteotomy site and controlled internal rotation of the distal segment is performed .
( in the case of excessive femoral anteversion , external derotation is performed . ) to assess sufficient derotation , divergence of the parallel - placed pins is viewed from a distal - based axial perspective .
an angular guide ( blade plate guide ; synthes ) is used to measure the relative angular degree of rotation ( fig .
once desired derotation is achieved , the intramedullary rod is fully inserted and percutaneous proximal screw placement is performed under fluoroscopic guidance .
distal interlocked screw fixation is performed once desired axial alignment and bony apposition are confirmed .
6.photograph from axial perspective during derotational correction of severe retroversion deformity over proximally fixated femoral rod .
photograph ( left ) during derotation with 30 internal rotation of distal segment using an ao angle guide referencing off of initial parallel guide pins ( right ) .
photograph from axial perspective during derotational correction of severe retroversion deformity over proximally fixated femoral rod .
photograph ( left ) during derotation with 30 internal rotation of distal segment using an ao angle guide referencing off of initial parallel guide pins ( right ) .
repeat hip arthroscopy is performed to confirm impingement - free internal rotation to 30 with flexion adduction internal rotation testing .
once satisfied with the rotational correction of the femoral deformity , foot alignment in both hip and knee extension , as well as hip and knee flexion are checked to ensure the absence of any significant compensatory tibial rotational deformity .
severe bilateral retrotorsion in a young man caused ongoing symptomatic cam fai despite previous arthroscopic surgeries with substantial femoroplasties .
he underwent staged proximal femoral derotational osteotomies using the aforementioned technique , was discharged home weight - bearing as tolerated on crutches after overnight hospitalization and demonstrated radiographic union at 3 months with improved gait ( pre - operative out - toeing , post - operative normal foot progression ) and symptoms at 12 and 15 months ( fig . 7 ) .
7.post-operative radiographs following cpfo of right femur at 15 months and left femur at 12 months .
post - operative radiographs following cpfo of right femur at 15 months and left femur at 12 months .
athletic osteitis pubis ( op ) is one of the more common causes of athletic pubalgia that has an often successful but prolonged conservative treatment course and 510% failure rate . of several surgical options including wedge resection , arthrodesis , extraperitoneal retropubic synthetic mesh placement and pubic symphyseal curettage ,
open curettage has been shown to be effective in athletes and is arguably less invasive than some of the other surgeries [ 21 , 22 ]
. a mini - open curettage has recently been introduced , but is done via a 57 cm pfannenstiel incision .
indeed , the constrained range of motion in the hip with fai is thought to cause increased transfer stress to the pubic symphysis .
although treatment of co - afflicted patients may be done with either fai or op surgery in patients that fail conservative measures , surgical treatment of both conditions offers the best outcomes .
eps is an attractive alternative to open or mini - open pubic symphyseal curettage that nicely complements athletes that undergo concurrent arthroscopic surgery for unilateral or bilateral fai .
moreover , more patients with athletic op may opt for this less invasive outpatient procedure rather than suffer with a typically prolonged conservative treatment course .
following arthroscopic or mini - open surgery for fai ( e.g. acetabuloplasty , labral refixation and femoroplasty ) and after redraping and sterile preparation of the pubic region , outpatient dual - portal endoscopic surgery is performed in the supine lithotomy position under hypotensive general anesthesia .
an indwelling urethral catheter is used not only because of the longer cumulative operative time needed for all procedures but also for bladder decompression to minimize risk of iatrogenic damage .
8) : one 2 cm proximal to the palpable superior border of the pubic symphysis ( suprapubic portal ) and one directly anterior to the mid - level of the pubic symphysis ( anterior portal ) .
the anterior and superior aspects of the pubic symphysis are endoscopically visualized with a 30 arthroscope after initial removal of overlying bursal tissue .
after demarcating the area of planned resection on the anterior surface of the pubic symphysis with an rf probe and meticulous hemostasis enabling low arthroscopic pump pressures at or below 40 mm hg , pubic symphysectomy is performed with a 4 mm round burr ( fig .
if present , a posterosuperior bone spur is resected . then , burr resection proceeds from anterior ( superficial ) to posterior ( deep ) under endoscopic visualization with intermittent fluoroscopic guidance .
removal of the burr sheath aids access to the deeper ( posterior ) pubic symphysis . a retractable sheath burr
( retractable sheath hip burr , smith and nephew , andover , ma ) is also an option and may aid visualization by preserving controlled fluid outflow via a retracted but retained sheath .
endoscopic resection of the anterior capsule , pubic symphyseal fibrocartilage and subchondral end - plates is performed while preserving the posterior and thick arcuate ( inferior ) ligaments .
final posteroinferior resection is done with the burr in the suprapubic portal , optimizing burr access to this region ( fig .
associated adductor longus tendinopathy or tears and even a torn rectus abdominus attachment may be treated via this approach .
an unhooded or retractable sheath burr may facilitate resection of the deeper ( posterior ) fibrocartilage and hyaline endplates without violating the posterior or inferior capsuloligamentous structures .
10.the suprapubic portal enables burr access to the posteroinferior pubic symphysis to complete the procedure .
an unhooded or retractable sheath burr may facilitate resection of the deeper ( posterior ) fibrocartilage and hyaline endplates without violating the posterior or inferior capsuloligamentous structures .
the suprapubic portal enables burr access to the posteroinferior pubic symphysis to complete the procedure .
post - operative rehabilitation includes initial weight - bearing as tolerated with two crutches ( 12 weeks ) and early exercise cycling with minimal resistance .
in contrast to our standard post - operative fai surgery protocol ( i.e. cycling on post - operative day 1 ) , patients undergoing endoscopic pubic symphysectomy typically are able to begin this within the first week
. gradual advancement to running is permitted at approximately 3 post - operative months and return to sport at 5 months , realizing that the typically concurrent unilateral or bilateral fai surgery may exert rate - limiting influence . in a multicenter case series ,
we report encouraging early outcomes in seven patients with symptomatic fai and op that underwent concurrent fai surgery and eps .
although one patient underwent pubic symphysis arthrodesis for unresolved pain without radiographic instability , overall clinical improvement was demonstrated via visual analogue scale for pain and non - arthritic hip score .
endoscopy - assisted peri - acetabular osteotomy has potential to improve safety and outcomes for patients with dysplasia or acetabular retroversion with posterior insufficiency .
closed derotational femoral osteotomy with adjuctive hip arthroscopy may offer a less invasive alternative to the treatment of severe femoral anteversion and retroversion .
| beyond the recent expansion of extra - articular hip arthroscopy into the peri - trochanteric and subgluteal space , this instructional course lecture introduces three innovative procedures : endoscopy - assisted periacetabular osteotomy , closed derotational proximal femoral osteotomy and endoscopic pubic symphysectomy .
supportive rationale , evolving indications , key surgical techniques and emerging outcomes are presented for these innovative less invasive procedures . |
in 2011 , minks on a breeding farm in raoyang county , in southeastern hebei province , became ill with an unidentified disease .
the illness rate was almost 100% among farmed minks ( mustela vison ) , although the death rate was < 5% , mainly in minks <3 months of age .
pcr excluded all classical endemic and emerging viruses , mink enteritis virus , canine distemper virus , aleutian mink disease virus , and mink coronavirus as the causative agent . to identify the cause of the disease ,
we homogenized fecal samples from affected minks in phosphate - buffered saline and subsequently inoculated the homogenate into fk81 , vero , and bhk-21 cells . on day 7 , a strong cytopathic effect was observed in fk81 cells , including rounded and detached cells ; on day 8 , a similar cytopathic effect was observed in vero cells ; and on day 10 , the cytopathic effect was observed in bhk-21 cells .
electron microscopy of infected cells demonstrated icosahedral , nonenveloped , viral particles characteristic of mrvs ( figure 1 ) .
the mink reovirus was able to hemagglutinate type o human erythrocytes ( 1% vol / vol ) but not chicken , mouse , goose , or rabbit erythrocytes ( 1% vol / vol ) , a finding characteristic of mrvs .
using mrv - specific reverse transcription pcr assays , we obtained products of the predicted size of 416 bp for the polymerase large ( l)1 gene regions . after direct sequencing of the pcr products ,
a blast ( www.ncbi.nlm.nih.gov/blast/blast.cgi ) search showed the sequences to be authentic reovirus sequences , with closest similarity to those of the recently identified human mrv2tou05 strain , which had been isolated from 2 children with acute necrotizing encephalopathy in 2005 ( 10 ) .
these initial findings provide the genetic evidence that an enteric reovirus is shed in the diarrheal feces of mink , confirming a previous report suggesting mrv as an etiologic agent of acute viral enteritis in mink ( 12 ) .
we tested the pathogenicity of mrv1-hb - a by orally infecting 3-month - old minks at a dose of 3 10 50% tissue culture infective dose .
electron micrograph of orthoreovirus mrv1-hb - a . to further identify the virus and its phylogeny , we amplified and sequenced the mrv1-hb - a l1l3 , medium ( m)1m3 , and small ( s)1s4 genes ( genbank accession nos .
the nucleotide sequences obtained for each segment were compared with those of other orthoreoviruses by using the clustalx1.83 ( www.clustal.org ) programs .
phylogenetic relationship was assessed by using 3 approaches : bayesian phylogenetic trees , neighbor - joining , and split network .
topology was essentially the same for bayesian trees , neighbor - joining , and split network ( figure 2 ) .
sequence analysis showed that the 6 segments ( l1l3 , m2 , m3 , and s3 ) of mrv1-hb - a were closely related to those of the human mrv2tou05 strain and that the s1 and s2 segments were similar to those of other serotype 1 reoviruses that infect humans .
the other 2 segments ( m1 and s4 ) were closest to those of the sc - a strain , which was isolated from swine in 2006 in sichuan , china ( table 1 ) .
the s1 segment of mrv1-hb - a is genetically similar to that of the human reovirus strains t1neth/84 and t1neth/85 ( 97% identity ) isolated in the netherlands in 1984 and 1985 ( figure 2 ) .
nucleotide sequences of the prototype type 1 lang and the mrv1-hb - a s1 genes shared 92% of positional identity , which provided sequence confirmation that this new isolate was a type 1 strain ( table 1 ) .
otherwise , the s3 gene showed high identity with type 2 human reovirus tou05 ( 98% identity ) and porcine reovirus shr - a ( 94% identity ) strains ( figure 2 ) .
on the basis of these data , we conclude that the novel type 1 mink reovirus , designated mrv1-hb - a , might have originated from reassortment between human and swine strains .
phylogenetic tree and network based on the nucleotide sequences of the small ( s)1 and s3 segments of orthoreoviruses .
a and b ) neighbor - joining tree of multiple orthoreovirus species . numbers at nodes indicate bootstrap values based on 1,000 replicates .
the neighbor - net graph was computed by using the splitstree 4.13.1 software ( http://ab.inf.uni-tuebingen.de/data/software/splitstree4/download/welcome.html ) .
* t1l , type1 lang ; t2j , type 2 jones ; t3d , type3 dearing ; t4n , type 4 ndelle ; l , large segment ; na , not available ; m , medium segment ; s , small segment .
furthermore , we assessed the seroprevalence of mink reovirus antibodies in the human population and in 2 animal populations ( mink and swine ) .
human serum samples were collected in raoyao county people s hospital ( n = 181 ) of hebei province and chaoyang district people 's hospital ( n = 128 ) of jilin province .
the human serum was donated by students , faculty members , and university workers , when they underwent annual health checkups at the 2 hospitals . from swine , 122 serum samples were collected in hebei ( n = 66 ) and guangdong ( n = 56 ) provinces . from mink ,
78 serum samples were collected in hebei ( n = 48 ) and jilin ( n = 30 ) provinces .
all samples were tested by hemagglutination inhibition and microneutralization assay as described ( 5,6 ) by using the mrv1-hb - a isolated strains as antigen .
samples with titers 16 were considered seropositive after 2 independent assays ; lower titers were considered nonspecific reactions .
for all groups , hemagglutination inhibition and microneutralization assays demonstrated similar trends , although the percentage of samples that were positive for mrv1-hb - a antibodies by microneutralization was slightly lower than by hemagglutination inhibition assay ( table 2 ) . because these antibodies were found in some , but not all , serum samples tested from each species and because the seropositive rate differed among regions , these antibodies probably reflect actual infection with reovirus mrv1-hb - a strain or with other strains that include a similar s1 gene .
our study provides genomic evidence and molecular confirmation of a novel reovirus in mink . although there is no direct evidence to prove the origin of mrv1-hb - a , the close genetic relationship of mrv1-hb - a with strains from humans and swine indicated a high probability that mrv1-hb - a resulted from a reassortment of human and swine strains . in view of the lack of sequence data for the reovirus from mink in public databases , addition of the complete genome sequencing information for the mink reovirus will aid in the characterization of mammalian reovirus diversity and evolution .
although mrvs were assumed to cause rather mild respiratory or gastrointestinal diseases , recent findings indicate the occurrence of higher virulent mrv strains in man and other mammals . to be prepared for the potential emergence of more virulent variants , we should carefully monitor virus evolution in real time .
primers used for amplification of the genome of mink reovirus hb - a strain from china , 2011 . | we identified a novel mink orthoreovirus , mrv1hb - a , which seems to be closely related to human strain mrv2tou05 , which was isolated from 2 children with acute necrotizing encephalopathy in 2005 .
evolution of this virus should be closely monitored so that prevention and control measures can be taken should it become more virulent . |
oksidovani lipoprotein niske gustine ( ox - ldl ) i visokosenzitivni c - reaktivni protein ( hs - crp ) povieni su u dijabetes melitusu ( dm ) i povezani sa ubrzanom atero - sklerozom . malo je poznata njihova dinamika u akutnoj fazi infarkta miokarda sa elevacijom st segmenta ( stemi ) , naroito u zavisnosti od prisustva dm ili predijabetesa ( pre - dm ) .
je analizirala promenu koncentracija ox - ldl i hs - crp u akutnoj fazi stemi u odnosu na prisustvo pre - dm i dm kod bolesnika leenih primarnom perkutanom koronarnom intervencijom ( ppki ) .
kod 103 konsekutivna bolesnika sa prvim prednjim stemi , hs - crp i ox - ldl mereni su pre ppci , drugog i sedmog dana nakon ppki .
u svakoj grupi maksimalna koncentracija ox - ldl bila je na prijemu , smanjivala se drugog dana i postizala najnie vrednosti sedmog dana ( p<0,001 ) .
dijabetiari su uvek imali najvie vrednosti ox - ldl u poreenju sa predijabetiarima i nedijabetiarima ( na prijemu : p=0,028 , drugog dana : p=0,056 i sedmog dana : p=0,004 ) .
koncentracija hs - crp je u svakoj grupi rasla od prijema , postizala maksimalne vrednosti drugog dana i smanjivala se sedmog dana ( p<0,001 ) .
i predijabetiara registrovana je na prijemu ( p=0,018 ) i drugog dana ( p=0,026 ) .
i ox - ldl i hs - crp su znaajno korelisali sa killip klasom , ejekcionom frakcijom leve komore , koncentracijom nt - probnp i maksimalnom vrednou troponina i.
kod bolesnika sa prvim stemi leenim ppki postojale su znaajne razlike u koncentraciji ox - ldl i hs - crp izmeu nedijabetiara , predijabetiara i dijabetiara .
koncentracije ox - ldl i hs - crp znaajno su korelisale sa parametrima srane insuficijencije .
inflammation and oxidative stress within the vascular wall represent key processes in the continuum of coronary atherosclerosis : from plaque formation , to plaque instability and rupture inducing acute myocardial infarction , reperfusion injury after treatment and reparation and tissue healing ( 1 ) .
c - reactive protein is an acute phase protein produced in the liver that appears in the circulation in response to inflammatory cytokines . high - sensitive c - reactive protein ( hs - crp ) is one of the most studied biochemical markers of atherosclerosis and a sensitive marker of increased inflammatory activity within the arterial wall ( 1 , 2 ) .
it is elevated in patients with diabetes mellitus ( dm ) , proportionally to the insulin resistance and/or beta cells dysfunction ( 3 ) , and can be used for cardiovascular risk assessment ( 4 ) . in patients with the acute st segment elevation myocardial infarction ( stemi ) undergoing primary percutaneous coronary intervention ( ppci )
hs - crp predicts long term mortality , re - infarction and adverse events ( 5 )
. the oxidatively modified form of low density lipoprotein ( ox - ldl ) is a proinflammatory and pro - atherogenic particle containing free radicals that plays a critical role in atherosclerosis ( 6 ) .
ox - ldl causes injury to endothelial cells via several complex mechanisms ( 713 ) , acts as a monocyte chemoattractant , impairs the motility of tissue macrophages and induces platelet adhesion ( 7 ) .
furthermore , ox - ldl in the experimental studies had a devastating effect on myocardial cells , inducing damage and irregular electrical activity similar to other oxidative stress - generating systems ( 14 ) .
a high level of circulating ox - ldl is an independent and significant predictor of future cardiac events in type 2 diabetic patients with chronic coronary artery disease ( 16 ) . in patients with
acute coronary syndrome ox - ldl concentration correlates well with the severity of acute coronary syndrome ( 17 ) , with the level of hs - crp ( 18 ) and predicts late stent restenosis after ppci ( 19 ) .
however , plasma kinetics of ox - ldl in the acute phase of stemi after mechanical reperfusion and its relation to the level of inflammation is unclear regarding the presence of dm and pre - diabetes ( pre - dm ) .
the aim of this study was to evaluate time - dependent changes in ox - ldl and hs - crp concentrations in stemi patients treated by ppci in relation to the presence of dm and pre - dm .
we also evaluated relationships between ox - ldl and hs - crp and left ventricular contractility and heart failure .
a total of 103 consecutive patients with the first anterior stemi treated by ppci were enrolled in the study from the end of november 2009 to the end of december 2010 .
the inclusion criteria for this prospective , single center , observational study included recanalization of the left anterior descending artery ( lad ) with visually assessed residual stenosis < 30% .
the exclusion criteria were : ( 1 ) inability or refusal to provide written informed consent ; ( 2 ) acute or chronic inflammation or infection ( 3 ) , a history of autoimmune , malignant disease , liver , kidney or thyroid diseases .
anthropometric parameters including weight and height were measured for all patients , and their body mass index was calculated as the ratio of weight to height squared .
hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or use of antihypertensive treatment .
dm and pre - dm were defined according to the american diabetes association ( ada ) 2014 guidelines ( 21 ) .
patients were considered smokers if they smoked 1 cigarette / day at the time of admission or in the preceding 12 months . clinical manifestation of the heart failure on admission was assessed by killip class ( killip 1 , no heart failure ; killip 2 , s3 and/or basal lung crepitations ; killip 3 , acute pulmonary edema ; killip 4 , cardiac shock ) .
when a diagnosis of stemi was established and a decision to perform ppci was made , blood samples were obtained from peripheral vein before starting intervention , and 4 h , 8 h , 12 h , 18 h , 24 h , 48 h ( 2 day ) and 168 h ( 7th day ) after intervention .
blood samples for troponin i ( tni ) , mb fraction of creatine kinase ( ck - mb ) , n - terminal pro - brain natriuretic peptide ( nt - probnp ) , and high - sensitive c - reactive protein ( hs - crp ) determination were allowed to coagulate at room temperature for 30 min , and then centrifuged at 4000 rpm for 10 min to obtain serum samples .
serum tni and ck - mb were measured by chemiluminescent microparticle immunoassay ( cmia ) on the architect i2000 system .
the serum levels of nt - probnp were measured by a roche cobas 6000 automated analyzer ( roche diagnostics , mannheim , germany ) .
the serum hs - crp concentrations were measured in blood samples on admission , on the 2 and 7 day by means of the immuno - turbidimetric test ( olympus life and material science europe gmbh , ireland ) on an olympus au 400 analyzer .
ox - ldl measurement in edta plasma from blood samples on admission , on the 2 and 7 day was performed using a mercodia elisa assay ( mercodia ab , uppsala , sweden ) . in this solid - phase two - site enzyme immunoassay
two monoclonal antibodies are directed against separate antigenic determinants on the oxidized apolipoprotein b molecule .
the estimated glomerular filtration rate ( egfr ) was calculated using an abbreviated modification of diet in renal disease study formula ( 22 ) .
pci was performed within 12 h from the onset of chest pain by experienced interventionists . in all patients , stent
angiographic thrombolysis in myocardial infarction ( timi ) flow grade was evaluated as described previously ( 23 ) .
all patients and their angiograms were graded according to the number of diseased coronary arteries .
a coronary artery was considered diseased if there was any obstructive lesion 70% in diameter in that artery or one of its major branches ( diameter 2.5 mm ) .
medication used in the acute phase included loading a 600 mg dose of clopidogrel and 300 mg of aspirin and an intravenous bolus of heparin before ppci , followed by dual antiplatelet therapy ( clopidogrel or ticlopidine and aspirin ) and statins in all patients .
glycoprotein iib / iiia inhibitor , thrombectomy and intracoronary vasodilatators were administered at the discretion of the interventional cardiologist .
normally distributed continuous variables are expressed with mean sd , and continuous variables that did not show normal distribution are expressed as the median value and interquartile range ( 25 , 75 percentile ) .
related - samples friedman s two ways anova by ranks was used to test time - dependent changes in hs - crp and ox - ldl concentrations .
spearman s rank correlation coefficients were used to assess the relationships between hs - crp and ox - ldl concentrations and others variables .
binary logistic regression analysis was used to assess determinants of ox - ldl concentrations and hs - crp concentrations higher than the 75 percentile on admission , on the 2 and 7 day .
all variables with p less than 0.05 from univariate analysis entered multivariate analysis ( wald method ) .
results are expressed as the odds ratios ( or ) and their 95% confidence intervals ( ci ) per one standard deviation increment of each measure .
the statistical analyses were performed using statistical package for social sciences ( spss ) version 20.0 ( spss , inc . ,
a total of 103 consecutive patients with the first anterior stemi treated by ppci were enrolled in the study from the end of november 2009 to the end of december 2010 .
the inclusion criteria for this prospective , single center , observational study included recanalization of the left anterior descending artery ( lad ) with visually assessed residual stenosis < 30% .
the exclusion criteria were : ( 1 ) inability or refusal to provide written informed consent ; ( 2 ) acute or chronic inflammation or infection ( 3 ) , a history of autoimmune , malignant disease , liver , kidney or thyroid diseases .
anthropometric parameters including weight and height were measured for all patients , and their body mass index was calculated as the ratio of weight to height squared .
hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or use of antihypertensive treatment .
dm and pre - dm were defined according to the american diabetes association ( ada ) 2014 guidelines ( 21 ) .
patients were considered smokers if they smoked 1 cigarette / day at the time of admission or in the preceding 12 months . clinical manifestation of the heart failure on admission was assessed by killip class ( killip 1 , no heart failure ; killip 2 , s3 and/or basal lung crepitations ; killip 3 , acute pulmonary edema ; killip 4 , cardiac shock ) .
when a diagnosis of stemi was established and a decision to perform ppci was made , blood samples were obtained from peripheral vein before starting intervention , and 4 h , 8 h , 12 h , 18 h , 24 h , 48 h ( 2 day ) and 168 h ( 7th day ) after intervention .
blood samples for troponin i ( tni ) , mb fraction of creatine kinase ( ck - mb ) , n - terminal pro - brain natriuretic peptide ( nt - probnp ) , and high - sensitive c - reactive protein ( hs - crp ) determination were allowed to coagulate at room temperature for 30 min , and then centrifuged at 4000 rpm for 10 min to obtain serum samples .
serum tni and ck - mb were measured by chemiluminescent microparticle immunoassay ( cmia ) on the architect i2000 system .
the serum levels of nt - probnp were measured by a roche cobas 6000 automated analyzer ( roche diagnostics , mannheim , germany ) .
the serum hs - crp concentrations were measured in blood samples on admission , on the 2 and 7 day by means of the immuno - turbidimetric test ( olympus life and material science europe gmbh , ireland ) on an olympus au 400 analyzer .
ox - ldl measurement in edta plasma from blood samples on admission , on the 2 and 7 day was performed using a mercodia elisa assay ( mercodia ab , uppsala , sweden ) . in this solid - phase two - site enzyme immunoassay
two monoclonal antibodies are directed against separate antigenic determinants on the oxidized apolipoprotein b molecule .
the estimated glomerular filtration rate ( egfr ) was calculated using an abbreviated modification of diet in renal disease study formula ( 22 ) .
pci was performed within 12 h from the onset of chest pain by experienced interventionists . in all patients , stent
angiographic thrombolysis in myocardial infarction ( timi ) flow grade was evaluated as described previously ( 23 ) .
all patients and their angiograms were graded according to the number of diseased coronary arteries .
a coronary artery was considered diseased if there was any obstructive lesion 70% in diameter in that artery or one of its major branches ( diameter 2.5 mm ) .
medication used in the acute phase included loading a 600 mg dose of clopidogrel and 300 mg of aspirin and an intravenous bolus of heparin before ppci , followed by dual antiplatelet therapy ( clopidogrel or ticlopidine and aspirin ) and statins in all patients .
glycoprotein iib / iiia inhibitor , thrombectomy and intracoronary vasodilatators were administered at the discretion of the interventional cardiologist .
normality distribution of the analyzed continuous variables was assessed with the kolmogorov smirnov test . normally distributed continuous variables
are expressed with mean sd , and continuous variables that did not show normal distribution are expressed as the median value and interquartile range ( 25 , 75 percentile ) .
related - samples friedman s two ways anova by ranks was used to test time - dependent changes in hs - crp and ox - ldl concentrations .
spearman s rank correlation coefficients were used to assess the relationships between hs - crp and ox - ldl concentrations and others variables .
binary logistic regression analysis was used to assess determinants of ox - ldl concentrations and hs - crp concentrations higher than the 75 percentile on admission , on the 2 and 7 day .
all variables with p less than 0.05 from univariate analysis entered multivariate analysis ( wald method ) .
results are expressed as the odds ratios ( or ) and their 95% confidence intervals ( ci ) per one standard deviation increment of each measure .
the statistical analyses were performed using statistical package for social sciences ( spss ) version 20.0 ( spss , inc . ,
risk factors , clinical characteristics and baseline biochemical variables are presented in table i. the mean age of patients was 60 years and 73% were male .
twenty - five percent of patients had dm , 35% had pre - dm and 40% did not have dm or pre - dm . among the patients , 42.7% had hypercholesterolemia and 63% had a bmi>25
the median time from symptom onset to balloon ( ppci intervention ) was 4.1 h. on admission , 67% of the patients were in killip class one , 28% in class two and 5% in class three .
the concentrations of nt - probnp ( pg / ml ) ( ng / l ) were as follows : on admission 290.05 ( 126.101039.50 ) , on the 2 day 3170 ( 12014990 ) and on the 7 day 1237.50 ( 489.632576.75 ) .
time - dependent changes in ox - ldl and hs - crp in the whole study group and comparisons between patients with non - dm vs pre - dm vs dm are presented in table 2 . in the whole group and in each of the three subgroups changes in ox - ldl concentration
were statistically significant and showed the same pattern : maximal on admission , decreased on the 2 day and minimal on the 7 day ( p<0.001 , for each group ) . at each time point diabetics had the highest ox - ldl concentrations compared to no - dm and pre - dm groups ( on admission : p=0.028 , on day 2 : p=0.056 , on day 7 : p=0.004 ) , whereas differences between no - dm and pre - dm groups were insignificant .
time - dependent changes in hs - crp concentrations were also significant and showed the same pattern within each group : hs - crp concentrations rose from admission , reached peak values on the 2 day and decreased on the 7 day , but to levels above the start values ( p<0.001 ) ( table ii ) .
diabetics had all hs - crp concentrations statistically significantly higher compared to non - diabetics .
the differences between non - diabetics and pre - diabetics were significant on admission ( p=0.010 ) and on the 2 day ( p=0.026 ) , whereas differences between pre - diabetics and diabetics were not significant ( table ii ) .
time - dependent changes in plasma lipid and lipoprotein concentrations with comparisons between non - diabetics , pre - diabetics and diabetics are presented in table iii .
correlations between ox - ldl and hs - crp concentrations and the biochemical and clinical parameters are presented in table iv .
ox - ldl concentrations did not correlate with ldl levels . in the multivariate logistic regression analysis , independent determinants for ox - ldl concentration higher than the 75 percentile on admission were diabetes mellitus ( or 8.013 , 95% ci 1.73536.999 , p=0.008 ) and peak tni ( or 4.004 , 95% ci 1.56610.241 , p=0.004 ) , on the 2 day diabetes mellitus ( or 10.741 , 95% ci 2.39448.191 , p=0.002 ) and peak tni ( or 2.333 , 95% ci 1.0635.123 , p=0.035 ) , and on the 7 day diabetes mellitus ( or 12.006 , 95% ci 1.57591.503 , p=0.016 ) and killip class ( or 12.006 , 95% ci 1.12033.840 , p=0.037 ) . in the multivariate logistic regression analysis
independent predictors of hs - crp concentration higher than the 75 percentile on admission were nt - probnp concentration on admission ( or 3.312 , 95% ci 1.4629.990 , p=0.006 ) , on the 2 day killip class ( or 18.446 , 95% ci 3.057111.321 , p=0.001 ) , glucose on admission ( or 1.535 , 95% 1.0242.332 , p=0.038 ) , wbc count on admission ( or 2.798 , 95% ci 1.0607.383 , p=0.038 ) and 2 day nt - probnp concentration ( or 4.914 , 95% ci 1.71414.090 , p=0.003 ) , and nt - probnp concentration on the 7 day ( or 15.712 , 95% ci 2.64793.285 , p=0.002 ) .
dm and pre - dm were significant predictors of hs - crp concentrations in univariate , but not in multivariate analyses .
to the best of our knowledge , the present study is the first to analyze the dynamics of ox - ldl and hs - crp plasma concentrations regarding the presence of dm , pre - dm and no diabetes in the acute phase of the first myocardial infarction treated by primary percutaneous coronary intervention . it has allowed us to make several inferences .
first , time - dependent changes in the ox - ldl concentration are similar regardless of the presence of dm or pre - dm , with the highest values on admission and a gradual fall towards the 7 day .
however , patients with diabetes had significantly higher levels of ox - ldl before and after ppci compared to pre - diabetics and non - diabetics .
second , the independent determinants of plasma ox - ldl concentrations in the acute stemi phase were dm , peak tni and killip class .
third , the dynamics of hs - crp concentration during the acute stemi phase is uniform apart from the presence of dm or pre - dm , with the lowest values on admission and peak on the 2 day after ppci . nevertheless , not only diabetics but also pre - diabetics had significantly higher hs - crp concentrations compared to non - diabetics .
fourth , both ox - ldl and hs - crp levels were significantly associated with the heart failure parameters , including killip class , left ventricular ejection fraction and nt - probnp .
previous studies evaluating the association between plasma ox - ldl concentration and acute coronary syndrome revealed higher levels of ox - ldl in more severe clinical forms of acute coronary syndrome ( 2426 ) .
data regarding the plasma kinetics of ox - ldl in patients with acute myocardial infarction treated by prim pci are scarce and results strongly depend on the methodology used for the ox - ldl assay . in the prospective study by tsmikas et al .
( 27 ) minimal ox - ldl measured by the antibody e06 ( oxldl - e06 ) , determining the content of oxidized phospholipids per apolipoprotein b-100 , increased at hospital discharge and at 30 days in patients with myocardial infarction and decreased towards the baseline over the next 7 months . also ,
a rapid transient increment in ox - ldl concentration immediately after ppci was reported following elective percutaneous coronary intervention in patients with stable angina pectoris ( 28 ) .
we , as others ( 19 , 29 ) , found the maximal values of ox - ldl before ppci and then a gradual decrement on the 2 and further on the 7 day .
this pattern of plasma kinetics is in accordance with the concept that plaque rupture is followed by release of ox - ldl particles from the vascular wall or oxidized phospholipids that bind to circulating ldl and cause an increment in plasma ox - ldl . in previous studies ( 28 ) ,
release of ox - ldl resulted in immune complex formation with ultimate clearance of these particles that could explain the decrement of ox - ldl concentration in the days following ppci found in the current study .
the main finding of our study is that diabetics in the acute stemi phase before and during the first week after ppci have higher plasma ox - ldl concentrations compared to pre - diabetics and non - diabetics .
several studies have shown increased oxidative stress in diabetes with increased values of ox - ldl compared to non - diabetics ( 15 , 30 ) , but to the best of our knowledge , this is the first study confirming that diabetics have increased ox - ldl in the acute stemi phase compared to both non - diabetics and pre - diabetics . in chronic states , serum levels of ox - ldl
were found to be significantly increased in patients with impaired glucose tolerance ( pre - diabetes ) compared to individuals with normal glucose tolerance ( 31 ) . in the current study , in the acute phase of stemi , we could not find a significant difference in serum ox - ldl concentrations between non - diabetics and pre - diabetics .
previous studies have identified body mass index ( 30 ) , percent of visceral fat ( 30 ) , and duration of diabetes ( 15 ) as important determinants of the ox - ldl concentration . in our study ,
plasma ox - ldl concentrations in stemi patients did not correlate with bmi , or with waist circumferences , suggesting that in the acute stemi these parameters might not be crucial for the level of oxidative modification of ldl . whereas glucose concentration on admission was not a determinant of the ox - ldl plasma concentration , presence of dm and quality of glucose metabolic control in the past several months , i.e. hba1c were .
furthermore , dm was the only investigated parameter that was a significant and independent predictor of high ox - ldl concentrations in the multivariate analysis , for all three time points .
these data strongly suggest the importance of dm with regard to oxidative stress during the acute stemi . the relationships between ox - ldl and other plasma lipid fractions in chronic stable patients were previously investigated . in patients with impaired fasting glucose ( igf ) ( pre - diabetes )
a strong correlation was detected between ox - ldl and ldl cholesterol and triglycerides indicating that ldl oxidation in igf is preferentially associated with dyslipidemia ( 31 ) . in older individuals
determinants of ox - ldl in the multivariate analysis were ldl cholesterol , triglycerides , and high - density lipoprotein ( hdl ) cholesterol ( 33 ) . in the current study , in the acute stemi phase ox - ldl
did not correlate well with ldl concentration , but was significantly inversely related to hdl cholesterol and apolipoprotein ai ( apo ai ) concentrations .
hdl - associated enzyme para - oxonase that inhibits the oxidation of ldl and paf - acetyl hydrolase , which circulates in association with hdl and degrades bioactive oxidized phospholipids , could be potential parameters explaining the inverse relation between ox - ldl and hdl concentrations in our study group .
apo ai , a major protein component of hdl , promotes fat efflux , including cholesterol , from tissues to the liver for excretion . in our study ,
apo ai concentration in stemi patients significantly inversely correlated with ox - ldl and this relation has not been previously described .
it has been suggested that oxidative stress and chronic inflammation during atherosclerosis are mutually coupled processes ( 1 ) .
the results of our study the positive correlation between ox - ldl and hs - crp concentrations in acute stemi patients are in agreement with the recently published data ( 18 ) .
data regarding the potential mechanisms connecting plasma ox - ldl and hs - crp concentrations in the acute stemi phase are scarce . in experimental models , c - reactive protein binds to oxidized ldl through recognition of a ligand phosphorylcholine of oxidized phospholipids ( 34 ) , as part of the innate immune response to oxidized phospholipids within ox - ldl .
c - reactive protein also promotes ox - ldl uptake in macrophages ( 35 ) . in our study ,
correlations between hs - crp and ox - ldl concentrations during the stemi course showed that the level of inflammation and increment in serum hs - crp concentration after ppci are proportional to the plasma ox - ldl concentration before ppci .
previous studies evaluating the clinical relevance of circulating ox - ldl concentration in stemi patients treated by ppci predominately explored whether ox - ldl can predict stent restenosis during the follow - up ( 29 ) . to the best of our knowledge ,
our study is the first connecting the level of plasma ox - ldl with acute heart failure . in our study ,
ox - ldl was associated with the killip class on admission , nt - pro bnp and left ventricular ejection fraction .
furthermore , ox - ldl on admission was related to the traditional marker of infarct size , peak value of tni , independently from other covariates . in previous studies ,
plasma ox - ldl was reported to be related to the nyha function class and lv ef in chronic heart failure patients ( 36 ) . in an experimental model ,
interestingly , in our study plasma ox - ldl before ppci had the strongest correlation with the marker of infarct size and the parameters of heart failure , suggesting that the concentration of circulating ox - ldl particle before ppci might impact the success of myocardial reperfusion and functional left ventricular recovery . indeed , in experimental models of myocardial ischaemia - reperfusion , receptors for ox - ldl particles ( lecithin - like ox - ldl receptors ) were found to be up - regulated and coupled with apoptosis , necrosis and left ventricular functional deterioration ( 38 ) .
hs - crp is one of the most often evaluated bio - markers of atherosclerosis , since atherosclerosis is a process of low grade inflammation .
it was shown to be increased in pre - diabetes ( 39 , 40 ) . however
, this is the first study that showed that in the acute stemi patients with pre - diabetes also have higher hs - crp compared to non - diabetics while the difference compared to diabetics is insignificant .
pre - dm or dm were determinants of hs - crp concentration on admission and on the 2 day in univariate , but not in multivariate analyses .
the kinetics of serum hs - crp in stemi patients with the peak achieved 48 h to 72 h after mechanical revascularization , and decrement between the third and seventh day found in this study is similar to the results of others ( 43 ) .
association between peak tni and hs - crp concentrations on day 2 and 7 found in this study is in accordance with the results from previous studies ( 41 ) suggesting that after mechanical revascularization hs - crp increases in the first days proportionally to the infarct size .
clinical relevance of increased hs - crp in stemi patients treated with ppci was extensively studied , and hs - crp on admission , before or immediately after procedures was found to be a predictor of mortality ( 4244 ) although its prognostic value depends on the time from chest pain onset to blood sampling . in the current study , 2 day hs - crp concentration in stemi patients after ppci significantly correlated with heart failure parameters , including killip class , nt - pro bnp and left ventricular ejection fraction .
the association between the baseline hs - c - reactive protein concentration and heart failure was previously described in a wide heterogeneous group of patients with the acute coronary syndrome ( 45 ) .
however , our population consisted of homogenous first anterior stemi patients treated by ppci that allows more uniform dynamics of biomarkers .
however , our population consisted of homogenous first anterior stemi patients treated by ppci that allows more uniform dynamics of biomarkers .
among patients with the first anterior stemi treated by ppci , there are significant differences in the concentration of hs - crp and ox - ldl between pre - diabetics , diabetics and non - diabetic individuals .
diabetes is an important independent determinant of high ox - ldl in the acute stemi .
both ox - ldl and hs - crp levels in patients with acute stemi treated by ppci are associated with markers of acute heart failure . whether the higher levels of ox - ldl and hs - crp in pre - dm and dm stemi patients could be translated into poor clinical outcome regarding heart failure remains to be determined in larger prospective studies . | summarybackgroundoxidized low density lipoprotein ( ox - ldl ) and high - sensitive c - reactive protein ( hs - crp ) are elevated in diabetes mellitus ( dm ) and associated with accelerated atherosclerosis .
little is known about their dynamics in the acute phase of st segment elevation myocardial infarction ( stemi ) , especially in relation to the presence of dm and pre - diabetes ( pre - dm ) .
this study aimed to analyze time - dependent changes in ox - ldl and hs - crp regarding the presence of pre - dm and dm in stemi patients treated by primary percutaneous coronary intervention ( ppci).methodsin 103 consecutive patients with the first anterior stemi ox - ldl and hs - crp were measured before ppci , on day 2 and day 7 after ppci.resultspatients were classified into : non - diabetics , pre - diabetics and diabetics . in each group
the maximal ox - ldl concentration was found on admission , decreased on day 2 and reached the lowest values on day 7 ( p<0.001 ) .
diabetics had the highest ox - ldl concentrations compared to pre - diabetics and non - diabetics ( on admission : p=0.028 , on day 2 : p=0.056 , on day 7 : p=0.004 ) .
hs - crp concentration rose from admission , reached its peak on day 2 and decreased on day 7 , in each group ( p<0.001 ) .
significant differences in hs - crp concentrations were found between non - diabetics and pre - diabetics on admission ( p=0.018 ) and day 2 ( p=0.026 ) . in a multivariate analysis dm was an independent determinant of high ox - ldl concentrations .
both ox - ldl and hs - crp significantly correlated with killip class , left ventricular ejection fraction , nt - probnp and peak troponin i.conclusionsin patients with the first stemi treated by ppci there were significant differences in ox - ldl and hs - crp concentrations between non - diabetics , pre - diabetics and diabetics .
ox - ldl and hs - crp concentrations were related to heart failure parameters . |
an 18-year - male patient by name vinith came with a complaint of generalized spacing in his upper front teeth . on clinical examination ,
the case was diagnosed as angles class i molar relation on class i skeletal base with retained deciduous lateral incisor 52 , with missing right side lateral incisor and spacing in the upper anterior teeth and mild crowding in the lower teeth .
the central incisor was drifted slightly toward unerupted lateral incisor and lack of space for the lateral incisor to erupt .
on palpation , there were no signs of bulge either in the labial vestibule or on palatal vault .
on radiographic examination , odontome and retained deciduous tooth was seen along with horizontally impacted lateral incisor [ figure 1 ] .
the central incisor was shifted toward the right side and occupied half of the lateral incisor space .
same side lingual , opposite side buccal technique with two intraoral periapical radiographs confirmed the presence of impacted lateral incisor on the palatal side .
pretreatment osteoprotegerin and lateral cephalogram the treatment options available were extraction of impacted lateral incisor and going for a prosthetic implant by creating sufficient space for the implant placement and residual space closure with the help of fixed orthodontic treatment .
second option was a fixed partial denture by closing the spaces in the upper front teeth , and the third option was to extract the deciduous tooth and bringing the impacted tooth into occlusion , but it is time - consuming .
the patient was more interested in saving the tooth instead of going for artificial teeth .
the treatment plan was to bring the impacted lateral incisor into occlusion and close the spaces in the upper arch .
odontome and retained deciduous lateral incisor was surgically excised [ figures 2 and 3 ] .
pretreatment intra oral view smile and buccal view showing missing lateral incisor an mclaughlin , bennett , terevisi fixed appliance with 0.022 slot was bonded , 0.016 niti was used for initial leveling and aligning .
the central incisors were moved to the left side in order to prevent root resorption , as the lateral incisor was lying in closer proximity to the root of central incisor , and to regain the space for lateral incisor .
space closure was done on 0.19 0.25 stainless steel wire , and to provide stability for the adjacent tooth while bringing the impacted tooth into occlusion .
once the considerable amount of space obtained for the lateral incisor to bring into occlusion , under local anesthesia surgical exposure was done on palatal side [ figure 4 ] .
after elevation of the mucoperiosteal flap , an adequate amount of bone was removed by creating a channel for the tooth to come out with the help of rotary cutting instruments . a lingual button was bonded onto the palatal aspect of the lateral incisor .
ligature wire with bull eye holes were attached to the lingual button and tied to the main arch wire .
surgical exposure of palatally placed impacted lateral incisor once wound got healed , 0.012 niti wire was used as piggyback wire and engaged it to the ligature wire and tightly tied to the rigid stainless steel main archwire .
as niti has shape memory effect , it started moving the tooth into occlusion , this was seen periodically through radiographs .
we have increased the force slightly in further visits by increasing the dimension of the wire to 0.014 and 0.016 niti .
once the tooth was seen on the labial aspect , 0.016 0.22 tma wire was used with a coil to bring the tooth into occlusion .
once the tooth came closer , 0.016 niti was placed directly into the bracket of lateral incisor and brought it into occlusion [ figure 5 ] .
a panoramic radiograph shows the dilacerated lateral incisor with uprighted teeth and with proper space closure [ figure 6 ] .
the stabilized teeth were retained with upper and lower fixed lingual retainer figure 5 . impacted lateral incisor into occlusion . impacted lateral incisor into occlusion posttreatment osteoprotegerin and lateral cephalogram
the patient wanted to retain the tooth instead of going for extraction and was very much cooperative throughout the treatment .
the lingual button was bonded onto the palatal side of the impacted tooth because the labial side was facing towards the nasal floor .
many precautions were taken during bonding because the chances of debonding were high on the lingual aspect compared to the labial side , due to its irregular morphology .
controlled amount of force was applied carefully with the help of ligature wire in every visit to prevent from debonding .
as the tooth gets closer , the ligature wire was cut and the loop adjacent to the tooth was tied to the niti wire .
complete space closure and a broad smile was achieved within a span of 18 months [ figure 7 ] .
impacted teeth can be treated easily in the mixed dentition with the periodic extraction of retained deciduous tooth .
if the impacted tooth was in favorable position and time was not a constraint impacted tooth can be brought into normal occlusion with orthodontic tooth movement .
| impaction of maxillary lateral incisor with odontome and retained deciduous tooth is not often seen in regular dental practice .
impaction of anterior teeth cause generalized spacing which affects the esthetics of the face . here we report a case of an 18-year - old patient with horizontally impacted dilacerated lateral incisor , which was bought into occlusion with the help of orthodontic tooth movement within a span of 18 months . |
united nations human settlements gave a comprehensive global description of urban slum communities and attempted to identify different approaches to address this problem to achieve the united nations millennium development goals ( mdgs ) . at the united nations expert group meeting held in nairobi in 2002 ,
a slum was operationally defined as a human settlement that has the following characteristics : inadequate access to safe water , sanitation and other infrastructure , poor structural quality of housing , overcrowding and insecure residential status ( 1 , 2 ) .
currently , these characteristics describe communities that comprise 43% of the combined urban populations in all developing countries , and 78% of the urban population in least developed countries ( 2 ) . apart from the standard social indices , such as life expectancy at birth , under five mortality rates and access to improved water sources and sanitation , the report did not address disease spectrum or burden in these communities .
hence little is known about the spectrum and burden of disease morbidity in urban slums of the world , whereas lack of such data hampers adequate health care resource allocation and provision of appropriate disease prevention services . in many countries , most disease burden or mortality information on urban slum dwellers
this type of information is not sufficient to plan health care expenditures , and grossly underestimates or misdirects the health care resource allocation needs .
non - communicable diseases refer to diseases or conditions that occur in , or are known to affect , individuals over an extensive period of time and for which there are no known causative agents that are transmitted from one affected individual to another ( 3 ) .
hypertension , diabetes , cardiovas - cular disease , lung diseases , chronic respiratory diseases , cancer , mental health problems , asthma , atherosclerosis and allergy are non - communicable diseases that are rapidly emerging as public health challenge to urban slum populations , whereas 72% of the total global burden of disease in adults thirty years or older are due to these chronic diseases ( 47 ) .
they also noted that formal health sector becomes aware of the health problems of slum populations relatively late in the course of their illnesses .
as such , it inevitably deals with the severe and end - stage complications of these diseases at a substantially greater cost than what it costs to manage non - slum community populations .
nigeria relies mainly on data from the national health management information systems in order to estimate the national burden of ncds as it has not conducted surveys to establish the national base line prevalence rates of these diseases so as to accurately quantify the magnitude of the problem .
nevertheless , it has been estimated that about 5 million nigerians may die of ncds by the year 2015 , while diabetes alone is projected to cause about 52% of the mortality by 2015 ( 8) .
presently , about 8 million nigerians suffer from hypertension and 4 million has diabetes , also 100 , 000 new cases of cancers are diagnosed each year , and about ten thousand nigerians die annually due to injuries from road traffic accidents ( 9 ) . however , due to the informal nature of slum settlements , and cultural , social , and behavioral factors unique to the slum populations , little is known about the burden of these chronic but preventable diseases in the three communities surveyed for this study . besides , the inhabitants are often unable to access the education and services required to prevent and treat ncds .
this study therefore aimed at determining the prevalence of hypertension , diabetes and obesity in three urban slums within lagos metropolis , southwestern nigeria .
it is hoped that this will shed more light on some health challenges facing the inhabitants and also inform local health authorities for timely intervention .
the study population consisted of individuals who were 5 years and above living permanently in ajegunle in ajeromi ifelodun local government area ( lga ) ; ijora oloye in apapa ( lga ) ; makoko in mainland ( lga ) . the current populations ( ajegunle - 429,381 ; ijora oloye - 18,278 ; makoko - 141,277 ) were calculated based on the projected growth rate of 7.5% using the 1991 national census figures as baseline .
sample size of single proportion method using epi info version 6 was used to calculate the sample size of 2,434 individuals .
prior to the commencement of the project , ethical clearance was obtained from the institutional review board of the nigerian institute of medical research .
permission to carry out the project in the selected communities was obtained from the three local government area authorities overseeing the study communities .
a cross - sectional survey was employed to elicit essential information from the respondents . before the commencement of the survey ,
training was provided on a one to one basis to all research assistants selected to participate in the study , with the aim of enhancing their understanding of the research protocols and competence in administering the questionnaire .
they were also trained to use the electronic machine to measure blood pressure and glucometer for estimating blood glucose .
the training helped to avoid biases or errors in the procedures employed and ensured their understanding and unified interpretation of basic terminologies that were used in the study .
after the training , there was a pilot study which helped the team to have a foretaste of problems that might be encountered during the main survey and also to test the reliability , validity and applicability of the research instruments .
a multi - stage sampling method was used to sample 2,434 household members across different socioeconomic background .
the first stage of this technique involved the stratification of each community into two groups on the basis of geographical closeness .
the second stage was the clustering of each of the 2 groups into different enumeration areas ( eas ) on the basis of existing delineation by national population commission of lagos state in the 2006 population census exercise .
third stage involved random selection of four eas from each of the three selected slum communities .
the fourth stage involved numbering of houses in each of the selected eas and selection of houses from the numbered houses within each of the strata using systematic random sampling .
the final step was the random sampling of households from each of the sampled houses by writing the identification numbers of the households on pieces of paper and the desired sample was selected by picking the required number of papers .
however , names of heads of the households were used in place of identification numbers .
a total of 2,434 respondents were polled from ijora oloye ( 805 ) , ajegunle ( 814 ) and makoko ( 815 ) communities .
figure 1 and 2 shows maps of nigeria and the study communities in lagos state , southwestern nigeria .
the survey made use of a semi - structured questionnaire , while the units of analysis for the survey were households .
the questionnaire included details regarding demographic and socio - economic characteristics like participant s self reported age , sex , educational status and occupational status .
health conditions were documented based on self - reported history of diabetes , and hypertension and family history for the conditions was also collected . body mass index ( bmi ) was calculated using the formula weight ( kg)/height ( m2 ) .
weight was measured with traditional weighing balance that was kept on a firm horizontal surface .
map of nigeria showing states and zones , with arrow pointing to lagos state map of lagos state showing the sixteen local government areas height was measured with a calibrated pole to the nearest cm .
subjects were requested to stand upright without shoes with their back against the wall , heels together and eyes directed forward .
participant s blood pressure levels were measured in mmhg in a sitting position and after a rest of five minutes using a pre - tested electronic omron machine ( omron corporation , tokyo , japan ) , while random blood glucose was determined using the glucometer ( on call plus , california , usa ) .
the survey made use of a semi - structured questionnaire , while the units of analysis for the survey were households .
the questionnaire included details regarding demographic and socio - economic characteristics like participant s self reported age , sex , educational status and occupational status .
health conditions were documented based on self - reported history of diabetes , and hypertension and family history for the conditions was also collected . in order to ensure quality control , credibility , reliability and precision of data collected ,
in addition , they had both written and spoken competence of the local and english languages , and good geographical knowledge of the three slums .
to further enhance rapport , quality of information and report , interviews and discussions were conducted in english , pidgin or local languages as was convenient for the participants .
completed questionnaires were checked on the spot and re - checked in the office for validation before data entry .
data was entered in ms - excel and was analyzed using the statistical package for social sciences ( spss ) window version 16.0 .
the study population consisted of individuals who were 5 years and above living permanently in ajegunle in ajeromi ifelodun local government area ( lga ) ; ijora oloye in apapa ( lga ) ; makoko in mainland ( lga ) . the current populations ( ajegunle - 429,381 ; ijora oloye - 18,278 ; makoko - 141,277 ) were calculated based on the projected growth rate of 7.5% using the 1991 national census figures as baseline .
sample size of single proportion method using epi info version 6 was used to calculate the sample size of 2,434 individuals .
prior to the commencement of the project , ethical clearance was obtained from the institutional review board of the nigerian institute of medical research .
permission to carry out the project in the selected communities was obtained from the three local government area authorities overseeing the study communities .
a cross - sectional survey was employed to elicit essential information from the respondents . before the commencement of the survey ,
training was provided on a one to one basis to all research assistants selected to participate in the study , with the aim of enhancing their understanding of the research protocols and competence in administering the questionnaire .
they were also trained to use the electronic machine to measure blood pressure and glucometer for estimating blood glucose .
the training helped to avoid biases or errors in the procedures employed and ensured their understanding and unified interpretation of basic terminologies that were used in the study .
after the training , there was a pilot study which helped the team to have a foretaste of problems that might be encountered during the main survey and also to test the reliability , validity and applicability of the research instruments .
a multi - stage sampling method was used to sample 2,434 household members across different socioeconomic background .
the first stage of this technique involved the stratification of each community into two groups on the basis of geographical closeness .
the second stage was the clustering of each of the 2 groups into different enumeration areas ( eas ) on the basis of existing delineation by national population commission of lagos state in the 2006 population census exercise .
third stage involved random selection of four eas from each of the three selected slum communities .
the fourth stage involved numbering of houses in each of the selected eas and selection of houses from the numbered houses within each of the strata using systematic random sampling .
the final step was the random sampling of households from each of the sampled houses by writing the identification numbers of the households on pieces of paper and the desired sample was selected by picking the required number of papers .
however , names of heads of the households were used in place of identification numbers .
a total of 2,434 respondents were polled from ijora oloye ( 805 ) , ajegunle ( 814 ) and makoko ( 815 ) communities .
figure 1 and 2 shows maps of nigeria and the study communities in lagos state , southwestern nigeria .
the survey made use of a semi - structured questionnaire , while the units of analysis for the survey were households .
the questionnaire included details regarding demographic and socio - economic characteristics like participant s self reported age , sex , educational status and occupational status .
health conditions were documented based on self - reported history of diabetes , and hypertension and family history for the conditions was also collected .
body mass index ( bmi ) was calculated using the formula weight ( kg)/height ( m2 ) .
weight was measured with traditional weighing balance that was kept on a firm horizontal surface .
map of nigeria showing states and zones , with arrow pointing to lagos state map of lagos state showing the sixteen local government areas height was measured with a calibrated pole to the nearest cm .
subjects were requested to stand upright without shoes with their back against the wall , heels together and eyes directed forward .
participant s blood pressure levels were measured in mmhg in a sitting position and after a rest of five minutes using a pre - tested electronic omron machine ( omron corporation , tokyo , japan ) , while random blood glucose was determined using the glucometer ( on call plus , california , usa ) .
the survey made use of a semi - structured questionnaire , while the units of analysis for the survey were households .
the questionnaire included details regarding demographic and socio - economic characteristics like participant s self reported age , sex , educational status and occupational status .
health conditions were documented based on self - reported history of diabetes , and hypertension and family history for the conditions was also collected . in order to ensure quality control , credibility , reliability and precision of data collected ,
in addition , they had both written and spoken competence of the local and english languages , and good geographical knowledge of the three slums .
to further enhance rapport , quality of information and report , interviews and discussions were conducted in english , pidgin or local languages as was convenient for the participants .
completed questionnaires were checked on the spot and re - checked in the office for validation before data entry .
data was entered in ms - excel and was analyzed using the statistical package for social sciences ( spss ) window version 16.0 .
all respondents were interviewed directly using personal interview method in order to avoid incomplete information .
a sample of 2,434 respondents was recruited from ijora oloye ( 805 ) , ajegunle ( 814 ) and makoko ( 815 ) communities .
table 1 shows the various languages used for the interview and the demographic characteristics of the respondents .
language of interview and demographic characteristics of the respondents only 312 ( 12.9% ) out of the 2,434 admitted being previously diagnosed of hypertension ( table 2 ) , while of the 312 , just 29 ( 9.3% ) were currently on treatment . out of 2,434 respondents
whose blood pressure measurements were taken , 650 ( 26.7% ) had systolic pressure greater than 140 mmhg , 562 ( 23.1% ) had diastolic pressure greater than 90mmhg , while 635 ( 26.7% ) had their pulse rates greater than 100 beats per minute ( table 3 ) .
they were considered to be hypertensive as indicated by the seventh report of the joint national committee on prevention , detection , evaluation , and treatment of high blood pressure ( jnc 7 , 2004 ) .
also , about 635 ( 26.7% ) respondents had pulse rates greater than 100 beats per minute .
respondents responses ( % ) to questions on history of raised blood pressure and diabetes results of blood pressure , body mass index ( bmi ) and random blood sugar of the respondents our data also showed that more males than females had systolic range greater than 140mmhg .
the same could also be said about diastolic pressure and pulse rates as more men than women have theirs above the normal range . in addition
, we observed that cases of high blood pressure were more common among respondents aged between 45 and54 years .
the results of the respondents bmi showed that more than half ( 55.3% ) of them were either overweight or obese ( table 3 ) and are at risk for diabetes due to their weights , however , about 3.3% had their sugar levels greater than 200mg / dl and thus were said to be diabetic .
however , there were no significant differences between the prevalence of hypertension and high glucose in the three communities .
associated factors such as person s lifestyle , genetics or environment are known to determine the likelihood of certain non communicable diseases .
of these three risk factors , 50% of all non communicable diseases are a result of poor lifestyle choices such as drug use , alcohol and tobacco use , diet , lack of exercise or stress management .
this study was conducted in three informal settlements otherwise referred to as slums in lagos state , southwestern nigeria to identify the prevalence ncds in the communities .
it was observed that more than one quarter of the participants were suffering from hypertension and only half of this were diagnosed earlier , while a further few were on treatment . therefore on screening , it had been possible to diagnose over three hundred more respondents .
thus high prevalence of undiagnosed hypertension points out to the fact that there is the need to devise comprehensive strategy for early identification and prompt treatment of hypertension to prevent its end - stage complications .
it is also important to note that more than half of the respondents were either overweight or obese and are at risk for diabetes .
in addition , what is most disturbing was the absence of regular follow up and treatment .
high hypertension prevalence and low levels of awareness and treatment as observed in this study point to a high cardiovascular disease burden in these slums .
this should be of great concern to health planners in nigeria . whereas interventions to improve the health of slum dwellers are not cutting - edge science .
effective interventions involve not only treating disease but also addressing the underlying social and living conditions of slums , while it has been shown that health promotion and primary prevention have the potential to prevent or delay the onset of chronic diseases and its risk factors ( 1214 ) . looking at the growing urban population and almost one third contribution of slum population in cities , the high prevalence of hypertension should be a matter of concern to the local and national health authorities .
in nigeria , the last national survey on ncd was carried out in 1999 . as a result of changes in the peoples lifestyles due to adoption of western lifestyle
, cases of ncds in the country may be on the increase and these diseases may rapidly emerge as a public health challenge in both urban and rural areas .
there is also paucity of programs to detect , manage and prevent these diseases in the country , and unless urgent and specific focus on preventing , treating and control of ncds are targeted , the burden of the ncds will be unbearable to the poor .
this study had provided a background data on ncds in slums and concerned organizations should focus and contribute to the prevention , control and reduction of ncds burden and their risk factors .
their prevention requires an integrated action across a range of sectors at local and national levels .
federal and state ministries of health can develop priority based infrastructures and modules to prevent and control the ncds at different stages .
they can also develop local and national levels policies and plans of action for good planning and implementation .
advocacy campaigns such as awareness raising programs , street dramas , concerts can also be conducted for the general people on how to prevent ncds , while involvement of public figures at the local and national media in these events can boost the impact .
we therefore recommend that government should take the lead in developing a comprehensive promotional campaign to highlight the dangers of some lifestyles / behaviors such as drug abuse , smoking and excessive alcohol intake , particularly among the youth . also continued funding by donors and governments is critical if sustainable strides are to be made in controlling these diseases and alleviating their effects on families and communities .
in addition , further research is needed on the current burden of ncds in nigeria so as to generate a more current national database on these diseases , and help move evidence to policy and practice .
it will also assist the government to put a priority setting on the control and treatment of ncds in nigeria .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | abstractbackgroundnon - communicable diseases ( ncds ) exist in slums as the inhabitants adopt an urbanized lifestyle which places them at a higher risk for .
lack of knowledge about the morbidity , complications and the method of control contributes to a large percentage of undetected and untreated cases.methodsthis cross - sectional survey polled 2,434 respondents from ijora oloye , ajegunle and makoko , three urban slums in lagos metropolis , southwestern nigeria between june 2010 and october 2012 .
we investigated the prevalence of hypertension , diabetes and obesity .
respondents signed consent forms and their health conditions were documented based on self - reported history of diabetes , hypertension and family history using a semi - structured questionnaire .
diagnostic tests ; weight and height for body mass index , blood glucose , and blood pressure were performed.resultsmore than one quarter of the participants were suffering from hypertension and only half of this were diagnosed earlier , while a further few were already on treatment . therefore on screening , it had been possible to diagnose over three hundred more respondents , who were not previously aware of their health status .
the respondents bmi showed that more than half of them were either overweight or obese and are at risk for diabetes , while 3.3% were confirmed as being diabetic , with their sugar levels greater than the normal range.conclusionthis study therefore revealed the near absence of screening programs for chronic diseases such as hypertension , diabetes and obesity in these urban slums .
this was further confirmed by the detection of new and undiagnosed cases of hypertension in about one quarter of the respondents . |
liver is the most massive of the viscera , occupying a substantial portion of abdominal cavity , that is , right hypochondrium and epigastrium , and extending into left hypochondrium as far as left lateral line .
it is convex in the front , to the right , above , and behind , and is somewhat concave inferiorly , where it is moulded to the shapes of the adjacent viscera .
even though the surface is smoothly continuous , liver is customarily apportioned by anatomists into a larger right and a much smaller left lobe by the line of attachment of the falciform ligament anteriorly and the fissure for ligamentum teres and ligamentum venosum on inferior surface .
in addition to the right and left lobes , there are two additional lobes , a quadrate lobe in the front and the caudate lobe behind , separated from each other by the porta hepatis ( figure 1 ) .
quadrate lobe visible on the inferior surface appears somewhat rectangular and is bounded in the front by the inferior border , on the left by fissure for ligamentum teres , behind by porta hepatis , and on the right by the fossa for the gall bladder ( figure 1 ) .
the caudate lobe is visible on the posterior surface , bounded on the left by fissure for ligamentum venosum , below by porta hepatis , and on the right by the groove for inferior vena cava . above
below and to the right , it has a narrow caudate process . below and to left it has a small round papillary process ( figure 1 ) .
the more common gross abnormalities are irregularities in form , number of lobules , and in the presence of cysts .
58 liver specimens available in the anatomy department of maharajah 's institute of medical sciences constituted the study material .
the liver specimens had been removed from adult human cadavers during routine dissection for medical undergraduate students from the year 2004 to 2012 and then preserved in 10% of formalin .
each lobe of the liver , that is , right lobe , left lobe , caudate lobe , and quadrate lobe was studied in detail for the size , shape , accessory fissures , and accessory lobes .
the maximum width ranged from 11.8 cm to 20 cm . in the present study the livers with normal surfaces , fissures , and borders
were normal without any accessory fissures or lobes and with normal contour ( figure 1 ) .
out of the remaining 34 specimens , 31 ( 53.44% ) specimens , even though they appear normal , they had accessory fissures on the left lobe , right lobe , caudate lobe , and quadrate lobe , which resulted in the formation of accessory lobes .
lingular process of left lobe was present only in 1 specimen ( 1.72% ) ( table 1 ) . in 8 specimens ,
accessory fissures were seen in different areas of the right lobe ( table 2 ) .
out of these 8 specimens , 6 specimens showed accessory fissures between caudate process and duodenal impression ( figure 2 ) .
, 2 small accessory fissures resulted in 2 small accessory lobes present close to the base of gall bladder near the inferior border ( figure 3 ) .
one specimen with diaphragmatic impressions , that is , netter type 7 liver , was also noted in the present study ( figure 4 ) . in 6 specimens ,
accessory fissures were noted over various areas of left lobe of liver ( figures 5 and 6 ) ( table 2 ) .
two specimens were with hypoplastic left lobes ( figure 7 ) . in 1 specimen ,
lingular process of left lobe , that is , netter type 5 , ( figure 8) was identified . out of 31
, 8 specimens showed accessory fissures and accessory lobes in the caudate lobe ( table 2 ) ( figure 9 ) . in 1 specimen
the fissure was found to be between the caudate process and papillary process ( figure 10 ) . out of 9 specimens with accessory fissures in quadrate lobe
, 1 specimen shows a complete transverse fissure dividing into a superior and an inferior lobe ( figure 11 ) .
quadrate lobe varies in shape from triangular ( figure 12 ) to irregular ( figure 13 ) and it also varies in size from very narrow ( figure 14 ) to ill - defined and also continuous with left lobe due to the presence of an incomplete fissure for ligamentum teres ( figure 15 ) . in 1 specimen accessory fissures
are present over the right , left , caudate , and the quadrate lobes ( figure 16 ) .
accessory lobes are present in both the caudate and quadrate lobes in one specimen ( figure 17 ) .
of all the digestive organs , the liver is the one which starts its organogenesis early during 3rd week of intrauterine life and develops most rapidly . gross abnormalities of the liver are rare in spite of its complex development .
the more common gross abnormalities are irregularities in form and less common abnormality is the occurrence of one or more accessory livers or lobes .
the single liver in some lower animals like pig and dog has distinct lobules separated by strands of connective tissue and sometimes the human liver shows this variation by reversion .
the variations in the anatomy of human liver have been classified as congenital or acquired .
the congenital anomalies of liver can be divided into anomalies due to defective development and anomalies due to excessive development .
defective development of left lobe of liver can lead to gastric volvulus , whereas defective development of right lobe may remain latent or progress to portal hypertension .
the excessive development of liver results in the formation of accessory lobes of liver which may carry the risk of torsion . acquired changes in the liver morphology are represented by the following characteristic features : ( 1 ) linguiform lobes , ( 2 ) costal organ with very small left lobe , ( 3 ) deep renal impressions and corset type constriction and local inflammation of the organ or gallbladder .
the accessory hepatic fissures are potential sources of diagnostic errors on both sonography and ct ( y. h. auh et al . ) .
sonographically multiple accessory fissures also may be confused at first look with a macronodular liver , so a supplementary ct scan is often helpful for further evaluation .
multiple hepatic fissures and lobes were more common on the under surface of liver , opposite to the quadrate lobe , and in the left lobe . in the present study ,
53.44% of livers are with accessory fissures over their various parts especially on the undersurface in accordance with cullen . in the present study 9 specimens have accessory fissures in quadrate lobe alone , whereas in 1 specimen , accessory fissures are present both in caudate and quadrate lobes ( figure 16 ) and in another liver all the lobes , that is , right , left , caudate , and quadrate lobes have accessory fissures on the under surface .
so , in total 11 out of 31 specimens ( 35.48% ) have accessory fissures in quadrate lobe .
there is a very sparse mention of the incidence of accessory fissures in various lobes of liver in the established anatomical literature .
knowledge of accessory fissures over various parts of liver is important for radiologists , which prevents misdiagnosis of cystic lesions or any macroscopic pathological lesions of the liver . | background . day to day advances in the fields of radiology like sonography and ct need to revive interest in the cadaveric study of morphological features of liver , as the accessory fissures are a potential source of diagnostic errors .
accessory fissures vary from single to multiple over different parts of the liver . aim . in the present study
the morphological features of human liver specimens were evaluated by macroscopic examination and morphometric analysis .
methods .
the study was conducted on 58 specimens obtained from cadavers utilized for routine dissection for medical undergraduates from the year 2004 to 2012 in the anatomy department of mims medical college .
results . in the present study the livers as described in the established anatomical literature with normal surfaces , fissures , and borders were considered normal . out of the 58 specimens ,
24 were normal without any accessory fissures or lobes and with normal contours .
two specimens were with hypoplastic left lobes .
lingular process of left lobe was observed in only one specimen .
conclusions .
knowledge of the various accessory fissures of liver prevents misdiagnosis of cystic lesions or any pathological lesions of the liver . |
promoter methylation has been well recognized as an important epigenetic change in the development of cancer .
normally , cpg islands in the promoter regions of a number of genes are present in an unmethylated state .
aberrant methylation of cpg islands in promoters is characteristic of several genes in cancer leading to loss of gene expression .
a nonrandom pattern of promoter hypermethylation has been noted in specific genes in specific tumor types , although some genes are commonly methylated in diverse tumors .
the extent of aberrant promoter hypermethylation and its association with loss of gene function in cancer suggests that cpg island methylation is an important mechanism in inactivating tumor suppressor genes ( tsgs ) .
germ cell tumors ( gcts ) are the most common cancer in men between the ages 2040 with an incidence of 4.2 cases per 100,000 .
gcts arise by transformation of spermatogonial lineage cells and display pluripotentiality for embryonal and extra - embryonal lineage differentiation .
histologically , they may present as undifferentiated germ cell ( gc)-like seminomas ( sgcts ) or highly differentiated nonseminomas ( nsgcts ) .
nsgcts display complex differentiation patterns that include embryonal , extra - embryonal , and somatic tissue types .
teratomas with somatic differentiation can undergo additional malignant transformation with characteristics of epithelial , mesenchymal , neurogenic , or hematologic tumors . while the majority of gcts exhibit exquisite sensitivity to cisplatin - based chemotherapy , a small proportion of metastatic tumors remain resistant .
therefore , male gcts comprise a unique model system to investigate the biology and genetics of gc transformation , differentiation , and chemotherapy resistance / sensitivity . during the life span of a normal gc ,
however , the role of epigenetic changes in gct etiology and biology are not well studied . to investigate such a role
, we evaluated the status of promoter hypermethylation of 21 genes in gct specimens and cell lines .
we found an absence of promoter hypermethylation in sgct and acquisition of unique patterns of promoter hypermethylation in nsgct .
we also showed that the hypermethylation leads to loss of expression in most of the genes and reactivate upon treatment with demethylating drug 5-aza-2 ' deoxycytidine .
we assessed 92 gct dnas representing all histologic subsets of nsgct , and sgct , and four normal testes for methylation status of cpg islands of 21 gene promoters by methylation - specific pcr ( msp ) ( fig .
, 15 genes ( mgmt , rassf1a , apc , rarb , cdh1 , mlh1 , timp3 , gstp1 , dapk , cdkn2a , p14 , brca1 , fhit , tp73 , and hic1 ) had previously been shown to be commonly methylated in various solid tumor types .
six additional genes ( rb1 , nme1 , nme2 , btg1 , nedd1 , and apaf1 ) were studied because of their possible involvement in genetic alterations in gct as indicated by loh studies [ 8 - 10 ] .
the rb1 gene at 13q14.2 showed frequent loss of heterozygosity ( loh ) in gct .
the nme1 and nme2 genes mapped to 17q21.3 also were affected by loh and exhibited loss of expression in teratoma .
the btg1 , apaf1 , and nedd1 genes mapped to the 12q22 common - deletion region , and thus considered as candidate tsgs in gct .
promoter hypermethylation was not found in normal testes for any of the tested genes except cdh1 .
however , promoter hypermethylation was detected in 43 of the 92 ( 46.7% ) gcts studied with an individual gene frequency of : rassf1a , 21.7% ; mgmt , 20.7% ; brca1 , 19.8% , hic1 , 19.6% ; apc , 9.8% ; rarb , 7.6% ; cdh1 , 7.6% ; fhit , 6.5% , mlh1 , 4.3% ; timp3 , 3.3% ; gstp1 , 1.1% ; and nme2 , 1.1% ( fig .
hypermethylation of one or more genes was found only in 5 of 29 ( 17.2% ) sgcts but in 38 of 63 ( 60.3% ) nsgcts ( fig .
four of the five sgcts that exhibited promoter hypermethylation were methylated at a single locus and one tumor at two loci , whereas 27 of the 38 nsgcts exhibited two or more methylated loci .
promoter hypermethylation was seen in all histologic subsets of nsgct , with yolk sac tumor ( yst ) exhibiting a higher frequency of methylation compared to other histologies ( fig .
u , unmethylated ; m , methylated ; tumor ( t ) and cell line ( cl ) numbers are indicated on the top . to examine the biological role of promoter hypermethylation in gct , we assessed the levels of gene expression by semi - quantitative rt - pcr in 23 tumors ( 15 nsgcts and 8 sgcts ) with known methylation status .
eight genes ( mgmt , rassf1a , brca1 , apc , rarb , cdh1 , mlh1 , and timp3 ) that exhibited methylation in > 3% of the cases were examined ( fig .
4 , table 1 ) . levels of expression of each gene were assessed by comparing with the respective control values , obtained from the averages calculated from 2 to 4 normal testes , after normalization against actb .
all tumors with promoter hypermethylation of the mgmt and mlh1 genes exhibited an absence or down - regulated expression of the respective gene , while 8 of 10 cases with rassf1a methylation and 3 of 5 tumors with rarb methylation showed down - regulated expression ( table 1 ) .
the other four genes ( brca1 , apc , cdh1 , and timp3 ) did not show a consistent pattern of correlation between methylation and loss of gene expression ( table 1 ) . of note ,
the mgmt gene exhibited down - regulated expression in 22 of the 23 ( 95.7% ) tumors , including all the tumors that showed promoter methylation .
no consistent down - regulation of expression of the other genes that lacked promoter methylation was detected in the same panel of specimens .
these data , thus , showed loss of mgmt expression in majority of gcts of all histologic subsets .
tumor ( t ) and cell line ( cl ) numbers are indicated on the top .
relation between promoter hypermethylation by msp and gene expression by rt - pcr . to further examine the role of promoter methylation in gene inactivation
, we treated five nsgct cell lines ( 2102e - r , 833k - e , tera-1 , tera-2 , and 218a ) with 5-aza-2 ' deoxycytidine and analyzed the expression of mgmt , rassf1a , rarb , and brca1 genes .
the mgmt gene exhibited promoter hypermethylation in four of the cell lines , which upon treatment with 5-aza-2 ' deoxycytidine showed reactivation of expression in three ( 2102e - r , 833k - e , and tera-2 ) .
one cell line ( t-218a ) showed no promoter hypermethylation of mgmt by msp and no detectable levels of mrna expression by rt - pcr but expression was reactivated after 5-aza-2 ' deoxycytidine treatment .
two of the five cell lines showed methylation in the rarb gene , one of which ( tera-2 ) showed detectable levels of gene expression in untreated cells ( fig .
the other four cell lines including the one with promoter hypermethylation ( 2102e - r ) exhibited no detectable levels of rarb expression .
azacytidine treatment activated gene expression in all the five cell lines , whether or not promoter had detectable methylation ( fig . 5 ) .
the rassf1a gene was methylated in 3 of the 5 cell lines studied . while one of the methylated cell lines showed expression in untreated cells
azacytidine treatment reactivated expression of rassf1a in one of each of the two methylated and two unmethylated cell lines .
irrespective of whether the promoter is methylated or not , the brca1 gene was expressed in all cell lines and the treatment of azacytidine had little or no effect on levels of gene expression ( fig .
5 ) analysis of gene expression after treatment of gct cell lines with the demethylating drug 5-aza-2 ' deoxycytidine .
we assessed 92 gct dnas representing all histologic subsets of nsgct , and sgct , and four normal testes for methylation status of cpg islands of 21 gene promoters by methylation - specific pcr ( msp ) ( fig .
, 15 genes ( mgmt , rassf1a , apc , rarb , cdh1 , mlh1 , timp3 , gstp1 , dapk , cdkn2a , p14 , brca1 , fhit , tp73 , and hic1 ) had previously been shown to be commonly methylated in various solid tumor types .
six additional genes ( rb1 , nme1 , nme2 , btg1 , nedd1 , and apaf1 ) were studied because of their possible involvement in genetic alterations in gct as indicated by loh studies [ 8 - 10 ] .
the rb1 gene at 13q14.2 showed frequent loss of heterozygosity ( loh ) in gct .
the nme1 and nme2 genes mapped to 17q21.3 also were affected by loh and exhibited loss of expression in teratoma .
the btg1 , apaf1 , and nedd1 genes mapped to the 12q22 common - deletion region , and thus considered as candidate tsgs in gct .
promoter hypermethylation was not found in normal testes for any of the tested genes except cdh1 .
however , promoter hypermethylation was detected in 43 of the 92 ( 46.7% ) gcts studied with an individual gene frequency of : rassf1a , 21.7% ; mgmt , 20.7% ; brca1 , 19.8% , hic1 , 19.6% ; apc , 9.8% ; rarb , 7.6% ; cdh1 , 7.6% ; fhit , 6.5% , mlh1 , 4.3% ; timp3 , 3.3% ; gstp1 , 1.1% ; and nme2 , 1.1% ( fig .
hypermethylation of one or more genes was found only in 5 of 29 ( 17.2% ) sgcts but in 38 of 63 ( 60.3% ) nsgcts ( fig .
four of the five sgcts that exhibited promoter hypermethylation were methylated at a single locus and one tumor at two loci , whereas 27 of the 38 nsgcts exhibited two or more methylated loci .
promoter hypermethylation was seen in all histologic subsets of nsgct , with yolk sac tumor ( yst ) exhibiting a higher frequency of methylation compared to other histologies ( fig .
u , unmethylated ; m , methylated ; tumor ( t ) and cell line ( cl ) numbers are indicated on the top .
to examine the biological role of promoter hypermethylation in gct , we assessed the levels of gene expression by semi - quantitative rt - pcr in 23 tumors ( 15 nsgcts and 8 sgcts ) with known methylation status .
eight genes ( mgmt , rassf1a , brca1 , apc , rarb , cdh1 , mlh1 , and timp3 ) that exhibited methylation in > 3% of the cases were examined ( fig .
4 , table 1 ) . levels of expression of each gene were assessed by comparing with the respective control values , obtained from the averages calculated from 2 to 4 normal testes , after normalization against actb .
all tumors with promoter hypermethylation of the mgmt and mlh1 genes exhibited an absence or down - regulated expression of the respective gene , while 8 of 10 cases with rassf1a methylation and 3 of 5 tumors with rarb methylation showed down - regulated expression ( table 1 ) .
the other four genes ( brca1 , apc , cdh1 , and timp3 ) did not show a consistent pattern of correlation between methylation and loss of gene expression ( table 1 ) . of note ,
the mgmt gene exhibited down - regulated expression in 22 of the 23 ( 95.7% ) tumors , including all the tumors that showed promoter methylation .
no consistent down - regulation of expression of the other genes that lacked promoter methylation was detected in the same panel of specimens .
these data , thus , showed loss of mgmt expression in majority of gcts of all histologic subsets .
multiplex rt - pcr analysis . tumor ( t ) and cell line ( cl ) numbers are indicated on the top .
to further examine the role of promoter methylation in gene inactivation , we treated five nsgct cell lines ( 2102e - r , 833k - e , tera-1 , tera-2 , and 218a ) with 5-aza-2 ' deoxycytidine and analyzed the expression of mgmt , rassf1a , rarb , and brca1 genes .
the mgmt gene exhibited promoter hypermethylation in four of the cell lines , which upon treatment with 5-aza-2 ' deoxycytidine showed reactivation of expression in three ( 2102e - r , 833k - e , and tera-2 ) .
one cell line ( t-218a ) showed no promoter hypermethylation of mgmt by msp and no detectable levels of mrna expression by rt - pcr but expression was reactivated after 5-aza-2 ' deoxycytidine treatment .
two of the five cell lines showed methylation in the rarb gene , one of which ( tera-2 ) showed detectable levels of gene expression in untreated cells ( fig .
the other four cell lines including the one with promoter hypermethylation ( 2102e - r ) exhibited no detectable levels of rarb expression .
azacytidine treatment activated gene expression in all the five cell lines , whether or not promoter had detectable methylation ( fig . 5 ) .
the rassf1a gene was methylated in 3 of the 5 cell lines studied . while one of the methylated cell lines showed expression in untreated cells
azacytidine treatment reactivated expression of rassf1a in one of each of the two methylated and two unmethylated cell lines .
irrespective of whether the promoter is methylated or not , the brca1 gene was expressed in all cell lines and the treatment of azacytidine had little or no effect on levels of gene expression ( fig .
5 ) analysis of gene expression after treatment of gct cell lines with the demethylating drug 5-aza-2 ' deoxycytidine .
un , untreated ; tr , treated with azacytidine . actin was used as an internal control .
epigenetic mechanisms of gene silencing are increasingly being recognized to affect a number of molecular pathways in human cancer .
the extent and the nature of such epigenetic modifications in gcts are currently poorly understood .
several studies have shown that both nsgcts and sgcts exhibit similar genetic alterations , including isochromosome for the short arm of chromosome 12 , i(12p ) .
thus epigenetic alterations such as those detected in the current study is one distinct molecular change that distinguishes these two histologic subsets .
the rare cpg hypermethylation seen in five sgct patients may be due to the existence of a minor nsgct component that might have escaped the histologic diagnosis .
a unique feature of gcts is their origin from germ cells at a stage in development where they undergo epigenetic reprogramming .
the absence of this epigenetic modification in sgcts is consistent with their gc - like nature as previously noted . on the other hand
, the extensive promoter hypermethylation seen in nsgcts suggests a mechanistic role in their potential for embryonal and extra - embryonal lineage differentiation .
establishment of dna methylation in the mammalian genome is controlled by at least three dna methyltransferases ( dnmts ) , dnmt1 , dnmt3a and dnmt3b .
the role of these dnmts in differential de novo methylation in sgct vs. nsgct remains to be elucidated .
the overall higher frequency of promoter methylation seen in nsgcts is noticeably evident in dna repair genes rassf1a ,
brca1 , and mgmt , and the hypermethylated in cancer 1 ( hic1 ) gene , which encodes a transcription factor .
the 3p21.3 region to which rassf1a maps undergoes deletions in many solid tumor types , including gcts .
rassf1a encodes a splice variant of human ras effector homologue , which interacts with the xpa protein and functions as a negative regulator of cell growth .
rassf1a has been shown to be inactivated by promoter methylation in a variety of tumor types [ 16 - 19 ] .
the 17q21 and 17p13 regions , to which brca1 and hic1 map , respectively , also have been characterized by high frequency of loh in gct .
the brca1 gene plays critical roles in dna repair and recombination , cell cycle checkpoint control , and transcription and has been shown to be hypermethylated in breast - ovarian cancer .
the hic1 gene is also often hypermethylated in many human cancers [ 20 - 22 ] .
the dna repair gene mgmt encodes o(6)-methylguanine - dna methyltransferase and this enzyme effectively removes dna adducts formed by alkylating agents .
also , a low frequency of methylation of the apc , rarb , and fhit genes was detected in nsgcts .
thus , the frequent hypermethylation in the mgmt , brca1 , and rassf1a , and hic1 define the methylation profile in nsgct .
these data suggest that promoter hypermethylation leading to gene silencing may affect key pathways in germ cell tumorigenesis .
aberrant promoter methylation changes that occur in cancer are associated with transcriptional repression and loss of function of the gene by interrupting the binding of proteins involved in transcription activator complex .
our gene expression analysis by rt - pcr demonstrated that all tumors that showed methylation of mgmt and mlh1 also showed down - regulated expression , while rassf1a and rarb genes showed down - regulation of mrna levels in most of the methylated tumors .
thus in these cases , promoter hypermethylation is one mechanism whereby gene expression can be deregulated in gcts . on the other hand , methylation of brca1 , apc , cdh1 , and timp3 genes did not correlate with expression levels .
interestingly , mgmt gene was also down regulated in 14 of the 15 tumors that did not exhibit methylation by msp analysis .
therefore , these data indicate that other epigenetic and/or genetic changes may be involved in regulating the expression of mgmt in gct .
the msp method detects only methylation of full - length cpg islands and can not identify partial methylation of the promoters .
thus , role of partial methylation in down - regulating mgmt can not be ruled out .
other epigenetic mechanisms involving defects in chromatin modification factors such as the association of methyl - cpg binding proteins , acetylation and methylation of histone proteins are also becoming known . the role of these chromatin - mediated components in inactivating the mgmt gene remains to be examined in gct . to determine whether the down - regulated expression of the mgmt gene is due to genetic mutations
, we examined the entire coding region in 30 gcts and found no inactivating mutations ( unpublished observations ) .
lack of methylation , on the other hand , associates with high - risk of death .
it has been suggested that the high - levels of mgmt proteins contribute to a drug - resistant phenotype .
more than 90% of newly diagnosed gcts and 7080% of patients who present metastatic disease are cured with cisplatin - based chemotherapy . however , 2030% of the patients with metastatic disease exhibit resistance to the cisplatin curative regimen leading to high mortality in this group .
the molecular basis of this exquisite chemotherapy sensitivity of gct and resistance is poorly understood .
we have previously shown that subsets of resistant tumors exhibit tp53 gene mutations and chromosomal amplifications .
however , the role of mgmt in gct sensitivity or resistance to chemotherapy is not known .
our current observation that undetectable levels of mgmt gene expression in > 95% of gcts appears to suggest that the lack of the o(6)-methylguanine - dna methyltransferase enzyme may direct cells to undergo apoptosis due to failure of repair of dna adducts formed by alkylating agents .
lack of mgmt expression in the majority of gcts suggests a potential role for this protein in lack of repair of cisplatin - induced dna damage that may result in exquisite sensitivity in this tumor .
it has been shown that engineered over - expression of wild - type p53 in vitro causes inhibition of mgmt transcription in human tumor cells .
abundant over - expression of wild - type p53 , owing to their stage of origin , is a characteristic feature of gcts .
a possibility also exists that the mgmt expression may , in general , be down regulated in tumors arising from embryonic - type cells . to examine this
, we analyzed 22 cases of wilms ' tumor but found no decreased levels of the mgmt gene expression ( data not shown ) .
these data , therefore , rule out the possibility that not all tumors arising from embryonic - type cells show down - regulated expression of mgmt .
transcriptional silencing of genes resulting from dna hypermethylation of cpg islands is reversed by treatment of the hypo - methylating agent 5-aza-2'-deoxycytidine in a dose and duration - dependent manner . since a number of gene promoters
were hypermethylated and showed down - regulated mrna in gct , we wanted to test whether hypomethylation reactivates the gene expression in these tumors .
we found that azacytidine treatment resulted in reactivation of gene expression in almost all cell lines that showed promoter methylation of mgmt , rassf1a and rarb genes , with the exception of the cell line tera-1 .
in addition , a number of genes that showed no evidence of full - length cpg methylation was also reactivated upon azacytidine treatment .
this was most evident for the rarb gene , where all five cell lines showed reactivation whether or not the promoter was methylated .
these data thus suggest that global demethylation may not only influence the expression of methylated genes but also unmethylated genes .
the data presented here show that promoter hypermethylation is an important molecular signature differentiating seminomatous and nonseminomatous gcts .
promoter methylation was frequently seen in dna repair genes mgmt , rassf1a , and brca1 , and a transcriptional repressor gene hic1 .
the data also suggest that multiple mechanisms , in addition to the promoter methylation , may play a role in silencing of mgmt gene expression in gcts of all histologic subsets . given the importance of the mgmt protein in treatment response to alkylating agents , this molecular switch may play a critical role in sensitivity to cisplatin - based therapy in gcts .
demethylation of the promoters reactivated the gene expression in mgmt , rarb and rassf1a genes .
further characterization of the exact mechanisms involved in epigenetic gene silencing , especially in the mgmt gene , may provide important clues in understanding the pathways relevant to gct biology .
a total of 92 gct tumor tissues consisting of 83 primary tumors and nine cell lines were used in this study .
the tumor biopsies were ascertained from patients evaluated at memorial sloan - kettering cancer center ( mskcc ) as described previously after appropriate institutional review board approval .
frozen tumor tissues or cell pellets were utilized for dna and/or rna isolation by standard methods .
histologically , 29 of these tumors were sgcts , 44 nsgcts , and 19 mixed or combined tumors .
placental dna treated in vitro with sssi methyltransferase ( new england biolabs , beverly , ma ) and similarly treated normal lymphocyte dna were used as controls for methylated and unmethylated templates , respectively .
the primers used for methylated and unmethylated - specific pcr for genes rarb , timp3 , cdkn2a , p14 , mgmt , dapk , cdh1 , gstp1 , apc promoter 1a , rb1 , mlh1 , tp73 , brca1 , fhit , and hic1 have been described previously ; [ 34 - 37 ] . for additional genes , we designed the following gene - specific primers for methylated ( mf and mr ) and unmethylated ( uf and ur ) sequences according to herman et al : btg1-mf 5'-gtcgttcgttttttacgttttt-3 ' btg1-mr 5'-cgacccgaatataaaaaaaatac-3 ' btg1-uf 5'-gttgtttgttttttatgtttttttt-3 ' btg1-ur 5'-caacccaaatataaaaaaaataca-3 ' nedd1-mf 5'-ggatattttttagtttagcgcg-3 ' nedd1-mr 5'-cgaccccctattatattactacg-3 ' nedd1-uf 5'-tggatattttttagtttagtgtg-3 ' nedd1-ur 5'-caaccccctattatattactaca-3 ' apaf1-mf 5'-gcgcgttcgtttatgtaaata-3 ' apaf1-mr 5'-caaaccgacgaaacccgaa-3 ' apaf1-uf 5'-ggtgtgtgtttgtttatgtaaata-3 ' apaf1-ur 5'-cacaaaccaacaaaacccaaa-3 ' nme1-mf 5'-gtttcgtgcgtgtaagtgttg-3 ' nme1-mr 5'-ccaccgacaaaaacgaatcca-3 ' nme1-uf 5'-gttttgtgtgtgtaagtgttgt-3 ' nme1-ur 5'-ccaccaacaaaaacaaatccac-3 ' nme2-mf 5'-ttttcggtcgcgtcgggtc-3 ' nme2-mr 5'-gcgcgaaacctacgaaaaatc-3 ' nme2-uf 5'-gttttttggttgtgttgggttg-3 ' nme2-ur 5'-cacacaaaacctacaaaaaatca-3 ' rassf1a - mf 5'-acgcgttgcgtatcgcgcg-3 ' rassf1a - mr 5'-ccgcgacgactacgctacc-3 ' rassf1a - uf 5'-atgtgttgtgtattgtgtgggg-3 ' rassf1a - ur 5'-ccacaacaactacactacccc-3 ' pcr products were run on 2% agarose gels and visualized after ethidium bromide staining .
purified msp products were sequenced in representative specimens by direct sequencing to confirm the methylation scored on agarose gels . to assess gene expression , total rna isolated from normal testes ,
the cell lines , and tumor tissues , and polya+ rna of testis obtained from clontech ( palo alto , ca ) was reverse transcribed using random primers and the pro - star first strand rt - pcr kit ( stratagene , la jolla , ca )
. a semi - quantitative analysis of gene expression was performed using 26 to 28 cycles of multiplex rt - pcr with -actin ( actb ) as control and gene specific primers spanning at least 2 exons , except in rassf1a . for the latter
the gene primers used and their positions in respective cdnas were : mgmt - f 5'-gcacgaaataaagctcctgg-3 ' ( 124143 bp ) mgmt - r 5'-agggctgctaattgctggta-3 ' ( 380399 bp ) mlh1-f 5'-ctggacgagacagtggtgaa-3 ' ( 5271 bp ) mlh1-r 5'-ctcacctcgaaagccatagg-3 ' ( 308327 bp ) apc - f 5'-aagccgggaaggatctgtat-3 ' ( 329348 bp ) apc - r 5'-tccaattgccttctggtcat-3 ' ( 588607 bp ) rarb - f 5'-aattcagtgaactggccacc-3 ' ( 770789 bp ) rarb - r 5'-ggcaaaggtgaacacaaggt-3 ' ( 10101029 bp ) cdh1-f 5'-ctcgacacccgattcaaagt-3 ' ( 335354 bp ) cdh1-r 5'-tgggcctttttcattttctg-3 ' ( 615634 bp ) timp3-f 5'-cttccgagagtctctgtggc-3 ' ( 14401450 bp ) timp3-r 5'-ggcgtagtgtttggactggt-3 ' ( 17131732 bp ) brca1-f 5'-tcagcttgacacaggtttgg-3 ' ( 676695 bp ) brca1-r 5'-ggttgtatccgctgctttgt-3 ' ( 896915 bp ) the pcr products were run on 1.5% agarose gels , visualized by ethidium bromide staining and quantitated using the kodak digital image analysis system ( kodak , new haven , ct ) .
a tumor was considered to have lost expression when the gene showed complete lack of expression or at least 50% reduction from the normalized values obtained from the average calculated utilizing 2 to 4 normal testes .
the effect of methylation on gene expression was similarly assessed on total rna isolated from cell lines treated with the demethylating agent 5-aza-2 ' deoxycytidine ( sigma ) for five days at a concentration of 25 m .
single strand conformational polymorphism ( sscp ) analysis was performed on all coding exons using primers flanking intronic sequences of the mgmt gene by standard methods .
a total of 92 gct tumor tissues consisting of 83 primary tumors and nine cell lines were used in this study .
the tumor biopsies were ascertained from patients evaluated at memorial sloan - kettering cancer center ( mskcc ) as described previously after appropriate institutional review board approval .
frozen tumor tissues or cell pellets were utilized for dna and/or rna isolation by standard methods .
histologically , 29 of these tumors were sgcts , 44 nsgcts , and 19 mixed or combined tumors .
placental dna treated in vitro with sssi methyltransferase ( new england biolabs , beverly , ma ) and similarly treated normal lymphocyte dna were used as controls for methylated and unmethylated templates , respectively .
the primers used for methylated and unmethylated - specific pcr for genes rarb , timp3 , cdkn2a , p14 , mgmt , dapk , cdh1 , gstp1 , apc promoter 1a , rb1 , mlh1 , tp73 , brca1 , fhit , and hic1 have been described previously ; [ 34 - 37 ] . for additional genes ,
we designed the following gene - specific primers for methylated ( mf and mr ) and unmethylated ( uf and ur ) sequences according to herman et al : btg1-mf 5'-gtcgttcgttttttacgttttt-3 ' btg1-mr 5'-cgacccgaatataaaaaaaatac-3 ' btg1-uf 5'-gttgtttgttttttatgtttttttt-3 ' btg1-ur 5'-caacccaaatataaaaaaaataca-3 ' nedd1-mf 5'-ggatattttttagtttagcgcg-3 ' nedd1-mr 5'-cgaccccctattatattactacg-3 ' nedd1-uf 5'-tggatattttttagtttagtgtg-3 ' nedd1-ur 5'-caaccccctattatattactaca-3 ' apaf1-mf 5'-gcgcgttcgtttatgtaaata-3 ' apaf1-mr 5'-caaaccgacgaaacccgaa-3 ' apaf1-uf 5'-ggtgtgtgtttgtttatgtaaata-3 ' apaf1-ur 5'-cacaaaccaacaaaacccaaa-3 ' nme1-mf 5'-gtttcgtgcgtgtaagtgttg-3 ' nme1-mr 5'-ccaccgacaaaaacgaatcca-3 ' nme1-uf 5'-gttttgtgtgtgtaagtgttgt-3 ' nme1-ur 5'-ccaccaacaaaaacaaatccac-3 ' nme2-mf 5'-ttttcggtcgcgtcgggtc-3 ' nme2-mr 5'-gcgcgaaacctacgaaaaatc-3 ' nme2-uf 5'-gttttttggttgtgttgggttg-3 ' nme2-ur 5'-cacacaaaacctacaaaaaatca-3 ' rassf1a - mf 5'-acgcgttgcgtatcgcgcg-3 ' rassf1a - mr 5'-ccgcgacgactacgctacc-3 ' rassf1a - uf 5'-atgtgttgtgtattgtgtgggg-3 ' rassf1a - ur 5'-ccacaacaactacactacccc-3 ' pcr products were run on 2% agarose gels and visualized after ethidium bromide staining .
purified msp products were sequenced in representative specimens by direct sequencing to confirm the methylation scored on agarose gels .
to assess gene expression , total rna isolated from normal testes , the cell lines , and tumor tissues , and polya+ rna of testis obtained from clontech ( palo alto , ca ) was reverse transcribed using random primers and the pro - star first strand rt - pcr kit ( stratagene , la jolla , ca ) .
a semi - quantitative analysis of gene expression was performed using 26 to 28 cycles of multiplex rt - pcr with -actin ( actb ) as control and gene specific primers spanning at least 2 exons , except in rassf1a . for the latter , we used single pcr with primers and conditions as previously described .
the gene primers used and their positions in respective cdnas were : mgmt - f 5'-gcacgaaataaagctcctgg-3 ' ( 124143 bp ) mgmt - r 5'-agggctgctaattgctggta-3 ' ( 380399 bp ) mlh1-f 5'-ctggacgagacagtggtgaa-3 ' ( 5271 bp ) mlh1-r 5'-ctcacctcgaaagccatagg-3 ' ( 308327 bp ) apc - f 5'-aagccgggaaggatctgtat-3 ' ( 329348 bp ) apc - r 5'-tccaattgccttctggtcat-3 ' ( 588607 bp ) rarb - f 5'-aattcagtgaactggccacc-3 ' ( 770789 bp ) rarb - r 5'-ggcaaaggtgaacacaaggt-3 ' ( 10101029 bp ) cdh1-f 5'-ctcgacacccgattcaaagt-3 ' ( 335354 bp ) cdh1-r 5'-tgggcctttttcattttctg-3 ' ( 615634 bp ) timp3-f 5'-cttccgagagtctctgtggc-3 ' ( 14401450 bp ) timp3-r 5'-ggcgtagtgtttggactggt-3 ' ( 17131732 bp ) brca1-f 5'-tcagcttgacacaggtttgg-3 ' ( 676695 bp ) brca1-r 5'-ggttgtatccgctgctttgt-3 ' ( 896915 bp ) the pcr products were run on 1.5% agarose gels , visualized by ethidium bromide staining and quantitated using the kodak digital image analysis system ( kodak , new haven , ct ) .
a tumor was considered to have lost expression when the gene showed complete lack of expression or at least 50% reduction from the normalized values obtained from the average calculated utilizing 2 to 4 normal testes .
the effect of methylation on gene expression was similarly assessed on total rna isolated from cell lines treated with the demethylating agent 5-aza-2 ' deoxycytidine ( sigma ) for five days at a concentration of 25 m .
single strand conformational polymorphism ( sscp ) analysis was performed on all coding exons using primers flanking intronic sequences of the mgmt gene by standard methods .
author 2 ( jh ) coordinated the selection of tumors , and isolation of genomic dna and rna .
authors 8 and 9 ( rskc and vvvsm ) have conceived and coordinated the study .
this study was also supported by the funds from lance armstrong foundation to vvvsm and jh , and the herbert irving comprehensive cancer center , columbia university , to jmm and vvvsm . | backgroundhuman male germ cell tumors ( gcts ) arise from undifferentiated primordial germ cells ( pgcs ) , a stage in which extensive methylation reprogramming occurs .
gcts exhibit pluripotentality and are highly sensitive to cisplatin therapy .
the molecular basis of germ cell ( gc ) transformation , differentiation , and exquisite treatment response is poorly understood.resultsto assess the role and mechanism of promoter hypermethylation , we analyzed cpg islands of 21 gene promoters by methylation - specific pcr in seminomatous ( sgct ) and nonseminomatous ( nsgct ) gcts .
we found 60% of the nsgcts demonstrating methylation in one or more gene promoters whereas sgcts showed a near - absence of methylation , therefore identifying distinct methylation patterns in the two major histologies of gct .
dna repair genes mgmt , rassf1a , and brca1 , and a transcriptional repressor gene hic1 , were frequently methylated in the nsgcts .
the promoter hypermethylation was associated with gene silencing in most methylated genes , and reactivation of gene expression occured upon treatment with 5-aza-2 ' deoxycytidine in gct cell lines.conclusionsour results , therefore , suggest a potential role for epigenetic modification of critical tumor suppressor genes in pathways relevant to gc transformation , differentiation , and treatment response . |
wnt/-catenin signaling is activated upon binding of wnt ligands to both frizzled ( fz ) receptors and low - density lipoprotein receptor - related protein 5/6 ( lrp5/6 ) co - receptors ( reviewed in ) .
subsequent -catenin translocation to the nucleus leads to t - cell factor / lymphoid enhancer factor ( tcf / lef)-driven transcription . among the wnt target genes are regulators of cell proliferation , growth , differentiation , and migration
this pathway also regulates homeostasis of bones , hematopoiesis , and renewal of tissues such as the intestine or the skin , and therefore remains essential throughout life .
consequently , misregulation of wnt/-catenin signaling leads to developmental defects , malformations , degenerative and metabolic diseases , and cancer ( reviewed in ) .
a tight regulation of wnt signaling involves feedback control mechanisms in which the expression of several wnt - signaling components is regulated by wnt/-catenin signaling itself ( reviewed in ) .
the cell adhesion molecule cd44 was identified as a canonical wnt target in the intestine , where it is highly expressed in intestinal stem and proliferative progenitor cells .
loss of cd44 in apc mice significantly reduced the tumor number in the small intestine , thus indicating an involvement of cd44 in wnt - induced tumorigenesis .
furthermore , increased cd44 expression correlates with late stages and poor prognosis of colorectal cancer .
however , considering cd44 solely as a wnt target gene might only be part of the story .
in fact , our recent paper shows that cd44 also acts as a positive wnt feedback regulator . in several cell lines , silencing of all cd44 isoforms suppressed wnt - induced activation and nuclear translocation of -catenin , as well as tcf / lef - driven transcription .
conversely , overexpression of cd44 isoforms enhanced wnt signaling regardless of the isoform , suggesting the involvement of a function common to all cd44 isoforms in the regulation of this pathway .
a cd44 isoform with deletion of the cytoplasmic domain had no effect on wnt pathway activation , indicating that the cd44 cytoplasmic domain is essential for the involvement of cd44 in wnt signaling .
ezrin , a member of the ezrin - radixin - moesin ( erm ) protein family , links cd44 to the cytoskeleton ( reviewed in ) .
interference with the binding of ezrin to cd44 resulted in loss of cd44 regulatory function .
the association of cd44 to erm proteins and to the cytoskeleton seems to be essential for wnt signaling .
wnt pathway activation at the level of wnt3a , lrp6 , dishevelled , or -catenin revealed regulation by cd44 at the level of membrane receptors .
downregulation of cd44 demonstrated a role of cd44 both in lrp6 phosphorylation , an event that is wnt - dependent , and in lrp6 membrane targeting , a step that is wnt independent .
these findings suggest a dual mechanism of action of cd44 in wnt signaling ( fig . 1 ) .
both of these functions depend on the cytoplasmic domain of cd44 and its binding to f - actin via ezrin .
finally , experiments in xenopus laevis demonstrated an in vivo requirement of cd44 for wnt/-catenin signaling in cns development , as indicated by reduced expression of the wnt - target genes tcf-4 and engrailed-2 in cd44 morphants .
( a ) in the absence of wnt ligands , cd44 bound to f - actin via erms regulates membrane targeting and cell surface expression of lrp6 .
( b ) in the presence of wnts , cd44 forms a complex with lrp6 and participates in lrp6 activation .
this step is also highly dependent on the association of cd44 with the actin cytoskeleton via erms .
abbreviations : apc , adenomatous polyposis coli ; ck1 , casein kinase 1 ; er , endoplasmic reticulum ; erm , ezrin - radixin - moesin ; gsk3 , glycogen synthase kinase ; lrp6 , low - density lipoprotein receptor - related proteins ; tcf , t - cell factor .
( a ) in the absence of wnt ligands , cd44 bound to f - actin via erms regulates membrane targeting and cell surface expression of lrp6 .
( b ) in the presence of wnts , cd44 forms a complex with lrp6 and participates in lrp6 activation .
this step is also highly dependent on the association of cd44 with the actin cytoskeleton via erms .
abbreviations : apc , adenomatous polyposis coli ; ck1 , casein kinase 1 ; er , endoplasmic reticulum ; erm , ezrin - radixin - moesin ; gsk3 , glycogen synthase kinase ; lrp6 , low - density lipoprotein receptor - related proteins ; tcf , t - cell factor .
the activity of the wnt cascade is regulated at each step from the cell surface to the nucleus ( reviewed in ) .
one important characteristic of cd44 is its ability to bind to the cytoskeleton through erm proteins .
this network formed by the cd44erm actin complex might provide a platform necessary for the tight association between lrp6 and kinases such as glycogen synthase kinase 3 and casein kinase 1. additionally , trafficking of the lrp6-containing vesicles from the golgi to the membrane might take place within the f - actin rich cortex .
these f - actin tracks might be tethered to the plasma membrane through the cd44-erm complex .
although these hypotheses are highly speculative one should note that cd44 can be found on coat protein complex 1 ( cop1 ) vesicles involved in vesicle trafficking .
additionally , cd44 was shown to co - localize with soluble nsf attachment protein receptors ( snares ) that play important roles in the fusion of vesicles with the plasma membrane .
cd44 is not the only wnt - target gene providing positive feedback regulation in wnt/-catenin signaling .
other positive regulators like lef1 or fz - receptors have been shown to be upregulated upon activation of canonical wnt signaling .
positive feedback loops between cd44 and wnt signaling might be required during development or for homeostasis of various organs , including the limbs or the skin .
the intestinal epithelium , a highly dynamic tissue that is renewed every 4 to 5 days , is also a strong candidate for such regulation .
indeed , renewal of the intestinal epithelium requires permanently active wnt signals in the intestinal stem and proliferative progenitor cells .
inactivation of canonical wnt signaling in the intestine causes a complete loss of proliferation of intestinal progenitor cells at the bottom of the intestinal crypts .
interestingly , an isoform - specific function of cd44 in this intestinal stem and proliferative progenitor compartment was recently suggested . in conclusion ,
our findings reveal a completely new aspect of cd44 , namely as a regulator of wnt signaling at the level of lrp6 , and add another regulatory function to the already described roles of cd44 in signaling . in colorectal cancer , cd44 might act as a wnt target gene in concert with met . additionally , cd44 might influence the activity of the wnt pathway in a positive feedback loop .
distinguishing the role of cd44 as a target gene or as a wnt - regulator might be difficult .
however , anti - cd44 therapies should be seriously considered , especially in colorectal cancers .
| cd44 was recently identified as a positive feedback regulator of wnt/-catenin signaling .
this regulation occurs at the level of low - density lipoprotein receptor - related protein 6 phosphorylation and membrane targeting .
these findings broaden our understanding of the wnt pathway activation process and open new perspectives for anti - cd44 therapies in diseases associated with wnt induction , including colorectal cancer . |
tumor thrombus from renal cell carcinoma is commonly reported in renal vein and inferior vena cava with a few reports of gonadal vein involvement . here
, we report a case of an elderly female who underwent fluorodeoxyglucose ( fdg ) positron emission tomography - computed tomography scan for initial staging of left renal cell carcinoma . along with an fdg avid left renal mass lesion ,
scan also revealed fdg avid tumor thrombus in the entire length of the left gonadal vein . |
|
various conventional mechanical test methods , such as shear , tensile , and flexural
tests , have been used to assess dental adhesion .
however , problems
related to the validity of the measurements obtained began to arise as cohesive failures
in the substrate were frequently observed with new adhesives that yielded improved bond
strengths . according to some researchers ,
the explanation for this fact was that stresses were mostly
concentrated in the substrate , thus causing it to fail prematurely , before failure at
the interface itself .
another point that has drawn fundamental criticism concerns the
non - uniform nature of stress distributions along tested interfaces . to improve stress distribution and the range of bond strength values ,
shear and tensile
tests were almost completely replaced by the microtensile bond strength ( tbs ) test ,
introduced by sano , et al .
the main characteristic of this test is the reduced specimen size , which provides a
higher bond strength mean .
more
recently , some authors have advocated a new test method using
specimens with reduced dimensions , as a substitute for the conventional shear test : the
so - called " microshear " bond strength ( sbs ) test .
a better stress distribution can be accomplished in smaller specimens , tested either
under tbs or sbs testing , since the number of voids and stress - raising factors is
lower than the ones that possibly occur in larger areas , such those used for shear or
tensile bond strength tests .
the
sbs test would allow small areas to be tested , and it has the same advantages as the
tbs , without the need for sectioning procedures to obtain specimens , as these
laboratory procedures themselves may induce early micro - cracking within the
specimen . whether or not this has any effect on
the overall conclusions reached , these methods deserve further investigations , since few
studies have compared them .
the data from bond strength studies may depend largely on experimental factors such as
the type of composite , stress rate , sample size and geometry , and the actual test
method . with regard
to resin composite ,
some authors use flowable instead of microhybrid composites
to fill the tygon tube in sbs testing due to their easy placement .
however , to the best
of our knowledge no study has so far addressed the effects of this variation in method
on the number of cohesive failures and bond strength values .
therefore , the objective of
the present investigation was two - fold : 1 ) to evaluate the effect of the type of resin
composite and adhesive system on the bond strength values obtained both in sbs r and
tbs tests ; and 2 ) to correlate the bond strength means gathered from these mechanical
tests to verify whether they are able to reach similar conclusions .
thirty - six extracted , caries - free human molars were used in this study .
the teeth were
collected after obtaining the patients ' informed consent . the research ethics committee
of the university of so paulo reviewed and approved this study under protocol number
193/06 .
teeth were disinfected ,
cleaned by removing all debris and calculus , and stored in distilled water for 48 h. the
teeth were decoronated and the crowns were sectioned transversally in a buccolingual
direction , using a diamond disc at slow speed ( isomet , buehler , lake bluff , il , usa ) in
order to obtain two tooth halves .
one half was used for the tbs test and the other half
was used for the sbs test .
the enamel surfaces were ground on wet # 180 and 600 si - c
papers ( 60 s ) . a three - step etch - and - rinse system solobond plus ( voco , cuxhaven , ls , deu ) , a two - step
etchand - rinse system adper single bond 2 ( 3 m espe , st .
paul , mn , usa ) and a one - step
self - etch adhesive futurabond nr ( voco , cuxhaven , ls , deu ) were used in the present
investigation together with the microhybrid composite filtek z250 ( 3 m espe ) and the
flowable composite filtek flow z350 ( 3 m espe ) .
the composition , application mode and
batch number of each material are shown in figure
1 .
composition , mode of application and batch number of the adhesives used a- acid - etching ( 15 s ) ; a1- acid - etching ( 30 s ) ; b- rinsing ( 15 s ) ; b1- rinsing
( 20 s ) ; c- air - drying ( 30 s ) ; d- two coats of adhesive were lightly applied ( 15
s ) ; d1- one coat of primer was lightly applied(30 s ) ; e- air - dry for 10 s at 20
cm ; f- one coat of adhesive was applied ( 15 s ) ; f1- mix one drop of liquid a
and one drop of liquid b(5 s ) ; f2- one coat of adhesive was lightly applied ( 20
s ) ; g- air dry for s at 20 cm ; h- light - polymerization ( 10 s - 600 mw / cm2 ) ;
i-
light polymerization ( 20 s -600 mw / cm2 ) bis - gma : bisphenol a diglycidyl
methacrylate ; hema : 2-hydroxyethyl methacrylate ; bht : butylated hydroxy
toluene ; udma : urethane dimethacrylate ; tegdma : triethylene glycol
dimethacrylate ; bis - ema : bisphenol a polyethylene glycol diether
dimethacrylate .
thirty - six tooth halves were randomly divided into six groups of equal size according
to the combination of the main factors adhesive and composite . after conditioning
procedures ,
adhesives were applied and light polymerized using a quartz - tungsten
halogen optilux 501 unit ( kerr corp . , orange , ca , usa ) set at 600 mw / cm .
resin composite build - ups were constructed in two 20 mm - thick increments , which were
individually light polymerized for 40 s. all bonding procedures were carried out by a
single operator at a room temperature of 24c . for placement of filtek flow z350 , an
individual matrix was placed around the enamel slices .
after storage in distilled water ( 37c/24 h ) , the specimens were sectioned
longitudinally perpendicular to the adhesive interface by means of a diamond saw in
an isomet machine , producing 0.9-mm - thick rectangular slabs . next , each slab was
visually analyzed to select the areas with the flattest interfaces and individually
cut into sticks with cross sectional areas of about 0.8 mm .
the cross - sectional area
of each specimen was measured with a digital caliper ( absolute digimatic , mitutoyo ,
tokyo , tyo , jpn ) to the nearest 0.01 mm and recorded for measuring the bond strength .
cyanoacrylate adhesive ( super bonder gel , loctite , henkel ltda , so paulo , sp , bra )
was used to fix the specimens to a microtensile testing device used in a universal
testing machine ( instron model 5565 , canton , ma , usa ) at 0.5 mm / min .
the other 36 tooth halves were randomly divided into six groups of equal size
according to the combination of the main factors adhesive and composite .
after enamel
conditioning , the adhesives were applied and light polymerized using the optilux 501
unit , set at 600 mw / cm . a plastic tube 54-hl ( tygon medical tubing , saint gobain , akron , oh , usa )
with an approximate internal diameter of 0.7 mm and height of 0.4 mm was placed on
the enamel surface .
resin composite was injected into the tube ; a clear cellophane
sheet was placed over the resin composite , pressed gently and photo - irradiated ( 40
s/600 mw / cm ) .
the plastic tubes were
removed with a sharp blade , and the specimens were checked with a light
stereomicroscope at 10 magnification to discard any with any evident air bubbles or
gaps at the interface . after this , the specimens were fixed to a modified testing
device with a cyanoacrylate
adhesive and placed in the instron testing machine for sbs testing .
a
0.20-mmdiameter stainless steel orthodontic wire ( morelli ortodontia , so paulo , sp ,
bra ) was looped around the resin cylinder , making contact through half of its
circumference , and was gently held flush against the resin - enamel interface .
a shear
force was applied to each specimen at a crosshead speed of 0.5 mm / min until failure
occurred .
all fractured specimens after tbs and sbs tests were mounted on aluminum
stubs , sputter - coated and observed under a scanning electron microscope ( jeol 5600
lvj , jeol ltd . ,
the bond failure modes were evaluated and
classified as one of three types : mixed ( adhesive + cohesive failure of the
neighboring substrates ) , cohesive ( failure exclusively within enamel or resin
composite ) and adhesive ( failure exclusively in adhesive interface ) .
the effect of conditioning with 35% phosphoric acid and self - etching adhesive on the
ground enamel surface was observed .
teeth ( n=2 for each treatment ) were cut into two
halves longitudinally in a mesial / distal direction .
a deep lingual slit was prepared
with a diamond bur to facilitate subsequent fracture of the etched surfaces .
phosphoric acid - etched enamel was rinsed with water spray for 15 s. enamel etched
with self - etch adhesive was rinsed with ethanol and acetone to remove the monomers .
after that , the same specimens were fractured to provide a sagittal view of the
etched enamel .
after 12 h in a desiccator , they were mounted on aluminum stubs for
sem analysis .
the mean bond strength of all specimens from the same hemi - tooth was averaged for
statistical purposes .
the cohesive failures and the pre - testing failures were not
included in the statistical analysis .
the bond strength mean for every tested group
was expressed as the average of the six teeth used per group .
the data from tbs and
sbs were subjected to a two - way analysis of variance ( adhesive vs. composite resin )
and tukey 's test for pair - wise comparison ( =0.05 ) .
the correlation between the two bond strength test methods was analyzed by simple
linear regression .
the strength of the association between these two properties was
estimated with pearson 's product - moment correlation statistics ( =0.05 ) .
first , the mean bond strength value of
each tooth half was paired ( total of 36 means ) and the values were tested by the
pearson correlation test at =0.05 .
in the second approach only the overall means for
each group were paired and tested using the same test ( total of 6 means ) .
thirty - six tooth halves were randomly divided into six groups of equal size according
to the combination of the main factors adhesive and composite . after conditioning
procedures ,
adhesives were applied and light polymerized using a quartz - tungsten
halogen optilux 501 unit ( kerr corp . , orange , ca , usa ) set at 600 mw / cm .
resin composite build - ups were constructed in two 20 mm - thick increments , which were
individually light polymerized for 40 s. all bonding procedures were carried out by a
single operator at a room temperature of 24c . for placement of filtek flow
after storage in distilled water ( 37c/24 h ) , the specimens were sectioned
longitudinally perpendicular to the adhesive interface by means of a diamond saw in
an isomet machine , producing 0.9-mm - thick rectangular slabs . next , each slab was
visually analyzed to select the areas with the flattest interfaces and individually
cut into sticks with cross sectional areas of about 0.8 mm .
the cross - sectional area
of each specimen was measured with a digital caliper ( absolute digimatic , mitutoyo ,
tokyo , tyo , jpn ) to the nearest 0.01 mm and recorded for measuring the bond strength .
cyanoacrylate adhesive ( super bonder gel , loctite , henkel ltda , so paulo , sp , bra )
was used to fix the specimens to a microtensile testing device used in a universal
testing machine ( instron model 5565 , canton , ma , usa ) at 0.5 mm / min .
the other 36 tooth halves were randomly divided into six groups of equal size
according to the combination of the main factors adhesive and composite . after enamel
conditioning ,
the adhesives were applied and light polymerized using the optilux 501
unit , set at 600 mw / cm . a plastic tube 54-hl ( tygon medical tubing , saint gobain , akron , oh , usa )
with an approximate internal diameter of 0.7 mm and height of 0.4 mm was placed on
the enamel surface .
resin composite was injected into the tube ; a clear cellophane
sheet was placed over the resin composite , pressed gently and photo - irradiated ( 40
s/600 mw / cm ) .
the plastic tubes were
removed with a sharp blade , and the specimens were checked with a light
stereomicroscope at 10 magnification to discard any with any evident air bubbles or
gaps at the interface . after this , the specimens were fixed to a modified testing
device with a cyanoacrylate
adhesive and placed in the instron testing machine for sbs testing . a
0.20-mmdiameter stainless steel orthodontic wire ( morelli ortodontia , so paulo , sp ,
bra ) was looped around the resin cylinder , making contact through half of its
circumference , and was gently held flush against the resin - enamel interface .
a shear
force was applied to each specimen at a crosshead speed of 0.5 mm / min until failure
occurred .
all fractured specimens after tbs and sbs tests were mounted on aluminum
stubs , sputter - coated and observed under a scanning electron microscope ( jeol 5600
lvj , jeol ltd . ,
the bond failure modes were evaluated and
classified as one of three types : mixed ( adhesive + cohesive failure of the
neighboring substrates ) , cohesive ( failure exclusively within enamel or resin
composite ) and adhesive ( failure exclusively in adhesive interface ) .
the effect of conditioning with 35% phosphoric acid and self - etching adhesive on the
ground enamel surface was observed .
teeth ( n=2 for each treatment ) were cut into two
halves longitudinally in a mesial / distal direction .
a deep lingual slit was prepared
with a diamond bur to facilitate subsequent fracture of the etched surfaces .
phosphoric acid - etched enamel was rinsed with water spray for 15 s. enamel etched
with self - etch adhesive was rinsed with ethanol and acetone to remove the monomers .
after that , the same specimens were fractured to provide a sagittal view of the
etched enamel .
after 12 h in a desiccator , they were mounted on aluminum stubs for
sem analysis .
the mean bond strength of all specimens from the same hemi - tooth was averaged for
statistical purposes .
the cohesive failures and the pre - testing failures were not
included in the statistical analysis .
the bond strength mean for every tested group
was expressed as the average of the six teeth used per group .
the data from tbs and
sbs were subjected to a two - way analysis of variance ( adhesive vs. composite resin )
and tukey 's test for pair - wise comparison ( =0.05 ) .
the correlation between the two bond strength test methods was analyzed by simple
linear regression .
the strength of the association between these two properties was
estimated with pearson 's product - moment correlation statistics ( =0.05 ) .
first , the mean bond strength value of
each tooth half was paired ( total of 36 means ) and the values were tested by the
pearson correlation test at =0.05 .
in the second approach only the overall means for
each group were paired and tested using the same test ( total of 6 means ) .
the fracture pattern mode ( % ) and the number of pre - testing failures observed in this
experiment are shown in table 1 .
the overall
number of cohesive failures was higher with filtek flow z350 ( ~60% ) when compared with
filtek z250 ( ~48% ) . a higher overall number of pre - testing failures was obtained with
the tbs test ( 14.2% or 68 out of 484 ) when compared to the sbs test ( 4.4% or 4 out of
93 ) .
representative figures of each fracture mode observed in the present investigation
for each test can be seen in figure 2 .
fracture pattern mode [ percentage ( number ) ] of pre - testing failures according to
each experimental condition representative figures of the failure modes observed in the microtensile ( 200x )
( a - d ) and microshear ( 140x ) ( e - f ) tests . in ( a )
enamel is represented by the pointer , adhesive by the white
star and resin composite by the black star .
( c ) represents a cohesive failure in
enamel the mean cross - sectional area of the tbs specimens ranged from 0.67 to 0.75
mm , with a mean value of 0.710.1 mm , while the bonding area
of the sbs specimens was 0.44 mm . for the tbs
, two - way anova detected that
the cross - product interaction ( p=0.44 ) as well as the main factor adhesive system
( p=0.58 ) were not statistically significant . only the main factor resin composite was
statistically significant ( p=0.00001 ) .
the means and standard deviations ( mpa ) of this
test are shown in table 2 .
it can be observed
that higher mtbs values were obtained with the microhybrid filtek z250 composite . with
regard to the msbs
, only the main factor resin composite ( p=0.0001 ) was significant and
the means and standard deviations ( mpa ) can be seen in table 2 .
similarly to the mtbs test , higher bond strength values were
observed with filtek z250 .
microtensile ( tbs ) and microshear bond strength ( sbs ) values standard
deviations ( mpa ) ( * ) groups with different letters are statistically different for tests
( tukey 's test , p<0.05 ) .
pearson 's correlation test detected a positive ( r=0.9106 ) and significant ( p=0.0116 )
correlation between the two bond strength tests , only when the means of each
experimental group were paired . when the bond strength values from the same tooth were
paired , the correlation was weak ( r=0.4749 ) , however highly significant ( p=0.003 ) ( figure 3 ) .
linear relationship between microshear ( mpa ) and microtensile bond strength means
( mpa ) sem micrographs of the etching pattern produced by 35% phosphoric acid and by the
self - etch futurabond nr are depicted in figure 4 .
although the enamel crystallite dissolution pattern produced by the self - etch system is
similar to that produced by phosphoric acid , as both treatments created selective
etching of prism cores and peripheries , there is contrast , as the demineralization
produced by the former is less defined and shallower than the one produced by phosphoric
acid .
scanning eletron microscopy micrographs of the 35% phosphoric acid etching ( a ) and
the self - etch futurabond nr ( b ) patterns .
selective demineralization of enamel
prism periphery can be observed ( white arrow , type 2 pattern ) .
( b )
demineralization created by self - etch adhesive resembles the type 2 pattern , prism
peripheries were demineralized more deeply than prism cores .
a shallower
demineralization is observed in comparison to that produced by the phosphoric acid
treatment
at present , with the improvements in adhesive system bond strength to enamel and dentin ,
new micro bond tests need to be developed . however , each test
method has both advantages and limitations . in view of this fact ,
the selection and use
of the most feasible test method appears to be an important parameter when conducting a
laboratory evaluation .
according to the results of the present study , both tbs and sbs tests showed that the
bond strength of the self - etch adhesive system futurabond nr to ground enamel was as
high as the bond strengths of the two etch - and - rinse adhesive systems tested .
although no data were found in the literature with
regard to bond tests using solobond plus and futurabond nr to ground enamel , there are
some studies that have used similar bonding approaches , which corroborate the present
findings .
this means that provided that the enamel is abraded , some strong and
intermediately strong self - etch systems may reach bond strength values as high as those
obtained with phosphoric acid based adhesives .
the analysis of the self - etch adhesive etching pattern improves the understanding of the
present findings .
since enamel bonding is primarily based on the micromechanical
interlocking of a low - viscosity resin through the formation of tag - like resin extensions
into the enamel microporosities , it seems that , apart from the mechanical properties of
the adhesive itself , the extent , depth and pattern of etching should influence the
performance of the evaluated adhesive . although the etching pattern provided by futurabond nr , an
intermediate strong self - etch system ( ph=1.4 ) , was not as deep and evident as that
provided by phosphoric acid etching , selective enamel etching could be observed , which
may have played a role in the good performance of this adhesive .
filtek z250
achieved higher bond strength values in both tests indicating that the resin type might
influence the results of the bond test . by reducing the filler content ,
low viscosity composites were developed
to achieve a better sealing of the cavity margins . in some clinical and laboratory scenarios
this explains why some authors have chosen this type of
composite to fill the tygon tube used in sbs testing instead of the conventional microhybrid
composite .
this reduction in
the filler load aroused some concerns regarding lower mechanical properties and higher
polymerization shrinkage when compared with traditional hybrid composites .
the elastic modulus of this composite
was also significantly reduced ( 30 - 50% ) when compared with traditional hybrid
composites .
this fact might explain the high number of cohesive failures ( ~60% ) and the lower
resin - enamel bond strength means measured in both bond test methods with composite
filtek flow z350 . in addition , the higher polymerization shrinkage of the low - viscosity
composite could potentially create more stress in the interface areas than traditional
composites during composite polymerization .
flowable composites do not support higher
stresses , particularly when subjected to the sbs bond strength test . according to a
recent finite element strength analyses
, the use of flowable composites in sbs testing concentrates more
stress around the adhesive interface than the use of high filled composites .
most studies that use the tbs test usually report premature failures during specimen preparation and this
finding was also observed in the present study . in comparison with sbs testing ,
this result
indicates that the rather aggressive slicing procedure used in specimen preparation for
tbs testing might induce several structural enamel defects and cracks , leading to
premature failures . it can be assumed that this might happen due to the intrinsic
brittleness of the enamel tissue in the reduced surface areas used in the tbs
specimens
this could be an advantage of the sbs over the tbs test since it does not
require any slicing of the enamel substrate prior to testing . in a previous scanning electron microscopy investigation of unloaded specimens prepared
for tbs testing , all the specimens
revealed the presence of structural defects , which would possibly influence the bond
strength values when loaded .
the authors pointed out that these defects were more
frequent in enamel than in dentin specimens .
it was then speculated that the brittleness
and low elasticity of enamel may render these specimens intrinsically more prone to
defects and failure .
this observation is in agreement with other studies that found that
enamel specimens can easily crack during the action of trimming .
this
can be attributed to the differences in the geometry of the test . despite this finding
,
the overall conclusion reached by both tests was the same when the adhesives were tested
in enamel .
this was confirmed by the positive and significant correlation found between
these two bond strength tests in the present investigation .
it is noteworthy to mention
that this situation might be different in dentin , since no cracking of the substrate is
expected to occur when tbs test is performed and higher bond strength values are to be
measured .
if a bond strength
test is capable of measuring higher values , an increase in the sensitivity of the test
makes it capable of detecting subtle differences between groups .
the ideal scenario would be to choose a test that produces only interfacial failures and
high bond strengths values .
for instance ,
determination of bond strengths to erosion / abrasion cavities in tooth substrates or
box - like cavities should be better achieved with the tbs test .
however , the sbs test should be preferred for testing
a flat tooth surface on which a cut tube can be placed .
moreover , in the case of
measuring bond strengths in complex preparations with high c - factors , only a tbs test ,
which can isolate the required area , can be chosen .
it is useful for measuring regional
variations in resin bond strength to endodontic posts or the inside of root
canals . in all other
situations where a flat or an almost flat surface
it may be hypothesized that the selection of the bond strength test seems to be much
more dependent on the experimental design of the study .
researchers need to understand
the limitations of their test technique and must be sure to document how they conducted
the test because it is imperative to
understand all conditions that act on the test protocol in in vitro
testing . some authors claim
that shear stress is considered more representative of the clinical situation5 .
nevertheless , it has been pointed out that the stress distribution in this test is
non - uniform .
while this shear stress is considerably lower than the
stresses occurring in the shear test arrangement , it is by no means suggested that
tensile testing is ideal . in the case of tbs test , although irregular stress
distributions due to geometry are avoided , the interfacial stress may not be uniformly
tensile due to the changes in elastic modulus of the bonding components .
both the tbs and the sbs tests can be used to test dental adhesives , provided that the
findings are cautiously interpreted , since differing methods of load application clearly
lead to differing stress distributions .
tensile and shear loadings seem to be equally good for laboratory
testing of the adhesive quality of resin systems .
within the limitations of the present investigation , it may be concluded that a
microhybrid resin composite should preferably be used for tbs and sbs testing due to
the reduced number of cohesive failures , and due to the number of high bond strength
values obtained , which makes the test more sensitive for measuring differences among
experimental conditions .
moreover , both methods seem to be positive and linearly
correlated , and can therefore lead to similar conclusions .
this study was performed as partial fulfillment for phd degree ( ama ) at the
university of so paulo ( usp ) .
mrio fernando de goes
for his assistance with the microshear tests , and to voco and saint gobain for the
donation of the materials used .
grants : conselho nacional de desenvolvimento
cientfico e tecnolgico ( cnpq ) : 473101/2006 - 8 , 305870/2004 - 1 , 135807/2006 - 9 and
307319/2006 - 7 . | objectivesthe aims of this study were to evaluate the effect of resin composite ( filtek z250
and filtek flow z350 ) and adhesive system [ ( solobond plus , futurabond nr ( voco )
and adper single bond ( 3 m espe ) ] on the microtensile ( tbs ) and microshear bond
strength ( sbs ) tests on enamel , and to correlate the bond strength means between
them .
material and methodsthirty - six extracted human molars were sectioned to obtain two tooth halves : one
for tbs and the other one for sbs .
adhesive systems and resin composites were
applied to the enamel ground surfaces and light - cured .
after storage ( 37c/24 h )
specimens were stressed ( 0.5 mm/ min ) .
fracture modes were analyzed under scanning
electron microscopy .
the data were analyzed using two - way anova and tukey 's test
( =0.05 ) .
resultsthe correlation between tests was estimated with pearson 's product - moment
correlation statistics ( = 0.05 ) .
for both tests only the main factor resin
composite was statistically significant ( p<0.05 ) .
the correlation test detected
a positive ( r=0.91 ) and significant ( p=0.01 ) correlation between the tests .
conclusionsthe results were more influenced by the resin type than by the adhesives .
both
microbond tests seem to be positive and linearly correlated and can therefore lead
to similar conclusions . |
professionalism is characterized by the degree of dedication displayed by individuals
regarding the values and behavioral attributes of a specific career identity .
professionals are generally defined in terms of
a particular body of knowledge obtained through formal education , an expanded level of
skills , some type of certification to prove entry to profession , and a set of behavioral
norms known as professionalism . moreover
,
professionalism indicates attitudes that represent high levels of identification with and
commitment to a specific profession .
healthcare practice today is changing and advancing rapidly and demands highly professional
nurses rather than just those with experience .
the
basic attributes of professionalism include educational preparation , research and
scholarship participation in professional organizations , community service , competence and
continuing education , the code of nurses , theory , and autonomy .
based on these
characteristics of professionalism , professionals can be distinguished from other workers .
professionalism in nursing has focused on the role of the expansion of nursing in the
rapidly changing healthcare environment .
nursing professionalism reflects the manner in
which nurses view their work and is a guide for the behaviors of nurses in practice to
ensure patient safety and quality care .
however , social , cultural , scientific , and technological elements have shaped the
development of nursing as a profession .
the foundations of nursing were established in turkey through the system offered by
florence nightingale and her colleagues to wounded british soldiers in the selimiye barracks
during the crimean war , which took place between 1854 and 1856 . in turkey , professionalization in nursing is still one of the
most important issues for nurse leaders . during the assessment of the evolution of nursing
in turkey , significant developments and changes
have been observed ; however , not all of them
are regarded as satisfactory .
the healthcare system in turkey is constantly undergoing major
changes ( nursing management about legal changes , health - care system about legal changes ) due
to social , consumer - related , governmental , technological , and economic pressures .
the level of
professionalism demonstrated by nurses , and the resulting image created , is increasingly
crucial in attracting clients .
few studies have been carried out in metropolitan hospitals in different regions of turkey
to identify the professional level of nursing , professional behavior of nurses in different
contexts , and the factors affecting professionalism .
a significant development in the
process of professionalism occurred in turkey after the 1980s .
however , there are still weak
fields in nursing , such as scientific knowledge and autonomy , which need to be strengthened .
additionally , the nursing field has significant obstacles that hinder the adoption of
professional identity , and hence the performance of professional roles related to it . in the
process of the professional development of nursing ,
various social , political , cultural ,
scientific , and technological factors affect these obstacles , which may impede the professional development of nurses and
their professional behaviors . therefore , the purpose of this study was to examine the
professional behavior of nurses working in a public hospital in turkey .
also , we aimed to
identify factors which affect the professional behavior of nurses .
data for this descriptive exploratory study were collected from september 2012 to december
2012 during face - to - face meetings with nurses .
the important criteria for accepting nurses
into this study were that all of the nurses must have been employed full time for at least 6
months and they must have had direct patient care experience during those six months .
the
study was conducted at a public hospital ( bolu izzet baysal public hospital ) in northwestern
turkey .
the institution had a 200 bed capacity , with 120 nurses in various clinical areas .
however , there were no pediatric , obstetrics /gynecology , and psychiatry departments in the
hospital where this study was conducted .
a total of 89 nurses ( response rate : 74% ) were
included in the final sample .
the data of the study were collected by using personal information form which was prepared
by researcher s involved sociodemographic and job characteristics , as well as behavioral
inventory for professionalism in nursing .
the behavioral inventory for professionalism in nursing ( bipn ) includes questions about the
professional behaviors of nurses .
the reliability and validity of the bipn in turkey was
assessed by karadag et al .
permission to
use the turkish version of the bipn was granted from these researchers . in an adaptation
study , the cronbach alpha coefficient was 0.780.87 and the test - retest coefficient was
0.86 .
the bipn consists of 9 subgroups : educational
preparation , publication , research , participation in a professional organization , community
service , competence and continuing education , code for nurses , theory , and autonomy . in this
study ,
the bipn was evaluated with the
original evaluation criteria . in the bipn , each behavior received 03 points .
the overall
score of each group was 3 and the total possible weighted score was 27 .
the instrument was initially administered to 20 nurses
who were asked to provide written or verbal comments regarding the clarity of the items in
the instrument .
the instrument was then administered to a pilot sample of 16 nurses and was
reviewed for completeness and clarity on their presentation for testing .
all of the data were analyzed using spss version 17 ( spss , chicago , illinois , usa ) .
the mann - whitney u test and the
kruskal - wallis tests , as nonparametric tests , were used to detect whether 2 or more samples
come from the same distribution or to test whether medians between comparison groups are
different , under the assumption that the shapes of the underlying distributions are the
same .
this study was conducted according to the principles expressed in the declaration of
helsinki . before starting the study ,
an ethical approval was received from ethics committee
of the abant izzet baysal university and written permissions were obtained from the
institutions involved .
the participants were informed that their participation was voluntary
and that all responses would be held in confidence .
all of the nurses ( 100% ) in the study were female , 52.8% ( n=47 ) of the participants were
between the ages of 39 and 45 , 27% ( n=24 ) had a bachelor s degree , and 55.1% ( n=49 ) had been
working in their present position for between 6 and 14 years .
all of the nurses had a minimum of a
bachelor s degree in nursing .
the distribution of the mean scores of the nurses obtained from the bipn subscales are
shown in table 1 .
the mean score of the nurses was
5.073.47 and the areas with low mean scores were in the areas of autonomy ( mean scores=
0.060.34 ) , publication ( mean scores= 0.100.25 ) , research ( mean scores= 0.250.60 ) , and
participation in a professional organization ( mean scores= 0.32 0.76 ) . the areas with the
highest scores were competence and continuing education ( mean scores= 1.880.34 ) .
( table 1 ) the mean bipn score was highest in the group who had been working as nurses for 1 to 5
years ( mean scores=7.013.32 ) and was the lowest in the group that had been working for 6 or
more years ( mean scores= 6.893.12 and mean scores= 5.032.98 ) .
the difference between the
groups was found to be statistically significant ( kw=6.342 ; p<0.05 ) . there was a
statistically significant difference between the total bipn scores and the education levels
of the nurses ( kw=7.112 ; p<0.05 ) ( table 2 ) .
the mean scores of professionalism of the nurses were 5.45 5.10 ( n = 1019 ) , 5.97 3.80
( n=225 ) , and 7.16 3.48 ( n=531 ) in the studies of karadag et al . ,
cerit & amp ; dinc , and
celik & amp ; hisar , respectively .
however , the mean scores on the bipn were higher for
nurse executives ( manny whitney u= 2.375 ; p<0.05 ) .
the present study revealed that the professional behavior of the nurses was quite low
compared to findings in other studies .
, based on the model for professionalism in nursing . this
model aimed to determine the extent of the professional behavior of nurses with the bipn
that she had developed using this model . the professional levels of nurses have been found to be low in professionalism studies
conducted in turkey , and these results also support our study
. the underlying reasons of these results , which inhibit the development of professional
behaviors , may be excessive workload , long work hours , and an inadequacy of the sources
provided .
professionalism in nursing is delayed due to many negative factors , such as the
differences between educational levels in nursing in turkey , perception in the community
about nursing as a profession , the hierarchic structures of hospitals , intense workloads ,
the focus of nursing on tasks , a lack of personnel and equipment , insufficient job security ,
low salaries , and weakness in organized labor .
educational preparation was found
to be one of the areas where the lowest scores were obtained ( table 1 ) .
this is a reflection of the status of nursing education levels
in turkey , as approximately one - third of the nurses participating in our study finished
their education with only associate degree level .
changes implemented in turkish nursing law in 2007 resulted in a
development in nursing education . with
this new regulation , requirements for basic nursing education were increased to that of a
baccalaureate degree in nursing ( bsn ) .
it is thought that this favorable development will
have a positive impact on nursing in future .
it has been established that bipn mean scores increase as the education level increases .
hwang et al . , also reported that korean and chinese nurses
with higher education levels demonstrated higher levels of professionalism .
however , the
nurses working in the hospital in the present study have lower education levels . some nurses
working in turkey graduated from a 2-year associate degree and some graduated from a 4-year
bachelor program .
the number of nurses who graduated from a 4-year bachelor program in
university and private hospitals was greater than that in the rural state hospitals in
turkey . in present study , level of nurses related to research and publication
were low in terms of
professional behavior [ publication ( 0.100.25 ) and research ( 0.25 0.60 ) ] ( table 2 ) compared to previous studies .
the
society for research and development in nursing , founded in turkey in 1996 , provided an
organized structure for research activities in nursing .
although the number of research studies in nursing has increased since the 1950s , it is
still insufficient .
stated perceived barriers as the reason for restricting research activities and the most
frequently ( 84,5% ) perceived barrier for turkish nurses was found to be the lack of time to
implement new ideas .
moreover , in
another study in turkey , it was found that most of the participants had not published a
research article ( 90,5% ) , and 23,4% reported that they had never read research
articles .
therefore , generally
undertaken in metropolitan training hospitals with nurses with higher levels of education in
turkey .
higher levels of research and publication scores in previous studies may be due to
better facilities for research activities among nurses with masters and phd
degrees .
autonomy is the important criteria in gaining a professional status , in the determination
or assessment of professionalism , responsibility for one s behavior , and the ability to take
risks . in our study ,
the autonomy levels of the nurses were scored as low for
professional behavior . a study conducted by karadag , in turkey
reported low levels of autonomy in nursing , resulting from laws and regulations in nursing .
it is low when compared with those obtained in similar studies carried out in other
countries . in the current turkish
health - care system , there are many challenges that influence a nurses autonomy , such as the
rules and regulations of the hospitals and health - care organizations .
furthermore , the low
education level of nurses who do not carry out research and do not have regular access to
publications contributes to the problem .
in turkey today , the majority of nurses work without an undergraduate degree , including
nurses in administrative positions .
professional organizations are established to solve problems that the members of a
profession can not individually deal with .
a sense of unity among the members of a profession shows the power of
that profession , but this seems to be rather low among nurses in turkey . the first nursing organization in turkey ,
founded in 1933 ,
was the turkish nurses association ( tna ) ; a member of the international
council of nursing ( icn ) since 1949 .
participation in a
professional organization of nurses was scored as low for professional behavior . in a study
by miller et al .
, concerning the membership of nurses in professional organizations , 15,9%
of nurses were found to have a membership to the american nurses association and 35% were
members in other specialty organizations ; whereas in turkey , this percentage is 11%38%
since last 30 years .
although awareness of nursing associations and the percentage
of nurses believing that an association membership is important were very high , the low rate
of participation in professional organizations is a very important problem in nursing .
nurses are obliged to have a code of ethics in order to meet the criteria of
professionalism .
however , only a
small number of nurses had copies of these codes ( n= 10 ) in this study . at present ,
ethic
codes specific to turkey are being prepared , and the translations of ethics codes developed by both the american
nurses association and the international council of nurses are available , and their use is
recommended .
our findings are consistent with those of similar studies , including that by
miller et al . , of nurses in the western usa and that of hisar and karadag with nurse
executives in turkey , which established that the majority of respondents did not have a copy
of the code .
in this study , increased working hours in professional life was found to cause decreases
in displaying professional behaviors ( p<0.05 ) .
results showed that a decrease in
professionalism was parallel to increases in burnout , depending on the number of years spent
working in the profession .
however , our findings were not consistent with the findings of
previous studies , which confirmed that nurses with longer professional
experience have also high professional scores .
it was found in a study in turkey that the
burnout of healthcare staff composed of female nurses ( n= 89 ) was directly related to
conditions of the work place and to increased work overload . since the profession of nursing is mainly regarded as a female
profession ,
stress factors became more dominant due to the addition of other gender related
roles and responsibilities . in our study , nurses with executive roles had high bipn scores ( p<0.05 ) in total when
compared to the results of other studies .
the professional standards of behavior required from nurse executives are crucial to the
development of professional nursing . as leaders
, nurse executives must become actively
involved in the ongoing development and improvement of professional standards of behavior
and conduct in their field .
the results of our study indicate that the professional behavior of nurses is at a low
level .
the areas with the highest levels for professional behavior were competence and
continuing education .
the professionalism levels for nurses were the lowest in the areas
of autonomy , publication , and research .
another noticeable problem in the field of nursing was the low number of publications
related to nursing and participation in professional organizations .
regarding autonomy , it
is believed that the current law on nursing in turkey prevents nurses from making decisions
and acting independently . finally , despite few rights gained by the 2007 and 2011 laws , nurses still have some
problems , which are more pronounced in rural areas than in urban parts of turkey .
the
arrangement of the nurses working conditions affects their professional behaviors ;
therefore , development in the field of professional behaviors in nursing must be assessed
and supported to increase the quality of patient care .
moreover , the involvement of nurses
in scientific research and in educational programs and the importance of membership in
professional associations must be supported by nursing leaders .
nurses have to learn to view
their roles in the healthcare field as decision - making positions as opposed to passive and
submissive behaviors from their past experiences .
additionally , nurses have to accept the
characteristics that make up the concept of professionalism by taking responsibility for
common problems , emphasizing both their own values and those of the community .
this study was conducted in a public hospital in northwestern turkey and may not be
representative of the entire population of nurses .
generalization is limited since only
those nurses who voluntarily chose to answer the bipn were included in the study .
the sample
was not randomized , and the items on the bipn were self - reported in nature .
one of
the variables that may have influenced the professional behavior of the nurses was the type
of patient care unit that the nurses worked on , but this was not examined in this
study .
| introduction : professionalism is characterized by the degree
of dedication displayed by individuals regarding the values and behavioral attributes of a
specific career identity . professionalism indicates attitudes that represent high levels
of identification with and commitment to a specific profession . in the process of the
professional development of nursing , various factors affect these obstacles which may
impede the professional development of nurses and their professional behaviors .
this study
was carried out with the aim of determining the professional behavior of nurses in a
hospital in turkey .
methods : in this descriptive exploratory study a total of 89
nurses working in a public hospital in northwestern of turkey were participated .
data were
collected using a demographic questionnaire and behavioral inventory form for
professionalism in nursing ( bipn ) .
results : the result showed that mean scores on the bipn
were 5.07 ( 3.47 ) .
the areas with the highest levels of professional behavior were
competence and continuing education 1.88 ( 0.34 ) .
the professionalism levels for nurses
were the lowest in the areas of autonomy 0.06 ( 0.34 ) , publication 0.10 ( 0.25 ) , and
research 0.25 ( 0.60 ) .
there was a statistically significant difference between the total
bipn scores and the education levels of the nurses and the working of nurses .
conclusion : the professional behavior of nurses is at a low
level . since the arrangement of the nurses working conditions affects their professional
behaviors ; therefore , development in the field of professional behaviors in nursing must
be assessed and supported to increase the quality of patient care . |
animals : this study included 46 dogs separated into the cr group ( n=27 )
and the cb group ( n=19 ) .
the mean age was 7 years for dogs with cr ( range : 214 years ) as
well as for dogs with cb ( range : 315 years ) .
these dogs were referred to the animal medical
center of nihon university from april 2009 to december 2012 for diagnostic purposes and
consultations on long - term therapy for nasal discharge or chronic cough .
the common breeds
were miniature dachshund ( n=8 ) , shiba ( n=3 ) , toy poodle ( n=3 ) , shih tzu ( n=2 ) , pembroke
welsh corgi ( n=2 ) , pomeranian ( n=2 ) and maltese ( n=2 ) .
the dogs did not have dermatitis ,
digestive complications ( i.e. , vomiting or diarrhea ) and the corticosteroid therapy .
the
diagnosis of cr was confirmed by computed tomography ( ct ) to rule out nasal tumors ,
lymphoplasmatic infiltration with or without neutrophils in nasal lavage and biopsy , and
fungal infections , such as the aspergillosis .
the diagnosis of cb was confirmed by ct to rule out pneumonia and
tumors , by slightly increased numbers of total cells , macrophages and neutrophils in
bronchoalveolar lavage collected by bronchoscopy .
diagnostic criteria for canine chronic rhinitis ( cr ) and bronchitis
( cb)cr : 1 ) nasal water discharge and/or sneezing for over one
month , with normal complete blood counts and no skin or gastrointestinal
disease.2 ) swelling and enlargement of nasal membrane , and no
tumor , foreign body or parasite in the nasal cavities by computed tomography ( ct )
and rhinoscopy.3 ) lymphocytic- and/or plasmacytic - dominant
inflammation in biopsies of nasal mucosa.cb:1 ) productive cough for over one month , with
normal complete blood counts and no skin or gastrointestinal disease.2 ) thickening of bronchial wall on chest radiography
and ct imaging.3 ) exclusion parameters : cardiac diseases and any
other respiratory diseases of the nose or pharyngeal , laryngeal , tracheal and lung
parenchyma determined by chest radiography , ct imaging and endoscopic
examination.4 ) elevated total cell number with macrophage
dominance or normal total cell number with neutrophil dominance , in
bronchoalveolar lavage fluid . presents a summary of the diagnostic criteria of cr and cb . sample collection and analysis : blood samples were collected from the
jugular vein and stored immediately at 4c until analysis .
the proportions of ccr4/cd4 cells
were determined by flow cytometry using an alexa 647-conjugated anti - canine cd4 antibody
( serotec , oxford , u.k . ) and r - phycoerythrin ( pe)-conjugated anti - human ccr4 antibody ( bd
biosciences , san jose , ca , u.s.a . ) , as previously reported [ 16 , 26 ] .
serum levels of each antigen - specific ige antibody were measured by
fluorometric enzyme - linked immunosorbent assay , as previously described [ 6 , 17 ] .
briefly , microwells were coated with 100 ml of 1
ml / ml allergens , including arthropods
( dermatophagoides pteronyssinus , d. farina , fleas ,
mosquitoes and cockroaches ) , pollens ( mugwort , ragweed , goldenrod , dandelion , daisy ,
orchard , sweet vernal , timothy , rye , bermuda grass , japanese cedar , birch and alder ) , molds
( aspergillus fumigatus , alternaria alternaria ,
cladosporium herbarum and penicillium notatum ) , meat and
dairies ( beef , pork , chicken , egg white , egg yolk , milk , lamb , turkey and duck ) , fish
( salmon , codfish , catfish and capelin ) and vegetables and grain ( wheat , soybean , corn ,
potato and rice ) . the wells were blocked with 1% gelatin phosphate buffered saline ( pbs ) for
2 hr at room temperature and then washed with phosphate buffered saline with tween 20
( pbst ) .
sera were diluted 1:1,000 , and 100 ml was applied to each
microwell . after incubating overnight at 4c ,
the wells were washed , and 100
ml of biotinylated cre - dm was used as an anti - canine ige monoclonal
antibody .
the serum levels of each antigen - specific ige antibody were calculated using a
standard curve .
sensitization was defined by antigen - specific ige concentrations > 100
ng / ml . treatment protocol : all dogs were treated according to our therapeutic
guidelines for cr and cb . when a diagnosis of cr or cb was made , macrolide therapy was
initiated with azithromycin ( 5 mg / kg , sid ) for the first 2 weeks .
if macrolide therapy
failed to control the clinical signs , an anti - allergic therapy was initiated , with
montelukast ( 0.1 mg / kg , sid ) and
ozagrel ( 510 mg / kg , bid ) , for
the second 2 weeks .
if this anti - allergic therapy failed to control the clinical signs ,
corticosteroid therapy was provided with prednisolone ( 0.5 mg / kg , bid ) for the third 2
weeks .
statistical analysis : all data were expressed as mean standard deviation
( sd ) .
the mean ratios of ccr4/cd4 cells in dogs with cr and cb were compared with the mean
value ( 21.2 3.4% ) obtained for five healthy 7-year - old dogs of similar breeds , which value is not statistically
different in 39 client - owned healthy dogs ( 19.1 6.9% ) .
the analysis was conducted by
unpaired t - test after a shapiro wilks test of normality .
all analyses were
performed with sigmaplot for windows , vers12.0 ( systat software , san jose , ca , u.s.a . ) .
the ratios of ccr4/cd4 cells were 31.9 8.4% for dogs with cr and 30.2 6.8% for dogs
with cb .
both values were significantly higher than the average value previously reported
for 7-year - old healthy dogs ( 21.2 3.4% ) .
in addition , ratios of ccr4/cd4
cells>28.0% were detected in 77% ( 20/27 ) of the dogs with cr and in 63% ( 12/19 ) of the
dogs with cb , which was the upper limit of the range found in healthy dogs ( mean 2sd )
( fig .
( mean 2sd ) for 7-year - old healthy dogs and dogs with chronic
rhinitis or bronchitis . )
. ratios of ccr4/cd4 cells ( mean 2sd ) for 7-year - old healthy dogs and dogs with chronic
rhinitis or bronchitis .
the sensitization rates for a single allergen were 77% ( 20/27 ) and 79% ( 15/19 ) for dogs
with cr and cb , respectively .
in addition , multi - sensitization rates were 80% ( 16/20 ) and
67% ( 10/15 ) for dogs with cr and cb , respectively .
2.sensitization rates of dogs with chronic rhinitis or bronchitis , determined by
measurements of serum - specific ige antibodies ( > 100
ng / ml ) . compares the sensitization rates of each allergen compiled in each group . over 25% of
the dogs with cr were sensitized for penicillium notatum [ median : 150 ,
range : 102317 ng / ml ] , beef [ 128 , 104335
ng / ml ] and soybean [ 165 , 112226
ng / ml ] .
in contrast , over 25% of the dogs with cb were
sensitized for aspergillus fumigatus [ 149 , 127452
ng / ml ] , alternaria alternaria [ 134 ,
102311 ng / ml ] , penicillium notatum [ 122 ,
115424 ng / ml ] , beef [ 249 , 1231054
ng / ml ] and rice [ 142 , 118306
ng / ml ] .
sensitization rates of dogs with chronic rhinitis or bronchitis , determined by
measurements of serum - specific ige antibodies ( > 100
ng / ml ) .
seven dogs with cr and one dog with cb were excluded from the treatment course for
financial reasons and time constraints faced by the owners . the remaining dogs with high
ratios of ccr4/cd4 cells ( > 28.0% ) or sensitized levels of specific - antigen ige ( > 100
ng / ml ) received macrolide therapy ( 59% vs 50% ) ,
anti - allergic therapy ( 24% vs 13% ) or corticosteroid therapy ( 18% vs 38% ; fig . 3fig .
3.frequency distribution of the definitive therapies effective for dogs with ( a )
chronic rhinitis or ( b ) chronic bronchitis , based on high ratios of ccr4/cd4 cells
( > 28.0% ) or high sensitized levels of specific - antigen ige ( > 100
ng / ml ) . ) .
macrolide therapy reduced clinical signs in 50% of the 36 dogs with cr and cb
( fig .
frequency distribution of the definitive therapies effective for dogs with ( a )
chronic rhinitis or ( b ) chronic bronchitis , based on high ratios of ccr4/cd4 cells
( > 28.0% ) or high sensitized levels of specific - antigen ige ( > 100
ng / ml ) .
it has been reported that serum tarc levels increase in eosinophilic inflammatory nasal and
respiratory diseases , such as allergic rhinitis and asthma [ 15 , 23 ] .
in addition , the number of ccr4-positive lymphocytes also increases in airway
epithelial cells of human patients with allergic cr and asthma , but not in those with
non - allergic rhinitis and other lung diseases , such as chronic obstructive pulmonary disease
[ 1 , 20 , 21 ] .
these phenomena indicate that
atopic inflammatory respiratory diseases are characterized by late allergic responses in
both the upper and lower airways .
recently , the concept of one airway , one disease was
proposed , because 6078% of asthma patients have co - existing allergic rhinitis , which is
better described as a continuum of inflammation involving one common airway . in our clinical experience , dogs
and cats sometimes show signs of both upper and lower respiratory diseases . in this study ,
the proportions of ccr4/cd4 cells were elevated in most dogs with cr and cb , although no
eosinophil infiltration was detected in nasal tissue samples or bronchoalveolar lavage
fluid .
in addition , they were sensitized to a broad range of aeroallergen and not only house
dust mite .
a major limitation of this study is that we are unaware how these dogs became sensitized to
such a broad range of allergens because there is no proof that ccr4 + lymphocytes increase
locally in the nasal mucosa and bronchoalveolar lavage fluid .
moreover , it was not possible
to include a healthy control group , because of the referral population of our hospital .
it
remains unclear , therefore , how many dogs with atopic predisposition were in a subclinical
state , because our study could not measure the proportions of ccr4/cd4 cells and sensitized
levels of antigen - specific ige in client - owned healthy dogs .
however , we hypothesize that
exposure to arthropods , molds and dry powder inhalation of food materials may be one of the
triggers for canine airway diseases . thus , our data suggest that most dogs with cr and cb
have a tendency toward atopic predisposition , necessitating a reduction in their exposure to
environmental allergens .
in addition , they may exhibit hypersensitivity of sensory receptors
in the airway , similar to atopic cough in humans [ 7 , 8 ] . regarding the allergic disease , corticosteroid therapy is commonly selected in clinical
settings . however , azithromycin ( 5 mg / kg sid for 5 days and then twice weekly ) was
introduced as an effective macrolide for dogs with cr .
accordingly , we observed that
macrolide therapy reduced the clinical signs in 50% of the dogs with cr and cb .
macrolide
therapy suppresses inflammatory responses by reducing the levels of pro - inflammatory
mediators , neutrophil and eosinophil chemotaxis , leukocyte adhesion and oxidative burst ,
bacterial adherence , biofilm formation and bacterial virulence , and by enhancing neutrophil
apoptosis , mucociliary clearance and mucus hypersecretion in the airways .
in addition , roxithromycin , a
14-membered ring macrolide , inhibited the production of tarc by suppressing p38 in the
mitogen - activated protein kinase pathway and the nf-b signaling , to maintain immune
homeostasis in barrier tissues .
the macrolide therapy also has a benefit to control the respiratory bacterial infection ,
such as mycoplasma , though we were not able to detect that by the
cultivation test in this study .
altogether , these data suggest that macrolide therapy
represents an effective alternative to corticosteroid therapy to control the clinical signs
of canine cr and cb with an atopic predisposition . in conclusion , most dogs with cr and cb have a possibility of atopic predisposition , and
those with an atopic predisposition may require improvements in their environmental
conditions to reduce allergens , as well as macrolide therapy to control their clinical
signs . | canine chronic rhinitis ( cr ) and bronchitis ( cb ) are suspected to be allergic diseases .
the present study tested whether dogs diagnosed with cr or cb present an atopic
predisposition based on the ratio of cc chemokine receptor 4 ( ccr4)-positive cells among
peripheral blood cd4-positive cells ( ccr4/cd4 ) and the serum levels of allergen - specific
ige antibodies .
we found that most dogs with cr and cb have a possibility of atopic
predisposition , and macrolide therapy constitutes an alternative to corticosteroid therapy
in controlling the clinical signs . |
cyclopropagative development of plasmodium parasites in their anopheline mosquito vectors is required for transmission between human hosts . during the first stages of this cycle , immediately following the ingestion of gametocytes by the female mosquito ,
following progression to the ookinete stage in the midgut lumen , plasmodium parasites invade the midgut epithelium at around 20 hours after ingestion and develop over approximately 10 days into a mature oocyst .
mitotic division leads to the production of thousands of sporozoites from a single oocyst , and these sporozoites are released into the hemolymph , at about 1020 days after infected blood ingestion , depending on the plasmodium species . at this stage ,
the parasites migrate to the salivary glands from where they can be transmitted to another host during a subsequent blood feed .
oocyst and sporozoite populations are severely compromised by mosquito - mounted immune responses , but the escape of a small proportion of parasites is sufficient for transmission to persist . with the increased resistance of plasmodium to the current arsenal of drugs and anopheles mosquitoes to insecticides and the lack of an efficacious malaria vaccine ,
it is clear that development of novel control strategies are crucial in order to reduce malaria transmission . here
, we discuss different methods to control transmission of malaria parasites via low - tech approaches using the mosquito 's natural bacteria microflora or high - tech approaches involving the direct manipulation of mosquito genomes to render them resistant to plasmodium .
numerous surveys of mosquito midgut - associated bacteria ( mab ) in laboratory and wild anopheline mosquitoes have been performed , and common bacterial genera ( enterobacter , pseudomonas , pantoea , and others ) have been identified [ 18 ] , with some of these bacteria closely associated with anopheles mosquitoes [ 911 ] .
a number of studies have shown that mab impact the ability of plasmodium parasites to develop to the oocyst stage in the mosquito gut tissue .
mosquitoes that have been treated with antibiotics to remove their mab are more susceptible to plasmodium infection , and reconstitution of the bacterial flora results in infections at the same level as untreated control mosquitoes . when added to a parasite - laden blood meal
, bacteria can interfere with parasite development [ 1 , 2 , 4 , 5 ] .
interestingly , this interference appears to be exclusive to gram - negative ( g ) bacteria but is bacterial strain dependent , suggesting some bacteria possess an anti - plasmodium property [ 1 , 4 ] .
however , no correlation between g bacteria presence and infection status was observed in field populations of a. gambiae and a. funestus from kenya and mali , although determination of the timing of bacterial and/or parasite acquisition by the mosquitoes was not performed .
multiple mechanisms could result in the inhibition of parasite infection by the presence of bacteria .
lysis of trypanosomes and leishmania parasites in triatomine bugs has been observed following biofilm formation on the parasite surface by serratia bacteria ( g ) , while no such phenomenon has been described in plasmodium infection of mosquitoes .
it was recently identified that an enterobacter bacterium isolated from wild mosquitoes in zambia produces reactive oxygen intermediates that kill developing parasites in the midgut lumen , inhibiting plasmodium prior to mosquito midgut infection .
small populations of the bacterium can nearly eliminate ookinete formation in the midgut , providing proof of principle for the use of this and other bacteria to control malaria parasite transmission .
in general , g bacteria show varying levels of inhibition at the early stages of parasite development , suggesting that diverse mechanisms of bacteria - mediated parasite inhibition exist . bacteria may play an indirect role in parasite interference through the induction of an anti - plasmodium immune response in the midgut .
studies have suggested that the mosquito 's anti - plasmodium and antibacterial defense systems are largely overlapping .
the mosquito gut microflora has been shown to stimulate basal immune activity , which in turn is acting against the malaria parasite [ 12 , 1517 ] .
the immune deficiency ( imd ) innate immune pathway , which is stimulated by the presence of g bacteria and appears to be the primary immune pathway activated in the mosquito midgut , has been shown to control p. falciparum infection intensities through the expression of anti - plasmodium effector molecules in multiple anopheline species [ 18 , 19 ] .
these molecules also control bacterial populations in the midgut , providing a direct link between antibacterial and anti - plasmodium immunity [ 12 , 15 , 19 ] .
although the absolute mechanism of inhibition exhibited by most bacteria remains unclear , their potential use as a biological - based control strategy is apparent . nonetheless , there are deficiencies in our understanding of the mosquito - bacteria interaction that needs to be resolved before such strategies can be implemented .
bacteria are necessary for larval mosquito development but the mechanism of transmission of bacteria through immature stages of development to the adult mosquito midgut is controversial .
studies have shown that bacteria provided to larvae can be identified in adult midguts [ 5 , 8 , 21 ] but other studies suggest that transstadial transmission does not occur and instead that mab are derived from adult sugar and water sources .
the interactions between mosquitoes and bacteria that lead to efficient colonization in the adult midgut must be understood for effective introduction of inhibitory mab in wild mosquito populations in malaria endemic areas .
another important issue that must be resolved is the concentration of mab required for efficient inhibition of parasite development in the mosquito .
as little as 100 bacteria can significantly impact p. falciparum development when provided concurrently in a blood meal [ 1 , 4 ] and mab can inhibit oocyst formation when provided in sugar solution prior to parasite challenge [ 4 , 19 ] , but the concentration necessary for inhibition in natural settings is unknown .
germline transformation of a. stephensi was first reported in 2000 , and other important malaria vectors have since been transformed [ 26 , 27 ] . in the process of transformation ,
a mobile genetic element is used to insert into the mosquito genome a gene of interest that is under the control of a specific promoter .
choice of promoters and effector genes are some of the most important factors for generating mosquitoes that are refractory to plasmodium infection and in limiting the adverse fitness effects exerted by transgene expression . genetic drive systems to integrate the transgene into wild mosquito populations are also essential for the implementation of genetically modified mosquitoes as tools for control of malaria transmission . to target plasmodium parasites during the developmental cycle
, an effective anti - plasmodium transgene must be expressed in a relevant tissue ( midgut , fat body , and salivary glands ) at a relevant time ( when the parasite is present in that tissue ) .
the promoter used for transgene expression will determine the timing and the mosquito tissue in which the transgene will be expressed . in anophelines , midgut - specific transgene expression has been achieved using the carboxypeptidase , peritrophin , antryp1 , and g12 promoters , the vitellogenin promoter has been used to drive transgene expression in the mosquito fat body , and the apyrase and anopheline antiplatelet protein promoters can drive transgene expression in the salivary glands .
conditional transgene expression in a. stephensi midguts under the control of the srpn10 promoter has also been shown .
expression of nonmosquito effector molecules in transgenic mosquitoes has been used to decrease p. falciparum development
. midgut - specific expression of a sea cucumber c - type lectin in a. stephensi and a synthetic anti - plasmodium peptide in a. gambiae decreased oocyst intensities .
transgenic technologies have also been used to increase the expression of endogenous mosquito genes that in turn increase anti - plasmodium responses in the mosquito .
overexpression of akt , a key signaling molecule in the insulin signaling pathway , in the midguts of a. stephensi completely blocks p. falciparum oocyst development .
because the anopheles innate immune system is engaged at multiple stages of plasmodium infection and mediated through multiple factors ( reviewed in ) , the transgenic overexpression of multiple anti - plasmodium immune effectors in several tissues at different times during plasmodium infection can provide tiers of inhibition , targeting parasites that may have escaped the first lines of defense and decreasing the likelihood of resistance developing in the parasite ( dimopoulos et al .
stable and heritable rna interference - mediated silencing of endogenous mosquito transcripts through the expression of a hairpin - loop transgene might also be used to target negative regulators of anti - plasmodium responses to increase resistance to parasite infection .
an effective genetic drive mechanism is needed to introduce anti - plasmodium effector transgenes into a wild mosquito population .
a drive mechanism should be powerful enough to spread the transgene to near fixation in the population , be tightly linked with the transgene so that separation can not occur and have minimal impact on mosquito fitness .
potential drive mechanisms are naturally occurring selfish gene mechanisms with non - mendelian inheritance ( reviewed in ) including , but not limited to , transposable elements ( tes ) homing endonuclease genes ( hegs ) and medea .
tes are mobile genetic elements that are capable of moving rapidly into populations and can be engineered to carry a transgene through a population
. however , the rates of transposition for the class ii transposons hermes , minos , mos1 , and piggybac , which have been vital for mosquito transgenesis , are not sufficient to serve as drive systems .
while tes randomly integrate into a genome , hegs use a specific dna sequence to integrate into the chromosome through a mechanism of double - stranded dna break repair .
these enzymes are active in a. gambiae cells and embryos and can also be engineered to carry specific dna sequences . a breakthrough in mosquito - based genetic drive systems
was recently achieved with the successful introduction of an heg into transgenic anopheline mosquitoes . in cage studies
, it was shown that the genetic element could invade nave mosquito populations rapidly and may provide a novel mechanism of genetic modification of wild mosquitoes .
medea , or maternal - effect - dominant embryonic arrest , causes the death of all offspring that do not inherit the medea - bearing gene . in this system
, there is maternal expression of a toxin regulated by a germline - specific promoter and only zygotes expressing an antidote to the toxin will survive .
studies in the fruit fly have shown that medea can effectively and rapidly drive transgenes into a population . as novel mosquito
germline - specific promoters are discovered , such as dna regulatory regions of the vasa gene , both hegs and medea will have tremendous potential as genetic drive systems in mosquitoes . in order for transgenic mosquito technologies to be successfully applied , the genetically modified mosquitoes must be able to compete with wild mosquitoes
. therefore , the transgenic mosquito must be reproductively fit to ensure that the transgene will fix in the population .
the impact on mosquito fitness could be due to insertional mutagenesis caused by the integration of a transgene into an endogenous gene [ 47 , 48 ] , the expression of the transgene itself , or inbreeding repression due to rearing transgenic mosquitoes to homozygosity .
however , some studies show that transgenic mosquitoes are as fit as nontransgenic mosquitoes [ 49 , 50 ] . of note ,
a report by marrelli et al . suggested that transgenic mosquitoes expressing antimalarial effectors may have a fitness advantage over wild - type mosquitoes when under the selective pressure of continuous infection .
here , we compare some of the important attributes for an effective control mechanism that each of these strategies has .
mass productionin order to test for anti - plasmodium activity in mab , the microorganisms must first be grown in culture . because of this , optimal bacterial candidates for eventual release could be produced in mass quantities with minimal supplies that could be housed in endemic countries .
in contrast , mass production of mosquitoes requires large facilities for rearing and sex selection and large amounts of supplies .
in order to test for anti - plasmodium activity in mab
, the microorganisms must first be grown in culture . because of this , optimal bacterial candidates for eventual release could be produced in mass quantities with minimal supplies that could be housed in endemic countries .
in contrast , mass production of mosquitoes requires large facilities for rearing and sex selection and large amounts of supplies .
storage and transportationbacteria can be freeze - dried for both storage and transportation , making introduction into remote areas possible .
this also suggests that mab could be combined with current mosquito control strategies such as entomopathogenic fungi in an applicable formulation .
no protocols are currently available for the preservation of viable anopheles eggs , making transportation of either larvae or adult mosquitoes necessary
.
bacteria can be freeze - dried for both storage and transportation , making introduction into remote areas possible .
this also suggests that mab could be combined with current mosquito control strategies such as entomopathogenic fungi in an applicable formulation .
no protocols are currently available for the preservation of viable anopheles eggs , making transportation of either larvae or adult mosquitoes necessary .
parasite species coverage and selection pressuremosquitoes can develop resistance to the toxin of a current biocontrol bacterium ( bti ) , but a bacterial product with plasmodium species specificity would be required for the parasite to develop resistance .
population genetic studies suggest that refractoriness is a dominant trait and that plasmodium infection is a result of immune failure [ 5456 ] .
this , combined with a general antibacterial immune response , suggests that the use of mab to inhibit malaria parasite infection of mosquitoes would not impart a selective pressure on the parasite .
indeed , both p. falciparum and p. vivax infections can be inhibited by mab [ 1 , 2 , 4 , 5 ] . for transgenic mosquitoes
, the transgene will determine the range of parasites that can be inhibited and the selective pressure imparted on the parasite .
current effector molecules may not impact human malaria parasites and transgenic activation of mosquito anti - plasmodium responses has only been shown to inhibit p. falciparum . the use of transgenic mosquitoes expressing an exogenous gene may be problematic in that the parasite could develop resistance , but this would be overcome using endogenous immune gene overexpression or multiple releases over time of mosquitoes carrying different transgenes .
mosquitoes can develop resistance to the toxin of a current biocontrol bacterium ( bti ) , but a bacterial product with plasmodium species specificity would be required for the parasite to develop resistance .
population genetic studies suggest that refractoriness is a dominant trait and that plasmodium infection is a result of immune failure [ 5456 ] .
this , combined with a general antibacterial immune response , suggests that the use of mab to inhibit malaria parasite infection of mosquitoes would not impart a selective pressure on the parasite .
indeed , both p. falciparum and p. vivax infections can be inhibited by mab [ 1 , 2 , 4 , 5 ] . for transgenic mosquitoes
, the transgene will determine the range of parasites that can be inhibited and the selective pressure imparted on the parasite .
current effector molecules may not impact human malaria parasites and transgenic activation of mosquito anti - plasmodium responses has only been shown to inhibit p. falciparum
. the use of transgenic mosquitoes expressing an exogenous gene may be problematic in that the parasite could develop resistance , but this would be overcome using endogenous immune gene overexpression or multiple releases over time of mosquitoes carrying different transgenes .
mosquito species coveragethe ability of a bacterium to colonize or survive in the mosquito midgut is dependent on the bacterium itself , whereas only mosquito species that have been transformed or those that are capable of hybridization with the transgenic species will be refractory to plasmodium infection . however , the introduction of bacteria is dependent on the mosquito species found in the coverage area and the route of introduction , whereas transgenic mosquitoes can disperse and infiltrate the natural populations .
the ability of a bacterium to colonize or survive in the mosquito midgut is dependent on the bacterium itself , whereas only mosquito species that have been transformed or those that are capable of hybridization with the transgenic species will be refractory to plasmodium infection .
however , the introduction of bacteria is dependent on the mosquito species found in the coverage area and the route of introduction , whereas transgenic mosquitoes can disperse and infiltrate the natural populations .
off - target effectsrelease of bacteria into an ecosystem could have effects on other organisms .
depending on the released bacterial species , there could be competition for resources with other essential bacteria within the environment or unintended mortality in nontarget insects and vertebrates .
assuming that the expressed transgene is not released from the mosquito body , one would not expect off - target effects from the release of transgenic mosquitoes .
depending on the released bacterial species , there could be competition for resources with other essential bacteria within the environment or unintended mortality in nontarget insects and vertebrates . assuming that the expressed transgene is not released from the mosquito body
, one would not expect off - target effects from the release of transgenic mosquitoes .
time and concentration dependencebacteria can be effective against plasmodium in the midgut lumen and also during oocyst maturation , but this time window requires that bacteria be present prior to or soon after parasite ingestion . also ,
variation in the concentration of inhibitory bacteria present in an individual mosquito can determine the efficiency of inhibition [ 1 , 4 ] .
therefore , there is a strict correlation between the timing of bacterial introduction and parasite inhibition . with transgenic mosquitoes , the timing and level of transgene expression is controlled by a mosquito promoter and
bacteria can be effective against plasmodium in the midgut lumen and also during oocyst maturation , but this time window requires that bacteria be present prior to or soon after parasite ingestion .
also , variation in the concentration of inhibitory bacteria present in an individual mosquito can determine the efficiency of inhibition [ 1 , 4 ] .
therefore , there is a strict correlation between the timing of bacterial introduction and parasite inhibition . with transgenic mosquitoes ,
the timing and level of transgene expression is controlled by a mosquito promoter and is experimentally determined prior to release of the mosquitoes into the field .
introduction into the fieldbacterial formulations are currently used for biocontrol of mosquito larvae . however , because of the unknown nature of the mosquito - bacteria interaction and the carriage of bacteria through immature stages to the adult stage ( discussed above ) , the determination of application procedures for effective coverage of mosquito populations remains to be resolved .
also , the number of applications , bacterial concentration , and the size of coverage area are currently unknown .
transgenic aedes aegypti mosquitoes have recently been released in field - based trials , but this technology utilized a female killing - based technique that reduces mosquito populations .
mosquitoes with an expressed transgene have not been released as of yet , but could follow a similar strategy to that currently being employed .
transgene integration into a population has been shown experimentally in large - cage trials but not in wild mosquito populations .
bacterial formulations are currently used for biocontrol of mosquito larvae . however , because of the unknown nature of the mosquito - bacteria interaction and the carriage of bacteria through immature stages to the adult stage ( discussed above ) , the determination of application procedures for effective coverage of mosquito populations remains to be resolved .
also , the number of applications , bacterial concentration , and the size of coverage area are currently unknown .
transgenic aedes aegypti mosquitoes have recently been released in field - based trials , but this technology utilized a female killing - based technique that reduces mosquito populations .
mosquitoes with an expressed transgene have not been released as of yet , but could follow a similar strategy to that currently being employed . transgene integration into a population has been shown experimentally in large - cage trials but not in wild mosquito populations .
ethical issuesrelease of genetically modified organisms has been under much scrutiny and a number of publications address these issues [ 5961 ] . among these issues
are ethical concerns of education of potential risks in endemic countries , spread of the transgenic mosquito to other countries that have not agreed to the release , and coverage under the cartagena protocol .
bacteria do not require genetic modification in order to exert an inhibitory effect on plasmodium development in the mosquito and biocontrol formulations using bacteria are currently in use , so ethical issues of bacterial release may not be as great .
release of genetically modified organisms has been under much scrutiny and a number of publications address these issues [ 5961 ] . among these issues
are ethical concerns of education of potential risks in endemic countries , spread of the transgenic mosquito to other countries that have not agreed to the release , and coverage under the cartagena protocol .
bacteria do not require genetic modification in order to exert an inhibitory effect on plasmodium development in the mosquito and biocontrol formulations using bacteria are currently in use , so ethical issues of bacterial release may not be as great .
even with tremendous research efforts and financial support to control transmission , malaria remains the most impactful vector - borne disease worldwide .
as plasmodium parasites and the mosquito vectors continue to develop resistance to effective drugs and insecticides , we must continue the development of novel strategies to interfere with the transmission cycle .
we have briefly summarized two potential strategies based on one low - tech approach using the mosquito 's natural midgut microflora and one more technologically - involved high - tech approach using transgenic mosquitoes refractory to parasite infection .
each has their advantages and disadvantages for eventual implementation , but in the future may be combined as part of an integrated control strategy for malaria transmission . | current efforts have proven inadequate to stop the transmission of plasmodium parasites , and hence the spread of malaria , by anopheles mosquitoes . therefore , a novel arsenal of strategies for inhibiting plasmodium infection of mosquitoes is urgently needed . in this paper
, we summarize research on two approaches to malaria control , a low - tech strategy based on parasite inhibition by the mosquito 's natural microflora , and a high - tech strategy using genetic modification of mosquitoes that renders them resistant to infection and discuss advantages and disadvantages for both approaches . |
chagas disease was first described by the brazilian physician , carlos chagas , in 1909 .
he identified the causal agent , the protozoan trypanosoma cruzi ( t. cruzi ) , the vectorial transmission and insect reservoirs as well as the clinical signs and symptoms .
in other words , he described the complete cycle of the disease and suggested the possibility of congenital transmission . in the human villous hemochorial placenta ,
fetal and maternal tissues are separated by a fetal epithelium ( the trophoblast ) . within the villous placenta , a single multinucleated cell layer ( syncytiotrophoblast ) contacts maternal blood within the intervillous space . beneath the syncytiotrophoblast
reside replicating progenitors ( cytotrophoblast ) that are separated by a basal lamina from the connective tissue of villous stroma containing vascular endothelium , fibroblasts , and macrophages .
therefore , in case of women with chagas disease , the parasite has the opportunity to interact with a large cellular surface .
the dual perfusion that simulates the maternal and fetal circulation could be an excellent method to study the mechanism of the transmission of the parasite .
however , this method requires complex equipment and very experienced users . another possibility is the ex vivo infection of human chorionic villi explants , in which samples of placental tissue ( chorionic villi ) can be challenged in vitro with t. cruzi or other pathogens .
this system is preferred to analyze the process of infection of the placental barrier , although the immune system does not participate .
the analysis of infection in animal models is not treated in this paper because their placentas are not similar to human placenta .
also , pathological findings of placentas are not deeply described because they represent the final stage of the placental infection process , and so , it is hard to understand an ongoing process .
the aim of the present paper is to review the congenital transmission of t. cruzi , particularly the role of possible local placental factors which contribute to the vertical transmission of the parasite and can be studied in the ex vivo infection model of human chorionic villi explants .
chagas disease develops in three phases . the acute phase is first developed , immediately after infection , with high levels of parasitemia and symptoms in only some patients ( regional lymph node enlargement , bipalpebral unilateral edema , or romaa 's sign , and characteristic electrocardiogram alterations ) . in most cases , acute infection is not accompanied by clinical findings , thus moving onto the latent phase that can last for months or years .
the chronic phase , present in 30% of infected individuals , is associated with mega colon , mega esophagus , degeneration of the autonomous nervous system , arrhythmias , and abnormal growth of the heart with progressive insufficiency , with evident negative impact on the patient 's health . in this phase
the disease can be handicapping , and can either be the concurrent or the direct cause of death .
the course of the disease depends on diverse factors : parasite load at the site of inoculation , both the parasite 's genetic group and strain , whether it is an infection de novo or reinfection , the host 's immunologic status , and the type of vector ( triatomid ) [ 3 , 4 ] .
congenital t. cruzi infection is associated with premature labor , low birth weight , and stillbirths [ 57 ] .
serologic prevalence among pregnant women may reach 80% , and rates of congenital infection vary from 121% [ 811 ] . in argentina
the transmission rate is estimated between 212% . in chile , in two of the endemic regions ( iv and v regions ) , the congenital transmission rate of the parasite is 8.4% . according to who / paho the number of infected women at fertile age is approximately 1.8 million and it is estimated that 14,400 neonates are being infected each year , this is another reason why this form of transmission becomes epidemiologically more important .
additionally , congenital transmission is partly responsible for the globalization of chagas 's disease [ 10 , 15 ] .
congenital chagas transmission implies a t. cruzi seropositive mother and a postpartum detection of parasites in the newborn .
congenital chagas disease is diagnosed by direct microscopic examination of blood samples , pcr , or standard serological assays .
the latter can be carried out in infants when igg antibodies transferred from the mother have been eliminated ( 8 - 9 months after birth ) . during congenital transmission
the fact that only a percentage of the infected mothers transmit parasites to their fetuses raises the question of the ability of the placenta as well as the immunological status of mother and fetus / newborn to impair the parasite transmission .
therefore , it is thought that congenital chagas disease is the product of a complex interaction between the parasite , the maternal and fetus / newborn immune responses , and placental factors [ 9 , 18 ] .
the parasite 's biological cycle includes three cellular forms characterized by the relative positions of the flagellum , kinetoplast , and nucleus : ( 1 ) trypomastigotes : approximately 20 m in length and sub terminal kinetoplast .
they constitute the nonreplicative , mammalian infecting cellular form that is found in the blood and in the posterior intestine of triatomids . in mammals , this is the cellular form that disseminates infection through blood .
( 2 ) epimastigotes : also 20 m in length with a kinetoplast anterior to the nucleus .
( 3 ) amastigotes : approximately 2 m in diameter , rounded , with no emergent flagellum .
it multiplies within the mammalian host cells , forming nests , until they rupture after several cell divisions . before their release from the host cells ,
amastigotes differentiate into trypomastigotes which once released , invade the blood stream ; they may then enter any other nucleated cell .
epimastigotes can be grown in axenic cultures while amastigotes are grown in cultured mammalian cells , releasing trypomastigotes that can be harvested to perform in vitro assays .
t. cruzi displays great biological , biochemical , and genetic diversity ; therefore different strains of the parasite have been identified and classified into six discrete typing units ( dtus ) [ 24 , 25 ] .
strains of t. cruzi have been involved in different clinical forms of chagas disease [ 26 , 27 ] , thus implicating a different genetic population in tissue tropism , replication , and virulence , and in consequence in disease outcome .
t. cruzi strains corresponding to different dtus might have relevant consequences on congenital transmission and fetal / neonatal pathology , even though virreira et al . and burgos et al
. concluded that congenital transmission of t. cruzi is not associated with genetic polymorphism of t. cruzi .
described biological differences among subpopulations of t. cruzi in experimental vertical transmission and placental infection .
the immune system is fundamental to protect the mother against the environment , and to prevent damage to the fetus . during pregnancy
the maternal immune system is characterized by a reinforced network of cellular and molecular recognition , communication , trafficking and repair ; it raises the alarm to maintain the wellbeing of the mother and the fetus . on the other hand ,
the fetus provides a developing active immune system that will modify the way the mother responds to the environment , providing a uniqueness of the immune system responses during pregnancy . a crucial factor to stop , limit , or permit the development of fetal / neonatal infection relates to the capacity of the mother and fetus / newborn to mount innate and/or specific immune response(s ) against pathogens .
clinical studies have shown a strong association between intrauterine infections and pregnancy disorders such as abortion , preterm labor , intrauterine growth retardation , and preeclampsia .
as described above , congenital t. cruzi infection is associated with some of these pathologies [ 57 , 15 ] .
contrarily , the levels of inflammation markers and activation of nk cells are rather low in congenitally infected newborns .
this data highly suggests a protective role of such innate defenses in an uninfected newborn from infected mothers .
on the other hand , maternal t. cruzi - specific igg antibodies play protective roles in mothers and in fetuses when antibodies are transferred through the placenta and also may contribute to a reduction in parasitaemia .
the placenta is the principal site for the exchange of nutrients and gases between the mother and fetus .
this organ plays an important role in hormone , peptide , and steroid synthesis necessary for a successful pregnancy .
the human placenta is classified as a hemochorial villous placenta in which the free chorionic villi , formed by the trophoblast and the villous stroma , are the functional units .
the trophoblast contacts maternal blood in the intervillous space , and it is separated by a basal lamina from the villous stroma , which is connective tissue containing the vascular endothelium , fibroblasts , and macrophages ( figure 1 ) .
trophoblast , basal lamina , and villous stroma with the endothelium of fetal capillaries form the placental barrier that must be crossed by different pathogens , including t. cruzi , to infect the fetus during vertical transmission [ 1622 , 3641 ] .
placentas from mother with acute chagas disease ( high parasitaemia ) show severe histopathological changes , such as extensive necrosis , inflammatory infiltrate , and amastigote nests .
contrarily , placentas from mother with chronic chagas disease do not present necrotic foci and inflammatory infiltrate .
although parasite antigens can be visualized in the villous stroma , the typical amastigote nests are not present . in accordance with these results , in ex vivo infected placental explants , though parasite antigens and dna can be detected [ 17 , 18 , 42 ] , amastigote nests are not observed .
this evidence suggests that antiparasite mechanisms may exist in the placental tissue of women suffering chronic chagas disease .
we updated the importance of the presence of the causal agent of chagas disease in the intervillous space of human placentas , the viability of the parasite in this environment , and the process of infection of the placental tissue , mainly by ex vivo and in vitro studies .
clearance of t. cruzi from the intervillous space is associated with the risk of congenital transmission .
thus , a high parasitaemia , as in acute infection , correlates with a higher transmission rate [ 15 , 18 , 43 , 44 ] .
thus the amount of parasites could be an important risk factor for mother to fetus transmission of t. cruzi .
there are only few publications analyzing the survival of t. cruzi in the placental environment .
employing chorionic villi ex vivo and in vitro infection model cocultured with trypomastigotes from two different strains of t. cruzi , observed that one of the strains presents a better survival rate than the other in the placental environment .
furthermore , the two strains of t. cruzi respond differently when they were treated with placental media .
therefore , the great biological , biochemical , and genetic diversity of the parasite may determine , at least partially , the capacity of placental infection .
these results open a new concept , that placenta might exert a clearance of the parasite from the intervillous space , and that different populations of t. cruzi have different survival capacities in that environment .
contact time between t. cruzi and the trophoblast in the intervillous space : the time that the parasite remains in the intervillous space in contact with the syncytiotrophoblast is poorly known .
placental barrier is constituted by the trophoblast tissue , that comprises a continuous multinucleated , nonreplicating cell layer , the syncytiotrophoblast , a replicating layer of cytotrophoblasts that fuses with the stb , a basal lamina , and an underlying villous stroma or connective tissue , that includes vascular endothelium .
the placental barrier must be crossed by the parasites , therefore the time that t. cruzi trypomastigotes stay in the intervillous space and interact with the syncytiotrophoblast is of outmost importance .
shippey et al . in a dual perfusion system of placental cotyledons observed t. cruzi dna in the maternal effluents at 30 min , 60 min , and 90 min after injection an only one bolus of t. cruzi trypomastigotes through the maternal perfusate .
there was no parasite dna in the fetal effluent , indicating there was no passage to fetal circulation despite the great concentration of parasites injected .
contrarily , in the ex vivo infection of chorionic villi explants , a reproducible infection is obtained after 24 hours of coincubation with the parasite . however , the perfusion experiments indicate that t. cruzi is present in the intervillous space at least for an hour and half . despite this long time of interaction ,
t. cruzi was not able to invade or survive in the placental barrier , indicating a defense mechanism of the placental barrier against the causal parasite of chagas .
placental infection : the ex vivo and in vitro infection of human chorionic villi explants from human term placenta with the parasite is an excellent and easy way to study the mechanism of cellular and tissue invasion mechanisms .
the explants can be kept in culture for several days , where constituent cells and tissues are in a more physiological condition than their isolated counterparts in monolayer cell culture models .
another advantage of this model is that the cells retain physical contact with the basal lamina and continue to receive paracrine growth factor signals from the underlying villous stroma . in our laboratories ,
we have established the optimal conditions for the ex vivo infection of chorionic villi explants with t. cruzi [ 17 , 18 , 20 , 21 , 3641 , 47 ] .
the coincubation of 10 or 10 trypomastigotes produces a reproducible infection of the chorionic villi .
this parasite 's concentration may seem to be extremely high , but if we consider the amount of blood that circulates through the placenta every day , and then calculate the number of parasites that reaches the placenta , the parasite concentration recommended for ex vivo infection is not high .
therefore , if we consider that the cardiac output in women is 4250 ml / min , and that during pregnancy the circulating blood volume increases in 20% and the cardiac output in 40% . then the cardiac output in pregnant women is 5950 ml / min . from this output ,
10% reaches the pregnant uterus and 80% of this volume reaches the placenta . taking into account all the data , a volume of 475 ml / minute of blood reaches the placenta . considering a parasitemia as low as 0,1 to 1 parasite / ml ,
a total of 68544 to 685440 parasites circulate through the placenta in 24 hours ( figure 2 ) . on the other hand , in pregnant women with acute chagas disease , torrico et al .
have reported parasitemias over 40 parasites / ml ; therefore , in this condition a total of 27 million parasites circulate in 24 hours in the placenta .
if we consider all these data , our experimental conditions are not far from in vivo conditions .
the trophoblast , the first tissue that is in contact with the parasite in the intervillous space , constitutes a potential barrier to t. cruzi .
we observed that the most notable tissue damage induced by t. cruzi in the chorionic villi explants is the trophoblast detachment and destruction .
additionally , the parasite induces selective disorganization of basal lamina , collagen i destruction , and apoptosis ( especially in the trophoblast ) in infected chorionic villi explants . in accordance
, we detected similar histopathological changes in placentas from women with chronic chagas disease ( manuscript in this number of j. of tropical medicine ) .
therefore , the similar histopathological changes observed in chagasic mothers and in ex vivo infected chorionic villi , validates the latter model . the extracellular matrix alteration produced by t. cruzi not only promotes its motility in tissues and its entrance into cells , but also alters the presence of cytokines and chemokines , which in turn permits t. cruzi to modulate and evade both the inflammatory and immune responses [ 16 , 50 , 51 ] .
alternatively , these changes in ecm function may be part of a local placental defense mechanism , which could explain why only very few parasites can be detected in the placenta .
similar effects can be observed in the chorionic villi explants during ex vivo infection , since placental explants do not allow a sustained infection by t. cruzi .
thus , the placenta controls the productive infection of t. cruzi in chorionic villous and exerts a protective function to fetus . in order to understand the mechanism by which t. cruzi fuses with trophoblast plasma membrane , caldern and fabro studied the interaction between syncytial plasma membranes from the human placenta and from the parasites , founding modifications of membrane lipids and proteins of the syncytiotrophoblast .
additionally , modifications of enzyme activities in the chorionic villi have been described [ 3739 ] .
for instance , placental alkaline phosphatase ( plap ) is a glycosylphosphatidylinositol anchored plasma membrane protein present in the trophoblast that decreases its activity in chagasic women and is related to congenital transmission . in ex vivo infected chorionic
villi , pretreatment of the placental tissue with phospholipase c prevents the parasite - induced decrease of plap activity and significantly reduces the infectivity of t. cruzi .
these results are consistent with a pathogenetic role for placental alkaline phosphatase in congenital chagas disease [ 36 , 54 ] .
additionally , t. cruzi induces in the ex vivo infection model an increase of lysosomal vesicles in the trophoblast , which are fundamental during cell invasion of the parasite [ 3639 ] . analyzing the process of trophoblast infection by t. cruzi in an in vitro system culturing
monolayer trophoblasts cells in interaction with infective trypomastigotes , it was shown that two types of chorionic villi trophoblasts , syncytiotrophoblast , and cytotrophoblast have a differential susceptibility to infection by the causal agent of congenital chagas disease .
the reduced infection in the syncytiotrophoblast was associated to fewer viable parasites in the culture medium and increased levels of nitric oxide .
these results emphasize the importance of the integrity of the first placental barrier , the syncytiotrophoblast , in order to avoid a t. cruzi infection of the inner trophoblasts or stromal chorionic villi cells .
as it was described above , structural trophoblast alteration is a common sign of miscarriages and premature births in placentas of chagasic women and strongly associated to the congenital transmission of t. cruzi . in these clinical situations ,
the detachment of the first placental barrier is a common sign which is also associated to parasitism of the placental tissue .
thus , differential infection between the first placental barrier with respect to the inner trophoblast or stromal cells could represent a mechanism of invasion of the human placenta by t. cruzi .
congenital chagas transmission constitutes an increasing public health problem , and it is responsible for the urbanization and spreading of the disease to nonendemic areas of latin america , united states of america , and europe [ 18 , 21 ] . the fact that the ex vivo infection of the chorionic villi explants with the parasite reproduces the in vivo infection in terms of cellular changes and infectivity makes it an excellent tool for studying parasite infection strategies as well as possible local antiparasitic mechanisms . | congenital chagas disease , a neglected tropical disease , endemic in latin america , is associated with premature labor and miscarriage . during vertical transmission
the parasite trypanosoma cruzi ( t. cruzi ) crosses the placental barrier .
however , the exact mechanism of the placental infection remains unclear .
we review the congenital transmission of t. cruzi , particularly the role of possible local placental factors that contribute to the vertical transmission of the parasite .
additionally , we analyze the different methods available for studying the congenital transmission of the parasite . in that context , the ex vivo infection with t. cruzi trypomastigotes of human placental chorionic villi constitutes an excellent tool for studying parasite infection strategies as well as possible local antiparasitic mechanisms . |
on september 22 , 2010 , a player ( patient 4 ) was hospitalized for a calf abscess that had spontaneously drained to the skin .
investigations identified 3 previous case - patients among the team members during the previous month ( figure ) .
a case - patient was defined as a player on the team who developed a skin abscess .
the abscesses began occurring after recruitment of a new player from fiji ( patient 1 ) , who had untreated axillary and back abscesses when he arrived on the team in july 2010 .
all other case - patients had contact with him during scrimmages , suggesting that cross - transmission occurred by close physical contact . in august 2010 ,
abscesses developed on the left wrist of patient 2 and on the arm of patient 3 ( figure ) .
timeline of infection and screening for pvl - positive staphylococcus aureus case - patients and carriers .
mssa , methicillin - susceptible s. aureus ; pvl , panton - valentin leukocidin ; + , positive . on september 28 , 2010 , we screened all team members for pvl - positive s. aureus carriage .
the team had 51 men , including 30 permanent team members ; mean age was 23.6 ( range 1742 ) years . screening consisted of nasal , throat , and skin - lesion swabbing .
dna microarray analysis was performed by the french national reference center for staphylococcal infections ( lyon , france ) and enabled detection of the meca gene and genes encoding various toxins and also assisted in agr typing and multilocus sequence typing .
the first round of screening showed that 35 ( 68.6% ) of the 51 team members were colonized with mssa , and 2 ( patient 1 and a player who never developed an abscess ) harbored pvl - encoding genes ( figure ) . during the screening process
, patient 1 was found to have a pvl - positive mssa left knee abscess that spontaneously drained to the skin but was not covered . to reduce risk of transmission
, we implemented a 5-day course of s. aureus decontamination for all team members ; decontamination consisted of mupirocin 2% nasal ointment twice daily and showering with chlorhexidine soap .
we also provided information about standard hygiene measures : showering and handwashing ; washing jerseys after play ; regularly cleaning and disinfecting showers and shared sports equipment ; avoiding sharing of personal items ; protecting and disinfecting skin lesions ; and treating abscesses early and appropriately .
team staff regularly checked players adherence to the control measures . despite these measures , 3 new skin abscesses developed in october 2010 on the chest and nape of patient 1 ( figure ;
isolates not available ) . in early november 2010 , abscesses developed on the axillary and thigh of patient 5 and on the right wrist ( sample not obtained ) of patient 6 . in january 2011 , a thigh abscess developed on patient 7 . on february 2 , 2011 , we conducted a second round of s. aureus carriage screening and a 10-day course of s. aureus decontamination for 8 players , focusing on previous pvl - positive mssa carriers and those with abscesses .
these infection control measures were successful : no further person - to - person transmission occurred .
overall , 8 ( 15.6% ) of the 51 players carried pvl - positive mssa ( n = 3 ) or had abscesses ( n = 7 ) ; 2 players had both .
all strains isolated in patients 17 belonged to clonal complex ( cc ) 121 and harbored agr4 allele .
one player who never had an abscess carried a different pvl - positive mssa strain in his throat ( agr1 , sequence type 152 ) .
all isolated pvl - positive mssa strains were susceptible to all antimicrobial drugs tested except penicillin g. except for the first 2 abscesses in patient 1 , all abscesses were treated with synergistin a and b ( 2 grams / day for 7 days ) and local disinfection . using a standardized questionnaire to interview the 51 rugby players , a member of the hygiene unit at the limoges teaching hospital collected epidemiologic data on demographics , sport practices , sport hygiene , and occurrence of hospitalization or abscess during the previous year .
the interviews highlighted poor hygiene practices : 49% of players shared personal items , and fewer than half disinfected or protected skin lesions ( table ) .
occurrence of abscess during the previous year was the only significant ( p = 0.00028 , fisher exact test ) risk factor found for a pvl - positive mssa carriage or abscess ; however , given the context of this abscess outbreak , this factor was considered a bias , not a general characteristic .
values are numbers except for body mass index , which is the mean for 51 players .
p values used fisher exact test except for body mass index , which used student t - test .
skin and soft - tissue infections are common in athletes , and the most common bacterial pathogen responsible for outbreaks is ca - mrsa , particularly the usa300 clone .
the strain in the outbreak we investigated was unrelated to usa300 but belonged to cc121 .
outbreaks of pvl - positive mssa skin infections have been described in families in italy ( 6 ) , schoolchildren in switzerland ( 7 ) , french soldiers in cte d'ivoire ( 8) , and prison inmates in france ( 9 ) . as in this outbreak among rugby players , infection control measures and s. aureus decontamination successfully interrupted transmission in most published outbreaks . in our study , abscess occurred in 4 players despite a round of decontamination strategies .
this failure was likely because of an uncovered , untreated knee abscess in the index case - patient ( patient 1 ) during the decontamination period .
nasal carriage of pvl - positive mssa was not systematically linked to infection ( e.g. , 1 team member carried a pvl - positive strain in his throat but had no active skin infection ) .
concordance of skin and soft - tissue infection and nasal carriage is reportedly lower in mssa than mrsa strains ( 10 ) .
following france s guidelines for grouped cases of community - associated s. aureus infections ( http://www.hcsp.fr/explore.cgi/avisrapportsdomaine?clefr=453 ) , we decontaminated all athletes , even those team members not carrying pvl - positive mssa .
decontamination temporarily reduces risk of colonization of noncarriers . along with reinforcement of simple personal hygiene measures ,
our decontamination regimen sufficiently halted transmission without needing to exclude players with abscesses from the team , an important factor in professional sports .
it belonged to a pvl - positive mssa lineage that predominated in france during 19811990 ( 11 ) .
the cc121 agr4 lineage was also linked to furunculosis in a study in poland ( 12 ) . like the strain in our study ,
however , the strain circulating among the rugby team players was positive for seg , sei , sem , sen , seo , and seu .
superficial , deep - skin , and soft - tissue infections linked to cc121 , pvl - positive mssa strains have been reported worldwide ( 13 ) .
similar strains have also been reported in highly lethal community - acquired pneumonia and in severe sepsis with progressive and metastatic soft - tissue infections ( 14,15 ) .
we investigated an outbreak of skin abscesses caused by a pvl - producing mssa strain and cross - transmitted through physical contact among players of a professional rugby team . a 10-day period of s. aureus decontamination combined with reinforcement of hygiene education and practices successfully interrupted person - to - person transmission and enabled control of the outbreak . | staphylococcus aureus strains that produce panton - valentine leukocidin are known to cause community infections .
we describe an outbreak of skin abscesses caused by panton - valentine leukocidin producing methicillin - susceptible s. aureus ( clonal complex 121 ) in a professional rugby team in france during july 2010february 2011 .
eight team members were carriers ; 7 had skin abscesses . |
the condition of the patient rapidly deteriorated and he died about 2 months after the first medical examination .
head and neck computed tomography showing swelling of multiple lymph nodes in the submandibular zone ( a ) .
[ color figure can be viewed at wileyonlinelibrary.com ] many large cells were found with mature lymphocytes by fna from the swelling lymph node ( figs .
these neoplastic cells had fine chromatin granules in touch smear cytology of the lymph node biopsy ( figs . 2c and d ) .
these atypical cells had a small nucleolus , and mitosis was observed ( figs . 2c and d ; yellow arrow ) .
several nuclear inclusion bodies were also confirmed ( figs . 2c and d ; light blue arrow ) .
however , the possibility of poorly differentiated carcinoma or malignant melanoma could not be completely ruled out . because we failed to prepare cellblock material from the cytology specimen for immunocytochemistry ,
cytological findings of the lymph node from fna ( a and b , papanicolaou staining ) .
cytological findings of imprint cytology ( c , papanicolaou staining ; d , giemsa staining ) .
these atypical cells have a small nucleolus , and mitosis is observed ( yellow arrow ) .
bar : 100 m ( a ) , 50 m ( b ) , 50 m ( c and d ) .
[ color figure can be viewed at wileyonlinelibrary.com ] the cut surface of the lymph node obtained by biopsy was solid and light grayish in color without necrosis or hemorrhage ( fig .
microscopically , large atypical cells were observed in the lymph node , similar to the results of cytodiagnosis ( fig .
the mitotic rate was high ( 58/10hpf ) and atypical mitotic forms were observed ( fig .
immunohistochemically , the tumor cells were positive for vimentin , cd68 , and cd163 and focally positive for s100 and cd1a ( figs . 3c
epithelial markers ( ae1/ae3 , ck7 , ck20 , and p40 ) , lymphocyte markers ( cd3 , cd20 , cd45 , and cd79a ) , and melanoma markers ( hmb45 and melana ) were negative ( data not shown ) . the possibility of a proliferative disease of histiocytes was considered from the positive results for cd68 , and the possibility of a malignant tumor was considered from the finding of extranodal invasion .
lcs was diagnosed by a high mitotic rate with an atypical form and positivity for cd1a and cd163 .
metastasis of lcs was confirmed by the autopsy in many organs including the heart , bilateral lungs , liver , pancreas , bilateral kidneys , left adrenal gland , spleen , bone marrow , and systemic lymph nodes .
tumor cells showing positive staining for vimentin ( c ) , cd68 ( d ) , s100 protein ( e ) , cd1a ( f ) , and cd163 ( g ) .
bar : 20 m ( b ) and 50 m ( c f ) .
[ color figure can be viewed at wileyonlinelibrary.com ] our case was a case of quintuple cancers .
the patient had two moderately differentiated adenocarcinomas ( sigmoid colon , 12 years ago , pt2
he also had tcell / histiocyterich large bcell lymphoma according to the who classification updated in 2008 ( 12 years ago , supporting information , figs .
the nasal skin tumor ( at the same time as the lcs , supporting information , figs . 1
no genetic mutations of kras and braf v600e were detected in these five tumor materials , including the lcs .
the condition of the patient rapidly deteriorated and he died about 2 months after the first medical examination .
head and neck computed tomography showing swelling of multiple lymph nodes in the submandibular zone ( a ) .
many large cells were found with mature lymphocytes by fna from the swelling lymph node ( figs .
these neoplastic cells had fine chromatin granules in touch smear cytology of the lymph node biopsy ( figs . 2c and d ) .
these atypical cells had a small nucleolus , and mitosis was observed ( figs . 2c and d ; yellow arrow ) .
however , the possibility of poorly differentiated carcinoma or malignant melanoma could not be completely ruled out . because we failed to prepare cellblock material from the cytology specimen for immunocytochemistry ,
cytological findings of the lymph node from fna ( a and b , papanicolaou staining ) .
cytological findings of imprint cytology ( c , papanicolaou staining ; d , giemsa staining ) .
these atypical cells have a small nucleolus , and mitosis is observed ( yellow arrow ) .
bar : 100 m ( a ) , 50 m ( b ) , 50 m ( c and d ) .
the cut surface of the lymph node obtained by biopsy was solid and light grayish in color without necrosis or hemorrhage ( fig .
microscopically , large atypical cells were observed in the lymph node , similar to the results of cytodiagnosis ( fig .
the mitotic rate was high ( 58/10hpf ) and atypical mitotic forms were observed ( fig .
immunohistochemically , the tumor cells were positive for vimentin , cd68 , and cd163 and focally positive for s100 and cd1a ( figs .
epithelial markers ( ae1/ae3 , ck7 , ck20 , and p40 ) , lymphocyte markers ( cd3 , cd20 , cd45 , and cd79a ) , and melanoma markers ( hmb45 and melana ) were negative ( data not shown ) . the possibility of a proliferative disease of histiocytes was considered from the positive results for cd68 , and the possibility of a malignant tumor was considered from the finding of extranodal invasion .
lcs was diagnosed by a high mitotic rate with an atypical form and positivity for cd1a and cd163 .
metastasis of lcs was confirmed by the autopsy in many organs including the heart , bilateral lungs , liver , pancreas , bilateral kidneys , left adrenal gland , spleen , bone marrow , and systemic lymph nodes .
tumor cells showing positive staining for vimentin ( c ) , cd68 ( d ) , s100 protein ( e ) , cd1a ( f ) , and cd163 ( g ) .
bar : 20 m ( b ) and 50 m ( c f ) .
the patient had two moderately differentiated adenocarcinomas ( sigmoid colon , 12 years ago , pt2 pn0 m0 stage i , supporting information , fig .
he also had tcell / histiocyterich large bcell lymphoma according to the who classification updated in 2008 ( 12 years ago , supporting information , figs . 1c
he underwent chemotherapy and achieved cr again . the nasal skin tumor ( at the same time as the lcs , supporting information , figs .
no genetic mutations of kras and braf v600e were detected in these five tumor materials , including the lcs .
as described above , atypical tumor cells were observed in cytology , suggesting that the tumor was a histiocytic neoplasm .
although a diagnosis of lcs only by these cytological findings is difficult,4 immunocytochemistry using cell block materials may be useful for an accurate preoperative diagnosis . in cases with the abovedescribed cytological findings
if cellblock materials had been prepared in this case , they might have been useful for diagnosis .
in addition , cytology can be very useful for staging of the disease and followup of the neoplasm .
the cytological findings described in this report may be useful for determining appropriate clinical management in the future .
quintuple cancers are rare.5 , 6 , 7 , 8 , 9 , 10 , 11 our case had 3 epithelial cancers and 2 tumors of the hematopoietic and lymphoid tissues .
it has been reported that kras gene mutation was found in colon adenocarcinoma12 and that braf gene mutation was found in both lcs and colon adenocarcinoma.4 , 12 however , kras and braf gene mutations were not detected in our case .
there have been several reports on lcs arising from other tumors of hematopoietic and lymphoid tissues.13 , 14 , 15 , 16 however , there has been no report on lcs related to tcell / histiocyterich large bcell lymphoma . some novel genetic mutations that can give rise to multiple neoplasms might have been hidden in his background .
| langerhans cell sarcoma ( lcs ) and quintuple cancers are extremely rare . in this report ,
a case of quintuple cancers including lcs was described .
an 80yearold man had squamous cell carcinoma of the nasal skin , colon and rectum adenocarcinomas , and tcell / histiocyterich large bcell lymphoma .
as swelling of multiple submental lymph nodes was observed , fineneedle aspiration was carried out .
many large cells with highgrade nuclear atypia and abundant cytoplasm were observed .
lymphocytes and eosinophils were observed in the background .
although a malignant tumor was suspected , a definite diagnosis could not be made . in a biopsy sample ,
the tumor cells were positive for vimentin , cd68 , s100 , cd1a , and cd163 and negative for epithelial , lymphocyte , and melanoma markers in immunohistochemistry .
a diagnosis of lcs was made from the immunohistochemical findings and high mitotic rate with atypical forms .
the patient died about 2 months after the first medical examination .
metastasis of lcs was confirmed in many organs by autopsy .
lcs has a poor prognosis . in cases with the abovedescribed cytological findings
, lcs should be added to the list of differential diagnosis .
the cytological findings presented here may be useful for determining appropriate clinical management such as staging of the disease and followup of the neoplasm .
diagn . cytopathol
. 2017;45:441445 .
2017 the authors diagnostic cytopathology published by wiley periodicals , inc . |
sinusitis is reported to be one of the most widespread diseases in the united states and europe1 , 2 , 3 and is one of the most common reasons for patients to see a doctor or receive an antibiotic.1 , 4 , 5 although the disease may be less serious than other common diseases such as asthma or peptic ulcer disease , the cost of sinusitis care including associated emergency room ( er ) visits , medical specialist referrals , and work days missed exceeds the costs for both of those conditions.3
for such a common and costly condition , we lack valid epidemiologic data .
methodological differences , imprecise terminology , and diagnostic inaccuracy all contribute to the data confusion .
for example , provider diagnoses indicate that outpatient visits for chronic sinusitis ( cs ) substantially exceed those for acute sinusitis ( as ) , with a visit prevalence of 1.5% for cs and 0.3% for as.6 however , considering that as typically develops following a viral uri a condition that afflicts tens of millions of americans annually
the selfreported patient prevalence of sinusitis is even less credible : 12% to 16% of patients report sinusitis each year ( as and cs combined).3
two recent studies highlight the inaccuracy of cs diagnosed by nonspecialty providers . by extension
hsu et al . used administrative data from a large academic institution to identify patients diagnosed with cs and performed a detailed review of the medical record to validate these diagnoses.7 they found that most cases of cs are never substantiated with imaging or endoscopy , and they ultimately concluded that cs diagnoses are unreliable unless they are confirmed by otolaryngologists or allergists .
similarly began with administrative data from a large academic institution to identify patients diagnosed with cs by primary care and emergency medicine providers.8 the conducted a detailed review of the patients ' clinical presentation at the time of diagnosis , including patients ' signs , symptoms , endoscopic findings , and any computed tomography ( ct ) scan results .
they found that most all diagnoses of cs made by primary care and emergency medicine providers are not substantiated by history at the time of diagnosis and that most cs diagnoses are never confirmed by specialty consultation , endoscopy , or imaging .
given our lack of confidence in the validity of existing epidemiologic data , we designed a crosssectional pilot study to compare the visit prevalence of sinusitis diagnosed by primary care and emergency medicine providers between two cohorts : patients diagnosed at a representative academic institution and patients diagnosed in community medicine practices and private institutions . in order to make the study design comparable to prior reports,6 , 9 , 10 , 11 , 12 , 13 we utilize national ambulatory medical care survey ( namcs ) , which is limited to ambulatory care clinics , and the national hospital ambulatory medical care survey ( nhamcs ) , which is mostly comprised of emergency department ( ed ) visits.14 , 15
we sought to improve the validity of the visit prevalence rates by using physiciancoded rather than patient selfreported diagnoses.3 we also sought to improve the specificity of the prevalence rates by analyzing cs and as separately .
we hypothesized that the relative proportions of as and cs at our institution would be similar to national estimates .
finally , as a control measure to validate our methods , we also chose to evaluate the prevalence of a very objective diagnosis : epistaxis .
this study thus provides novel insights into the prevalence of sinusitis diagnoses made by primary care and emergency medicine provider at academic institutions , private institutions , and community medicine practices .
for calculation of institutional visit prevalence , we identified adult ( age 18 years ) patients using the university of michigan health system ( umhs ) robust clinical research and health information exchange .
the exchange contains demographic information ; inpatient and outpatient visits ; officebased , radiology , and surgical procedures ; and professional feebilling information .
we compiled a census of all adult patients with one or more visits to either a primary care clinic or emergency medicine department between january 1 , 2005 , and december 31 , 2010 , and then calculated the total number of visits for sinusitis .
primary care clinics included family medicine , general practice , internal medicine , general pediatrics , and internal medicine pediatrics clinics .
we then identified the subset of patients seen for sinusitis using international classification of diseases , 9th revision ( icd9 ) codes ( icd9 461.x for as , 473.x for cs ; both within first three diagnosis codes for each visit ) .
we collected demographic information ( e.g. , age , gender , and race ) for all patients . to validate our methodology
, we carried out the same process for epistaxis ( icd9 784.7 ) , a less subjective diagnosis .
for calculation of a national visit prevalence estimate , we used namcs and nhamcs to identify adult ( age 18 years ) visits between january 1 , 2005 , and december 31 , 2010 , to nonfederal employed officebased physicians and to eds and outpatient departments of nontertiary care general and shortstay hospitals , respectively.14 , 15
because namcs and nhamcs are visitbased data sources , we identified sinusitis visits based on primary , secondary , or tertiary diagnoses of as or cs using icd9 codes ( icd9 461.x , 473.x ) .
namcs uses a threestage and nhamcs uses a fourstage probability sampling of nonfederal officebased and hospitalbased physicians , which is conducted annually by the u.s . national center for health statistics .
sample data collected includes visitlevel information on demographic characteristics , comorbidities , up to three diagnoses ( one primary and two secondary diagnoses ) , procedures performed , radiographic studies ordered , and types of providers seen . for example , physician specialty codes allow for the identification of primary care physicians ( general or family medicine , internal medicine , and pediatrics ) in order to differentiate from medical specialists .
patient visit weights are provided by the national center for health statistics.16 application of these weights in a multistage estimation procedure produces unbiased national estimates .
we also compared the visit prevalence of epistaxis between our institution 's patient population and the national patient population .
we chose to use patients with epistaxis as a control group because the diagnosis of epistaxis is less subjective than sinusitis and we had no a priori reason to think the rate of epistaxis would be different between the two study groups .
this study was approved by the institutional review board at the university of michigan , ann arbor , michigan .
annual descriptive statistics regarding demographic and clinical characteristics within the institution and nationally were calculated .
the prevalence of sinusitis or epistaxis was defined as a ratio of the number of visits with a diagnosis of each disease by icd9 code to the total number of visits identified in that calendar year .
we calculated prevalence separately for both as and cs based on icd9 codes listed above .
visit weights provided by the national center for health statistics were applied , and we followed recommendations that estimates with a relative standard error > 30% , or estimates based on sample sizes of less than 30 observations , are considered unreliable .
statistical analyses were performed using stata se 12 ( statacorp , college station , tx ) statistical software .
for calculation of institutional visit prevalence , we identified adult ( age 18 years ) patients using the university of michigan health system ( umhs ) robust clinical research and health information exchange .
the exchange contains demographic information ; inpatient and outpatient visits ; officebased , radiology , and surgical procedures ; and professional feebilling information .
we compiled a census of all adult patients with one or more visits to either a primary care clinic or emergency medicine department between january 1 , 2005 , and december 31 , 2010 , and then calculated the total number of visits for sinusitis .
primary care clinics included family medicine , general practice , internal medicine , general pediatrics , and internal medicine pediatrics clinics .
we then identified the subset of patients seen for sinusitis using international classification of diseases , 9th revision ( icd9 ) codes ( icd9 461.x for as , 473.x for cs ; both within first three diagnosis codes for each visit ) .
we collected demographic information ( e.g. , age , gender , and race ) for all patients . to validate our methodology
, we carried out the same process for epistaxis ( icd9 784.7 ) , a less subjective diagnosis .
for calculation of a national visit prevalence estimate , we used namcs and nhamcs to identify adult ( age 18 years ) visits between january 1 , 2005 , and december 31 , 2010 , to nonfederal employed officebased physicians and to eds and outpatient departments of nontertiary care general and shortstay hospitals , respectively.14 , 15
because namcs and nhamcs are visitbased data sources , we identified sinusitis visits based on primary , secondary , or tertiary diagnoses of as or cs using icd9 codes ( icd9 461.x , 473.x ) .
namcs uses a threestage and nhamcs uses a fourstage probability sampling of nonfederal officebased and hospitalbased physicians , which is conducted annually by the u.s . national center for health statistics .
sample data collected includes visitlevel information on demographic characteristics , comorbidities , up to three diagnoses ( one primary and two secondary diagnoses ) , procedures performed , radiographic studies ordered , and types of providers seen . for example , physician specialty codes allow for the identification of primary care physicians ( general or family medicine , internal medicine , and pediatrics ) in order to differentiate from medical specialists .
patient visit weights are provided by the national center for health statistics.16 application of these weights in a multistage estimation procedure produces unbiased national estimates .
we also compared the visit prevalence of epistaxis between our institution 's patient population and the national patient population .
we chose to use patients with epistaxis as a control group because the diagnosis of epistaxis is less subjective than sinusitis and we had no a priori reason to think the rate of epistaxis would be different between the two study groups .
this study was approved by the institutional review board at the university of michigan , ann arbor , michigan .
annual descriptive statistics regarding demographic and clinical characteristics within the institution and nationally were calculated .
the prevalence of sinusitis or epistaxis was defined as a ratio of the number of visits with a diagnosis of each disease by icd9 code to the total number of visits identified in that calendar year .
we calculated prevalence separately for both as and cs based on icd9 codes listed above .
visit weights provided by the national center for health statistics were applied , and we followed recommendations that estimates with a relative standard error > 30% , or estimates based on sample sizes of less than 30 observations , are considered unreliable .
statistical analyses were performed using stata se 12 ( statacorp , college station , tx ) statistical software .
during the 6year study period of 2005 to 2010 , our institution had an annual average of 79,806 adult patients with at least one visit per year ( range 76,474 to 81,776 ) in primary care offices or hospital eds .
there was an average of 3.8 visits per patient per year ( range 1 to 42 ) . during the corresponding period ,
namcs and nhamcs had an average of 962 million ambulatory care visits per year ( range 892 million to 1.03 billion ) ; patientlevel statistics are unavailable in this dataset .
demographic analysis revealed a younger patient population at our institution ( mean 46.1 years , standard deviation 0.06 ) versus nationally ( mean 52.0 years , standard error 0.5 ) and comparable gender and race distributions ( table 1 ) .
the distribution between primary care and er visits in each data set was also calculated . at our institution ,
primary care visits accounted for 76.0% of visits for sinusitis , whereas ed visits accounted for 24.0% . for namcs and nhamcs ,
82.2% of visits for sinusitis were to primary care providers , and 17.8% were to an ed .
university of michigan health system patientbased institutional cohort , reflecting entire patient population with no sampling error .
namcs and nhamcs visitbased national cohort , reflecting sample of national visits with population weights applied .
namcs = national ambulatory medical care survey ; nhamcs = national hospital ambulatory medical care survey ; sd = standard deviation ; se = standard error ; umhs = university of michigan health system .
the prevalence of epistaxis , our control diagnosis , as a percentage of all patient visits was similar between the two datasets , with a range of 0.1% to 0.2% at our institution and a consistent 0.1% nationally ( p = 0.980.99 ) ( table 2 ) .
in contrast , the visit prevalence of sinusitis was substantially lower at our institution ( 0.7%1.0% ) compared to national data ( 3.1%3.7% ) ( p <
there were very small differences in prevalence of as between the two settings , with a difference of only 0.1% to 0.5% ( p
in contrast , there were large differences in prevalence of cs between the two settings , with a difference of 1.6% to 2.8% ( p <
we explored regional variations in cs prevalence as a possible explanation for the reduced prevalence of cs at the umhs .
we found the lower prevalence is not due to reduced prevalence of cs in the midwest , which would be reflected by the midwest cs prevalence in the namcs / nhamcs ( table 5 ) .
proportion of adult ambulatory care visits for epistaxis comparing the umhsa with namcs / nhamcs national cohort.b
university of michigan health system patientbased institutional cohort , reflecting entire patient population with no sampling error .
namcs and nhamcs visitbased national cohort , reflecting sample of national visits with population weights applied .
namcs = national ambulatory medical care survey ; nhamcs = national hospital ambulatory medical care survey ; sd = standard deviation ; se = standard error ; umhs = university of michigan health system .
proportion of adult ambulatory care visits for sinusitis comparing the umhsa with namcs / nhamcs national cohort.b
university of michigan health system patientbased institutional cohort , reflecting entire patient population with no sampling error .
namcs and nhamcs visitbased national cohort , reflecting sample of national visits with population weights applied .
namcs = national ambulatory medical care survey ; nhamcs = national hospital ambulatory medical care survey ; sd = standard deviation ; se = standard error ; umhs = university of michigan health system .
proportion of adult ambulatory care visits for acute and chronic sinusitis comparing the umhsa with namcs / nhamcs national cohort.b
university of michigan health system patientbased institutional cohort , reflecting entire patient population with no sampling error .
namcs and the nhamcs visitbased national cohort , reflecting sample of national visits with population weights applied .
ci = confidence interval ; namcs = national ambulatory medical care survey ; nhamcs = national hospital ambulatory medical care survey ; sd = standard deviation ; se = standard error ; umhs = university of michigan health system .
proportion of adult ambulatory care visits for chronic sinusitis comparing the umhsa with four regions within namcs / nhamcs national cohort.b
university of michigan health system patientbased institutional cohort , reflecting entire patient population with no sampling error national ambulatory medical care survey and the national hospital ambulatory medical care survey visitbased national cohort , reflecting sample of national visits with population weights applied namcs = national ambulatory medical care survey ; nhamcs = national hospital ambulatory medical care survey ; sd = standard deviation ; se = standard error ; umhs = university of michigan health system .
in this study , we find our academic institution has a nearly 10fold lower prevalence of cs , as diagnosed by primary care and er providers compared to national estimates for the same geographic region .
this large discrepancy was not found with the other conditions that we investigated as and epistaxis for which we found very similar prevalence estimates .
the regional difference in cs across regions is too modest to account for the full magnitude of this discrepancy.10 the magnitude of the discrepancy in cs prevalence leads us to question the validity of national estimates of cs prevalence and burden of disease .
chronic sinusitis is a difficult diagnosis with complex diagnostic criteria , and the condition must be differentiated from multiple other conditions with similar symptoms .
otolaryngologists are experts in cs ; however , national estimates of cs prevalence and burden of disease are not based on expert diagnoses but on nonexpert diagnoses , often primary care and emergency medicine providers.6 , 10 , 11 , 17 these findings reflect the nature of the datasets that are used to study this problem .
namcs and nhamcs are the most comprehensive datasets to study ambulatory care in the u.s .
these surveys include a proportional sample of patient visits to all provider types , and statistical analysis allows one to make estimates about ambulatory care for the entire u.s . population .
however , because there are fewer specialists than primary care providers , there are fewer patient visits to specialists in the datasets .
accurate statistical analysis using this data relies on having sufficient number of patient visits in the dataset in order to make reliable estimates about the entire u.s .
population . when there are relatively few patient visits to a particular provider type for a particular diagnosis , the types of research questions that can be answered is limited by statistical imprecision .
we speculate that widely cited estimates of cs prevalence based on estimates from namcs and nhamcs are badly flawed by inaccurate diagnoses .
this idea is supported by a recent longitudinal study of cs diagnoses , also using administrative data in community healthcare practices.18 the authors explored cs diagnoses and found that most diagnoses were never confirmed by endoscopy or ct .
they further explored these diagnoses ( both confirmed and unconfirmed cases ) and found that , prior to a diagnosis of cs , many patients have visits for upper respiratory illness.18 the authors interpreted this association as evidence of the unified airway hypothesis .
an alternative interpretation is that this association between frequent upper respiratory illness and diagnosis of cs reflects imprecise diagnosis of cs .
providers may be assigning the diagnosis of cs to patients with recurrent or persistent uri symptoms without regard to cs diagnostic criteria .
it is not clear why the prevalence of cs is so much lower at our academic institution compared to national data .
it is possible that diagnoses of cs made within an academic institution are more accurate than diagnoses made in the community .
in contrast , the diagnoses within our institution are made by a comparatively small cohort .
physicians at academic centers may have more exposure to institutionally sponsored education that shapes their practice patterns .
for example , our institution had an active effort prior to this study period to promote distinction between viral and bacterial sinusitis and judicious use of antibiotics .
this institutional effort may have increased the diagnostic rigor , shaping diagnostic patterns locally in a way that the national sample of physicians included in namcs and nhamcs would not be affected . regional variation in cs prevalence
regional differences in cs visit prevalence have been reported namcs and nhamcs.6 , 10 data from those publications agree with the data we report in this study : the midwestern and southern regions have a higher prevalence of cs diagnoses than the northeastern and western regions .
this consistently higher visit prevalence for cs in the midwest would not explain the lower prevalence we found at our midwestern academic institution .
validation of cs diagnoses is a critically important factor that confounds sinusitis clinical research . although validation of diagnoses was beyond the scope of this pilot study , it was the focus of a recent study at our institution in which we attempted to validate new diagnoses of cs by primary care and emergency medicine providers.8 in that study , we compared each patient 's clinical characteristics to diagnostic criteria.5 we found that of all the patients given a new diagnosis of cs by a primary care or emergency medicine provider , less than 1% of them met clinical diagnostic criteria.8 considering symptom duration alone , less than 10% of patients had symptoms 12 weeks .
very few patients were referred for endoscopy or had imaging ; of the few patients with imaging , many studies were normal or near normal .
interestingly , we also found that in most patients with a coded diagnosis of cs , the provider 's clinical impression did not indicate cs , and the treatment plan was not consistent with cs .
we concluded that nonotolaryngologists use the diagnostic code for cs without regard for the american academy of otolaryngology head and neck surgery 2015 definition of cs .
we do not suggest that data from a single institution is indicative of the national disease prevalence .
we acknowledge that , at our institution , the diagnostic accuracy of cs is very poor . however , the findings of this study as well as the study previously by novis8indicate that , at an institution where the rate of cs diagnosis is far lower than national norms , most patients still do not meet diagnostic criteria . taken together
, they suggest the prevalence of cs may be significantly lower than national estimates from administrative data indicate .
however , without better quality data , the true prevalence remains unknown . to our knowledge ,
the most rigorous study conducted to estimate cs prevalence across a population was a korean survey utilizing patient history and nasal endoscopy .
this study demonstrated a 1% population prevalence of sinusitis.19 although the population prevalence can not be directly compared to visit prevalence among patients seeking treatment , this study illustrates a rigorous methodological approach to address the question .
the prevalence of cs in the united states is highly relevant to diagnostic and treatment recommendations .
for example , a prior study suggested that for cs in the primary care setting , upfront ct is more costeffective than empiric medical therapy .
based on what appears to be an extremely low pretest probability , we suggest instead that perhaps neither empiric medical therapy for cs nor upfront ct is appropriate for the majority of patients diagnosed with cs in this setting . it is critical that we understand these differences before we translate cs care from academic rhinology centers to the broader population of patients diagnosed with cs .
further study of sinusitis in the community setting , as well as the education of primary care and emergency medicine providers , is needed before we encourage wide adaptation of intensive or expensive diagnostic or treatment protocols .
first , the crosssectional design of the namcs and nhamcs datasets makes it impossible to determine if a visit for cs represents the initial diagnosis or a previously established diagnosis . to mitigate this limitation
, we also used a crosssectional design when we created the academic dataset and did not differentiate between visits for the initial versus previously establish diagnosis of cs .
second , it is also worth noting that we were unable to validate the accuracy of the diagnoses .
epistaxis is a straightforward diagnosis presumably without substantial diagnostic variability , which is why we selected this as our control group .
our finding that epistaxis rates were the same between the two datasets affirms that our analytic methods are valid .
in contrast , sinusitis is a less straightforward diagnosis and presumably subject to greater diagnostic and coding variability , and a prior study demonstrated that administrative data are unreliable for identifying cases of cs.7 however , one of the important strengths of this study is the parallel study design .
this is the first study to examine the prevalence of as and cs diagnosed by nonotolaryngologists at an academic institution .
the prevalence of cs diagnosed by primary care and emergency medicine providers is much lower at our academic institution compared to national data , but the prevalence estimates of as and epistaxis are similar to national data .
this finding suggests that across the country , where community healthcare settings outnumber academic institutions , cs is overdiagnosed .
chronic sinusitis that is diagnosed outside of an academic institution or a specialty clinic may not hold up under diagnostic scrutiny in a specialty clinic .
for this reason , diagnostic and treatment protocols for cs that have been developed in academic specialty clinics should not be extrapolated to patients diagnosed with cs in the community setting .
education of primary care and emergency medicine providers and patients about conditions that may be misdiagnosed as cs may be the most appropriate treatment for the majority of patients diagnosed with cs in primary care and emergency medicine . | objectiveto compare the prevalence of acute sinusitis ( as ) and chronic sinusitis ( cs ) diagnosed by primary care and emergency medicine physicians in our academic institution to national data.study designcrosssectional pilot study of institutional census data and a populationbased national sample .
the setting was primary care and emergency departments at an academic healthcare institution and community healthcare practices nationally.materials and methodswe determined the proportion of adults visits at our institution for as and cs from january 1 , 2005 , to december 31 , 2010 .
we used the same parameters with the national ambulatory medical care survey and the national hospital ambulatory medical care survey . as a control comparison
, we determined the proportion of visits for epistaxis.resultsthe sinusitis prevalence was considerably lower at our academic institution : all sinusitis ( as and cs combined ) ranged from 0.8% to 1.0% at our institution compared to 3.1% to 3.7% nationally .
there were very small differences between as rates at the academic institution ( 0.7%0.8% ) and nationally ( 0.8%1.4% , p < 0.001 ) but very large differences between cs rates at the academic institution ( 0.1% ) and national data ( 1.7%2.9% , p < 0.001 ) .
epistaxis rates were nearly identical in both datasets ( 0.1%0.2% , p = 0.980.99).conclusionthe prevalence of cs is much lower at our academic institution , but the prevalence of as and epistaxis are similar to national data .
this suggests cs is overdiagnosed by primary care and emergency medicine providers and that cs diagnosed outside of an academic institution or a specialty clinic may not hold up to diagnostic scrutiny .
for this reason , diagnostic and treatment protocols for cs that have been developed in academic specialty clinics should not be extrapolated to patients diagnosed with cs in the community setting .
the most appropriate intervention for the majority of patients diagnosed with cs in primary care and emergency medicine may be education of providers and patients about conditions that may be misdiagnosed as cs . |
data were collected from members of kaiser permanente medical care plan , northern california region ( kpnc ) .
kpnc is an integrated health service delivery system with a membership of 3.2 million that comprises about 2530% of the population of a 22-county service area and is the largest health care provider in northern california .
membership is largely representative of the general population in the service area ; however , persons in impoverished neighborhoods are underrepresented .
eligible kpnc cases were defined as individuals with a diagnosis of ms by a neurologist ( icd-9 code 340.xx ) , age 1869 years , and membership in kpnc at initial contact .
the study was restricted to self - identified white ( non - hispanic ) race / ethnicity , the population with the highest prevalence of ms .
the treating neurologist was contacted for approval to contact each case as a potential ms study participant .
a total of 3,293 potential ms cases were reviewed by kpnc neurologists , who approved contact with 2,823 ( 86% ) at the time of the data freeze ( august 2014 ) .
diagnoses were validated using electronic health record ( ehr ) review and according to published diagnostic criteria .
multiple sclerosis severity scores ( msss ) were calculated for each case at the time of study entry ( mean disease duration = 17.7 years ) , as described , and participants were asked to recall the age of first ms symptom onset which was validated using ehr data when possible .
controls were white ( non - hispanic ) current kpnc members without a diagnosis of ms or related condition ( optic neuritis , transverse myelitis , or demyelinating disease ; icd-9 codes : 340 , 341.0 , 341.1 , 341.2 , 341.20 , 341.21 , 341.22 , 341.8 , 341.9 , 377.3 , 377.30 , 377.39 , and 328.82 ) confirmed through ehr data .
additional controls were individuals of the genetic epidemiology research on adult health and aging ( gera ) cohort participating in the kpnc research program on genes , environment , and health , which is described elsewhere ( dbgap phs000674.v2.p2 ) .
approximately 103,000 samples were successfully genotyped , and 77% of participants subsequently returned new consent forms for placement in dbgap ( nih ) , resulting in a final sample size of 78,486 participants .
from these participants , we selected a subset of 12,605 self - reported non - hispanic white individuals matched to ms cases for sex and age ( 2 years ) at a 10:1 ratio .
data were collected from 2 population - based case - control studies on incident ms patients ( the epidemiological investigation of multiple sclerosis [ eims ] study ) and prevalent ms patients ( the genes and environment in multiple sclerosis [ gems ] study ) . in the eims study , the inclusion criteria were age 1670 years , recently ( within 2 years ) diagnosed ms according to the mcdonald criteria , and ability to understand swedish .
for the gems study , the participants were identified from the swedish national ms registry and recruited during 20092011 . in both studies , controls ( without ms ) were randomly chosen from the population register and matched to the patients with ms by sex , age at inclusion in the study , and region of residence ( 2 controls per case in eims and 1 control per case in gems ) .
data on msss were retrieved from the swedish national ms registry for all participants , in both eims and gems studies as per september 2014 ( mean disease duration = 20.1 years ) .
the participation rate was 92% for cases and 67% for controls in eims , and 82% for cases and 66% for controls in gems .
study protocols for kpnc participants were approved by the institutional review boards of kpnc and the university of california , berkeley .
ethical approval for both eims and gems was obtained from the regional ethical review board in stockholm at karolinska institutet , and participants provided written informed consent .
kpnc participants completed a computer - assisted telephone interview comprised questions related to various events and exposures , as described elsewhere .
gera controls were mailed a survey consisting of questions related to health behaviors , sociodemographic information , and diagnoses ( dbgap phs000674.v2.p2 ) .
medium resolution hla - drb1 and genome - wide snp genotyping were performed as previously described using illumina infinium 660k and human omni express beadchip arrays for kpnc cases and controls , and axiom ( affymetrix ) custom chips for the additional gera controls .
< 90% , or not in hardy - weinberg equilibrium ( hwe ) among controls ( p < 0.000001 ) were removed from analysis .
imputation against reference haplotypes from phase i of the 1000 genomes project was conducted using shapeit and impute2 . to ensure high - quality imputation results , only snps with info score
> 0.8 on all 3 genotyping platforms and with maf in controls with sd < 0.03 across all 3 platforms were retained for analysis .
cross - platform association tests were conducted to remove snps associated with the genotype array ( fdr q < 0.05 ) .
two mds components were used to adjust for population stratification due to genetic ancestry differences between cases and controls in the association analysis .
the exposure assessment was done through an extensive questionnaire that covered demographic and environmental factors ; details are described elsewhere .
participants were asked to provide blood samples , which were genotyped on an illumina custom array ( ms replication chip ) .
hla - drb1 information was imputed with a modified version of hla*imp:02 with 400 swedish controls added to the reference panel for mhc class ii genes .
snps with < 2% maf , success rate < 98% , or not in hwe among controls ( p <
individuals with > 2% failed genotype calls , with increased heterozygosity ( > mean + 2sd ) , related individuals , or whose recorded sex differed from genotype were removed from analysis .
we removed population outliers identified using the smartpca program with standard settings using 3,736 ancestry informative markers .
two principal component analysis vectors , those with p < 0.05 , were used to adjust for population stratification in the association analysis , similar to kpnc comparisons described above .
a 25(oh)d iv was constructed for each individual using the coefficients for 3 published genetic variants associated at genome - wide significance with higher serum 25(oh)d : rs2282679-a , in an intron of gc ; rs2060793-a , upstream of cyp2r1 ; and rs3829251-g , in an intron of nadsyn1 and upstream of dhcr7 .
the iv was calculated by multiplying the number of alleles that correspond to an increase in 25(oh)d for each locus by the coefficient from the genome - wide association study ( gwas ) for that variant and then taking the sum across the 3 loci ( table 1 ) . for kpnc , either the genotyped alleles or imputed allele probabilities were used to calculate the iv . for eims / gems , genotyped alleles were used to calculate the iv , and missing genotypes ( 2 for rs2282679 and 243 for rs3822951 ) were replaced with 2 times the maf .
in addition , rs10741657 , which is in perfect linkage disequilibrium ( ld ) with rs2060793 ( r = 1 in 1,000 genomes phase i european population ) , was used in the iv calculation for eims / gems , as the latter snp was not genotyped . a weighted genetic risk score ( wgrs ) for 110 non - hla ms susceptibility loci identified through the most recent ms gwas was calculated for each individual .
the wgrs was calculated by multiplying the number of risk alleles for each locus by the logarithm of the odds ratio ( or ) for that variant , then taking the sum across the 110 loci .
one snp was missing for kpnc ( rs201202118 ) , and 2 snps were missing for eims / gems ( rs2028597 and rs6874308 ) .
characteristics of snps used to construct the 25(oh)d instrumental variable after quality control and removal of population outliers , 1,655 individuals from kpnc ( 1,056 cases and 599 controls ) with genetic data were available as well as an additional 8,416 controls from the gera study , for a total of 1,056 cases and 9,015 controls . data for 6,335 cases and 5,762 controls were available from the swedish studies ( eims and gems ) . demographic differences between cases and controls were compared using and independent sample t tests where appropriate .
linear regression was used to test the assumption that the iv is not associated with confounding factors .
mr analysis , in this case a separate - sample iv analysis , was performed by regressing ms case status on the 25(oh)d iv in logistic models , and regressing msss and age at onset on the 25(oh)d iv in linear regression models .
all analyses were controlled for sex , year of birth , ever smoking , college education , hla - drb1 * 15:01 carrier status , wgrs of non - hla ms risk variants , and genetic ancestry ( as derived from the first 2 components from mds for kpnc or smartpca for sweden ) .
swedish analyses were additionally controlled for region of residency and study type ( eims vs gems ) .
matching variables were included as covariates because the final study populations included all participants with genotyping data available , and a matched analysis was not performed .
all analyses were conducted using plink , stata ( statacorp , college station , tx ) , sas ( sas institute , cary , nc ) , or r.
data were collected from members of kaiser permanente medical care plan , northern california region ( kpnc ) .
kpnc is an integrated health service delivery system with a membership of 3.2 million that comprises about 2530% of the population of a 22-county service area and is the largest health care provider in northern california .
membership is largely representative of the general population in the service area ; however , persons in impoverished neighborhoods are underrepresented .
eligible kpnc cases were defined as individuals with a diagnosis of ms by a neurologist ( icd-9 code 340.xx ) , age 1869 years , and membership in kpnc at initial contact .
the study was restricted to self - identified white ( non - hispanic ) race / ethnicity , the population with the highest prevalence of ms .
the treating neurologist was contacted for approval to contact each case as a potential ms study participant .
a total of 3,293 potential ms cases were reviewed by kpnc neurologists , who approved contact with 2,823 ( 86% ) at the time of the data freeze ( august 2014 ) .
diagnoses were validated using electronic health record ( ehr ) review and according to published diagnostic criteria .
multiple sclerosis severity scores ( msss ) were calculated for each case at the time of study entry ( mean disease duration = 17.7 years ) , as described , and participants were asked to recall the age of first ms symptom onset which was validated using ehr data when possible .
controls were white ( non - hispanic ) current kpnc members without a diagnosis of ms or related condition ( optic neuritis , transverse myelitis , or demyelinating disease ; icd-9 codes : 340 , 341.0 , 341.1 , 341.2 , 341.20 , 341.21 , 341.22 , 341.8 , 341.9 , 377.3 , 377.30 , 377.39 , and 328.82 ) confirmed through ehr data .
additional controls were individuals of the genetic epidemiology research on adult health and aging ( gera ) cohort participating in the kpnc research program on genes , environment , and health , which is described elsewhere ( dbgap phs000674.v2.p2 ) .
approximately 103,000 samples were successfully genotyped , and 77% of participants subsequently returned new consent forms for placement in dbgap ( nih ) , resulting in a final sample size of 78,486 participants .
from these participants , we selected a subset of 12,605 self - reported non - hispanic white individuals matched to ms cases for sex and age ( 2 years ) at a 10:1 ratio .
data were collected from 2 population - based case - control studies on incident ms patients ( the epidemiological investigation of multiple sclerosis [ eims ] study ) and prevalent ms patients ( the genes and environment in multiple sclerosis [ gems ] study ) . in the eims study , the inclusion criteria were age 1670 years , recently ( within 2 years ) diagnosed ms according to the mcdonald criteria , and ability to understand swedish .
for the gems study , the participants were identified from the swedish national ms registry and recruited during 20092011 . in both studies , controls ( without ms ) were randomly chosen from the population register and matched to the patients with ms by sex , age at inclusion in the study , and region of residence ( 2 controls per case in eims and 1 control per case in gems ) .
data on msss were retrieved from the swedish national ms registry for all participants , in both eims and gems studies as per september 2014 ( mean disease duration = 20.1 years ) .
the participation rate was 92% for cases and 67% for controls in eims , and 82% for cases and 66% for controls in gems .
study protocols for kpnc participants were approved by the institutional review boards of kpnc and the university of california , berkeley .
ethical approval for both eims and gems was obtained from the regional ethical review board in stockholm at karolinska institutet , and participants provided written informed consent .
kpnc participants completed a computer - assisted telephone interview comprised questions related to various events and exposures , as described elsewhere .
gera controls were mailed a survey consisting of questions related to health behaviors , sociodemographic information , and diagnoses ( dbgap phs000674.v2.p2 ) .
medium resolution hla - drb1 and genome - wide snp genotyping were performed as previously described using illumina infinium 660k and human omni express beadchip arrays for kpnc cases and controls , and axiom ( affymetrix ) custom chips for the additional gera controls .
snps with a minor allele frequency ( maf ) < 1% , success rate < 90% , or not in hardy - weinberg equilibrium ( hwe ) among controls ( p < 0.000001 ) were removed from analysis .
imputation against reference haplotypes from phase i of the 1000 genomes project was conducted using shapeit and impute2 . to ensure high - quality imputation results , only snps with info score
> 0.8 on all 3 genotyping platforms and with maf in controls with sd < 0.03 across all 3 platforms were retained for analysis .
cross - platform association tests were conducted to remove snps associated with the genotype array ( fdr q < 0.05 ) .
two mds components were used to adjust for population stratification due to genetic ancestry differences between cases and controls in the association analysis .
the exposure assessment was done through an extensive questionnaire that covered demographic and environmental factors ; details are described elsewhere .
participants were asked to provide blood samples , which were genotyped on an illumina custom array ( ms replication chip ) .
hla - drb1 information was imputed with a modified version of hla*imp:02 with 400 swedish controls added to the reference panel for mhc class ii genes .
snps with < 2% maf , success rate < 98% , or not in hwe among controls ( p < 0.0001 ) were removed from analysis .
individuals with > 2% failed genotype calls , with increased heterozygosity ( > mean + 2sd ) , related individuals , or whose recorded sex differed from genotype were removed from analysis .
we removed population outliers identified using the smartpca program with standard settings using 3,736 ancestry informative markers .
two principal component analysis vectors , those with p < 0.05 , were used to adjust for population stratification in the association analysis , similar to kpnc comparisons described above .
a 25(oh)d iv was constructed for each individual using the coefficients for 3 published genetic variants associated at genome - wide significance with higher serum 25(oh)d : rs2282679-a , in an intron of gc ; rs2060793-a , upstream of cyp2r1 ; and rs3829251-g , in an intron of nadsyn1 and upstream of dhcr7 .
the iv was calculated by multiplying the number of alleles that correspond to an increase in 25(oh)d for each locus by the coefficient from the genome - wide association study ( gwas ) for that variant and then taking the sum across the 3 loci ( table 1 ) . for kpnc , either the genotyped alleles or imputed allele probabilities were used to calculate the iv . for eims / gems , genotyped alleles were used to calculate the iv , and missing genotypes ( 2 for rs2282679 and 243 for rs3822951 ) were replaced with 2 times the maf .
in addition , rs10741657 , which is in perfect linkage disequilibrium ( ld ) with rs2060793 ( r = 1 in 1,000 genomes phase i european population ) , was used in the iv calculation for eims / gems , as the latter snp was not genotyped .
a weighted genetic risk score ( wgrs ) for 110 non - hla ms susceptibility loci identified through the most recent ms gwas was calculated for each individual .
the wgrs was calculated by multiplying the number of risk alleles for each locus by the logarithm of the odds ratio ( or ) for that variant , then taking the sum across the 110 loci .
one snp was missing for kpnc ( rs201202118 ) , and 2 snps were missing for eims / gems ( rs2028597 and rs6874308 ) .
characteristics of snps used to construct the 25(oh)d instrumental variable after quality control and removal of population outliers , 1,655 individuals from kpnc ( 1,056 cases and 599 controls ) with genetic data were available as well as an additional 8,416 controls from the gera study , for a total of 1,056 cases and 9,015 controls .
data for 6,335 cases and 5,762 controls were available from the swedish studies ( eims and gems ) .
demographic differences between cases and controls were compared using and independent sample t tests where appropriate .
linear regression was used to test the assumption that the iv is not associated with confounding factors . mr analysis , in this case a separate - sample iv analysis ,
was performed by regressing ms case status on the 25(oh)d iv in logistic models , and regressing msss and age at onset on the 25(oh)d iv in linear regression models .
all analyses were controlled for sex , year of birth , ever smoking , college education , hla - drb1 * 15:01 carrier status , wgrs of non - hla ms risk variants , and genetic ancestry ( as derived from the first 2 components from mds for kpnc or smartpca for sweden ) .
swedish analyses were additionally controlled for region of residency and study type ( eims vs gems ) .
matching variables were included as covariates because the final study populations included all participants with genotyping data available , and a matched analysis was not performed .
all analyses were conducted using plink , stata ( statacorp , college station , tx ) , sas ( sas institute , cary , nc ) , or r.
demographic and disease characteristics of ms cases and controls are found in table 2 for both kpnc and sweden studies .
there were significant differences between cases and controls with respect to smoking , college graduation , obesity at age 1820 years or in 20s , and hla - drb1 * 15:01 status for both kpnc and eims / gems , as expected , and for age and sex in eims / gems .
the 25(oh)d iv was lower among cases than that in controls in kpnc ( 1.026 vs 1.045 , respectively ; p = 0.049 ) and in eims / gems ( 1.044 vs 1.056 , respectively ; p = 0.043 ) . in both kpnc and eims / gems ,
the iv was not associated with year of birth , sex , smoking , college education , obesity at age 1820 years or in 20s , hla - drb1 * 15:01 status , or the wgrs of 110 non - hla ms risk variants , or with study type in the swedish population . in eims / gems ,
population characteristics for the kpnc and eims / gems study participants the 25(oh)d iv was associated with ms susceptibility after controlling for sex , year of birth , ancestry , smoking , wgrs of 110 non - hla ms risk variants , and number of hla - drb1 * 15:01 alleles , as well as study type and region of residency in the swedish study .
an increasing iv score corresponding to increasing 25(oh)d levels was protective against ms ( or 0.79 , 95% ci : 0.640.99 ; p = 0.04 ) in the kpnc study .
an association was also found for the swedish study ( or 0.86 , 95% ci : 0.760.98 ; p = 0.03 ) .
adjustment did not alter the findings substantially ; however , for both kpnc and eims / gems data sets , p values and ors were both lower in the full models compared with those in the unadjusted models ( data not shown ) .
expanded models are shown for kpnc ( table e-1 at neurology.org/ng ) and eims / gems ( table e-2 ) .
both studies were combined into a meta - analysis : the association remained ( or 0.85 , 95% ci : 0.760.94 ; p = 0.003 ) .
no evidence of heterogeneity between populations was observed ( i = 0.0% , heterogeneity
p = 0.51 ) .
the 25(oh)d iv was not associated with msss or age at onset in either study ( data not shown ) .
results of mendelian randomization analysis for causal effect of vitamin d in kpnc and eims / gems and the combined meta - analysis result to test the mr model assumptions for the 25(oh)d iv , we conducted overidentification tests to evaluate the null hypothesis that effect estimates from multiple ivs are identical .
estimates suggested the same direction of causal effect , with ors ranging from 0.92 to 0.94 in kpnc and 0.84 to 0.99 in eims / gems ( table 4 ) .
to test the mr model assumptions for the 25(oh)d iv , we conducted overidentification tests to evaluate the null hypothesis that effect estimates from multiple ivs are identical .
estimates suggested the same direction of causal effect , with ors ranging from 0.92 to 0.94 in kpnc and 0.84 to 0.99 in eims / gems ( table 4 ) .
this study , using data from 2 different populations , provides strong evidence that low 25(oh)d is causally associated with ms susceptibility .
numerous observational studies have shown an association between low serum 25(oh)d level and increased risk of ms , and some have provided evidence supporting a causal association . in a study that examined patients with clinically isolated syndrome , a first event suggestive of ms , low 25(oh)d levels early in the disease course predicted higher ms activity .
two prospective , nested case - control studies , which collected serum prior to ms onset , showed a significantly reduced risk of ms in those with high 25(oh)d .
results from the current study rule out the most plausible alternative ( noncausal ) interpretations of these observational studies , thus strengthening evidence of a causal link between 25(oh)d and ms , even after accounting for other risk factors and potential confounders .
molecular studies also suggest that low serum 25(oh)d may be a causal risk factor for ms .
studies examining the location of vitamin d receptor binding sites ( also known as vitamin d response elements or vdres ) in the genome have shown that ms - associated loci are substantially enriched for vdres , including in the promoter region of hla - drb1 , and that vdres are more often exposed in open chromatin regions in immune cells compared with nonimmune cells .
these findings reinforce the plausibility that vitamin d regulates genes that play important roles in the development or progression of ms .
furthermore , increased exposure to vitamin d leads to changes in immune cells that lead to decreased production of inflammatory cytokines , a decrease in th1 and th17 cell differentiation , and an increase in t regulatory cells , suggesting that low vitamin d is acting on ms by shifting the balance of the immune system toward a more proinflammatory state .
the results of this study are in agreement with another recent mr study that used summary - level data only from the international multiple sclerosis genetics consortium and showed a causal effect for low 25(oh)d on ms risk .
there is some data overlap between previous and current studies ; specifically , 2,812 eims / gems participants included here were also in the summary data analysis .
however , because individual - level data were not available for the prior study , the authors were unable to control for established genetic and environmental risk factors associated with ms .
importantly , the current study shows that measured variables did not contribute substantially to confounding of the causal relationship between low 25(oh)d and ms risk .
furthermore , the previous analysis relied on stronger assumptions compared with a traditional mr analysis as presented in the current study .
finally , a cyp24a1 snp described in the previous report was not included in our analysis , as it did not demonstrate association with 25(oh)d at genome - wide significance , which was among the criteria for snps to be included in our iv for mr analysis .
it is possible that the association between a new iv that included the cyp24a1 snp and risk of ms might show a stronger magnitude of effect .
the number of snps that capture variation in serum 25(oh)d levels is likely to grow as gwas become larger .
an mr study relies on the following assumptions regarding the validity of the iv : ( 1 ) the genotype ( iv ) is associated with the phenotype ( 25(oh)d levels ) , ( 2 ) it is independent of measured or unmeasured confounders , and ( 3 ) it can only influence the outcome via the causal effect of the exposure . we were able to meet most model assumptions by using a 25(oh)d iv established to be strongly associated with serum 25(oh)d in an independent population through a large gwas and testing whether the 25(oh)d iv is independent of measured confounders
however , associations with unmeasured or unknown confounders can not be ruled out , leaving one assumption not fully testable .
common reasons for violations of mr assumptions are population stratification , ld ( between the loci under study and other polymorphisms associated with the outcome ) , pleiotropy , and developmental canalization .
the potential for population stratification has been handled rigorously in the data analysis stage , and it is unlikely that it has caused confounding in our study . we have evaluated possible loci that might be associated with the 25(oh)d snps and with ms and have not found any basis for ld being the explanation for our findings .
pleiotropy concerns the possibility of polymorphisms having different biological effects that may influence the outcome through other pathways than the one studied . to our knowledge
, the snps do not have other biological effects than in vitamin d metabolism , with the exception of rs3892951 , upstream of dhcr7 , which plays a role in cholesterol synthesis .
cholesterol metabolism has been associated with ms , although the exact mechanisms are not yet understood ; a role for pleiotropy can not be excluded . on the other hand ,
the snps are near genes that have a clear , biologically plausible role in determining 25(oh)d levels .
gc codes for the vitamin d binding protein , which transports vitamin d to target tissues ; cyp2r1 converts vitamin d to its main circulating form , 25(oh)d ; and dhcr7 converts 7-dehydrocholesterol , the compound that is converted to vitamin d3 in the skin in the presence of uv radiation , to cholesterol .
in addition , a 2012 study evaluated snps in these 3 genes to look for evidence of pleiotropic effects and found that there were no associations with several biomarkers . a study of 1,500 danish ms patients found that snps in gc and cyp2r1 have significant effects on 25(oh)d levels , further indicating that variants in those 2 genes are affecting ms via serum vitamin d. canalization refers to the buffering of the effects of genetic variants against changing 25(oh)d levels ;
if this effect is present , the association between the iv and ms risk would be biased toward the null .
our study included non - hispanic whites , which limits the generalizability of our findings .
this limitation is particularly relevant in light of recent findings indicating that 25(oh)d levels may not be associated with ms in hispanic populations .
we assume that the 3 alleles associated with 25(oh)d levels in the previous gwas on europeans are also associated with 25(oh)d levels in our populations .
however , we were able to test this assumption in a subset of 2,077 eims participants for whom serum samples were collected at the time of inclusion in the study : a linear regression model adjusted for the same confounders as the main analyses showed that the iv was associated with 25(oh)d levels ( p < 0.0001 ) among ms cases and healthy controls .
other limitations include the assumption of linearity and the assumption that the 3 alleles used to construct the iv have additive effects on 25(oh)d levels .
furthermore , our analysis of severity was restricted to a cross - sectional measure , the msss , and models could not account for the use of disease - modifying therapies .
additional studies should aim to replicate findings , specifically in populations of other races / ethnicities , and better examine how specific 25(oh)d - related variants might influence ms susceptibility and progressive disease .
the strengths of this mr study are that results are very unlikely to be due to reverse causation or confounded by unmeasured variables , that we were able to adjust for genetic ancestry , which could feasibly still confound the relationship between 25(oh)d snps and ms , and that similar results were found in 2 independent populations from 2 areas with different sunlight exposure levels .
our study included non - hispanic whites , which limits the generalizability of our findings .
this limitation is particularly relevant in light of recent findings indicating that 25(oh)d levels may not be associated with ms in hispanic populations .
we assume that the 3 alleles associated with 25(oh)d levels in the previous gwas on europeans are also associated with 25(oh)d levels in our populations .
however , we were able to test this assumption in a subset of 2,077 eims participants for whom serum samples were collected at the time of inclusion in the study : a linear regression model adjusted for the same confounders as the main analyses showed that the iv was associated with 25(oh)d levels ( p < 0.0001 ) among ms cases and healthy controls .
other limitations include the assumption of linearity and the assumption that the 3 alleles used to construct the iv have additive effects on 25(oh)d levels .
furthermore , our analysis of severity was restricted to a cross - sectional measure , the msss , and models could not account for the use of disease - modifying therapies .
additional studies should aim to replicate findings , specifically in populations of other races / ethnicities , and better examine how specific 25(oh)d - related variants might influence ms susceptibility and progressive disease .
the strengths of this mr study are that results are very unlikely to be due to reverse causation or confounded by unmeasured variables , that we were able to adjust for genetic ancestry , which could feasibly still confound the relationship between 25(oh)d snps and ms , and that similar results were found in 2 independent populations from 2 areas with different sunlight exposure levels .
milena gianfrancesco , amanda mok , and ingrid kockum : interpretation of data and revision of manuscript .
ling shen , catherine schaefer , jenny link , alexandra gyllenberg , tomas olsson , and jan hillert : acquisition of data and revision of manuscript .
lars alfredsson and lisa f. barcellos : acquisition of data , revision of manuscript , and study supervision .
development of the kaiser permanente research program on genes , environment , and health was supported by grants from the wayne and gladys valley foundation , the ellison medical foundation , the robert wood johnson foundation , and the kaiser permanente community benefit program .
genotyping of the gera cohort was supported by a grant ( rc2 ag036607 ; c.s . and neil risch , pis ) .
b. rhead is funded by nih training grant 5t32hg000047 and received support from the rheumatology research foundation in 2014 .
m. gianfrancesco has received research support from nih / national institute of neurological disorders and stroke .
c. schaefer has received research support from glaxosmithkline , niehs , nimh , niaid , nia , and the national multiple sclerosis society .
t. olsson has received lecture and/or advisory board honoraria and unrestricted ms research grant support from biogen , novartis , genzyme , sanofiaventis , medimmune , and merck - serono ; has received academic grant support from the swedish research council , the afa foundation , the knut and alice wallenberg foundation , and the swedish brain foundation ; and has received research support from merck , biogen , sanofiaventis , bayer , novartis , astrazeneca , euratrans neurinox , combims , the swedish brain foundation , and the afa foundation .
j. hillert has received honoraria for serving on advisory boards for biogenidec , novartis , and sanofi - genzyme ; has received travel funding / speaker honoraria from biogenidec , merck - serono , bayer - schering , teva , novartis , sanofi - genzyme , and sanofi - aventis ; has served on the editorial board of the journal of neuroimmunology ; has served as principle investigator for projects or received unrestricted research support from biogenidec , merck - serono , teva , sanofi - aventis , novartis , and bayer - schering ; and has received research support from the swedish research council , biogen , novartis , sanofi - genzyme , merck - serono , bayer - schering , the karolinska institutet , and the swedish brain foundation .
i. kockum has received speaker honoraria from merck - serono ; has held stock in several swedish companies , including novo nordisk ( none related to this study ) ; and has received research support from the
100rs fonden , the nhr foundation , karolinska university hospital , and the swedish childhood diabetes foundation .
glymour has served on the scientific advisory boards of the mrc centre for causal analyses in translational epidemiology and the society for epidemiologic research ; has received travel funding from institut de sant publique , d'epidmiologie et de developpement , universit victor segalen bordeaux ; has served on the editorial boards of epidemiology , plos one , the journal of causal inference , and the american journal of epidemiology ; has received publishing royalties from oxford university press ; is an employee of the university of california , san francisco ; and has received research support from nih / nia , nih / nimh , nia / harvard program on the global demography of aging pilot , nih / nichd , the office for minority health and health disparities ( nih ) , the milton fund for harvard university junior faculty , the american heart association , and the robert wood johnson foundation .
l. alfredsson receives research support from the swedish medical research council ( 521 - 2012 - 2917 ) , the swedish research council for health , working life and welfare ( 2012 - 0325 and 2015 - 00195 ) , afa insurance , and the swedish brain foundation ; and has received speaker honoraria from teva and biogen idec .
barcellos has received research support from nih / niehs , nih / national institute of neurological disorders and stroke , usepa , nih / nci , nih / niams , nih / niaid , the national multiple sclerosis society , the peder sather grant for collaborative research , and the robert wood johnson health and society program pilot grant . | objective : we sought to estimate the causal effect of low serum 25(oh)d on multiple sclerosis ( ms ) susceptibility that is not confounded by environmental or lifestyle factors or subject to reverse causality.methods:we conducted mendelian randomization ( mr ) analyses using an instrumental variable ( iv ) comprising 3 single nucleotide polymorphisms found to be associated with serum 25(oh)d levels at genome - wide significance .
we analyzed the effect of the iv on ms risk and both age at onset and disease severity in 2 separate populations using logistic regression models that controlled for sex , year of birth , smoking , education , genetic ancestry , body mass index at age 1820 years or in 20s , a weighted genetic risk score for 110 known ms - associated variants , and the presence of one or more hla - drb1 * 15:01 alleles.results:findings from mr analyses using the iv showed increasing levels of 25(oh)d are associated with a decreased risk of ms in both populations . in white , non - hispanic members of kaiser permanente northern california ( 1,056 ms cases and 9,015 controls ) , the odds ratio ( or ) was 0.79 ( p = 0.04 , 95% confidence interval ( ci ) : 0.640.99 ) . in members of a swedish population from the epidemiological investigation of multiple sclerosis and genes and environment in multiple sclerosis ms case - control studies ( 6,335 cases and 5,762 controls ) , the or was 0.86 ( p = 0.03 , 95% ci : 0.760.98 ) .
a meta - analysis of the 2 populations gave a combined or of 0.85 ( p = 0.003 , 95% ci : 0.760.94 ) .
no association was observed for age at onset or disease severity.conclusions:these results provide strong evidence that low serum 25(oh)d concentration is a cause of ms , independent of established risk factors . |
the key aspects of radioprotective agents are their practicality for use in specific scenarios of radiation exposure and the corresponding tactical and technical requirements for medical preparations . at the present time , amifostine , a radioprotector from the aminothiol family ,
is used in clinical practice as a radioprotectant and a chemoprotectant during the radio chemotherapy of patients with head and neck tumors , lung cancer and breast cancer , reducing the radiotoxicity and cytoxicity of therapies [ 13 ] . according to clinical data reported by trog et al .
( on reduction of the symptoms of postradiation mucositis during radiotherapy treatment of head and neck cancer patients ) , dose reduction factor ( drf ) for amifostine is equal to 1.37 .
the first clinical investigations of the radioprotective effect of radioprotector mexamine were reported by votkevich and palyga .
mexamine is used as a mitigator to reduce the chemotoxicity of chemotherapy [ 68 ] .
indralin ( b-190 ) is used as a radioprotective agent for the medical protection of personnel during emergency situations at nuclear power plants [ 9 , 10 ] . in 1951
chemical protection against the damaging effects of ionizing radiation via the administration of cystamine prior to lethal doses of radiation .
most of the known medications at the time of this discovery were screened for radioprotective properties [ 12 , 13 ] .
biogenic amines including epinephrine , norepinephrine , dopamine , serotonin , tryptamine , 5-methoxytryptamine ( mexamine ) , melatonin and histamine , i.e. essential components of the neurohumoral regulation of vital body functions , were also subjected to such testing . of the above - mentioned compounds , serotonin had the highest radioprotective effect , comparable with that of cystamine [ 1416 ] . later ,
the radioprotective effects were slight and did not exceed 1040% [ 1822 ] . in later studies , however , with high - dose - rate radiation exposure and reduction of the exposure time to a few minutes , these biogenic amines exhibited a pronounced radioprotective effect [ 23 , 24 ] . according to kulinskii
, the radioprotective effectiveness of epinephrine and norepinephrine is realized through their binding to 1-adrenergic receptors .
later , highly protective properties were observed in the 1-adrenergic agonists methoxamine , phenylephrine , naphazoline and indralin [ 2633 ] .
the radioprotective activity of biogenic amines is associated with a partial neutralization of the radiobiological
oxygen effect phenomenon : i.e. the fact that an increase in cellular oxygen tension permits more radiation damage to occur .
evidence for the hypoxic mechanism of the radioprotective effect of biogenic amines was first obtained by van der meer and van bekkum [ 23 , 34 ] , and confirmed by konstantinova and graevskii . a close relationship between the radioprotective efficacy of biogenic amines and
the local tissue hypoxia induced by their vasoactive actions has been established [ 3541 ] .
application of pharmacological antagonists eliminated the radioprotective effect of serotonin , histamine , epinephrine , norepinephrine , phenylephrine and indralin [ 25 , 32 , 35 , 43 , 44 ] .
the same effect was observed with animal radiation exposure in an atmosphere of increased oxygen pressure [ 32 , 4547 ] .
the therapeutic window for drugs , including radioprotectors , is their most important characteristic , and is closely associated with the selectivity and affinity of the drug in relation to the expressed cellular receptors responsible for its pharmacological action .
the therapeutic window for radioprotectors can be estimated from the therapeutic index ( ti ) , which is defined as the ratio of the drug ld50 ( lethal dose , 50% ) to the drug ed50 ( effective dose , 50% ) .
the ld50 and the ed50 is based on a probit analysis , typically using at least three drug doses that do not result in all - or - none mortality or drug effect .
the ed50/30 of a radioprotector is its average effective dose for 30-day survival when the animals are exposed to radiation ld90100/30 .
figure 1 and table 1 present comparative data for the dose response of the radioprotectors and the ti of the following biogenic amines : epinephrine , norepinephrine , tryptamine , serotonin and mexamine ; and the aminothiol cystamine , following intraperitoneal ( ip ) administration in mice . in small laboratory animals exposed to 9-gy -radiation at a high dose rate ( > 1 gy / min ) , epinephrine , norepinephrine , serotonin , mexamine and cystamine have been observed to have remarkable radioprotective properties [ 40 , 49 ] .
table 1.the therapeutic index for the radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected ip to mice 5 min before 9 gy ( ld90100 ) and > 1 gy / min -irradiation [ 41 , 49]compounded50/30 ( mg / kg)ld50/3 ( mg / kg)therapeutic indexepinephrine0.236.2827.3 ( 14.652.0)norepinephrine0.9029.232.4 ( 17.061.9)serotonin3.16435.3137.7 ( 91.8206.6)mexamine3.46186.453.9 ( 43.560.8)tryptamine90.4288.83.08 ( 1.984.79)cystamine87.5285.13.26 ( 2.823.7)data shown are therapeutic index with confidence limits for the interval 95%
fig
response radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected intraperitoneally to mice 5 min before 9 gy ( ld90100/30 ) and > 1 gy / min -irradiation [ 41 , 49 ] .
the therapeutic index for the radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected ip to mice 5 min before 9 gy ( ld90100 ) and > 1 gy / min -irradiation [ 41 , 49 ] data shown are therapeutic index with confidence limits for the interval 95% the dose response radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected intraperitoneally to mice 5 min before 9 gy ( ld90100/30 ) and > 1 gy / min -irradiation [ 41 , 49 ] .
the window of radioprotection defined by the ld50/ed50 for epinephrine ( 27.3 ) and norepinephrine ( 32.4 ) in mice was very similar ( table 1 ) .
the ti of serotonin was 137.7 , more than 23-fold higher than that of mexamine and the sympathomimetics ( table 1 ) . the significantly lower radioprotective effectiveness of tryptamine resulted in its low ti .
the tryptamine molecule differs from the serotonin molecule by the lack of a hydroxyl group in the fifth position of the indole ring , which predetermines a high binding affinity for the serotonin receptor .
therefore , there is a marked decrease in selectivity of the pharmacological and radioprotective action of tryptamine . as seen in fig .
the ti of aminothiols , such as cystamine , was 10-fold lower than that of the biogenic amines ( table 1 ) ; this was also noted in early research [ 5052 ] .
the largest ti for sulphur - containing radioprotectors is 912 ( for phosphorothioates ) [ 13 , 5355 ] , 10-fold lower than for serotonin .
this distinction is caused by the different mechanism of action in the sulphur - containing radioprotectors compared with the biogenic amines .
biogenic amines exert their effect via specific cell receptors that initiate an amplification cascade and produce a vasoconstrictive reaction , inducing acute hypoxia in radiosensitive tissues and thus increasing body radioresistance .
sulphur - containing radioprotectors produce their effect via immediate participation in the primary radiochemical and biochemical processes that develop in the cell during irradiation .
as is known , the damage to body tissues by radiation is induced by the development of free radical processes in cells , resulting in dna radical among other radical molecules .
aminothiols can take part in competitive radical oxidation / reduction reactions via oh scavenging and by
the mechanism of their radioprotective action is first of all to prevent interactions between dna radicals and oxygen ( which lead to dna strand breakage and chromosome aberrations ) .
the induction of increased cellular reducing equivalents [ 56 , 57 ] and the change in tertiary dna structure by aminothiols contributes significantly to this process . finally , a common feature of the radioprotective action of biogenic amines and aminothiols is the neutralization of the oxygen effect , although the mechanisms differ for these compounds .
biogenic amines exert their effect through the neurohormonal receptor system , but sulphur - containing radioprotectors act directly on tissues .
biogenic amine molecules have some anti - radical activity , but compared with aminothiols , their contribution to cell redox potential is limited due to the extremely low drug doses used for radioprotection ( fig .
response function in terms of drf : a linear relationship for sulphur - containing radioprotectors [ 49 , 5961 ] and a logarithmic relationship for biogenic amines .
this translates to the larger protective effect of low doses of biogenic amines , compared with sulphur - containing radioprotectors , increasing the therapeutic window of the former . in fig .
1 , the higher specificity of the radioprotective action of biogenic amines compared with cystamine is seen by the 100-fold lower requirement in concentration . this scheme explaining the radioprotective effect of biogenic amines and aminothiols rather oversimplifies the true situation [ 13 , 63 ] , but as noted above , the character of their dose response curves confirms the basic mechanisms of their modes of action . to compare the windows of radioprotection for radioprotectors in small and large animals ,
the following drugs were chosen : indralin ( 1-adrenomimetic ) , mexamine ( serotonin derivative ) and cystamine ( a sulphur - containing radioprotector ) .
this choice was based on the availability of published data from experiments with large animals ( dogs and monkeys ) .
figure 2 shows the dose response relationship of indralin in experiments with mice , rats , hamsters and dogs . as seen , optimal radioprotective doses of indralin for dogs are appreciably lower than those for small animals . table 2
a 530 mg / kg dose of indralin protects 90100% of dogs exposed to lethal doses of -radiation .
mexamine at doses that are effective in small animals is ineffective at similar doses in dogs under similar irradiation conditions .
table 2.the radioprotective effect of indralin and mexamine injected i m into dogs 5 min before -irradiation ( 47)groupsdose ( gy)dose rate ( gy / min)dose ( mg / kg)n60-day survival ( % ) mls , ( days)control3.82.32.81414.317.0indralin3.82.32.830.012100.0*10.01586.7 * 18.05.01190.9 * 20.0mexamine3.82.32.830.0714.317.210.07016.45.0520.017.3control4.00.10.112714.817.3indralin4.00.10.1130.01190.9
* 16.0mexamine4.00.10.1130.0812.517.6statistically significant ( p < 0.05 by two - tail fisher exact test ) difference between indralin and mexamine groups is indicated with an asterisk .
mls = mean of life span of deceased animals , n = number of animals .
response radioprotective effect of indralin in various species of animals exposed to ld90/3060 and > 1 gy / min -radiation
.
the radioprotective effect of indralin and mexamine injected i m into dogs 5 min before -irradiation ( 47 ) statistically significant ( p < 0.05 by two - tail fisher exact test ) difference between indralin and mexamine groups is indicated with an asterisk .
the dose response radioprotective effect of indralin in various species of animals exposed to ld90/3060 and > 1 gy / min -radiation .
this striking difference between indralin and mexamine provides evidence of the fact that the same decrease in blood flow in hematopoietic tissues ( owing to the vasoconstrictor effects of mexamine and indralin ) when used in experiments with dogs does not exert a highly radioprotective effect , and that indralin has another mechanism of action for its protective properties .
table 3 displays the windows of radioprotective action for indralin , mexamine and cystamine in various laboratory animals , including dogs .
there is a fundamental difference between indralin versus mexamine or cystamine in the ti value for smaller and larger animals .
indralin , an 1-adrenergic agent [ 32 , 44 ] , had a ti typical for epinephrine and norepinephrine ( tables 1 and 3 ) and this ti remained the same for both smaller and larger animals .
for example , the ti for indralin in mice , rats , hamsters , guinea pigs and dogs following an intramuscular ( i m ) injection of the drug was equal to 23.7 , 16.9 , 17.8 , 25.6 and 31.1 , respectively ( table 3 ) .
it is very important to have an expanded window of radiation protection for indralin when orally administered in large animals ( when sulphur - containing radioprotectors are weak or ineffective ) [ 54 , 65 ] .
ti for indralin given per os in dogs corresponds to 23.7 ( table 3 ) .
the large window of radioprotection for indralin is maintained for both dogs and non - human monkeys .
in contrast , the window of protection for cystamine was decreased in going from mice to rats and dogs , i.e. with increased size of animal .
the ti of cystamine following parenteral injection of the drug in mice , rats and dogs was 3.3 , 2.1 and 1.2 , respectively ( table 3 ) .
a similar picture was observed for amifostine , whose window of protection was reduced in terms of ti from 12 to 3 in going from mice to dogs [ 5355 , 6769 ] .
table 3.the window for the radioprotective effect of indralin , mexamine and cystamine administrated by various routes to small and large animals 5 min before ld90100/30 and > 1 gy / min -irradiation radioprotectorsanimal speciesadministrationned50/30 ( mg / kg)therapeutic indexindralinmiceip48017.4 ( 13.522.4)19.3 ( 14.025.1)im24021.9 ( 16.229.4)23.7 ( 15.336.5)po18014.8 ( 12.417.6)59.6 ( 41.485.9)ratsip21032.1 ( 25.838.5)8.4 ( 6.311.3)im31061.5 ( 39.296.6)16.9 ( 9.629.8)po11070.018.2hamstersim52250.7 ( 42.959.8)17.8 ( 14.824.1)po90124.4 ( 95.7161.8)8.9 ( 5.514.5)guinea pigsim3528.8 ( 17.049.0)25.6 ( 13.747.4)dogsim966.0 ( 4.38.3)31.1 ( 20.647.3)mexaminemicepo7823.2 ( 20.725.9)23.7ip3204.1 ( 3.05.5)53.9 ( 43.560.8)ratsip905.7 ( 4.37.6)23.6 ( 14.137.9)dogsim2030.0 < ed50nocystaminemiceip40087.5 ( 77.098.0)3.3 ( 2.83.7)ratsip10057.7 ( 45.173.9)2.1 ( 1.62.8)dogsiv3560.01.2data shown are the means and confidence limits for the means interval 95% .
the window for the radioprotective effect of indralin , mexamine and cystamine administrated by various routes to small and large animals 5 min before ld90100/30 and > 1 gy / min -irradiation data shown are the means and confidence limits for the means interval 95% .
the above fact may be explained by the more pronounced increase in aminothiol toxicity in going from mice to dogs compared with the change in the radioprotective effect of the doses .
it is known that the somatogenic stage of cystamine toxicity is much longer than the duration of its radiation protective effect , and this toxicity is prolonged by radiation exposure .
one might expect aggravation of the above situation in dogs as a result of the slower metabolism of aminothiols in irradiated animals .
the increase in the radioprotective effectiveness of cystamine with increasing drug dosage is limited by the maximum tolerated dose , which does not exceed the ed50 in dogs [ 66 , 74 ] .
the decrease in the toxicity of aminothiols by vitamins and other agents permits a possible increase in their radioprotective effect [ 13 , 7582 ] .
similar trends in reducing the window of protection were observed for mexamine , where ti decreased from 53.9 ( 43.560.8 ) for mice to 23.6 ( 14.137.9 ) for rats ( table 3 ) ; the radioprotective effect of mexamine did not exceed 50% in experiments with dogs .
in contrast to cystamine , a reduction in mexamine toxicity was observed following radiation exposure , a result of receptor desensitization under these conditions .
the decrease in the radioprotective effectiveness of mexamine is likely attributed to the weaker hypoxic response caused by this agent in larger animals .
this effect is associated with the initial cellular oxygen consumption rate . if there is sufficient time for the cell to adapt to the lack of oxygen supply by reducing oxygen consumption , acute low cellular oxygen tension is averted .
the reduced reactivity of dogs to acute hypoxia may be explained by the 25-fold lower initial oxygen consumption per unit body weight in large animals as compared with mice and rats .
the acute stress reaction to hypoxia caused by inhalation of a hypoxic gas mixture that contains 57% oxygen , reflected by an increase in the succinate dehydrogenase activity in lymphocytes , has been shown to be lower in dogs than in rats [ 64 , 85 ] .
in contrast to the effects seen in small animals , the acute hypoxic hypoxia noted above protects less than 50% of dogs [ 64 , 86 ] .
therefore , the decrease in blood flow in the dog 's spleen and bone marrow ( by up to 25% and 50% respectively ) induced by mexamine is not adequate for radioprotection .
the low radioprotective effectiveness of acute hypoxia and mexamine has previously been shown in experiments in dogs and monkeys [ 81 , 8791 ] .
the question arises about whether the radioprotective properties of indralin in experiments in dogs and monkeys [ 64 , 92 ] are high compared with those of mexamine , with the same reduction of blood flow in hematopoietic tissues .
we propose a hypothesis based on the scientific concept that metabolic activation in hypoxic tissues is initiated and sustained by the sympathetic nervous system , for which an adaptation
trophic role was discovered by orbeli ; and excessive adrenergic stimulation may sharply increase cellular oxygen consumption .
this can lead to acute ischemia in tissues in both small and large animals , with a concomitant increase in radioresistance if tissues lack an adequate oxygen supply .
the vasoconstrictive effect of sympathomimetic drugs is inevitably associated with increased tissue oxygen consumption , in contrast to serotonin [ 94101 ] .
an increase in adrenaline leads to an increase in succinate - dependent atp synthesis and ca2 + accumulation in mitochondria , which is due to the known activation of succinate oxidation and oxygen consumption [ 102105 ] .
indralin increases oxygen consumption in bone marrow cells in vitro by up to 50% when tissue oxygen tension is lower than 10 mol .
myeloid multipotent progenitors and pluripotent stem cells have 1-adrenergic receptors that realize a similar scenario .
the lack of blood flow in radiosensitive tissues caused by the vasoconstrictive effect of the 1-adrenergic agonist indralin , with its simultaneous stimulation of tissue respiration , may lead to more acute tissue hypoxia , which would be sufficient to explain the observed increase in tissue radioresistance .
the increase in cell radioresistance owing to acute low oxygen tension is a result of the considerable increase in cellular oxygen consumption previously discussed [ 64 , 109 ] . the radioprotective effect of uncouplers of oxidative phosphorylation confirms such a possibility [ 110112 ] .
it is necessary to examine the other pharmacological properties of adrenergic agents that could potentially mitigate radiation damage and possibly influence their radioprotective effects .
catecholaminergic neurotransmitters are known to be able to regulate the migration and repopulation of immature human cd34 + cells [ 113116 ] .
norepinephrine increases dna synthesis in bone marrow mesenchymal stem cells through 1-adrenergic receptors , which plays a significant part in early post - irradiation haematopoietic recovery .
this stimulatory effect is very likely accomplished via map kinase signaling cascades ( mek > erk ) as intracellular transducers of noradrenergic signals [ 119 , 120 ] .
besides , acute adrenergic stimulation inhibits the proliferation of haematopoietic progenitor cells via p38/mapk signalling , which could provide an opportunity for an extension of post - irradiation repair time and mitigation of radiation damage to myelopoiesis .
proinflammatory cytokine il-6 gene expression , induced by 1-adrenergic agents through involving p38 mapk and nf-b pathways [ 122 , 123 ] , could potentially contribute to early processes of post - irradiation hematopoietic recovery [ 124127 ] .
ros play a critical role in mediating the response to alpha1-adrenergic stimulation . the importance of these effects of adrenomimetics for their complete protective action may be observed if radioprotectors are applied after radiation exposure .
in such a situation , they fail to exert a protective effect as antagonists of the oxygen effect. radioprotectors , such as serotonin , adrenaline , cystamine and 2-aminoethylisothiuronium bromide hydrobromide ( aet ) are known to have a small radioprotective effect if applied within 10 min after irradiation [ 129132 ] . under conditions of liver shielding in rats ,
[ 133 , 134 ] has detected a protective effect from cysteamine applied after exposure to lethal doses of whole - body radiation in cases where the radioprotector alone was not sufficient .
the therapeutic effect of indralin saves up to 55% when it is applied to rats after whole - body irradiation with partial shielding of the upper quadrant of the abdomen .
it is clear that the therapeutic action of indralin and other radioprotectors noted above is essentially lower than its preventive protective effect .
thus , neutralization of the oxygen effect by these drugs is a key aspect of their radioprotective action .
it is important to note that pharmacological modulation of gene expression by radioprotector action ca n't of itself achieve significant chemical protection .
therefore , the favourable effects of indralin on early post - irradiation hematopoietic recovery do not in themselves constitute a high radioprotective action . in summary , indralin is likely to provide a high therapeutic index in large animals via the specificity of its adrenergic effect on tissue respiration , promoting the development of acute hypoxia in radiosensitive tissues ( aggravated by its vasoconstrictive effect ) , and also partly via the therapeutic potential of its influence on early post - irradiation hematopoietic recovery .
the therapeutic window for drugs , including radioprotectors , is their most important characteristic , and is closely associated with the selectivity and affinity of the drug in relation to the expressed cellular receptors responsible for its pharmacological action .
the therapeutic window for radioprotectors can be estimated from the therapeutic index ( ti ) , which is defined as the ratio of the drug ld50 ( lethal dose , 50% ) to the drug ed50 ( effective dose , 50% ) .
the ld50 and the ed50 is based on a probit analysis , typically using at least three drug doses that do not result in all - or - none mortality or drug effect .
the ed50/30 of a radioprotector is its average effective dose for 30-day survival when the animals are exposed to radiation ld90100/30 .
figure 1 and table 1 present comparative data for the dose response of the radioprotectors and the ti of the following biogenic amines : epinephrine , norepinephrine , tryptamine , serotonin and mexamine ; and the aminothiol cystamine , following intraperitoneal ( ip ) administration in mice . in small laboratory animals exposed to 9-gy -radiation at a high dose rate ( > 1 gy / min ) , epinephrine , norepinephrine , serotonin , mexamine and cystamine have been observed to have remarkable radioprotective properties [ 40 , 49 ] .
table 1.the therapeutic index for the radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected ip to mice 5 min before 9 gy ( ld90100 ) and > 1 gy / min -irradiation [ 41 , 49]compounded50/30 ( mg / kg)ld50/3 ( mg / kg)therapeutic indexepinephrine0.236.2827.3 ( 14.652.0)norepinephrine0.9029.232.4 ( 17.061.9)serotonin3.16435.3137.7 ( 91.8206.6)mexamine3.46186.453.9 ( 43.560.8)tryptamine90.4288.83.08 ( 1.984.79)cystamine87.5285.13.26 ( 2.823.7)data shown are therapeutic index with confidence limits for the interval 95%
fig
response radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected intraperitoneally to mice 5 min before 9 gy ( ld90100/30 ) and > 1 gy / min -irradiation [ 41 , 49 ] .
the therapeutic index for the radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected ip to mice 5 min before 9 gy ( ld90100 ) and > 1 gy / min -irradiation [ 41 , 49 ] data shown are therapeutic index with confidence limits for the interval 95% the dose response radioprotective effect of epinephrine , norepinephrine , serotonin , mexamine , tryptamine and cystamine injected intraperitoneally to mice 5 min before 9 gy ( ld90100/30 ) and > 1 gy / min -irradiation [ 41 , 49 ] .
the window of radioprotection defined by the ld50/ed50 for epinephrine ( 27.3 ) and norepinephrine ( 32.4 ) in mice was very similar ( table 1 ) .
the ti of serotonin was 137.7 , more than 23-fold higher than that of mexamine and the sympathomimetics ( table 1 ) . the significantly lower radioprotective effectiveness of tryptamine resulted in its low ti .
the tryptamine molecule differs from the serotonin molecule by the lack of a hydroxyl group in the fifth position of the indole ring , which predetermines a high binding affinity for the serotonin receptor .
therefore , there is a marked decrease in selectivity of the pharmacological and radioprotective action of tryptamine . as seen in fig .
the ti of aminothiols , such as cystamine , was 10-fold lower than that of the biogenic amines ( table 1 ) ; this was also noted in early research [ 5052 ] .
the largest ti for sulphur - containing radioprotectors is 912 ( for phosphorothioates ) [ 13 , 5355 ] , 10-fold lower than for serotonin .
this distinction is caused by the different mechanism of action in the sulphur - containing radioprotectors compared with the biogenic amines .
biogenic amines exert their effect via specific cell receptors that initiate an amplification cascade and produce a vasoconstrictive reaction , inducing acute hypoxia in radiosensitive tissues and thus increasing body radioresistance .
sulphur - containing radioprotectors produce their effect via immediate participation in the primary radiochemical and biochemical processes that develop in the cell during irradiation .
as is known , the damage to body tissues by radiation is induced by the development of free radical processes in cells , resulting in dna radical among other radical molecules .
aminothiols can take part in competitive radical oxidation / reduction reactions via oh scavenging and by
the mechanism of their radioprotective action is first of all to prevent interactions between dna radicals and oxygen ( which lead to dna strand breakage and chromosome aberrations ) .
the induction of increased cellular reducing equivalents [ 56 , 57 ] and the change in tertiary dna structure by aminothiols contributes significantly to this process . finally , a common feature of the radioprotective action of biogenic amines and aminothiols is the neutralization of the oxygen effect , although the mechanisms differ for these compounds .
biogenic amines exert their effect through the neurohormonal receptor system , but sulphur - containing radioprotectors act directly on tissues .
biogenic amine molecules have some anti - radical activity , but compared with aminothiols , their contribution to cell redox potential is limited due to the extremely low drug doses used for radioprotection ( fig .
response function in terms of drf : a linear relationship for sulphur - containing radioprotectors [ 49 , 5961 ] and a logarithmic relationship for biogenic amines .
this translates to the larger protective effect of low doses of biogenic amines , compared with sulphur - containing radioprotectors , increasing the therapeutic window of the former . in fig .
1 , the higher specificity of the radioprotective action of biogenic amines compared with cystamine is seen by the 100-fold lower requirement in concentration . this scheme explaining the radioprotective effect of biogenic amines and aminothiols rather oversimplifies the true situation [ 13 , 63 ] , but as noted above , the character of their dose response curves confirms the basic mechanisms of their modes of action .
to compare the windows of radioprotection for radioprotectors in small and large animals , the following drugs were chosen : indralin ( 1-adrenomimetic ) , mexamine ( serotonin derivative ) and cystamine ( a sulphur - containing radioprotector ) .
this choice was based on the availability of published data from experiments with large animals ( dogs and monkeys ) .
figure 2 shows the dose response relationship of indralin in experiments with mice , rats , hamsters and dogs .
as seen , optimal radioprotective doses of indralin for dogs are appreciably lower than those for small animals .
table 2 presents the comparative radioprotective efficacies of indralin and mexamine in experiments with dogs .
a 530 mg / kg dose of indralin protects 90100% of dogs exposed to lethal doses of -radiation .
mexamine at doses that are effective in small animals is ineffective at similar doses in dogs under similar irradiation conditions .
table 2.the radioprotective effect of indralin and mexamine injected i m into dogs 5 min before -irradiation ( 47)groupsdose ( gy)dose rate ( gy / min)dose ( mg / kg)n60-day survival ( % ) mls , ( days)control3.82.32.81414.317.0indralin3.82.32.830.012100.0*10.01586.7 * 18.05.01190.9 * 20.0mexamine3.82.32.830.0714.317.210.07016.45.0520.017.3control4.00.10.112714.817.3indralin4.00.10.1130.01190.9 * 16.0mexamine4.00.10.1130.0812.517.6statistically significant ( p < 0.05 by two - tail fisher exact test ) difference between indralin and mexamine groups is indicated with an asterisk .
mls = mean of life span of deceased animals , n = number of animals .
response radioprotective effect of indralin in various species of animals exposed to ld90/3060 and > 1 gy / min -radiation .
the radioprotective effect of indralin and mexamine injected i m into dogs 5 min before -irradiation ( 47 ) statistically significant ( p < 0.05 by two - tail fisher exact test ) difference between indralin and mexamine groups is indicated with an asterisk .
mls = mean of life span of deceased animals , n = number of animals .
response radioprotective effect of indralin in various species of animals exposed to ld90/3060 and > 1 gy / min -radiation .
this striking difference between indralin and mexamine provides evidence of the fact that the same decrease in blood flow in hematopoietic tissues ( owing to the vasoconstrictor effects of mexamine and indralin ) when used in experiments with dogs does not exert a highly radioprotective effect , and that indralin has another mechanism of action for its protective properties .
table 3 displays the windows of radioprotective action for indralin , mexamine and cystamine in various laboratory animals , including dogs .
there is a fundamental difference between indralin versus mexamine or cystamine in the ti value for smaller and larger animals .
indralin , an 1-adrenergic agent [ 32 , 44 ] , had a ti typical for epinephrine and norepinephrine ( tables 1 and 3 ) and this ti remained the same for both smaller and larger animals .
for example , the ti for indralin in mice , rats , hamsters , guinea pigs and dogs following an intramuscular ( i m ) injection of the drug was equal to 23.7 , 16.9 , 17.8 , 25.6 and 31.1 , respectively ( table 3 ) .
it is very important to have an expanded window of radiation protection for indralin when orally administered in large animals ( when sulphur - containing radioprotectors are weak or ineffective ) [ 54 , 65 ] .
ti for indralin given per os in dogs corresponds to 23.7 ( table 3 ) .
the large window of radioprotection for indralin is maintained for both dogs and non - human monkeys .
in contrast , the window of protection for cystamine was decreased in going from mice to rats and dogs , i.e. with increased size of animal .
the ti of cystamine following parenteral injection of the drug in mice , rats and dogs was 3.3 , 2.1 and 1.2 , respectively ( table 3 ) .
a similar picture was observed for amifostine , whose window of protection was reduced in terms of ti from 12 to 3 in going from mice to dogs [ 5355 , 6769 ] .
table 3.the window for the radioprotective effect of indralin , mexamine and cystamine administrated by various routes to small and large animals 5 min before ld90100/30 and > 1 gy / min -irradiation radioprotectorsanimal speciesadministrationned50/30 ( mg / kg)therapeutic indexindralinmiceip48017.4 ( 13.522.4)19.3 ( 14.025.1)im24021.9 ( 16.229.4)23.7 ( 15.336.5)po18014.8 ( 12.417.6)59.6 ( 41.485.9)ratsip21032.1 ( 25.838.5)8.4 ( 6.311.3)im31061.5 ( 39.296.6)16.9 ( 9.629.8)po11070.018.2hamstersim52250.7 ( 42.959.8)17.8 ( 14.824.1)po90124.4 ( 95.7161.8)8.9 ( 5.514.5)guinea pigsim3528.8 ( 17.049.0)25.6 ( 13.747.4)dogsim966.0 ( 4.38.3)31.1 ( 20.647.3)mexaminemicepo7823.2 ( 20.725.9)23.7ip3204.1 ( 3.05.5)53.9 ( 43.560.8)ratsip905.7 ( 4.37.6)23.6 ( 14.137.9)dogsim2030.0 < ed50nocystaminemiceip40087.5 ( 77.098.0)3.3 ( 2.83.7)ratsip10057.7 ( 45.173.9)2.1 ( 1.62.8)dogsiv3560.01.2data shown are the means and confidence limits for the means interval 95% .
the window for the radioprotective effect of indralin , mexamine and cystamine administrated by various routes to small and large animals 5 min before ld90100/30 and > 1 gy / min -irradiation data shown are the means and confidence limits for the means interval 95% .
the above fact may be explained by the more pronounced increase in aminothiol toxicity in going from mice to dogs compared with the change in the radioprotective effect of the doses .
it is known that the somatogenic stage of cystamine toxicity is much longer than the duration of its radiation protective effect , and this toxicity is prolonged by radiation exposure .
one might expect aggravation of the above situation in dogs as a result of the slower metabolism of aminothiols in irradiated animals .
the increase in the radioprotective effectiveness of cystamine with increasing drug dosage is limited by the maximum tolerated dose , which does not exceed the ed50 in dogs [ 66 , 74 ] .
the decrease in the toxicity of aminothiols by vitamins and other agents permits a possible increase in their radioprotective effect [ 13 , 7582 ] .
similar trends in reducing the window of protection were observed for mexamine , where ti decreased from 53.9 ( 43.560.8 ) for mice to 23.6 ( 14.137.9 ) for rats ( table 3 ) ; the radioprotective effect of mexamine did not exceed 50% in experiments with dogs .
in contrast to cystamine , a reduction in mexamine toxicity was observed following radiation exposure , a result of receptor desensitization under these conditions .
the decrease in the radioprotective effectiveness of mexamine is likely attributed to the weaker hypoxic response caused by this agent in larger animals .
if there is sufficient time for the cell to adapt to the lack of oxygen supply by reducing oxygen consumption , acute low cellular oxygen tension is averted .
the reduced reactivity of dogs to acute hypoxia may be explained by the 25-fold lower initial oxygen consumption per unit body weight in large animals as compared with mice and rats .
the acute stress reaction to hypoxia caused by inhalation of a hypoxic gas mixture that contains 57% oxygen , reflected by an increase in the succinate dehydrogenase activity in lymphocytes , has been shown to be lower in dogs than in rats [ 64 , 85 ] .
in contrast to the effects seen in small animals , the acute hypoxic hypoxia noted above protects less than 50% of dogs [ 64 , 86 ] .
therefore , the decrease in blood flow in the dog 's spleen and bone marrow ( by up to 25% and 50% respectively ) induced by mexamine is not adequate for radioprotection .
the low radioprotective effectiveness of acute hypoxia and mexamine has previously been shown in experiments in dogs and monkeys [ 81 , 8791 ] .
the question arises about whether the radioprotective properties of indralin in experiments in dogs and monkeys [ 64 , 92 ] are high compared with those of mexamine , with the same reduction of blood flow in hematopoietic tissues .
we propose a hypothesis based on the scientific concept that metabolic activation in hypoxic tissues is initiated and sustained by the sympathetic nervous system , for which an adaptation
trophic role was discovered by orbeli ; and excessive adrenergic stimulation may sharply increase cellular oxygen consumption .
this can lead to acute ischemia in tissues in both small and large animals , with a concomitant increase in radioresistance if tissues lack an adequate oxygen supply .
the vasoconstrictive effect of sympathomimetic drugs is inevitably associated with increased tissue oxygen consumption , in contrast to serotonin [ 94101 ] .
an increase in adrenaline leads to an increase in succinate - dependent atp synthesis and ca2 + accumulation in mitochondria , which is due to the known activation of succinate oxidation and oxygen consumption [ 102105 ] .
indralin increases oxygen consumption in bone marrow cells in vitro by up to 50% when tissue oxygen tension is lower than 10 mol .
myeloid multipotent progenitors and pluripotent stem cells have 1-adrenergic receptors that realize a similar scenario
. the lack of blood flow in radiosensitive tissues caused by the vasoconstrictive effect of the 1-adrenergic agonist indralin , with its simultaneous stimulation of tissue respiration , may lead to more acute tissue hypoxia , which would be sufficient to explain the observed increase in tissue radioresistance .
the increase in cell radioresistance owing to acute low oxygen tension is a result of the considerable increase in cellular oxygen consumption previously discussed [ 64 , 109 ] . the radioprotective effect of uncouplers of oxidative phosphorylation confirms such a possibility [ 110112 ] .
it is necessary to examine the other pharmacological properties of adrenergic agents that could potentially mitigate radiation damage and possibly influence their radioprotective effects .
catecholaminergic neurotransmitters are known to be able to regulate the migration and repopulation of immature human cd34 + cells [ 113116 ] .
norepinephrine increases dna synthesis in bone marrow mesenchymal stem cells through 1-adrenergic receptors , which plays a significant part in early post - irradiation haematopoietic recovery .
this stimulatory effect is very likely accomplished via map kinase signaling cascades ( mek > erk ) as intracellular transducers of noradrenergic signals [ 119 , 120 ] .
besides , acute adrenergic stimulation inhibits the proliferation of haematopoietic progenitor cells via p38/mapk signalling , which could provide an opportunity for an extension of post - irradiation repair time and mitigation of radiation damage to myelopoiesis .
proinflammatory cytokine il-6 gene expression , induced by 1-adrenergic agents through involving p38 mapk and nf-b pathways [ 122 , 123 ] , could potentially contribute to early processes of post - irradiation hematopoietic recovery [ 124127 ] .
ros play a critical role in mediating the response to alpha1-adrenergic stimulation . the importance of these effects of adrenomimetics for their complete protective action may be observed if radioprotectors are applied after radiation exposure .
in such a situation , they fail to exert a protective effect as antagonists of the oxygen effect. radioprotectors , such as serotonin , adrenaline , cystamine and 2-aminoethylisothiuronium bromide hydrobromide ( aet ) are known to have a small radioprotective effect if applied within 10 min after irradiation [ 129132 ] . under conditions of liver shielding in rats ,
maisin et al . [ 133 , 134 ] has detected a protective effect from cysteamine applied after exposure to lethal doses of whole - body radiation in cases where the radioprotector alone was not sufficient .
the therapeutic effect of indralin saves up to 55% when it is applied to rats after whole - body irradiation with partial shielding of the upper quadrant of the abdomen .
it is clear that the therapeutic action of indralin and other radioprotectors noted above is essentially lower than its preventive protective effect .
thus , neutralization of the oxygen effect by these drugs is a key aspect of their radioprotective action .
it is important to note that pharmacological modulation of gene expression by radioprotector action ca n't of itself achieve significant chemical protection .
therefore , the favourable effects of indralin on early post - irradiation hematopoietic recovery do not in themselves constitute a high radioprotective action . in summary , indralin is likely to provide a high therapeutic index in large animals via the specificity of its adrenergic effect on tissue respiration , promoting the development of acute hypoxia in radiosensitive tissues ( aggravated by its vasoconstrictive effect ) , and also partly via the therapeutic potential of its influence on early post - irradiation hematopoietic recovery .
the radioprotective properties of biogenic amines and aminothiols have attracted investigators ' attention for more than six decades .
this review provides a comparative study of the window of radioprotection for biogenic amines and aminothiols based on personal and literary databases .
comparative analysis of the window of radioprotection for biogenic amines and their derivates and the aminothiol cystamine indicates that catecholamines , serotonin and mexamine have a more than 10-fold greater ti relative to cystamine in experiments with small animals .
the ti of tryptamine , which lacks a hydroxyl - group in the fifth position of the indole ring , is deprived of serotonin selectivity and does not differ from that of cystamine .
the considerable differences in ti between catecholamines , serotonin and cystamine are caused by the differences in the pharmacology , toxicology of radioprotectors and mechanisms of their radioprotective action .
receptor - mediated radioprotective agents have greater preferences over aminothiols and thus provide an expanded window of protection .
we propose a hypothesis explaining why the window of radioprotection for cystamine and mexamine is reduced , and that for the 1-adrenomimetic indralin is not essentially changed in moving from small to large animals .
the reduction in the ti of cystamine in larger animals , such as dogs , may be caused by the greater increase in toxicity of aminothiols in relation to the decrease in their optimal doses for radioprotective effect in going from mice to dogs , which is a consequence of the slower metabolic processes in larger animals .
the somatogenic phase of intoxication by cystamine is significantly longer than the duration of its radioprotective effect , and increases with irradiation .
antioxidants lower the toxicity of aminothiols and increase the maximum tolerated dose and thus the corresponding radioprotective effect .
the decrease in the radioprotective effect and ti of mexamine in experiments with dogs may be caused by their lower sensitivity to the acute hypoxia induced by mexamine ( because of a decrease in the oxygen tension gradient in tissues under conditions of lower initial oxygen consumption in a large animal as compared with a small animal ) .
indralin , owing to its high radiation protective effect as observed in experiments on dogs and monkeys , would not provide that via only a vasoconstrictor action for reasons similar to that noted above for mexamine
. the stimulatory effect of indralin on early post - irradiation haematopoietic recovery can not provide high radioprotective action , but may only promote recovery .
thus , indralin is likely to provide optimal radioprotective effects and a high ti in large animals because of the specificity of its adrenergic effect on tissue respiration , promoting acute hypoxia in radiosensitive tissues when the tissues lack an adequate oxygen supply because of the development of pharmacological vasoconstriction . | this review gives a comparative evaluation of the radioprotective properties and the therapeutic index ( ti ) of radioprotectors from various pharmacological group in experiments on both small and large animals .
it presents a hypothesis explaining the decrease in the ti of cystamine and 5-methoxytryptamine ( mexamine ) , and the retention of that of 1-adrenomimetic indralin , and also compares the effects on large and small animals .
the considerable differences in the therapeutic indices of catecholamines , serotonin and cystamine are a consequence of specific features of their mechanisms of radioprotective action .
radioprotectors acting via receptor mediation tend to provide a more expanded window of protection .
the reduction in the ti of cystamine in larger animals , such as dogs , may be caused by the greater increase in toxicity of aminothiols in relation to the decrease in their optimal doses for radioprotective effect in going from mice to dogs , which is a consequence of the slower metabolic processes in larger animals .
the somatogenic phase of intoxication by cystamine is significantly longer than the duration of its radioprotective effect , and increases with irradiation .
the decrease in the radioprotective effect and the ti of mexamine in experiments with dogs may be caused by their lower sensitivity to the acute hypoxia induced by the mexamine .
this is because of lower gradient in oxygen tension between tissue cells and blood capillaries under acute hypoxia that is determined by lower initial oxygen consumption in a large animal as compared with a small animal .
indralin likely provides optimal radioprotective effects and a higher ti for large animals via the increased specificity of its adrenergic effect on tissue respiration , which supports the development of acute hypoxia in the radiosensitive tissues of large animals .
the stimulatory effect of indralin on early post - irradiation haematopoietic recovery can not provide a high level of radioprotective action for large animals , but it may promote recovery . |
malignant tumors of the anus are uncommon and scarcely encountered in the field of proctology .
according to the report of the japanese society for cancer of the colon and rectum on the frequency of cancers , anal canal carcinomas accounted for only 0.8% of rectal carcinomas . despite the low incidence , treatment of anal canal carcinoma is very important because it significantly influences the quality of life of cancer patients .
it has been reported that the incidence of anal canal adenocarcinomas is high in japan , while that of squamous cell anal canal carcinomas is high in western countries .
the standard therapy for anal adenocarcinoma has not yet been established in japan or western countries , and current guidelines recommend that patients with anal carcinoma should be treated similarly to those with rectal carcinoma [ 4 , 5 ] . here
, we report a case of anal canal adenocarcinoma with distant metastases to the lung and liver successfully treated with mfolfox6 + bevacizumab according to the guidelines for rectal carcinoma .
a 62-year - old man was admitted to a local clinic complaining of difficulty in defecation , anal pain , and bleeding during bowel movement for approximately 2 months . his past medical history and family history were unremarkable .
the examination revealed an anal mass , and the patient was suspected to have anal canal carcinoma and was referred to our hospital for further testing and treatment .
we found a solid mass of a thumb tip size with an uneven indented surface , which was erosive and bled easily ; the mass was located mainly on the left side of the anal canal ( fig .
although the mass was protruding out of the anal area , no anal fistula or pagetoid spread was observed .
a computed tomography ( ct ) scan at the time of the first examination revealed multiple masses in the lung and liver .
the patient was diagnosed with anal canal adenocarcinoma with multiple metastases to the lung and liver .
although there were distant metastases , we decided to initiate treatment for the anal cancer immediately , because the patient was experiencing difficulty in defecation , pain , and bleeding due to the growing tumor .
first , we performed abdominoperineal resection to control local growth of the tumor ; then , the patient was referred for chemotherapy to treat the distant metastases .
the patient 's general condition was good , and there were no significant problems with bone marrow , liver , or renal functions .
it is generally recommended that patients with anal canal adenocarcinoma should be treated similarly to those with rectal carcinoma [ 4 , 5 ] .
the patient was treated according to the guidelines for rectal carcinoma with distant metastasis . after considering the toxicity profile , administration method , and the patient 's compliance , we chose mfolfox6 ( folinic acid , fluorouracil , oxaliplatin ) + bevacizumab therapy .
because the patient had an activating g12d mutation in the kras proto - oncogene , anti - egfr therapy was not considered . before the start of chemotherapy , thoracic - abdominal ct scan
was performed , which showed multiple metastatic lesions in the lung and liver , similar to those revealed by the initial examination ( fig .
was observed already after 4 courses of mfolfox6 + bevacizumab therapy , and after 22 courses , ct scan showed maximum reduction in the metastatic lesions in both sites ( fig .
thus , before the start of chemotherapy , serum levels of the tumor markers cea and ca 199 were elevated ( 38.1 ng / ml and 101.9 u / ml , respectively ) , but gradually decreased with the reduction of the metastatic lesions ( the lowest levels were 4.7 ng / ml and 24.6 u / ml , respectively ) .
at the time of this report , the patient was in the partial response state for 1 year .
we plan to continue the current treatment unless the patient develops progressive disease or intolerable adverse reactions .
the term anal canal carcinoma is applied to tumors located in the tubular body of the anal canal from the upper margin of the puborectalis muscle to the anal verge .
based on the histological features , most anal canal tumors are classified as adenocarcinomas and squamous cell carcinomas , although other histological types such as adenosquamous carcinoma , basaloid carcinoma , and malignant melanoma are observed .
anal canal adenocarcinomas are further classified into colorectal , anal gland , and fistula - associated subtypes .
our patient had no history of anal fistula and was diagnosed with adenocarcinoma of anal gland origin .
treatment of anal canal carcinoma significantly varies according to the histological type . for patients with squamous cell carcinoma without metastasis , combined 5-fluorouracil +
mitomycin chemoradiotherapy has been demonstrated to be effective [ 7 , 8 ] and is currently accepted as the standard treatment .
chemoradiotherapy can contribute to the preservation of the anal function and improvement in survival rate .
for patients with distant metastasis , combined 5-fluorouracil + cisplatin therapy is recommended . in contrast , no studies have provided convincing evidence for the effectiveness of anal canal adenocarcinoma - specific therapy .
the guidelines in japan and western countries recommend that patients with anal canal adenocarcinomas should be treated similarly to those with rectal carcinomas because of the similarity in their pathological features [ 4 , 5 ] .
the patient in the present study was treated according to the guidelines for rectal cancer with distant metastasis . after discussing the treatment plans with the patient , we performed abdominoperineal resection to improve local symptoms ( pain , bleeding , and obstruction ) before initiating chemotherapy for distant metastases .
treatment options included oxaliplatin - based chemotherapy such as folfox , xelox , sox , irinotecan - based chemotherapy such as folfiri , iris , and the combination of molecular targeted drugs .
since the patient had an activating g12d mutation in the kras oncogene , anti - egfr therapy was not an option [ 14 , 15 ] .
after considering the toxicity profiles , administration methods , and patient 's compliance , mfolfox6 + bevacizumab therapy was chosen . over approximately 1 year , 22 courses of mfolfox6 + bevacizumab therapy were performed . at the time of this report
, the patient demonstrated tolerable levels of oxaliplatin - induced peripheral neurotoxicity ( grades 12 ) .
we are going to continue the current treatment unless the patient develops intolerable adverse reactions or progressive disease . in the near future
, we plan to conduct imaging studies , including pet / ct scan , and consult specialists in respiratory and digestive surgery to determine if operative intervention is appropriate . in conclusion ,
we experienced a rare case of anal canal adenocarcinoma with distant metastases , which was successfully treated with mfolfox6 + bevacizumab therapy according to the guidelines for rectal carcinoma . case reports of chemotherapy for anal canal adenocarcinoma with distant metastasis are limited , and there is no convincing evidence for treatment effectiveness .
anal canal carcinoma originates from a wide range of tissues and has multiple histological subtypes . to date
we believe that it is important to establish a specific treatment strategy for anal canal carcinoma according to the histological type .
informed consent was obtained from the patient for publishing this case and the accompanying images .
| anal canal adenocarcinoma is a relatively rare malignancy without established diagnostic and treatment criteria .
case reports of chemotherapy for anal canal adenocarcinoma with distant metastasis are limited , and there is no convincing evidence for treatment effectiveness .
a 62-year - old man complained of difficulty in defecation , anal pain , and bleeding during bowel movement .
he was diagnosed with moderately differentiated primary anal canal adenocarcinoma .
a computed tomography scan revealed multiple metastases in the lung and liver .
the patient was treated with abdominoperineal resection to control local tumor growth and then with chemotherapy consisting of mfolfox6 + bevacizumab . because he had an activating kras mutation ,
anti - egfr therapy was not considered . a reduction in the size of lung and liver metastases
was observed after 4 courses of mfolfox6 + bevacizumab , and after 22 courses , maximum reduction in the metastatic lesions was achieved .
the patient demonstrated tolerable levels of oxaliplatin - related peripheral neurotoxicity ( grades 12 ) and was considered as having partial response to treatment .
he is currently at the partial response state for 1 year .
we plan to continue the treatment unless the patient develops progressive disease or intolerable adverse reactions .
this case demonstrates that anal canal adenocarcinoma with distant metastases could be successfully treated with mfolfox6 + bevacizumab therapy according to the guidelines for rectal carcinoma .
however , as anal canal carcinoma has multiple histological subtypes , it is important to establish subtype - specific treatment strategies . |
nonhuman primate models have contributed greatly to our understanding of hiv-1 pathogenesis and have been invaluable for testing the efficacy of experimental vaccines and drug regimens [ 1 , 2 ] .
there are , however , surprising differences in outcomes of hiv-1 infection between humans and captive chimpanzees .
the major circulating clade of hiv-1 arose via cross - species transfer of a chimpanzee sivcpz and ultimately resulted in rapid progression to aids in the great majority of untreated infected humans .
endemic sivcpz infection in wild chimpanzees can cause a less severe aids - like syndrome , with cd4 + t cell depletion , lymphatic tissue destruction , and premature death .
however , experimental infections of chimpanzees with hiv-1 only rarely caused aids , with the great majority of hiv-1-infected chimpanzees still surviving > 20 years later .
several explanations have been put forward , including a lack of cd4 + t cell bystander apoptosis , a relative resistance of chimpanzee monocyte macrophages to infection with primary isolates , low hiv-1-specific cytotoxic t lymphocyte responses , low immune activation , and preservation of cd4 + t helper function ( reviewed in ) .
experimental siv infection in other nonhuman primate models has led to a better understanding of the pathogenesis of hiv-1 in humans ( recently reviewed in ) .
for example , it appears that hyperimmune activation that occurs in patients infected with hiv-1 is driven by factors such as loss of gut - associated cd4 + t cells with loss of gi mucosal integrity and translocation of microbial products , differential expression of pro - inflammatory factors , and differences in upregulation of hiv coreceptors .
these systemic factors are doubtless important , but cell - intrinsic factors involving the infected cd4 + t cells themselves also contribute .
one host difference between human and chimpanzee cd4 + t cells is much higher expression of inhibitory siglecs ( sialic acid - binding immunoglobulin - like lectins ) in the latter .
siglecs are a subfamily of i - type lectins capable of modulating immune cell activation and death .
most of the cd33-related siglecs have inhibitory itim motifs in their cytosolic tails , which recruit src homology region 2 domain - containing phosphatases ( shps ) shp-1 and shp-2 , thus limiting activation pathways stimulated by tyrosine kinases .
siglecs also appear to be involved in apoptotic and nonapoptotic cell death and may regulate immune responses by modulating the life span of cells of the innate immune system .
siglec-10 , for example , protects host cells against lethal responses to pathological cell death and helps discriminate danger versus pathogen - associated molecular patterns . in the context of hiv-1 infection ,
a recent study showed upregulation of siglec-6 on tissue - like memory b cells of infected individuals .
prior to the availability of antiviral treatments , hiv-1 infection in humans almost universally led to aids and death within less than 510 years .
the marked difference in outcomes of humans versus captive chimpanzees infected with hiv-1 remains unexplained and is likely due to complex and multifaceted interactions between virus and host - specific factors .
we have recently shown , using multiple approaches , that chimpanzee t cells are less responsive to stimulation than human t cells and that this difference correlates with siglec-5 expression .
based on these observations , and on the fact that cd4 + t cells from chimpanzees and humans are equally susceptible to hiv-1 infection in vitro [ 15 , 16 ] , we sought to determine whether a siglec - mediated cell - intrinsic mechanism contributes to differences in outcomes of hiv-1 infection in cd4 + t cells .
the cem t leukemia cell line ( american type culture collection , manassas , va ) was maintained in rpmi 1640 medium ( gibco - invitrogen , carlsbad , ca ) supplemented with 1 mm l - glutamine , 50 u / ml penicillin , 50 g / ml streptomycin , and 10 % ( vol / vol ) fetal bovine serum ( complete medium ) . for generation of stable clones expressing siglec-5 , 5 10 cells were nucleofected using the human t cell nucleofector kit ( amaxa , gaithersburg ,
the siglec-5-positive population was then sorted by flow cytometry ( moflo , xdp , beckman coulter , brea , ca ) into siglec-5-positive and negative subpopulations .
chimpanzee blood samples were collected into edta - containing tubes at the yerkes national primate center ( atlanta , ga ) and shipped on ice overnight to the university of california san diego , la jolla , ca .
human blood was collected from healthy volunteer donors , with approval from the university of california san diego institutional review board .
these samples were collected into identical edta - containing tubes and stored overnight on ice to ensure similar treatment conditions .
total cd4 + t cells were isolated by negative selection from buffy coats using the rosettesep cell separation procedure ( stemcell technologies , vancouver , bc , canada ) followed by density gradient centrifugation with histopaque 1077 ( sigma - aldrich , st .
resulting cell preparations were routinely > 95 % positive for cd4 + expression by flow cytometry .
the isolated cells were cultured in complete medium . to induce cell stimulation , 24 10 cells per 2 ml medium
were distributed into flat - bottom wells of a six - well , nontissue culture - treated plate that was precoated with anti - cd3 ( 550 ng / ml , clone hit3a ) plus anti - cd28 ( 0.2 g / ml ) monoclonal antibodies ( bd biosciences , san jose , ca ) .
the cells were maintained at a concentration of 35 10 cells per well in complete medium for the remainder of the culture period ( 1314 days ) .
the purity of cd4 + lymphocyte preparations and siglec-5 expression were monitored by direct staining with fitc - conjugated anti - cd4 and/or apc - conjugated anti - siglec-5 antibodies ( bd biosciences ) .
trail / dr5 expression was monitored using pe - conjugated anti - trail and anti - dr5 antibodies ( ebioscience , san diego , ca ) .
simple cell surface staining was performed for 30 min at 4 c per manufacturer 's instructions with cell aliquots containing 0.5 10 to 1 10 cells .
for intracellular hiv gag ( p24 ) analysis , cells were washed in calcium - free and magnesium - free dulbecco 's phosphate - buffered saline ( pbs ; mediatech , herndon , va ) , then fixed and permeabilized following the manufacturer 's instructions with cytofix / cytoperm buffer ( bd pharmingen , san diego , ca ) .
after washing with perm / wash buffer ( bd pharmingen ) , cells were incubated for 30 min with kc57-rd1 antibody ( beckman coulter , fullerton , ca ) .
cells were then washed again with perm / wash buffer and stored in 0.5 % formaldehyde at 4 c until data acquisition on a facscalibur ( bd biosciences ) . for cfse labeling , 12
10 pbmcs were labeled with 5 m cfse ( invitrogen , carlsbad , ca ) , incubated for 15 min at 37 c , rested on ice for 5 min , and then washed .
cell viability at the end of culture was monitored using ethidium homodimer-1 staining , following the manufacturer 's protocol ( live / dead viability / cytotoxicity kit , invitrogen ) .
infectious virus stocks of the nl4 - 3 strain of hiv-1 were prepared by transfecting plasmid dna ( nih aids research and reference reagent program , germantown , md ) into the cem t cells with lipofectin transfection reagent ( invitrogen ) and harvesting supernate at the time of peak viral replication and spread .
aliquots of 24 10 cells were incubated with 0.5 ml of the nl4 - 3 virus stock for 46 h at 37 c at multiplicities of infection of 0.01 to 0.5 tcid50 per cell . after infection ,
excess virus was removed by extensive washing with pbs plus 2 % fetal calf serum .
cells were stimulated as described above , and virus infection was monitored at different time points during culture .
productive hiv replication was assessed by quantifying the amount of soluble p24 antigen released into culture supernatants by elisa ( abbott , abbott park , il , and perkinelmer , boston , ma ) .
the human phospho - immunoreceptor array and the human apoptosis antibody array ( both from r&d systems , minneapolis , mn , usa ) allow for the simultaneous detection of 59 different phosphorylated immunoreceptors or the relative expression of 35 apoptosis - related proteins .
briefly , cell lysates from cem cells were diluted with array buffer , added to a four - well multidish and incubated overnight at 28 c .
after washing , antibody conjugated to horseradish peroxidase was added , and chemiluminescence was quantified after 2 h by scanning the developed x - ray film on a transmission - mode scanner according to the manufacturer 's recommendations .
1 10 cem cells were plated into each well of a 96-well tissue culture plate and treated with varying concentrations ( 520 g / ml ) of an activating clone of anti - fas antibody ( clone ch11 , millipore , temecula , ca ) . the percent killing was calculated by comparing the number of viable cells in untreated wells versus the number of viable cells in treated wells after 24 h in culture .
the san diego first choice program was approved by the local human research protections program and enrolled participants from july 2010 to april 2011 . at enrollment
, participants underwent a point - of - care rapid antibody test ( oraquick advance rapid hiv , orasure technologies , inc .
if this test was positive , then confirmation and hiv staging was performed using western blot ( cambridge biotech , distributed by ortho diagnostics ) , plasma viral load determination ( cobas amplicor hiv-1 test , roche molecular systems , pleasanton , ca ) , and detuned hiv eia ( vironostika
ls eia , biomerieux inc , durham , nc , and vitros ls eia , ortho - clinical diagnostics , inc . , uk ) .
all study participants had 2 ml whole blood drawn into an edta test tube and washed with wash buffer ( 1 l pbs , 10 ml 1 m sodium azide , 20 ml filtered heat - inactivated fetal bovine serum , adjusted to ph 7.2 ) , then centrifuged for 5 min at 300g to allow collection of the buffy coat layer . washed whole blood
( 100 l ) was then stained with a fluorescent ab mixture ( fitc / siglec-5 , pe / cd45ro , per - cp / cd4 , pe - cy7/cd38 , apc / cd27 , apc - cy7/cd3 , and pac - blue / cd8 ) before evaluation on a facs canto ii ( bd biosciences , san jose , ca ) . acquired data were compensated using diva software , and analysis was performed with flowjo software ( ashland , or ) .
we have previously shown that human and chimpanzee cells differ in expression levels of siglec-5 and that higher expression correlates with decreased response to activating stimuli . we hypothesized that siglec-5 would also protect t cells from hiv-1-induced cell death , by dampening responses of activated cells to virus infection . to address this ,
a mixed population of cem cells positive and negative for siglec-5 expression was infected in vitro with the hivnl4 - 3 clone .
productive infection was evaluated in each siglec-5 subpopulation by measuring released hiv gag ( p24 ) at different time points and also by detecting the expression of intracellular p24 7 days after infection .
both showed similar levels of productive infection , with 30 % of cells expressing intracellular p24 ( fig .
1a ) and similar levels of p24 being released in the culture supernatant ( fig .
the percentage of cells positive for siglec-5 increased over time in hiv-1-infected cultures , suggesting that siglec-5-positive cells show enhanced survival following hiv-1 infection ( fig .
1c ) . to further support the hypothesis that siglec-5 expression enhanced cell survival and to identify a potential mechanism , we measured relative expression of 35 apoptosis - related proteins in siglec-5-positive and negative cem subsets .
siglec-5-negative cells , some of which were infected with hiv-1 , showed increased expression of several apoptosis - related proteins , including the active form of caspase-3 , and trailr2/dr5 ( fig .
siglec-5-positive cells were also more resistant to fas - mediated cell death , induced by antibody cross - linking and activation of the membrane fas ( fig .
these observations support the hypothesis that siglec-5 expression , either directly or indirectly , by affecting the expression of other cofactors , enhances t cell survival during hiv infection.fig .
mixed population of cem cells positive or negative for siglec-5 expression were infected with the nl4 - 3 clone of hiv .
a 7 days later , uninfected control ( top ) and infected cells ( bottom ) were stained for intracellular p24 expression and analyzed by flow cytometry .
b supernatant from siglec-5 positive ( closed circles ) and siglec-5 negative ( open squares ) was collected at multiple time points after hiv-1 infection and analyzed for p24 content by elisa .
c percentages of siglec-5-positive versus siglec-5-negative cells in uninfected and infected cultures over time ( only live cells as determined by fsc and ssc gating are included in the analysis ) .
d cells were collected on day 7 , and relative expression of different apoptosis - related proteins was measured using an antibody array .
the graph depicts proteins that showed greater than 1.5-fold difference in expression in siglec-5-negative cells over siglec-5-positive cells .
e cem cells were treated with an activating anti - fas antibody for 24 h. percent killing was determined by comparing the number of viable cells in treated versus untreated wells .
error bars represent sem , n = 3 cem cells expressing siglec-5 survive better in hiv-1-infected cultures .
mixed population of cem cells positive or negative for siglec-5 expression were infected with the nl4 - 3 clone of hiv .
a 7 days later , uninfected control ( top ) and infected cells ( bottom ) were stained for intracellular p24 expression and analyzed by flow cytometry .
b supernatant from siglec-5 positive ( closed circles ) and siglec-5 negative ( open squares ) was collected at multiple time points after hiv-1 infection and analyzed for p24 content by elisa .
c percentages of siglec-5-positive versus siglec-5-negative cells in uninfected and infected cultures over time ( only live cells as determined by fsc and ssc gating are included in the analysis ) .
d cells were collected on day 7 , and relative expression of different apoptosis - related proteins was measured using an antibody array .
the graph depicts proteins that showed greater than 1.5-fold difference in expression in siglec-5-negative cells over siglec-5-positive cells .
e cem cells were treated with an activating anti - fas antibody for 24 h. percent killing was determined by comparing the number of viable cells in treated versus untreated wells .
error bars represent sem , n = 3 in order to identify potential pathways involved , cem t cells were transfected with a siglec-5 expression plasmid and activated with pha . the relative phosphorylation of > 50 immunoreceptors in cells with or without activation was then analyzed using an immunoblot array .
2a ) , suggesting a dampened response to pha stimulation . of note , siglec-5 itself was phosphorylated upon activation .
consistent with an inhibitory role , expression of siglec-5 in cem cells also resulted in lower percentages of cells expressing tnf following anti - cd3/pma stimulation ( fig .
2divergent pattern of immunoreceptor phosphorylation and decreased tnf production in response to stimulation in cem cells expressing siglec-5 .
cem cells were nucleofected with a siglec-5 expression plasmid and sorted into homogeneous populations of siglec-5-positive and siglec-5-negative cells .
a cells were activated with pha for 4 h and the cell lysate collected .
lysate from stimulated and unstimulated cells was added to phospho - immunoreceptor antibody array , and immunoblot image analyzed .
the graph shows a change in pixel density of stimulated cells above unstimulated cell control .
b mixed population of cem cells positive or negative for siglec-5 expression were stimulated with pma and anti - cd3 .
error bars represent sem , n = 4 divergent pattern of immunoreceptor phosphorylation and decreased tnf production in response to stimulation in cem cells expressing siglec-5 .
cem cells were nucleofected with a siglec-5 expression plasmid and sorted into homogeneous populations of siglec-5-positive and siglec-5-negative cells .
a cells were activated with pha for 4 h and the cell lysate collected .
lysate from stimulated and unstimulated cells was added to phospho - immunoreceptor antibody array , and immunoblot image analyzed .
the graph shows a change in pixel density of stimulated cells above unstimulated cell control .
b mixed population of cem cells positive or negative for siglec-5 expression were stimulated with pma and anti - cd3 .
n = 4 we next asked if similar results would be observed in primary t cells that naturally express siglec-5 .
cd4 + t cells were isolated from human ( more than 99 % siglec-5 negative ) and chimpanzee ( more than 99 % siglec-5 positive ) whole blood and infected with hiv-1 , and both human and chimpanzee cells were stimulated with a high dose of anti - cd3/cd28 antibodies .
the percentage of cd4 + t cells productively infected did not differ significantly between human and chimpanzee samples ( fig .
there was , however , a significant difference in the number of surviving cells at the end of culture ( 14 days postinfection ) , with chimpanzee cells having a significantly better rate of survival ( fig .
if the increased survival in chimpanzee cell cultures was due to cell - intrinsic or cell - extrinsic mechanisms , chimpanzee cd4 + t cells were labeled with cfse and then mixed at a ratio of 1:1 with unlabeled human cd4 + t cells .
a portion of the mixed culture was infected with hiv , both infected and uninfected cultures were stimulated with anti - cd3/cd28 antibodies , and the relative percentage of cells in each population ( cfse+ and cfse ) was monitored for 14 days . as shown in fig .
3d and e , chimpanzee cells survived better following hiv-1 infection , even within the same culture as human cells . in striking contrast
, there was an increase in percentage of human cells in the absence of hiv infection , due to their increased proliferation , as anticipated from our previous work .
these results point to a cell - intrinsic mechanism being responsible for the increased survival of chimpanzee cells following hiv-1 infection.fig .
3chimpanzee cd4 + t cells expressing siglec-5 survive better than human cd4 + t cells in hiv-1-infected cultures .
human and chimpanzee cd4 + t cells were isolated from whole blood , infected with hiv-1 , and stimulated with anti - cd3/cd28 .
a intracellular p24 expression was monitored on days 5 and 8 postinfection by flow cytometry .
btop panel : representative absolute numbers of viable cells in human- and chimpanzee - infected or uninfected cultures over time .
bottom panel : the percentage of live cells at day 14 of culture was determined by flow cytometry ( n = 5 , error bars represent sem ) .
numbers on the top right corner represent absolute number of viable cells ( as determined by forward and side scatter gating ) collected for a specified amount of time .
d chimpanzee cd4 + t cells were labeled with cfse and then mixed at a ratio of 1:1 with human cd4 + t cells , infected with hiv or not as a control , and stimulated with anti - cd3/cd28 .
percentage of cells in each population ( cfse+ and cfse ) was monitored for 14 days .
histograms depict the percentage of live cells that are cfse positive and cfse negative at day 0 and at the end of culture ( day 14 ) .
e graphs depict the percentage of each population ( cfse+ and cfse ) over time in uninfected cultures ( top ) and cultures infected with hiv-1 ( bottom ) .
data shown are representative of three experiments chimpanzee cd4 + t cells expressing siglec-5 survive better than human cd4 + t cells in hiv-1-infected cultures .
human and chimpanzee cd4 + t cells were isolated from whole blood , infected with hiv-1 , and stimulated with anti - cd3/cd28 .
a intracellular p24 expression was monitored on days 5 and 8 postinfection by flow cytometry .
btop panel : representative absolute numbers of viable cells in human- and chimpanzee - infected or uninfected cultures over time .
bottom panel : the percentage of live cells at day 14 of culture was determined by flow cytometry ( n = 5 , error bars represent sem ) .
numbers on the top right corner represent absolute number of viable cells ( as determined by forward and side scatter gating ) collected for a specified amount of time .
d chimpanzee cd4 + t cells were labeled with cfse and then mixed at a ratio of 1:1 with human cd4 + t cells , infected with hiv or not as a control , and stimulated with anti - cd3/cd28 .
percentage of cells in each population ( cfse+ and cfse ) was monitored for 14 days .
histograms depict the percentage of live cells that are cfse positive and cfse negative at day 0 and at the end of culture ( day 14 ) .
e graphs depict the percentage of each population ( cfse+ and cfse ) over time in uninfected cultures ( top ) and cultures infected with hiv-1 ( bottom ) .
data shown are representative of three experiments next , we examined potential apoptosis - related signaling differences between hiv-1-infected human and chimpanzee cd4 + t cells , by analyzing the expression profiles of 35 apoptosis - related proteins using a proteome array . in agreement with data obtained with cem cells expressing siglec-5 , we observed lower levels of expression of the active form of caspase-3 , fas , and trail receptors 1 and 2 in chimpanzee cells that naturally express siglec-5 ( fig .
chimpanzee cells also demonstrated significantly lower surface level expression of dr5 and trail 10 days after infection ( fig .
4b ) , in agreement with previous reports showing increased susceptibility to apoptosis in human cells when compared to chimpanzee cells [ 16 , 17 ] .
attempts at sirna - mediated knockdown of siglec-5 did not work in primary chimpanzee t cells , due to upregulation of siglec-5 mrna following cell activation , and the toxicity of sirnas in primary cells in long - term studies ( data not shown).fig .
4increased cell death of human cd4 + t cell is associated with increased expression of apoptosis - related proteins . hiv-1-infected human and chimpanzee cd4 + t cells were collected 8 days after infection and analyzed for expression of apoptosis - related proteins .
a relative expression of different apoptosis - related proteins was measured using an antibody array .
the graph depicts proteins that showed greater than 1.5-fold difference in increased expression in hiv-1-infected human over chimpanzee cd4 + t cells .
b surface expression of trail and dr5 were analyzed at day 8 postinfection in hiv-1-infected human and chimpanzee cd4 + t cells .
error bars represent sem , n = 4 increased cell death of human cd4 + t cell is associated with increased expression of apoptosis - related proteins .
hiv-1-infected human and chimpanzee cd4 + t cells were collected 8 days after infection and analyzed for expression of apoptosis - related proteins .
a relative expression of different apoptosis - related proteins was measured using an antibody array .
the graph depicts proteins that showed greater than 1.5-fold difference in increased expression in hiv-1-infected human over chimpanzee cd4 + t cells .
b surface expression of trail and dr5 were analyzed at day 8 postinfection in hiv-1-infected human and chimpanzee cd4 + t cells .
error bars represent sem , n = 4 to directly assess whether siglec expression in human cd4 + t cells would improve cell survival , we took advantage of the fact that a minor subset of cd4 + t cells ( usually less than 1 % ) in some humans do express members of the cd33-related family of receptors .
we hypothesized that this minor subpopulation would be enriched following hiv-1 infection . in order to increase the detection of such a minor population
, cells were stained for expression of two members of the siglec family : siglec-5 and siglec-9 , both of which are inhibitory .
purified human cd4 t cells were infected with hiv-1 , stimulated with anti - cd3/cd28 , and cultured for 8 days , and the percentage of cd4 + t cells expressing intracellular p24 and/or siglecs 5 and 9 was analyzed by flow cytometry and compared to the cells expressing siglecs in uninfected cultures .
cultures from three different individuals showed an increase in the small percentage of siglec - expressing cells following hiv-1 infection ( fig .
the data suggest that siglec - expressing cells are better able to survive in hiv-1-infected cultures , resulting in enrichment of these cells , as the majority of cells dying are non - siglec - expressing cells .
we do not believe that siglec-5-positive cells are expanding with hiv infection , since expression of siglec-5 in human cells is strongly repressed , as suggested by our prior studies , which have shown that siglec-5 expression is not induced upon cell activation nor upon treatment with certain epigenetic modifying drugs ( data not shown ) .
it is still possible , however , that in the three individuals used in our study , siglec expression may not be as strongly repressed as in other individuals.fig .
5enrichment of cd4 + t cells expressing siglecs in human cd4 + t cell cultures infected with hiv-1 and in hiv-1-infected patient samples .
a purified primary human cd4 + t cells were infected with hiv-1 or left uninfected as a control , and stimulated with anti - cd3/cd28 .
after 8 days , the percentage of cd4 + t cells expressing intracellular p24 and both inhibitory siglecs 5 and 9 was analyzed by flow cytometry and compared to the percentage of siglec - expressing cells in uninfected cultures .
b the graph depicts summary data of hiv-1 infection of cd4 + t cells from three different individuals as described above .
the data shown represent the percentage of total cells expressing siglecs 8 days postinfection .
c the percentage of cd3+cd4 + cells also positive for siglec-5 expression in pbmcs from patients with recent hiv infection ( n = 10 ) was analyzed by flow cytometry and compared to samples from uninfected healthy donors ( n = 6 ) .
error bars represent sem enrichment of cd4 + t cells expressing siglecs in human cd4 + t cell cultures infected with hiv-1 and in hiv-1-infected patient samples .
a purified primary human cd4 + t cells were infected with hiv-1 or left uninfected as a control , and stimulated with anti - cd3/cd28 .
after 8 days , the percentage of cd4 + t cells expressing intracellular p24 and both inhibitory siglecs 5 and 9 was analyzed by flow cytometry and compared to the percentage of siglec - expressing cells in uninfected cultures .
b the graph depicts summary data of hiv-1 infection of cd4 + t cells from three different individuals as described above .
the data shown represent the percentage of total cells expressing siglecs 8 days postinfection .
c the percentage of cd3+cd4 + cells also positive for siglec-5 expression in pbmcs from patients with recent hiv infection ( n = 10 ) was analyzed by flow cytometry and compared to samples from uninfected healthy donors ( n = 6 ) .
error bars represent sem to determine if enrichment of siglec-5-positive cells also occurs in vivo , the percentage of cd4 + cells with siglec-5 expression was analyzed by flow cytometry in peripheral blood samples from patients with recent hiv infection ( table 1 ) .
compared to hiv - negative controls , such patients demonstrated a significant increase in percentage of cd4 + t cells that expressed siglec-5 ( fig .
5c).table 1estimated date of infection , cd4 counts , and viral load for hiv-1-positive individualspatient numberdays from edicd4 counts ( cells / ml)hiv plasma viral load ( log10 copies / ml)1194015.52918703.03253625.74765213.85204254.561064715.87298974.981028624.99356093.210756986.2estimated date of infection .
all patients were antiretroviral naive estimated date of infection , cd4 counts , and viral load for hiv-1-positive individuals estimated date of infection .
since the discovery of hiv-1 as the causative agent of aids , the use of chimpanzees as disease models has been insightful , challenging , and controversial . based on the fact that chimpanzees were equally susceptible to infection by hiv ,
there was great hope that they would be useful as an animal model for disease pathogenesis [ 18 , 19 ] .
however , despite similar infection susceptibility and virus production , the outcome of hiv-1 infection was quite different in these animals [ 5 , 15 , 17 ] with the great majority surviving without aids for > 20 years and many still alive today .
the exception that actually proves the rule was an unusual strain that evolved to cause aids in a multiply infected chimp and proved highly pathogenic when transferred to other chimps . over the years
, the literature has accumulated conflicting reports regarding cytopathic effects of hiv in chimpanzee cd4 + t cells , virus replication capacity , and cd8 t cell - killing ability [ 16 , 2226 ] .
our study addresses cell - intrinsic differences between human and chimpanzee cd4 + t cells that can clarify differences in their ability to succumb to hiv-1 infection . here
, we show that a human t cell line expressing siglec-5 shows both a reduced response to activating stimuli and an intrinsic advantage in cell survival following hiv-1 infection . the decreased response to activating stimuli
was associated with higher tyrosine phosphorylation of activating receptors , such as cd3 epsilon and nkp46 , in siglec-5-negative cem cells .
the increased survival of siglec-5-positive cells in hiv-1-infected cultures was associated with decreased expression of apoptosis - related proteins , like the active form of caspase-3 , and trailr2/dr5 .
how does siglec-5 expression confer an intrinsic advantage in terms of cell survival following hiv-1 infection in vitro ?
siglec-5 has been previously shown to mediate shp-1- and/or shp-2-dependent signaling even in the absence of tyrosine phosphorylation and may affect t cell survival via this mechanism .
more recently , the absence of shp-1 has been shown to increase fas - induced cell death .
t cells with siglec-5 expression demonstrated a similar functional phenotype , consistent with shp-1 recruitment and inhibition of apoptosis .
we can not of course rule out the possibility that siglec expression is indirectly correlated with protection via some other unknown mechanism .
further work is needed to clarify this relationship . when compared to hiv - negative controls , recently infected hiv-1-positive individuals had significant enrichment of siglec-5-positive cd4 + t cells .
interestingly , siglec-6 is upregulated on tissue - like memory b cells of hiv - viremic individuals .
the authors of that study suggest that siglec expression is a marker of a dysfunctional , anergic phenotype in the setting of immune system exhaustion .
however , another possible interpretation is that cells expressing siglecs preferentially survive the heightened immune activation and activation - induced cell death caused by hiv-1 infection .
the differences in functionality of siglec - positive cells could also reflect their maturational state .
in our hiv - infected cohort , siglec-5 expression was mainly detected on nave cd4 + t cells ( data not shown ) , which could appear dysfunctional if compared to responses of mature memory and effector t cells .
thus , instead of representing an exhausted phenotype , siglec expression in this setting may be a marker of differentiation correlating with a less mature phenotype .
further work is needed to understand the mechanisms regulating siglec-5 expression and its relation to t cell differentiation .
another recent study concluded that decreased expression of siglec-7 on natural killer cells represents an early marker of dysfunctional nk - cell subsets , associated with high levels of hiv-1 viremia .
these authors suggested that high frequencies of siglec-7-negative nk cells might reflect the immune and clinical status of hiv-1 infection and can also track the effectiveness of therapy .
interestingly , they also observed maintenance of siglec-7-positive nk cells in long - term nonprogressors . in this
uncommon setting , siglec expression may also contribute to control of immune activation and delayed disease progression .
the use of lentivirus infection of chimpanzees as a model for understanding hiv pathogenesis has been further complicated by a long - term natural history study of infected wild chimpanzees which revealed that , contrary to what was previously thought , sivcpz can be pathogenic and may be associated with chimpanzee population decline .
interestingly , the latter study concludes that population extinction is not an inevitable consequence of sivcpz infection despite negative effects of the virus on population size . taken together ,
the data indicate sivcpz infection in this population is less pathogenic than untreated hiv-1 infection in humans , which was almost always fatal prior to the availability of antiviral treatments . these recently observed differences in outcome of sivcpz infection in its natural host may appear contradictory at first , as with in vitro comparisons between human and chimpanzee t cells , but could be explained by a combination of factors .
siglec expression is one of these factors that can tilt the balance in favor of the host but obviously does not offer complete protection .
also , the results obtained from comparisons of human and chimp cd4 + t cells in terms of activation thresholds , susceptibility to infection , and susceptibility to cytopathic effects can be rather different depending on the experimental conditions , i.e. , how the cells are activated , for how long , and what type of virus strain is used .
clearly , the factors that contribute to different hiv / siv infection outcomes in different nonhuman primate species are many , and these differences may be greater than previously thought . here , we report on a novel cell - intrinsic factor that may help protect t cells from activation and hiv - induced cell death and supports the role of excessive immune activation as one of the main contributors to cd4 t cell loss .
understanding the pathways involved in dampening immune activation and that result in protection may lead to novel therapeutic strategies . | human and chimpanzee cd4 + t cells differ markedly in expression of the inhibitory receptor siglec-5 , which contributes towards differential responses to activating stimuli . while cd4 + t cells from both species are equally susceptible to hiv-1 infection , chimpanzee cells survive better , suggesting a cell - intrinsic difference .
we hypothesized that siglec-5 expression protects t cells from activation - induced and hiv-1-induced cell death .
transduction of human cem t cells with siglec-5 decreased cell responses to stimulation . following hiv-1 infection
, a higher percentage of siglec-5-positive cells survived , suggesting relative resistance to virus - induced cell death .
consistent with this , we observed an increase in percentage of siglec-5-positive cells surviving in mixed infected cultures .
siglec-5-transduced cells also showed decreased expression of apoptosis - related proteins following infection and reduced susceptibility to fas - mediated cell death .
similar siglec-5-dependent differences were seen when comparing infection outcomes in primary cd4 + t cells from humans and chimpanzees .
a protective effect of siglec-5 was further supported by observing greater proportions of circulating cd4 + t cells expressing siglec-5 in acutely infected hiv-1 patients , compared to controls . taken together
, our results suggest that siglec-5 expression protects t cells from hiv-1- and apoptosis - induced cell death and contributes to the different outcomes of hiv-1 infection in humans and chimpanzees . |
a 67-year - old male presented in our emergency department complaining sudden , severe dizziness and left ptosis of an hour 's duration . on admission , his symptoms gradually worsened , showing left - side facial palsy , severe dysarthria , and left - limb ataxia .
he was on oral anticoagulation with a daily aspirin since he had a mechanical aortic valve replaced more than a year previously . however , his international normalization ratio ( inr ) on admission turned out to be only 1.4 .
subsequent , acute stroke mr imaging showed occlusion of the basilar artery with a focal infarction in the left superior cerebellar artery territory ( fig .
. systemic tissue plasminogen activator ( actylase , boehringer ingelheim , germany ) was given at a dose of 0.6 mg / kg as the patient was still within the time window of intravenous thrombolytic therapy . because the patient did not show any symptomatic improvement , our endovascular treatment team was called in per our institutional acute stroke bridging therapy protocol .
however , the f irst retrieval was unsuccessful and only showed a slight change in the shape of the filling defect . the pattern repeated during several , following trials . eventually , the clot migrated further distally into the left posterior cerebral artery ( fig .
at the time of the final device retrieval , we obtained a control angiogram while the device was still in the midportion of the basilar trunk ( fig .
we were able to retract the filling defect proximally into the mid portion of the basilar trunk .
eventually we could pull down the device to the distal vertebral artery ( va ) level proximal to the ipsilateral posterior inferior cerebellar artery ( pica ) origin . on the control angiogram we noted that half of the filling defect had migrated into the right pca and half of it was still within the device mesh
as we thought that further manipulation of the device would result in additional distal migration of the clot , we decided to purposely detach the device at the current position in order to avoid the risk of another distal migration ( fig .
a loading dose of tirofiban ( aggrastat , iroko cardio australia pty ltd , australia ) was given systemically on the table .
on the following day , the patient 's symptoms improved significantly and only showed mild residual diplopia on the left lateral gaze .
the patient was discharged with instructions to take both aspirin and warfarin after adjustment of the inr .
he was found unconscious and his last known normal time period was four hours previously .
acute stroke mr revealed multi - territorial , wedge - shaped infarcts involving both cerebellar hemispheres and the left pca territory .
subtle signal changes were also noted in the pons . an urgent , right vertebral angiogram showed distal bao with a filling defect showing a meniscus sign .
2a ) an oval - shaped filling defect was noted along the open arterial lumen when the sfr was placed ( fig .
we could pull down the device with the filling defect down to the distal va level below the origin of the pica without any fragmentation and/or migration of the clot distally .
we decided to detach the stent part at that level ( fig . 2c ) .
as the volume of the initial infarct was significant , aspirin monotherapy was started without anti - coagulation which could not be initiated due to combined gastro - intestinal tract bleeding during the acute phase . on his discharge from the intensive care unit ,
the sfr is a self - expanding stent retriever designed for mechanical thrombectomy and restoration of blood flow in patients with acute ischemic stroke .
the recommended usage is in conjunction with at least an 8-french balloon guide sheath and aspiration , so as to reduce the risk of clot fragmentation and distal embolization during device retrieval .
however , for vertebrobasilar application , the small size and tortuosity of the vertebral artery makes cannulation very difficult . due to this inherent limitation ,
clot fragmentation and migration occur quite frequently during use of stent retrievers in patients with bao .
attempt flow arrest using a balloon - tipped catheter of a smaller caliber ( o.d . ) , which is , however , not currently possible due to its unavailability .
this could be the best solution , however , due to the limitation of the inner diameter , there might be some limitation in its ability to aspirate .
another possible solution is the use of another type of thrombectomy device , such as the penumbra aspiration device ( penumbra , inc . , alameda , ca
, usa ) or the merci device ( concentric medical , mountain view , ca , usa ) .
however , we do not believe that anyone would go back to the merci device again as , actually , the reported successful recanalization rate using the merci device is only 57.3% and with a mortality rate of 34% [ 4 , 5 ] .
therefore , the penumbra aspiration catheter should be selected as the first - line device for distal bao as the reported successful recanalization rate is 81.6% with the 90-day mortality rate being 32.8% [ 6 , 7 ] . however , as we previously mentioned , that device also has the problem of clot fragmentation and migration unless it has the assistance of proximal flow arrest .
reported cases have suggested as one of the useful options for mechanical thrombectomy in acute bao .
we can retrieve the device catching the clot below the vertebrobasilar junction ( vbj ) and insert a compliant occlusion balloon into the basilar trunk via the contralateral va . by occluding the vbj
, we can protect the artery from distal migration while removing the device and clot through the guiding catheter .
in addition to those options , we would like to add to the list this technical variation of using sfr . we believe this ' intentional device detachment technique ' has several advantages over other methods .
for example , we can minimize the procedure time and can achieve antegrade flow as soon as the device is placed and then left open afterwards . as the device was pulled back just once , we can thus minimize potential endothelial damage .
most of all , this technique may minimize the risk of clot fragmentation and subsequent distal embolization which occurs quite frequently when using the current techniques .
however , as we experienced in our patients , the requirement for antiplatelet therapy due to the residual stent segment , could be the most significant disadvantage of this technique .
when the infarct volume is not large , as it was in our patient 1 , the use of dual antiplatelets would not pose a significant problem .
however , if the volume is large , as it was in our patient 2 , it would pose a difficult clinical decision - making issue due to the potential risk of hemorrhagic transformation .
moreover , as both of our patients were , the clinical decision would be much more difficult when a patient required anticoagulation , and which could be quite common in acute stroke patients .
however , since many clinicians have already experienced successful use of various , self - expanding stents for the treatment of acute ischemic stroke before the stent retriever became available , this technique could be an option for this particular situation of bao .
clot fragmentation and distal migration frequently occurs during application of the solitaire fr system for acute bao due to the lack of proximal flow arrest during retrieval .
the problem can be eliminated using the ' intentional device detachment technique ' which can minimize the time to recanalization and thus easily reduce the potential for endothelial damage . | acute , distal , basilar artery occlusion is a challenging neurovascular emergency .
there have been several reports regarding the successful application of the solitaire fr device for treating this lesion . however , due to the lack of a suitable , balloon - tipped , guiding catheter for the vertebral artery , during this procedure we frequently experience the occurrence of clot fragmentation and distal migration
. there may be some technical solutions to solve this problem .
the purpose of this report is to present a technical variation of using the solitaire fr , and which is referred to as the ' intentional device detachment technique . '
as a clot tends to re - embolize during its passage through the tortuous cranio - cervical junction level of the vertebral artery or its passage through the tip of the guiding catheter , due to the lack of proximal flow arrest , we thought that not removing the stent segment of the device which is capturing the clot could avoid this problem .
we were able to successfully apply this technique in two cases .
we believe that this technique can be a possible technical option for using the solitaire fr device when a patient has little concern regarding the subsequent use of antiplatelets . |
the physical stimuli that represent the model input variables are : physical velocity of monitor in space m ; velocity of the image ( grating ) on the monitor r ; and eye velocity in space e. the psychophysical constants of the model are : the weber fractions for the difference between retinal and reference signals w , and for the difference between two retinal velocity signals w ; and a stimulus - dependent gain factor g for the visual perception of velocities
. let
\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ \theta { \left ( { x , t } \right ) } $ $ \end{document } be a function defined by :
\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ \theta { \left ( { x , t } \right ) } = 0{\text { if } } { \left| x \right| } < t\quad { \text{and}}\quad \theta { \left ( { x , t } \right ) } = x - t $ $ \end{document } otherwise .
the perceived velocity of the monitor in space is related to the difference between the retinal velocity of the monitor vmon / ret = e m , and the reference signal vref which is equal to e for a still observer and to e + vhead / space for a moving observer : \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ \hat{v}_{{{\text{mon / space } } } } = \theta { \left ( { v_{{{\text{ref } } } } - v_{{{\text{mon / ret } } } } { \text { , jnd}}_{1 } } \right ) } , $ $ \end{document}where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ { \text{jnd}}_{1 } = - { \text{sign}}(v_{{{\text{mon / ret } } } } ) \,w{\kern 1pt } { \sqrt { v_{{{\text{ref } } } } ^{2 } + v_{{{\text{mon / ret } } } } ^{2 } } } .
$ $ \end{document}the perceived velocity of the grating in space is related to the difference between the retinal velocity of the grating vgrat / ret e ( m + r ) , and the reference signal vref : \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ \hat{v}_{{{\text{grat / space } } } } = \theta { \left ( { v_{{{\text{ref } } } } - v_{{{\text{grat / ret } } } } { \text { , jnd}}_{2 } } \right ) } , $ $ \end{document}where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ { \text{jnd}}_{2 } = - { \text{sign}}(v_{{{\text{grat / ret } } } } ) \,w{\kern 1pt } { \sqrt { v_{{{\text{ref } } } } ^{2 } + v_{{{\text{grat / ret } } } } ^{{\text{2 } } } } } . $ $ \end{document}the perceived velocity of the grating relative to the monitor is related to the difference between the two perceived velocities in space , using a jnd based on the difference between the two retinal signals involved .
these are assumed to be : the retinal velocity of the monitor vmon / ret = e m ; and the velocity difference between the image of the monitor and the grating within it vdelta = (m r ) .
thus : \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ \hat{v}_{{{\text{grat / mon } } } } = \theta { \left ( { \hat{v}_{{{\text{grat / space } } } } - \hat{v}_{{{\text{mon / space } } } } { \text { , jnd}}_{3 } } \right ) } , $ $ \end{document}where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ { \text{jnd}}_{3 } = - { \text{sign}}(\hat{v}_{{{\text{mon / space } } } } { \text{)}}\,w_{\delta } \,{\sqrt { v_{{{\text{mon / ret } } } } ^{2 } + v_{{{\text{delta } } } } ^{2 } } } .
$ $ \end{document}this value is then to be factored by a stimulus - dependent gain g to model the experimentally measured perceived velocity of the grating on the monitor .
note that the model is deterministic and treats jnd s as signed values , the sign of which is defined as opposite to that of the perceived velocity of the monitor or grating in space . however , since we think of a jnd as intrinsic noise , it should be an interesting challenge to translate the model in more probabilistic terms . | when a slowly moving pattern is presented on a monitor which itself is moved , the pattern appears to freeze on the screen ( mesland and wertheim in vis res 36(20):33253328 , 1996 ) even if we move our head with the monitor , as with a head mounted display ( pavard and berthoz in perception 6:529540 , 1977 ) .
we present a simple model of these phenomena , which states that the perceived relative velocity between two stimuli ( the pattern and the moving monitor ) is proportional to the difference between the perceived velocities of these stimuli in space , minus a noise factor .
the latter reflects the intrinsic noise in the neural signals that encode retinal image velocities . with noise levels derived from the literature
the model fits empirical data well and also predicts strong distortions of visually perceived motion during vestibular stimulation , thus explaining both illusions as resulting from the same mechanism . |
cells are complex systems whose physiology is governed by an intricate network of molecular interactions ( mis ) of which a relevant subset are protein protein interactions ( ppis ) .
signal transduction pathways and transcriptional regulation are typical examples of such biological processes mediated by ppi .
the mi database ( mint , ) was designed to collect experimentally verified ppis in a binary or complex representation . over the past four years , mint has undergone a profound reorganization of both the data model and the database structure , and has dramatically increased the number of stored interactions .
intact is an open source database designed for the storage , presentation and analysis of mis ( 1 ) ( schema available at ) .
the main advantages of adopting the intact model lie in its ability to represent protein complexes and other types of molecules as interaction participants , and in the ease with which new features and toolkits for data storage , representation and analysis can be added .
in addition mint , from now on , will be compatible with all the upgrades and tools developed by the intact consortium .
mint is based on the open source postgresql database management system ( ) . all the data can be accessed as java objects through the intact api by using ojb ( ) as the object - relational mapping tool . the web application is based on the struts framework ( ) running on the tomcat servlet container ( ) and the apache server ( ) .
since mint was first reported ( 2 ) the number of curated entries has grown significantly . given the new database structure , binary and n - ary interactions can now be represented .
the number of binary interactions has increased > 20-fold ( figure 1 ) . as of september 2006 , more then 95 000 physical interactions involving 27 461 proteins from 325 organisms are stored in mint ( figure 2 ) . although , 90% of the interactions stored in the database are the result of large scale , genome wide experiments , the value of mint resides in the high number of curated articles , each of which reports a small number of interactions .
this is reflected in the steady increase of curated articles that is mainly due to the curation of publications describing low - throughput experiments ( figure 1 ) .
the mint curation team consists of two full - time and one part - time curators .
this is not sufficient to capture all the interaction information steadily reported in research articles .
thus , we have chosen to focus our efforts on consistently curating all the issues of febs letters ( since january 2005 ) and embo journal and embo reports ( since january 2006 ) .
this choice was made in agreement with the other members of the international molecular - interaction exchange consortium ( imex ) , including dip ( 3 ) , intact ( 1 ) , mpact ( 4 ) and bind ( 5 ) .
imex aims at avoiding work overlaps , at sharing the curation workload and at exchanging completed records on mi data .
the graph on the left represents the growth in the number of interactions stored in mint .
the pie charts represent the number of interactions stored in mint for the different species .
since january 2006 , the syntax and the semantics for data representation have been provided by the proteomics standards initiative - molecular interaction ( psi - mi 2.5 ) standards .
the psi workgroup develops and maintains a common data standard allowing users to retrieve all relevant data from different data providers and to perform comparative analysis ( 6 ) .
each stored interaction represents , according to the psi - mi standards , a physical interaction , a direct interaction or a co - localization .
all the database records created before january 2005 underwent a drastic quality control performed by the new mint curation staff composed of phd level curators .
all the previous entries were re - curated according to the new psi - mi standard .
entries that could not be updated according to psi - mi standards were deleted from the database in order to maintain a high quality dataset .
the mint curation reference manual is being developed in collaboration with the other imex partners and is available at .
the new data submission html forms benefit from an improved automatic check based on curation rules .
this ensures that mandatory fields are filled and that annotated ranges or residues are consistent with the protein length reported by uniprot .
in addition , for the purpose of ensuring high fidelity annotation , every new entry derived from low - throughput experiments undergoes a further validation step performed by a different curator before release to the public .
the new web - based interface includes a number of improvements and enhancements allowing a more efficient database exploration .
most notably , the query can be based on protein or gene names , uniprot keywords or identifiers of external databases : uniprotkb , pdb , ensembl , flybase , sgd , wormbase , omim , huge , pubmed and reactome .
it is also possible to query species specific datasets ( mammalian , saccharomyces cerevisiae , caemorhabaditis elegans , drosophila melanogaster , viruses ) .
finally , a sequence similarity search ( blast ) can also be performed to search for proteins which are homologous to the query protein .
the query results are displayed in a table showing in the left frame a summary of the protein features reported in uniprot and , in the right frame , the list of the interaction partners curated in mint .
the interactions can be displayed graphically by an enhanced version of the mint viewer , a java applet derived from the applet graph ( ) . the viewer represents the interactions by lines ( edges ) and nodes ( proteins ) , and assigns the nodes a size proportional to the protein 's molecular weight and a color which depends on the species .
the graph displayed by the viewer can be expanded and edited interactively by moving or deleting nodes .
proteins linked to omim are now highlighted in red . in order to attribute a reliability index to the reported interactions
, we have also assigned each interaction a confidence level , based on the experimental detection method and experimental conditions .
the results of the analysis performed in the mint viewer can be captured in different formats ready for export : psi1.0-xml , psi2.5-xml , flat - file , osprey .
mint is now also complemented by homomint ( 7 ) , an inferred human protein interaction network where interactions discovered in model organisms ( and collected in mint ) are mapped onto the corresponding human orthologs . through the mint web pages
a web service allows direct computational access so as to freely retrieve interaction networks in different formats : flat - file , psi1.0-xml , psi2.5-xml .
it is also possible to download specific subsets of the database based on the taxonomy of the interactors . | the molecular interaction database ( mint , ) aims at storing , in a structured format , information about molecular interactions ( mis ) by extracting experimental details from work published in peer - reviewed journals . at present
the mint team focuses the curation work on physical interactions between proteins .
genetic or computationally inferred interactions are not included in the database . over
the past four years mint has undergone extensive revision .
the new version of mint is based on a completely remodeled database structure , which offers more efficient data exploration and analysis , and is characterized by entries with a richer annotation . over the past few years the number of curated physical interactions has soared to over 95 000 .
the whole dataset can be freely accessed online in both interactive and batch modes through web - based interfaces and an ftp server .
mint now includes , as an integrated addition , homomint , a database of interactions between human proteins inferred from experiments with ortholog proteins in model organisms ( ) . |
a 44-year - old male presented with complaints of pain and yellowish discharge in the right eye for one week .
he suggested that he may have been infected by his family members or neighbors , all of whom had conjunctivitis . on examination ,
anterior segment examination of the right eye revealed localized conjunctival and episcleral congestion in the temporal quadrant with an adjacent area of conjunctival ulceration on the bulbar conjunctiva [ fig . 1 ] and
the rest of the anterior segment and the posterior segment of the right eye were normal and so was the left eye .
localized conjunctival and episcleral congestion with conjunctival ulceration on the bulbar conjunctiva in the right eye conjunctival scraping was obtained from the ulcer under topical anesthesia and was subjected to gram 's stain , koh preparation , and acid - fast stain .
2 ] , while both koh and acid - fast stain revealed no fungal or bacterial elements .
gram 's stain showed the presence of gram - negative bacilli after 24 hours of incubation , confluent growth of gram - negative bacilli with smooth , glistening yellow colonies was observed on both blood [ fig . 3 ] and chocolate [ fig .
the organism was identified as s. maltophilia ( > 100 cfu/100 l ) using mini api i d 32gn strips ( biomrieux , new delhi , india ) .
this was also confirmed by negative oxidase , positive catalase , positive -glucose , positive -glucose , positive -maltose , positive -galactose , positive lipase , positive malonate , positive oxidative fermentative maltose , and negative oxidative fermentative mannitol tests .
confluent growth of gram - negative bacilli with smooth , glistening yellow colony was observed on blood agar confluent growth of multiple colonies on chocolate agar susceptibility testing was performed against ampicillin / sulbactum , amoxicillin , amoxy / clavulanic acid , pipercillin , pipercillin / tazobactum , ceftizidime , cefazolin , amikacin , tobramycin , gentamicin , ofloxacin , norfloxacin , ciprofloxacin , gatifloxacin , lomefloxacin , moxifloxacin , chloramphenicol , and co - trimoxazole by the kirby
the organism was resistant to aminoglycosides ( amikacin , tobramycin , and gentamicin ) and sensitive to quinolones ( ciprofloxacin , norfloxacin , ofloxacin , gatifloxacin , moxifloxacin , except lomefloxacin ) and co - trimoxazole .
topical tobramycin was discontinued in view of aminoglycoside resistance , and ciprofloxacin eye ointment along with oral co - trimoxazole twice a day was added for a period of two weeks .
s. maltophilia is an opportunistic ocular pathogen which is known to cause conjunctivitis , keratitis , and endophthalmitis .
it was , however , sensitive to most quinolones and co - trimoxazole , and the patient responded well to treatment with both .
reported that most infections caused by this organism occur in patients with ocular compromise , and the characteristically resistant antibiogram of s. maltophilia limits the therapeutic options .
our case did not have any ocular compromise , but the antibiogram susceptibility showed similar results .
timely identification of the organism is important in the management of ocular infections caused by s. maltophilia .
das et al . have reported a successfully treated case of endogenous endophthalmitis due to s. maltophilia infection with antibiotic sensitivity - guided antibacterial therapy .
stenotrophomonas infections , especially conjunctivitis / conjunctival ulcer , have a good prognosis if treated appropriately . to conclude , we report , to the best of our knowledge , the first case of conjunctival ulcer caused by s. maltophilia that resolved completely without any morbidity owing to early recognition and appropriate treatment .
it would thus be prudent to keep in mind s. maltophilia as a possible pathogen in the etiology of conjunctival ulcer . | we report a case of unilateral conjunctival ulcer due to stenotrophomonas maltophilia infection in an immunocompetent individual . a 44-year - old male presented with complaints of pain and yellowish discharge in the right eye for one week .
patient underwent complete ophthalmic evaluation and relevant laboratory investigations .
anterior segment examination revealed localized conjunctival and episcleral congestion with conjunctival ulceration on the bulbar conjunctiva in the right eye .
gram 's stain revealed gram - negative bacilli .
culture and sensitivity revealed s. maltophilia and responded well to topical moxifloxacin with systemic co - trimoxazole therapy . |
proprioceptive neuromuscular facilitation ( pnf ) is a technique used to improve lower - limb
muscle strength and gait function .
neuromuscular joint facilitation ( njf ) is a new
therapeutic exercise based on kinesiology , which is used to increase strength , flexibility ,
and range of motion ( rom ) .
njf integrates the facilitation element of pnf and the joint
composition movement , with the aim to improve the movement of the joint through passive
exercise , active exercise , and resistance exercise1 .
the characteristics of njf emphasize the
final rotation movement to improve the function of the knee joint .
, njf intervention has an immediate effect on knee muscle force and
iemg reaction time2 , 3 , and it not only decreased pain severity but also improved the
walking ability of elderly subjects with knee osteoarthritis4 .
the aim of this study was to investigate the change in tibial rotation function during
walking in younger persons after neuromuscular joint facilitation treatment .
the subjects
characteristics are detailed in table
1table 1.subject characteristics ( n=12)age ( yrs)height ( cm)weight ( kg)21.3 2.5165.8 9.659.8 10.321.2 2.7166.2 6.258.0
the purpose and contents of this
research were explained to the subjects , and they gave their informed consent to participate
in the study .
the study was approved by the research ethics committee of the international
university of health and welfare ( iuhw 12 - 197 ) .
values are mean standard deviation to measure the rotational function of the tibia during walking , subjects were asked to walk
at a self - determined velocity .
the angular velocity of tibial internal and external rotation
was measured over the gait cycle .
eight - channel small wireless motion recorders ( mvp - rf8-bc ,
microstone inc . ) were used to collect the tibial internal and external rotation data .
six - axis motion sensors were set on the proximal portion of the femur lateral condyle and
the fibula head of the right lower limb .
strong double - sided tape and an elastic bandage
were used to affix the 6-axis motion sensor to subjects skin .
in addition , two pressure
sensors set on the heel and toe of the right foot were used to separate the stance phase and
swing phase of the gait cycle . in the control measurement ,
the subjects were asked to walk at a self - determined velocity ,
and the degree of tibial internal and external rotation over 10 seconds was measured . then
after a 5-minute rest , the subjects were asked to repeat the walk .
the same measurements
were carried out . in the njf intervention measurement , 1 week after the control measurement
, the same
subjects were asked to walk , and the degree of tibial internal and external rotation over 10
seconds was measured .
two knee patterns of njf were used : the knee extension - tibial external
rotation ( e - er ) pattern and the knee flexion - tibial internal rotation ( f - ir ) pattern .
each
pattern was performed three times at random as a passive exercise and as a resistance
exercise . in the njf intervention group ,
both proximal resistance and distal resistance were
performed by a physiotherapist . for data processing ,
when the heel of the right lower limb
was on the ground , the angle of the knee joint was set at 0. the maximum relative angular
velocities of tibial internal and external rotation were measured over one gait cycle .
two - way repeated - measures analysis of variance ( anova ) was used to test for statistically
significant differences , and the factors were intervention and measurement ( control or njf ) .
if any significant interaction was found , a paired t - test was performed to compare the
outcome indicators before and after the intervention .
the maximum relative angular velocities of tibial internal and external rotation are shown
in table 2table 2.comparison of each measurement item before and after intervention ( n=12)beforeafternjfone gait cyclemaximum degrees of tibial internal rotation ( )19.1 5.916.3 7.4**maximum degrees of tibial external rotation ( )3.6 2.95.4 3.2*the total degrees of tibial rotation ( )22.7 6.721.6 8.0stance phasemaximum degrees of tibial internal rotation ( )18.9 5.915.7 7.6**maximum degrees of tibial external rotation ( )1.3 2.23.2 2.8*the total degrees of tibial rotation ( )20.2 7.218.9 8.5swing phasemaximum degrees of tibial internal rotation ( )16.4 8.113.4 8.7**maximum degrees of tibial external rotation ( )3.1 2.74.3 3.7the total degrees of tibial rotation ( )19.5 7.917.7 7.6controlone gait cyclemaximum degrees of tibial internal rotation ( )19.5 6.318.6 7.2maximum degrees of tibial external rotation ( ) 3.3 2.2 2.7 2.6the total degrees of tibial rotation ( )22.8 6.821.3 7.9stance phasemaximum degrees of tibial internal rotation ( )19.0 6.418.1 7.4maximum degrees of tibial external rotation ( ) 1.0 2.0 1.1 1.5the total degrees of tibial rotation ( )20.0 7.519.2 7.9swing phasemaximum degrees of tibial internal rotation ( )17.1 8.116.5 7.6maximum degrees of tibial external rotation ( ) 2.9 2.0 2.2 2.6the total degrees of tibial rotation ( )20.1 8.118.7 8.2values are mean standard deviation . comparison before and after intervention : * p<0.05 ; * * p<0.01 .
two - way anova revealed significant interactions among the time of one gait
cycle , the degrees , and the maximum relative angular velocities of tibial internal and
external rotation .
the degrees of tibial internal rotation were reduced , and the degrees of
tibial external rotation were increased by the njf intervention .
in this study , novel angular velocity sensors were used to calculate the relative angular
velocities of tibial internal and external rotation , and the immediate effects of njf
intervention on the knee movement pattern were demonstrated by objective data .
compared with that in the control group , the degree of tibial internal rotation was
significantly reduced in the njf group , the degree of tibial external rotation was
significantly increased , and the time of a gait cycle was significantly decreased .
these
results may be attributable to the improvement of periarticular muscle function by the
application of proximal resistance .
the alignment of the knee joint capsule , the function of
periarticular muscles of the knee joint , and the knee position sense were improved ;
therefore , the maximum relative angular velocities of tibial internal and external rotation
and the time of the gait cycle changed significantly .
these results suggest that njf with proximal resistance training can be used as a novel
form of exercise to improve knee joint function and walking ability . | [ purpose ] the aim of this study was to investigate the change in tibial rotation during
walking among young adults after neuromuscular joint facilitation therapy . [ subjects and
methods ] the subjects were twelve healthy young people ( 6 males , 6 females ) .
a
neuromuscular joint facilitation intervention and nonintervention were performed .
the
interventions were performed one after the other , separated by a 1-week interval .
the
order of the interventions was completely randomized .
the rotation of the tibia during
walking was evaluated before and after treatment .
[ results ] the neuromuscular joint
facilitation group demonstrated increased lateral rotation of the tibia in the overall
gait cycle and stance phase , and decreased medial rotation of the tibia in the overall
gait cycle , stance phase , and swing phase after the neuromuscular joint facilitation
intervention . in the control group
, there were no significant differences .
[ conclusion ]
these results suggest neuromuscular joint facilitation intervention has an immediate
effect on the rotational function of the knee . |
the symposium was organised by the clinical trials and evaluation unit , royal brompton and harefield nhs trust ( uk ) , in collaboration with the national heart and lung institute ( uk ) and the maryland medical research institute ( usa ) , and was held at the royal college of physicians , london ( uk ) .
the theme was ' advanced issues in the design and conduct of randomised clinical trials ' .
it brought together key people involved at the practice end of clinical trials ( co - ordinators , medical personnel , epidemiologists ) , scientists , members of regulatory bodies , industry representatives , publishers , statisticians and data analysers .
the symposium was divided into eight sessions addressing a range of topical and challenging issues in clinical trials : economic evaluation ; use of baseline data ; innovative designs ; the role of data and safety monitoring committees ; sample size issues in clinical trials ; meta - analysis as a guide to clinical practice ; regulatory issues ; and trials in developing countries .
the subject of clinical trials in developing countries was introduced briefly during the keynote address and covered in more detail in a session devoted to it .
two speakers , baruch brody and salim yusuf , gave their views on ethical and organisational issues , using specific examples of trials carried out in developing countries .
richard smith of the british medical journal addressed the subject of research and the publication of data from developing countries , highlighting the problems faced and outlining possible solutions .
professor david demets ( university of wisconsin - madison , usa ) outlined the role of the randomised clinical trial ( rct ) in the advancement of medical technology and therapeutics , and how it has evolved over the 50 years since it was first introduced . statistical methodology and information technology
have been developed to improve collation , monitoring , analysis and access to the huge quantities of data involved in today 's large international multi - centre trials .
the prospect for clinical trials has changed in recent years . in the usa , for example
, government funding has been levelling out except in few key areas , such as breast cancer and aids research .
investors and many patient advocacy groups keenly monitor trial activity , and new policies on trial monitoring are being debated in the us congress . in this changing environment
existing standards need to be re - evaluated in particular areas of medical technology such as medical devices , new procedures and alternative medicine , which demets felt were not properly regulated .
he stressed that the development of revised standards should not result in high costs for industry , which have become a problem in the testing and approval of new drugs .
demets also pointed out emerging areas likely to affect medical technology , such as the potential impact of genomics : if utilised constructively , results from genomics research could lead to the design of better , more accurate , treatment strategies and efficient trials .
the situation of developing nations contrasts with this vision of high - cost technological advancement in highly developed westernised countries .
demets stressed the need to address the often complicated ethical , moral and logistical issues involving clinical trials in these countries .
dr baruch brody ( baylor college of medicine , usa ) explored the concept of medical imperialism in the conduct of trials in developing countries .
he used as a direct example the criticisms raised of recent clinical trials for the prevention of vertical transmission of hiv in developing countries .
the proposed revision of the declaration of helsinki states that the control group ' should be assured that they will not be denied access to the best treatment otherwise available to him or her ' .
brody felt that the revision would be more plausible if it specified ' .... in light of the practical realities of health care resources available in that country ' .
he felt this would force the focus onto issues of justice and less on what should be provided or actually is provided . coercion .
if participants join a trial simply to receive treatment normally unavailable , and so not on a strictly voluntary basis , does this imply coercion ?
brody dismissed this point , explaining that coercion generally implies a threat and simply offering someone a great opportunity should not be deemed unfair or coercive .
exploitation . is the treatment being tested unlikely ever to be available or of real use to participants ?
it is generally accepted that clinical trials should ideally be carried out in areas where the host community is likely to benefit from a positive outcome and where the treatment will be reasonably available . if not , and the results are likely to benefit only the richer developed countries carrying out the trial , the host population is being exploited .
should avoidance of exploitation be an ideal , or should it be a requirement prior to ethical approval
? how stringent should the guidelines be ? who needs to be protected from exploitation -the trial participants only or the whole country in question ?
brody pointed out that imposition of such long - term conditions might discourage drug companies from conducting such trials , because of the high cost of making the treatment available and accessible throughout the country .
, it is the individual participants in trials who are at highest risk of exploitation and it is their long - term welfare , which should be of primary importance .
one delegate felt there were arguments for not getting involved in trials in developing countries .
trialists , he said , should be extremely cautious before considering conducting trials in developing countries , pointing out some of the pitfalls involved : less than ideal data collection , false reporting by patients and theft of supplies . in reply ,
brody pointed out that the critical public health issues plaguing many third world countries outweighed these considerations .
he stated that it should be the moral imperative of richer developed nations to continue carrying out trials that benefit the participants in these countries , regardless of potential pitfalls .
dr salim yusuf ( mcmaster university , canada ) started his talk by giving an example from his personal experience with the emeras / ecla trials carried out in south america , which demonstrated advantages to carrying out clinical trials in developing countries .
this project showed that simple well - organised trials paid off well above expectations . with the help of local staff it resulted in excellent quality data collection and follow - up .
it was also the impetus for setting up ' with minimum funding but maximum zeal and determination ' other local projects and spin - off studies , data registries , local evidence - based clinical forums and resulted in an overall increase in clinical awareness .
he discussed the large successful high - quality trials carried out in developing countries such as india and china .
conditions there may be simpler and more suitable for certain trials than in other countries , yielding high - quality data .
he noted that , although more time was often needed to set up these trials and to train staff , the ' cleanliness ' of data and the diligence of follow - up could be at least as good as that of equivalent trials in western countries .
this was often due to the enthusiasm and motivation of local staff to address the very real problems existing in their communities .
yusuf proposed several general issues for consideration when attempting to design international trials involving developing countries : is the disease similar in different countries ?
( epidemiological data are required to answer this question . ) is the trial relevant to the country : are the risk factors the same , is the treatment relevant and are the outcomes approximately the same ? do the culture and infrastructure exist to carry out this trial ?
determining the difference between ' wants ' and ' needs ' , yusuf felt , is crucial to providing effective health care solutions in a developing country .
western nations should be aiming to improve long - term healthcare in developing countries rather than providing ' quick - fix ' short - term solutions .
in particular , he mentioned the expansion of clinical research organisations ( cros ) into developing countries .
it is a damaging influence if they are there simply to carry out trials as cheaply as possible , in order to maximise profits , without real concern for the welfare of the local population .
he made it clear that organisers of trials in developing countries should aim to make the trials as simple as possible , and that it was crucial to understand local conditions : geography , infrastructure limitations , traditions , social organisation and politics , and to aim to work efficiently and sensitively within them .
long - term commitment to the project is essential , as is the understanding that more hands - on input would be needed than in developed countries , at all levels of the project .
trials in developing countries should not become a new form of neo - colonialism , however ; researchers should see their role as helping , guiding and teaching , but not taking control . in concluding this inspiring and passionate talk
, yusuf urged that trials in developing countries were possible and that the key was in the careful planning of large simple trials .
richard smith ( chief executive , british medical journal ) addressed the disparities of publishing research from the developed compared to the developing world .
he began with the statistic that , 20 years from now , 80 - 90% of all disability - adjusted life years lost would be in the developing world , as a result of the escalating levels of disease spread in areas such as africa , india and in southeast asia . and yet by comparison only a minute fraction of relevant research may be carried out in these countries ( he estimated less than 1% ) .
what little research is done is often carried out on the diseases of the richer developing countries rather than the poor .
a bmj editors ' survey of 33 african research institutes brought to light what researchers there considered their biggest obstacles : poor institutional organisation , lack of funding , hopeless career structure , lack of mentors and support and very little research culture . in many african nations
, research is often regarded as a luxury rather than a necessity - possible only when there is money to spare . regarding publishing ,
barriers perceived were the use of english as the language of publication , lack of guidance in the preparation of papers , a fear of criticism by editors of journals in the developed world , and ignorance both of the way journals operate and of which would be suitable for publishing their research .
they perceived a bias against research from their part of the world and felt that reviewers often did not understand the special difficulties of carrying out research in the developing world .
he predicted that , in 5 years , publication of most research ( including clinical trials ) would not take place in the paper form of journals , but on forums such as pubmed central ( ) or biomed central ( ) .
he felt sure some version of this form of publishing would " play out " in the long run .
smith felt that , at present , most publishers were unfairly exploiting the system and actually devaluing it by breaking up research information . in the current system researchers
do 99% of the work involved in trials , then edit and review manuscripts , and the copyright is then handed over to the journal .
the academic community must then often pay high prices to access and archive this research information .
he felt that this was less than ideal , ' sucking out of the system without giving anything back ' . in developing countries
the world wide web has facilitated accessibility to data from different sources simply and cheaply .
sites such as pubmed central and biomed central would potentially allow all research data to become easily available regardless of journal bias .
an editor would not have to consider the journals ' readership , issue lengths and other matters unrelated to the research itself .
this is good news for research from the developed world , which sometimes is of interest only to readers in the originating region and which may not meet the needs of a general readership .
the material would be freely available to everyone with internet access - the availability of which is growing exponentially around the world .
journals , he felt , could become more accessible to the developing world : by making internet access free to users in poorer regions , and by having regional editions ( where feasible ) .
smith also proposed that the standards applicable to research , and in particular to trials , in the developed world could differ for research generated in less developed countries .
such trials are being carried out under different conditions and their aims are likely to be different .
he pointed out , for example , that research done in community medicine is evaluated differently from laboratory research .
this does not have to imply lower standards -just different sets . despite this proposal ,
smith suggested that all trials published should conform to certain basic ethical guidelines and information should be fully disclosed .
although this was only one of the many important issues raised at this symposium , it is nevertheless an important and complicated subject deserving attention and discussion .
one point raised many times was the huge disparity in resources devoted to clinical trials in the developed world compared with those in the underdeveloped world , where the level of effective and realistic treatment for major population - threatening diseases lags far behind acceptable levels .
further discussion of these issues at future symposia should help to target trial resources more fairly towards areas of greatest need . | this symposium provided a useful forum for the discussion of issues relating to the design and conduct of clinical trials .
there is a need for greater awareness of the complexity of modern day trials , in which a host of statistical , logistical , regulatory and ethical issues are involved .
issues discussed ranged from the effect of sample size on the outcome , and subgroup analysis , to defining and maintaining discrete endpoints . some useful debate centred on the use of meta - analysis and the current limitations of combining information from different data sets .
this brought up the subjects of trial registries and raw data repositories for all clinical trials .
progress and relevance of the cochrane collaboration were reviewed .
the economics of clinical trials was another important topic .
regulatory issues such as the role of data and safety monitoring boards ( dsmb ) and the guidelines in place for effective data monitoring and progress analysis were discussed .
representatives of government organisations and industry gave both european and american perspectives .
this report however focuses specifically on the section devoted to the subject of clinical trials in developing countries . |
retrograde root canal filling following apicoectomy is an important procedure , aimed at hermetically sealing the root canal against the leakage of irritants from the canal into the periapical tissues .
thus , it is important to choose a biocompatible root - end filling material with high sealing ability .
evaluation of the marginal adaptation of filling materials with dentinal walls can provide valuable information about their sealing ability .
several root - end filling materials have been used such as amalgam , gutta - percha , zinc oxide - eugenol cements , glass ionomer , composite resins , calcium hydroxide cements , and mta .
mta is a mixture of dicalcium silicate , tricalcium silicate , tricalcium aluminate , tetra calcium aluminoferrite , bismuth oxide , gypsum and some other ingredients . since its introduction
, mta has shown superior sealing properties and marginal adaptation to other root end filling materials .
new root end filling materials are now available in dental market such as cem cement , biodentine and bioaggregate .
cem cement is composed of calcium hydroxide , calcium oxide , calcium phosphate , calcium sulfate , calcium carbonate and calcium silicate .
most of its constituents are similar to those of white mta ; the main difference is that bioaggregate is aluminum - free .
it is composed of tricalcium silicate , dicalcium silicate , calcium phosphate monobasic , and amorphous silicone dioxide with the addition of tantalum pentoxide , instead of bismuth oxide in mta , for radiopacity .
concluded that bioaggregate and mta had the same leakage properties . also , the antibacterial properties and biocompatibility of bioaggregate are the same as those of mta .
it is believed that biodentine has the same applications as mta and it may play a role in dentinal repair .
the powder includes tricalcium silicate , calcium carbonate and zirconium oxide as radi - opaque agent and the liquid consists of water , calcium chloride as an accelerator of setting and water reducing agent , and a modified poly carboxylate as superplasticizer .
with respect to the available dental literature and lack of information on the marginal adaptation of bioaggregate and biodentine and the effect of blood contamination on their properties , this study sought to evaluate and compare marginal adaptation of mta , cem cement , bioaggregate and biodentine .
preoperative mesiodistal and buccolingual radiographs of each root were taken to verify that only one root canal was present and that there were no internal or external resorption or calcifications .
all the specimens were immersed in 5.25% sodium hypochlorite for 24 hours and then they were stored in saline soaked gauze during the study period .
the crowns were cut with a high speed handpiece ( w&h , trend , austria ) and a long cylindrical diamond bur ( tizkavan , tehran , iran ) under water spray to prepare a standardized 15-mm tooth length from the root apex . to ensure that no cracks had been created in the specimens , they were all examined under a microscope ( carl zeiss , f170 , germany ) at 25x magnification .
working length was determined 1 mm short of the length determined by a # 10 k - file ( dentsply maillefer , ballaigues , switzerland ) with its tip visible at the apical foramen .
canals were shaped using the standard technique with protaper rotary files ( dentsply , maillefer , ballaigues , switzerland ) .
the preparation was started with sx - file and followed by s1 , s2 , f1 , f2 and f3 files . between each two files ,
the canal was rinsed with 2ml of 5.25% sodium hypochlorite and the final rinsing was done with 5ml of normal saline . after drying with paper points ( meta biomed co. ltd , korea ) ,
the canals were filled with size 30 , 0.02 taper gutta - percha ( meta biomed co. ltd , korea ) and ah26 sealer ( dentsply maillefer , ballaigues , switzerland ) using the conventional lateral compaction technique .
next , the teeth were wrapped in wet gauze and placed in an incubator at 37c for 24 hours for complete setting of the filling materials .
the apical 3 mm of roots was sectioned perpendicular to the long axis of the tooth with a high speed handpiece and and a long cylindrical diamond bur under water spray .
then , a 3-mm - deep root - end cavity was prepared using a retrotip ( e32d , nsk , japan ) attached to an ultrasonic unit ( varios 970 , nsk , japan ) under continuous irrigation with saline solution .
once the cavities were prepared , the teeth were randomly divided into 4 groups ( n=20 ) .
the filling materials , biodentine ( septodent , saint maur des fosss , france ) , cem cement ( bionique dent , tehran - karaj , iran ) , proroot mta ( dentsply maillefer , tulsa , ok , usa ) and bioaggregate ( innovative bioceramix , vancouver , canada ) were mixed according to the manufacturer s instructions . in order to have a homogenous mixture , the mixing procedure was carried out in capsules by means of an amalgamator adjusted at 4500 rpm for 30 seconds .
the filling materials were placed into root end cavities by a mta carrier ( medesy , maniago , italy ) and condensed with a plugger .
ten specimens in each group were placed in a 1.5 ml volume test tube with a cotton pellet moistened with blood ; the remaining 10 specimens were placed in a test tube with a cotton pellet moistened with normal saline .
thus , no sample was replaced and the materials in all samples were well condensed .
the specimens were stored in an incubator ( 37c and 100% humidity ) for 96 hours .
next , they were removed from the incubator and their complete setting was ensured using a size 15 k - file ( dentsply maillefer , ballaigues , switzerland ) .
the impression of the resected root surfaces and cavities were obtained using additional silicone ( panasil , kettenbach gmbh & co. kg .
, germany ) by means of customized mini - trays made by cutting the tip of test tubes .
the technique used for making the impressions was single stage with heavy and extra - light consistency .
the replicas were obtained by pouring the mixture of 2/1 w / w epoxy resin ( epoxyran8060 , tehran , iran ) and hardener ( epoxyran1946 , tehran , iran ) into the set impressions .
set replicas were evaluated for bubbles and in case of any imperfection , the pouring procedure was repeated .
replicas were mounted on aluminum stubs , sputter - coated with gold and examined and photographed at 40 to 2000 magnifications using sem ( s4160 , hitachi , japan ) . to measure the gap width at the tooth - filling interface , the area of each micrograph was divided into 16 portions ; on each portion , the greatest width was determined visually and measured with field emission scanning electron microscope ( fesem ) software , and recorded in micrometer in excel software ( version 2010 , microsoft , usa ) .
the mean value of these 16 measurements was calculated and recorded as the maximum mean value of the marginal gap for that specimen .
these calculations were repeated for each of the 10 specimens and the mean value of these 10 measurements was reported as the maximum mean value of marginal gap in each subgroup .
the effect of media ( normal saline or blood ) on the marginal adaptation in each group was analyzed using the mann - whitney test .
the marginal gap of the four materials in each medium was compared using the kruskal - wallis test with p<0.05 as the limit of significance .
preoperative mesiodistal and buccolingual radiographs of each root were taken to verify that only one root canal was present and that there were no internal or external resorption or calcifications .
all the specimens were immersed in 5.25% sodium hypochlorite for 24 hours and then they were stored in saline soaked gauze during the study period .
the crowns were cut with a high speed handpiece ( w&h , trend , austria ) and a long cylindrical diamond bur ( tizkavan , tehran , iran ) under water spray to prepare a standardized 15-mm tooth length from the root apex . to ensure that no cracks had been created in the specimens , they were all examined under a microscope ( carl zeiss , f170 , germany ) at 25x magnification .
working length was determined 1 mm short of the length determined by a # 10 k - file ( dentsply maillefer , ballaigues , switzerland ) with its tip visible at the apical foramen .
canals were shaped using the standard technique with protaper rotary files ( dentsply , maillefer , ballaigues , switzerland ) .
the preparation was started with sx - file and followed by s1 , s2 , f1 , f2 and f3 files . between each two files ,
the canal was rinsed with 2ml of 5.25% sodium hypochlorite and the final rinsing was done with 5ml of normal saline . after drying with paper points ( meta biomed co. ltd , korea ) , the canals were filled with size 30 , 0.02 taper gutta - percha ( meta biomed co. ltd , korea ) and ah26 sealer ( dentsply maillefer , ballaigues , switzerland ) using the conventional lateral compaction technique .
next , the teeth were wrapped in wet gauze and placed in an incubator at 37c for 24 hours for complete setting of the filling materials .
the apical 3 mm of roots was sectioned perpendicular to the long axis of the tooth with a high speed handpiece and and a long cylindrical diamond bur under water spray . then
, a 3-mm - deep root - end cavity was prepared using a retrotip ( e32d , nsk , japan ) attached to an ultrasonic unit ( varios 970 , nsk , japan ) under continuous irrigation with saline solution .
once the cavities were prepared , the teeth were randomly divided into 4 groups ( n=20 ) .
the filling materials , biodentine ( septodent , saint maur des fosss , france ) , cem cement ( bionique dent , tehran - karaj , iran ) , proroot mta ( dentsply maillefer , tulsa , ok , usa ) and bioaggregate ( innovative bioceramix , vancouver , canada ) were mixed according to the manufacturer s instructions . in order to have a homogenous mixture ,
the mixing procedure was carried out in capsules by means of an amalgamator adjusted at 4500 rpm for 30 seconds .
the filling materials were placed into root end cavities by a mta carrier ( medesy , maniago , italy ) and condensed with a plugger .
ten specimens in each group were placed in a 1.5 ml volume test tube with a cotton pellet moistened with blood ; the remaining 10 specimens were placed in a test tube with a cotton pellet moistened with normal saline .
thus , no sample was replaced and the materials in all samples were well condensed .
the specimens were stored in an incubator ( 37c and 100% humidity ) for 96 hours .
next , they were removed from the incubator and their complete setting was ensured using a size 15 k - file ( dentsply maillefer , ballaigues , switzerland ) .
the impression of the resected root surfaces and cavities were obtained using additional silicone ( panasil , kettenbach gmbh & co. kg .
, germany ) by means of customized mini - trays made by cutting the tip of test tubes .
the technique used for making the impressions was single stage with heavy and extra - light consistency .
the replicas were obtained by pouring the mixture of 2/1 w / w epoxy resin ( epoxyran8060 , tehran , iran ) and hardener ( epoxyran1946 , tehran , iran ) into the set impressions .
set replicas were evaluated for bubbles and in case of any imperfection , the pouring procedure was repeated .
replicas were mounted on aluminum stubs , sputter - coated with gold and examined and photographed at 40 to 2000 magnifications using sem ( s4160 , hitachi , japan ) . to measure the gap width at the tooth - filling interface , the area of each micrograph was divided into 16 portions ; on each portion , the greatest width was determined visually and measured with field emission scanning electron microscope ( fesem ) software , and recorded in micrometer in excel software ( version 2010 , microsoft , usa ) .
the mean value of these 16 measurements was calculated and recorded as the maximum mean value of the marginal gap for that specimen .
these calculations were repeated for each of the 10 specimens and the mean value of these 10 measurements was reported as the maximum mean value of marginal gap in each subgroup .
the effect of media ( normal saline or blood ) on the marginal adaptation in each group was analyzed using the mann - whitney test .
the marginal gap of the four materials in each medium was compared using the kruskal - wallis test with p<0.05 as the limit of significance .
the mean value and standard deviation ( sd ) of the marginal gap in each group are summarized in table 1 .
there was no significant difference in the measured marginal gap between the 4 filling materials ( p>0.05 ) .
there was no significant difference between the effect of normal saline and blood on the marginal adaptation of the 4 different filling materials either ( p>0.05 ) ( figure 1 ) .
in general , the difference between the measured marginal gap in all 8 groups was not significant ( p>0.05 ) .
results of microleakage assessment of the 8 experimental groups
micrograph of root dentin - bioaggregate interface exposed to normal saline ( 200)micrograph of root dentin - bioaggregate interface exposed to human blood ( 200)micrograph of root dentin - biodentine interface exposed to normal saline ( 200)micrograph of root dentin - biodentine interface exposed to human blood ( 200)micrograph of root dentin - cem interface exposed to normal saline ( 200)micrograph of root dentine - cem interface exposed to human blood ( 200)micrograph of root dentine - mta interface exposed to normal saline ( 200)micrograph of root dentine - mta interface exposed to human blood ( 200 )
micrograph of root dentin - bioaggregate interface exposed to normal saline ( 200 ) micrograph of root dentin - bioaggregate interface exposed to human blood ( 200 ) micrograph of root dentin - biodentine interface exposed to normal saline ( 200 ) micrograph of root dentin - biodentine interface exposed to human blood ( 200 ) micrograph of root dentin - cem interface exposed to normal saline ( 200 ) micrograph of root dentine - cem interface exposed to human blood ( 200 ) micrograph of root dentine - mta interface exposed to normal saline ( 200 ) micrograph of root dentine - mta interface exposed to human blood ( 200 )
there are conflicting results reported in the literature about the relationship of marginal adaptation and sealing ability of root end filling materials .
some authors believe that there is no relationship between the marginal adaptation and the sealing properties of root end filling materials , while some others concluded otherwise [ 1,15 , 16 ] .
however , considering the controversial results and limitations , it seems that evaluating marginal adaptation of root end filling materials with root dentin can provide valuable information about their apical sealability .
evidence shows that mta as a root end filling material has an acceptable marginal adaptation , which is superior to that of other materials like amalgam , irm , super - eba and vitremer [ 13 , 1521 ] .
numerous studies have investigated different properties of cem cement , bioaggregate and biodentine including their antimicrobial properties , effects on reparative dentin , connective tissue reactions , cytotoxicity , chemotactic effects and bacterial leakage , and the results of these studies have been encouraging [ 6,811,2244 ] .
except one , there were no other studies on the marginal adaptation of these materials in comparison with one another .
there are some disadvantages with sem like its two dimensional nature and the potential separation of the filling material from the root dentin or crack formation in hard tissue when using high vacuum type . in order to overcome the two dimensional limitations , some researchers like torabinejad et al . and abdal et al .
used longitudinal sections in addition to cross sections ; but conflicting results were obtained using this method .
they attributed this to artificial gaps as the result of longitudinal sectioning [ 14,16 , 46 ] .
replicas were used in the current study since many reports are available on the successful use of this method .
producing replicas prevents expansion and contraction of tooth structure or root end filling material that occur during sputter coating and alter the results [ 1 , 13 , 1517 , 20 , 47 , 48 ] .
indicated that replicas like teeth showed artificial gaps at the interface of root end filling material and root dentin as the result of longitudinal sectioning . in a sem study ,
gondim et al . reported that hard tissue details were not lost in replicas when compared to teeth . in order to minimize the risk of crack formation in the specimens , ultrasonic device was used with no hand pressure .
another measure taken to control cracks was preparing the canals up to size f3 file so that after sectioning , the 3 mm diameter of the root end would fit the retrotip and this would diminish the strokes that could make the root susceptible to cracks . despite all these measures , the specimens were checked under a dental microscope at x25 magnification in different steps throughout the study . in a sem study ,
measured gap width at the interface of root end filling material and tooth on four points on a micrograph and the mean value of these four measurements was reported in micrometer as the gap width of that specimen .
the amount obtained for each specimen was calculated and the mean value was reported as gap width of the study group . the value reported for mta was 2.68 1.33m .
they studied replicas in both cross sections and longitudinal sections and reported the gap mean value as 1.59.615 m and 2.1410.530 m , respectively . to be accurate , in the current study
, the measurements were made in 16 portions and for each portion , the maximum gap value was reported .
the explanation may lie in the fact that all of the investigated materials had similar composition with calcium silicate as their main constituent .
for evaluation of the marginal adaptation of five root - end filling materials , materials containing calcium oxide ( mta and pc ) showed similar results .
another explanation for their similar marginal adaptation may be the method of mixing applied in the filling procedure that creates almost the same flow and consistency of filling materials . in the current study
, blood did not significantly affect the marginal adaptation of the root end filling materials . according to the dental literature , mta s physical properties like resistance to displacement and microhardness decrease by blood contamination , which may be due to the effect of blood on the configuration of crystals and prevention of acicular crystal formation .
it also has a short - term adverse effect on calcium hydroxide crystals [ 5054 ] .
two in vitro studies investigated the effect of blood on cem cement and reported its unfavorable effects on physical properties of cem .
they found that the mean dye leakage of mta contaminated with blood did not change significantly , which was in line with our results .
this result regarding the effect of blood can not be generalized to the in vivo condition ; because the duration of exposure of root end filling material to blood can not be exactly simulated in vitro . by preventing the blood from coagulation in vitro , the clinical situation can be better simulated . but to make it happen , using anticoagulant agents does not seem logical since their effect on root end filling material is not clear . however , some published studies reported unfavorable effects of citrate as an anticoagulant on mta setting .
this study showed that marginal adaptation of mta , cem cement , biodentine and bioaggregate was not adversely affected by blood contamination . | objectives : the aim of this study was to evaluate marginal adaptation of mineral trioxide aggregate ( mta ) , calcium enriched mixture ( cem ) cement , biodentine and bioaggregate in presence of normal saline and human blood.materials and methods : in this in - vitro experimental study , 80 extracted single - rooted human teeth were instrumented and filled with gutta - percha .
after resecting the root - end , apical cavity preparation was done and the teeth were randomly divided into 4 groups ( n=20)(a total of 8 subgroups ) .
root - end filling materials were placed in 3 mm root - end cavities prepared ultrasonically .
half the specimens in each group were exposed to normal saline and the other half to fresh whole human blood .
after 4 days , epoxy resin replicas of the apical portion of samples were fabricated and scanning electron microscopy ( sem ) analysis was performed to find gaps in the adaptation of the root - end filling materials at their interface with dentin .
the kruskal - wallis and mann - whitney tests were used for statistical analysis of data with p<0.05 as the limit of significance.results:there were no significant differences in marginal adaptation of the 8 tested groups ( p>0.05).conclusion : based on the results , blood contamination does not affect the marginal adaptation of mta , cem cement , biodentine or bioaggregate . |
an estimated 5.7 million american adults have heart failure , and the annual incidence is 10 per 1000 population in people above 65 years age .
survival estimates for heart failure are 50% at 5 years and 10% at 10 years , respectively .
the incidence of heart failure has remained stable , but survival has increased resulting in an increased prevalence among the elderly .
heart failure patients have frequent exacerbations requiring hospitalization and nearly 1 million hospitalizations for heart failure occur each year .
it is estimated that 2050% of patients with heart failure have normal left ventricular ejection fraction ( ef ) .
this study aims to study the hospitalized patients who have systolic heart failure to determine common electrocardiogram ( ekg ) changes and arrhythmias among them .
this is a retrospective analysis of patients with systolic heart failure admitted to our hospital .
we selected all admitted patients in our hospital with an ef < 50% based on echocardiography done at our hospital between january and july 2014 .
we then retrospectively reviewed the medical records of those patients and analyzed different variables such as age , sex , length of hospital stay , outcome , body mass index ( bmi ) , co - morbid conditions , vital signs , hematocrit , chemistry , lipid panel , and ekg abnormalities .
twelve - lead ekgs were studied and different variables such as pr , qrs , and corrected qt ( qtc ) intervals , rate , rhythm , and arrhythmias were analyzed .
patients with systolic heart failure defined as ef < 50% were characterized into two groups ; group one with an ef 35% and group two with an ef > 35% .
the demographic , baseline disease characteristics and ekg abnormalities of the study groups were compared with the chi - squared test for categorical and independent samples t - test for continuous variable . for each analysis ,
the demographic , baseline disease characteristics and ekg abnormalities of the study groups were compared with the chi - squared test for categorical and independent samples t - test for continuous variable . for each analysis ,
of total 157 patients with systolic heart failure 60.5% ( n = 95 ) were male and 63.7% ( n = 100 ) had an ef 35 .
the average bmi was 27.6 kg / m and 28.8% ( n = 45 ) were obese ; 25.8% ( n = 16 ) were female and 30.5% ( n = 29 ) were male . on admission
, 35% ( n = 55 ) had acute decompensation of heart failure , and decompensated heart failure was more common in patients with severe systolic heart failure ( p < 0.001 ) .
other common cardiac problems during admission were non - st - elevation myocardial infarction and atrial fibrillation / flutter and chest pain 7.6% ( n = 12 ) each .
about 2.5% ( n = 4 ) of patients presented with cardiac arrest and 30% ( n = 47 ) were admitted for noncardiac problems . among all patients ,
10.8% ( n = 17 ) had automatic implantable cardioverter defibrillator and 3.8% ( n = 6 ) had cardiac resynchronizing therapy device .
hypertension 82.8% ( n = 130 ) , diabetes mellitus 49% ( n = 77 ) , coronary artery disease 40.8% ( n = 64 ) , chronic obstructive pulmonary disease / asthma 22.3% ( n = 35 ) , stroke 12.1% ( n = 19 ) , peripheral artery disease 8.9% ( n = 14 ) , and human immunodeficiency virus 6.4% ( n = 10 ) were common co - morbidities .
about 65.6% ( n = 103 ) had the past or current history of smoking and 28% consumed alcohol .
about 85.5% ( n = 134 ) of patients were discharged and 12.7% ( n = 20 ) expired .
mortality was more common among females , 17% ( n = 11 ) than males , 9.5% ( n = 9 ) . moreover , among patients who had acute decompensated heart failure on admission , 3.6% ( n = 2 ) expired .
about 42% ( n = 66 ) had increased systolic or diastolic blood pressure on presentation and on analysis of laboratory values , 63.7% ( n = 100 ) were anemic , 51.4% ( n = 72 ) had elevated troponin , 43.9% ( n = 69 ) had elevated creatinine , 26% ( n = 41 ) had hyponatremia , and 12.7% ( n = 12 ) had hypokalemia .
in addition , 24.3% ( n = 34 ) had acetylated hemoglobin ( hbga1c ) > 7 , 18% ( n = 26 ) had cholesterol above 200 mg / dl , and 27.7% ( n = 39 ) had low - density lipoprotein above 100 mg / dl .
the study groups were similar in many aspects ; however , group one with severe heart failure had significantly higher rate of hypokalemia , elevated values of brain natriuretic peptide ( bnp ) , and acute decompensation [ table 1 ] . characteristics of patients based on ejection fraction the values are reported as number ( percentage ) or mean ( sd ) .
bmi = body mass index , bp = blood pressure , bnp = brain natriuretic peptide , sd = standard deviation , ef = ejection fraction a total of 147 ekgs were reviewed , 10 ( 6.3% ) were excluded from further analysis because they had electronic ventricular paced rhythm . on analysis ,
28.6% ( n = 42 ) had tachycardia , 21.9% ( n = 14 ) had prolonged pr more than 200 ms , 16.3% ( n = 24 ) had wide qrs > 120 ms , 70.7% ( n = 111 ) had prolonged qtc ( reference range qtc < 440 for male and qtc < 460 for female ) , 42.2% ( n = 62 ) had left axis , and 47.9% ( n = 70 ) had normal axis .
most common arrhythmias were sinus tachycardia which was found in 14.6% ( n = 23 ) and atrial fibrillation / flutter which was found in 13.4% ( n = 21 ) . among patients with atrial fibrillation / flutter , 57% ( n = 12 ) had rapid ventricular rate .
the left ventricular hypertrophy was a common abnormality found in 22.4% ( n = 33 ) followed by ventricular premature contraction ( vpc ) 18.4% ( n = 27 ) , atrial premature contraction ( apc ) 9.5% ( n = 14 ) , left bundle branch block ( lbbb ) 6.1% ( n = 9 ) , and right bundle branch block ( rbbb ) 4.8% ( n = 7 ) .
the two groups had statistically significant differences in qrs and qtc duration and occurrence of lbbb and vpcs [ table 2 ] .
electrocardiogram changes based on ejection fractions the values are reported as number ( percentage ) .
hr = heart rate , lvh = left ventricular hypertrophy , vpc = ventricular premature contractions , apc = atrial premature contractions , lbbb = left bundle branch block , rbbb = right bundle branch block , ef = ejection fraction , qtc = corrected qt
of total 157 patients with systolic heart failure 60.5% ( n = 95 ) were male and 63.7% ( n = 100 ) had an ef 35 .
the average bmi was 27.6 kg / m and 28.8% ( n = 45 ) were obese ; 25.8% ( n = 16 ) were female and 30.5% ( n = 29 ) were male . on admission
, 35% ( n = 55 ) had acute decompensation of heart failure , and decompensated heart failure was more common in patients with severe systolic heart failure ( p < 0.001 ) .
other common cardiac problems during admission were non - st - elevation myocardial infarction and atrial fibrillation / flutter and chest pain 7.6% ( n = 12 ) each .
about 2.5% ( n = 4 ) of patients presented with cardiac arrest and 30% ( n = 47 ) were admitted for noncardiac problems . among all patients ,
10.8% ( n = 17 ) had automatic implantable cardioverter defibrillator and 3.8% ( n = 6 ) had cardiac resynchronizing therapy device .
hypertension 82.8% ( n = 130 ) , diabetes mellitus 49% ( n = 77 ) , coronary artery disease 40.8% ( n = 64 ) , chronic obstructive pulmonary disease / asthma 22.3% ( n = 35 ) , stroke 12.1% ( n = 19 ) , peripheral artery disease 8.9% ( n = 14 ) , and human immunodeficiency virus 6.4% ( n = 10 ) were common co - morbidities .
about 65.6% ( n = 103 ) had the past or current history of smoking and 28% consumed alcohol .
about 85.5% ( n = 134 ) of patients were discharged and 12.7% ( n = 20 ) expired .
mortality was more common among females , 17% ( n = 11 ) than males , 9.5% ( n = 9 ) .
moreover , among patients who had acute decompensated heart failure on admission , 3.6% ( n = 2 ) expired .
about 42% ( n = 66 ) had increased systolic or diastolic blood pressure on presentation and on analysis of laboratory values , 63.7% ( n = 100 ) were anemic , 51.4% ( n = 72 ) had elevated troponin , 43.9% ( n = 69 ) had elevated creatinine , 26% ( n = 41 ) had hyponatremia , and 12.7% ( n = 12 ) had hypokalemia .
in addition , 24.3% ( n = 34 ) had acetylated hemoglobin ( hbga1c ) > 7 , 18% ( n = 26 ) had cholesterol above 200 mg / dl , and 27.7% ( n = 39 ) had low - density lipoprotein above 100 mg / dl .
the study groups were similar in many aspects ; however , group one with severe heart failure had significantly higher rate of hypokalemia , elevated values of brain natriuretic peptide ( bnp ) , and acute decompensation [ table 1 ] .
characteristics of patients based on ejection fraction the values are reported as number ( percentage ) or mean ( sd ) .
bmi = body mass index , bp = blood pressure , bnp = brain natriuretic peptide , sd = standard deviation , ef = ejection fraction
a total of 147 ekgs were reviewed , 10 ( 6.3% ) were excluded from further analysis because they had electronic ventricular paced rhythm . on analysis ,
28.6% ( n = 42 ) had tachycardia , 21.9% ( n = 14 ) had prolonged pr more than 200 ms , 16.3% ( n = 24 ) had wide qrs > 120 ms , 70.7% ( n = 111 ) had prolonged qtc ( reference range qtc < 440 for male and qtc < 460 for female ) , 42.2% ( n = 62 ) had left axis , and 47.9% ( n = 70 ) had normal axis .
most common arrhythmias were sinus tachycardia which was found in 14.6% ( n = 23 ) and atrial fibrillation / flutter which was found in 13.4% ( n = 21 ) . among patients with atrial fibrillation / flutter , 57% ( n = 12 ) had rapid ventricular rate .
the left ventricular hypertrophy was a common abnormality found in 22.4% ( n = 33 ) followed by ventricular premature contraction ( vpc ) 18.4% ( n = 27 ) , atrial premature contraction ( apc ) 9.5% ( n = 14 ) , left bundle branch block ( lbbb ) 6.1% ( n = 9 ) , and right bundle branch block ( rbbb ) 4.8% ( n = 7 ) .
the two groups had statistically significant differences in qrs and qtc duration and occurrence of lbbb and vpcs [ table 2 ] .
electrocardiogram changes based on ejection fractions the values are reported as number ( percentage ) .
hr = heart rate , lvh = left ventricular hypertrophy , vpc = ventricular premature contractions , apc = atrial premature contractions , lbbb = left bundle branch block , rbbb = right bundle branch block , ef = ejection fraction , qtc = corrected qt
in our study , a statistically significant prolongation of the qrs duration and qtc was seen in patients with severe systolic heart failure . in a swedish heart failure registry ,
qrs prolongation was more common in patients with reduced than with preserved ef and was an independent risk factor for mortality . in heart failure ,
neurohormonal , adrenergic , and cytokine systems are activated , and there is an alteration in ventricular architecture which leads to depressed left ventricular systolic function .
in systolic heart failure , the left ventricular dyssynchrony manifests as prolonged qrs on surface ekg and is associated with a worse prognosis .
prolongation of the qrs duration is associated with lower left ventricular ef and larger end - systolic and end - diastolic volumes , and is strong predictor of both pump failure and sudden death . in our study , the left bundle branch block and vpcs were more common in patients with severe systolic heart failure . in lbbb , the normal sequence of electric activation is reversed , and the right ventricle is depolarized before the left ventricle .
previous literature shows that lbbb is far more common than rbbb in patients with heart failure and among the patients with severe cardiomyopathy with ef < 30 , prolonged qrs and lbbb are independent predictors of increased total mortality .
studies have shown a high prevalence of vpc ( 82% ) in patients with heart failure , and they are associated with increased overall mortality . in our study , atrial fibrillation was found in 13.4% of patients , but ventricular arrhythmia was not observed .
previous studies have reported atrial fibrillation in 15 - 30% of patients with heart failure . over 80% of patients with congestive heart failure have frequent and complex ventricular arrhythmias documented on holter monitoring , and almost 50% demonstrate runs of nonsustained ventricular tachycardia . in our study , it is possible that we were not able to find ventricular tachycardia because we used ekgs on admission which might have missed ventricular arrhythmias .
the length of hospital stay and the outcome did not differ among the two groups ; however , potassium and bnp levels differed significantly among both groups . in a previous study of patients hospitalized for worsening systolic heart failure , serum potassium abnormalities were common at baseline .
elevated bnp has diagnostic , and prognostic significance in heart failure and some reports indicate that a bnp - guided strategy reduced the risk of heart failure - related death or hospital stay in patients with systolic heart failure .
the reported ef was a visual estimation on echo , which might be operator dependent .
furthermore , the ekg and echo demonstrate the cardiac picture at a given point of time and may fail to capture variability at different times .
the reported ef was a visual estimation on echo , which might be operator dependent .
furthermore , the ekg and echo demonstrate the cardiac picture at a given point of time and may fail to capture variability at different times .
in patients admitted with systolic heart failure , sinus tachycardia , and atrial fibrillation were a common arrhythmia . prolonged qrs and qtc on ekg was present in patient with severely depressed left ventricular systolic function .
further studies are needed to investigate arrhythmias in systolic heart failure and their prognostic significance .
| background : heart failure is a common condition that that leads to hospitalization .
it is associated with various atrial and ventricular arrhythmias.aim:the aim of this study is to find common arrhythmias and electrocardiographic changes in hospitalized patients who have systolic heart failure.materials and methods : this is a retrospective study of medical records , and electrocardiograms ( ekgs ) of 157 patients admitted to our hospital who had systolic heart failure with ejection fraction ( ef ) < 50% on echocardiogram . based on ef ,
the patients were divided into two groups ; one with ef 35% and the other with ef > 35% .
twelve - lead ekg of these patients was studied to identify common arrhythmia and demographic variables ; laboratory results were compared to identify the differences.results:a total of 157 patients with systolic heart failure , 63.7% had an ef 35% .
hypertension 82.8% , diabetes 49% , coronary artery disease 40.8% , chronic obstructive pulmonary disease or bronchial asthma 22.3% , and stroke 12.1% were common associated co - morbidities . on analysis of ekg , 28.6% had tachycardia , 21.9% had prolonged pr > 200 ms ,
16.3% had wide qrs > 120 ms , 70.7% had prolonged corrected qt ( qtc ) , and 42.2% had left axis deviation .
the most common arrhythmias were sinus tachycardia and atrial fibrillation / flutter which were found in 14.6% and 13.4% , respectively .
the left ventricular hypertrophy was a common abnormality found in 22.4% followed by ventricular premature contractions 18.4% , atrial premature contractions 9.5% , and left bundle branch block 6.1% .
patients with severe systolic heart failure had prolonged qrs ( p = 0.02 ) and prolonged qtc ( p = 0.01 ) as compared to the other group.conclusions:sinus tachycardia and atrial fibrillation / flutter were common arrhythmias in patients with systolic heart failure .
patients with severe systolic heart failure had statistically significant prolongation of the qrs duration and qtc interval . |
first described in 1976 , conjunctival mucoepidermoid carcinoma is a rare and highly aggressive variant of conjunctival squamous cell carcinoma which can often require enucleation or orbital exenteration.1,2 histologically , conjunctival mucoepidermoid carcinoma is characterized by cells with squamous differentiation accompanied by variable proportions of mucus - secreting cells . to our knowledge , there have been 42 previously reported cases of conjunctival mucoepidermoid carcinoma , although this probably underestimates the true incidence of the condition due to both clinical and histopathological misdiagnosis .
a case of this rare tumor has not been described from australia , thus we report the first case described from an australian center and discuss its significance .
a 56-year - old man with no background medical history or past ophthalmic history was referred by his general practitioner for a left nasal pterygium .
the lesion had been causing ocular irritation and had initially been reviewed by an ophthalmologist 10 years earlier . since that time , the patient reported that the lesion had slowly grown and his irritation had worsened . on examination ,
best - corrected visual acuity was 20/20 bilaterally and anterior and posterior segment examinations were unremarkable apart from a left conjunctival lesion .
this pearly white lesion was situated on the nasal limbus of the left eye and was circular in shape with a 4 mm diameter .
overall , the lesion had an appearance in keeping with an ocular surface squamous neoplasm and wide local excision of the lesion , and reconstruction with a superior autoconjunctival graft was recommended with adjunctive mitomycin c. this uncomplicated procedure was undertaken 3 weeks later .
histopathology of the operative specimen reported a possible low - grade mucoepidermoid carcinoma , and the specimen was referred to an ophthalmic pathologist who confirmed the diagnosis of low - grade conjunctival mucoepidermoid carcinoma 2 weeks later .
initial hematoxylin and eosin stains were followed by periodic acid - schiff diastase stains , which confirmed the mucinous components of the lesion ( figures 1 and 2 ) .
the specimen showed conjunctival and limbal tissue that was infiltrated with carcinoma at the limbus .
it was composed of islands of well differentiated epithelial cells showing both squamous and glandular differentiation with the glandular lumina containing inspissated mucoid material ( figure 1a ) .
a course of 0.04% mitomycin c was prescribed four times a day for 1 week , followed by only ocular lubricants for 1 week , followed then by another week of mitomycin c four times a day . on review 2 months after excision , there was no sign of ocular recurrence , and the patient had no ocular symptoms and was systemically well apart from some anxiety related to the possibility of distant spread of the tumor . a subsequent computed tomography scan of the head , neck , chest , abdomen , and pelvis ruled out any signs of regional or distant metastasis . on review
10 months after excision , the patient reported no ocular irritation or other ocular symptoms , had no signs of recurrence of the lesion or lymphadenopathy , and was otherwise systemically well .
in the most recent review on conjunctival mucoepidermoid carcinoma in 2006 , robinson et al reported 22 previously reported cases from the english literature . now including our own case , several other recent cases , and cases described in the non - english literature , to our knowledge there have been 43 reported cases of conjunctival mucoepidermoid carcinoma.217 of these total 43 cases ,
26 have been reported from north america , nine from europe , two each from india and saudi arabia , and one each from nigeria , people s republic of china , mexico , and now australia .
thirty - two cases involved men , and six involved women , with a mean age of 64 years .
the reports of five cases did not detail demographic information.5,8,10,16 the site of the lesion was the limbal conjunctiva in 26 patients ( 67% ) , other sites of the bulbar conjunctiva in nine patients ( 23% ) , and the palpebral conjunctiva in four patients ( 10% ) .
these lesions have had variable clinical appearances , from a pearly white bleb / nodule / mass ( 73% ) to a pedunculated lesion ( 8% ) , a raised conjunctival ulcer ( 11% ) , and also as an inflamed pterygium ( 8%).1,2 the reports of four cases did not detail lesion site or appearance.4,5,16 conjunctival mucoepidermoid carcinoma has recurred in 25 ( 58% ) of the 43 reported cases .
simple excision has been attempted initially in 23 cases , and recurrence has occurred in 19 of these cases ( 70% ) .
wide local excision has been attempted initially in nine cases , and recurrence has occurred in four of these cases ( 44% ) .
overall , exenteration / enucleation has been required in 28 of the 43 cases ( 65% ) for local control of the tumor . in terms of local invasion
, intraocular invasion has occurred in 14 cases , and intraorbital invasion has occurred in 14 cases .
intraocular then subsequent intraorbital invasion has occurred in two cases.7,18 in terms of advanced orbital invasion , extension into the paranasal sinuses has been described by margo and weitzenkorn in 1986,19 and one other case from nigeria has also described complete destruction of the orbit with extension into the maxillary antrum.4 six previous cases have reported distant metastases five cases with preauricular / cervical lymph node metastases7,15,16,20 and one case with nodal / hepatic metastases.1,21 of the five cases with preauriclar / cervical lymph node metastases , only four underwent neck dissection.15,16,20 the other patient did not undergo neck dissection and eventually died 6 years after initial presentation the only known mortality from conjunctival mucoepidermoid carcinoma.7 from this brief summary of all reported cases , it is clear that conjunctival mucoepidermoid carcinoma is a highly aggressive tumor which most commonly presents as a limbal mass in elderly men .
although this condition has a historically high preponderance for local invasion if not adequately excised , there is some evidence that a pathologically lower - grade conjunctival mucoepidermoid carcinoma subtype exists which has a lower disposition for local invasion and recurrence .
this is illustrated by the slow growth over 10 years of the lesion in our patient without any deep invasion .
this could also be illustrated in the recently reported case by quintas et al3 in 2011 , where the patient has had no recurrence after only local excision , cryotherapy , and topical mitomycin c. this management is comparable to the management our patient received , and our patient has also had no recurrence .
these cases may support a role for adjuvant cryotherapy and topical mitomycin c , especially in cases of movable in situ , superficial conjunctival mucoepidermoid carcinoma , as previously suggested by rankin et al.2 it is also important to note that this lower - grade subtype could be related to lower - grade salivary gland mucoepidermoid carcinomas , which are associated with mect1-maml2 translocation mutations.2 unfortunately , genetic testing of the excised tumor from our patient was unavailable , and we were thus unable to examine this possibility .
given the difficulty in clinical diagnosis of rare conjunctival mucoepidermoid carcinoma , we recommend that full histopathologic examination of all suspicious conjunctival biopsies should occur , including the use of specialized mucin - staining techniques , including periodic acid - schiff , alcian blue , and mucicarmine stains .
immunohistochemical techniques should also be used , especially in cases where histopathological diagnostic uncertainty exists.2 if these laboratory measures are not taken , the chance for early diagnosis and treatment could be compromised and could lead to misdiagnosis , possible aggressive local invasion , and even systemic dissemination . in summary , due to its rare incidence and accompanying poor prognosis
, conjunctival mucoepidermoid carcinoma represents both a diagnostic and therapeutic challenge for the ophthalmologist and therefore should always be considered in the differential diagnosis of conjunctival neoplasms . | conjunctival mucoepidermoid carcinoma is a very rare but highly aggressive conjunctival neoplasm with 42 previously reported cases .
we report the case of a 56-year - old male with a left ocular surface squamous neoplasm , which was subsequently treated with excision and autoconjunctival graft .
histopathology of the operative specimen reported a low - grade conjunctival mucoepidermoid carcinoma , and the patient was then treated with an adjunctive course of mitomycin c. on review 10 months after lesion excision , there was no recurrence , and the patient was otherwise well . due to its rare incidence , difficult clinical diagnosis , and accompanying poor prognosis , conjunctival mucoepidermoid carcinoma should always be considered in the differential diagnosis of conjunctival neoplasms , and full histopathologic examination , including mucin - staining techniques , of all suspicious conjunctival biopsies should occur . |
pituitary apoplexy is an uncommon event and usually occurs in non - functioning pituitary tumors . among the functioning tumors , prolactinomas are the ones most likely to apoplexy .
apoplexy in growth hormone ( gh ) producing adenomas is a very rare event with less than thirty cases reported worldwide .
a 55 year old smoker male presented to the our outpatient clinic in 2004 with complaints of gradual onset increase in the size of hands and feet , bilateral knee pain , increased sweating and blurring of vision .
investigations uncovered diabetes mellitus by a casual blood glucose of 243 mg / dl and hba1c of 8.5% .
growth hormone suppression test using 75 gram oral glucose showed a 60 minute growth hormone of 105 ng / ml .
magnetic resonance imaging of the sellar region showed a 12.0 mm 10.0 mm pituitary adenoma .
eight - years later , he presented in the emergency department of our institute with sudden onset headache , vomiting and decreased level of consciousness of one day duration .
ct scan of the head with focus on the sella was suggestive of apoplexy which was later confirmed by the mri of the sellar region .
although acromegaly can remit following apoplexy of the responsible pituitary adenoma , long term follow up is needed for early detection of the development of deficiency of pituitary hormones which may occur over years following the event as well as to detect tumor regrowth which again may occur several years later .
pituitary apoplexy ( pa ) is a neurosurgical emergency presenting with sudden onset headache , vomiting and focal neurological signs and decreased level of consciousness .
clinically apparent pa usually occurs in pituitary macroadenomas with a reported incidence being 1.6% . in surgically resected adenomas , the prevalence varies between 0.6% and 10% with a mean of 2% .
very often , the diagnosis of a functioning or non - functioning adenoma is made in retrospect .
we describe one such case of a middle aged male who was diagnosed with acromegaly 8 years back , remained untreated , and presented with pa following , which there was resolution of growth hormone ( gh ) excess .
a 55-year - old smoker male presented to our out - patient clinic in 2004 with complaints of gradual onset increase in the size of hands and feet , bilateral knee pain , increased sweating and blurring of vision .
physical examination revealed coarse facial features , large spade like hands , large feet , macroglossia , oily skin , and excessive sweating .
the patient was hemo - dynamically stable with a blood pressure of 150/96 mm hg .
investigations revealed a normal complete blood count , liver and kidney function tests and electrolytes and evidence of left ventricular hypertrophy on electrocardiogram .
previously undiagnosed diabetes mellitus was uncovered by casual blood glucose of 243 mg / dl and hba1c of 8.5% .
gh suppression test using 75 g oral glucose showed a 60 min gh of 105 ng / ml . the basal levels of other pituitary and target hormones are depicted in table 1 . magnetic resonance imaging ( mri ) of the sellar region showed a 12.0 mm 10.0 mm pituitary adenoma not compressing the optic chiasm [ figure 1a ] . the patient refused insulin and was started on metformin and glimepiride , and planned for transsphenoidal tumor decompression .
hormonal analysis of the patient , before and after apoplexy magnetic resonance imaging ( mri ) , done 8 years before pituitary apoplexy , showing large pituitary macroadenoma 12 mm x 10.0 mm not compressing optic chiasma ( a ) , and a recent mri ( post - gadolinium ) showing features of heterogeneous pituitary hemorrhage in large adenoma ( b ) eight years later , he presented in the emergency department of our institute with sudden onset headache , vomiting and decreased level of consciousness of 1 day duration
. examination revealed a glasgow coma scale of 10 with right sided oculomotor nerve palsy and facial features suggestive of acromegaly .
subsequent investigations revealed random blood glucose of 67 mg% and normal electrolytes . computed tomography scan of the head with focus on the sella was suggestive of apoplexy which was later confirmed by the mri of the sellar region [ figure 1b ] .
the patient was initially stabilized using intravenous glucocorticoids after which a transsphenoidal tumor debulking was done .
his post - operative endocrine workup after the apoplexy revealed a gh ( post - glucose challenge ) level of 1.48 ng / ml and secondary adrenal insufficiency and central hypothyroidism [ table 1 ] . at present , the patient is doing well on metformin 500 mg , levothyroxine 75 g / day and hydrocortisone 7.5 mg .
in this report , we describe a patient in whom the diagnosis of acromegaly with diabetes mellitus was 8 years before the apoplexy .
he then underwent a clinical episode strongly suggestive of acute pituitary necrosis , followed by normalization of gh levels and remission of diabetes mellitus ; other pituitary functions revealed dissociated hypopituitarism in the form of central hypothyroidism , hypogonadism , and hypocortisolism .
pa is characterized by sudden onset headache , visual disturbance and decreased level of consciousness . clinical remission of acromegaly following apoplexy has been reported in less than 30 cases in literature . the mechanisms proposed to explain the predisposition of pituitary adenomas to apoplexy include compression of the superior hypophyseal artery against diaphragma sellae by large pituitary tumors , friability of and increased fenestrations in the immature vessels supplying the tumor and ischemia of the adenoma because of the increasing demands on the blood supply of the growing tumor .
an intrinsic vasculopathy has also been incriminated in the susceptibility of pituitary adenomas to apoplexy .
lee et al . , found markedly increased vascular endothelial growth factor in pituitary adenomas and showed positive correlation with pituitary hemorrhage .
our patient had a macroadenoma at the time of diagnosis , which must have progressed over period of 8 years ultimately culminating into pa .
apoplexy in a gh secreting adenoma leading to cure has been previously reported in literature .
tanriverdi et al . , reported a 60 year acromegalic male who presented with panhypopituitarism and complete ophthalmoplegia without visual field defects and as in our patient , had no precipitating factors .
wang et al . , recently reviewed six patient of acromegaly in whom spontaneous remission was reported .
all these cases had subclinical presentation without features of acute apoplexy and all of these patients had a nadir gh less than 1 mcg / l after 75 g oral glucose tolerance test .
our patient also had nadir gh level of 1.48 ng / ml after apoplexy and his blood glucose got easily controlled on metformin only and patient did not require any antihypertensive agent .
management of pa with mild neuro - ophthalmic signs is conservative , but requires a close and careful follow - up by endocrinologist , radiologist and neurologist .
however , if neuro - ophthalmic signs fail to improve or patient shows clinical deterioration then the patient needs urgent tumor decompression by a dedicated neurosurgical unit .
although acromegaly can remit following apoplexy of the responsible pituitary adenoma , long - term follow - up is needed for early detection of the development of deficiency of pituitary hormones , which may occur over years following the event as well as to detect tumor regrowth , which again may occur several years later .
significant worsening of existing headache or new onset severe headache in a patient with acromegaly should prompt a consideration of pa . | introduction : pituitary apoplexy is an uncommon event and usually occurs in non - functioning pituitary tumors . among the functioning tumors ,
prolactinomas are the ones most likely to apoplexy .
apoplexy in growth hormone ( gh ) producing adenomas is a very rare event with less than thirty cases reported worldwide.objective:to describe a case of spontaneous pituitary apoplexy in acromegaly.case report : a 55 year old smoker male presented to the our outpatient clinic in 2004 with complaints of gradual onset increase in the size of hands and feet , bilateral knee pain , increased sweating and blurring of vision .
investigations uncovered diabetes mellitus by a casual blood glucose of 243 mg / dl and hba1c of 8.5% .
growth hormone suppression test using 75 gram oral glucose showed a 60 minute growth hormone of 105 ng / ml .
magnetic resonance imaging of the sellar region showed a 12.0 mm 10.0 mm pituitary adenoma .
the patient was planned for transsphenoidal tumor decompression .
however , the patient was lost to follow up .
eight - years later , he presented in the emergency department of our institute with sudden onset headache , vomiting and decreased level of consciousness of one day duration .
ct scan of the head with focus on the sella was suggestive of apoplexy which was later confirmed by the mri of the sellar region.conclusion:although acromegaly can remit following apoplexy of the responsible pituitary adenoma , long term follow up is needed for early detection of the development of deficiency of pituitary hormones which may occur over years following the event as well as to detect tumor regrowth which again may occur several years later . |
this is partly due to a large body of data available from western population where obesity is considered a major public health concern [ 13 ] .
epidemiological studies with longitudinal follow - up have demonstrated association between simple anthropometric measures like height , weight ( body mass index : bmi ) , and waist circumference ( wc ) with cardiovascular risks [ 3 , 4 ] . within a given bmi range ,
heart rate variability ( hrv ) is a simple noninvasive , sensitive measure to evaluate autonomic system activity .
changes in hrv have been demonstrated to detect even subclinical states [ 7 , 8 ] . decreased heart rate variability ( both low and high frequency ) has been observed in obese , compared to individuals with normal bmi [ 911 ] .
pockets of data available from indian population are not different from those of western data [ 12 , 13 ] .
however , india has an additional burden of chronic energy deficiency with one - third of population being of low bmi .
recent evidence based on hrv measures from our laboratory demonstrated decreased hrv in undernourished subjects when compared to well - nourished / normal bmi group .
it has been speculated that undernourished / low bmi individuals might have more of visceral adiposity or ectopic fat than subcutaneous fat .
although wc has been suggested as being superior to bmi in predicting cardiovascular risks in obese , its ability to predict increased cardiovascular risk in individuals with low bmi needs to be explored .
further , wc is highly sensitive to body size and fat distribution and is correlated with bmi .
recently a new anthropometric measure , called a body shape index ( absi ) , has been derived from waist circumference which is independent of bmi and is said to be a better index than using either wc or bmi independently . thus being independent of bmi ,
absi helps in understanding whether abdominal obesity has predictive ability that can not be explained by bmi alone .
current study aimed to explore the association between indices of hrv and the anthropometric measures including bmi , wc , and absi in healthy indians with low bmi and compare it with normal .
one hundred and seventy eight males aged 18 to 78 years were recruited from in and around the medical college .
based on their bmi , subjects were categorized into low bmi group ( < 18.5 kg / m ) and normal bmi group ( between 18.5 and 24.9 kg / m ) . subjects with any chronic ailments including diabetes , hypertension , and renal and endocrinal disorders were excluded .
none of the subjects reported any symptoms suggestive of peripheral or autonomic neuropathy like giddiness on standing , urinary urgency , tingling sensation of limbs , or limb weakness or gastrointestinal symptoms like burning sensation in epigastric region , diarrhea , and constipation .
all subjects underwent anthropometric assessment including weight recorded in minimal clothing to the nearest 0.1 kg , using a digital scale ( alfoset , model hw-100ka1 , mumbai , india ) and height being recorded to the nearest 0.1 centimeter , using a vertically mobile scale ( holtain , crymych , uk ) .
wc was measured using a standard nonstretchable tape measure , at the narrowest point between the iliac crest and ribcage .
the measured wc from our population was compared with the predicted wc derived from the equation log(wc ) = ( 2.589 0.020)+(0.6807 0.0052)log weight ( 0.814 0.020)log height .
absi was defined as wc/(bmi ) ( height ) . in the above equation
after explaining the process of ecg recording , subjects were asked to rest and relax in supine posture for 30 minutes .
ecg recording was performed in a quiet room with soothing lighting and with comfortable temperature being maintained .
any electronic gadgets or metal or magnetic objects which could interfere with the ecg recording were removed .
disposable electrodes were placed firmly onto the skin and we made sure that a good contact between the skin and the electrode was maintained .
electrodes were placed on the right arm , left arm , and left leg ( lead ii ) .
ecg module contains the electronics that detect electrical impulses from the heart and convert them into digital data that is transmitted to the computer .
one end of the ecg module was connected to the subject through leads and another end to the usb port of the computer .
analog lead ii ecg signal obtained was digitized using analog to digital converter ( cio - ad16jr a / d card ) .
sampling frequency of ecg signals was 1000 hz using an ibm compatible pc and a data acquisition package ( cvms ; world precision instruments inc . , sarasota , fl , usa . )
the data acquisition system included a threshold peak detection system , from which rr intervals were determined .
the rr intervals were plotted as a tachogram ( rr values versus interval number ) .
data segments of 128 sec duration were sampled at 2 hz to create 256 point data sets . for each 10 min recording ,
power spectral density ( psd ) was calculated using mathematical algorithm fast fourier transform ( fft ) .
fft algorithm uses the signals in the time domain ( rr interval ) and transforms them into discrete frequency domain representation ( power spectra ) . to prevent digital leakage during fft hanning
the spectra obtained for the different data sets were averaged to reduce variance and to sharpen reproducible central peaks .
the 0.040.15 hz band of rr power ( referred to as the low - frequency band ) reflects , at least in part , sympathetic nerve activity to the heart and partly parasympathetic activity , while the 0.150.4 hz band ( high - frequency band ) reflects parasympathetic nerve activity to the heart . absolute total power
( tp ) represents the total variance of the power spectral density , that is , 00.4 hz band ( msec ) .
in addition to the absolute power , data for heart rate variability are also presented as normalized units , as recommended , where the power in the low- and high - frequency bands are expressed as percentage of the total power minus the power of the very - low - frequency band ( 0.00.04 hz ) .
all normally distributed data are expressed as mean sd and median ( quartile1 and quartile3 ) , when not normally distributed .
the differences between low and normal bmi study group were compared using independent t test .
bland - altman plots were constructed to examine limits of agreement between measured wc and the predicted wc .
correlation of log transformed hrv indices with bmi , wc , and absi was examined using pearson 's correlation coefficient .
further , correlation of hrv indices with bmi , wc , and absi was examined in low bmi and normal bmi study groups .
the correlation of hrv with age , absi , and wc was examined using linear regression models in the two bmi groups .
table 1 represents the anthropometric and hrv indices in absolute units . out of the 178 subjects , based on their bmi ,
73 subjects were categorized as low bmi group and 105 subjects as normal bmi group . predicted wc was within limits of agreement when compared with measured wc .
mean of difference between observed wc from the study population and predicted wc was 0.01 and the limits of agreement were 0.10 and 0.12 ( figure 1 ) .
bmi was positively and significantly correlated with wc ( r = 0.77 , p < 0.001 ) and not with absi ( r = 0.028 , p = 0.71 ) .
hrv indices were significantly and negatively correlated with wc ( log lf , r = 0.25 , p < 0.01 ; log hf , r = 0.30 , p < 0.01 ; log tp , r = 0.22 , p < 0.01 ) and absi ( log lf , r = 0.54 , p < 0.01 ; log hf , r = 0.59 , p < 0.01 ; log tp , r = 0.55 , p < 0.01 ) but not with bmi ( log lf , r = 0.06 , p = 0.4 ; log hf , r = 0.03 , p = 0.7 ; log tp , r = 0.1 , p = 0.2 ) .
the correlation of absi with hrv remained significant even after controlling for age but not that of wc with hrv ( figure 2 ) .
when this correlation was examined separately within low bmi and normal bmi groups , absi was significantly correlated with all hrv indices in the normal group after controlling for age , whereas log hf alone was correlated with absi in the low bmi group ( table 2 ) .
none of the hrv indices were correlated with wc in either of the groups after controlling for age .
there was no significant correlation between the normalized values ( nu of lf and hf ) and absi , bmi or wc .
current study demonstrated that absi was significantly and negatively correlated with lf , hf , and tp indices of hrv . when grouped based on bmi , hf ( an indicator of cardiac pns activity ) was negatively and significantly correlated with absi in both low bmi and normal bmi study group .
however , lf ( by far an indicator of cardiac sns activity ) and tp ( total variability ) were negatively correlated with absi only in normal bmi study group .
increased migration of individuals from rural to urban setup and increased urbanization has caused easy access to high caloric foods .
this has caused individuals with low bmi to shift towards either becoming normal bmi or even obese . with reduced physical activity and increased caloric consumption with preexisting low muscle mass , susceptibility to develop chronic disease is increasing in indians [ 2224 ] .
one of the contributing factors is increased body fat accumulation , particularly fat within tissues , which is commonly termed as ectopic / visceral fat .
the visceral deposition of fat is considered to be critical in defining the risk for metabolic disease and is relatively more pronounced in asian indians compared to other ethnic groups .
visceral fat carries greater risk of insulin resistance , cvs disease , metabolic syndrome [ 27 , 28 ] .
although these techniques might help us give accurate measures , their feasibility and application at a population level are questionable .
simple indices like wc have long been used as a surrogate of central adiposity . using wc ,
a simple index called absi has emerged of late , which could by far act as a surrogate of visceral fat . in this study
increasing central adiposity ( measured using waist circumference ) has been associated with a reduced autonomic functionality .
this has been demonstrated in individuals who are obese or who are on a weight loss program .
there is lack of understanding of association between indices of central or visceral adiposity and autonomic nervous activity particularly in individuals with low - normal bmi .
reported higher abdominal - to - peripheral body fat distributions measured by dxa were strongly correlated with lower sympathetic and parasympathetic function in young and old healthy men .
other studies have also shown that body fat distribution is a major factor , particularly visceral fat carrying the greatest risk for cardiovascular morbidity and mortality [ 26 , 27 , 35 ] . in keeping with this , data from the current study demonstrated that cardiac autonomic activity particularly hf ( cardiac parasympathetic activity ) was negatively correlated with absi across bmi range .
this suggests that one of the possible explanations for reduced cardiac parasympathetic activity could well be due to increased absi which is by far an indicator of visceral fat .
greater degree of autonomic involvement , that is , both cardiac sympathetic and parasympathetic nervous activity , is suggested to be associated with higher visceral adiposity [ 10 , 34 ] .
the fact that normal bmi group were having significantly greater wc and marginally higher absi though not significant suggests the possibility of greater visceral adiposity in this group .
in addition , data from the current study demonstrated a negative association with cardiac sympathetic activity and absi in the normal study group .
one of the mechanisms which has been linked to greater autonomic involvement ( both components of ans ) and visceral fat includes reduced arterial distensibility .
therefore , it is possible that lower levels of carotid artery distensibility with elevated visceral fat would reduce mechanical transduction of arterial blood pressure into barosensory stretch .
another mechanism could be greater circulating neurohumoural factors that act centrally modifying the cardiovagal baroreflex [ 38 , 39 ] .
finally , impaired muscarinic receptor function has been demonstrated in an animal model of diet - induced obesity .
thus it is possible that the reduction in cardiovagal baroreflex gain observed with elevated total body and abdominal visceral fat in the present study was due , in part , to reduced cardiac muscarinic receptor number and/or sensitivity .
thin - fat phenotype , a term coined for indian population with low - normal bmi , might well have greater visceral adiposity .
this calls for urgent need to explore the visceral adiposity status in indians across all bmi ranges .
possible causes for greater deposition of fat at tissue level may well be due to states of positive energy balance , environmental exposures such as inflammation , stress , tobacco , alcohol , and pollution interacting , and amplifying the effect of the deposition of fat on a thin frame .
studies are further required to explore the role of above factors in contributing towards the deposition of visceral adiposity .
further , studies are also required to explore implication of absi in larger population based follow - up studies including females to understand the role of absi in predicting the metabolic risk in low bmi group . in conclusion ,
greater absi by far an indicator of visceral adiposity was associated with reduced cardiac parasympathetic and sympathetic activity even in individuals with low bmi .
thus , even with slight increase in bmi among low bmi individuals , there could be a greater risk of cardiovascular morbidity and mortality . | background .
one third of indian population is said to be suffering from chronic energy deficiency ( ced ) , with increased risk of developing chronic diseases . a new anthropometric measure called a body shape index ( absi )
is said to be a better index in predicting risks for premature mortality .
absi is also in part said to be a surrogate of visceral fat .
objective . the present study aimed to explore the association between indices of hrv ( heart rate variability ) , bmi , wc , and absi in healthy indian males with low bmi ( bmi < 18.5 kg / m2 ) and to compare with normal bmi group ( bmi 18.5 to 24.9 kg / m2 ) . methodology .
absi and bmi were derived from anthropometric parameters , namely , height , weight , and waist circumference in 178 males aged 18 to 78 years .
subjects were categorized into two groups based on their bmi .
results and conclusions .
power spectral analysis of hrv demonstrated a significant negative correlation between log hf ( high frequency ) and absi in both low bmi [ 24.2 ( 9.4 ) , p < 0.05 ] and normal bmi group [ 23.41 ( 10.1 ) , p < 0.05 ] even after controlling for age .
thus even with slight increase in bmi among low bmi individuals , there could be a greater risk of cardiovascular morbidity and mortality . |
benign tumors of the hypopharynx are very rare , with the most common two being the fibrolipoma and leiomyoma .
the ductal cysts are mucous retention cysts that develop after obstruction of the collecting ducts of the submucosal glands .
although the oral cavity or larynx are often involved , hypopharyngeal localization is extremely rare .
we report a new case of a ductal cyst that developed on the lateral wall of the pyriform sinus of the hypopharynx .
there was a delay in the diagnosis because no mass - like lesion was found with routine fiberoptic laryngoscopic examination .
a 64-year - old man presented with a four - year history of globus sensation .
he was referred for intractable symptoms despite having taken reflux medication for two months . despite continued medication , his symptoms developed to dysphagia , even when swallowing liquid .
he had experienced weight loss of 3 kg over the previous 2 months . on his first presentation
, flexible fiberoptic laryngoscopy showed pooling saliva , but no mass - like lesion in the hypopharynx .
an ovoid submucosal mass with a smooth contour in the left pyriform sinus was revealed ( fig .
subsequently , computed tomography ( ct ) scans showed a 34 cm mass with central low attenuation in the left hypopharynx ( fig .
it was removed by means of submucosal dissection with the microelectrode . the resected specimen consisted of a 234 cm cystic mass with proteinaceous fluid ( fig .
histologic examination showed a true epithelial - lined cyst consisting of cuboidal epithelium ( fig .
the final diagnosis , made by a pathologist , was a ductal cyst of the hypopharynx .
reported that the ductal cyst is one of the two most common types of cysts in the larynx .
pathologically , the epithelium - lined cyst wall consists of a uniform layer of cuboidal , columnar , or non - keratinizing squamous epithelium .
ductal cysts usually are slow - growing and painless , appearing as a circumscribed and often fluctuant swelling . the presence or absence of symptoms in patients with benign pharyngeal masses
, we missed the mass at the patient 's first visit . despite intractable globus symptoms
, we could not find any specific abnormality in the larynx or hypopharynx by routine fiberoptic laryngoscopy .
a number of techniques have been suggested to improve the view of the hypopharynx with flexible fiberoptic laryngoscopy .
one such technique is letting the patient sustain high - pitch phonation or perform a modified valsalva maneuver .
hillel and schwartz suggested performing a trumpet maneuver to fully visualize the pyriform sinus and the postcricoid region .
in addition , purser and antippa reported that manual anterosuperior traction applied to the prelaryngeal skin results in a useful view of the hypopharynx . when nothing can be detected despite multiple laryngoscopic methods during outpatient examination in dysphagia patients
, double contrast pharyngoesophagography may be useful for evaluating both the structure and the function of the hypopharynx and other organs involved in swallowing .
benign lesions typically appear as small , round or ovoid , well - circumscribed , smooth - surfaced submucosal masses etched in white , best visualized on frontal views of the pharynx .
ct or magnetic resonance imaging ( mri ) is useful in determining the extent and location of the cyst and distinguishing it from malignant tumors .
most hypopharyngeal tumors are squamous cell carcinomas . therefore , hypopharyngeal masses should be differentiated from malignant tumors .
therefore , we included the metastatic mass in the differential diagnosis before surgery . generally , there is no reason to resect small pharyngeal retention cysts that are not causing symptoms .
the surgical removal of a small cyst is simple , and many of these cysts may be removed by endopharyngeal microsurgery using a direct laryngoscope .
marsupialization may be adequate , and it may be necessary to reduce the size of a large cyst by puncturing and draining it before complete removal .
we successfully removed the ductal cyst in our patient with a microdissection electrode under direct laryngoscopy .
we recommend that , in any patient with a history of intractable globus symptoms , careful physical examination with a flexible laryngoscope and radiologic studies such as double contrast pharyngoesophagogram , ct , or mri should be performed to rule out other benign or malignant lesions . | the ductal cyst of the hypopharynx is a very rare tumor .
we report a case of hypopharyngeal ductal cyst in a 63-year - old man presenting with globus sensation .
it was removed by a laryngomicrosurgical technique , using a microdissection electrode .
masses of the hypopharynx may not always be easily visible on routine examination of the hypopharynx with flexible fiberoptic laryngoscopes . particularly in cases of benign tumors , the diagnosis may be delayed due to a prolonged history of mild and subtle symptoms .
we missed the hypopharyngeal mass at the initial presentation , but could detect the mass in the pyriform sinus with a double contrast barium swallow study .
we describe the diagnostic method to detect hypopharyngeal tumors and the treatment of benign hypopharyngeal masses . |
abstractcancer exosomes are gaining considerable amount of attention in basic and applied clinical research for their established role in the modulation of the tumor niche , and their broad - range contribution to tumor - host cross - talk . supporting evidence to
their role in tumorigenesis comes from the observation that exosome secretion , composition and functional effects are all altered as tumors become more aggressive . at the molecular level ,
the mechanisms underlying exosome biogenesis and uptake are far from being understood .
recent work has highlighted the critical role for the small intracellular adaptor protein syntenin in the biogenesis of a subset of exosomes and loading of cargo .
here , we review this recent work and some unpublished data that further highlight the possible implications of syntenin and the syndecan ( sdc ) heparan sulphate proteoglycans during exosome uptake , suggesting a supporting role for this pathway in the entire life cycle of cancer exosomes . |
|
talaromyces marneffei ( tm ) infection is a deep fungal infection caused by the dimorphic fungus tm ( formerly known as penicillium marneffei ) , a species endemic to southeast asia , including some districts in china ( e.g. , guangdong , guangxi , yunnan , hong kong ) , and nearby countries including thailand , laos , and malaysia .
there are also reports of tm infection outside of southeast asia in patients who traveled to this region .
there is some indication that the symptoms of tm infection are different in human immunodeficiency virus ( hiv)-positive and hiv - negative patients , presumably because of the differences in the causes and characteristics of immune suppression .
however , little is known about tm infection in hiv - negative patients , and there have been no previous reports of tm infection in fujian , china .
previous research indicated a higher incidence of fever in hiv - positive than hiv - negative patients with tm infections . in this study
, we retrospectively analyzed 26 cases of tm infection in fujian , china and compared the characteristics of hiv - positive and hiv - negative patients with tm infection who presented in fujian provincial hospital from september 2005 to april 2014 .
, tm infection in china is occasionally found in several southern cities , but seldom elsewhere .
we therefore sought to identify the clinical manifestations and outcomes after therapy for tm infection in hiv - positive and hiv - negative patients from southern china .
we focused on the clinical manifestations and efficacy of therapies for tm infection in an effort to provide evidence that can be used for clinical diagnosis and treatment . from the scientific perspective
, we sought to identify the clinical manifestations of tm infection in hiv - negative and hiv - positive patients in order to shed light on the pathogenesis of this disease in these two groups of patients .
this study retrospectively analyzed the records of 26 patients who were admitted to fujian provincial hospital ( a tertiary level hospital with 2500 beds ) with diagnoses of tm infection from september 2005 to april 2014 .
this study was approved by the institutional review board of the fujian provincial hospital in fuzhou city , fujian province , china ( no .
k2014 - 023 - 01 ) . the need for informed consent was waived because this study was retrospective .
data on demographic factors ( gender , age , weight , smoking , drinking , employment rate , and coexisting disease ) , personal history ( visit prostitutes , drug addiction , and opportunistic infections ) , clinical symptoms and signs ( cough , expectoration , dyspnea , chest pain , diarrhea , vomiting , fever , body temperature , respiratory rate , moist rales , and dry rales ) and laboratory test results ( white blood cell [ wbc ] counts , neutrophil , lymphocyte , hematocrit , and platelets [ plt ] [ xe-500 blood analyzer , sysmex , japan ] and albumin [ alb ] , alanine aminotransferase [ alt ] , aspartate aminotransferase [ ast ] , alkaline phosphatase [ alp ] , total bilirubin [ tbil ] , blood creatinine , blood sodium , prothrombin time and activated partial thromboplastin time [ the cobas 8000 automatic biochemical analyzer , roche , switzerland ] , ph , pao2 , pao2/fio2 [ abl8000 , radiometer , danes ] ) t - cell immune function was assessed by measuring cd3 ,
cd4 , nk , and cd19 , and humoral immune function was assessed by measuring igg , igm , iga , c3 , c4 , and c - reactive protein ( crp ) ( facscalibur flow cytometry , bd biosciences , becton , dickinson and company , usa ) .
chest radiology ( x - ray or computed tomography [ ct ] , siemens , germany ) was also examined . all treatments and outcomes
acquired immune deficiency syndrome ( aids ) was diagnosed by the 1993 revised classification system for hiv infection and expanded surveillance case definition for aids among adolescents and adults from the centers for disease control and prevention ( cdc ) of the united states ( 1992 ) and the 2005 guidelines for hiv / aids diagnosis and treatment in china , which was jointly issued by the chinese medical association and ministry of health ( 2005 ) .
positive hiv antibodies were verified by immunoblotting in the hiv / aids laboratory at the fujian provincial center for disease control and prevention .
tm infection was diagnosed based on the presence of this species in body fluids ( blood [ n = 23 , 92% ] , bone marrow [ n = 5 , 20% ] , bronchoalveolar lavage fluid [ n = 1 , 4% ] , bronchial secretions [ n = 1 , 4% ] , ascites
[ n = 1 , 4% ] ) , and in tissue biopsy [ n = 1 , 4% ] ) .
blood and bone marrow were directly inoculated into neutralizing antibiotic flasks of bact / alert three - dimensional blood culture system ( biomrieux , inc . , durham , nc , usa ) .
if the cultures were positive , specimens were inoculated onto sabouraud dextrose agar plate ( beiruite bio - technology co. , ltd . , zhengzhou , henan , china ) as well as other body fluids , at 25c for 48 h and then identified by the mycology laboratory of the fujian provincial hospital , which is a biosafety level-2 certified laboratory .
identification was based on the characteristic appearance of the mycelial phase , with a soluble red pigment in the background that gradually diffused into the agar [ figure 1a ] .
the yeast phase grows at 37c in culture , appears white or brown with a gyrus - shaped or radial - cleft - like surface , and has no pigments .
the yeast spores are sausage - shaped and partitioned by septa [ figure 1c ] .
( a ) fungi were cultured in sabouraud 's medium at 25c , at which mycelial phase and typical red products develop .
( c ) fungi were cultured in sabouraud 's medium at 37c , at which the yeast phase and typical red products develop .
we defined four levels of fever : mild ( 37.3 to 38.0c ) , moderate ( 38.139.0c ) , severe ( 39.140.9c ) , and very severe ( 41.0c ) .
treatment regimens were according to the guidelines for diagnosis and treatment of hiv / aids in china ( 2005 ) . among hiv - positive patients ,
twelve cases were treated with amphotericin b liposomal complex ( 1 mg / kg qd ) or amphotericin b ( 0.50.6 mg / kg qd ) .
eight of these 12 patients received additional treatments as follows : amphotericin b liposomal complex or amphotericin b with fluconazole ( 0.4 g qd ) for 1332 days , plus oral fluconazole ( 0.4 g qd ) for 34 months . among the 15 cases who received antifungal therapy , 12 cases also received antiretroviral therapy using sanilvudin ( d4 t , 30 mg bid ) + lamivudine ( 3tc , 0.3 g qd ) + nevirapine ( nvp , 200 mg bid ) or zidovudine ( azt , 300 mg bid ) + 3tc ( 0.3 g qd ) + nvp ( 200 mg qd ) .
the other three patients were treated with fluconazole ( 0.4 g qd ) alone due to intolerance to the other treatment regimens . among hiv - negative patients ,
two patients were treated with liposomal amphotericin b ( 1 mg / kg daily ) or amphotericin b ( 0.50.6 mg / kg qd ) combining with itraconazole ( 200 mg / d ) , one was treated with itraconazole , one was treated with fluconazole ( 0.4 g qd ) alone due to economic difficulty , and the other three patients did not receive any treatment without timely diagnosis . continuous variables with normal distributions were presented as mean standard deviations ( sds ) and continuous variables with nonnormal distributions were shown as medians and interquartile ranges .
the differences between groups were assessed by an independent t - test ( for age and weight ) and the mann
counts and percentages were calculated for categorical variables and compared by fisher 's exact test .
all statistical assessments were two - sided and evaluated at the 0.05 level of significance .
all analyses were performed using spss 22.0 statistics software ( ibm spss inc . , chicago , illinois , usa ) .
this study retrospectively analyzed the records of 26 patients who were admitted to fujian provincial hospital ( a tertiary level hospital with 2500 beds ) with diagnoses of tm infection from september 2005 to april 2014 .
this study was approved by the institutional review board of the fujian provincial hospital in fuzhou city , fujian province , china ( no .
k2014 - 023 - 01 ) . the need for informed consent was waived because this study was retrospective .
data on demographic factors ( gender , age , weight , smoking , drinking , employment rate , and coexisting disease ) , personal history ( visit prostitutes , drug addiction , and opportunistic infections ) , clinical symptoms and signs ( cough , expectoration , dyspnea , chest pain , diarrhea , vomiting , fever , body temperature , respiratory rate , moist rales , and dry rales ) and laboratory test results ( white blood cell [ wbc ] counts , neutrophil , lymphocyte , hematocrit , and platelets [ plt ] [ xe-500 blood analyzer , sysmex , japan ] and albumin [ alb ] , alanine aminotransferase [ alt ] , aspartate aminotransferase [ ast ] , alkaline phosphatase [ alp ] , total bilirubin [ tbil ] , blood creatinine , blood sodium , prothrombin time and activated partial thromboplastin time [ the cobas 8000 automatic biochemical analyzer , roche , switzerland ] , ph , pao2 , pao2/fio2 [ abl8000 , radiometer , danes ] ) t - cell immune function was assessed by measuring cd3 ,
cd4 , nk , and cd19 , and humoral immune function was assessed by measuring igg , igm , iga , c3 , c4 , and c - reactive protein ( crp ) ( facscalibur flow cytometry , bd biosciences , becton , dickinson and company , usa ) .
chest radiology ( x - ray or computed tomography [ ct ] , siemens , germany ) was also examined . all treatments and outcomes
acquired immune deficiency syndrome ( aids ) was diagnosed by the 1993 revised classification system for hiv infection and expanded surveillance case definition for aids among adolescents and adults from the centers for disease control and prevention ( cdc ) of the united states ( 1992 ) and the 2005 guidelines for hiv / aids diagnosis and treatment in china , which was jointly issued by the chinese medical association and ministry of health ( 2005 ) .
positive hiv antibodies were verified by immunoblotting in the hiv / aids laboratory at the fujian provincial center for disease control and prevention .
tm infection was diagnosed based on the presence of this species in body fluids ( blood [ n = 23 , 92% ] , bone marrow [ n = 5 , 20% ] , bronchoalveolar lavage fluid [ n = 1 , 4% ] , bronchial secretions [ n = 1 , 4% ] , ascites
[ n = 1 , 4% ] ) , and in tissue biopsy [ n = 1 , 4% ] ) . blood and bone marrow
were directly inoculated into neutralizing antibiotic flasks of bact / alert three - dimensional blood culture system ( biomrieux , inc . , durham , nc , usa ) .
if the cultures were positive , specimens were inoculated onto sabouraud dextrose agar plate ( beiruite bio - technology co. , ltd . , zhengzhou , henan , china ) as well as other body fluids , at 25c for 48 h and then identified by the mycology laboratory of the fujian provincial hospital , which is a biosafety level-2 certified laboratory .
identification was based on the characteristic appearance of the mycelial phase , with a soluble red pigment in the background that gradually diffused into the agar [ figure 1a ] .
the yeast phase grows at 37c in culture , appears white or brown with a gyrus - shaped or radial - cleft - like surface , and has no pigments .
the yeast spores are sausage - shaped and partitioned by septa [ figure 1c ] .
( a ) fungi were cultured in sabouraud 's medium at 25c , at which mycelial phase and typical red products develop .
( c ) fungi were cultured in sabouraud 's medium at 37c , at which the yeast phase and typical red products develop . an oral temperature above 37.2c
we defined four levels of fever : mild ( 37.3 to 38.0c ) , moderate ( 38.139.0c ) , severe ( 39.140.9c ) , and very severe ( 41.0c ) .
treatment regimens were according to the guidelines for diagnosis and treatment of hiv / aids in china ( 2005 ) . among hiv - positive patients ,
twelve cases were treated with amphotericin b liposomal complex ( 1 mg / kg qd ) or amphotericin b ( 0.50.6 mg / kg qd ) .
eight of these 12 patients received additional treatments as follows : amphotericin b liposomal complex or amphotericin b with fluconazole ( 0.4 g qd ) for 1332 days , plus oral fluconazole ( 0.4 g qd ) for 34 months . among the 15 cases who received antifungal therapy , 12 cases also received antiretroviral therapy using sanilvudin ( d4 t , 30 mg bid ) + lamivudine ( 3tc , 0.3 g qd ) + nevirapine ( nvp , 200 mg bid ) or zidovudine ( azt , 300 mg bid ) + 3tc ( 0.3 g qd ) + nvp ( 200 mg qd ) .
the other three patients were treated with fluconazole ( 0.4 g qd ) alone due to intolerance to the other treatment regimens . among hiv - negative patients ,
two patients were treated with liposomal amphotericin b ( 1 mg / kg daily ) or amphotericin b ( 0.50.6 mg / kg qd ) combining with itraconazole ( 200 mg / d ) , one was treated with itraconazole , one was treated with fluconazole ( 0.4 g qd ) alone due to economic difficulty , and the other three patients did not receive any treatment without timely diagnosis .
continuous variables with normal distributions were presented as mean standard deviations ( sds ) and continuous variables with nonnormal distributions were shown as medians and interquartile ranges .
the differences between groups were assessed by an independent t - test ( for age and weight ) and the mann
counts and percentages were calculated for categorical variables and compared by fisher 's exact test .
all statistical assessments were two - sided and evaluated at the 0.05 level of significance .
all analyses were performed using spss 22.0 statistics software ( ibm spss inc . , chicago , illinois , usa ) .
table 1 shows the baseline characteristics of hiv - positive and hiv - negative patients who were diagnosed with tm infection and treated at fujian provincial hospital from september 2005 to april 2014 .
these two groups had similar age , sex distribution , body weight , employment rate , and rates of smoking and drinking . however , the hiv - negative group had a significantly longer diagnostic interval ( time from onset of symptoms to confirmed diagnosis of tm infection ; mann whiney u = 31.50 , p = 0.041 ) and a greater rate of opportunistic infection ( mann whitney u = 6.18 , p = 0.041 ) .
the data also show that the hiv - negative group had a higher prevalence of malignancy ( 14.3% vs. 0% ) , systemic lupus erythematosus ( sle ) ( 28.6% vs. 0% ) , primary immunodeficiency ( 14.3% vs. 0% ) , and leukemia ( 14.3% vs. 0% ) , and the hiv - positive group had a higher prevalence of liver dysfunction ( 58.1% vs. 28.6% ) . however , these other differences were not statistically significant .
there was one case from yunnan , one from jiangsu , one from jianxi , and one who traveled to vietnam ; all other patients were from fujian province and never visited thailand or other southeast regions ( e.g. , guangdong , guangxi , or hong kong ) of china ( data not shown ) .
characteristics of 26 patients diagnosed with tm from september 2005 to april 2014 in fujian , china age and weight are presented as mean sd , disease duration as median ( p25 , p75 ) , and other parameters as count ( % ) .
p values were estimated by an * independent t - test , mann whitney u - test , or fisher s exact test;underlying disease indicates malignancy , systemic lupus erythematosus , primary immunodeficiency and any disease of the heart , liver or kidney ; one patient may have more than one underlying disease ; missing data were found in six patients for weight and in one patient for opportunistic infection ; * * liver dysfunction was defined as aminotransferase > 40 u / l and aspartate aminotransferase > 40
sd : standard deviation ; tm : talaromyces marneffei ; hiv : human immunodeficiency virus .
most patients were admitted with fever as the main complaint ( n = 23/26 , 88.5% ) . among the hiv - positive patients ,
seven cases were initially diagnosed with pulmonary infections at the respiratory departments , seven were diagnosed with gastrointestinal tract infections at the gastroenterology department , two were diagnosed with leukemia at the hematology department , one was diagnosed with rheumatic fever at the rheumatology department , one was diagnosed with an intracranial infection at the neurology department , and one was diagnosed with infective endocarditis at the cardiology department . in the hiv - negative group ,
three patients were admitted to the department of respiratory and critical care medicine , two were diagnosed with sle and pulmonary infection at the rheumatology department , one was admitted to the pediatrics department with a pulmonary infection , and one was diagnosed with postchemotherapy infection at the hematology department .
one patient with sle who received prednisone for 3 months had oral leukoplakia on admission .
the throat secretion was collected with a swab and oral candida albicans infection was diagnosed .
table 2 shows the clinical symptoms and lung ct findings of the hiv - negative and hiv - positive groups .
the two groups were similar in most clinical symptoms , including fever , cough , weight loss , lymphadenectasis , hepatosplenomegaly , rash , wheezing in the lungs , and pleural effusion . however , dyspnea was significantly more common in patients who were hiv - negative ( 57% vs. 5% , = 8.86 , p = 0.010 ) .
clinical signs and symptoms of 26 patients diagnosed with penicilliosis marneffei in fujian , china data are shown as count ( % ) and tested by fisher s exact test .
* fever was classified as mild ( 37.338.0c ) , moderate ( 38.139.0c ) , severe ( 39.140.9c ) , or very severe ( 41.0c ) .
figure 2 shows representative chest x - rays of an hiv - positive patient and an hiv - negative patient .
figure 2a shows a ground - glass opacity in the upper lobe of the left lung of an hiv - negative patient .
figure 3 shows representative ct imaging of lesions in the lungs of four tm patients .
these images show multinodular lesions in both lungs of an hiv - negative patient [ figure 3a ] , patchy shadows in both lungs of an hiv - positive patient [ figure 3b ] , ground - glass - like lesions in both lungs of an hiv - positive patient [ figure 3c ] , and diffused interstitial and multiple cavity - like changes in both lungs of an hiv - negative patient [ figure 3d ] . in general ,
representative chest x - rays of human immunodeficiency virus - positive and human immunodeficiency virus - negative patients with talaromyces marneffei infection .
( a ) male human immunodeficiency virus ( negative ) , 71-year - old with chronic lymphocytic leukemia , the x - ray shows patchy shadows in the upper lobe of the left lung ( arrow ) .
( b ) male , human immunodeficiency virus ( positive ) , 54-year - old with repeated fever for 2 weeks , the x - ray shows nearly normal in both lungs .
representative computed tomography images of human immunodeficiency virus - positive and human immunodeficiency virus - negative patients with talaromyces marneffei infections .
( a ) male , 31 years , human immunodeficiency virus ( positive ) , computed tomography shows multinodular lesions ( arrows ) in both lungs .
( b ) female , 47 years , human immunodeficiency virus ( positive ) , computed tomography shows scattered patchy shadows in both lungs . ( c ) male , 31 years , human immunodeficiency virus ( positive ) , computed tomography shows diffuse ground - glass - like lesions in both lungs .
( d ) male , 56 years , human immunodeficiency virus ( negative ) , computed tomography shows diffuse interstitial lesions with cavity - like changes ( arrows ) in both lungs .
table 3 compares the biochemical indexes of hiv - positive and hiv - negative patients .
the two groups were similar with regard to wbcs , hemoglobin , plt , alb , alt , ast , alp , tbil , and c3 . however , hiv - positive patients had a significantly higher level of neutrophils ( mann whiney u = 27.00 , p = 0.029 ) and lower levels of cd4-positive cells ( mann whiney u = 0.00 , p = 0.009 ) and lymphocytes ( mann whiney u = 21.00 , p = 0.009 ) .
biochemical indexes of 26 patients diagnosed with penicilliosis marneffei in fujian , china * data were not available for one patient for wbc and albumin , ten patients for cd4 , and 13 patients for c3 . mann
g / l ) , mild anemia ( 90120 g / l for males and 90110
g / l for females ) , or moderate anemia ( 6090 g / l ) ; data were not available for one patient for wbc and albumin , ten patients for cd4 , and 13 patients for c3 .
iqr : interquartile range ; alt : alanine aminotransferase ; ast : aspartate transaminase ; alp : alkaline phosphatase ; wbc : white blood cells ; hiv : human immunodeficiency virus . among 12 hiv - positive patients with amphotericin b treatment
one of the patients who had renal toxicity took itraconazole ( 400 mg qd ) and the other took voriconazole ( 200 mg q12h ) instead of the drugs above and both improved .
one patient took amphotericin b for more than 105 days and the total dose exceeded 2.5 g ; this medication was stopped due to hypokalemia .
the symptoms of the remaining eight patients improved without obvious side effects . for the three patients treated with fluconazole ( 0.4 g qd ) alone , one patient died and two patients improved without recurrence , and oral fluconazole ( 0.4 g qd ) as sequential therapy was carried out for 34 months .
two cases in the hiv - positive group were infected with other pathogens ( escherichia coli , streptococcus agalactia , and pseudomonas aeruginosa ) and were treated with antibiotics as well . among hiv - negative patients ,
one patient improved after combined administration of amphotericin b liposomal ( 1 mg / kg qd ) and itraconazole ( 200 mg , qd ) for 23 weeks . thereafter , oral itraconazole ( 200 mg , bid ) was given for 4 months .
the other patient was given fluconazole ( 0.4 g qd ) for only 2 months due to financial hardship , and the body temperature gradually decreased to normal .
both patients had histories of glucocorticoid misuse , and gradual tapering was carried out after diagnosis .
one patient with primary immunodeficiency ( c3 complement deficiency ) and one patient with chronic lymphocytic leukemia were treated with itraconazole , but both died due to serious underlying diseases .
the other patient with an intratracheal infection following radiotherapy for lung cancer was discharged without timely diagnosis .
table 1 shows the baseline characteristics of hiv - positive and hiv - negative patients who were diagnosed with tm infection and treated at fujian provincial hospital from september 2005 to april 2014 .
these two groups had similar age , sex distribution , body weight , employment rate , and rates of smoking and drinking . however , the hiv - negative group had a significantly longer diagnostic interval ( time from onset of symptoms to confirmed diagnosis of tm infection ; mann whiney u = 31.50 , p = 0.041 ) and a greater rate of opportunistic infection ( mann whitney u = 6.18 , p = 0.041 ) .
the data also show that the hiv - negative group had a higher prevalence of malignancy ( 14.3% vs. 0% ) , systemic lupus erythematosus ( sle ) ( 28.6% vs. 0% ) , primary immunodeficiency ( 14.3% vs. 0% ) , and leukemia ( 14.3% vs. 0% ) , and the hiv - positive group had a higher prevalence of liver dysfunction ( 58.1% vs. 28.6% ) . however , these other differences were not statistically significant .
there was one case from yunnan , one from jiangsu , one from jianxi , and one who traveled to vietnam ; all other patients were from fujian province and never visited thailand or other southeast regions ( e.g. , guangdong , guangxi , or hong kong ) of china ( data not shown ) .
characteristics of 26 patients diagnosed with tm from september 2005 to april 2014 in fujian , china age and weight are presented as mean sd , disease duration as median ( p25 , p75 ) , and other parameters as count ( % ) .
p values were estimated by an * independent t - test , mann whitney u - test , or fisher s exact test;underlying disease indicates malignancy , systemic lupus erythematosus , primary immunodeficiency and any disease of the heart , liver or kidney ; one patient may have more than one underlying disease ; missing data were found in six patients for weight and in one patient for opportunistic infection ; * * liver dysfunction was defined as aminotransferase > 40 u / l and aspartate aminotransferase > 40
sd : standard deviation ; tm : talaromyces marneffei ; hiv : human immunodeficiency virus .
most patients were admitted with fever as the main complaint ( n = 23/26 , 88.5% ) . among the hiv - positive patients ,
seven cases were initially diagnosed with pulmonary infections at the respiratory departments , seven were diagnosed with gastrointestinal tract infections at the gastroenterology department , two were diagnosed with leukemia at the hematology department , one was diagnosed with rheumatic fever at the rheumatology department , one was diagnosed with an intracranial infection at the neurology department , and one was diagnosed with infective endocarditis at the cardiology department . in the hiv - negative group , three patients were admitted to the department of respiratory and critical care medicine , two were diagnosed with sle and pulmonary infection at the rheumatology department , one was admitted to the pediatrics department with a pulmonary infection , and one was diagnosed with postchemotherapy infection at the hematology department .
one patient with sle who received prednisone for 3 months had oral leukoplakia on admission .
the throat secretion was collected with a swab and oral candida albicans infection was diagnosed .
table 2 shows the clinical symptoms and lung ct findings of the hiv - negative and hiv - positive groups . the two groups were similar in most clinical symptoms , including fever , cough , weight loss , lymphadenectasis , hepatosplenomegaly , rash , wheezing in the lungs , and pleural effusion . however , dyspnea was significantly more common in patients who were hiv - negative ( 57% vs. 5% , = 8.86 , p = 0.010 ) .
clinical signs and symptoms of 26 patients diagnosed with penicilliosis marneffei in fujian , china data are shown as count ( % ) and tested by fisher s exact test .
* fever was classified as mild ( 37.338.0c ) , moderate ( 38.139.0c ) , severe ( 39.140.9c ) , or very severe ( 41.0c ) .
figure 2 shows representative chest x - rays of an hiv - positive patient and an hiv - negative patient .
figure 2a shows a ground - glass opacity in the upper lobe of the left lung of an hiv - negative patient .
figure 3 shows representative ct imaging of lesions in the lungs of four tm patients .
these images show multinodular lesions in both lungs of an hiv - negative patient [ figure 3a ] , patchy shadows in both lungs of an hiv - positive patient [ figure 3b ] , ground - glass - like lesions in both lungs of an hiv - positive patient [ figure 3c ] , and diffused interstitial and multiple cavity - like changes in both lungs of an hiv - negative patient [ figure 3d ] . in general , the intrapulmonary lesions were more severe in hiv - negative patients .
representative chest x - rays of human immunodeficiency virus - positive and human immunodeficiency virus - negative patients with talaromyces marneffei infection .
( a ) male human immunodeficiency virus ( negative ) , 71-year - old with chronic lymphocytic leukemia , the x - ray shows patchy shadows in the upper lobe of the left lung ( arrow ) .
( b ) male , human immunodeficiency virus ( positive ) , 54-year - old with repeated fever for 2 weeks , the x - ray shows nearly normal in both lungs .
representative computed tomography images of human immunodeficiency virus - positive and human immunodeficiency virus - negative patients with talaromyces marneffei infections .
( a ) male , 31 years , human immunodeficiency virus ( positive ) , computed tomography shows multinodular lesions ( arrows ) in both lungs .
( b ) female , 47 years , human immunodeficiency virus ( positive ) , computed tomography shows scattered patchy shadows in both lungs .
( c ) male , 31 years , human immunodeficiency virus ( positive ) , computed tomography shows diffuse ground - glass - like lesions in both lungs .
( d ) male , 56 years , human immunodeficiency virus ( negative ) , computed tomography shows diffuse interstitial lesions with cavity - like changes ( arrows ) in both lungs .
table 3 compares the biochemical indexes of hiv - positive and hiv - negative patients .
the two groups were similar with regard to wbcs , hemoglobin , plt , alb , alt , ast , alp , tbil , and c3 . however , hiv - positive patients had a significantly higher level of neutrophils ( mann whiney u = 27.00 , p = 0.029 ) and lower levels of cd4-positive cells ( mann whiney u = 0.00 , p = 0.009 ) and lymphocytes ( mann whiney u = 21.00 , p = 0.009 ) . biochemical indexes of 26 patients diagnosed with penicilliosis marneffei in fujian , china * data were not available for one patient for wbc and albumin , ten patients for cd4 , and 13 patients for c3 .
g / l ) , mild anemia ( 90120 g / l for males and 90110
g / l for females ) , or moderate anemia ( 6090 g / l ) ; data were not available for one patient for wbc and albumin , ten patients for cd4 , and 13 patients for c3 .
iqr : interquartile range ; alt : alanine aminotransferase ; ast : aspartate transaminase ; alp : alkaline phosphatase ; wbc : white blood cells ; hiv : human immunodeficiency virus .
among 12 hiv - positive patients with amphotericin b treatment , one patient died due to treatment failure and two patients had kidney damage .
one of the patients who had renal toxicity took itraconazole ( 400 mg qd ) and the other took voriconazole ( 200 mg q12h ) instead of the drugs above and both improved .
one patient took amphotericin b for more than 105 days and the total dose exceeded 2.5 g ; this medication was stopped due to hypokalemia .
the symptoms of the remaining eight patients improved without obvious side effects . for the three patients treated with fluconazole ( 0.4 g qd ) alone , one patient died and two patients improved without recurrence , and oral fluconazole ( 0.4 g qd ) as sequential therapy was carried out for 34 months . two cases in the hiv - positive group were infected with other pathogens ( escherichia coli , streptococcus agalactia , and pseudomonas aeruginosa ) and were treated with antibiotics as well . among hiv - negative patients ,
one patient improved after combined administration of amphotericin b liposomal ( 1 mg / kg qd ) and itraconazole ( 200 mg , qd ) for 23 weeks .
thereafter , oral itraconazole ( 200 mg , bid ) was given for 4 months .
the other patient was given fluconazole ( 0.4 g qd ) for only 2 months due to financial hardship , and the body temperature gradually decreased to normal .
both patients had histories of glucocorticoid misuse , and gradual tapering was carried out after diagnosis .
one patient with primary immunodeficiency ( c3 complement deficiency ) and one patient with chronic lymphocytic leukemia were treated with itraconazole , but both died due to serious underlying diseases .
the other patient with an intratracheal infection following radiotherapy for lung cancer was discharged without timely diagnosis .
the hiv - positive and hiv - negative groups both had typical symptoms of systemic tm infection , including fever , weight loss , anemia , and hepatosplenomegaly .
lymph node enlargement , diarrhea , and necrotic skin rash were more common in the hiv - positive group , but dyspnea was more common in the hiv - negative group .
there were no significant decreases in plt numbers , absolute neutrophil count , and crp ( data not shown ) in either group .
most of our patients were males ( hiv - positive group : 86% ; hiv - negative group : 79% ) , in contrast to a previous study in thailand , which reported that females accounted for 50% ( 17/34 ) of the hiv - negative population with tm infection .
the time from symptom onset to diagnosis of tm infection was significantly longer in our hiv - negative patients [ table 1 ] .
the average time from symptom onset to diagnosis in our hiv - negative patients was similar to that reported in nanning china , but longer than that reported in thailand .
this may be because tm infection progresses more rapidly in hiv - positive patients , and these cases tend to present with specific skin rashes , making diagnosis easier . in our hiv - negative group , 71.4% of patients ( 5/7 ) had an underlying disease - related to immune function , higher than reported in thailand ( 38.2% ) and guangdong ( 35.3% ) .
hematogenous dissemination can lead to hepatosplenic damage and lymph node enlargement , although in contrast to the results of kawila et al .
, our hiv - positive and hiv - negative groups had no significant differences in lymphadenopathy or hepatosplenomegaly .
our results indicated that hiv - negative patients were more likely to develop dyspnea than hiv - positive patients , but patients in the two groups had similar lung ct results , in contrast to some previous reports .
previous studies indicated that about 50% of patients with tm infections with hiv - positive have additional opportunistic infections .
more than 70% of our hiv - positive cases had co - infections , mostly with fungi , herpes , and syphilis , but none with tuberculosis or cytomegalovirus , in contrast to previous reports .
hiv - positive patients with low cd4 counts ( < 100 cells/l ) have greatly increased risk of tm infection .
serve as an animal vector for tm , and the increasing incidence of tm infection in the endemic region parallels the increasing incidence of hiv / aids in the same region .
patients may be infected by inhalation of asexual spores or by skin injury , and the weakened immune systems of hiv - infected patients may awaken latent infections .
rapid diagnosis and treatment of tm infection are critical because untreated patients have greatly increased risk of mortality from sepsis . in cases of restricted infection of the lung , the symptoms may resemble bronchitis , bronchiectasis , acute respiratory distress syndrome , or tuberculosis , possibly complicating diagnosis .
patients with disseminated disease develop fever , anemia , weight loss , and skin lesions that typically occur on the face , extremities , and genitalia .
such patients may also have thrombocytopenia , hepatosplenomegaly , and various symptoms of the pulmonary and digestive systems .
drug susceptibility testing of tm showed that the minimum inhibitory concentration ( mic ) for tm increases from low to high for voriconazole , itraconazole , terbinafine , fluconazole , to amphotericin b. the cdc of the usa recommends 2 weeks of intravenous liposomal amphotericin b ( 35 mg / kg body weight ) and then oral itraconazole ( 400 mg qd ) for 10 weeks as a standard treatment for an hiv - infected patient .
however , in fujian , china , itraconazole treatment is not possible in most patients due to its high cost .
thus , in our study , a combined therapy with amphotericin b and fluconazole was used in most patients although standard treatment with amphotericin b and itraconazole was used in several critically ill patients .
our findings , together with previously reported results , indicate that amphotericin b is preferred for the therapy of tminfection
although some patients are responsive to fluconazole in the intensified treatment , caution is needed due to the limited effects .
first , this is a retrospective study with a small sample size that studied patients admitted to a single institution .
second , some patients were lost to follow - up because they were from different provinces of china .
finally , the patients ranged widely in age ( 171 years old ) , so we can not make any inferences regarding the characteristics or treatments of different age groups . in conclusion , patients with tm infection tend to present with fever , weight loss , and anemia .
compared with hiv - positive patients , hiv - negative patients have a longer diagnostic interval , a higher percentage of dyspnea , higher levels of cd4-positive cells and lymphocytes , and lower neutrophil counts .
this study was supported by grants from the national science and technology major special project ( no .
2012y0016 ) , the development and reform commission of fujian province ( no . 2013045 ) , key project of fujian provincial hospital ( no .
this study was supported by grants from the national science and technology major special project ( no .
2012y0016 ) , the development and reform commission of fujian province ( no . 2013045 ) , key project of fujian provincial hospital ( no . 2014080 ) .
| background : talaromyces ( penicillium ) marneffei ( tm ) is an emerging dimorphic human pathogenic fungus that is endemic to southeast asia .
tm mostly occurs as an opportunistic infection in patients with human immunodeficiency virus ( hiv ) .
the objective of this study was to compare the clinical and laboratory parameters of patients with tm infections who were hiv - positive and hiv - negative and to assess therapies and outcomes.methods:this was a retrospective analysis of 26 patients diagnosed with disseminated tm infection from september 2005 to april 2014 at fujian provincial hospital , china.results:patients with tm infection tend to present with fever , weight loss , and anemia . the time from symptom onset to confirmed diagnosis was greater for hiv - negative patients ( n = 7 ; median : 60 days , range : 14365 days ) than for hiv - positive patients ( n = 19 ; median : 30 days , range : 390 days , mann
whitney u = 31.50 , p = 0.041 ) .
hiv - negative patients were more likely to have dyspnea ( 57.1% vs. 5.3% , 2 = 8.86 , p = 0.010 ) , low neutrophil count ( mann whitney u = 27.00 , p = 0.029 ) , high cd4 count ( mann whitney u = 0.00 , p = 0.009 ) , and high lymphocyte count ( mann whitney u = 21.00 , p = 0.009 ) .
there were no significant differences in other demographic , clinical , or biochemical characteristics .
among all the patients , 12 hiv - positive patient and 1 hiv - negative patient received amphotericin and fluconazole treatment , 9 of whom improved , 1 died , 2 had kidney damage , 1 had hypokalemia due to exceeded doses.conclusions:hiv-negative patients with tm infections tend to have a longer diagnostic interval , a higher percentage of dyspnea , higher levels of cd4 and lymphocytes , and lower neutrophil counts than tm infection in hiv - positive patients . treatment programs with amphotericin and fluconazole are mostly effective . |
congenital adrenal hyperplasia ( cah ) is a disorder characterized by impaired biosynthesis of adrenal steroids due to various defects in the activity of the enzymes involved in the synthetic pathway .
the most common variant of cah is due to defect in the 21 hydroxylase enzyme . the defects in this enzyme lead to impaired cortisol and aldosterone synthesis along with diversion of their precursors into adrenal androgens .
the patients may present with salt wasting crisis in infancy ( salt wasting cah ) or with ambiguous genitalia in a female child ( simple virilizing cah ) .
the therapy includes replacement of glucocorticoids and mineralocorticoids to alleviate the deficiency along with control of androgen excess .
glucocorticoids can cause a reduction in bone mineral density ( bmd ) . on the other hand , androgens , including adrenal androgens , are important in achieving and preserving peak bone mass .
hence , it is interesting to study the bmd of patients with cah in whom both these factors are in operation . in previous studies on bmd in cah patients , some have observed normal and while others observed decreased bmd .
the aim of our study is to assess bmd of adult female patients with cah and compare it with healthy women of similar age .
the study group consisted of fifteen female patients with cah with age ranging from 18 to 40 years ( mean standard deviation ( sd ) = 27.5 6.2 years ) being treated in our endocrine outpatient department .
of these 2 had salt wasting cah while 13 had been diagnosed with simple virilizing cah .
the diagnosis was based on clinical grounds and raised serum 17-hydroxyprogesterone ( ohp ) levels .
the study was approved by the institute ethics committee . all patients gave consent for the study .
detailed history including past history of fractures was taken , and physical examination was done .
fasting blood samples were drawn for serum total calcium , phosphate and alkaline phosphatase , serum 25 hydroxy vitamin d , serum intact parathyroid hormone ( pth ) , serum total testosterone , and dehydroepiandrosterone ( dheas ) .
serum 25 ( oh ) d and pth were measured by radioimmunoassay ( diasorin , stillwater , mn , usa ) and electrochemiluminescence assay ( roche diagnostics , gmdh - manheim , germany ) , respectively .
bmd at the anteroposterior lumbar spine ( l1-l4 ) , femur ( total hip ) , and forearm ( 33% radius ) was measured using the hologic discovery dual - energy x - ray absorptiometry system ( hologic inc . ,
at any measured site was defined as osteopenia , and values below 2.5 sd . as osteoporosis .
statistical analysis was carried out using software spss for windows version 20.0 ( spss , inc . ,
bmd was adjusted for age and body mass index ( bmi ) and mean bmd was compared using analysis of covariance test .
the study group consisted of fifteen female patients with cah with age ranging from 18 to 40 years ( mean standard deviation ( sd ) = 27.5 6.2 years ) being treated in our endocrine outpatient department .
of these 2 had salt wasting cah while 13 had been diagnosed with simple virilizing cah .
the diagnosis was based on clinical grounds and raised serum 17-hydroxyprogesterone ( ohp ) levels .
the study was approved by the institute ethics committee . all patients gave consent for the study .
detailed history including past history of fractures was taken , and physical examination was done .
fasting blood samples were drawn for serum total calcium , phosphate and alkaline phosphatase , serum 25 hydroxy vitamin d , serum intact parathyroid hormone ( pth ) , serum total testosterone , and dehydroepiandrosterone ( dheas ) .
serum 25 ( oh ) d and pth were measured by radioimmunoassay ( diasorin , stillwater , mn , usa ) and electrochemiluminescence assay ( roche diagnostics , gmdh - manheim , germany ) , respectively .
bmd at the anteroposterior lumbar spine ( l1-l4 ) , femur ( total hip ) , and forearm ( 33% radius ) was measured using the hologic discovery dual - energy x - ray absorptiometry system ( hologic inc . ,
at any measured site was defined as osteopenia , and values below 2.5 sd . as osteoporosis .
statistical analysis was carried out using software spss for windows version 20.0 ( spss , inc . ,
bmd was adjusted for age and body mass index ( bmi ) and mean bmd was compared using analysis of covariance test .
the cases included 15 women , 13 with simple virilizing and 2 with salt - wasting cah .
the mean age of cases was 27.5 6.2 years while that of the controls was 27.2 5.2 years .
the mean serum calcium level was 8.6 mg / dl ( normal range : 8.510.5 mg / dl ) , serum phosphorus 2.9 mg / dl ( normal range : 2.55.5 mg / dl ) , serum alkaline phosphatase 120 iu / l ( normal range : < 240 ) , serum dheas 186 ng / dl ( normal range : 98340 ng / dl ) , and mean serum testosterone 0.9 ng / ml ( normal range : 0.080.48 ng / ml ) .
the mean pth was 76.29 pg / ml ( normal range : 1065 pg / ml ) and mean 25 hydroxy vitamin d was 9.8 ng / ml ( reference range : < 10 ng / dl - deficient , 1030 ng / dl insufficient , > 30 ng / dl sufficient ) . the age , bmi , bmd at hip , lumbar spine , and forearm of the cah patients are shown in table 1 .
characteristics of cah cases the most commonly used drug was dexamethasone which was used by 14 out of 15 cases .
one case had been managed on prednisolone alone . among the cases managed with dexamethasone , six cases received prednisolone and
exact data on doses of steroids used in these cases was not available since that was to be obtained from patient records which were not available in few patients .
being a disease for which patients had been on steroids for long , ( many since childhood ) patients did not remember the exact period of default .
the mean age and bmi of patients and controls were comparable [ table 2 ] . among controls ,
the mean bmd at hip , spine and for arm was 0.92 0.07 , 1.02 0.08 , and 0.56 0.04 g / cm respectively .
the t - score at the hip , spine and for arm were 0.9 ( 1.8 , 0.5 ) , 0.7 ( 2.2 , 0.7 ) and 0.4 ( 2.4 , 2.1 ) , respectively .
comparison of mean bmd and t - score in cah and controls among cases , the mean bmd at the hip was 0.84 0.09 g / cm which were significantly lower when compared to healthy controls .
bmd at spine among cases was lower ( 0.96 0.09 g / cm ) than among controls ( 1.02 0.08 g / cm ) .
bmd at forearm was not significantly different between cases and controls [ table 3 ] .
the median t - scores were 0.9 and 0.7 at the hip and lumbar spine , respectively .
age and bmi adjusted mean bmd at hip , lumbar spine and forearm in cah and control subjects after adjusting for age and bmi , bmd in cah was significantly lower at the hip ( p = 0.039 ) , low at the spine ( approaching significance ; p = 0.057 ) and not different from controls at forearm [ table 3 ] .
our study revealed significantly lower bmd at hip in cah subjects as compared to healthy controls .
the mean bmd at the spine in cah patients was also lower than healthy controls , almost reaching the level of significance ( p = 0.057 ) , [ table 3 ] . however , bmd at forearm was not different from controls .
several initial studies of bmd in cah patients did not report significantly lower bmd compared to controls .
both classical and nonclassical cah have been reported to have bmd similar to controls after adjusting for confounding variables .
it was proposed that low dose glucocorticoids used in cah may not predispose to low bmd .
inhibitory effect of corticosteroid therapy on bone formation could be counteracted by estrogen 's effect on the rank - l / osteoprotegerin system reducing bone resorption .
a study comparing bmd in cah and central precocious puberty found higher bmd in cah ( after adjusting for bone age ) thus suggesting that adrenal androgens either directly or by conversion to estrogens are important determinants of bmd .
interestingly , one of these studies showed a reduction in bone turnover markers such as serum osteocalcin , bone alkaline phosphatase , tartrate - resistant acid phosphatase , and urinary cross - linked n - telopeptides of type i collagen despite no significant decline in bmd .
it is plausible that such a biochemical profile would eventually lead to reduced bmd and due to a small sample size , the effect was probably missed . however , more recent reports have shown low bmd in cah cases . in a study of 61 female patients with cah due to 21
hydroxylase deficiency with age ranging from 18 to 63 years , total body , lumbar spine , and femoral neck bmd were lower as compared to matched controls . in that study ,
this might suggest that patients , who have been taking corticosteroids for a longer period of time and thereby having a larger cumulative dose , are at increased risk of osteopenia .
this is evident from the point that among patients younger than 30 years , 48% were osteopenic versus 12% in controls ( p < 0.009 ) . on the other hand , in patients
30 years or older , 73% were osteopenic or osteoporotic versus 21% in controls ( p < 0.001 ) .
the mean age of cah in our study is lower than studies which show higher fracture rates in cah . in our study ,
patient group had significantly lower bmd at the hip while bmd at spine was also low .
no fractures occurred in our cases . in another study of 45 adults with cah out of which 36 were females , 55% patients had decreased bmd at the femoral neck and/or at the lumbar spine . subjects with osteopenia had a significantly lower bmi and received higher hydrocortisone dose than those with normal bmd . in a recent study of eighty cah adults ( 47 classic and 33 nonclassic ) ,
patients with classic compared to nonclassic cah , had higher 17-ohp , lower dheas , and higher nontraumatic fracture rate .
higher dheas was independently associated with higher bmd at the spine , radius , and whole body .
authors of this study suggest that lower dheas in classical cah may be associated with weak cortical bone independent of glucocorticoid exposure .
mean testosterone was 0.9 ng / ml ( normal range : 0.080.48 ) and mean serum dheas level was 186 ng / ml ( normal for this age 98340 ng / ml ) . in another study , salt wasting cah was associated with greater risk of low bmd in adult females as compared to simple virilizing and nonclassic cah . over suppression of adrenal androgens increased the risk for low bmd .
our cah cases had a slightly higher mean testosterone ( 0.9 ng / ml ; normal range : 0.080.48 ng / ml ) .
mean 25 hydroxy vitamin d was 9.8 ng / ml . vitamin d deficiency is known to be associated with low bmd .
low bmd has been reported in a study of 30 male cah subjects of age ranging from 19 to 67 years with mean age of 36.5 years .
there was no change in fracture frequency . in studies in children with cah , low bmd at lumbar spine and hip
poor control , prednisolone use , use of hydrocortisone doses more than 20 mg / m , longer duration , low 25 hydroxy vitamin d , and higher 17-ohp levels were all associated with low bmd . in another study ,
the use of dexamethasone did not by itself increase the risk of low bmd as long as the glucocorticoid dose in hydrocortisone equivalents remained the same .
total cumulative glucocorticoid dose was an important factor for low bmd in both classic and nonclassic cah patients .
these discrepancies in studies on bmd in cah could be due to differences in age of patients , type and severity of enzyme deficiencies , and different therapeutic regimes and their duration .
a major limitation of our study is that since data on intake of steroids was collected retrospectively , patient record and prescriptions alone did not confirm steroid intake ( especially in simple virilizing cah who were not sick without steroids ) .
majority of patients , i.e. , 13 out of 15 were simple virilizing and admitted they did not remember how long they had not taken medicine intermittently .
thus , hydrocortisone equivalent doses are not available , and its impact can not be assessed .
similarly , a single time testosterone and dheas level can not be correlated to the bmd as it will vary with time depending upon a amount of steroids treatment taken .
our study showed reduced bmd at the hip ( significant ) and spine ( reaching significance ) in adult female cah cases as compared to healthy controls .
glucocorticoid doses should be optimized , monitored , and adequate vitamin d prophylaxis and treatment instituted to make patients vitamin d replete .
| background : there is equipoise regarding the status of bone mineral density ( bmd ) in patients with congenital adrenal hyperplasia ( cah ) , where patients need to be on long - term low - dose steroids.objective:we aimed to evaluate bmd at the hip , spine and forearm in women with cah and compare it to healthy young adult women of the same age range.subjects and methods : fifteen adult women with cah with age ranging from 18 to 40 years ( mean standard deviation = 27.5 6.2 years ) underwent dual - energy x - ray absorptiometry along with laboratory evaluation .
bmd at lumbar spine , hip , forearm along with t - scores were measured .
serum total calcium , phosphate , alkaline phosphatase , 25 hydroxy vitamin d , intact parathyroid hormone , total testosterone , and dehydroepiandrosterone were assayed .
history of any fractures in the past was taken .
fifteen healthy women in the same age range were taken as controls for comparison.results:the bmd at hip ( 0.85 0.02 g / cm2 ) in cah was significantly lower as compared with controls ( 0.92 0.03 g / cm2 , p = 0.029 ) .
bmd at lumbar spine was also reduced ( 0.96 0.02 vs. 1.03 0.03 , p = 0.057 ) .
the bmd at forearm was not significantly different between cah and controls .
the mean vitamin d was 9.8 ng / ml ( deficient range ) .
there was no history of fractures in cah.conclusion:young adult cah women had lower bmd at spine and hip than healthy young adult women of the same age range .
the forearm bmd was not different from controls .
no change in fracture frequency was present .
patients with cah being treated with steroids are at increased risk of osteopenia , and their bone health needs to be monitored . |
research on cardiopulmonary resuscitation ( cpr ) has been intensively carried out over recent years and led to improved rates of successful resuscitation . however , the topic of interest is not only the ultimate outcome of whether patients are discharged from the hospital , but also the neurological outcome . in this context
a processed eeg analysis computing the bispectral index ( bis ) is one method for monitoring the level of consciousness during anaesthesia .
the bis value is a single numeric value on a scale from 0 to 100 .
while values of 85100 indicate consciousness , sedation occurs at levels ranging from 65 to 85 and general anaesthesia is titrated to values between 40 and 60 .
the spontaneous eeg will be inhibited once cerebral perfusion pressure is reduced below a critical value as a result of the protective mechanism that reduces the metabolic demands of neuronal ischaemia . a review of the literature revealed only eight case reports of using bis monitoring during cpr published in the last 6 years , but none described bis monitoring in only one patient undergoing double cardiac resuscitation within a few days .
we report the case of a 69-year - old man suffering twice from cardiac arrest within 8 days , both monitored with bis , which revealed different results with different outcomes .
the first cardiac arrest occurred on the haematological ward . on arrival of the cpr team ,
the patient was gasping for air , had enlarged pupils , and primary pulseless electrical activity was the first heart rhythm identified on electrocardiography .
after immediate intubation and ventilation , the patient received a total of 4 mg of epinephrine during cpr .
spontaneous circulation returned after 13 min and the patient was transferred to the intensive care unit ( icu ) , where he needed extensive catecholamine treatment for the next 6 h. bis monitoring was started 11 min after the cardiac arrest and showed an initial bis value of 87 and an average value of 78 5 , a suppression ratio of 0 and a sufficient sqi ( signal quality index , derived from impedance measurement of electrodes ) , which is considered to be above 50 ( fig . 1 ) .
the sedation regimen consisted of 20 mg etomidate in the first 15 min of cpr ; additionally propofol ( between 80 and 160 mg / h ) and fentanyl ( 157 g / h ) were administered after return of spontaneous circulation . in the following 2
h the patient suffered several times from brief cardiac arrest , which required short periods of cpr and 200 meq of sodium bicarbonate to stabilize metabolism .
eight hours after the first cpr the catecholamine dosage could be stopped , and the patient emerged from anaesthesia without showing neurological deficiencies .
a mini - mental state examination showed 27 of 30 points , and the cerebral performance category score was 2 . to detect the cause of the cardiac arrest , computed tomography ( ct ) angiography scan of the body was performed and showed incomplete , bilateral pulmonary embolism of single segmental arteries as the probable cause of the cardiac arrest , while radiological examination disclosed no pathological findings in the brain .
the patient was discharged from the icu on day 4 after admission under stable cardiopulmonary conditions , but suffering from acute renal failure .
1bis monitoring during the first cardiac arrest , when the patient survived without any neurological deficiency .
note that the value of the suppression ratio was 0 during the entire external cardiac compression bis monitoring during the first cardiac arrest , when the patient survived without any neurological deficiency .
note that the value of the suppression ratio was 0 during the entire external cardiac compression eight days after discharge , the patient collapsed again and suffered from respiratory insufficiency with dyspnoea , cyanosis and an oxygen saturation of 70% .
it was possible to stabilize the patient under biphasic positive airway pressure ( bipap ) ventilation .
no ct scan for the diagnosis of pulmonary embolism followed due to the lack of therapeutic consequences .
after the first stabilization with non - invasive artificial ventilation the patient s respiration and circulation became increasingly insufficient , requiring intubation and catecholamine treatment .
sedatives and analgesics consisted of midazolam ( 10 mg / h ) and fentanyl ( 157 g / h ) .
later on , the patient again needed cpr after diagnosis of pulseless electrical activity on the ecg , probably caused by a second thromboembolic event .
the initial bis value was 72 and decreased to 13 during cpr with an average value of 46 22 ( fig . 2 ) .
the suppression ratio increased from 11 to 68 and emg decreased from 39 to 28 . despite intensive treatment with high catecholamine doses ,
it was not possible to combat the haemodynamic insufficiency and thus intensive care physicians decided to stop cpr .
bis values initially reached high levels and decreased after 15 min of cardiac decompression .
the burst suppression pattern occurred immediately at the beginning of resuscitation and suppression continuously rose until the end of cardiac compression .
the last increase of bis possibly represents improved cerebral activity following a rise of mean arterial pressure caused by a final bolus of 5 mg epinephrine prior to stopping cpr the second cardiac arrest was followed by an unsuccessful cardiac resuscitation .
bis values initially reached high levels and decreased after 15 min of cardiac decompression .
the burst suppression pattern occurred immediately at the beginning of resuscitation and suppression continuously rose until the end of cardiac compression .
the last increase of bis possibly represents improved cerebral activity following a rise of mean arterial pressure caused by a final bolus of 5 mg epinephrine prior to stopping cpr
bis monitoring has shown its value in operating rooms around the world in preventing awareness during surgery and in the control of anaesthesia [ 1 , 2 ] .
there are a few reports of using bis as a monitor in cardiac arrest and there is considerable interest in whether it could be useful to predict the outcome of cpr .
we report a case of a 69-year - old patient with the unique situation of having had two cardiac arrests within 8 days , receiving bis monitoring twice during the cpr and showing two different courses of bis values , resulting in two completely different outcomes . during the first event the patient had immediately high bis values under cpr and a good neurological outcome .
the cpr team considered stopping resuscitation due to the length of the resuscitation and the patient s palliative status , but the patient showed return of spontaneous circulation . assuming that high bis values result from good cerebral perfusion , the conclusion would be that high bis values might be the result of a sufficient mechanical resuscitation .
additionally , bis monitoring of the suppression ratio can also detect suppression patterns indicating cerebral ischaemia . during the first course of cpr the electrical activity of the patient s brain did not show any suppression ratio , when bis monitoring started .
this fact highlights the existing activity of basic and functional metabolism of the brain . in the second course of cpr 8
days later , the patient had low bis values under cpr , which further decreased .
the most interesting point seems to be that bis monitoring may be a good parameter of sufficient cardiac output under cardiac massage in cases of pulmonary thromboembolism . during the first event fragmentation of the pulmonary thrombus apparently occurred resulting in good cerebral perfusion and bis values . at the second event cardiac massage failed to result in sufficient cerebral perfusion .
previous reports have suggested bis values above 40 as favourable for the patient s outcome .
additionally , increasing bis values in the early stage of both during and after resuscitation are associated with good survival and sufficient cerebral performance [ 5 , 6 ] . unlike former case reports , the bispectral index , suppression ratio and emg values are presented for discussion in the context of a double cpr event in the same patient .
there are several concerns in the overestimation of pure bis values , which could limit the prognostic value of bis monitoring .
various manipulations to the head and body during cpr can lead to high emg values , which can cause an artificial increase of the bis and may diminish the assessment of bis values .
emg levels between 40 and 60 may influence the bis values and cause false high bis values .
a low signal quality and narcotics can also influence the bis value , especially propofol , anaesthesia gas and other anaesthetics [ 810 ] .
the bis values of our patient increased despite sedation with etomidate and fentanyl during the first cpr and decreased during the second cpr under an even lower amount of sedatives .
additionally , etomidate in particular is known to cause muscle fasciculations , which can produce an emg artifact .
however , the administered drugs did not have a strong influence on the bis and emg values in the dose in which they were applied in both cprs , and the emg remained at the same level despite the application of a small dose of etomidate .
one limitation of interpreting bis values may be a low eeg quality , but the signal quality was sufficient and high bis values resulted in survival and a good cerebral outcome after the first cpr . initially lower and further decreasing bis values were associated with the death of the patient at the second cpr ( fig . 2 ) .
the patient showed bis values around 77 , which resulted in a good outcome ( fig . 1 ) , while values between 55 and 10 during cpr resulted in an unfavourable outcome ( fig . 2 ) .
other authors described bis values above 40 as acceptable during cpr [ 3 , 12 ] .
interestingly , the pattern of the suppression ratio showed a relatively high value at the beginning of monitoring , which continuously increased until the end of resuscitation during the second cardiac arrest . there may be a possible reciprocal correlation between the high suppression ratio values and the success of cpr .
presumably , the suppression ratio may give more information in combination with the bis value than the latter value alone .
since the suppression ratio value can not be influenced by the emg , it may be a more reliable parameter than the bis value , which is calculated from many subparameters including the emg .
however , increasing bis values after stabilization of the circulation correlated with favourable outcome in this particular case , while decreasing values ended with death . besides cerebral monitoring during anaesthesia bis may monitor the success and quality of external cardiac compression especially in patients suffering from thromboembolism in the pulmonary circulation . | research on cardiac resuscitation has led to various changes in the techniques and drug administration involved in modern advanced life support . besides improving primary cardiac survival ,
interest is increasingly focused on a favourable neurological outcome .
however , until now there has been no on - site equipment to support the clinical observations of the cardiopulmonary resuscitation ( cpr ) team .
bispectral index ( bis ) monitoring has been used for avoiding awareness during anaesthesia for many years .
we report a case of a 68-year - old patient suffering twice from cardiac arrest due to thromboembolism within a few days .
while the first cardiac resuscitation was survived without neurological consequences , the patient died after the second event .
both resuscitation events were monitored using the bis .
we discuss the course of bis values and their possible contribution to the prediction of outcome . |
one of the enduring challenges in biology is to learn how the amazing complexity and diversity of life forms arise from a limited repertoire of heritable factors . to understand the emergent properties of biological systems , it is necessary to first map the functional organization of the complex biological networks that underlie them .
many levels of function will need to be analyzed systematically to arrive at this goal .
mapping molecular interactions such as protein - protein , protein - dna , and rna - rna interactions will help define structural and regulatory relationships .
however , understanding organizational principles that determine how different parts of these networks are coordinated will require uncovering functional dependencies that may not be reflected in direct physical interactions , for example between actin- and tubulin - dependent cellular processes .
large - scale mapping of genetic interactions in model organisms offers a powerful approach to tackle this challenge . a recent genetic - interaction study published in journal of biology by byrne et al . ,
focusing on signaling pathways of the nematode worm caenorhabditis elegans , pushes the envelope of genetic - interaction mapping in a multicellular organism by developing a novel approach to defining networks of genetic interactions based on interaction strength , and integrating these networks with other dimensions of genome - scale data in order to reveal global patterns of functional relationships .
one simple reason is to help assign functions to the many nonessential genes whose in vivo requirements remain obscure . genetic and reverse genetic studies in saccharomyces
cerevisiae , c. elegans [ 4 - 7 ] , and drosophila melanogaster indicate that the majority of genes ( around 7585% ) in both single - celled eukaryotes and metazoans appear to be dispensable for survival ; moreover , only about half of protein - coding genes in yeast and about 25% in the worm give rise on their own to any discernable phenotype in vivo .
however , genetic modifier screens for enhancement or suppression of specific phenotypes have been used with great success in model organisms to identify genes with related functions and to order genes within pathways involved in numerous biological processes ( for a review see ) .
many genetic elements identified in this way give rise to detectable phenotypes only when their function is compromised in combination with other genetic loci . in medicine , there is an increasing recognition that the etiology of many diseases involves multiple genetic factors that confound simple genotype - phenotype relationships .
characterizing patterns of genetic interactions can also help us understand how organisms resist or adapt to environmental or genetic variation .
biological networks are increasingly seen as modular systems , in which coordinated assemblies of components with specialized functions mediate distinct processes that are , to some extent , insulated from other parts of the network . thus perturbing
the activity of a single component is often not catastrophic ; instead , systems find ways to compensate .
this impressive resilience is thought to reflect fundamental architectural properties of molecular networks that underlie both the robustness and the adaptability of biological systems .
robustness refers to the ability of organisms to maintain phenotypic stability through homeostatic mechanisms that allow them to tolerate fluctuations in environmental conditions or genetic variation .
phenotypic buffering allows the accumulation of mutations in a particular genetic background ; when buffering mechanisms break down , this hidden genetic variation may become expressed .
this is famously illustrated by the example of hsp90 which when impaired can release striking morphological diversity in almost any adult structure in the fly but may be a more general property of genetic networks .
thus , buffering can both promote homeostasis and foster phenotypic plasticity under the right conditions . identifying functional connections between particular molecules and modules on a global scale will help us both to learn about explicit mechanisms and to develop a theoretical framework for how organisms adjust to variability in external conditions and internal network states .
the most comprehensive analyses of genetic interactions so far have been performed in s. cerevisiae .
high - throughput approaches have been developed in yeast to create qualitative and quantitative maps of genetic interactions , including synthetic sick or lethal ( ssl ) interactions for essential and nonessential sets of genes , synthetic dosage suppression or lethality , and complex haploinsufficient interactions .
these techniques are enabled by the generation of strain libraries with mutations in every gene , allowing large - scale screening of deletions , conditional or hypomorphic alleles and inducible overexpression constructs .
these approaches have also been extended to map the sensitivity of yeast to various chemicals , revealing interactions between specific genes and environmental perturbations ( see , for example , [ 20 - 22 ] ) .
the growing body of genetic - interaction studies has greatly extended our understanding of the functional organization of biological processes in yeast , in terms of both specific functional relationships and global properties .
for example , although the ssl and protein - protein interaction ( ppi ) maps overlap more than expected by chance ( approximately 13% of within - complex ppis are ssls , compared with 0.5% expected by chance ) , the number of overlapping interactions is very small overall ( around 14% of ssl pairs are also ppis ) , pointing to essential differences in the type of information that these networks provide about functional organization within cells .
ppis correspond mainly to physical complexes and pathways , whereas patterns of ssl interactions predominantly reveal between - pathway relationships that expose functional links between related cellular processes ; thus genes in the same pathway or complex tend to share many of the same genetic - interaction partners .
this body of data has also stimulated significant interest in exploring the types of interactions that can be observed genetically and in defining mathematical models that should be applied to interpret the results of genetic - interaction studies .
for example , using a ' min ' definition , in which any phenotype worse than either of the single mutants is called a genetic interaction , will yield a different ( and much larger ) set of interactions than using a ' product ' rule , in which the phenotype of a double mutant must be worse than the product of either single mutant alone . considering synergistic genetic interactions in yeast ,
alternative definitions differ with respect to identifying functional relationships and can lead to different conclusions regarding the underlying biology .
this issue also has significant implications for the interpretation of genetic interactions in other organisms .
similar approaches now need to be extended to study complex interactions in multicellular organisms . as described in byrne et al . , a collaborative study between the groups of peter roy and josh stuart takes a significant new step in this direction .
although the analysis of genetic interactions for individual genes of interest has long been a mainstay of genetics in metazoan model organisms such as the worm and the fly , large - scale systematic efforts have lagged far behind those in yeast , mainly because of technical limitations : comprehensive libraries of deletion strains do not yet exist , and selecting and analyzing progeny from the 200 million or so possible mutant crosses using forward genetic methods is a logistical nightmare . with few reported exceptions ,
a purely reverse genetic approach using combinatorial rna interference ( rnai ) to target two genes simultaneously in the same animal has not met with great success in most worm labs . however , a hybrid strategy , in which individual genetic alleles are screened against a library of genes depleted one at a time by rnai , has proved an effective alternative in studies of increasing scale [ 26 - 29 ] .
report a network of 1,246 genetic interactions between genetic alleles of 11 ' query ' genes ( primarily involved in conserved signaling pathways specific to metazoans ) and genes from a library of 858 ' target ' genes depleted individually by rnai .
the target gene set was split between 372 genes likely to be involved in signal transduction ( based on functional annotations ) and 486 genes on linkage group iii ( which may contain new , previously unidentified signaling targets ) . although the total number of interactions tested was not significantly larger than several recent studies [ 27,29 - 31 ] , the work by byrne et al .
stands out in its attempt to provide a more quantitative assessment of the strength of genetic interactions and in its novel use of a global data - analysis approach designed to identify interacting pairs in an unbiased fashion .
the experimental design involved estimating numbers of progeny on solid agar over several days using a graded scoring scheme in blind triplicate assays . from these data the authors constructed a large compendium matrix of 56,347 scores and inferred 51 unique sets of genetic interactions by varying six parameters ( for example , deviation between experimental and control samples , number of days with an observed deviation and reproducibility ) .
they then chose two network variants that corresponded best to shared gene ontology ( go ) terms : a ' high confidence ' variant containing 656 unique interactions among 253 genes , and a larger variant with slightly higher recall containing 1,246 interactions among 461 genes .
to evaluate their results , the authors analyzed their genetic - interaction networks in a variety of ways , both independently and in combination with other datasets .
first , they identified many potential new functional links and confirmed a number of previously noted links within and between specific signaling pathways ( for example , transforming growth factor wnt/-catenin ; fibroblast growth factor epidermal growth factor ) .
these links provide many hypotheses for follow - up studies to determine their potential significance in development .
second , based on comparisons with a variety of other datasets , byrne et al . concluded that their approach resulted in much higher detection sensitivity than most previous screens , which they attributed to their ability to detect both strong and weak interactions and their novel method of identifying interacting pairs .
third , by overlaying their genetic - interaction network with protein - protein interactions , coexpression and co - phenotype data , the authors found that there is little overlap between datasets , suggesting that the genetic interactions they identified are revealing novel functional relationships .
even though the ppi and phenotype data are still relatively sparse with respect to the entire genome , and the level of specificity provided by the phenotype and expression links is limited , this result is consistent with studies in yeast . within the superimposed network ,
the authors identified highly connected subnetworks , which in at least one example revealed a significant enrichment for similar rnai phenotypes and previously undocumented genetic interactions upon retesting .
many of these subnetworks were enriched for shared functional annotations , and a significant number were bridged by genetic interactions ( figure 1 ) , supporting the idea that genetic interactions connect different functional modules .
this observation is curious in light of the fact that the final genetic - interaction network was selected to maximize shared go terms , and possibly suggests that this standard may not be the optimal measure to evaluate the fine structure of functional relationships within a cell or organism .
alternatively , refining the functional neighborhoods used for this analysis ( ' broad subnetworks ' based on a single mode of interaction , such as co - expression , and containing dozens or hundreds of genes ) may provide a higher level of resolution that would bring these relationships into better focus . finally , when the authors compared the connectivity of yeast and worm genetic - interaction networks , they found no significant evidence for conservation of synthetic genetic interactions between species .
thus , as in yeast , genetic interactions identified in the worm appear to reveal higher - level inter - module functional relationships ( see figure 1 ) ; however , the specific patterns of connectivity between modules may not be evolutionarily conserved . adapted from byrne et al .
, a superimposed network composed of different types of functional linkages contains subnetworks of genes that are highly interconnected based on one type of data : coexpression ( blue ) , co - phenotype ( green ) , or eukaryotic protein - protein interactions ( ' interolog ' ; purple ) .
byrne et al . found that these subnetworks were bridged by genetic interactions ( pink ) more often than expected by chance .
many such subnetworks were enriched for genes with shared functional annotations , supporting the idea that enhancing genetic interactions ( identified by reduced function of a pair of genes ) tend to bridge distinct functional modules .
these are very early days for systematic genetic interaction studies in metazoans , and many questions both theoretical and technical remain unresolved .
a notably unglamorous but important set of technical considerations is that differences in methodology between different studies in the same organism will heavily influence both the composition of reported datasets and conclusions drawn from them .
chief among these considerations , as illustrated by the 51 network variants identified by byrne et al . and comparisons with results from a similar study by lehner et al .
, is that differences in experimental design , scoring methods and models used to define genetic interactions will necessarily result in different sets of reported interactions .
notably , both byrne et al . and lehner et al . achieved high technical reproducibility ( 83% and more than 90% , respectively ) ; in contrast , when genetic alleles and rnai for query - target pairs were reversed , only 40% ( 6/15 ) of reciprocal tests by byrne et al . interacted .
this indicates that these screens may be far from saturation , as rnai does not always phenocopy genetic alleles and can carry considerable false - negative rates . unlike lehner et al .
, who placed a lower estimate of 32% on their detection rate for previously reported genetic interactions ( some of which , for example suppressors , would not be expected to be detected as synthetic lethals ) , byrne et al . did not compare their results with a ' gold standard ' of genetic interactions from the literature .
instead , they evaluated functional cohesion by precision and recall of shared go terms , achieving somewhat lower precision but much higher recall ( as well as a higher total number of interactions ) among pairs tested in both studies .
this and other comparisons suggest that the detection methods used by lehner et al . were more stringent , resulting in a bias toward stronger genetic interactions , and that byrne et al .
. , which was based on binned ranges of estimated survival rates , would be to precisely measure lethality in these assays .
currently , one of the biggest technical limitations for large - scale rnai - based screens in c. elegans is the lack of efficient high - throughput methods to quantitate lethality , growth rates , and other morphological phenotypes , which limits the extent to which issues surrounding the quantitative definition of genetic interactions can be explored . over time , as technical approaches evolve and further large - scale screens and in - depth studies accumulate , it will be interesting to revisit these comparisons .
a more profound question is , to what extent will patterns of genetic interactions be conserved across species ?
answers to this question will inform how we use cross - species inferences to guide studies in less experimentally tractable systems .
a preliminary comparison between worm and yeast suggested that , in contrast to ppis , there is little conservation of genetic interactions between these two organisms .
for example , it is not clear if this comparison considered whether all of the positive genetic interaction pairs in c. elegans were actually tested in yeast .
since the set of gene pairs that has been tested differs substantially between yeast and worm , tests of conservation should be made only for subsets of gene pairs that have been systematically tested in both organisms .
more obvious is the dichotomy between unicellular and multicellular organisms : yeast are directly exposed to the environment , and must modulate their internal states accordingly , whereas metazoans comprise many different cell types with distinct internal states and external contacts .
measuring survival and growth rates thus provides a relatively direct readout of cell status in yeast , whereas the types of phenotypic assay performed in metazoans will heavily influence our ability to detect different patterns of genetic interactions .
the interpretation of negative results in whole - animal assays is further complicated by the possibility given a particular experimental setup or phenotypic assay that two potentially interacting components may not become limiting in the same cell types , or that interactions in a subset of cells will not give rise to obvious organismal phenotypes .
studies of mammalian and drosophila cells in culture have begun to report genome - wide genetic requirements for specific cellular functions , but these can not reveal how biological systems as a whole adapt to the loss of specific genetic determinants .
thus , the answer to whether genetic - interaction studies in model systems will provide practical insights into human biology and disease mechanisms awaits further studies .
good reason for optimism stems from the deep conservation of many developmental signaling pathways and the fact that many human disease processes can be effectively studied in these models ( the fly and worm , for example , even provide model systems to study mechanisms underlying alzheimer 's disease ) .
what 's next ? extending systematic genetic - interaction maps to other metazoan systems , including alleviating ( suppressing ) as well as synthetic ( enhancing ) interactions , using more specific high - throughput assays ( for example , those that allow tissue - specific readouts ) , and developing quantitative assays , will greatly expand our understanding of molecular network organization in complex multicellular organisms .
these approaches could also be combined with chemical genetic profiling , as pioneered in yeast , to develop therapeutic strategies based on multiple molecular targets within the cell .
experimental approaches for mapping genetic interactions will both inform and be guided by efforts to generate predictive models for both gene function and functional associations between genes ( for example ): the continued accumulation of large unbiased training sets will help develop better predictive methods , which in turn will help fill out neighborhoods of interactions and reduce the combinatorial search space for studies directed at specific pathways . finally , it will be interesting to compare the spectrum of phenotypes and genetic interactions identified in systematic studies of genetic alleles and rnai with those arising from variation in natural populations ( for example , see ) . building on knowledge gained from decades of studying specific genes and pathways , global analysis of genetic - interaction networks
promises to reveal new insights that will broadly influence our thinking about both applications to medicine and the relationship between network architecture and biological function .
i wish to thank f. roth , m. siegal , f. piano and a. fernandez for constructive comments on the manuscript and nih ( hd046236 and hg004276 ) , us department of the army ( w23ryx-3275-n605 ) , and nystar ( c040066 ) for research support . | systematic mapping of genetic - interaction networks will provide an essential foundation for understanding complex genetic disorders , mechanisms of genetic buffering and principles of robustness and evolvability .
a recent study of signaling pathways in caenorhabditis elegans lays the next row of bricks in this foundation . |
the most common sites affected are the ovaries , uterine ligaments , recto- and vesico - vaginal septae , pelvic peritoneum , cervix , labia and vagina .
malignant transformation of endometriosis may occur in up to 1% of women , with the most common site being the ovary ( 1 ) .
the risk of ovarian cancer increases among patients with a long history of ovarian endometrioma ( 2 ) , and the malignant transformation of endometriosis may be affected by the hormonal changes associated with menopause ( 3 , 4 ) endometriosis is present in 10% to 15% of patients with ovarian cancer , with the most common extra - ovarian site of neoplastic transformation being the rectovaginal septum ( 5 ) .
forty patients with endometriosis - associated intestinal tumors have been reported ( 6 - 7 ) , but malignant transformation of endometriosis in the uterine cervix is exceedingly rare . in this report
, we describe a woman with endometrioid adenocarcinoma arising from endometriosis of the uterine cervix .
in addition , we review the literature on this condition , and discuss the prognostic factors and the most appropriate therapeutic approaches .
a 48-yr - old woman complaining of severe dysmenorrhea was referred for investigation of a pelvic mass .
she was otherwise well , was not taking hormone medication , and had a body mass index of 24.4 kg / m .
magnetic resonance imaging showed an image typical of an endometrial cyst of the uterine cervix , with high intensity in t1w1 and t2w1 , a smooth surface , and shading .
adenomyosis was observed in the body of the uterus , but there was no evidence of enlarged lymph nodes or ascites ( fig .
her serum concentration of ca125 was 359 u / ml ( normal < 35 u / ml ) . at the time of laparotomy , she had an enlarged uterus ( 1276 cm ) , which weighed 231 g , and her uterine cervix was enlarged to the size of an egg , with multiple round masses .
severe adhesion was observed , with endometrial tissue in the posterior wall of the uterus and the peritoneum and total posterior cul - de - sac obliteration .
the left ovary was adherent to the posterior surface of the uterus , with a dark brownish cyst typical of an endometrial cyst .
total abdominal hysterectomy and bilateral salpingo - oophorectomy with adhesiolysis were performed , and the specimens were submitted for frozen section analysis .
pathologic examination of the frozen sections suggested an adenocarcinoma arising from endometriosis in the cervical wall . on gross examination ,
the cervical wall of the uterus contained a relatively well defined , cystic lesion filled with dark brown fluid , measuring 32.22.2 cm .
the dark brown colored inner surface of the cyst showed multi - focal , papillary growing , solid and granular masses , measuring up to 0.80.80.5 cm ( fig .
2 ) . microscopically , these masses were composed of well differentiated endometrioid adenocarcinoma , which was directly adjacent to the epithelium of the endometriotic cyst of the cervical wall . transitional areas between the glandular epithelium of the endometriosis and the endometrioid adenocarcinoma cells were observed .
there was no invasion to the cervical stroma and no connection between the overlying mucosal epithelium of the endo - ectocervix and the epithelium of the endometriosis or the adenocarcinoma .
there was no evidence of a primary endometrial or endocervical adenocarcinoma in the endocervix or endometrium ( fig .
multiple foci of endometriosis were present within the posterior wall of the uterus and both ovaries .
a serous cystadenoma was also present in the right ovary , measuring 4.0 cm in greatest dimension .
the expression of estrogen and progesterone receptors , p53 and c - erb b-2 was analyzed using paraffin immunohistochemistry .
weak expression of p53 and c - erbb2 ( 10 - 20% of nuclear staining ) was observed in the carcinomatous area .
the patient was diagnosed as having an endometrioid adenocarcinoma arising from endometriosis of the uterine cervix .
following recovery from surgery , she was treated with six courses of chemotherapy , consisting of cyclophosphamide 600 mg / m and cisplatin 50 mg / m every 4 weeks . at the present time
endometriosis of the cervix is generally regarded as a rare lesion , but its incidence has been as high as 2.4% in some series ( 8) . previous trauma to the cervix may contribute to this condition .
for example , cervical endometriosis has been observed in 43% of postconization hysterectomy specimens obtained from patients with cervical intraepithelial neoplasia ( cin ) recurrence and other conditions ( not endometriosis ) ( 9 ) .
therefore , the increasing incidence of invasive cervical procedures may increase the incidence of endometriosis .
cervical smears taken from most patients with cervical endometriosis have shown glandular cellularity ( 10 , 11 ) .
in contrast , a cervical smear taken from our patient before exploration showed normal features .
there was no invasion to the stroma of the cervix , or to the mucosal layer of the endocervix or exocervix .
neoplastic transformation is a rare complication of endometriosis , documented in 0.3 - 0.8% of patients with ovarian endometriosis ( 7 ) . of 147 women with pelvic endometriosis , only one had ovarian cancer arising from the endometriosis ( 0.7% ) ( 12 ) .
the risk of cancer arising from pre - existing endometriosis has been estimated at 0.7% to 1.0% ( 1 ) .
of neoplasms complicating endometriosis , 75% arise in the ovaries , with the majority ( almost 70% ) being of endometrioid type .
endometriosis - associated ovarian cancer ( eaoc ) usually occurs in younger women , has favorable outcomes , and appears as either a low - grade tumor of endometrioid cell type or as a clear cell tumor . as the pathologic features of " atypical endometriosis " may constitute a precancerous state
for example , a survey of 45 extragonadal malignancies associated with endometriosis in 1977 found that 16 ( 36% ) were in the rectovaginal area , 5 ( 11% ) in the colorectal area , 4 ( 9% ) each in the bladder and vagina , 3 ( 7% ) in the pelvic ligaments , and 2 ( 4% ) each in the umbilicus , cervix , and fallopian tube ( 13 ) .
a more recent survey of 27 malignancies associated with endometriosis found that 17 ( 62% ) were in the ovary , 3 ( 11% ) in the vagina , 2 ( 7% ) each in the fallopian tube or mesosalpinx , pelvic sidewall , and colon , and 1 ( 4% ) in the parametrium ( 14 ) ; this report , however , did not include cervical malignancies associated with endometriosis .
malignant transformation of extra - ovarian endometriosis is thought to account for approximately 25% of all malignant transformations of endometriosis ( 1 , 15 ) . because of the rarity of malignant transformation of endometriosis at extraovarian sites , including the cervix , it is difficult to design an optimal surgical procedure .
when feasible , however , primary surgical treatment should consist of complete resection of all disease containing tissue .
gross lesions in the pelvis should be surgically staged ( 1 ) . although postoperative treatment has not been clearly defined ,
70% of these patients have been reported to receive chemotherapy or radiotherapy after first line surgery ( 1 , 15 ) .
the 5-yr survival rate for patients with estrogen - stimulated endometriosis - associated neoplasms arising at all sites has been reported to be 82% ( 1 ) .
moreover , patients with endometrioid adenocarcinoma coexisting with endometriosis have a favorable prognosis ( 16 ) . to classify a malignancy as arising from endometriosis ,
these include the demonstration of cancer arising in the tissue and not invading it from another source , and the presence of tissue resembling endometrial stroma surrounding the epithelial glands .
thus , if any ovarian tissue remains following a hysterectomy , the disease is likely to recur in as many as 40% of women after 5 yr ( 6 , 18 ) .
in addition , an association has been noted between unopposed estrogen therapy and the development of endometrioid or clear cell epithelial ovarian tumors ( 19 , 20 ) .
of 21 women with extraovarian cancers arising in endometriosis , 13 ( 62% ) had received hormone replacement therapy ( hrt ) ( 15 ) .
in contrast , only 10% of other groups of patients , including those with ovarian cancer arising within the endometriosis , ovarian cancer with adjacent endometriosis and ovarian cancer with incidental endometriosis , had received hrt , with the majority of the latter receiving unopposed estrogen .
in addition , tamoxifen therapy has been associated with endometriosis and the exacerbation of endometriotic foci in postmenopausal women ( 21 ) , and obesity may affect tumor development ( 22 )
. however , the body mass index of our patient was 24.4 kg / m and she had no previous history of estrogen or tamoxifen use . also , our patient was 48 yr old and was premenopausal .
of three women with malignant tumors arising in endometriosis , 2 showed loss of er and pr expression , suggesting that these tumors lose hormonal responsiveness as a result of malignant transformation ( 20 ) .
in contrast , the tumors in our patient showed consistent er and pr expression , and she had no history of exposure to unopposed estrogen .
these findings suggest that the loss of hormonal responsiveness did not play a part in the malignant transformation of endometriosis in our patient .
the increased association of hrt use with extraovarian cancer arising in endometriosis raises interesting questions that should prompt further investigation .
patients with endometrial cysts of the pelvic organs associated with high levels of serum ca125 should be managed with special care , even premenopausal women with no history of hormone therapy .
further work is required to determine whether the differences translate into a causal relationship . in conclusion
, we present an extremely rare case of endometriosis - associated adenocarcinoma of the uterine cervix in a premenopausal woman .
the clinical behavior of these tumors is unpredictable and long - term follow - up is essential in all patients .
additional case reports and prospective studies are needed to determine optimal treatment options to improve patient prognosis . | endometrioid adenocarcinoma arising from endometriosis of the uterine cervix is rare in premenopausal woman .
we describe here a patient with this condition and review the clinical and pathological features of these tumors .
a 48-yr - old woman complaining of severe dysmenorrhea was referred for investigation of a pelvic mass .
total abdominal hysterectomy and bilateral salpingo - oophorectomy were performed .
histological examination revealed an endometrioid adenocarcinoma directly adjacent to the endometriosis at the uterine cervix , with a transition observed between endometriosis and endometrioid adenocarcinoma .
the patient was diagnosed as having endometrioid adenocarcinoma arising from endometriosis of the uterine cervix and underwent postoperative chemotherapy .
gynecologists and pathologists should be aware of the difficulties associated with a delay in diagnosis of endometrioid adenocarcinoma arising from endometriosis when the tumor presents as a benign looking endometrioma . |
severe carotid , vertebral or subclavian stenosis is found in 16.6% of patients with 3-vessel coronary artery disease ( cad ) , whereas multivessel coronary disease and significant carotid stenosis only coexists in 2.822% of patients undergoing coronary artery bypass grafting ( cabg ) .
the frequency of carotid artery disease ( stenosis > 50% ) increases from 5% in patients with 1-vessel cad up to 40% in patients with left main coronary artery stenosis . on the other hand , among patients who underwent elective carotid stenting , concomitant cad
the majority of these patients required coronary revascularization , either percutaneous coronary intervention ( pci ) or cabg ( 7% ) , and the rest were treated conservatively , while the others ( 16% ) already had a history of coronary revascularization .
severe coronary disease is found in up to 37% of carotid endarterectomy ( cea ) patients , and myocardial infarction ( mi ) is the most common cause of death after cea .
the risk of stroke associated with cardiac surgery is estimated at about 2% in patients without significant ( < 50% ) carotid stenosis and it increases with the severity of carotid disease .
the risk doubles in patients with unilateral carotid stenosis ( 5099% ) , triples in those with bilateral carotid stenosis , and increases to almost 12% in patients with unilateral occlusion .
the stroke risk during cabg increases with age and rises to 9% in patients above age 80 ; in the elderly the cabg - associated mortality reaches 13% .
another independent risk factor for neurological complications associated with cabg is female sex ; the risk of neurological complications might be 1.6-fold higher for women than for men .
another important issue is that about 60% of strokes associated with cardiac surgery are of embolic origin as determined from examination of material from carotid plaques , aortic arch and ascending aorta ( most probably mobilized during aortic clamping ) .
in addition , systemic hypotension during on - pump cabg , combined with stenoses of extracranial arteries , may lead to brain hypoperfusion , which is responsible for 8.8% of strokes .
concomitant carotid and coronary disease is a common problem and an important risk factor of cabg - associated stroke .
the optimal treatment strategy in coexistent severe carotid and coronary disease remains undefined , and this is reflected in the guidelines on cabg , carotid endarterectomy ( cea ) and carotid artery stenting ( cas ) .
cea and cabg can be performed either at one stage ( synchronous / simultaneous cea - cabg ) or as a staged ( two - staged ) procedure with cea preceding cabg or cabg preceding cea .
in addition , cabg performed off - pump may have advantages in context of required carotid revascularization .
current surgical guidelines indicate that cea is usually recommended before or concomitant with cabg in patients with a symptomatic carotid stenosis or asymptomatic carotid stenosis of 80% or more ( class iia / c ) , and it is recommend that the revascularization strategy should be based on the individual risk profile of each patient .
the risk of stroke associated with synchronous cea and cabg is twice ( 3.9% vs. 1.7% ) that of isolated cabg ( without coexistent carotid disease ) . a systematic review of 97 studies in 8972 patients treated with cea and cabg ( years 19722002 ) revealed that the risk of stroke or death is highest when both procedures are performed simultaneously ( 8.7% ) and lowest when
however , the risk of myocardial infarction is highest in staged procedures , estimated at 6.5% . in the analyzed studies , no matter whether the procedures ( cea and cabg ) were synchronous or staged , the overall rate of stroke , death or mi was 10.211.5% at 30 days .
cea and opcab seem to be associated with the lowest complication rate ( 3.6% ) of stroke , mi and death at 30-day observation .
these results indicate the clinical need for alternative ( safer ) revascularization methods for patients with coexistent severe carotid and coronary disease . as far as carotid revascularization alone
is concerned , cas with use of neuroprotection system devices ( npds ) seems to be a safe and effective alternative to cea , especially for high surgical risk patients .
cea / cas guidelines are unclear about the role of carotid artery stenting prior to cabg ; it remains to be shown whether cas could be the therapy of choice for patients with coronary and carotid artery disease when treated simultaneously .
this is indicated as an option for patients in whom cabg can be deferred for 45 weeks ( because of clopidogrel therapy after cas ) .
dual antiplatelet therapy : acetylsalicylic acid ( continued lifelong ) and clopidogrel is recommended for at least 4 weeks and preferably 3 months after cas , because of the stent endothelization , which takes 2896 days [ 1416 ] .
recently published guidelines recommend that revascularization , either by cea or cas with embolic protection , is a reasonable procedure for use before or concurrent with cabg in symptomatic patients with carotid stenosis > 80% ( class iia / c ) , but the need for simultaneous or staged carotid and coronary revascularization in asymptomatic patients remains to be proven ( class iib / c ) .
two possible hybrid revascularization strategies are staged cas - cabg ( 1 stage cas and then cabg in at least 5 weeks , figures 1 , 2 ) , and simultaneous 1-stage cas - cabg ( cas and then cabg on the same day , figures 36 ) . in a single - center registry of staged cas - cabg including 356 neurologically asymptomatic patients , the overall rate of death , stroke and myocardial infarction was 6.7% at 30 days after cabg . in the waiting period ( mean 22 days ) between cas and cabg , there were 1 major stroke ( intracranial hemorrhage ) , 4 ( 1.1% ) ipsilateral minor strokes , and 8 ( 2.2% ) transient ischemic attacks ( tia ) .
the cardiac complication rate was 2.3% : 1 cardiac death ( 0.3% ) , 2 ( 0.6% ) mis , and 5 ( 1.4% ) episodes of unstable angina . in this study
npds were used in only 40% of cases . a meta - analysis of 11 studies including 760 patients ( 356 from a single center ) , who were mainly ( 87% ) asymptomatic revealed a 30-day outcome of 9.4% ( death , stroke and myocardial infarction ) for staged cas - cabg ( both on- and off - pump procedures ) ; not significantly different from synchronous or staged surgical strategies ( 10.211.5% ) .
the period between cas and cabg ranged between 2 and 70 days in studies included in the meta - analysis .
the overall 30-day outcome ( from cas to 30 days after cabg ) suggests that this form of hybrid revascularization might be a viable alternative to cea - cabg because it provides similar safety profiles to
cas combined with cabg could assume a much greater role in the treatment of patients with coexistent carotid and coronary disease due to its less invasive nature .
nevertheless , cas patients undergoing cabg are suspected to be at increased risk of bleeding complications because of dual antiplatelet therapy ( acetylsalicylic acid indefinitely and clopidogrel for at least a month after cas ) .
the studies included in the meta - analysis were heterogeneous in terms of antiplatelet regimen ( different timing of dual antiplatelet therapy : aspirin+ clopidogrel or aspirin+ticlopidine or additional gpiibiiia infusion , clopidogrel was either stopped prior to cabg or continued during cabg ) .
however , in this meta - analysis only 7 major bleedings ( 0.9% ) in 760 patients ( 1 intracranial hemorrhage , 4 chest bleedings , 1 cardiac tamponade , 1 groin hemorrhage ) were reported . in the analyzed studies
the npds were not routinely used ; this might have overestimated the stroke rate . in another observation of 20 patients undergoing cas before cabg ,
the time interval between procedures ranged from 162 days , and antiplatelet strategies were different ; on long - term observation only 1 stroke occurred ( 677 days after procedure ) , and no deaths or myocardial infarcts were noted . in the sharp study , in 4 high - volume centers
, 101 consecutive patients with severe coronary and carotid disease underwent simultaneous cas and cabg .
the 30-day cumulative incidence of stroke , mi or death was 4% : 2 patients ( 2% ) had stroke immediately after cas before cabg , and another 2 patients died ( 2% ) in the post - operative period .
a further 3 patients died between the 31 day and the 12 month after the procedure .
the very first observation ( during years 19952005 ) of simultaneous cas cabg ( including redo - cabg procedures in 10% of patients ) performed in a group of 30 extremely high surgical risk patients indicated that the in - hospital rate for stroke and death of 10% and myocardial infarction of 3% was comparable to the cumulative outcome of simultaneous surgical strategy ( 11.5% ) derived from the meta - analysis of cea - cabg . in another registries of simultaneous cas
cabg performed within 1 day , the 30-day complication rate of 1.44.5% ( table 1 ) was even lower .
these initial results of simultaneous hybrid cas - cabg indicate that this form of revascularization might be associated with the lowest event rate in comparison with the surgical approach or staged cas - cabg .
another possible method to reduce neurological complications during simultaneous hybrid procedures is the combination of cas with opcab . in the analyzed studies ,
cabg procedures [ 2729 ] ; in the largest patient series , the sharp study , all procedures were on - pump .
opcab can reduce complications associated with aortic clamping ( embolization risk ) and extracorporeal circulation ( blood pressure drops , cardioplegia , hemodynamic instability , systemic inflammatory response and clotting disorders ) , but it is more technically demanding , which is probably why it is still performed less frequently .
opcab patients , in comparison with those undergoing cabg , seem to have lower stroke rate ( 1.0% vs. 2.4% , p<0.01 ) , stroke related mortality ( 0.1% vs. 0.9% , p<0.01 ) , and lower myocardial infarction rate ( 1.6% vs. 3.0% , p<0.01 ) .
moreover , opcab showed better outcomes among high surgical risk and elderly patients , faster postoperative recovery , lower mortality rate , and shorter post - operative in - hospital stay compared to cabg [ 3032 ] .
as simultaneous cea and opcab is associated with a low mi , stroke and death rate of 3.6% , similarly , 1-stage cas and opcab could be associated with a low outcome , but this strategy has not yet been evaluated in larger studies . the surgical approach and a hybrid revascularization are hard to compare because of the lack of evidence from randomized trials and patient selection in registries , depending on individual risk profile , lesion morphology in coronary and carotid arteries , and co - morbidities . in the registry of 27,084 concurrent carotid revascularizations and cabgs performed during the same hospitalization over a 5-year period ,
96.7% of patients were treated with cea - cabg , whereas only 3.3% ( 887 ) had cas - cabg .
patients undergoing cas - cabg had significantly lower rates of postoperative stroke ( 2.4% vs. 3.9% , p<0.001 ) and slightly lower rates of combined stroke and death ( 6.9 vs. 8.6% , p=0.1 ) compared with patients who underwent cea - cabg ; however , in - hospital death rates were similar for both strategies ( 5.2% vs. 5.4% , respectively ) .
the results of this study indicate that asymptomatic patients who undergo cas - cabg have a lower stroke rate compared with those undergoing cea - cabg , but have similar in - hospital mortality ; furthermore , according to this observation , cas - cabg may be an alternative strategy in high - risk asymptomatic patients .
finally , this study suggests that the role of cas - cabg is still unclear in symptomatic patients ( the group of symptomatic patients undergoing cas - cabg was very small and npd usage rate was not reported , with a possible effect on the incidence of periprocedural stroke ) .
another limitation of this study is that the authors did not asses mi rate after cas - cabg vs. cea - cabg .
our initial experience with 21 patients treated with hybrid revascularization ( cas - cabg ) includes 8 with simultaneous cas - cabg and 13 with a staged cas - cabg ( table 2 ) . no major adverse events ( death , stroke , mi ) at 30-day observation were observed .
all cas procedures were performed using npds ( either proximal or distal ) and stent type ( closed / open - cell stent ) according to the
the procedures were performed in a high - volume endovascular and surgical center performing over 200 cass and over 1400 cabgs per year .
in patients with significant asymptomatic carotid stenosis of 80% or symptomatic carotid stenosis of 50% and coexistent multivessel coronary artery disease , several therapeutic options exist . considering the patient risk profile ,
lesion morphology and symptom status , either surgical strategy or hybrid cas - cabg revascularization may be considered .
cea - cabg ( staged or synchronous ) is associated with an event rate of 10.211.5% at 30-day observation ( mi / stoke / death ) .
the outcome of staged cas - cabg appears comparable to cea - cabg ( cumulative risk of stroke / death / myocardial infarction of 9.4% ) and in experienced centers the complication rate can be even lower 6.5% .
based on this data , staged cas - cabg might be a feasible alternative to
conventional surgical strategy or might even be an option associated with lower complication rate . a novel
simultaneous 1-stage cas - cabg seems to be associated with the lowest event rate of all therapeutic methods .
further development of cas , especially the strategy of fitting neuroprotection and stent type to the lesion morphology , stenosis severity and symptom status ( tailored cas ) , may lead to a reduction in peri- and post - procedural event rates .
however , in published studies on staged or synchronous cas - cabg [ 2229 ] , distal npd was the only system device used during cas procedure ( in all sharp study patients , but only 40% of 356 staged cas - cabg patients ) .
usage of npd ( either proximal or distal ) in all cases , as well as off - pump cardiac surgery ( aorta no touch technique ) could probably minimize neurological complications of cabg .
the main goal of performing carotid revascularization before cardiac surgery is stroke prevention or at least reduction of the stroke rate , as stroke remains the major noncardiac complication of cabg .
after successful carotid revascularization ( by cas ) the incidence of any stroke after cabg decreases to 2.2% , which is the
usual stroke risk associated with cabg without coexistent carotid disease . with the presently available , limited , evidence , it is hard to compare the surgical and hybrid strategies due to the heterogeneity of patients included in the reported groups .
an ideal randomized trial should compare isolated cabg with cas - cabg and cea - cabg both in symptomatic and asymptomatic patients , but such a study is unlikely to ever be conducted .
a recent report included over 650 patients divided in 3 groups : surgical ( cea - cabg ) , endovascular ( cas and pci ) , and hybrid ( cas - cabg ) revascularization , but the patient characteristics were not comparable . because of this heterogeneity ( anatomic severity of disease and symptom status ) the outcome of the endovascular strategy ( cas and 1-vessel pci ) can not be compared with the outcome of a patient with severe cad and carotid disease undergoing either surgical or hybrid strategy .
the primary end point ( death , stroke , mi ) of about 10% for hybrid cas - cabg performed in a minority of patients ( n=68 ) remains in contrast with emerging data from other high - volume centers [ 25,2729 ] .
a single ideal revascularization strategy for patients with coexisting severe carotid and coronary artery disease is unlikely to exist , and an individualized approach is mandatory , but this is ill - defined .
the emerging cas - cabg strategy may be a viable alternative to cea - cabg , particularly if performed by experienced surgeons in high - volume centers .
single- center results of simultaneous 1-stage cas - cabg are promising ( both for cardiac and neurological complications ) , but more data and larger patient series are needed before widespread use of this strategy is possible . | summarycoexistent carotid artery stenosis ( cs ) and multivessel coronary artery disease ( cad ) is not infrequent .
one in 5 patients with multivessel cad has a severe cs , and cad incidence reaches 80% in those referred for carotid revascularization .
we reviewed treatment strategies for concomitant severe cs and cad.we performed a literature search ( medline ) with terms including carotid artery stenting ( cas ) , coronary artery bypass grafting ( cabg ) , carotid endarterectomy ( cea ) , stroke , and myocardial infarction ( mi).the main therapeutic option for cs - cad has been ( simultaneous or staged ) cea - cabg .
this , however , is associated with a high risk of mi ( in those with cea prior to cabg ) or stroke ( cabg prior to cea ) , and the cumulative major adverse event rate ( mae death , stroke or mi ) reaches 1012% . with increasing adoption of cas ,
a sequential strategy of cas followed by cabg has emerged .
registries ( usually single - centre ) indicate an mae rate of 7% for cas followed by cabg ( frequently after > 30 days , due to double antiplatelet therapy ) . recently ,
1-stage cas - cabg has been introduced .
this involves different antiplatelet regimens and , in some centers , preferred off - pump cabg , with a cumulative mae of 1.44.5%.no randomized trial comparing different treatment strategies in cs - cad has been conducted , and thus far reported series are prone to selection / reporting bias .
in addition to the established surgical treatment ( cea - cabg , sequential / simultaneous ) , hybrid revascularization ( cas - cabg ) is emerging as a viable therapeutic option .
larger , preferably multi - centre , studies are required before this can become widely applied . |
administration of the phytoestrogen coumestrol to ovariectomized rats leads to increases in both wet and dry uterine weights in the absence of an increase in uterine dna content , as reported by markaverich et al .
[ effects of coumestrol on estrogen receptor function and uterine growth in ovariectomized rats .
environ health perspect 103:574 - 581 ( 1995 ) ] .
it was not possible to know if the observed atypical uterotrophic response of coumestrol was associated uniquely with the ovariectomized uterotrophic assay protocol .
this question is answered in the present paper .
two experiments are described in which three daily oral gavage administrations of 60 mg / kg / day coumestrol to immature ap rats were followed by assessment of the reproductive tract on the fourth day . in both experiments coumestrol
increased uterine fluid content and increased the weights of the uterus , cervix , and vagina .
in addition , bromodeoxyuridine staining of uterine sections enabled confirmation of uterine hyperplasia for the coumestrol - treated animals . in the second experiment ,
total uterine dna was determined ; it doubled in the coumestrol - treated animals .
estradiol benzoate acted as the positive control agent for both of these experiments , and in each case it gave similar responses to those seen for coumestrol .
we conclude that the uterotrophic activity of the phytoestrogen coumestrol in the immature intact rat is typical of the activity of the natural estrogen estradiol.imagesfigure 1figure 2 |
|
antisynthetase syndrome ( ass ) is a heterogeneous systemic autoimmune syndrome characterized by inflammatory myopathy , arthritis or arthralgias , interstitial lung disease ( ild ) , fever , raynaud 's phenomenon , and mechanic 's hands 1 , 2 associated with antisynthetase antibodies .
there are three patterns of onset of ild and myositis : simultaneous onset , myositis preceding ild , and ild preceding myositis .
when physicians treat and follow patients with asspositive ild alone , it is well known that careful attention should be paid to the development of myositis during followup . here ,
we report a 56yearold woman whose ild with antiej antibody had been treated , but 8 years after the onset of ild , myasthenia gravis ( mg ) developed .
mg is an autoimmune disorder characterized by weakness and skeletal muscle fatigue , and it is sometimes associated with other autoimmune disorders . however , only two cases of polymyositis ( pm ) with positive antisynthetase antibodypositive pm overlapping mg have been reported 3 , 4 . both had antijo1 antibody , and there have been no reports of patients with antisynthetase antibody other than antijo1 antibody who had overlapping mg .
our case suggests that not only myositis but also overlapping of mg should be considered when antisynthetase antibodypositive ild patients develop muscle symptoms during their followup .
a 56yearold woman with no past history or family history of note developed dyspnea on effort in november 2007 without muscle pain or arthralgia and presented to a local physician . heliotrope rush and gottron 's papules were not found .
serum muscle enzymes were within normal range , and she was negative for antijo1 antibody , antiscl70 antibody , antidsdna antibody , antissa / ro antibody , antissb / la antibody , antirnp antibody , and antinuclear cytoplasmic antibodies .
chest xray showed reticular shadows and groundglass opacities ( ggos ) in both lung fields , and her serum kl6 was elevated to 1460 u / ml .
she was diagnosed as having idiopathic interstitial pneumonia , and prednisolone ( psl ) 30 mg / day was started . as a result , her conditions improved , as shown by chest xrays , and the dose of psl was tapered ; however , she developed dyspnea and dry cough when the daily dose of psl was tapered to 10 mg / day .
another chest xray showed the development of new ggos in both lung fields , and she was referred to saitama cardiovascular and respiratory center for further evaluation in august 2008 . on presentation , auscultation detected fine crackles in both chest fields .
mechanic 's hands were found , but heliotrope rush and gottron 's papules , which are characteristic of pm / dermatomyositis ( dm ) , were not found .
arterial blood gas analysis showed a ph of 7.46 , paco2 of 39.2 torr , and pao2 of 78.5 torr under ambient air , and her serum kl6 was 1982 u / ml . serum antinuclear antibody was 160 titers ( speckled pattern ) , and she was negative for antijo1 antibody , antidsdna antibody , antissa / ro antibody , antissb / la antibody , antirnp antibody , antiscl70 antibody , and anticcp antibody .
chest xray showed reticular shadows in both lung fields , and chest computed tomography showed ggos and reticular shadows predominantly in the lower lobes ( fig .
bronchoalveolar lavage fluid showed 48.6% macrophages , 39.3% lymphocytes , 5.6% neutrophils , and 6.5% eosinophils , but the specimen obtained via transbronchial lung biopsy was inadequate for evaluation .
we suspected her of having ass , and serum antisynthetase antibodies other than antijo1 antibody were investigated by an immunoprecipitation method as reported elsewhere 1 , and the result was positive for antiej antibody .
we diagnosed her as having assild and increased her psl dose to 50 mg / day , which improved the lung opacities ( fig .
the psl was gradually tapered , but new lung opacities developed in july 2010 when the psl dose was at 9 mg / day ( fig .
we began cyclosporin a 150 mg / day and increased the psl to 15 mg / day .
1e ) , but new lesions developed in january 2013 when the psl was at 5 mg / day ( fig .
the psl was increased to 15 mg / day , and the cyclosporin a was changed to azathioprine , which was later stopped because of druginduced liver damage .
tacrolimus 2 mg / day was then introduced , and the psl was increased to 30 mg / day , which improved the lung opacities , after which the psl was again gradually tapered . from november 2015 , the psl was tapered from 20 to 17.5 mg / day , but then bilateral ptosis and diurnal variation in muscle weakness ( morningtime improvement and eveningtime worsening ) developed in her proximal lower limbs in december 2015 .
she did not complain of muscle pain or dyspnea , but manual muscle testing showed muscle weakness ( 4/5 ) in her quadriceps .
findings of mechanic 's hands ; results of pulmonary function testing including vital capacity , forced expiratory volume in 1 sec , total lung capacity , and residual volume ; and results of arterial blood gas analysis indicated no deterioration .
her blood concentration of tacrolimus was low in january 2016 ( 2.9 ng / ml ) .
brain magnetic resonance imaging testing showed no abnormal findings , chest xray and computed tomography showed no deterioration , and chest computed tomography showed no new pulmonary lesions or findings suggestive of thymic disorders .
systemic screening tests including a urinary test , gastrointestinal endoscopy , abdominal ultrasonography , and mammography did not show any findings suggestive of malignant diseases .
her muscle weakness partially and transiently improved immediately after intravenous administration of edrophonium chloride , and an electromyographic study revealed both waning of neuromuscular potentials on repetitive lowfrequency stimulation and myogenic changes ( fig .
although her antiacetylcholine receptor antibody and antimusk ( musclespecific tyrosine kinase ) antibody were both negative , we diagnosed her as having seronegative mg ( mg foundation of america class ii 6 ) .
tacrolimus was increased to 3 mg / day in march 2016 , which increased her blood concentration of tacrolimus to 6.0 ng / ml as measured 2 months later .
she continues to be followed on an outpatient basis without deterioration of her ild and no muscle symptoms .
chest xray ( a ) and computed tomography ( b ) on presentation in november 2008 .
chest xray showed bilateral groundglass opacities ( ggos ) and reticular shadows predominantly in the lower lung fields .
chest computed tomography showed bilateral ggos , consolidation , and reticular shadows predominantly in the lower lobes .
chest computed tomography performed in september 2009 ( c ) showed improvement of the ggos ; however , they increased in july 2010 ( d , arrowheads ) .
computed tomography showed ggos in the left lower lobe in october 2011 ( e ) ; however , they had increased in the left lower lobe in january 2013 ( f , arrow ) .
we present a patient who developed mg during treatment of ild with antiej antibodypositive ass for 8 years .
these antibodies are classified as myositisspecific antibodies , and to date , eight types of autoantibodies specifically directed against the aminoacyltrnasynthetase enzymes have been identified 7 .
these antibodies are detected mainly in pm / dm : antijo1 ( antihistidyltrna synthetase ) antibody has a prevalence of 1525% in patients with pm / dm 8 , 9 , 10 , 11 , antipl7 ( antithreonyltrna synthetase ) and antiej antibody ( antiglycyltrna synthetase ) are identified in 510% of cases , and the others are found with even less frequency 12 .
patients with ass show different clinical features according to their autoantibodies ; however , strategies are often worked out by using those of pm / dm as a reference .
myasthenia gravis can be found in association with other autoimmune disorders such as systemic lupus erythematosus and rheumatoid arthritis 13 , 14 ; however , the association of mg with ass or pm / dm is less frequent .
reports of overlap of mg and pm / dm were limited to only about 20 cases from 1976 to 2014 15 .
furthermore , pm with antisynthetase antibody was reported only in two patients 3 , 4 , both of whom had antijo1 antibody .
our case is , to our knowledge , the first case of ass with antisynthetase antibodies other than antijo1 antibody .
hamaguchi et al . reported that 29% of patient with antiej antibodypositive ild alone develop myositis during followup 1 .
the present patient with antiej antibodypositive ild alone developed mg 8 years after the onset of ild .
this suggests that not only myositis but also overlapping of mg should be considered when antisynthetase antibodypositive patients with ild develop muscle symptoms during followup .
although corticosteroids and immunosuppressants possibly delay the development of occult mg , proximal muscle weakness with diurnal variation , ptosis , and abnormal electromyographic findings were not found when the patient presented to our hospital in 2008 , which suggests the secondary overlap of mg on ass .
there are no drugs that are known to cause the development of mg . in patients with thymoma
, the association of underlying abnormal immunity due to thymic disorders and the development of autoimmune disorders can be considered as a common cause of developing mg and pm / dm or ass ; however , thymic disorders were not found by computed tomography in our patient .
however , some reports suggest the existence of a shared pathophysiology between pm / dm and mg , which is especially emphasized in cases with the concomitant development of pm / dm and mg 16 . for example , the susceptibility of a patient to generalized mg and pm seems to be related to human leukocyte antigen ( hla ) dr 16 , 17 .
interestingly , the association of pm with hla dr3 expression is claimed to be related to the coexistence of antijo1 antibody 18 ; however , the present patient did not express hla dr3 .
involvement of hla in ass has been unknown , especially in cases without muscle symptoms and elevated serum muscle enzymes , and future studies are needed to clarify a shared pathophysiology between ass and mg as in the present case .
myasthenia gravis developed in our patient during corticosteroid therapy with an added immunosuppressant , tacrolimus , which is a calcineurin inhibitor that is useful for both assild 19 and steroidresistant mg 20 .
the serum trough concentration in the present patient was low , and thus , the tacrolimus dose was increased .
other treatments for mg include intravenous immunoglobulin and plasma exchange , and these modalities can be considered depending on the patient 's clinical course . in conclusion , we report the case of a patient who developed mg 8 years after the onset of assild .
although rare , physicians should consider not only myositis but also mg when patients with assild develop muscle symptoms during the followup of ass .
ti : is the guarantor of the paper , taking responsibility for the integrity of the work as a whole , from inception to published article .
nk , ek , ko , yt , kk , and nt : aggregated the data , created the figures , and helped draft the discussion of the manuscript .
| key clinical messagepatients with antisynthetasepositive interstitial lung disease ( ild ) alone sometimes develop myositis during followup , but myasthenia gravis ( mg ) overlapping on antisynthetase syndrome is unusual . a 56yearold woman with ild and antiej antibody treated for 8 years developed mg .
physicians should consider myositis and mg when patients develop muscle symptoms during followup . |
anthocyanins are responsible for the color of red grape varieties and the wines produced from them .
flavonols are also important because they participate both in stabilizing anthocyanins in young red wines through copigmentation and in increasing the health - related properties of wine [ 1 , 2 ] .
grape anthocyanins and flavonols are final products arising from the flavonoid biosynthetic pathway ( figure 1 ) .
vitis vinifera varieties are characterized by the presence of 3-o - glucosides of delphinidin , peonidin , petunidin , cyanidin , and malvidin , together with their acylated derivatives .
the 3-o - glucosides of kaempferol , quercetin , and myricetin are the major flavonols in grapes as first reported by cheynier and rigaud and recently confirmed by castillo - muoz et al .
, with quercetin glycosides usually being dominant , although a high presence of quercetin-3-o - glucuronide has also been observed in some varieties such as petit verdot [ 5 , 6 ] . when studying grapes for winemaking , it is not only the quantity of anthocyanins that is important .
the hydroxylation pattern of the b - ring of anthocyanins is one of the main structural features of flavonoids and is an important determinant of their coloration , stability , and antioxidant capacity .
trihydroxylated anthocyanins ( delphinidin , petunidin , and malvidin-3-glucosides ) are more stable in wines than dihydroxylated ones ( cyanidin and peonidin-3-glucosides ) . those with orthodiphenolic groups ( cyanidin , delphinidin , and petunidin ) have an enhanced susceptibility to oxidation .
the same applies to acylated anthocyanins , since their esterification of anthocyanins promotes intramolecular aggregation or stacking , which protects the oxonium ion from decomposition .
as hydroxylation of the b - ring is carried out by flavonoid-3-hydroxylase ( f3h ) and flavonoid-3,5-hydroxylase ( f35h ) enzymes , the composition of anthocyanins in grape skins will be determined by the relative activities of these enzymes . at the same time
, methyl transferase ( mt ) activity will determine the different methoxylation patterns of b ring and acyl transferase the presence of acyl derivatives .
plant adaptation to different environments and centuries of selection by humans has produced numerous genotypes in which the intensity of the red coloration varies extensively .
a mixture of variation in anthocyanin content and the relative proportion of different anthocyanins can produce different phenotypes for skin pigmentation with consequent technological and nutritional differences . also , these differences could be a very useful chemotaxonomical tool . at present , cross - breeding and bud mutation are still the most common way for developing new wine grape cultivars .
the determination of the mechanisms of the inheritance of the flavonoid composition could help in the election of the parentals in the breeding programs .
the objective of this study therefore was to explore the characteristics of the anthocyanin and flavonol composition and content in intraspecific hybrids of monastrell syrah , monastrell cabernet sauvignon , and monastrell barbera , in order to acquire information for future breeding efforts aimed at improving fruit quality through the effects of flavonoids and to provide an insight into the mechanisms that control the inheritance of flavonoid characteristics among hybrids .
a collection of plants arising from crosses from monastrell syrah , monastrell cabernet sauvignon , and monastrell barbera was used in this study .
the study was conducted in an experimental vineyard of 1 ha located in bullas ( murcia , se spain ) .
the parentals ( monastrell , syrah , cabernet sauvignon , and barbera ) were planted in 1997 , whereas the seeds for the interspecific hybrids were planted in 2000 .
the training system was a bilateral cordon trellised to a three - wire vertical system , and drip irrigation was applied .
the plants derived from monastrell self - pollination and from pollen donors other than syrah , cabernet sauvignon , or barbera were identified genetically and discarded using the microsatellite ( ssr , simple sequence repeat ) loci segregating 1 : 1 : 1 : 1 according to bayo - canha et al . .
total dna was extracted from approximately 20 mg of young frozen leaves using a dneasy plant mini kit ( qiagen , valencia , ca , usa ) following the manufacturer 's protocol .
pcr products were separated by capillary electrophoresis performed on an abi prism 3100 genetic analyzer ( applied biosystems , carlsbad , ca , usa ) , and the fragments were sized using genemapper software ( applied biosystems , carlsbad , ca , usa ) . grapes were harvested at a total of soluble solids content between 23 and 27brix .
the sampling was randomly made by picking berries from the top , central , and bottom parts of several clusters of each hybrid vine .
the size of the sample was around 300 berries , which were bulked and separated in 3 subsamples of approximately 100 berries to run triplicate analyses .
samples ( 2 g ) were immersed in methanol ( 40 ml ) in hermetically closed tubes and placed on a stirring plate at 150 rpm and 25c .
after 2 hours , the methanolic extracts were acidified with 5% formic acid ( 1 : 2 v / v ) , filtered through 0.2 m ptfe filters , and analysed by hplc .
the hplc analyses were performed on a waters 2695 liquid chromatograph ( waters , pa , usa ) , equipped with a waters 2996 diode array detector and a primesep b2 column ( sielc , illinois , usa ) , 25 0.4 cm , 5 m particle size , using as solvents water plus 5% formic acid ( solvent a ) and hplc grade acetonitrile ( solvent b ) at a flow rate of 0.8 ml min .
elution was performed with a gradient starting with 5% b to reach 9% b at 28 min , 13% b at 30 min , 21% b at 52 min , 24% b at 65 min , and 70% b at 75 min , maintaining this gradient for 5 minutes .
chromatograms were recorded at 520 nm ( anthocyanins ) and 360 nm ( flavonols ) .
identification of the compounds was carried out by comparing their uv spectra recorded with the diode array detector and those reported in the literature .
also , an hplc - ms analysis was made to confirm the identity of each peak .
an lc - msd - trap vl-01036 liquid chromatograph - ion trap mass detector ( agilent technologies , waldbronn , germany ) equipped with an electrospray ionization ( esi ) system was used .
elution was performed in the hplc analysis conditions described previously , with a flow rate of 0.8 ml min .
the heated capillary and voltage were maintained at 350c and 4 kv , respectively .
mass scans ( ms ) were measured from m / z 100 up to m / z 800 .
anthocyanins were quantified at 520 nm as malvidin-3-glucoside , using malvidin-3-glucoside chloride as external standard ( extrasynthse , genay , france ) .
flavonols were quantified at 360 nm as quercetin-3-glucoside , using this compound as external standard ( sigma , missouri , usa ) .
for this study , 27 hybrids bearing red grapes and 15 hybrids bearing white grapes from monastrell syrah , 32 red and 6 white from monastrell cabernet sauvignon , and 13 red from monastrell barbera were studied .
the presence of white hybrids in monastrell cabernet sauvignon and monastrell syrah indicates the heterozygous nature of the parentals in regard to genes controlling anthocyanin synthesis , whereas barbera , being homozygous , does not produce hybrids bearing white grapes .
. showed that expression of the udp - glucose : flavonoid 3-o - glucosyltransferase ( ufgt ) gene is critical for anthocyanin biosynthesis in grape .
experiments with the berry skins of white and red cultivars revealed that the ufgt gene was expressed in all the red cultivars but not in the white ones whereas the other genes involved in anthocyanin biosynthesis ( figure 1 ) are expressed in both white and red cultivars .
the presence or absence of the enzyme ufgt is controlled by myb - related regulatory genes , and the insertion of the retroelement gret1 in the promoter region of vvmyba1 gene appears to be associated with white - fruited cultivars when present in a homozygous state .
pigmented cultivars possess at least one allele at the vvmyba1 locus not containing this large retroelement [ 13 , 16 ] , as is the case of parentals of this study .
table 1 shows the results of the anthocyanin analysis for the studied grapes and figure 2 the range of concentrations among the hybrids .
the mean concentration in their hybrid grapes ( 16.31 mg / g fresh skin ) was slightly higher than in syrah ( 15.06 mg / g fresh skin ) , and the maximum value reached by the grapes of one seedling ( 39.49 mg / g fresh skin ) was twice the value found in syrah .
cabernet sauvignon and barbera grapes also showed higher concentration , of anthocyanins than monastrell and were similar to that of syrah grapes .
the mean values of anthocyanin content in the grapes of their seedlings were slightly lower than in cabernet sauvignon and barbera ( 14.42 and 12.08 mg / g fresh skin respectively ) and higher than that shown by monastrell grapes ( 7.40 mg / g fresh skin ) , and , again , the maximum value found in their seedlings was double that of cabernet sauvignon and barbera grapes .
many hybrids presented grapes with much higher concentration than their parentals as can be seen in figure 2 .
the appearance of a large number of hybrids in which the anthocyanin concentration is not within the range of concentration of their parental phenotypes is called transgressive segregation , frequent in intraspecific crosses and in domesticated populations .
the occurrence of the segregation of a given trait manifested mainly in one direction ( as happens in our case , most of the hybrids showing higher values of anthocyanin concentration than the parentals ) may imply that the trait has undergone fairly constant directional selection or a certain overdominance of the genes controlling phenolic synthesis [ 17 , 18 ] .
similar results were found by liang et al . in grapes , but our findings differ from those of ju et al . in apples that found that crossing between two red - fruited apple cultivars produced less colored progeny . a previous work exploring the proanthocyanidin content of monastrell
as stated previously , the presence of the enzyme ufgt is necessary for anthocyanin biosynthesis .
however , the biosynthesis of the different anthocyanin precursors is driven upstream of the enzyme ufgt by the activity of f3h and f35h enzymes , which add either a single hydroxyl group or two to dihydrokaempferol ( figure 1 ) .
once converted to dihydroquercetin or dihydromyricetin , these intermediates flow through common downstream enzymes to form disubstituted and trisubstituted anthocyanins , when ufgt is expressed , and to form other polyphenols ( flavanols , flavonols ) at different developmental stages .
all the studied hybrids bearing red grapes synthesised all five anthocyanins ( the dihydroxylated cyaniding , peonidin-3-glucosides , the trihydroxylated delphinidin , petunidin , and malvidin-3-glucosides ) , together with their acylated derivatives .
this means that all the parentals and the hybrids expressed functional f3h and f35h genes for the synthesis of 34-oh and 345-oh anthocyanins , as well as methyltransferases ( mt ) for the methylation of primary anthocyanins .
as regards the percentage of the different anthocyanins in the different parentals , monastrell grapes were characterized by a high percentage of cyanidin , suggesting a lower f35h activity than in the other varieties .
a low expression of f35h has been associated with cyanidin - based anthocyanins in grape leafs .
the percentages of malvidin - based anthocyanins in monastrell did not exceed 40% , so the total percentage of trihydroxylated anthocyanins was low .
the percentage of trihydroxylated anthocyanins reached 83% in syrah grapes , 87.4% in cabernet sauvignon grapes , and 92.3% in barbera grapes .
the percentage of trihydroxylated anthocyanins was even higher in some monastrell cabernet sauvignon and monastrell barbera hybrids , reaching values as high as 90.5% and 93% , respectively .
the mean value of the percentage of trihydroxylated anthocyanins in the hybrid grapes is close to the mean value between both parentals .
the segregation can be fitted to a normal distribution , and a very low number of hybrids presented higher or lower values than in the parentals , as can be seen in figure 3 .
these results were similar to those obtained during the first screening of the anthocyanin profile in monastrell cabernet sauvignon grapes . in spite of the presence of all anthocyanin biosynthetic enzymes in all the investigated hybrids ( since all the possible structures were found ) , a genotype - specific regulation of the structural genes along the core pathway and at the main branching points is presumed to underlie the observed methoxylation and hydroxylation variations among the grapes from the parentals and those of their hybrid plants . with regard to the percentage of anthocyanin acylation , barbera grapes showed the lowest percentage of acylation ( 34.3% ) , followed by monastrell ( 44.8% ) , and cabernet sauvignon showed the highest percentages ( 54% ) .
the mean values of the percentage of acylated anthocyanins for monastrell cabernet sauvignon hybrids were 47% , 56.8% for monastrell syrah ( higher than the percentage found in syrah ) while the hybrid grapes from monastrell barbera showed the lowest percentages of acylation ( 28% ) .
as in the case of the anthocyanin concentration data , there was a tendency towards higher values of acylation in the hybrids , and no hybrid contained only nonacylated anthocyanins .
as regards flavonols ( table 2 ) , these flavonoids were present in both white and red grapes
. we could identify mono- ( kaempferol ) , di- ( quercetin and isorhamnetin ) , and trihydroxylated ( myricetin , laricitrin , and syringetin ) flavonol glycosides ( glucosides , glucoronides , and small quantities of galactosides ) .
in red grapes , the monohydroxylated flavonols represented the lowest percentage , especially in barbera grapes ( 4.3% ) .
monastrell grapes presented a very high percentage of dihydroxylated flavonols ( 70.7% ) , much higher than in the other varieties and , therefore , a lower percentage of trihydroxylated flavonols whereas barbera , syrah , and cabernet sauvignon grapes reached a percentage of trihydroxylated flavonols of around 4550% .
this fact indicates lower f35h activity in monastrell grapes , as also observed for the anthocyanins .
as regards the flavonol content , cabernet sauvignon grapes showed low concentrations of flavonols and monastrell and syrah much higher concentrations while the highest value was found in red grapes from a hybrid plant from monastrell syrah ( table 2 , figure 4 ) , reaching values as high as 1.83 mg / g of skin . in the hybrids bearing white grapes , a lower concentration of flavonols
[ 23 , 24 ] stated that myb genes , besides the regulation of the ufgt expression , appear to enhance the expression of all the genes involved in the anthocyanin biosynthesis pathway because the transcription of all anthocyanin biosynthesis genes appears to be slightly activated , which would explain the higher concentration of flavonols in red grapes .
studying the flavonol profile of several grape varieties , did not detect trihydroxylated flavonols in white grapes .
did not find significant expression of f35h and ufgt in white grape varieties , which suggests a related regulation of f35h and ufgt during berry ripening and justifies the almost null presence of trihydroxylated flavonols in white grapes .
chardonnay but prior to veraison since it is needed for flavanol biosynthesis , which seems to be controlled differently ; indeed , no differences in the percentage of trihydroxylated flavanols were observed between the red and white grapes arising from the cross of monastrell syrah .
however , other studies stated that flavonol synthase ( fls ) was not upregulated when ufgt was expressed and that the increase in flavonols in red grapes was a consequence of an increase flux through the flavonoid pathway .
the study of the anthocyanin and flavonol profiles of the grapes from the hybrid plants can be useful for a targeted informative metabolomic analysis , a tool for selecting promising grapes according to their profile and/or content .
seedlings with grapes presenting very high concentrations of anthocyanins and flavonols can be expected from intraspecific crosses , and these resulting grapes could lead to highly colored wines , with increased health - related properties . in this way , three plants arising from monastrell syrah ( hybrids 8 , 37 , and 71 ) presented anthocyanin and flavonol concentrations higher than 20 and 1 mg / g fresh skin , respectively ( figures 2 and 4 ) . also , four plants arising from monastrell cabernet sauvignon ( hybrids 38 , 59 , 55 , and 80 ) and two from monastrell barbera ( hybrid plants 120 , 121 ) showed anthocyanin values higher than 20 mg / g fresh skin accompanied with high concentration of flavonols ( figures 2 and 4 )
. the hydroxylation pattern , which also influences wine color and its stability , will be strongly influenced by the parentals pattern since values higher than that shown by the best parental in this respect will be difficult to obtain .
also , in the case of the crosses between heterozygous parentals ( monastrell , cabernet sauvignon , and syrah ) hybrids bearing white grapes can be obtained , some of them with a high concentration of flavonols , that could be of importance in the health properties of this fruit and its derived products , such as the wine .
the information obtained in this study should be helpful for selecting parentals for breeding programs . | this paper explores the characteristics of the anthocyanin and flavonol composition and content in grapes from plants resulting from intraspecific crosses of vitis vinifera varieties monastrell cabernet sauvignon , monastrell syrah , and monastrell barbera , in order to acquire information for future breeding programs .
the anthocyanin and flavonol compositions of twenty - seven hybrids bearing red grapes and 15 hybrids bearing white grapes from monastrell syrah , 32 red and 6 white from monastrell cabernet sauvignon , and 13 red from monastrell barbera have been studied . among the intraspecific crosses , plants with grapes presenting very high concentrations of anthocyanins and flavonols
were found , indicating a transgressive segregation for this character , and this could lead to highly colored wines with an increased benefits for human health . as regards the qualitative composition of anthocyanins and flavonols , the hydroxylation pattern of the hybrids that also may influence wine color hue and stability presented intermediate values to those of the parentals , indicating that values higher than that showed by the best parental in this respect will be difficult to obtain .
the results presented here can be helpful to acquire information for future breeding efforts , aimed at improving fruit quality through the effects of flavonoids . |
constraint - induced movement therapy ( cimt ) is an intervention for stroke patients that has
been suggested to promote the movement of the upper extremities on the paralyzed side .
it is
an intensive rehabilitation treatment method that promotes the use of the unused affected
side by restricting the less - affected side , which is the side that is primarily used in
daily life1 .
although many previous
studies have demonstrated the effectiveness of cimt at recovering the upper extremity
function of stroke patients , there are many issues regarding its practical clinical use ,
since it restricts the movement of the less - affected upper extremity by the wearing of
assistive devices such as splints or gloves for 90% of the time spent performing daily
living activities over a 2 to 3 week span , and the patients suffer from the excess time
taken to perform their daily living activities , as well as psychological anxiety and
pressure arising from intensive treatment of the paralyzed side for 6 to 7 hours a day2,3,4 . to minimize the limitations of cimt ,
the most typical form consists of restricting the movement of the less - affected
side of the upper extremities for 5 hours a day , 5 times a week for 10 weeks , in combination
with an intensive training session for the affected side of the upper extremity 3 times a
week2 .
another design consists of
restricting the movement of the less - affected side of the upper extremity for 6 hours a day ,
5 times a week for 2 to 3 weeks and conducting intensive training for 2 hours5 , 6 .
many previous studies have reported that chronic stroke patients exhibit improvement in the
functional capabilities of the upper extremities , performance of daily living activities ,
and quality of life when m - cimt was conducted for them7 , 8 .
however , there were many
studies of chronic stroke patients in which the number of participants was too low , and , in
terms of experimental design , the majority of studies only consisted of simple comparisons
of results before and after the intervention .
it is difficult to treat this as an analysis
that considers the many variables that can affect general therapy environments and influence
the results of an experiment .
it is also difficult to differentiate the recovery of
participants that would have occurred under normal conditions from the recovery that
occurred due to an intervention9 .
the interrupted time series ( its ) design is an experimental design that is appropriate for
experiments that have a low number of participants , and it investigates the functional and
performance abilities of the participants over a set period of time before and after an
intervention , rather than measuring them at a certain point in time before and after an
intervention , in order to compare the trend of recovery under normal conditions with
recovery after an intervention through the comparison of the trend lines of the recovery of
each patient based on the results obtained before and after intervention9 . hence , this study used the its design to
understand the therapeutic effects of m - cimt when it was conducted for chronic stroke
patients .
the subjects were 2 patients who were hospitalized in one hospital in korea after being
diagnosed with hemiplegia due to stroke .
the general characteristics of the subjects are
noted in table 1table 1.general characteristics of the subjectsagegenderdiagnosisaffected sidedominant handmonth from stroke onsetmmse - kparticipant 168femaleischemiclt.rt.6026participant 247maleischemicrt.rt.3827 .
participant 1 was a 47-year - old male who had right hemiplegia due to middle cerebral artery
infarction that had occurred 48 months earlier .
participant 2 was a 68-year - old female who
had left hemiplegia due to middle cerebral artery infarction that had occurred 60 months
earlier .
both participants had used their right hand as their dominant hand before stroke ,
and they were participating in 30 minutes each of conservative physical therapy and
occupational therapy 5 times a week .
the subjects and their guardians signed an informed
consent form after receiving information about the purpose and method of the study .
the
selection criteria for the participants were as follows : no m - cimt or related treatments in
the past two years , the ability to stand without falling when the less - affected side was
restricted , a score of 25 points or more on mini - mental status examination - korea ( mmse - k )
indicating absence of cognitive damage , no restriction of passive joint range of motion , and
some amount of active joint range in motion exercises .
this study was conducted after
receiving approval of its safety , procedures , and ethics from the research ethics committee
of daegu haany university .
this study used an interrupted time series ( its ) design to determine whether cimt had an
effect greater than that of natural recovery on the impairment of the hemiplegic arm and
hand of elderly persons after stroke .
its designs are characterized by the collection of
multiple observations over time that are interrupted by an intervention or treatment10 .
an its design enables the researcher to
quantify a stable baseline level of function or a trend before treatment and then project
that trend into the future .
the effect of the treatment is determined as the difference
between the actual and projected outcomes11 .
this study followed the effective practice and organization of
care cochrane definition of an its design , which requires that there be at least three time
points before and after the intervention , that the intervention occurs at a clearly defined
point in time , and that the study uses objective performance or outcome measures9 .
the assessment of the participants was conducted 5 times over 3 weeks before and after the
m - cimt intervention .
the assessment tools chosen were those that are most frequently used in
real clinical environments and easily accessible .
these included the modified barthel index
( mbi ) for assessing the daily living activity capabilities of the participants , a hand - held
dynamometer to measure their grip strength and assess their upper extremity functional
levels , and the box and block test ( bbt ) .
as one of the tools that assesses the daily living
activity capabilities of stroke patients , mbi is widely used for its convenience , high
accuracy , consistency , sensitivity , and ease of statistical processing compared to other
assessment tools12 .
bbt is a standardized
assessment tool that assesses the agility of the upper extremities .
it is simple to assess
since it measures the number of wooden blocks moved in one minute .
the test - retest
reliability of this tool was reported as 0.93 for the left hand and 0.97 for the right , and
the reliability between testers was reported as 0.99 for the left hand and 1.00 for the
right13 .
the hand - held dynamometer was
used to measure grip strength , which was measured with the participants sitting on a chair ,
with their elbow joint flexed at 90 and the forearm in the neutral position .
the
participants were asked to squeeze the handle tightly on the tester s verbal order and were
then given some rest time to recover from fatigue .
the m - cimt program designed for the participants was conducted 5 times a week for 2 weeks ,
and it comprised 6 hours in which the participants wore a resting splint in their normal
life to restrict the movement of the less - affected side .
the activities used in the therapy program included
those that participants came across frequently in their daily life , such as turning over
book pages , writing words , moving cones , opening a toothpaste cap and squeezing the
toothpaste out , cutting paper with scissors , putting on and taking off socks , etc .
the
patients were asked to perform various activities with objects of various sizes and
shapes .
data analysis included descriptive analysis of mean differences and trend line analysis to
test whether the modified cimt had a larger positive effect on impairment than natural
recovery .
for each participant , individual pre - intervention data points were used to
determine the mean pre - intervention score of each measure . the same procedure was followed
to obtain the mean post - intervention scores .
the pre - intervention scores were also used to
create trend lines for each participant .
trend lines were calculated using the excel 2010
scatterplot function , and linear regression was used to predict the post - intervention result
if no change was expected .
ninety - five percent confidence intervals ( cis ) were calculated
for each data point .
the predicted trend lines were then compared with the actual
post - intervention results in terms of slope and in terms of the overlap of 95% cis for each
data point . a significant change was considered to have occurred if the cis did not
overlap15 .
the before , after , and mean difference scores of both measures are presented in table 2table 2.mean pre- and post - intervention scores and mean differencemeasurepre - intervention meanpost - intervention meanmean differencebbtparticipant 113.019.06.0participant 212.615.22.6grasp powerparticipant 19.110.81.7participant 23.36.63.3mbiparticipant 181.081.0-participant 272.076.04.0 .
positive changes were observed in most of the items for all participants , and
only the mbi scores of participant 2 showed no difference between pre- and
post - intervention . for both participants , the post - intervention trend lines for the score of
the bbt and grip
strength was above the predicted trend lines . for both of the participants
, there was no
overlap in cis between the predicted and post - intervention bbt score and grip strength trend
lines , indicating improvements associated with treatment rather than natural recovery .
the mbi scores before and after the intervention of participant 1 were identical , resulting
in overlapping trend lines . for participant 2 , the post - intervention trend lines for the
score of the mbi was above the predicted trend lines . for participant 2
, there was no
overlap in cis between the predicted and post - intervention mbi trend lines , indicating
improvements associated with treatment rather than natural recovery .
the primary purpose of this study was to evaluate whether modified cimt had a greater
effect on the upper extremity function and adl than natural recovery of two chronic phase
stroke patients .
the results of this study confirmed the positive effect of m - cimt for all
items except the mbi of participant 1 . for five days a week over a 2 week span , the participants of this study had restriction of
the less - affected side for only 4 hours during normal daily activities , excluding the 2
hours they spent during the therapy program . using a 16 hours as the patients waking
activity time , 6 hours , corresponding to 37.5% of the waking hours of the day is
considerably less than the times used for cimt in previous studies .
constraint of the less
affected side was applied 5 days a week for 2 weeks , and included 2 hours of therapy
programs . despite this , positive effects on the functional capabilities of the affected side
were observed for most of the evaluation measures used in this study8 .
one possible explanation for why we were able to see a
strong effect is that the high - intensity program of massed practice may be more important
than motor restriction of the less affected arm , as suggested by liepert et al . and taub et
al16 , 17 .
the results of the study reveal there were positive improvements in the upper extremity
function of both participants , which is in agreement with the results of dromerick et al .
who reported that the upper extremity function of the affected side improved when
however , there was no change in the daily living activity capabilities of participant 1 .
we
think this was because the participant 1 was older than participant 2 , and because the
affected side of participant 1 was her dominant side before the disease ; the affected side
of participant 2 was his dominant side before the disease .
the present results are in
agreement with those of paik young - rim and kim soo - kyoung who reported that , due to the
nature of m - cimt , which restricts the less - affected side and promotes the use of the
affected side , recovery of the neurologic pattern of the dominant hand ( primarily used in
functional tasks before the disease ) would be quicker since modification of learned non - use
in the dominant hand is easier than in the non - dominant hand7 .
the clinical significance of this research is that it has verified a valid research method
from the experimental design aspect furthering the work of previous studies that conducted
m - cimt for chronic stroke patients .
however , considering the small test group , for further
research and for the generalization of study results , it will be necessary to perform a
statistically meaningful experiments with a minimum number of 30 experimental subjects . | [ purpose ] the purpose of this study was to investigate the impact that modified
constraint - induced movement therapy has on upper extremity function and the daily life of
chronic stroke patients .
[ subjects and methods ] modified constraint - induced movement
therapy was conduct for 2 stroke patients with hemiplegia .
it was performed 5 days a week
for 2 weeks , and the participants performed their daily living activities wearing mittens
for 6 hours a day , including the 2 hours of the therapy program .
the assessment was
conducted 5 times in 3 weeks before and after intervention .
the upper extremity function
was measured using the box and block test and a dynamometer , and performance daily of
living activities was assessed using the modified barthel index .
the results were analyzed
using a scatterplot and linear regression .
[ results ] all the upper extremity functions of
the participants all improved after the modified constraint - induced movement therapy .
performance of daily living activities by participant 1 showed no change , but the results
of participant 2 had improved after the intervention . [ conclusion ] through the results of
this research , it was identified that modified constraint - induced movement therapy is
effective at improving the upper extremity functions and the performance of daily living
activities of chronic stroke patients . |
over one third of u.s . children are overweight or obese putting them at higher risk for adverse health outcomes .
food intake must balance with energy expenditure and growth demands in order for children to maintain a healthy body weight .
complex neural regulatory feedback systems monitor available energy stores in the body in order to prompt feeding behaviors to match energy needs .
while these homeostatic mechanisms play a critical role in maintaining energy balance , non - homeostatic ( hedonic ) pathways can also drive consumption of highly palatable foods .
such foods are known to activate the dopaminergic mesolimbic pathway that is responsible for detecting rewarding stimuli and motivating behaviors to repeat exposure to those stimuli .
this pathway is also involved in classical conditioning , i.e. a learning process where a reward - related stimulus can lead to anticipation and motivation for that reward .
our current obesogenic environment is replete with food - related stimuli , or food cues , that may activate reward pathways and motivate overconsumption .
the food industry spends $ 1.79 billion marketing primarily energy - dense , nutrient - poor foods to u.s .
children under 11 years old , resulting in an average viewing of 15 tv ads per day or 5,500 over each year . given the high prevalence of exposure , it is important to understand whether tv food ads prompt excessive caloric consumption in children .
randomized studies assessing whether tv food advertising affects consumption in children have had mixed results .
some have shown significantly higher consumption when children view food ads compared to non - food ads .
for example , harris et al . showed 118 children , ages 711 years , two minutes of food or non - food ads embedded in a 14-minute cartoon and provided crackers to consume while watching the show .
children who viewed the food ads consumed an average of 28.5 g ( 133 kcals ) more than those shown the non - food ads , even though the crackers were not advertised during the session .
others have not observed a main effect of food ad exposure on consumption ; however , several of these studies reported effects of food ad exposure in subsets of participants ( e.g. boys and children with maternal encouragement to be thin ) , or when looking at specific foods ( e.g. celebrity - endorsed foods ) . genetic factors
likely interact with environmental drivers of eating behavior and could affect how individuals respond to environmental cues to eat .
a common variant in the fat mass and obesity associated ( fto ) gene was the first genetic factor to be associated with common obesity in large genome - wide association studies .
while the biological mechanism is yet unknown pediatric studies suggest that fto may decrease satiety responsiveness and lead to excess consumption .
interestingly , one study ( n=24 ) examined fto rs9939609 in relation to brain response to food images in adult men .
the authors reported that , for the participants in a fasted state , fto homozygous high - risk participants had a significantly greater response to food vs. nonfood images in brain reward regions compared to homozygous low - risk participants .
this past research motivated our hypothesis that children with the fto rs9939609 high - risk allele would have heightened susceptibility to excess consumption after viewing food ads . in this study , we tested the effect of food ad exposure on cued eating among children enrolled in a randomized trial and further explored whether a common variant in fto modified that effect .
we recruited 200 children through community fliers and a contact list from children s hospital at dartmouth between july 2013 and february 2015 ( figure 1 ) .
inclusion criteria included age 9 or 10 years , english fluency , absence of food allergies / restrictions , and absence of health conditions / medication use that may impact appetite or attention span .
caregivers and children provided written consent and assent , respectively , and dartmouth s committee for the protection of human subjects approved all study protocols . to limit the analysis to unrelated children , one sibling from each of 21 sibling pairs
in addition , four children were excluded because they did not report satiety after lunch , and three were excluded because of protocol violations ( i.e. , health condition potentially affecting appetite , caregiver interaction with child during experiment ) .
there were no significant differences between included and excluded children in terms of baseline covariates or consumption ( data not shown ) .
children and one parent were schedule for a study appointment at 11:30 am or 12:30 pm .
children were instructed to eat a normal breakfast , but not to eat for the two hours prior to the appointment . during the appointment ,
children were provided lunch with their choice of main dish ( macaroni and cheese , pizza bites , or chicken nuggets with ketchup ) , along with string cheese , carrots and dressing , apple slices , bread , butter , milk , and water .
meals were balanced on macronutrients and contained 552704 kcals of carbohydrates , 315405 kcals of fat , and 152188 kcals of protein .
foods were pre - and post - weighed , and nutrient labels and the usda national nutrient database for standard reference were used to calculate caloric consumption .
after lunch , each child was asked to assess his / her satiety with a 5-point likert scale ranging from
i am very hungry to i am very full . children who reported ,
i am a little hungry were excluded from the analysis . after lunch , all children viewed a 34-minute tv show ( figure it out ! , nickelodeon ) that included 7.7 minutes of either food or toy ads , along with 3.1 minutes of neutral ads .
our outcome measure was caloric consumption after self - reported satiety , i.e. , eating in the absence of hunger ( eah ) , during the experimental exposure .
we provided four snack foods during the experimental exposure : gummy candy ( 546 kcals ) , cookies ( 692 kcals ) , chocolate ( 1000 kcals ) , and cheese puffs ( 536 kcals ) .
food was pre- and post - weighed , and product nutrition information was used to calculate caloric consumption .
buccal cell swabs were collected before lunch and stored at room temperature with desiccant capsules ( isohelix , kent , u.k . ) .
dna was isolated using ddk-50 isolation kits ( isohelix , kent , u.k . ) .
genotyping for rs9939609 was conducted with real - time pcr and taqman chemistry using the 7500 fast real - time instrument ( primers and instrument from thermo fisher scientific ( waltham , usa ) ) .
all samples were successfully genotyped and there was 100% genotyping consistency among the 10% blinded replicates .
we measured children s weight ( to the nearest 0.1 kg ) and height ( to the nearest 0.5 cm ) , using a digital scale and stadiometer ( model 597kl , seca , hamberg , germany ) .
we calculated body mass index ( bmi ) percentile using u.s . center for disease control ( cdc ) 2000 age- and sex - specific distributions .
< 95 percentile and obese was defined as 95 percentile . estimated daily energy requirement ( eer ) was calculated according to institute of medicine guidelines using child s sex , measured height and weight , and caregiver - reported daily average physical activity .
caregivers answered , how much time does your child spend doing physical activity such as running around , climbing , biking , dancing , swimming , playing sports , etc . ?
separately for school or weekend days . a single weighted average was created and categorized as
low active for 30<60 , active for 60<120 , and very active for 120 min / day .
caregivers reported their child s race and ethnicity , their highest level of education , their spouse s highest level of education , and their household income category .
caregivers also reported their child s typical number of hours spent watching tv or movies on a weekend day and school day , and responses were used to create a single weighted average . parental eating restriction was calculated as an average of caregiver responses to the restriction subscale questions of the child feeding questionnaire , e.g . ,
answered on a scale of : 1=disagree , 2=slightly disagree , 3=neutral , 4=slightly agree , and 5=agree ) .
we compared participant characteristics by study condition using unpaired , 2-tailed t - tests for continuous measures and x or fisher s exact tests for categorical measures , as appropriate .
next , we examined unadjusted associations between participant characteristics and caloric consumption during the lunch and eah phases using linear regression ; consumption during the eah phase was computed for total foods and separately for foods that were and were not advertised during the experiment .
we then estimated the effect of the experimental condition on eah for total foods , advertised food , and non - advertised foods separately using multivariable linear regression adjusted for eer and all covariates related to eah at the p < 0.10 threshold .
we did not include sex and bmi percentile as covariates because they were used to calculate eer ; however , we conducted a sensitivity analysis to determine whether adding those variables to the final models influenced findings . to address whether the fto rs9939609 genotype modified the effect between food ad exposure and eah
, we included a multiplicative interaction term between the exposure and genotype in the adjusted models and used a wald test to determine the significance of the interaction term .
to assess the robustness of our findings , we repeated the final models after excluding participants who were above the 90 percentile for eah consumption ( > 840 kcals ) .
we also performed analyses stratified by sex and weight status , because some previous studies found interactions between food ad exposure and these variables on consumption .
we conducted all analyses using sas 9.4 ( sas institute , cary , usa ) .
we recruited 200 children through community fliers and a contact list from children s hospital at dartmouth between july 2013 and february 2015 ( figure 1 ) .
inclusion criteria included age 9 or 10 years , english fluency , absence of food allergies / restrictions , and absence of health conditions / medication use that may impact appetite or attention span .
caregivers and children provided written consent and assent , respectively , and dartmouth s committee for the protection of human subjects approved all study protocols . to limit the analysis to unrelated children , one sibling from each of 21 sibling pairs
in addition , four children were excluded because they did not report satiety after lunch , and three were excluded because of protocol violations ( i.e. , health condition potentially affecting appetite , caregiver interaction with child during experiment ) .
there were no significant differences between included and excluded children in terms of baseline covariates or consumption ( data not shown ) .
children and one parent were schedule for a study appointment at 11:30 am or 12:30 pm .
children were instructed to eat a normal breakfast , but not to eat for the two hours prior to the appointment . during the appointment ,
children were provided lunch with their choice of main dish ( macaroni and cheese , pizza bites , or chicken nuggets with ketchup ) , along with string cheese , carrots and dressing , apple slices , bread , butter , milk , and water .
meals were balanced on macronutrients and contained 552704 kcals of carbohydrates , 315405 kcals of fat , and 152188 kcals of protein .
foods were pre - and post - weighed , and nutrient labels and the usda national nutrient database for standard reference were used to calculate caloric consumption .
after lunch , each child was asked to assess his / her satiety with a 5-point likert scale ranging from
i am very hungry to i am very full . children who reported ,
after lunch , all children viewed a 34-minute tv show ( figure it out ! , nickelodeon ) that included 7.7 minutes of either food or toy ads , along with 3.1 minutes of neutral ads .
our outcome measure was caloric consumption after self - reported satiety , i.e. , eating in the absence of hunger ( eah ) , during the experimental exposure .
we provided four snack foods during the experimental exposure : gummy candy ( 546 kcals ) , cookies ( 692 kcals ) , chocolate ( 1000 kcals ) , and cheese puffs ( 536 kcals ) .
food was pre- and post - weighed , and product nutrition information was used to calculate caloric consumption .
buccal cell swabs were collected before lunch and stored at room temperature with desiccant capsules ( isohelix , kent , u.k . ) .
dna was isolated using ddk-50 isolation kits ( isohelix , kent , u.k . ) .
genotyping for rs9939609 was conducted with real - time pcr and taqman chemistry using the 7500 fast real - time instrument ( primers and instrument from thermo fisher scientific ( waltham , usa ) ) .
all samples were successfully genotyped and there was 100% genotyping consistency among the 10% blinded replicates .
we measured children s weight ( to the nearest 0.1 kg ) and height ( to the nearest 0.5 cm ) , using a digital scale and stadiometer ( model 597kl , seca , hamberg , germany ) .
< 95 percentile and obese was defined as 95 percentile . estimated daily energy requirement ( eer )
was calculated according to institute of medicine guidelines using child s sex , measured height and weight , and caregiver - reported daily average physical activity .
caregivers answered , how much time does your child spend doing physical activity such as running around , climbing , biking , dancing , swimming , playing sports , etc . ?
separately for school or weekend days . a single weighted average was created and categorized as
low active for 30<60 , active for 60<120 , and very active for 120 min / day .
caregivers reported their child s race and ethnicity , their highest level of education , their spouse s highest level of education , and their household income category .
caregivers also reported their child s typical number of hours spent watching tv or movies on a weekend day and school day , and responses were used to create a single weighted average .
parental eating restriction was calculated as an average of caregiver responses to the restriction subscale questions of the child feeding questionnaire , e.g . ,
answered on a scale of : 1=disagree , 2=slightly disagree , 3=neutral , 4=slightly agree , and 5=agree ) .
we compared participant characteristics by study condition using unpaired , 2-tailed t - tests for continuous measures and x or fisher s exact tests for categorical measures , as appropriate .
next , we examined unadjusted associations between participant characteristics and caloric consumption during the lunch and eah phases using linear regression ; consumption during the eah phase was computed for total foods and separately for foods that were and were not advertised during the experiment .
we then estimated the effect of the experimental condition on eah for total foods , advertised food , and non - advertised foods separately using multivariable linear regression adjusted for eer and all covariates related to eah at the p < 0.10 threshold .
we did not include sex and bmi percentile as covariates because they were used to calculate eer ; however , we conducted a sensitivity analysis to determine whether adding those variables to the final models influenced findings . to address whether the fto rs9939609 genotype modified the effect between food ad exposure and eah , we included a multiplicative interaction term between the exposure and genotype in the adjusted models and used a wald test to determine the significance of the interaction term .
to assess the robustness of our findings , we repeated the final models after excluding participants who were above the 90 percentile for eah consumption ( > 840 kcals ) .
we also performed analyses stratified by sex and weight status , because some previous studies found interactions between food ad exposure and these variables on consumption .
we conducted all analyses using sas 9.4 ( sas institute , cary , usa ) .
the analysis included 172 children who were equally distributed across study conditions ( table 1 ) .
approximately half of the children were male , and they were mostly white ( 86% ) and non - hispanic ( 97% ) .
twenty - three percent of children were overweight or obese , which is slightly lower than the new hampshire rate of 26% .
the mothers of the children were generally highly educated with 78% obtaining at least a college degree .
children watched an average ( sd ) of 1.4 ( 1.0 ) hours of tv per day .
baseline characteristics were balanced across experimental conditions with the exception of eer , which was 145 kcals higher in the toy vs. food arm of the study ( p = 0.03 ) .
the frequency of fto rs9939609 genotype frequencies ( 36% tt , 48% at , and 16% aa ) were similar to those of other studies and were consistent with hardy - weinberg equilibrium ( x test p value = 0.93 ) .
there was a strong relationship between the fto genotype and adiposity ; the rate of overweight / obesity was 18% among low - risk ( tt ) children compared to 44% among the highest - risk ( aa ) children ( p < 0.01 ) . in our sample , 21% of heterozygotes were overweight / obese , a rate similar to that for homozygous low - risk participants ( p = 0.68 ) .
the fto genotype was not associated with any other child , caregiver or household characteristic at the p < 0.05 significance level ( table s3 ) .
participants across both experimental conditions consumed an average ( sd ) of 453 ( 185 ) kcals during lunch .
being male , having a higher bmi , and having a higher eer were associated with higher caloric consumption at lunch ( table 2 ) .
participants consumed an additional 482 ( sd : 274 ) kcals during the eah phase .
baseline characteristics associated with greater total eah consumption were being male , increased bmi percentile , eer and parental eating restriction ( table 2 ) .
there was a statistically significant main effect of the food vs. toy ad exposure on the consumption of the food advertised during the session ; children exposed to food ads consumed , on average , 44 additional calories of gummy candy than children exposed to toy ads ( p = 0.02 ) .
there was no main effect of experimental condition on total consumption or on foods not advertised during the experiment . in analyses adjusted for eer and parental eating restriction ( table 3 ) , the association between food ad exposure and consumption of the advertised food remained similar ( = 48 kcals , p = 0.01 ) .
there were no main effects for total consumption ( p = 0.21 ) or consumption of foods not advertised ( p = 0.98 ) .
we conducted a bonferonni correction of the significance level for the 3 hypothesis tests of consumption conducted ( total food , advertised food , non - advertised food ) and the association between food ad exposure and consumption of advertised food was still significant at the p < 0.017 level . in a sensitivity analysis that also included sex and bmi percentile in the final models ,
findings also remained unchanged when the analysis was restricted to individuals below the 90 percentile of eah consumption .
there was a significant interaction between the fto rs9939609 genotype and food ad exposure with advertised food consumption ( p for interaction = 0.02 ) ( figure 2 ) .
the magnitude of the association between food ad exposure and consumption increased linearly with each additional risk allele ; the estimate ( 95% ci ) for the tt , at , and aa genotypes were 3 ( 64 , 59 ) , 59 ( 4 , 115 ) , and 125 ( 16 , 233 ) kcals , respectively .
stratum - specific estimates also increased linearly when considering total foods rather than only the advertised food , though the estimates were not significant , nor was the interaction .
there were no significant interactions between participant sex or weight status with food ad exposure on consumption ( data not shown ) .
in this randomized study , we observed a significant interaction between the fto rs9939609 genotype and food ad exposure on the consumption of a recently advertised food .
our results suggest that the fto obesity - risk allele may confer children with a predisposition to heightened consumption in response to food cues .
although we did not find evidence of a generalized effect of food ad exposure on overall cued eating , we did find that exposure to food ads influenced the consumption of a recently advertised food . during just 34 minutes of tv viewing
, children who viewed a show with embedded food ads , including one ad for gummy candy , ate an average of 48 more kcals of gummy candy than children who viewed toy ads .
moreover , that consumption occurred immediately after children reported eating lunch to satiety , reflecting excessive intake .
the implications of such findings are concerning given the frequent exposure that children have to tv food ads and that the majority of television food advertising is for energy - dense , nutrient poor foods .
food cues such as those present in food advertising are thought to drive non - homeostatic pathways of food consumption via their incentive - motivational properties acquired via classical conditioning .
the nucleus accumbens , part of the dopaminergic reward pathway of the brain , is the likely functional interface between motivational food cues and consumptive behaviors , and functional neuroimaging studies have observed activation of the nucleus accumbens in response to food advertisements . in addition , studies also suggest that the neural reward response to food cues is greater for participants with fto rs9939609 obesity risk alleles , independent of adiposity .
fto rs9939609 may regulate dopamine ( d2)-dependent reward learning , so the increased responsiveness to food cues may be a result of heightened prior conditioning .
we hypothesize that genetic differences in the neural reward response to food cues underlies our observed behavioral findings ; however , further research is needed to better understand genetic differences in the effect of food cues on overconsumption .
ten studies performed by five unique research groups have explored measured food consumption in children during or after viewing tv food ads ( systematically reviewed by boyland in 2016 ) . of these studies ,
a series of school - based experiments in the u.k . found that children consumed more after viewing a tv program proceeded by 810 food ads compared to toy ads . while compelling , the non - naturalistic presentation of ads in a single block before the show may have suggested the study goals to participants and thereby influenced behavior . however , two other studies presented the ads during more naturalistic commercial breaks , as we did in our study , and showed increased consumption related to food ad exposure .
the remaining five studies did not find a main effect of food advertising exposure on consumption .
the fact that the advertising effect was only observed for an advertised food differs from the majority of previous studies on cued eating that have demonstrated that the effect of advertising extends to non - advertised foods , a beyond - brand effect . unlike our study , however , most of those previous studies only provided participants with foods that were not advertised during the experimental session and did not also provide them the choice of an advertised food .
only one other study provided participants with the choice between an advertised and non - advertised food ; in that study , exposure to an ad for a celebrity - endorsed potato chip increased consumption of that specific chip , but did not impact consumption of chips with a generic label .
like our study , that study also did not observe a significant difference in consumption of the non - advertised food across study condition .
we do not deem our study findings a contradiction of a beyond - brand effect , but consider them evidence of a preference for consuming advertised food when provided , a behavior that was not captured in most previous studies .
the specificity of our food ad effect could also relate to the particular characteristics of the gummy candy , such as macronutrient composition , that differ from those of the other provided foods ( cookies , chocolate , cheese puffs ) .
in addition , while only one ad for the gummy candy was shown , six of the 20 ads shown were for candy and those ads may have also influenced the consumption of the gummy candy .
future research is necessary to better understand the observed specificity of the advertising effect on consumption .
the implications of our findings for weight gain are unclear given that we did not find a significant difference in total caloric consumption related to ad exposure , though we did observe a positive trend for the association . given the high inter - individual variability in total consumption , our study may have been underpowered to test the effect of food ad exposure on this outcome . unlike four of the five studies that found a significant main effect , our study did not measure consumption in the same children under both conditions . while a within - participant design may have been more powerful , we chose not to use such a design because of our concerns that participant awareness of study goals could influence their behavior .
we posited that children would be more likely to remain nave to the study goals when they were randomized to a single experiment condition .
a larger study will be necessary to more definitively assess food ad exposure s effect on total consumption .
our finding that parental eating restriction of child eating was positively related to total consumption recapitulate results from other groups .
alternatively , parents may impose more restrictive feeding practices in response to a child s tendency to overeat .
this study has the strength of controlling for initial satiety level , thereby enabling us to measure eah .
indeed , a surprising finding was that children consumed approximately the same number of calories during the eah and lunch phases , suggesting the inability of children to regulate caloric intake when presented with highly palatable foods . through this eah paradigm , we were able to demonstrate that recent food ad exposure prompted children to consume a recently advertised food even when they were full .
our study was limited in that it measured one instance of cued eating in a laboratory setting , and it is unknown whether children compensate for increased short - term intake by modifying long - term intake , thus mitigating any effects on excess weight gain .
also , the generalizability of our laboratory - based findings to the home environment is unknown .
furthermore , studies also suggests that tv ads prompt children to request the purchase of advertised foods , which may relate to an increased availability of those foods at home .
thus , it is plausible that exposure to tv food ads among children at home may indeed relate to cued eating .
while tv is still a primary mechanism for advertising to children , food companies are increasingly using other marketing tactics .
for example , advergames , internet games that promote brand recognition , have been shown to increase short - term caloric consumption in children .
in addition , the use of celebrity endorsements and character tie - ins is concerning and warrants further research .
our study was also limited by its examination of a single genetic obesity risk factor , rs9939609 .
this polymorphism has shown one of the strongest associations with child obesity , however , so understanding potential mechanisms of its action are of both scientific and public health importance .
this is also one of the first studies to examine genetic predisposition to reactivity to food cues and the first examination of this research area in children .
our study can not rule out the possibility that unmeasured confounders , like other genetic loci related to excess consumption , were unbalanced between study arms and could have contributed to the association we report .
future , larger studies are necessary to study multiple genetic obesity risk factors related to food cue reactivity .
in this randomized experimental trial , exposure to tv food ads was associated with increased caloric consumption of a recently advertised food in children who had already eaten a meal to satiety , and that association was modified by the fto rs9939609 obesity - risk allele .
future research is needed to understand the neurological mechanism underlying these associations and whether other genetic risk factors also influence reactivity to food cues . given the high exposure that children have to ads marketing unhealthy foods , the observed cued eating may have a substantial impact on children s dietary choices .
| background / objectiveexposure to food advertisements may cue overeating among children , especially among those genetically predisposed to respond to food cues .
we aimed to assess how television food advertisements affect eating in the absence of hunger among children in a randomized trial .
we hypothesized that the fat mass and obesity associated gene ( fto ) rs9939609 single nucleotide polymorphism would modify the effect of food advertisements.subjects/methodsin this randomized experiment , 200 children aged 910 years old were served a standardized lunch and then shown a 34-minute television show embedded with either food or toy advertisements .
children were provided with snack food to consume ad libitum while watching the show and we measured caloric intake .
children were genotyped for rs9939609 and analyses were conducted in the overall sample and stratified by genotype .
a formal test for interaction of the food ad effect on consumption by rs9939609 was conducted.results172 unrelated participants were included in this analysis .
children consumed on average 453 ( sd=185 ) kcals during lunch and 482 ( sd=274 ) kcals during the experimental exposure .
children who viewed food advertisements consumed an average of 48 kcals ( 95% ci : 10 , 85 ; p=0.01 ) more of a recently advertised food than those who viewed toy advertisements .
there was a statistically significant interaction between genotype and food advertisement condition ( p for interaction = 0.02 ) , where the difference in consumption of a recently advertised food related to food advertisement exposure increased linearly with each additional fto risk allele , even after controlling for bmi percentile.conclusionsfood advertisement exposure was associated with greater caloric consumption of a recently advertised food , and this effect was modified by an fto genotype .
future research is needed to understand the neurological mechanism underlying these associations . |
it has been implicated in inducing nephrogenic diabetes inspidus , chronic tubulointerstitial nephropathy , and acute tubular necrosis .
we describe a case of lithium - induced minimal change disease ( mcd ) and acute kidney injury ( aki ) .
a 32-year - old female with a medical history of bipolar disorder treated with chronic lithium therapy presented with anasarca , fatigue , and tremors .
work - up revealed supra - therapeutic lithium levels , hypoalbuminemia , and significant proteinuria .
she underwent a renal biopsy that demonstrated effacement of podocyte foot processes consistent with lithium - induced mcd .
this was treated with corticosteroids , which decreased the proteinuria and resolved all the patient 's symptoms .
it is often associated with therapeutic lithium and is typically resolved with discontinuation of lithium . in some cases , concurrent aki may result due to vascular obstruction from hyperalbuminuria and associated renal interstitial edema .
corticosteroids may be needed to reduce the proteinuria and prevent progression to chronic kidney disease . as such
, patients on lithium therapy may benefit from monitoring of glomerular function via urinalysis to prevent the onset of nephrotic syndrome .
nephrotic syndrome is characterized by proteinuria of > 3 g / day , hypoalbuminemia , edema , and hyperlipidemia / lipiduria .
several subtypes of this syndrome exist such as focal segmental glomerulosclerosis , membranous nephropathy , and minimal change disease ( mcd ) .
mcd is the most common presentation of nephrotic syndrome in the preadolescent population and accounts for up to 15% of primary nephrotic syndrome in adults .
although most causes of mcd are idiopathic , extraglomerular processes such as toxic reactions to drugs can also precipitate the disease in susceptible patients .
specifically , several cases of lithium - induced nephrotic syndrome have been reported in literature .
historically , lithium is commonly associated with nephrogenic diabetes inspidus , chronic tubulointerstitial nephropathy , and acute tubular necrosis .
rarely , an idiosyncratic reaction has been established between lithium use and development of proteinuria and nephrotic syndrome . since duffot and colleagues first identified the association of this metal to nephrotic syndrome in 1973 ,
most cases have linked nephrotic syndrome to therapeutic serum lithium levels and the majority of cases have demonstrated prompt reversal of proteinuria upon discontinuation of lithium .
we describe a case of a young woman with no evidence of preexisting renal disease that developed mcd on supratherapeutic lithium levels in whom the renal injury worsened after discontinuation of lithium .
the purpose of this case is to stress the importance of close follow - up of renal and glomerular function of patients on acute as well as chronic lithium therapy .
a 32-year - old female presented to the emergency room with a chief complaint of marked edema of 5 days ' duration .
past medical history included : bipolar disorder , panic disorder , hypothyroidism , and hidradenitis suppurativa .
her daily home medications included lithium carbonate 900 mg , synthroid 75 g , cymbalata 60 mg , nortryptiline 30 mg , cipralex 30 mg , gabapentin 600 - 900 mg , and ibuprofen 200 mg .
the patient had been on a stable dose of lithium for approximately 5 years experiencing no side effects .
she presented to the hospital with a 5-day history of severe fatigue , migraine - like headaches , lethargy , and significant anasarca .
she denied chest pain , shortness of breath , constitutional symptoms , and any urinary symptoms .
the patient 's vital signs were : blood pressure 115/61 , heart rate 61 beats / min , respiratory rate 20 breaths / min , and oxygen saturation 96% on room air .
there was generalized + 2 edema of lower extremities , upper extremities , and periorbital regions .
( baseline 69 mol / l ) and a blood urea of 10.4 mmol / l .
urine dipstick showed a specific gravity of 1.016 , ph 7.5 , and 4 + protein ; and was negative for glucose , ketones , and nitrites .
the urine albumin to creatinine ratio was 973.4 mg / mmol and 24-h urine protein was 15.69 g. on admission , serum lithium level was 2.66
mmol / l , potassium 4.5 mmol / l , chloride 105 mmol / l , and bicarbonate 27
g / l , white blood cell count 9.46 10 /l , and platelet count 234 10 /l .
g / l ; but all liver enzymes , total bilirubin , and coagulation studies were within normal limits .
serology for hepatitis b and c , anti - double stranded deoxyribonucleic acid , antineutrophilic cytoplasmic antibodies , ribonucleoprotein , sjogren 's syndrome , scleroderma , inflammatory myositis , and smith antibody were all negative .
once stabilized , she was discharged from the hospital and lithium remained discontinued . at 2 months
follow - up , the patient experienced worsening anasarca , significant acute kidney injury ( aki ; serum creatinine 209 mol / l ) , and persistent proteinuria .
she was readmitted to the hospital and subsequently underwent a renal biopsy , when at the time her creatinine peaked at 348 mol / l . on light microscopy , there was no global sclerosis , crescent formation , or necrotic lesions capillary wall thickness was normal .
electron microscopy revealed widespread fusion of podocyte foot processes affecting more than 75% of the surface of glomerular capillary loops [ figure 1b ] .
no electron dense deposits were evident . a diagnosis of mcd secondary to lithium use was established and the patient was started on high dose corticosteroids , initially intravenously , but changed to oral prednisone 80 mg daily on discharge . over the next 2 months of follow - up , the patient 's creatinine , proteinuria , and edema all decreased significantly and she was tapered to oral prednisone 40 mg . at her 4 months
follow - up , her albumin / creatinine ratio had decreased to 220 mg / mmol and she remained on oral prednisone 40 mg daily .
( a ) light microscopy identifying focal interstitial fibrosis and cellular mesangial expansion ( black arrows ) .
no evidence of ischemic injury to tubular structures . developed with periodic acid - schiff stain .
magnification , 12,000 serum creatinine and albumin / creatinine ratio throughout the hospitalization and post - hospitalization follow - up
. progression of serum creatinine and albumin / creatinine ratio from first day of hospitalization to current follow - up .
lithium - induced nephrotic syndrome is an idiosyncratic reaction that has affected the adult and pediatric population as summarized in table 1 .
nephrotic syndrome has been associated with therapeutic lithium levels in all but 32% of the cases .
a majority of cases have demonstrated complete reversal of proteinuria upon discontinuation of lithium providing evidence for lithium as the potential etiology of the initial renal insult . in cases of persistent proteinuria despite discontinuation of the medication , steroids have been prescribed to prevent chronic renal failure . additionally ,
however , to our knowledge , we demonstrate the first case in which the aki presented at follow - up after discontinuation of lithium use .
defined as interstitial edema of the kidney , in association with high degree of albuminuria , nephrosarca may have caused physical obstruction of vasculature and tubular structures resulting in florid aki . specifically , histological interstitial edema and improvement with diuresis therapy are criteria for the diagnosis of nephrosarca , although highly controversial . of note
there was no tubular injury or marked interstitial nephritis seen on biopsy as is often seen in mcd and aki associated with extrinsic factors such as nonsteroidal anti - inflammatory use .
there was however chronic interstitial fibrosis noted , likely as the result of long - term lithium use in this patient .
all reported cases in worldwide literature of lithium - induced nephrotic syndrome the pathophysiological mechanism by which lithium induces nephrotic syndrome is not yet delineated .
the three - layered permselective barrier consisting of the glomerular capillary , glomerular basement membrane , and podocyte foot processes contains anionic sulfated glycosaminoglycans .
it is hypothesized that the cationic lithium may interact with these anionic sites , thereby disrupting the charge barrier and inducing albuminuria .
furthermore , toxic circulating lymphokines are associated with damage to the glomerular basement membrane resulting in mcd .
it is hypothesized that lithium may induce mcd by activating t lymphocytes and cytokines such as tumor necrosis factor .
lithium is a well - known modulator of the phosphoinositol pathway , which is involved in t cell stimulation .
activating this pathway may result in excessive cytotoxic t cells that may disrupt the selective barrier of the glomerular basement membrane and podocyte foot processes resulting in marked proteinuria and mcd .
mild proteinuria , presumably from glomerular damage , is a relatively common complication of lithium use .
it is estimated up to 42% of patients on lithium may have greater than 1.0 g / day proteinuria . as more evidence suggests lithium - induced proteinuria and nephrotic syndrome ,
it is inevitable that close follow - up with renal function tests as well as urine dipstick analysis is required to prevent chronic renal failure .
historical data suggests most patients will respond to lithium withdrawal and in rare cases , corticosteroids may be required to reverse the proteinuria .
there have been several cases that have demonstrated persistence of proteinuria despite steroid use suggesting alternative hypotheses such as nephrosarca . as such
, the importance of early biopsy and early treatment with hemodialysis or aggressive diuresis may prevent progression of aki .
further research is necessary to better understand the mechanism of concurrent lithium - induced mcd and aki . | context : lithium carbonate is a psychiatric medication commonly used in the treatment of bipolar disorder . it has been implicated in inducing nephrogenic diabetes inspidus , chronic tubulointerstitial nephropathy , and acute tubular necrosis .
we describe a case of lithium - induced minimal change disease ( mcd ) and acute kidney injury ( aki).case report : a 32-year - old female with a medical history of bipolar disorder treated with chronic lithium therapy presented with anasarca , fatigue , and tremors .
work - up revealed supra - therapeutic lithium levels , hypoalbuminemia , and significant proteinuria .
the patient was treated conservatively with fluids and discontinuation of lithium therapy .
subsequently , she developed significant aki and persistent proteinuria .
she underwent a renal biopsy that demonstrated effacement of podocyte foot processes consistent with lithium - induced mcd .
this was treated with corticosteroids , which decreased the proteinuria and resolved all the patient 's symptoms.conclusion:lithium-induced mcd is a rare disease that affects patients of all ages . it is often associated with therapeutic lithium and is typically resolved with discontinuation of lithium . in some cases , concurrent aki may result due to vascular obstruction from hyperalbuminuria and associated renal interstitial edema . corticosteroids may be needed to reduce the proteinuria and prevent progression to chronic kidney disease . as such , patients on lithium therapy may benefit from monitoring of glomerular function via urinalysis to prevent the onset of nephrotic syndrome . |
human retinopathy of prematurity ( rop ) results when the developing retinal vasculature in the premature infant is exposed to higher - than normal oxygen levels ( hyperoxia ) .
hyperoxia causes development of the retinal vasculature to cease and vaso - obliteration to occur .
as the neural retina continues to develop and consumes greater levels of oxygen , the retina becomes hypoxic due to an attenuated retinal vasculature .
the resultant hypoxia causes increased levels of hypoxia inducible factor ( hif ) and subsequent increased expression of hif - inducible angiogenic factors like vegf cause the vasoproliferative stage in rop .
none of the models exactly replicates human rop , but each has some pathological characteristics that mimic the human disease .
canine oir was first developed by arnall patz in an effort to experimentally determine the effects of hyperoxia on the developing retinal vasculature1,2 and modified by flower et al.3 dogs are similar to humans in regards to the mechanism of retinal vascular development , and also the end - stage pathology of the canine model is similar to stage iv human rop having tractional retinal folds in retina . unlike rodents
vasculogenesis is the development of blood vessels by differentiation , aggregation , and assembly of vascular precursors or angioblasts ( figure 1 ) .
this process is occurring at birth in dogs and begins in humans at around 14 weeks gestation.46 the canine retina is only 60% vascularized at birth and angioblasts ( positive for adenosine diphosphatase [ adpase ] enzyme activity ) are present throughout avascular peripheral retina at this time.4,7 the initial assembly of the angioblasts results in cords and then lumen develop within the cords . in dogs and humans ,
astrocyte ( the inner retinal glia ) differentiation trails vascular development and guidance is provided by muller glia not astrocytes , unlike neonatal rodent retinas.57 the muller cells , which span the retina from internal to external limiting membrane , form glycosaminoglycan - rich extracellular spaces in which vasculogenesis occurs4 while also providing adenosine via the enzyme 5 nucleotidase to stimulate the vasculogenic process.7 vascular endothelial cell markers ( cd34 and von willebrand s factor ) are not expressed in angioblasts and are expressed only in endothelial cells after lumen formation and presumably the presence of serum within the lumens .
this exposure to hyperoxia arrests the development of the superficial retinal vasculature and causes the vaso - obliterative phase of oir ( figure 2 ) .
this results in 60% loss in vascular area and the vaso - obliteration is the greatest in the capillaries , whereas large blood vessels appear viable as determined by adpase activity ( figure 3).8 the vaso - obliteration occurs throughout the retina but islands of surviving endothelial cells can be found throughout the once - vascularized areas ( figure 3 ) .
the loss of vasculature in the presence of a differentiating neuroblastic layer ( neuronal progenitors ) after removal from hyperoxia results in extreme hypoxia , the initiating event in the vaso - proliferative stage in canine oir .
revascularization of retina occurs in a burst of disorganized angiogenesis that results in a very dense capillary network in the inner retina ( figure 4).9 the extracellular spaces created by muller cell processes are filled with proliferating astrocytes , and multiple layers of capillaries form the inner retina . at the periphery of the surviving retinal vasculature , glial proliferation occurs resulting in gliosis ; in humans , gliosis causes the formation of a ridge of tissue between vascularized and nonvascularized retina , but no anatomical ridge occurs in dogs.10 by postnatal day 15 ( p15 ) , tufts of neovascularization can be seen in vitreous with fundus and red free photography ( figure 5).9 vitreous , the gel in posterior chamber of the eye , normally has had regression of the fetal vasculature occur by this time and is becoming avascular .
fluorescein angiography demonstrates the leaky nature of these formations and the extreme tortuosity of arteries ( figure 5).11 in cross sections , the dense cellularity of these preretinal formations is apparent
. often adjacent tufts of neovascularization will anastomose with each other forming a vascular complex ( figure 6 ) .
eventually the complexes will anastomose forming a dense mat - like structure of new blood vessels , which expands to form an extensive preretinal vascular membrane ( figure 6).12 the membranes , when visualized with fundus photography and fluorescein angiography at p22 , appear at times to cover entire vascular arcade ( figure 7).11 the preretinal membranes persist at least until p45 ( figure 8) when they appear as tented membranes putting tractional force on the retinas .
the result is tractional retinal folds in retina at p45 ( figure 8) similar to those formed in stage iv human rop . in all of the oir models
, vegf plays a key role in vasculogenic and angiogenic processes in retina.1214 vegf expression is upregulated in retina during development because there is no retinal vasculature and neurons have become metabolically active , consuming the oxygen that is available . in the dog retina ,
vegf receptor-2 ( vegfr2 or kinase domain receptor [ kdr ] ) is present on angioblasts and endothelial cells during development.14 however , this receptor is greatly upregulated in vasoproliferative stage of oir in forming intra - retinal as well as extra - retinal neovascularization ( figure 9).14 the effects of neutralization of vegfr2 in the canine oir model was evaluated by implanting elvax slow - release polymer pellets ( elvax 40 ; aldrich chemical , milwaukee , wi ) with 300 g of anti - vegfr2 ( imclone systems , new york city , ny , usa ) or control non - immune immunoglobulin in the vitreous at p6 , 1 day after the removal of the animals from hyperoxia.14 the animals were sacrificed at p21 and vitreous as well as retinas were incubated for adpase activity .
anti - vegfr2 inhibited the formation of preretinal neovascularization , which remains attached to the vitreous body in dog ( figure 10).14 however , anti - vegfr2 also inhibited the revascularization of retina compared to control igg , resulting in a reduced retinal vasculature present only in central retina ( figure 10 ) .
analysis of the area of retinal vasculature demonstrated a significant reduction in retinal vasculature in anti - vegfr2-implanted eyes ( figure 11 ) .
similarly , the reduction in the area of neovascularization in vitreous was significant in anti - vegfr2 eyes compared to igg control eyes ; therefore , anti - vegfr2 at the doses used inhibits the formation of preretinal neovascularization as well as revascularization of inner retina .
the effect of vegf neutralization in canine oir model was evaluated using the vegf - trap ( aflibercept , regeneron , tarrytown , ny , usa ) .
the vegf - trap is a recombinant fusion protein invented by regeneron that has the binding sites for vegf - r1 and -r2 fused with the fragment , crystallizable ( fc ) portion of human igg1 .
a single 5 , 25 , or 250 g dose of vegf - trap in 50 l was injected into the vitreous at p7 .
the effects of these reagents were evaluated at p21 by incubating both the vitreous and the retina for adpase activity .
all doses of vegf - trap resulted in the complete prevention of preretinal neovascularization ( figure 12).16 the vegf - trap also resulted in smaller areas of retinal vasculature at 25 and 250 g doses ( figure 13 ) ; however , the 5 g trap eyes had normal areas of retinal vasculature ( figure 13 ) .
the area of retinal vasculature in 5 g dose eyes was comparable to control fc injected eyes , so inner retina could revascularize and reduce hypoxia and vegf production by retina .
unlike rodents , the superficial retinal vasculature of the dog develops by vasculogenesis and not angiogenesis .
vasculogenesis is the development of blood vessels by differentiation , aggregation , and assembly of vascular precursors or angioblasts ( figure 1 ) .
this process is occurring at birth in dogs and begins in humans at around 14 weeks gestation.46 the canine retina is only 60% vascularized at birth and angioblasts ( positive for adenosine diphosphatase [ adpase ] enzyme activity ) are present throughout avascular peripheral retina at this time.4,7 the initial assembly of the angioblasts results in cords and then lumen develop within the cords . in dogs and humans ,
astrocyte ( the inner retinal glia ) differentiation trails vascular development and guidance is provided by muller glia not astrocytes , unlike neonatal rodent retinas.57 the muller cells , which span the retina from internal to external limiting membrane , form glycosaminoglycan - rich extracellular spaces in which vasculogenesis occurs4 while also providing adenosine via the enzyme 5 nucleotidase to stimulate the vasculogenic process.7 vascular endothelial cell markers ( cd34 and von willebrand s factor ) are not expressed in angioblasts and are expressed only in endothelial cells after lumen formation and presumably the presence of serum within the lumens .
this exposure to hyperoxia arrests the development of the superficial retinal vasculature and causes the vaso - obliterative phase of oir ( figure 2 ) .
this results in 60% loss in vascular area and the vaso - obliteration is the greatest in the capillaries , whereas large blood vessels appear viable as determined by adpase activity ( figure 3).8 the vaso - obliteration occurs throughout the retina but islands of surviving endothelial cells can be found throughout the once - vascularized areas ( figure 3 ) .
the loss of vasculature in the presence of a differentiating neuroblastic layer ( neuronal progenitors ) after removal from hyperoxia results in extreme hypoxia , the initiating event in the vaso - proliferative stage in canine oir .
revascularization of retina occurs in a burst of disorganized angiogenesis that results in a very dense capillary network in the inner retina ( figure 4).9 the extracellular spaces created by muller cell processes are filled with proliferating astrocytes , and multiple layers of capillaries form the inner retina . at the periphery of the surviving retinal vasculature , glial proliferation occurs resulting in gliosis ; in humans , gliosis causes the formation of a ridge of tissue between vascularized and nonvascularized retina , but no anatomical ridge occurs in dogs.10 by postnatal day 15 ( p15 ) , tufts of neovascularization can be seen in vitreous with fundus and red free photography ( figure 5).9 vitreous , the gel in posterior chamber of the eye , normally has had regression of the fetal vasculature occur by this time and is becoming avascular .
fluorescein angiography demonstrates the leaky nature of these formations and the extreme tortuosity of arteries ( figure 5).11 in cross sections , the dense cellularity of these preretinal formations is apparent .
often adjacent tufts of neovascularization will anastomose with each other forming a vascular complex ( figure 6 ) .
eventually the complexes will anastomose forming a dense mat - like structure of new blood vessels , which expands to form an extensive preretinal vascular membrane ( figure 6).12 the membranes , when visualized with fundus photography and fluorescein angiography at p22 , appear at times to cover entire vascular arcade ( figure 7).11 the preretinal membranes persist at least until p45 ( figure 8) when they appear as tented membranes putting tractional force on the retinas .
the result is tractional retinal folds in retina at p45 ( figure 8) similar to those formed in stage iv human rop .
in all of the oir models , vegf plays a key role in vasculogenic and angiogenic processes in retina.1214 vegf expression is upregulated in retina during development because there is no retinal vasculature and neurons have become metabolically active , consuming the oxygen that is available . in the dog retina , vegf receptor-2 ( vegfr2 or kinase domain receptor [ kdr ] ) is present on angioblasts and endothelial cells during development.14 however , this receptor is greatly upregulated in vasoproliferative stage of oir in forming intra - retinal as well as extra - retinal neovascularization ( figure 9).14 the effects of neutralization of vegfr2 in the canine oir model was evaluated by implanting elvax slow - release polymer pellets ( elvax 40 ; aldrich chemical , milwaukee , wi ) with 300 g of anti - vegfr2 ( imclone systems , new york city , ny , usa ) or control non - immune immunoglobulin in the vitreous at p6 , 1 day after the removal of the animals from hyperoxia.14 the animals were sacrificed at p21 and vitreous as well as retinas were incubated for adpase activity .
anti - vegfr2 inhibited the formation of preretinal neovascularization , which remains attached to the vitreous body in dog ( figure 10).14 however , anti - vegfr2 also inhibited the revascularization of retina compared to control igg , resulting in a reduced retinal vasculature present only in central retina ( figure 10 ) .
analysis of the area of retinal vasculature demonstrated a significant reduction in retinal vasculature in anti - vegfr2-implanted eyes ( figure 11 ) .
similarly , the reduction in the area of neovascularization in vitreous was significant in anti - vegfr2 eyes compared to igg control eyes ; therefore , anti - vegfr2 at the doses used inhibits the formation of preretinal neovascularization as well as revascularization of inner retina .
the effect of vegf neutralization in canine oir model was evaluated using the vegf - trap ( aflibercept , regeneron , tarrytown , ny , usa ) .
the vegf - trap is a recombinant fusion protein invented by regeneron that has the binding sites for vegf - r1 and -r2 fused with the fragment , crystallizable ( fc ) portion of human igg1 .
a single 5 , 25 , or 250 g dose of vegf - trap in 50 l was injected into the vitreous at p7 .
the effects of these reagents were evaluated at p21 by incubating both the vitreous and the retina for adpase activity .
all doses of vegf - trap resulted in the complete prevention of preretinal neovascularization ( figure 12).16 the vegf - trap also resulted in smaller areas of retinal vasculature at 25 and 250 g doses ( figure 13 ) ; however , the 5 g trap eyes had normal areas of retinal vasculature ( figure 13 ) .
the area of retinal vasculature in 5 g dose eyes was comparable to control fc injected eyes , so inner retina could revascularize and reduce hypoxia and vegf production by retina .
there is profound global vaso - obliteration resulting in the loss of predominantly capillaries and a 50% reduction in vascular density .
the angiogenesis is so exuberant that large membranes can completely cover the retinal vascular arcades .
the model is excellent for evaluating antiangiogenic therapies , including targeting vegf or its receptor , provided that the reagents recognize dog proteins .
the newborn dog eye is comparable in size and its vitreous body is comparable in volume to the premature human eye , so preclinical dosing studies are appropriate in canine oir .
evaluation of reagents targeting vegfr2 or vegf in canine model of oir demonstrates a very important point : preretinal neovascularization must be inhibited without inhibiting revascularization of retina .
therefore , dosing of the reagents is critical and adult human doses are not appropriate for a premature human eye.17 avery predicted that 6.5 g would seem an appropriate dose for a human premature infant eye , which is almost comparable to our 5 ug dose in the canine oir model , because the premature human eye is slightly larger than neonatal dog model .
the goal is to determine a titer that inhibits preretinal neovascularization but permits revascularization of inner retina . | development of the dog superficial retinal vasculature is similar to the mechanism of human retinal vasculature development ; they both develop by vasculogenesis , differentiation , and assembly of vascular precursors called angioblasts .
canine oxygen - induced retinopathy ( oir ) was first developed by arnall patz in an effort to experimentally determine the effects of hyperoxia on the development of the retinal vasculature .
the canine oir model has many characteristics in common with human retinopathy of prematurity .
exposure of 1-day - old dogs to hyperoxia for 4 days causes a vaso - obliteration throughout the retina .
vasoproliferation , after the animals have returned to room air , is robust .
the initial small preretinal neovascular formations anastomose to form large preretinal membranes that eventually cause tractional retinal folds .
the end - stage pathology of the canine model is similar to stage iv human retinopathy of prematurity .
therefore , canine oir is an excellent forum to evaluate the response to drugs targeting vegf and its receptors .
evaluation of an antibody to vegf - r2 and the vegf - trap demonstrated that doses should be titered down so that preretinal neovascularization is inhibited but retinal revascularization is able to proceed , vascularizing peripheral retina and preventing it from being a source of vegf . |
endodontic management of necrotic immature permanent teeth is often difficult , as such teeth lack an apical stop and are also weak and fragile . traditionally , the treatment of choice in these teeth has been apexification using calcium hydroxide or mineral trioxide aggregate ( mta ) .
a barrier is induced or created in the apical region against which obturation is performed ; but these roots still remain short and are susceptible to fracture . hence , currently there is a shift in focus towards a more biological treatment called revascularization that allows for continued root development .
numerous case reports and case series on successful revascularization of necrotic immature teeth have been recently reported [ 58 ] .
three critical components identified to contribute to the successful outcome of this procedure are the presence of stem cells , signalling molecules ( growth factors ) and a 3-dimensional physical scaffold .
revascularization procedures involve disinfecting the root canal by using sodium hypochlorite ( naocl ) , and placement of an intracanal medicament .
after 23 weeks , an intentional over instrumentation is done to induce bleeding into the root canal .
once a clot is formed inside the root canal , a cervical barrier with mineral trioxide aggregate is placed .
root canal irrigants that are used for disinfection in immature teeth should not cause any damage to the stem cells .
. stated that naocl used for disinfecting the immature root canals should be used very carefully , as any extrusion of this irrigant can result in damage to these stem cells .
immature teeth have a large apical opening and thin divergent or parallel dentinal walls and hence with conventional needle irrigation there is a very high possibility of extrusion . the endovac system ( discus dental , culver city , ca , usa ) was introduced in 2007 and was designed to safely deliver irrigants to the apical terminus of the root canals . the device consisted of a delivery / evacuation tip that is attached to a syringe containing the irrigant and high speed suction of the dental chair . using a combination of macro or micro cannulae attached to the suction device
, the irrigant is introduced into the pulp chamber and is then pulled by negative pressure down the canal into the tip of the cannula and then removed through a coronally positioned suction hose [ 11 , 12 ] .
apical negative pressure system has proven to be the safest when compared to other irrigation systems , in terms of extrusion in teeth with mature apices .
evaluated the intracanal aspiration technique for irrigation and found it to be superior for smear layer removal , when compared with conventional irrigation .
they also reported that this intracanal aspiration technique resulted in limited extrusion of irrigants beyond the apical foramen in canine teeth where the apex of the root was resected . to date , there are no studies done on extrusion of irrigants in immature teeth using endovac .
hence , the aim of this study was to compare the apical extrusion of naocl in immature roots delivered using endovac and needle irrigation .
in addition , this study quantified the volume of irrigant extruded in immature permanent teeth .
the study design was analyzed and approved by the institutional review board of meenakshi ammal dental college , meenakshi university , tamil nadu , india .
collection , storage , sterilization , and handling of extracted teeth followed occupational safety and health administration guidelines and regulations .
each tooth was radiographed to confirm the presence of a single canal and all the teeth were decoronated and the root length was standardized to 17 mm .
endodontic access was achieved and the canals were negotiated with an iso size # 15 stainless steel k file ( mani inc , toshigi - ken , japan ) until the tip just appeared through the apical foramen .
the teeth were then instrumented under constant sterile saline irrigation using peeso reamer ( mani inc , toshigi - ken , japan ) from size 14 to create an apical opening of 1.3 mm in diameter and simulate an open / immature apex .
suggested the organotypic model for creating immature apex wherein lsx instrument to the size of 130 was used .
since a peeso reamer size 4 corresponds to size 130 , it was used to create an immature apex .
the samples were then divided randomly into four groups of 20 teeth each based on the irrigant delivery system .
the recommended protocol for using apical negative pressure irrigation system includes 2 main phases namely , macroirrigation and microirrigation . since this study aimed to evaluate the apical extrusion of irrigants in open apices , the manufacturer s recommended protocol was modified .
irrigation with endovac ( discus dental , culver city , ca , usa ) system was started by placing the microcannula at 16 mm .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds through the master delivery / evacuation tip that was placed above the access opening .
irrigation with endovac ( discus dental , culver city , ca , usa ) system was started by placing macrocannula at 16 mm .. then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds through the master delivery / evacuation tip that was placed above the access opening .
irrigation with navitip ( ultradent products inc.india ) 29 gauge needle was done by placing the needle 2 mm short of the working length .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds .
new delhi , india ) was done by placing the needle 2 mm short of the working length .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds . experimental model used in this study
was taken and a hole was created with a heated instrument in the center of the rubber stopper .
the tooth was then inserted under pressure into the rubber stopper which was fixed to the cementoenamel junction using cynaoacrylate glue .
another glass vial ( smaller in size than the previous vial ) that fits tightly into the suspended apical portion of the root was used as the collecting container .
the whole assembly of rubber stopper with the collecting container was inserted into the main vial . to equalize the pressure ,
the irrigation protocol was performed in each group and the irrigant extruded periapically was collected .
the root canal diameter was very large when compared to the needle diameter ( this may be the reason why the entire irrigant fluid escaped without wetting the canal ) . presence or absence of extrusion of irrigant in each group was determined .
in addition to this , the volume of irrigant extruded in each group was calculated . for the extrusion of irrigants ,
the mean values in groups i and ii were statistically analyzed using independent sample t - test . in the present study ,
the statistical analysis was conducted using spss 17 software ( spss inc , chicago , ill .
the teeth were then instrumented under constant sterile saline irrigation using peeso reamer ( mani inc , toshigi - ken , japan ) from size 14 to create an apical opening of 1.3 mm in diameter and simulate an open / immature apex .
trevino et al . suggested the organotypic model for creating immature apex wherein lsx instrument to the size of 130 was used .
since a peeso reamer size 4 corresponds to size 130 , it was used to create an immature apex .
the samples were then divided randomly into four groups of 20 teeth each based on the irrigant delivery system .
the recommended protocol for using apical negative pressure irrigation system includes 2 main phases namely , macroirrigation and microirrigation . since this study aimed to evaluate the apical extrusion of irrigants in open apices , the manufacturer s recommended protocol was modified .
irrigation with endovac ( discus dental , culver city , ca , usa ) system was started by placing the microcannula at 16 mm .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds through the master delivery / evacuation tip that was placed above the access opening .
irrigation with endovac ( discus dental , culver city , ca , usa ) system was started by placing macrocannula at 16 mm .. then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds through the master delivery / evacuation tip that was placed above the access opening .
irrigation with navitip ( ultradent products inc.india ) 29 gauge needle was done by placing the needle 2 mm short of the working length .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds .
new delhi , india ) was done by placing the needle 2 mm short of the working length .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds . experimental model used in this study
a vial with a rubber stopper was taken and a hole was created with a heated instrument in the center of the rubber stopper .
the tooth was then inserted under pressure into the rubber stopper which was fixed to the cementoenamel junction using cynaoacrylate glue . another glass vial ( smaller in size than the previous vial ) that fits tightly into
the whole assembly of rubber stopper with the collecting container was inserted into the main vial . to equalize the pressure ,
the irrigation protocol was performed in each group and the irrigant extruded periapically was collected .
the root canal diameter was very large when compared to the needle diameter ( this may be the reason why the entire irrigant fluid escaped without wetting the canal ) .
irrigation with endovac ( discus dental , culver city , ca , usa ) system was started by placing the microcannula at 16 mm .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds through the master delivery / evacuation tip that was placed above the access opening .
irrigation with endovac ( discus dental , culver city , ca , usa ) system was started by placing macrocannula at 16 mm .. then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds through the master delivery / evacuation tip that was placed above the access opening .
irrigation with navitip ( ultradent products inc.india ) 29 gauge needle was done by placing the needle 2 mm short of the working length .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds .
new delhi , india ) was done by placing the needle 2 mm short of the working length .
then , 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds .
experimental model used in this study was based on the myers and montegomery model . a vial with a rubber stopper
was taken and a hole was created with a heated instrument in the center of the rubber stopper .
the tooth was then inserted under pressure into the rubber stopper which was fixed to the cementoenamel junction using cynaoacrylate glue .
another glass vial ( smaller in size than the previous vial ) that fits tightly into the suspended apical portion of the root was used as the collecting container .
the whole assembly of rubber stopper with the collecting container was inserted into the main vial . to equalize the pressure ,
the irrigation protocol was performed in each group and the irrigant extruded periapically was collected .
the root canal diameter was very large when compared to the needle diameter ( this may be the reason why the entire irrigant fluid escaped without wetting the canal ) .
in addition to this , the volume of irrigant extruded in each group was calculated . for the extrusion of irrigants ,
the mean values in groups i and ii were statistically analyzed using independent sample t - test . in the present study ,
the statistical analysis was conducted using spss 17 software ( spss inc , chicago , ill .
all the samples in group i , group iii and group iv showed extrusion ( 100% ) while only 8 samples in group ii showed extrusion ( 40% ) .
there was a statistically significant difference ( p < 0.001 ) between group ii and other groups ( table 1 ) . regarding the volume of irrigant extrusion , group iii and group iv extruded the entire volume of irrigants ( 9ml ) and were considered the worst .
group ii extruded significantly less volume of irrigant when compared to group i. there was a statistically significant difference between groups i and ii ( p < 0.001 , table 2 ) .
various stem cells that may play a role in revascularization are dental pulp stem cells ( dspscs ) , stem cells from pdl or bone and stem cells from the apical papilla ( scap ) [ 16 , 17 ] . of all these stem cells ,
scap are thought to play a major role as they are in close proximity to the apical root canal .
it is speculated that during over instrumentation these scap get seeded into the root canal .
these scap allow revascularization to occur in the presence of a blood clot which acts as a scaffold and also provides growth factors [ 19 , 20 ] .
disinfection of the root canal in immature teeth during the revascularization procedure is mainly carried out by the use of irrigants and by placement of intracanal medicaments .
naocl and triple antibiotic paste are the most commonly used irrigants and medicaments by most authors .
mechanical instrumentation is usually avoided in these teeth , as it might further weaken the thin dentinal walls and also result in the formation of smear layer .
any extrusion of naocl during irrigation is likely to damage these cells ; which are vital for revascularization .
they further stated that it may be safe to use endovac in immature teeth to prevent extrusion .
to date , there are no studies done on extrusion of irrigants in immature teeth using endovac .
hence , this study was done to compare the apical extrusion of naocl while using endovac and needle irrigation systems .
in addition , this study quantified the volume of irrigant extruded in immature permanent teeth .
the model used in this study was based on the myers and montegomery model used for testing extrusion in case of mature roots .
suggested the organotypic model for creating an immature apex wherein lsx instrument to the size of 130 was used . in this study , we followed a modified organotypic model protocol with peeso reamers ( size 14 ) , which was used to prepare a parallel - walled canal space with constant 1.3 mm diameter without destroying the structural integrity of the root .
the results of the present study revealed that all four groups showed extrusion of irrigants .
extrusion was seen in all samples ( 100% ) in groups i , iii and iv ; whereas , in group ii ( endovac macrocannula ) extrusion was seen in only 8 out of 20 samples ( 40% ) .
our results were similar to those of an earlier study by ross paton et al , who reported less extrusion of irrigants with endovac in teeth with mature apices , where extrusion was seen in 2 out of 24 samples ( 8.33% ) . in terms of volume of extrusion , group ii ( endovac macrocannula )
group i extruded less volume of irrigants when compared to groups iii and iv . in groups
iii ( closed ended ) and iv ( open ended ) , samples leaked the entire 9 ml of irrigants used , in spite of the needle being placed 2 mm short of the working length .
they reported that the open ended needle caused more extrusion than closed ended needle and the extrusion of irrigants decreased as the needles were moved away from the working length . in our study both open ended and closed ended needles caused extrusion of the entire volume of irrigants used .
the mean volume of extrusion was 7.53 and 0.23 ml for microcannula and macrocannula groups , respectively .
endovac macrocannula extruded only 0.23 of 9 ml delivered but it is still not clear whether this small amount will cause any significant damage to the stem cells and needs further investigation . both endovac microcannula and macrocannula are connected to the chair - side suction apparatus .
less extruded volume in macrocannula may be due to the large diameter ( 0.55 mm ) of the opening of the macrocannula and the presence of this opening at the tip of the cannula in contrast to the microcannula which is of smaller diameter ( 0.10 mm ) and has only side vents .
we used an open ended model to test the extrusion as the worst case scenario .
however , in clinical situations some resistance to extrusion will be provided by the periapical tissue and bone .
recently , it has been established that even 1 microgram of triple antibiotic paste can be toxic to stem cells ; hence , to avoid the extrusion of sodium hypochlorite it is better to use the endovac macrocannula for irrigation in an immature apex .
within the limitations of this study , endovac macrocannula ( apical negative pressure technique ) resulted in the least extrusion of irrigant beyond the apex in immature teeth when compared to endovac microcannula and conventional needle irrigation . | objective : immature teeth have a large apical opening and thin divergent or parallel dentinal walls ; hence , with conventional needle irrigation there is a very high possibility of extrusion .
this study was done to compare the apical extrusion of naocl in an immature root delivered using endovac and needle irrigation.materials and methods : eighty freshly extracted maxillary central incisors were decoronated followed by access cavity preparation .
modified organotypic protocol was performed to create an open apex ; then , the samples were divided into four groups ( n=20 ) : endovac microcannula ( group i ) , endovac macrocannula ( group ii ) , navitip irrigation needle ( group iii ) and max - i - probe irrigating needle ( group iv ) ; 9.0 ml of 3% sodium hypochlorite was delivered slowly over a period of 60 seconds .
extruded irrigants were collected in a vial and analysed statistically.results:group i , group iii and group iv showed 100% extrusion ( 20/20 ) but group ii showed only 40% extrusion ( 8/20 ) .
the difference in this respect between group ii and other groups was statistically significant ( p<0.001 ) .
with regards to the volume of extrusion , group ii had only 0.23 ml of extruded irrigant .
group i extruded 7.53ml of the irrigant .
group iii and group iv extruded the entire volume of irrigant delivered.conclusion:endovac macrocannula resulted in the least extrusion of irrigant in immature teeth when compared to endovac microcannula and conventional needle irrigation . |
stroke is the second highest cause of death worldwide and the third highest cause of disability - adjusted life - years ( dalys ) ( 1 ) and its regional burden is escalating . a meta - analysis and review of 56 population - based studies published over four decades ( 1970 to 2008 ) showed that in ten low - income and middle - income countries ( lmics ) the age - adjusted incidence of stroke more than doubled when comparing the years between 1970 to 1979 and 2000 to 2008 , while the incidence in 18 high - income countries almost halved during the same period ( 2 ) .
in fact , the incidence of stroke in lmics exceeded that in high - income countries by 20% for the first time in 2000 - 08 .
moreover , decreasing stroke fatalities have led to a global trend of increasing stroke survivor rates and dalys lost due to stroke , with most of the burden now in lmics .
although this study might be subject to selection or sampling bias ( 1 ) , it clearly shows a divergent pattern in the incidence of stroke when comparing countries based on income stratification .
one of the major findings in a previously published systematic analysis , the global burden of disease study 2010 ( 3 ) is that most of the burden of stroke , independent from whether it is ischemic or hemorrhagic , is in low - income and middle - income countries , with the average age of incidence and fatality being 6 yr younger than in high - income countries ( hics ) leading to greater dalys lost . a focused analysis of first - ever ischemic and hemorrhagic strokes in the same database ( 4 ) specifically demonstrated that 1 ) most of the burden of ischemic and hemorrhagic stroke is in low - income and middle - income countries , which bear 63% of the incident ischemic strokes and 80% of hemorrhagic strokes , 57% of deaths due to ischemic stroke and 84% due to hemorrhagic stroke , and 64% of dalys lost due to ischemic stroke and 86% due to hemorrhagic stroke ( 1 ) .
2 ) while all other age - standardized rates have decreased over the past two decades , the incidence of hemorrhagic stroke in lowincome and middle - income countries is the only one rate that has continued to increase [ 22% increase , 95% confidence interval ( ci ) 5 - 30 ] , particularly in people younger than 75 yr ( 19% increase , 95% ci 5 - 30 ) , over the same period ( 4 ) . when compared to high - income countries , low- and middle - income ones in fact had a 40% higher incidence , 77% higher mortality , and 65% higher daly rates of hemorrhagic stroke ( 4 ) .
these data clearly indicate that priorities in the quest to reduce the global and regional burden of stroke need to focus on the prevention of hemorrhagic stroke particularly in lmics and in people younger than 75 yr ( 4 ) .
given that most hemorrhagic strokes can be attributed to hypertension and an unhealthy life - style ( e.g. , physical inactivity , obesity , unhealthy diet , excessive alcohol intake , and smoking ) ( 56 ) , population - based mass strategies for improving education and the environment to reduce the consumption of salt , calories , alcohol , and tobacco , along with strategies for identifying those at high risk of stroke are urgently needed in lmics
. a particular emphasis should be put on the reduction of blood pressure in women in these countries , since the global burden of blood pressure - related diseases is escalating faster among women than men ( 7 ) . in recent years
, the age - adjusted mortality rate among women has actually increased , likely due to the underestimation of cardiovascular risks and suboptimal therapy ( 7 ) . a peculiar fact regarding the distribution of the global burden of vascular disorders
is that the proportions of ischemic heart disease and stroke within the category of cardiovascular disease vary significantly across countries ( 8) .
while most european and arab counties show an extreme predominance of ischemic cardiac diseases over stroke , people in asian countries exhibit the exact opposite pattern that is , an extremely high incidence and burden of stroke relative to a rather low incidence and burden of ischemic heart disease .
the concern of the spread of diseases across national boundaries and the acute and prominent deaths caused by infectious diseases are more publically noticeable and easily evoke alarm .
the relatively simple underlying causal association exhibited by infectious diseases perhaps makes it easier for donors to contribute when deciding to give assistance .
also the relatively short - term and measurable outcomes expected once the assistance is implemented also contribute to the relatively larger attraction to infectious diseases over non - communicable diseases ( ncds ) .
recently the increasing awareness of the importance of ncds as major health problems facing lmics is a belated but certainly welcomed improvement in global health . while ncds including stroke pose a serious burden globally , the impact of the burden is particularly worse in lmics for the following reasons : first , lmics suffer from double burdens in that ncds are rising rapidly , while infectious diseases are still rampant in vulnerable populations , posing significant threats to already overburdened medical services and infrastructure that are being poorly managed due to a lack of expertise , skills , and resources in the public health sectors in these countries .
second , lmics ' usual inequality in economic development introduces health problems related to over- and under - nutrition or malnutrition concurrently .
some in the population become obese from rapidly westernizing dietary patterns , while others in the same population are continuously threatened by malnutrition and even starvation .
third , the poor medical care delivery system makes the outcome of ncds worse in lmics .
access to medical information and resources for managing risk factors is extremely limited in these countries , such that risk factors that would be easily controlled in high - income countries are left untreated . when complications do occur from ncds ,
factors determining the incidence , severity and outcome of first - ever strokes include uncontrolled high blood pressure ( 5 ) , inadequate use of anti - platelet treatment in patients at risk for stroke ( 9 ) , and low cholesterol ( 10 ) .
these factors certainly are more prevalent in lmics than in high - income countries because of low public awareness regarding these issues , weak medical surveillance , and the poor nutritional status of people in lmics . for these reasons , compared to hics , stroke in lmics is poorly managed in terms of both its prevention , including the control of risk factors , and medical care when stroke events do occur .
stroke is a prototypical example of an ncd against which dual - track strategies are required .
most ncds have risk factors related to lifestyle factors , such as dietary habits , the consumption of hazardous items like tobacco and alcohol , and a lack of physical activity .
therefore , to intervene and disrupt the causal link between risk factors and ncds including stroke , changes in lifestyle need to occur .
the means to induce lifestyle changes , such as education , supervision of behavior , and improvement of social and cultural environments , are all long - term strategies , which require weeks to decades of investment . on the other hand , ncds , stroke in particular ,
these events develop over a very short period of time , within seconds or minutes , and worsen if not responded to properly in a timely manner .
the occurrence of each crisis is stochastic in nature and unpredictable in time and place , requiring a wide deployment of human and physical resources for a proper response in case the events occur .
furthermore , the seriousness of these events is also unpredictable at the onset , and urgent interventions are critical to curtail the probability of progressive worsening and to improve the chances of a better ultimate outcome .
according to the american stroke association , the only fda approved treatment for ischemic strokes is tissue plasminogen activator ( tpa ) which acts by dissolving the clot obstructing blood flow to part of the brain .
if administered within 3 hr ( up to 4.5 hr in eligible patients ) , tpa may improve the chances of recovering from a stroke .
however , a significant number of stroke victims do not arrive at the hospital in time for tpa treatment ; this is why it is imperative to identify symptoms and signs of stroke immediately .
this is also why the neurologist is now an essential member of the emergency care team in developed countries , whereas this benefit of early detection and treatment for stroke is scarcely attainable in lmics .
the dual nature of stroke and ncd problems is difficult to manage , especially in lmics where setting priorities for resource distribution tends to neglect long - term planning against stroke , and the lack of fundamental infrastructure hinders the transportation of patients to adequate medical service facilities , let alone the provision of urgently needed thrombolytic therapy .
given the dual - nature of stroke , the most beneficial strategies for development assistance in lmics should be focused at the level of the community , as opposed to individual patients or hospitals .
advantages of the community - based approach over hospital - based or individual - directed ones are many and not limited to the following : first , planning and management are more likely to be sustained over longer periods of time at the community level if based on consensus building and democratic decision - making .
stake - holders would be more easily identifiable , and their responsibility and participation in the making and execution of health - related policies would be more prominent and inducible at the level of the local community than , for example , for individual patients or at the national level .
this is particularly important for stroke detection , because stroke victims often need assistance from neighbors or passers - by in the local community , and widely spreading the public awareness of " stroke attacks " takes time and effort on a long - term basis .
second , lifestyle changes require a comprehensive approach that involves the improvement in neighborhoods as well as the behavioral correction of individuals .
this point has been clearly illustrated by a study on the effects of neighborhood allocation on extreme obesity and diabetes : the opportunity to move from a neighborhood with a high level of poverty to one with a lower level of poverty was associated with modest but potentially important reductions in the prevalence of extreme obesity and diabetes ( 11 ) .
the mechanisms underlying these associations need further investigation , given their potential to guide the design of community - level interventions intended to improve health .
another example in this regard is the finding that lower perceived neighborhood crime , indicative of greater neighborhood walkability , was associated with a lower risk of symptoms of depression ( 12 ) , indicating that community - level approaches may be beneficial for other ncds as well .
third , the limited resources in lmics will be best utilized and mobilized when deployed at the community level .
information on health , sanitation , and the environment needs to be provided for and made continuously available to the whole community .
comprehensive , community based primary health care programs , such as the family health program in brazil , that act by promoting cardiovascular disease prevention , care , and follow - up , were negatively associated with mortality rates from cerebrovascular and heart diseases ( ambulatory care - sensitive conditions ) in both unadjusted models and models adjusted for demographic , social , and economic confounders ( 13 ) .
moreover , the program coverage increased the number of health education activities , domiciliary visits , and medical consultations and reduced hospitalization rates for cerebrovascular and heart disease , demonstrating the propensity of community - based activities to reach beyond the confines of their originally - targeted diseases and crossing over to beneficially impact many other health - related aspects .
future directions in dah need to achieve paradigm shifts in theory and practice to tackle the ever - increasing burden of ncds in developing countries .
a couple of suggestions are worth drawing from the above review on the current burden and potential strategies for stroke in lmics .
first , development assistance must recognize the dual - nature of the problems related to stroke and non - communicable diseases .
plans against these problems should include specific strategies for building both primary health and emergency care systems .
primary health strategies are needed to reduce the underlying causes of ncds by changing risky life - style behaviors of individuals . at the same time , build - up strategies should be put in place to strengthen emergency medical care and transport to properly respond to unpredictable , critical events , such as brain and heart attacks .
the two branches of medical services should be supplemented and coordinated by an integrated system of information delivery and emergency management . also modern science and technology
must be brought into the scene for event prediction and the rational distribution of limited resources according to such predictions .
second , the current and most typical practice of dah in providing treatment to individual stroke patients at the level of clinics and hospitals should be changed to an approach focusing these efforts at the community level .
this will involve paying closer attention to the social , cultural , and environmental determinants of health and disease in lmics .
assistance should be planned and coordinated in a multi - sectorial fashion , consisting of activities in economic development , education and training of human resources , and environmental protection and preservation , as well as in the health sector .
the main aim of this effort should be the collective empowerment of the community to take responsibility into their own hands and continue to work for the betterment of their lives for the long run . | while communicable diseases still pose a serious health threat in developing countries , previously neglected health issues caused by non - communicable diseases such as stroke are rapidly becoming a major burden to these countries . in this review
we will discuss the features and current status of stroke in low- and middle - income countries ( lmics ) .
overall the global burden of hemorrhagic stroke is larger than ischemic stroke , with a disproportionately greater burden , measured in incidence and disability - adjusted life - years , regionally localized in lmics .
patients in poorer countries suffer due to insufficient primary care needed to control risk factors such as hypertension , and inadequate emergency care systems through which sudden events should be managed . in light of these situations , we emphasize two strategic points for development assistance .
first , assistance should be provided for bolstering , integrating , and coordinating both the primary health and emergency care systems , in order to prevent stroke and strengthen stroke management , respectively .
second , the assistance needs to focus on programs at the community level , to reduce life - style risks of stroke in a more sustainable manner , and to improve stroke outcomes more effectively . |
hepatocellular carcinoma ( hcc ) is primarily an ordinary cause of cancer - related death worldwide , especially in china ( 1 - 6 ) .
the incidence of hcc keeps the highest in eastern asia and africa , while its frequency has been increased rapidly in western countries and japan as well ( 7 , 8) .
transcatheter arterial chemoembolization ( tace ) is one of the most common therapeutic methods for large or multinodular hccs , which can not undergo other treatments such as resection or radiofrequency ablation ( 9 ) .
after tace treatment , follow - up imaging modalities such as computed tomography ( ct ) and magnetic resonance imaging ( mri ) are performed to assess therapeutic efficacy such as lipiodol deposition and residual cancer . however , there are some limitations in individuals .
for example , a hypovascular residual cancer can be more difficult to assess on ct , because accumulation of lipiodol in tumors can mask its enhancement .
in contrast , mri is superior to ct in showing residual tumor ( 10 - 13 ) , but can not demonstrate lipiodol deposition .
therefore , there is a need for a new option able to monitor both lipiodol deposition and residual cancer for hcc after tace .
recently , a new ct scanning mode depended on the rapid switching of high and low tube voltages on neighboring views during a single rotation has been generated on high - definition discovery ct750 hd scanner .
this spectral ct imaging model is called gemstone spectral imaging ( gsi ) mode , which provides correct registration of data sets for conduction of accurate material decomposition images ( e.g. water- and iodine - based material decomposition images ) for quantitative density measurement and monochromatic images at energy levels ranging from 40 to 140 kev for optimized angiographic imaging .
spectral ct has potential to make hyperenhancing lesions brighter on the attenuation scale by taking advantage of the markedly increased density of iodine at photon energy levels just above the outmost electron binding energy .
the aim of this study was to investigate the usefulness of spectral ct imaging in assessment of lipiodol deposition and residual cancer for hcc after tace .
the ethics committee at our institution approved this prospective study and all patients provided written informed consent . from april to november 2014 , 10 hcc male patients ( mean age of 61 years , ranged 50 to 73 years ) after tace underwent both mri and multiple - phase ct scanning .
the interval between tace and mri imaging examination was 2 - 3 days , and the interval between mri and ct imaging examination was 7 - 14 days .
three - phase contrast material - enhanced mri examinations were performed using the discovery mri750 3 t scanner ( general electric healthcare , milwaukee , usa ) with a peak gradient amplitude of 45 mt / m and maximal gradient slope of 200 t / ms .
the conventional mri protocol was adopted in this experiment containing transverse respiratory - navigated t2-weighted fat - suppressed turbo spin echo sequence [ repetition time ( tr)/echo time ( te ) = 3500/84 ms ; section thickness , 5 mm ; intersection gap , 1 mm ; field of view optimized to patients body habitus , 285 214 - 308 380 mm ; matrix , 168 320 ] and transverse t1-weighted in - phase and out - phase gradient echo [ tr / te = 6.8/2.35 ( in - phase ) , 4.75 ( out - phase ) ms ; section thickness , 5 mm ; intersection gap , 1 mm ; field of view optimized to patients body habitus , 285 214 - 308 380 mm ; matrix , 180 320 ] .
dynamic imaging was performed once before and three times after intravenous administration of gadopentetate dimeglumine ( magnevist ; bayer healthcare , germany ) with a transverse breath - hold t1-weighted three - dimensional volumetric interpolated body examination sequence ( tr / te = 5.0/2.3 ms ; section thickness , 2 mm ; no intersection gap ; field of view optimized to patients body habitus , 285 214 - 308 380 mm ; matrix , 270 360 ) .
gadopentetate dimeglumine was administered at a dose of 0.1 mmol / kg and a rate of 2 ml / s followed by a 20 ml saline flush by a power injector ( spectris ; medrad , pittsburgh , pa , usa ) .
the acquisitions were performed at 30 s , 60 s and 180 s after contrast administration during the hepatic arterial phase ( ap ) , portal venous phase ( pp ) and delayed phase , respectively .
two - phase contrast material - enhanced spectral ct examinations were used by the discovery ct750 hd scanner ( general electric healthcare , wisconsin , usa ) .
after scout ct scanning , patients received nonionic contrast materials ( ioversol , optiray 350 ; tyco healthcare , montreal , quebec , canada ) with antecubital venous access at a rate of 3 - 4 ml / s .
a total of 70 - 110 ml ( 1.5 ml per kilogram of body weight ) was injected during phases of ap and pp .
ap scanning automatically began at 30 seconds after the trigger attenuation threshold [ 100 hounsfield unit ( hu ) ] was reached at the level of supraceliac abdominal aorta ( 10 ) . pp scanning began with a delay of 30 seconds after ap scanning .
ap and pp scanning were performed in the spectral imaging mode with fast tube voltage switching between 80 and 140 kev on adjacent views during a single rotation .
other scanning parameters were as follows ; collimation thickness of 0.625 mm , tube current of 600 ma , rotation speed of 0.6 second , helical pitch of 0.983 and ct dose index volume of 21.8 mgy ( comparable to 21.5 mgy dose administered for conventional contrast - enhanced liver scanning in a normal - size patient with body mass index within normal range at our institution ) .
ct images were reconstructed by projection - based material - decomposition software and a standard reconstruction kernel .
the adaptive statistical iterative reconstruction algorithm was applied to suppress image noise on decomposition images .
three types of images were reconstructed from the single spectral ct acquisition for analysis : conventional polychromatic images obtained at 140 kev , iodine - based material decomposition images and monochromatic images obtained at energies ranging from 40 to 140 kev .
mri imaging studies were evaluated in consensus by two radiologists ( each with more than 10 years experience in abdominal imaging ) on a picture archiving and communication system ( pacs ) ( impax 6.4 , agfa , mortsel , belgium ) .
the gold standard of a residual cancer was defined as a hypervascular nodule seen on gadoxetic acid - enhanced arterial phase mri images with a washout pattern considered a residual hcc ( 14 ) .
washout , a unique feature of hcc , was described as a change from high intense relative to the intense of the liver during the ap to isointense or hypointense relative to that of the liver during the pp .
all the measurements of spectral ct were performed on an advanced workstation ( aw4.4 ; ge healthcare , waukesha , wi , usa ) with the gsi viewer .
circular or elliptical regions of interest ( rois ) were drawn to encompass as much of the hyperenhancing portion of the lesion as possible ( mean pixel number 100 , range 20 - 190 ) from three contiguous slices .
mean ct data for the adjacent hepatic parenchyma as the background regions was obtained by manually placing circular rois in the hepatic parenchyma ( mean pixel number of 200 , range 100 - 280 )
. areas of focal change in hepatic parenchymal attenuation , large vessels and prominent artefacts were avoided carefully . to ensure consistency ,
all measurements were performed three times at different image levels and average values were calculated . for all measurements , the size , shape and position of the rois
were kept consistent between the two phases by applying the copy - and - paste function .
the spectral ct imaging studies were assessed by other two radiologists , each of them with more than eight years experiences in abdominal imaging .
the gsi viewer software package automatically calculated the ct values , iodine ( water ) , water ( iodine ) concentration for the lesions and normal hepatic parenchyma .
two parameters were derived from the ct values measurements : 1 ) contrast - to - noise ratio ( cnr ) at different energy levels ( 40 - 140 kev , interval 10 kev ) , calculated as cnr = ( ct lesion - ct liver)/sd noise , where ct lesion and ct liver are the ct values in the lesions and in the normal hepatic parenchyma and sd noise is the standard deviation for ct values of the normal parenchyma as background ; 2 ) the lesion - to - normal parenchyma ratio ( lnr ) , calculated as lnr = ct lesion / ct liver , where ct lesion and ct liver are the ct values in the lesions and in the normal hepatic parenchyma .
spectral ct images including conventional polychromatic images , monochromatic images and iodine - based material decomposition images were reviewed with gsi viewer in consensus at a workstation .
the readers were blinded to mri diagnosis of lesion , patient information and results of correlative imaging examinations .
they recorded the following lesion features : number , density , presence of feeding vessels and enhancement pattern . to detect ability of each set of images ,
the true number of lesions in each image set was evaluated by comparing them with standard - of - reference findings .
the relative density of the lesion with respect to the hepatic parenchyma was recorded as one of three grades of hypodensity , isodensity and hyperdensity .
the changes in enhancement degree or pattern between the two phases were characterized as expansion , washout or none .
finally , readers in consensus characterized each lesion as a residual hcc based on imaging findings .
the typical enhancement pattern for residual hcc consisted of a rapid enhancement in the ap with a relatively quick washout in the pp , which was called quick in and quick out .
the sensitivity and specificity of residual hcc on the individual phase were evaluated compared to mri consequences .
receiver operating characteristic ( roc ) curves were generated to help establish the threshold values of lnr required for significant differentiation of hcc .
the null hypothesis test was that the area under the roc curve was 0.5 ; the alternative was that this area was greater than 0.5 .
the ethics committee at our institution approved this prospective study and all patients provided written informed consent . from april to november 2014 , 10 hcc male patients ( mean age of 61 years , ranged 50 to 73 years ) after tace underwent both mri and multiple - phase ct scanning .
the interval between tace and mri imaging examination was 2 - 3 days , and the interval between mri and ct imaging examination was 7 - 14 days .
three - phase contrast material - enhanced mri examinations were performed using the discovery mri750 3 t scanner ( general electric healthcare , milwaukee , usa ) with a peak gradient amplitude of 45 mt / m and maximal gradient slope of 200 t / ms .
the conventional mri protocol was adopted in this experiment containing transverse respiratory - navigated t2-weighted fat - suppressed turbo spin echo sequence [ repetition time ( tr)/echo time ( te ) = 3500/84 ms ; section thickness , 5 mm ; intersection gap , 1 mm ; field of view optimized to patients body habitus , 285 214 - 308 380 mm ; matrix , 168 320 ] and transverse t1-weighted in - phase and out - phase gradient echo [ tr / te = 6.8/2.35 ( in - phase ) , 4.75 ( out - phase ) ms ; section thickness , 5 mm ; intersection gap , 1 mm ; field of view optimized to patients body habitus , 285 214 - 308 380 mm ; matrix , 180 320 ] .
dynamic imaging was performed once before and three times after intravenous administration of gadopentetate dimeglumine ( magnevist ; bayer healthcare , germany ) with a transverse breath - hold t1-weighted three - dimensional volumetric interpolated body examination sequence ( tr / te = 5.0/2.3 ms ; section thickness , 2 mm ; no intersection gap ; field of view optimized to patients body habitus , 285 214 - 308 380 mm ; matrix , 270 360 ) .
gadopentetate dimeglumine was administered at a dose of 0.1 mmol / kg and a rate of 2 ml / s followed by a 20 ml saline flush by a power injector ( spectris ; medrad , pittsburgh , pa , usa ) .
the acquisitions were performed at 30 s , 60 s and 180 s after contrast administration during the hepatic arterial phase ( ap ) , portal venous phase ( pp ) and delayed phase , respectively .
two - phase contrast material - enhanced spectral ct examinations were used by the discovery ct750 hd scanner ( general electric healthcare , wisconsin , usa ) .
after scout ct scanning , patients received nonionic contrast materials ( ioversol , optiray 350 ; tyco healthcare , montreal , quebec , canada ) with antecubital venous access at a rate of 3 - 4 ml / s .
a total of 70 - 110 ml ( 1.5 ml per kilogram of body weight ) was injected during phases of ap and pp .
ap scanning automatically began at 30 seconds after the trigger attenuation threshold [ 100 hounsfield unit ( hu ) ] was reached at the level of supraceliac abdominal aorta ( 10 ) .
ap and pp scanning were performed in the spectral imaging mode with fast tube voltage switching between 80 and 140 kev on adjacent views during a single rotation .
other scanning parameters were as follows ; collimation thickness of 0.625 mm , tube current of 600 ma , rotation speed of 0.6 second , helical pitch of 0.983 and ct dose index volume of 21.8 mgy ( comparable to 21.5 mgy dose administered for conventional contrast - enhanced liver scanning in a normal - size patient with body mass index within normal range at our institution ) .
ct images were reconstructed by projection - based material - decomposition software and a standard reconstruction kernel .
the adaptive statistical iterative reconstruction algorithm was applied to suppress image noise on decomposition images .
three types of images were reconstructed from the single spectral ct acquisition for analysis : conventional polychromatic images obtained at 140 kev , iodine - based material decomposition images and monochromatic images obtained at energies ranging from 40 to 140 kev .
mri imaging studies were evaluated in consensus by two radiologists ( each with more than 10 years experience in abdominal imaging ) on a picture archiving and communication system ( pacs ) ( impax 6.4 , agfa , mortsel , belgium ) .
the gold standard of a residual cancer was defined as a hypervascular nodule seen on gadoxetic acid - enhanced arterial phase mri images with a washout pattern considered a residual hcc ( 14 ) .
washout , a unique feature of hcc , was described as a change from high intense relative to the intense of the liver during the ap to isointense or hypointense relative to that of the liver during the pp .
all the measurements of spectral ct were performed on an advanced workstation ( aw4.4 ; ge healthcare , waukesha , wi , usa ) with the gsi viewer .
circular or elliptical regions of interest ( rois ) were drawn to encompass as much of the hyperenhancing portion of the lesion as possible ( mean pixel number 100 , range 20 - 190 ) from three contiguous slices .
mean ct data for the adjacent hepatic parenchyma as the background regions was obtained by manually placing circular rois in the hepatic parenchyma ( mean pixel number of 200 , range 100 - 280 )
. areas of focal change in hepatic parenchymal attenuation , large vessels and prominent artefacts were avoided carefully . to ensure consistency ,
all measurements were performed three times at different image levels and average values were calculated . for all measurements , the size , shape and position of the rois
were kept consistent between the two phases by applying the copy - and - paste function .
the spectral ct imaging studies were assessed by other two radiologists , each of them with more than eight years experiences in abdominal imaging .
the gsi viewer software package automatically calculated the ct values , iodine ( water ) , water ( iodine ) concentration for the lesions and normal hepatic parenchyma .
two parameters were derived from the ct values measurements : 1 ) contrast - to - noise ratio ( cnr ) at different energy levels ( 40 - 140 kev , interval 10 kev ) , calculated as cnr = ( ct lesion - ct liver)/sd noise , where ct lesion and ct liver are the ct values in the lesions and in the normal hepatic parenchyma and sd noise is the standard deviation for ct values of the normal parenchyma as background ; 2 ) the lesion - to - normal parenchyma ratio ( lnr ) , calculated as lnr = ct lesion / ct liver , where ct lesion and ct liver are the ct values in the lesions and in the normal hepatic parenchyma .
spectral ct images including conventional polychromatic images , monochromatic images and iodine - based material decomposition images were reviewed with gsi viewer in consensus at a workstation .
the readers were blinded to mri diagnosis of lesion , patient information and results of correlative imaging examinations .
they recorded the following lesion features : number , density , presence of feeding vessels and enhancement pattern . to detect ability of each set of images ,
the true number of lesions in each image set was evaluated by comparing them with standard - of - reference findings .
the relative density of the lesion with respect to the hepatic parenchyma was recorded as one of three grades of hypodensity , isodensity and hyperdensity .
the changes in enhancement degree or pattern between the two phases were characterized as expansion , washout or none .
finally , readers in consensus characterized each lesion as a residual hcc based on imaging findings . the typical enhancement pattern for residual hcc consisted of a rapid enhancement in the ap with a relatively quick washout in the pp , which was called
the sensitivity and specificity of residual hcc on the individual phase were evaluated compared to mri consequences .
receiver operating characteristic ( roc ) curves were generated to help establish the threshold values of lnr required for significant differentiation of hcc .
the null hypothesis test was that the area under the roc curve was 0.5 ; the alternative was that this area was greater than 0.5 .
table 1 shows that they were found in iodine - based images and monochromatic images versus 29 in conventional ct images .
the lesion - liver cnr for residual hcc at different energy levels ( 40 - 140 kev , interval 10 kev ) showed certain regularity ( figure 1 ) .
in general , the lesion - liver cnrs at low energy levels ( 40 - 70 kev ) were higher than those at high energy levels ( 80 - 140 kev ) .
box plots of lnr in diagnosing residual hcc with conventional ct images , monochromatic images and iodine - based material decomposition images are shown in figure 2 .
the results of iodine - based material decomposition images were significantly higher than the other two groups .
moreover , the roc curves of them for detecting residual hcc are shown in figure 3 . the areas for the lnr during the ap of conventional ct , monochromatic images and iodine - based material decomposition images were 0.817 ( 0.677 - 0.956 ) , 0.833 ( 0.700 - 0.967 ) and 0.933 ( 0.844 - 1.023 ) , respectively ( table 2 ) .
the area of iodine - based images was evidently greater than that for other quantitative parameters for diagnosing hcc .
figure 4 shows that a residual hcc was easily missed on conventional ct images , but could be detected on iodine - based material decomposition images and 40 kev of monochromatic images .
in fact , all of the residual hccs were consequently detected on 40 kev of monochromatic images , especially on iodine - based material decomposition images .
therefore , the iodine - based material decomposition images showed a higher detectability than conventional polychromatic images .
figure 4 shows that monochromatic images and iodine - based images detected a hypovascular residual cancer , but conventional ct images could not detect it .
figure 5 displays that conventional ct images and monochromatic images found a false positive lesion ( lipiodol deposition ) as there was non - enhancement of mri on the ap ; however , iodine - based images made a right diagnosis due to a still hyperattenuated lesion on the pp .
figure 6 shows that iodine - based material decomposition images and 40 kev of monochromatic images clearly displayed the residual hccs and spectral ct contained many methods to demonstrate the lnr of residual hccs .
hcc is the sixth most frequent cancer worldwide and the third most prevalent cancer resulting in death ( 15 ) .
however , only a few patients with hccs are surgical candidates at diagnosis ( 16 , 17 ) .
tace usually contains intra - arterial delivery of emulsions mixed with chemotherapeutic agents and lipiodol , followed by administration of embolic agent .
it has been demonstrated that the amount of intratumoral lipiodol deposition and the proportion of residual cancer associate well to tumor necrosis , tumor recurrence and survival rate after tace ( 18 - 20 ) .
accurate and quick assessment of lipiodol deposition and residual cancer is especially relevant for hcc after tace and provides interventional radiologist with better information to evaluate the effect of tace and to offer feedback for tace ( 18 - 22 ) .
mri is optimal to detect viable tumor with higher sensitivity owing to better contrast of different soft tissues and higher spatial resolution than ct ; whereas , absence of presentation of lipiodol disposition . in clinical practice ,
although ct is usually used to monitor lipiodol disposition of tace for hcc , there is a considerable difficulty in accurately detecting residual viable tumor with this modality , because high attenuation of iodized oil makes it difficult to differentiate areas of true enhancement from areas of reserved lipiodol .
for example , in our study , the conventional ct images omitted a positive residual cancer . in this study ,
ct imaging not only contained the monochromatic ct images and iodine - based material decomposition images for the detection and characterization of residual cancer , but also provided kinds of quantitative maps ( e.g. spectral curve , scatterplot , histogram ) to distinguish residual cancer from adjacent liver .
spectral ct imaging can produce monochromatic images at energy levels ranging from 40 to 140 kev , which is devoid of averaging attenuation effects ( 23 ) .
the optimal monochromatic images obtained at optimal kev markedly improved cnr of residual hcc . as shown in our study
, 40 kev monochromatic images showed a higher ability to detect hccs than conventional polychromatic images .
iodine - based material decomposition images were used for quantifying iodine concentrations whatever the amount of iodine ( 24 ) . for hypovascular liver lesions
, iodine - based material decomposition images could show focal uptake of iodinated contrast material obviously attributed to low defect of lipiodol deposition .
for example , there was a lipiodol deposition mistaken for a false residual in the conventional ct images and monochromatic images ; whereas , the iodine - based material decomposition images provided a right diagnosis .
besides , as shown in our study , the average lnr of iodine - based material decomposition images was significantly higher than the conventional ct images , which showed a higher ability of displaying residual hccs .
roc curves analyses in the present study revealed that compared with conventional qualitative image analysis , iodine - based material decomposition images with spectral ct improved the sensitivity .
the iodine concentration lesions derived from the iodine - based material decomposition images are quantitative , as demonstrated in in vitro experiments , and thus might be a useful parameter ( 23 ) .
first , the results were preliminary and need to be verified by additional studies on larger number of lesions .
second , because the readers assessed the images in consensus , intra- or interobserver variability data are lacking . in conclusion ,
spectral ct imaging with quantitative analysis of iodine concentration may be helpful for increasing the accuracy of follow - up of patients with hcc after tace . | background : it is critical to follow up hepatocellular carcinoma ( hcc ) after transcatheter arterial chemoembolization ( tace ) in clinical practice . computed tomography ( ct ) is used to assess lipiodol deposition , whereas it is difficult to assess hypovascular residual cancer masked by lipiodol . in contrast , magnetic resonance imaging ( mri ) is superior to ct in showing residual cancer , but can not display lipiodol deposition.objectives:the aim of this study was to investigate the value of spectral ct imaging in both lipiodol deposition and residual cancer for hcc patients after tace.patients and methods : ten hcc patients after treated with tace underwent discovery ct750 hd and mri750 3 t examination .
receiver operating characteristic ( roc ) curves of iodine - based material decomposition images , monochromatic images and conventional ct images were generated.results:consequently , 30 residual lesions were detected in mri of 10 patients .
they were found in iodine - based images and monochromatic images versus 29 in conventional ct images .
the area under roc curves for the lesion - to - normal parenchyma ratio ( lnr ) on arterial phase ( ap ) in iodine - based material decomposition images , monochromatic images and conventional ct images were 0.933 , 0.833 and 0.817 , respectively.conclusion:the study data highlighted good value of iodine - based material decomposition images of spectral ct in assessment of both lipiodol deposition and residual cancer for follow - up of hcc patients previously treated with tace . |
colonic perforation may occur either as a sequela of various colorectal diseases or as a complication of colonoscopy .
perforation associated with severe acute appendicitis , diverticulitis , or colorectal cancer is an example of disease - related perforation .
toxic megacolon accompanying such conditions as severe ulcerative colitis or clostridium colitis may also lead to colonic perforation .
although the incidence of perforation associated with colonoscopy is only 0.05% to 0.39%,1 - 4 it is of importance because surgical intervention may be necessary for the management of colonoscopy - associated perforation .
in addition , recent advent of endoscopic submucosal dissection ( esd ) resulted in high incidence of perforation although the indication for endoscopic therapy of colorectal neoplasm has been expanded .
understanding the clinical characteristics of colonic perforation and its management is becoming more important as colonoscopic procedures become more diverse and aggressive . in this paper , colonic perforation associated with colonoscopy will be reviewed , especially from the viewpoint of endoscopic management of perforation .
the incidence of colonoscopy - associated perforation is reported to be 0.05% to 0.39%.1 - 4 rectosigmoid colon is the segment where perforation occurs most commonly .
old age , female , comorbidity , diverticulosis , and polypectomy were reported as risk factors of colonoscopy - associated perforations.5 recently , esd has been introduced for the resection of large colorectal neoplasm , which was complicated with high incidence of colonic perforation ranging from 1.4% to 10.0%.6 - 13 large tumor size , presence of submucosal fibrosis , and laterally spreading tumor type were reported as risk factors of colorectal esd - associated perforations.14,15 furthermore , the cecum and ascending colon appear to be more susceptible to perforation during esd compared to the rectum.13
several mechanisms may be involved in colonoscopy - associated colonic perforation , which include blunt trauma on the colonic wall , unintentional endoscopic resection , and excessive thermal injury . in general , blunt trauma is the main cause of diagnostic colonoscopy - associated perforation .
they occur commonly in rectosigmoid area because they develop when colonoscope is pushed without resolution of looping at the rectosigmoid colon or when colonoscope is retroflexed immoderately.5 unintentional endoscopic resection and excessive thermal injury are related to perforations during therapeutic colonoscopy such as endoscopic mucosal resection or esd .
perforations resulted from unintentional endoscopic resection are generally small and more common in the right colon.5 thermal injury - related perforations , in general , are also small.5 thermal injury - related perforations may not be detected often during colonoscopic procedure because only excessive transmural burn is evident without overt perforation right after endoscopic mucosal resection .
therefore , thermal injury - related perforations are usually diagnosed after the completion of colonoscopic procedure .
colonoscopy - associated perforations may be classified into an endoscopically proven perforation and a radiologically proven perforation based on the diagnostic process.16 an endoscopically proven perforation refers to colonic mural defect detected during colonoscopy procedure ( fig .
1 ) . it may be accompanied by observable intraabdominal organ or fat tissue through the mural defect if the perforation is large enough .
a target sign , white center ( muscularis propria and/or serosa ) with surrounding blue area ( indigo carmine stained submucosa ) , at the postresection colon ulcer site or at the resection side of resected specimen , may be helpful in determining the probability of small perforation.17 a radiologically proven perforation is defined as a pneumoperitoneum or a pneumoretroperitoneum shown on a simple abdominal x - ray or as extraluminal air density or abscess at the site of the therapeutic procedure ( fig .
, endoscopic clipping has been introduced and conservative management has been feasible in many perforation cases . however , surgery is still indicated in cases of large perforations , generalized peritonitis , aggravating peritonitis , ongoing sepsis , and concomitant colorectal pathology such as large advanced neoplasm which is difficult to resect by endoscopic techniques.5 one study showed diagnostic colonoscopy - associated perforation or large perforation , leukocytosis over 10,000/mm , fever 37 , severe abdominal pain , and large amount of free air in peritoneal cavity 3 cm might be risk factors for surgery within 24 hours after colonoscopic clip closure trial.18 therefore , patients with these factors should be observed closely after the initiation of medical management by clipping and emergency surgery should be considered when patients show clinical deterioration such as generalized peritonitis .
endoscopic management of colonic perforation has progressed significantly since the first report of clip application by yoshikane et al.19 through the scope clips have been used in clinical practice for decades of years with satisfactory success rate for the management of colonoscopy - associated perforation ( fig .
3).16 they are especially useful in the closure of small perforations such as those developing after endoscopic mucosal resection or esd of colorectal tumors .
because diagnostic colonoscopy - associated perforation is usually larger than the therapeutic colonoscopy - associated perforation , overall clip success rate in the management of colon perforation appears to be higher in the therapeutic colonoscopy - associated perforation ( tables 1 , 2).18,20,21 in case of closure failure with clipping , combination of clips with detachable snare ( endoloop ) can be useful for endoscopic closure.22 recently , over the scope clips were reported to be useful for the management of large gastrointestinal perforations.23 a case series which investigated the usefulness of over - the - scope clip in the management of nine colon perforation cases showed successful deployment and closure in all of the nine perforations up to 30 mm in size . out of those nine cases ,
the other three cases required laparoscopy for the inspection of possible peritonitis , but none of the three cases showed leakage or peritonitis .
therefore , the authors concluded that the over the scope clip may be useful for the endoscopic management of colon perforation up to 30 mm in size.24 for the successful endoscopic management of colonic perforations , adequate supportive measures should be provided with timely endoscopic clipping .
they include nil per os , immediate intravenous antibiotics , and needle decompression of tension pneumoperitoneum .
tension pneumoperitoneum may lead to respiratory and circulatory compromise and air embolism through the portal venous system .
therefore , urgent decompression through the abdominal wall puncture by a large bore needle is important.5 in addition , to avoid serious peritonitis by the leakage of fecal material through the perforation site , endoscopists should remove all the residual feces , if possible , before attempting endoscopic resection of colorectal tumors . in case of a radiologically proven perforation with no evidence of endoscopic perforation during colonoscopy
, there is a debate on the necessity of the second look endoscopy with clipping trial .
if the patient complains of little symptoms , conservative management only with nil per os and antibiotics may be sufficient .
if the patient shows moderate abdominal pain , the second look endoscopy with clipping trial may be helpful .
despite recent progress in endoscopic management of colonoscopy - associated perforations , some perforations still need surgical interventions . in a colonoscopy - associated perforation study , of the 38 patients with perforations , 29 ( 76% )
improved without surgery.16 however , surgical intervention was necessary in six of six ( 100% ) endoscopically evident perforations in which endoscopic closure by clipping was not successful .
radiologically proven perforations , that is , delayed perforations whose perforation site was not detected during colonoscopy procedures , required surgical interventions in two of 10 patients ( 20%).16 in another colorectal esd study , microperforations which were detected radiologically after the completion of esd required longer hospital stay although they could be managed conservatively.25 based on these studies , immediate endoscopic clipping appears to be important to avoid surgical management of colonoscopy - related perforations although it is not absolutely imperative .
, endoscopic clipping has been introduced and conservative management has been feasible in many perforation cases . however , surgery is still indicated in cases of large perforations , generalized peritonitis , aggravating peritonitis , ongoing sepsis , and concomitant colorectal pathology such as large advanced neoplasm which is difficult to resect by endoscopic techniques.5 one study showed diagnostic colonoscopy - associated perforation or large perforation , leukocytosis over 10,000/mm , fever 37 , severe abdominal pain , and large amount of free air in peritoneal cavity 3 cm might be risk factors for surgery within 24 hours after colonoscopic clip closure trial.18 therefore , patients with these factors should be observed closely after the initiation of medical management by clipping and emergency surgery should be considered when patients show clinical deterioration such as generalized peritonitis .
endoscopic management of colonic perforation has progressed significantly since the first report of clip application by yoshikane et al.19 through the scope clips have been used in clinical practice for decades of years with satisfactory success rate for the management of colonoscopy - associated perforation ( fig .
3).16 they are especially useful in the closure of small perforations such as those developing after endoscopic mucosal resection or esd of colorectal tumors .
because diagnostic colonoscopy - associated perforation is usually larger than the therapeutic colonoscopy - associated perforation , overall clip success rate in the management of colon perforation appears to be higher in the therapeutic colonoscopy - associated perforation ( tables 1 , 2).18,20,21 in case of closure failure with clipping , combination of clips with detachable snare ( endoloop ) can be useful for endoscopic closure.22 recently , over the scope clips were reported to be useful for the management of large gastrointestinal perforations.23 a case series which investigated the usefulness of over - the - scope clip in the management of nine colon perforation cases showed successful deployment and closure in all of the nine perforations up to 30 mm in size . out of those nine cases ,
the other three cases required laparoscopy for the inspection of possible peritonitis , but none of the three cases showed leakage or peritonitis .
therefore , the authors concluded that the over the scope clip may be useful for the endoscopic management of colon perforation up to 30 mm in size.24 for the successful endoscopic management of colonic perforations , adequate supportive measures should be provided with timely endoscopic clipping .
they include nil per os , immediate intravenous antibiotics , and needle decompression of tension pneumoperitoneum .
tension pneumoperitoneum may lead to respiratory and circulatory compromise and air embolism through the portal venous system .
therefore , urgent decompression through the abdominal wall puncture by a large bore needle is important.5 in addition , to avoid serious peritonitis by the leakage of fecal material through the perforation site , endoscopists should remove all the residual feces , if possible , before attempting endoscopic resection of colorectal tumors . in case of a radiologically proven perforation with no evidence of endoscopic perforation during colonoscopy
, there is a debate on the necessity of the second look endoscopy with clipping trial .
if the patient complains of little symptoms , conservative management only with nil per os and antibiotics may be sufficient .
if the patient shows moderate abdominal pain , the second look endoscopy with clipping trial may be helpful .
despite recent progress in endoscopic management of colonoscopy - associated perforations , some perforations still need surgical interventions . in a colonoscopy - associated perforation study , of the 38 patients with perforations , 29 ( 76% )
improved without surgery.16 however , surgical intervention was necessary in six of six ( 100% ) endoscopically evident perforations in which endoscopic closure by clipping was not successful .
radiologically proven perforations , that is , delayed perforations whose perforation site was not detected during colonoscopy procedures , required surgical interventions in two of 10 patients ( 20%).16 in another colorectal esd study , microperforations which were detected radiologically after the completion of esd required longer hospital stay although they could be managed conservatively.25 based on these studies , immediate endoscopic clipping appears to be important to avoid surgical management of colonoscopy - related perforations although it is not absolutely imperative .
colonoscopy - associated perforations can be managed endoscopically if they can be closed by endoscopic clipping during colonoscopy .
therefore , cautious management by intense medical therapy may be warranted in colonoscopy - related perforations if they are not clinically deteriorated . | colonic perforation occurs in a variety of clinical scenarios and colonoscopy - associated perforation is one of the important reasons for colonic perforation .
colonoscopy - associated perforation may be diagnosed during colonoscopy procedure by the visualization of evident colonic wall defect or , after the completion of colonoscopy , by the visualization of leaked air in the peritoneal or retroperitoneal space .
recently , the incidence of colonoscopy - associated perforation increased because of the introduction of colorectal endoscopic submucosal dissection .
traditionally , colonoscopy - associated perforation was managed surgically .
however , medical management has been introduced widely and endoscopic clipping is the most important component for the medical management of colonoscopy - associated perforation .
timely administration of antibiotics is also important .
large perforations , diagnostic colonoscopy - associated perforations , large amount of pneumoperitoneum , and severe abdominal pain have been reported to be predictive of the necessity of surgery after endoscopic clipping .
surgery should be performed if patients show clinical deterioration even after the initiation of medical management . |
the number of people with diabetes mellitus is alarmingly increasing due to the growing prevalence of obesity , genetic susceptibility , urbanization , and ageing .
type 2 diabetes , the most common form of the disease , may remain undetected for many years and its diagnosis is often made incidentally through an abnormal blood or urine glucose test .
hence , physicians often face this disease at an advanced stage when vascular complications have already occurred in most of patients .
diabetes - related microvascular disease such as retinopathy and nephropathy are major causes of blindness and renal insufficiency . based on this scenario , a better understanding of the mechanisms underlying diabetic vascular disease is mandatory because it may provide novel approaches to prevent or delay the development of its complications .
this review will focus on the most current advances in the pathophysiology of vascular disease ( part i ) and will address clinical manifestations and management strategies of patients with diabetes ( part ii ) .
the alterations in vascular homeostasis due to endothelial and smooth muscle cell dysfunction are the main features of diabetic vasculopathy favouring a pro - inflammatory / thrombotic state which ultimately leads to atherothrombosis .
macro- and microvascular diabetic complications are mainly due to prolonged exposure to hyperglycemia clustering with other risk factors such as arterial hypertension , dyslipidemia as well as genetic susceptibility .
interestingly , nephropathy , retinopathy , and diabetic vascular disease are in line with the notion that endothelial , mesangial , and retinal cells are all equipped to handle high sugar levels when compared with other cell types .
the detrimental effects of glucose already occur with glycemic levels below the threshold for the diagnosis of diabetes .
this is explained by the concept of glycemic continuum across the spectrum of prediabetes , diabetes , and cardiovascular risk .
early disglycemia caused by obesity - related insulin resistance or impaired insulin secretion is responsible for functional and structural alterations of the vessel wall culminating with diabetic vascular complications .
the initial trigger whereby high glucose concentrations alter vascular function is the imbalance between nitric oxide ( no ) bioavailability and accumulation of reactive oxygen species ( ros ) , leading to endothelial dysfunction .
indeed , hyperglycemia - induced generation of superoxide anion ( o2 ) inactivates no to form peroxynitrite ( onoo ) , a powerful oxidant which easily penetrates across phospholipid membranes and induces substrate nitration .
protein nitrosylation blunts activity of antioxidant enzymes and endothelial no synthase ( enos , figure 1 ) .
importantly , reduced no bioavailability is a strong predictor of cardiovascular outcomes .
figure 1mechanisms of hyperglycemia - induced vascular damage .
high intracellular glucose concentrations lead to pkc activation and subsequent ros production by nadph oxidase and p66 adaptor protein . increased oxidative stress rapidly inactivates no leading to formation of the pro - oxidant onoo responsible for protein nitrosylation .
indeed , pkc triggers enzyme up - regulation thus enhancing enos uncoupling and leading to a further accumulation of free radicals . on the other hand ,
together with the lack of no , glucose - induced pkc activation causes increased synthesis of et-1 favouring vasoconstriction and platelet aggregation .
accumulation of superoxide anion also triggers up - regulation of pro - inflammatory genes mcp-1 , vcam-1 , and icam-1 via activation of nf - kb signalling .
these events lead to monocyte adhesion , rolling , and diapedesis with formation of foam cells in the sub - endothelial layer .
foam cell - derived inflammatory cytockines maintain vascular inflammation as well as proliferation of smooth muscle cells , accelerating the atherosclerotic process .
endothelial dysfunction in diabetes also derives from increased synthesis of txa2 via up - regulation of cox-2 and inactivation of pgis by increased nitrosylation .
furthermore , ros increase the synthesis of glucose metabolite methylglyoxal leading to activation of age / rage signalling and the pro - oxidant hexosamine and polyol pathway flux .
pkc , protein kinase c ; enos , endothelial nitric oxide synthase ; et1 , endothelin 1 ; ros , reactive oxygen species ; no , nitric oxide ; mcp-1 , monocyte chemoattractant protein-1 ; vcam-1 , vascular cell adhesion molecule-1 ; icam-1 , intracellular cell adhesion molecule-1 ; age , advanced glycation end product . mechanisms of hyperglycemia - induced vascular damage .
high intracellular glucose concentrations lead to pkc activation and subsequent ros production by nadph oxidase and p66 adaptor protein . increased oxidative stress rapidly inactivates no leading to formation of the pro - oxidant onoo responsible for protein nitrosylation .
indeed , pkc triggers enzyme up - regulation thus enhancing enos uncoupling and leading to a further accumulation of free radicals . on the other hand
together with the lack of no , glucose - induced pkc activation causes increased synthesis of et-1 favouring vasoconstriction and platelet aggregation .
accumulation of superoxide anion also triggers up - regulation of pro - inflammatory genes mcp-1 , vcam-1 , and icam-1 via activation of nf - kb signalling .
these events lead to monocyte adhesion , rolling , and diapedesis with formation of foam cells in the sub - endothelial layer .
foam cell - derived inflammatory cytockines maintain vascular inflammation as well as proliferation of smooth muscle cells , accelerating the atherosclerotic process .
endothelial dysfunction in diabetes also derives from increased synthesis of txa2 via up - regulation of cox-2 and inactivation of pgis by increased nitrosylation .
furthermore , ros increase the synthesis of glucose metabolite methylglyoxal leading to activation of age / rage signalling and the pro - oxidant hexosamine and polyol pathway flux .
pkc , protein kinase c ; enos , endothelial nitric oxide synthase ; et1 , endothelin 1 ; ros , reactive oxygen species ; no , nitric oxide ; mcp-1 , monocyte chemoattractant protein-1 ; vcam-1 , vascular cell adhesion molecule-1 ; icam-1 , intracellular cell adhesion molecule-1 ; age , advanced glycation end product .
overproduction of ros by mitochondria is considered as a causal link between elevated glucose and the major biochemical pathways involved in the development of vascular complications of diabetes .
indeed , hyperglycemia - induced ros production triggers several cellular mechanisms including polyol and hexosamine flux , advanced glycation end products ( ages ) , protein kinase c ( pkc ) activation , and nf - kb - mediated vascular inflammation .
one of the main sources of ros in the setting of hyperglycemia is represented by pkc and its downstream targets .
the hyperglycemic environment induces a chronic elevation of diacyglycerol levels in endothelial cells with subsequent membrane translocation of conventional ( , 1 , 2 ) and non - conventional ( ) pkc isoforms . once activated , pkc is responsible for different structural and functional changes in the vasculature including alterations in cellular permeability , inflammation , angiogenesis , cell growth , extracellular matrix expansion , and apoptosis
. an important consequence of pkc activation is ros generation . in vascular endothelial cells , hyperglycemia - induced activation of pkc increases superoxide production via nadph oxidase ( figure 1 ) .
more recently , it has been reported that glucose - induced activation of pkc 2 isoform phosphorylates p66 at serine 36 leading to its translocation to the mitochondria , cytochrome c oxidation and accumulation of ros into the organelle .
the p66 adaptor protein functions as a redox enzyme implicated in mitochondrial ros generation and translation of oxidative signals into apoptosis .
interestingly , diabetic p66 mice are protected against hyperglycemia - induced endothelial dysfunction and oxidative stress .
the relevance of p66 in the clinical setting of diabetes is supported by the notion that p66 gene expression is increased in peripheral blood mononuclear cells obtained from patients with type 2 diabetes and correlates with plasma 8-isoprostane levels , an in vivo marker of oxidative stress . moreover ,
p66 protein has recently emerged as an upstream modulator of nadph activation further strengthening its pivotal role in ros generation .
pkc affects no availability not only via intracellular accumulation of ros but also by decreasing enos activity .
pkc also leads to increased production of endothelin-1 ( et-1 ) favouring vasoconstriction and platelet aggregation ( figure 1 ) .
the role of et-1 in the pathophysiology of diabetic complications is confirmed by the observation that the activity of endogenous et-1 on et(a ) receptors is enhanced in the resistance vessels of patients with diabetes . in the vessel wall
, pkc - dependent ros production also participates in the atherosclerotic process by triggering vascular inflammation .
indeed , ros lead to up - regulation and nuclear translocation of nf - kb subunit p65 and , hence , transcription of pro - inflammatory genes encoding for monocyte chemoattractant protein-1 ( mcp-1 ) , selectins , vascular cell adhesion molecule-1 ( vcam-1 ) , and intracellular cell adhesion molecule-1 ( icam-1 ) .
this latter event facilitates adhesion of monocytes to the vascular endothelium , rolling , and diapedesis in the sub - endothelium with subsequent formation of foam cells ( figure 1 ) .
secretion of il-1 and tnf- from active macrophages maintains up - regulation of adhesion molecules by enhancing nf - kb signalling in the endothelium and also promotes smooth muscle cells growth and proliferation ( figure 1 ) .
consistently , inhibition of pkc 2 isoform blunts vcam-1 up - regulation in human endothelial cells upon glucose exposure .
endothelial dysfunction in diabetes is not only the result of impaired no availability but also of increased synthesis of vasocontrictors and prostanoids .
pkc - mediated cyclooxygenase-2 ( cox-2 ) up - regulation is associated with an increase of thromboxane a2 and a reduction of prostacyclin ( pgi2 ) release ( figure 1 ) .
these findings suggest that pkc is the upstream signalling molecule affecting vascular homeostasis in the setting of hyperglycemia ( figure 1 ) .
in experimental diabetes , methylglyoxal is a key player in the pathophysiology of diabetic complications through oxidative stress , ages accumulation , and endothelial dysfunction .
generation of ages leads to cellular dysfunction by eliciting activation of the ages receptor ( rage ) .
age - rage signalling in turn activates ros - sensitive biochemical pathways such as the hexosamine flux . in the hyperglycemic environment , an increased flux of fructose-6-phosphate activates a cascade of events resulting in different glycosilation patterns which are responsible for deregulation of enzymes involved in vascular homeostasis .
specifically , o - glcnacylation at the akt site of enos protein leads to reduced enos activity and endothelial dysfunction .
moreover , glycosylation of transcription factors causes up - regulation of inflammatory ( tgf , tgf1 ) and pro - thrombotic genes ( plasminogen activator inhibitor-1 ) .
glucose induced - ros production also activates the polyol pathway flux involved in vascular redox stress .
accordingly , hyperactivation of this pathway has been associated with increased atherosclerotic lesions in diabetic mice .
insulin resistance is a major feature of type 2 diabetes and develops in multiple organs , including skeletal muscle , liver , adipose tissue , and heart .
the onset of hyperglycemia and diabetes is often preceded by many years of insulin resistance .
obesity plays a pivotal role in this phenomenon providing an important link between type 2 diabetes and fat accumulation .
obesity is a complex disorder leading to alterations in lipid metabolism , deregulation of hormonal axes , oxidative stress , systemic inflammation , and ectopic fat distribution .
adipose tissue is an active source of inflammatory mediators and free fatty acids ( ffas ) .
accordingly , obese patients with type 2 diabetes display increased plasma levels of inflammatory markers .
free fatty acids bind toll - like receptor ( tlr ) activating nf - kb through degradation of the inhibitory complex ikb by ikk-kinase . as a result
, nf - kb triggers tissue inflammation due to up - regulation of inflammatory genes il-6 and tnf-. toll - like receptor activation by ffa leads to phosphorylation of insulin receptor substrate-1 ( irs-1 ) by c - jun amino - terminal kinase ( jnk ) and pkc , thereby altering its ability to activate downstream targets pi3-kinase and akt .
these molecular events result in the down - regulation of the glucose transporter glut-4 and , hence , insulin resistance ( figure 2 ) .
insulin resistance is critically involved in vascular dysfunction in subjects with type 2 diabetes . indeed , down - regulation of pi3-kinase / akt pathway leads to enos inhibition and decreased no production .
together with reduced no synthesis , intracellular oxidation of stored ffa generates ros leading to vascular inflammation , ages synthesis , reduced pgi2 synthase activity , and pkc activation ( figure 2 ) .
figure 2insulin resistance as trigger of atherothrombosis . in subjects with obesity or type 2
diabetes the increase in ffa activates tlr leading nf - kb nuclear translocation and subsequent up - regulation of inflammatory genes il-6 and tnf-. on the other hand , jnk and protein kinase c phosphorylate insulin receptor substrate-1 ( irs-1 ) , thus blunting its downstream targets pi3-kinase and akt .
this results in down - regulation of glucose transporter glut-4 and , hence , insulin resistance .
impaired insulin sensitivity in the vascular endothelium leads to increased ffa oxidation , ros formation , and subsequent activation of detrimental biochemical pathways such as age synthesis , pkc activation , protein glicosylation as well as down - regulation of pgi2 .
lack of insulin signalling in platelets impairs the irs1/pi3k pathway resulting in ca accumulation and increased platelet aggregation .
ffa , free fatty acids ; tlr , toll - like receptor ; jnk , c - jun amino - terminal kinase ; irs-1 , insulin receptor substrate-1 ; no , nitric oxide ; enos , endothelial nitric oxide shyntase ; il-6 , interleukin-6 ; tnf- , tumor necrosis factor .
diabetes the increase in ffa activates tlr leading nf - kb nuclear translocation and subsequent up - regulation of inflammatory genes il-6 and tnf-. on the other hand , jnk and protein kinase c phosphorylate insulin receptor substrate-1 ( irs-1 ) , thus blunting its downstream targets pi3-kinase and akt .
this results in down - regulation of glucose transporter glut-4 and , hence , insulin resistance .
impaired insulin sensitivity in the vascular endothelium leads to increased ffa oxidation , ros formation , and subsequent activation of detrimental biochemical pathways such as age synthesis , pkc activation , protein glicosylation as well as down - regulation of pgi2 .
lack of insulin signalling in platelets impairs the irs1/pi3k pathway resulting in ca accumulation and increased platelet aggregation .
ffa , free fatty acids ; tlr , toll - like receptor ; jnk , c - jun amino - terminal kinase ; irs-1 , insulin receptor substrate-1 ; no , nitric oxide ; enos , endothelial nitric oxide shyntase ; il-6 , interleukin-6 ; tnf- , tumor necrosis factor . increased ros levels associated with insulin resistance scavenge no production and produce peroxynitrite , with a further reduction of no bioavailability . reduced cellular levels of no facilitate pro - inflammatory pathways triggered by increased cytokine production .
tnf- also stimulates the expression of c - reactive protein which down - regulates enos and increases the production of adhesion molecules and endothelin-1 .
a recent study clearly demonstrated that loss of insulin signalling in the vascular endothelium leads to endothelial dysfunction , expression of adhesion molecules , and atherosclerotic lesions in mice .
although insulin resistance development has been attributed to adipocyte - derived inflammation , recent evidence is overturning the adipocentric paradigm .
indeed , inflammation and macrophage activation seem to primarily occur in non - adipose tissue in obesity .
this concept is supported by the notion that suppression of inflammation in the vasculature prevents insulin resistance in other organs and prolongs lifespan .
consistently , transgenic mice with endothelium - specific overexpression of the inhibitory nf - kb subunit ikb were protected from the development of insulin resistance . in these mice ,
obesity - induced macrophage infiltration of adipose tissue and plasma oxidative stress markers were reduced whereas blood flow , muscle mitochondrial content , and locomotor activity were increased , confirming the pivotal role of the transcription factor nfkb in oxidative stress , vascular dysfunction , and inflammation .
another study confirmed these findings , showing that genetic disruption of the insulin receptor substrate 2 ( irs-2 ) in endothelial cells reduces glucose uptake by skeletal muscle .
these novel findings strengthen the central role of endothelium in obesity - induced insulin resistance , suggesting that blockade of vascular inflammation and oxidative stress may be a promising approach to prevent metabolic disorders .
notably , pharmacological improvement in insulin sensitivity in patients with type 2 diabetes and metabolic syndrome is associated with restoration of flow - mediated vasodilation .
the atherogenic effects of insulin resistance are also due to changes in lipid profile such as high triglycerides , low hdl cholesterol , increased remnant lipoproteins , elevated apolipoprotein b ( apob ) as well as small and dense ldl . once circulating ffa reach the liver , very low density lipoprotein ( vldl ) are assembled and made soluble by increased synthesis of apob .
vldl are processed by cholesteryl ester transfer protein allowing transfer of triglycerides to ldl , which become small and dense and , hence , more atherogenic .
atherogenic dyslipidemia is a reliable predictor of cardiovascular risk and its pharmacological modulation reduces vascular events in subjects with type 2 diabetes and metabolic syndrome .
coronary events in patients with insulin resistance are triggered by virtue of a prothrombotic state . under physiological conditions
, insulin inhibits platelet aggregation and thrombosis via tissue factor ( tf ) inhibition and enhanced fibrinolytic action due to modulation of plasminogen activator inhibitor-1 ( pai-1 ) levels .
indeed , patients with acute myocardial infarction receiving fibrinolityic therapy plus 48 h insulin infusion displayed a marked decrease in pai-1 levels .
in contrast , insulin resistance facilitates atherothrombosis through increased cellular synthesis of pai-1 and fibrinogen and reduced production of tissue plasminogen activator . in platelets ,
lack of insulin leads to a down - regulation of the irs-1/akt pathway resulting in calcium accumulation upon basal conditions ( figure 2 ) .
this latter mechanism may explain why platelets from diabetic patients show faster response and increased aggregation compared with those from healthy subjects .
moreover , platelet reactivity and excretion of tromboxane metabolites are increased in obese patients with insulin resistance and this phenomenon is reversed by weight loss or 3-week treatment with pioglitazone .
body weight as well as impaired insulin sensitivity may also account for the faster recovery of cyclooxygenase activity despite aspirin treatment . indeed , higher body mass index was an independent predictor of inadequate suppression of tromboxane biosynthesis in non - diabetics subjects treated with aspirin . in this study ,
this clinical observation may explain the residual cardiovascular risk in obese patients treated with anti - platelet medications .
hyperglycemia and insulin resistance alone may not explain the persistent cardiovascular risk burden associated with type 2 diabetes .
indeed , normalization of glycemia does not reduce macrovascular events suggesting that mediators of vascular risk other than glucose significantly participate to increase the residual cardiovascular risk in diabetic patients . in this
regard , adipose tissue dysfunction , inflammation , and aberrant adipokine release may be particularly relevant . in patients with abdominal obesity
, an increased lipid storage leads to hypoxia , chronic inflammation together with changes in the cellular components of adipose tissue , leading to an altered secretory profile .
adipokines linked to vascular disease are leptin , adipocyte fatty acid - binding protein , interleukins , and novel ones like lipocalin-2 and pigment epithelium - derived factor .
these molecules may drive vascular dysfunction via increased proliferation / migration of smooth muscle cells , enos inhibition , and activation of nfkb signalling with subsequent expression of adhesion molecules and atherosclerosis .
future work will need to address the potential role of these molecules as biomarkers and/or drug targets .
micrornas ( mirs ) are a newly identified class of small non - coding rnas emerging as key players in the pathogenesis of hyperglycemia - induced vascular damage .
these small non - coding rnas orchestrate different aspects of diabetic vascular disease by regulating gene expression at the post - transcriptional level .
microarray studies have shown an altered profile of mirs expression in subjects with type 2 diabetes . indeed , diabetic patients display a significant deregulation of mirs involved in angiogenesis , vascular repair , and endothelial homeostasis . over the last few years
, different studies have explored the mechanisms whereby deregulation of mirs expression may contribute to vascular disease in subjects with diabetes .
in endothelial cells exposed to high glucose mir-320 is highly expressed and targets several angiogenic factors and their receptors , including vascular endothelial growth factor and insulin - like growth factor-1 ( igf-1 ) .
elevated levels of this mir are associated with decreased cell proliferation and migration , while its down - regulation restores these properties and increases igf-1 expression , promoting angiogenesis and vascular repair ( figure 3 ) .
schematic representation of micrornas and their relative targets contributing to reduced vascular repair and , hence , diabetes - related vascular dysfunction .
vegf , vascular endothelial growth factor ; igf-1 , insulin - like growth factor-1 ; ecs , endothelial cells ; ages , advanced glycation end - products .
schematic representation of micrornas and their relative targets contributing to reduced vascular repair and , hence , diabetes - related vascular dysfunction .
vegf , vascular endothelial growth factor ; igf-1 , insulin - like growth factor-1 ; ecs , endothelial cells ; ages , advanced glycation end - products .
hyperglycemia also increases the expression of mir-221 , a regulator of angiogenesis targeting c - kit receptor which is responsible for migration and homing of endothelial progenitor cells ( epcs ) .
indeed , down - regulation of mir-222 both in human endothelial cells exposed to high glucose and in diabetic mice elicits age - related endothelial dysfunction via targeting , cyclin - dependent kinase proteins involved in cell cycle inhibition ( p27kip1 and p57kip2 ) .
a recent study demonstrated that mir-503 is critically involved in hyperglycemia - induced endothelial dysfunction in diabetic mice and is up - regulated in ischaemic limb muscles of diabetic subjects .
the detrimental effects of mir-503 in the setting of diabetes have been explained by its interaction with ccne and cdc25a , critical regulators of cell cycle progression affecting endothelial cell migration and proliferation .
interestingly , mir-503 inhibition was able to normalize post - ischaemic neovascularization and blood flow recovery in diabetic mice .
these findings provide the rationale to foresee a protective effect of the modulation of mir-503 expression against diabetic vascular complications .
plasma mir profiling showed a profound down - regulation of mir-126 in a cohort of diabetic patients .
recent evidence suggest that reduced mir-126 expression levels are partially responsible for impaired vascular repair capacities in diabetes .
mir-126 expression was reduced in epcs isolated from diabetics and transfection with anti - mir-126 blunted epcs proliferation and migration .
in contrast , restored expression of this mir promoted epcs - related repair capacities and inhibited apoptosis .
mir-126 role in epcs function is mediated by spred-1 , an inhibitor of ras / erk signalling pathway , a critical regulator of cell cycle .
collectively , these studies support the notion that mirs drive complex signalling networks by targeting the expression of genes involved in cell differentiation , migration , and survival .
individuals affected by diabetes display an increased risk of coronary events and cardiovascular mortality when compared with non - diabetic subjects .
this phenomenon is largely explained by a deregulation of factors involved in coagulation and platelet activation . both insulin resistance and hyperglycemia
the largest increase in pai-1 has been reported in diabetic patients with poor glycemic control and treatment with glucose - lowering agents glipizide or metformin comparably decreased pai-1 .
hyperinsulinemia induces tf expression in monocytes of patients with type 2 diabetes leading to increased tf procoagulant activity and thrombin generation .
low - grade inflammation induces tf expression also in the vascular endothelium of diabetic subjects contributing to atherothrombosis .
figure 4coagulation and platelet reactivity in diabetes . in patients with diabetes chronic hyperglycemia and insulin resistance
determine a significant alteration in the coagulation factors as well as increased platelet aggregation , leading to a prothrombotic state .
fibrin organization is further enhanced due to high pai-1 and reduced t - pa levels . increased ca content , thrombin stimulation as well as interaction with vwf via gpiib / iiia receptor lead to platelet shape change , granule release , and aggregation .
endothelial dysfunction precipitates rupture of the endothelial layer leading to exposure of collagen and vwf thereby activating platelets and favouring vascular thrombosis .
tf , tissue factor ; t - pa , tissue plasminogen activator ; pai-1 , plasminogen activator inhibitor -1 ; mps , microparticles ; vwf , von willebrand factor ; ecs , endothelial cells .
coagulation and platelet reactivity in diabetes . in patients with diabetes chronic hyperglycemia and insulin resistance
determine a significant alteration in the coagulation factors as well as increased platelet aggregation , leading to a prothrombotic state .
fibrin organization is further enhanced due to high pai-1 and reduced t - pa levels . increased ca content , thrombin stimulation as well as interaction with vwf via gpiib / iiia receptor lead to platelet shape change , granule release , and aggregation .
endothelial dysfunction precipitates rupture of the endothelial layer leading to exposure of collagen and vwf thereby activating platelets and favouring vascular thrombosis .
tf , tissue factor ; t - pa , tissue plasminogen activator ; pai-1 , plasminogen activator inhibitor -1 ; mps , microparticles ; vwf , von willebrand factor ; ecs , endothelial cells .
microparticles ( mps ) , vescicles released in the circulation from various cell types following activation or apoptosis , are increased in diabetic patients and predict cardiovascular outcome .
microparticles from patients with type 2 diabetes have shown to increase coagulation activity in endothelial cells ( figure 4 ) . moreover , mps carrying tf promote thrombus formation at sites of injury representing a novel and additional mechanisms of coronary thrombosis in diabetes . among the factors contributing to the diabetic prothrombotic state
a number of mechanisms contribute to platelet dysfunction affecting adhesion , activation as well as aggregation phases of platelet - mediated thrombosis ( figure 4 ) .
hyperglycemia alters platelet ca homeostasis leading to cytoskeleton abnormalities and increased secretion of proaggregant factors .
moreover , up - regulation of glycoproteins ib and iib / iiia in diabetic patients triggers thrombus via interacting with von willebrand factor ( vwf ) and fibrin molecules ( figure 4 ) .
recent prospective clinical trials have shown that normalization of glycemia failed to reduce cardiovascular burden in the diabetic population . in these trials ,
intensive glucose - lowering therapy was started after a median duration of diabetes ranging from 8 to 11 years .
hyperglycemic memory. a substantial understanding of its mechanisms has been achieved only in recent years .
it has been recently demonstrated that transient hyperglycemia activates nf - kb , and this effect persists despite subsequent normalization of glucose levels .
this finding is explained by epigenetic changes occurring at the level of dna and histone - binding promoter of pro - oxidant and pro - inflammatory genes
. specifically , methylation and acetylation are critical epigenetic mark modulated by the hyperglycemic environment .
methylation of p65/nfkb promoter by the ros - dependent methyltransferase set7/9 is indeed the mechanisms whereby vascular inflammation is not reverted by restoration of normoglycemia ( figure 5 ) .
we have recently identified the source of ros perpetuating vascular dysfunction despite normoglycemia restoration .
hyperglycemia causes a deregulation of sirt1 resulting in increased acetylation of histone 3-binding p66 promoter . together with these changes ,
hypomethylation of p66 promoter leads to persistent overexpression of the adaptor protein despite glucose normalization .
overexpression of p66 causes mitochondrial ros accumulation leading to vascular apoptosis , vascular inflammation ( set7/9-dependent methylation of p65 promoter and expression of inflammatory genes ) and endothelial dysfunction via a detrimental vicious cycle involving ros , pkc2 and enos inhibiting phosphorylation at thr-495 .
h3 , histone 3 ; ros , reactive oxygen species ; pkcii , protein kinase c ii ; no , nitric oxide ; mcp-1 , monocyte chemoattractant protein 1 ; vcam-1 , vascular cell adhesion molecule 1 .
hyperglycemia causes a deregulation of sirt1 resulting in increased acetylation of histone 3-binding p66 promoter . together with these changes ,
hypomethylation of p66 promoter leads to persistent overexpression of the adaptor protein despite glucose normalization .
overexpression of p66 causes mitochondrial ros accumulation leading to vascular apoptosis , vascular inflammation ( set7/9-dependent methylation of p65 promoter and expression of inflammatory genes ) and endothelial dysfunction via a detrimental vicious cycle involving ros , pkc2 and enos inhibiting phosphorylation at thr-495 .
h3 , histone 3 ; ros , reactive oxygen species ; pkcii , protein kinase c ii ; no , nitric oxide ; mcp-1 , monocyte chemoattractant protein 1 ; vcam-1 , vascular cell adhesion molecule 1 . in diabetic mice and human endothelial cells
, glucose normalization did not revert up - regulation of p66 protein , a mitochondrial adaptor critically involved in ros generation .
persistent p66 expression is driven by epigenetic changes as reduced promoter methylation and acetylation of histone 3 ( figure 5 ) . moreover ,
p66-dependent ros generation maintains up - regulation of pkcii and inhibits enos activity , thus feeding a detrimental vicious cycle despite restoration of normoglycemia ( figure 5 ) .
gene silencing of p66 blunted persistent endothelial dysfunction and oxidative stress in the vasculature of diabetic mice , suggesting that this protein drives hyperglycemic memory ( figure 5 ) .
in addition , other studies have shown that both mammalian deacetylase sirt-1 and tumour suppressor p53 have a strong memory effect despite glucose normalization .
interestingly enough , these findings are in line with the notion that both sirt-1 and p53 control p66 transcription .
indeed , reduced sirt-1 activity in diabetes favours acetylation of histone 3-binding p66 promoter . moreover , increased p53 activity maintains p66 memory effect ( figure 5 ) .
all together , these pathways might be involved in self - perpetuating vascular damage of patients with diabetes despite optimal glycemic control .
accumulation of free radicals in the vasculature of diabetic patients is responsible for the activation of detrimental biochemical pathways , mirs deregulation , release of mps , and epigenetic changes contributing to vascular inflammation and ros generation . since cardiovascular risk burden
is not eradicated by intensive glycemic control associated with optimal multifactorial treatment , mechanism - based therapeutic strategies are in highly demand .
specifically , inhibition of key enzymes involved in hyperglycemia - induced vascular damage or activation of pathways improving insulin sensitivity may represent promising approaches .
moreover , the progressive identification of a complex scenario driven by epigenetic changes that modulate transcription of ros - generating and pro - inflammatory genes may represent an attractive opportunity to dampen oxidative stress , vascular inflammation , and hence to prevent cardiovascular complications in patients with diabetes .
this work was supported by grants from the swiss heart foundation , fondazione roma , italy ( to f.c . ) .
conflict of interest : f.p is the recipient of a fellowship from the italian society of hypertension . | hyperglycemia and insulin resistance are key players in the development of atherosclerosis and its complications .
a large body of evidence suggest that metabolic abnormalities cause overproduction of reactive oxygen species ( ros ) . in turn ,
ros , via endothelial dysfunction and inflammation , play a major role in precipitating diabetic vascular disease .
a better understanding of ros - generating pathways may provide the basis to develop novel therapeutic strategies against vascular complications in this setting .
part i of this review will focus on the most current advances in the pathophysiological mechanisms of vascular disease : ( i ) emerging role of endothelium in obesity - induced insulin resistance ; ( ii ) hyperglycemia - dependent micrornas deregulation and impairment of vascular repair capacities ; ( iii ) alterations of coagulation , platelet reactivity , and microparticle release ; ( iv ) epigenetic - driven transcription of ros - generating and proinflammatory genes .
taken together these novel insights point to the development of mechanism - based therapeutic strategies as a promising option to prevent cardiovascular complications in diabetes . |
oral metastatic lesions from distant tumors are uncommon and mainly involve the bony structures , whereas metastases to soft tissues are extraordinarily rare . in most patients , the primary tumor is already known before the oral metastatic lesions appear .
this particular case is worth reporting , because of extremely rare nature of simultaneous metastasis of pancoast tumor to the adrenal gland and gingiva and in spite of the wide spread metastasis the patient did not present with any other symptoms , except for the presence of recurrent gingival lesions .
the clinical appearance in this case was of a gingival mass that could have been misdiagnosed as a hyperplastic lesion associated with a tooth or as a reactive process .
in many cases diagnosis can be difficult and requires patient 's remote medical history , biopsy for histological diagnosis as well as some target organs investigations , such as brain , lungs , liver , to establish the correct diagnosis .
a 49-year - old male patient reported to the department of oral and maxillofacial surgery , government dental college , with a painless sessile growth of size 2 3 cm on the lingual attached gingiva in relation to mandibular incisors of one month duration .
clinically , only four mandibular anterior teeth were present which includes left incisors , right central incisor , and canine .
clinical examination revealed the lesion to be soft to firm in consistency with no bleeding on probing .
grade 3 mobility of anterior teeth was found except for the left lateral incisor which was grade i mobile .
radiographic examination showed extensive bone resorption in relation to the mandibular anterior ( left lateral incisor to right lateral incisor ) region with a floating tooth appearance [ figure 1 ] .
a tentative diagnosis of pyogenic granuloma was suggested by the oral surgeons as there were no other symptoms .
extensive bone resorption in relation to the mandibular anterior teeth region with a floating tooth appearance after 20 days of initial excision , the patient came back with the presentation of recurrent lesion at the same site , i.e. on the gingiva in mandibular anterior teeth region in the extracted area [ figure 2 ] along with two other similar looking lesions on palate close to the alveolus on the left side in the molar region and in the maxillary tuberosity area on the same side [ figure 3 ] . on examination ,
the lesions were reddish in color , firm in consistency and bleeding on probing was also noticed .
submandibular and sublingual lymph nodes were enlarged and fixed , but no involvement of the supraclavicular , superficial and deep cervical lymph nodes .
patient was also complaining of weight loss and dull radiating pain in the left shoulder .
recurrent lesion on the gingiva in mandibular anterior teeth region after the extraction lesion on palate close to the alveolus on the left side in the molar region and in the maxillary tuberosity area on the same side on routine investigation , hemoglobin was seen to be reduced by two units over a period of 20 days .
orthopantomogram revealed bone loss in the edentulous alveolus in relation to lower left and right incisor area and left canine premolar region [ figure 4 ] orthopantomogram revealing bone loss in the edentulous alveolus in relation to lower left and right incisor area and left canine
premolar region all the three lesions were excised in the department of oral surgery and sent for histopathological examination . on gross examination , there were three bits of firm consistency ; light brown in color .
size of the larger bit was 1.5 1 1 cm , and two smaller bits of size each 1.5 0.5 0.5 cm .
two out of three bits showed stratified squamous epithelium overlying connective tissue , which appeared torn at places which was thought to be a processing error .
underlying connective tissue showed some atypical cells with granular cytoplasm which were arranged in alveolar pattern .
large atypical hyperchromatic cells and some clear cells with nucleus pushed to one side were also seen .
none of the cells had any resemblance to the native cells of oral mucosa [ figure 5 ] .
h and e photomicrograph of magnification 40 showing large atypical hyperchromatic cells and some clear cells with nucleus pushed to one side patient underwent human immunodeficiency virus ( hiv ) test to rule out any hiv associated tumor , but it came negative .
other differential diagnoses were malignant minor salivary gland neoplasm , angioproliferative lesions , melanoma , and lymphoma . to rule out malignant salivary gland neoplasm , immunohistochemistry using p63
immunohistochemical ( ihc ) markers , leucocyte common antigen ( lca ) and cd 34 , were used to rule out lymphoma and angioproliferative lesions , respectively . to rule out metastasis from lung and thyroid , thyroid transcription factor ( ttf-1 )
immunohistochemistry for cytokeratin showed focal positivity [ figure 6 ] which suggested metastasis from kidney or gastrointestinal tract ( git ) or lung .
immunohistochemistry for cytokeratin showing focal positivity , 4 ultrasound of chest and abdomen showed hyperechoic bilateral adrenal mass .
x - ray chest suggested a homogenous opacity in the apex of left lung [ figure 7 ] with destruction of underlying ribs .
x - ray was suggestive of pancoast tumor . computerized tomography ( ct ) scan of chest and abdomen with iv contrast revealed an irregularly and poorly enhancing soft tissue density mass in the apico - posterior segment of left upper lobe of size 6.2 5 cm [ figure 8 ] .
left apical soft tissue mass lesion measuring approx 7 5 cm with destruction of the adjoining posterior aspect of left rib was also noted .
well defined poorly enhancing areas were noted in the aorto pulmonary window and left hilum suggestive of enlarged lymphnodes of size 3 2 cm .
a left suprarenal mass was noted of size 5 3.2 cm [ figure 9 ] .
x - ray chest suggesting a homogenous opacity in the apex of left lung the ct scan of chest revealing an irregularly and poorly enhancing soft tissue density mass in the apico - posterior segment of left upper lobe the ct scan of abdomen revealing a left suprarenal mass ct scan of head and neck region revealed destruction of left alveolar process with enhancing soft tissue component .
there was destruction of floor of the left maxillary sinus with soft tissue component into it [ figure 10 ] .
multiple enlarged bilateral level ia , ib , and ii nodes were noticed . a cyst measuring 1.3 1 cm
the ct scan of head and neck region revealed destruction of left alveolar process and floor of the left maxillary sinus with soft tissue component infiltrating into it the lesion was diagnosed as bronchoalveolar carcinoma of the left lung metastasized to bilateral adrenal glands and multiple sites in the oral cavity .
metastasis to the oral cavity is very rare and represents only 1% of all neoplasm in the oral cavity . in 25% of the cases ,
oral metastases are found to be the first sign of the metastatic spread ; and in 23% of the cases , it is the first indication of an undiscovered malignancy at a distant site .
oral soft tissues were less frequently affected than the jaw bones ( 1:2.5 ) . in the oral soft tissues ,
the major primary sites presenting oral metastases were the lung , kidney , liver , and prostate for men ; breast , female genital organs ( fgo ) , kidney , and colo - rectum for women . in men ,
the lung was the most common primary site affecting both the jawbones and oral mucosa ( 22% and 31.3% , respectively ) followed by the prostate gland in the jawbones ( 11% ) , and kidney in the oral soft tissues ( 14% ) . in women ,
the breast was the most common primary tumor affecting the jawbones and soft tissues ( 41% and 24.3% , respectively ) , followed by the adrenal and fgo to the jawbones ( 7.7% ) , and fgo to the soft tissues ( 14.8% ) .
lung carcinoma normally metastasizes to the gingiva and kidney primary metastasizes to the jaw . according to van der waal , in most patients ,
this particular case is worth reporting , because , in spite of the wide spread metastasis , the patient was unaware of the symptoms , except for the presence of recurrent oral lesions .
thus , a retrograde diagnosis had to be made by an experienced pathologist with the aid of all supporting investigations .
pancoast tumor is a tumor in the apico - posterior part of the lung . it represents fewer than 5% of all primary lung cancers .
pancoast tumor can invade the brachial plexus , pleura , or ribs , causing shoulder and upper extremity pain and weakness or atrophy of the ipsilateral hand and horner 's syndrome ( ptosis , miosis , enophthalmos , and anhidrosis ) .
more than 95% of pancoast tumors are non small cell carcinomas , most commonly squamous cell carcinomas ( 52% ) , or adenocarcinomas ( 23% ) , and large cell carcinomas ( approximately 23% ) .
bronchoalveolar carcinoma , a subtype of adenocarcinoma , is a malignant neoplasm of the lung arising from the epithelium of the bronchus or bronchiole in which patient presents with a variety of clinical manifestations like cough , weight loss , chest pain , and dyspnea . in this particular case , patient did not have any of these features except for occasional dull radiating pain in the shoulder .
brain , adrenal gland , liver , and bone are the common distant sites for a pancoast tumor to be metastasized . to the best of our knowledge , there have been no previous reports of metastases of pancoast tumors to the gingiva . though the adrenal gland is one of the common sites of metastasis of pancoast tumor , it usually occurs unilaterally .
however , bilateral adrenal metastases are seen in 10% of all lung cancer patients ; of these 23% occurs at the time of initial presentation of non - small cell lung cancer .
studies have shown that bilateral adrenal neoplasms are almost always metastatic tumors rather than primary , and clinical presentation varies with tumor type .
hence , there was a need for search of a primary elsewhere in the body in our case , even after locating bilateral mass in the adrenal gland .
to the best of our knowledge , as of now , there is no case report of simultaneous metastasis to both adrenal glands and oral cavity from a lung primary with the first symptoms noted clinically in the oral cavity and the patient being apparently healthy . as the prognosis of the metastatic lesions to the oral cavity is very poor , combination chemotherapy to alleviate the symptoms is the only preferred therapeutic modality . because of its rarity , the diagnosis of metastatic lesions in the oral cavity is very often missed .
so , diligent clinical and histopathological investigations should be done to diagnose the metastatic lesion and its origin . | metastatic lesions to the oral region are uncommon and account for approximately 1% of all malignant oral tumors . in 25% of the cases ,
oral metastases are found to be the first sign of the metastatic spread ; and in 23% of the cases , it is the first indication of an undiscovered malignancy at a distant site .
metastases to oral soft tissues are even less frequent than jaw bones .
because of its rarity , the clinical presentation of a metastatic lesion in the oral cavity can be deceiving , leading to a misdiagnosis of a benign process ; therefore , in any case where the clinical presentation is unusual , especially in patients with a known malignant disease , a biopsy is mandatory . here
, we are presenting a rare case of multiple secondary tumors in the attached gingiva in an otherwise apparently healthy patient with no other symptoms of the primary tumor .
it subsequently led to the diagnosis of pancoast tumor ( bronchoalveolar carcinoma ) metastasizing simultaneously to multiple sites in the oral cavity and bilateral adrenal glands . |
alarming increase in childhood obesity is one of the major health concerns due to its long - term health consequences as cardiovascular disease , type 2 diabetes , hypertension , fatty liver etc .
high prevalence rate of overweight and obesity is reported in many studies in iranian pediatric population .
the relationship of obesity and insulin resistance is well - established . although , the risk of insulin resistance is higher in overweight persons , but all overweight persons are not insulin resistant .
it modulates long - term energy intake and might identify children at risk of obesity .
thus , in spite of high leptin levels , its metabolic actions might face resistance . moreover
association of leptin and insulin resistance is documented . although , some animal studies reported insulin as a potent regulator of leptin expression , but such experience is limited from human studies .
some studies have evaluated the leptin or insulin levels and their associations among adults , but few studies are conducted in the pediatric age group . in addition , the effects of ethnic differences and diverse lifestyles on levels of insulin and leptin levels are reported .
this study aims to compare insulin and leptin levels , as well as their correlations in a nationally representative sample of overweight and normal - weight iranian adolescents .
this study was conducted as a sub - study of the third survey of a national surveillance program entitled childhood and adolescence surveillance and prevention of adult non - communicable diseases study . after obtaining the ethical confirmation from national and provincial committees , the study was conducted in 2009 - 2010 among 5528 school students , aged 10 - 18 years .
participants were selected by random cluster sampling from urban and rural areas of 27 provinces in iran . those students with any chronic disease and long - term medication use were not included to the study .
the current case - control study was conducted among a randomly selected sample of 486 adolescents , i.e. , 243 with overweight and 243 with normal - weight .
the cut points suggested by the world health organization were used to categorize these groups .
we used the demographic and anthropometric data and lipid profile and fasting blood sugar obtained in the main study ; for measuring leptin and insulin , we used the serum subsamples that were kept frozen at 70c .
serum leptin levels were measured by elisa method using dueset elisa development kit ( r and d systems , abingdon , uk ) , and serum insulin levels were measured by elisa method ( monobid , california , usa ) according to manufacturer 's protocols and recommendations .
we used the statistical package for the social sciences , version 17.0 ( spss inc . ,
the mean of variables studied in the case and control groups were compared by independent t , chi - square , and mann - whitney u - tests , where applicable .
pearson correlation was used to determine the association of insulin and leptin levels with other variables .
we used the statistical package for the social sciences , version 17.0 ( spss inc . ,
the mean of variables studied in the case and control groups were compared by independent t , chi - square , and mann - whitney u - tests , where applicable .
pearson correlation was used to determine the association of insulin and leptin levels with other variables .
the mean age and body mass index ( bmi ) of participants were 14.10 2.82 years and 22.12 6.49
kg / m , respectively . the characteristics of the overweight and normal - weight participants are presented in table 1 .
insulin and leptin levels were significantly higher in obese adolescents than in their normal - weight counterparts .
characteristics of overweight and normal - weight adolescents characteristics of adolescents with or without abdominal obesity leptin concentration and most cardiometabolic risk factors were higher in participants with abdominal obesity than in those without it [ table 2 ] .
leptin level had significant correlation with age , fasting blood glucose , bmi , and insulin level [ table 3 ] .
in this study , we investigated the difference and correlations of leptin and insulin levels in overweight and normal - weight adolescents , as well as in those with and without abdominal obesity .
the main finding of this study is significant high level of insulin and leptin in obese children in compared with normal weights .
it is documented that both concentration of insulin and insulin resistance might contribute to variations in leptin levels in individuals with similar bmi .
several studies among adults showed that leptin level is higher in obese than in non - obese individuals .
likewise , a study among adolescents found higher levels of leptin in obese than in non - obese subjects . in a study , among 7 - 12-year - old children in iran , leptin was associated to obesity indexes such as bmi and waist circumference .
it is inconsistent to a previous study . in another study , among 6 - 13-year - old children in kuwait ,
fasting insulin level had a positive correlation with serum triglycerides ( tg ) and very low density lipoproteins , as well as negative correlation with high density lipoprotein - cholesterol ( hdl - c ) , and no correlation with total cholesterol .
some studies in other countries have documented the correlation of leptin and insulin with lipid profiles .
parts of inconsistencies between the study findings might be because of ethnic differences . in this study
, we did not determine the pubertal stage of participants . in a study among prepubertal children in the obese group ,
leptin showed a positive correlation with bmi , insulin , tg , and correlated negatively with hdl - c .
moreover , we did not consider the effect of physical activity on insulin and leptin levels , as found in a previous study .
in this study , we did not determine the pubertal stage of participants . in a study among prepubertal children in the obese group ,
leptin showed a positive correlation with bmi , insulin , tg , and correlated negatively with hdl - c .
moreover , we did not consider the effect of physical activity on insulin and leptin levels , as found in a previous study .
in summary , this study has confirmed the significant difference in leptin and insulin levels among overweight and normal - weight children , as well as among those with or without abdominal obesity . | background : in this study , we aim to compare insulin and leptin levels in adolescents with or without excess weight and in those with or without abdominal obesity.materials and methods : this case - control study was conducted among 486 samples .
we randomly selected 243 overweight and an equal number of normal - weight adolescents from among participants of the third survey of a national surveillance program entitled childhood and adolescence surveillance and prevention of adult non - communicable diseases study .
serum insulin and leptin were compared between two groups and their correlation was determined with other variables.results:the mean age and body mass index ( bmi ) of participants were 14.10 2.82 years and 22.12 6.49 kg / m2 , respectively .
leptin and insulin levels were higher in overweight than in normal - weight adolescents ( p < 0.05 ) .
leptin level was higher in children with abdominal obesity than in their other counterparts ( p < 0.001 ) .
leptin level was correlated with age , fasting blood glucose , bmi , and insulin level.conclusion:insulin and leptin levels were higher among overweight and obese children , which may reflect insulin and leptin - resistance . given the complications of excess weight from early life , prevention and controlling childhood obesity should be considered as a health priority . |
to date , percutaneous transluminal coronary angioplasty ( ptca ) and stenting have been the important strategies for the treatment of coronary heart diseases ( chd ) .
however , the incidence of restenosis ( rs ) is at a high level within 6 months after surgery .
although the drug - eluting stent has significantly reduced the rs incidence , the application of drug - eluting stents still has some limitations .
thus , the prevention and treatment of rs have become a hot topic in the field of interventional cardiology .
ptca may cause damage to the vascular endothelial cells ( vecs ) , aggregation of inflammatory cells , activation of platelets , and release of some cytokines such as interleukin-1 ( il-1 ) , interferon ( ifn ) , fibroblast growth factor ( fgf ) , platelet - derived factor ( pdgf ) , and transforming growth factor- ( tgf- ) .
these can lead to the migration and hyperplasia of vascular smooth muscle cells ( vsmcs ) finally resulting in vascular stenosis . tgf- , with many biological activities , has been confirmed to be an important cytokine regulating the production and deposition of extracellular matrix ( ecm ) .
tgf-1 is a growth factor with hormone - like activity , has the molecular weight of about 25 kda , and can form dimmers via disulfide bond .
studies showed , at 6 h after balloon injury , the tgf-1 expression began to rise and the increased tgf-1 sustained for 14 days .
tgf-1 may stimulate the proliferation of neointimal cells and induce the synthesis and remodeling of ecm resulting in vascular restenosis . in vivo study
tranilast was found to effectively reduce the thickening of neointima and restenosis at the stent via reducing the tgf-1 activity or directly inhibit tgf-1 expression [ 8 , 9 ] .
in addition , tgf-1 was demonstrated to stimulate the synthesis of fibronectin in the vsmcs via the smad3 signaling pathway , leading to the deposition of ecm in the neointima , which contributes to the rs .
these findings demonstrate that neointimal formation is closely related to the tgf-1/smad3 signaling pathway , but the exact mechanism is still unclear . in our previous study ,
the adenoviral vectors expressing antisense smad3 were constructed and used to transfect vsmcs collected from rats undergoing vascular injury .
results revealed that inhibition of smad3 expression could compromise the proliferation of vsmcs . in the rat carotid artery balloon injury model ,
inhibition of smad3 expression was found to reduce the thickening of vascular intima and decrease the ratio of intima area to media area ( i / m ) . in the present study ,
adenoviral vectors expressing antisense smad3 were used to transfect vsmcs of rats undergoing balloon injury in vitro or directly injected into rats receiving balloon injury followed by detection of collagen i and iii ( components of ecm ) .
this study aimed to investigate the role of tgf-1/smad3 signaling pathway in the neointimal formation and our findings may provide evidence for the prevention and treatment of postoperative rs .
male sprague - dawley ( sd ) rats aged 6 weeks ( weight : 350450 g ) were purchased from the shanghai slac laboratory animal co. , ltd ( production license : scxk [ hu ] 2004 - 0005 ; use license : syxk[hu]2007 - 0007 ) .
the construction , packaging , amplification , and purification of blank adenovirus and adenovirus expressing antisense smad3 were purchased from the shanghai ji kaiji chemical technology company limited ( shanghai , china ) .
adenoviral vectors were prepared at 6 10 pfu / ml before study .
the 2f catheter was used to induce left carotid artery balloon injury in above rats according to previously reported methods .
two weeks later , tissue block culture method was employed to culture the vsmcs in dmem containing 10% fetal bovine serum ( fbs ) .
the vsmcs from injured artery ( injury group ) and normal vsmcs ( normal group ) were included .
the cells of passage 3 were used in the following experiments . in the in vitro experiment ,
the vsmcs from injured artery and divided into three groups and included : experiment group ( cells transfected with adenovirus expressing antisense smad3 ) , negative control group ( cells transfected with blank adenovirus ) , and blank control group ( cells collected from rats with balloon injury but without any treatment ) .
transfection was performed with the multiplicity of infection ( moi ) of 100 pfu , and detection was done 72 h later .
the rat balloon injury model was established in 90 rats according to previously reported methods . in the blank control group ,
rats underwent carotid artery balloon injury alone ; in the experiment group , rats received carotid artery balloon injury and subsequently the adenovirus expressing antisense smad3 ( 0.5 ml ; 6 10 pfu / ml ) was injected via the external carotid artery ; in the negative control group , rats received carotid artery balloon injury , and subsequently the blank adenovirus solution ( 0.5 ml ; 6 10 pfu / ml ) was injected via the external carotid artery . during the injection , the tension of common carotid artery was maintained . at 30 min after perfusion ,
the external carotid artery was clamped but the blood flow of the internal and common carotid artery was assured . following wound closure , the rats were given ad libitum assess to food and water . at 1 day , 3 days , 1 week , 2 weeks , 1 month , and 3 months after balloon injury , rats were sacrificed .
the left common carotid artery was collected , washed in normal saline , fixed in 4% paraformaldehyde , embedded in paraffin and sectioned .
a fraction of tissues were stored in liquid nitrogen and then at 80c for real - time pcr . before sample collection , 5 ml of blood
real - time pcr was done in the mx3000p thermal cycler ( applied biosystems ) .
the conditions for pcr were 95c for 5 min and 40 cycles of 95c for 30 s , 58c for 30 s , and 72c for 45 s. -actin served as an internal reference and the expression of target genes was normalized to that of -actin .
the contents of tgf-1 and type i and iii collagen in the culture medium and serum were measured with elisa according to manufacturer 's instructions .
image analysis system ( image pro plus 4.5 ) was used to measure the lumen area and intima area .
all data were expressed as means sd , and spss version 11.0 was employed for statistical analysis .
significant differences were found in the expressions of tgf-1 , smad3 , type i and iii collagen between the injury group and normal group ( p < 0.05 ) .
results from real - time pcr are shown in figure 1(a ) . in the injury group , the mrna expressions of tgf-1 , smad3 ,
type i and iii collagen were increased by 21% , 32% , 41% , and 46% , respectively , as compared to the normal group .
results demonstrated that the contents of tgf-1 , smad3 , and type i and iii collagen in the injury group were 81 6.71 , 56 5.21 , 37 2.37 , and 77 6.13 ng / ml , respectively , which were significantly different from those in the normal group . in the in vitro study , the mrna expression of smad3 in the experiment group
was markedly lowered by 47% when compared to the negative control group ( figure 2 ) ( p < 0.01 ) , but no marked difference was noted between the negative control group and blank control group ( p > 0.05 ) . in the in vitro experiment ,
the type i and iii collagen expression in the experiment group were dramatically reduced by 35% and 47% , respectively , when compared with negative control group ( p < 0.05 ) ( figure 3(a ) ) .
elisa revealed the contents of type i and iii collagen in the experiment group were 21 1.34 ng / ml and 55 2.74 ng / ml , respectively , which were markedly lower than those in the negative control group ( p < 0.05 ) ( figure 3(b ) ) .
however , significant differences in the contents of type i and iii collagen were not found between the negative control group and the blank control group ( p > 0.05 ) .
previous study showed the smad3 expression in the experiment group was significantly reduced at 1 day , 3 days , and 2 weeks after injury as compared to the negative control group ( p < 0.05 ) , thereafter decreased gradually and reached a minimal level at 3 months after injury ( 0.96 0.24 ) .
no significant difference in the smad3 expression was found between the experiment group and the negative control group at 3 months after injury ( p > 0.05 ) . in the present study ,
our findings revealed the type i collagen expression was dramatically inhibited at 3 days , 1 week and 2 weeks after injury when compared with the negative control group ( p < 0.05 ) ( figures 4(a)-4(b ) ) , but there was no significant difference between experiment group and negative control group at 3 months after injury ( p > 0.05 ) .
in addition , the type iii collagen expression was dramatically reduced at 3 days , 1 week , and 2 weeks after injury when compared with the negative control group ( p < 0.05 ) ( figures 4(c)-4(d ) ) , but no pronounced difference was found between the experiment group and the negative control group at 3 months after injury ( p > 0.05 ) .
a previous study showed the ratio of i / m in the experiment group was markedly lower than that in the negative control group ( p < 0.05 ) at 1 day , 2 weeks , and 3 months after injury , but there was no significant difference between the negative control group and the blank control group at above three time points ( p > 0.05 ) . in the present study , we also measured the vascular lumen area and intima area and results are shown in table 2 .
results showed the lumen area at 2 weeks and 3 months after injury in the experiment group was significantly increased as compared to the negative control group ( p < 0.05 ) , but marked difference was absent at 1 week after injury ( p > 0.05 ) .
the intima area in the injury group was dramatically reduced at 2 weeks and 3 months after injury as compared to the negative control group , but no significant difference was found between them at 1 week after injury ( p > 0.05 ) .
percutaneous coronary intervention ( pci ) has been the most effective strategy in the treatment of chd , but the incidence of rs is as high as 3550% at 36 months after injury , which has been a pivotal factor affecting the therapeutic efficacy of pci and become a focus in the field of chd .
overdeposition of ecm is a key step in the vascular intimal hyperplasia and lumen stenosis . in humans ,
vsmcs account for only 11% of neointima during the rs and the remaining components are ecm .
currently , studies have demonstrated that inhibition of ecm deposition is a novel strategy for the prevention of post - ptca restenosis .
tgf-1 can promote the proliferation and migration of smcs in the vascular intima and facilitate the formation of ecm resulting in rs .
tgf-1 can bind to receptors on the smooth muscle and fibroblasts and then exert its biological effects via inducing the phosphorylation of signal regulatory proteins .
the down - stream proteins of tgf-1 include erk , mapk , jnk , and smad3 , and smad3 has been confirmed as a definite and important regulator at the down - stream of tgf-1 [ 18 , 19 ] . following vascular injury ,
the tgf-1 is up - regulated and then stimulates the fibronectin synthesis via the smad3 signaling pathway , which may increase the deposition of ecm in the neointima .
in addition , tgf-1 can induce the transformation of fibroblasts into -sma expressing myofibroblasts and promote the secretion of ecm , which have been found to play important roles in the vascular remodeling .
members of smad family play critical roles in the tgf- signal transduction and different smads mediate the signal transduction of different members of smad family .
studies showed the gene transcription and apoptosis could be regulated by tgf-/smad2/3-smad4 . in the smcs
, tgf-1 can increase the phosphorylation of smad2 and smad3 , which then form heterogeneous trimmers with smad4 .
the heterogeneous trimmers then translocate into the nucleus and bind to the smad - related dna sequence , leading to the transcription of fibronectin , type i collagen and connective tissue growth factor , which may finally result in vascular rs .
multiple in vivo models [ 2326 ] revealed that the protein expression of smads was upregulated at the site of arterial injury .
studies on carotid artery injury demonstrated an upregulated expression of smad3 but not smad2 in both medial and neointimal cells . in humans , the smad3 expression at the site of rs was higher than that in the atherosclerotic plaques .
the majority of cells expressing smad3 at high level also express the markers of proliferation .
the smad3 treated artery was found to have larger lumen than that in the control group , which indicates that smad3 involves in the vascular remodeling .
the establishment of carotid artery injury in rats is relatively simple in operation and has relatively high success rate .
in addition , the pathophysiology of intimal hyperplasia following injury , and changes in the expression of related cytokines and proteins are similar to those in humans .
thus , this animal model has been widely used in the investigation of postoperative vascular rs . in our previous study , the smad3 expression in the blood vessels was detected at different time points after injury .
results showed the smad3 expression increased dramatically at 1 day after injury ( p < 0.05 ) and the high smad3 expression maintained for 2 weeks ( p < 0.05 ) but returned to nearly normal level at 3 months after injury , which were consistent with previous findings . in the present study ,
the vsmcs were collected from rats undergoing balloon injury , and results ( figure 1 ) showed the expressions of tgf-1 , smad3 , and type i and iii collagen were markedly increased when compared with the normal group ( p < 0.05 ) .
to further investigate the role of tgf-1/smad3 signaling pathway in the vsmcs induced rs , adenovirus expressing antisense smad3 was constructed and used to transfect vsmcs from rats with balloon injury and the mrna expression of smad3 was detected .
results demonstrated that the mrna expression of smad3 was reduced by about 50% ( figure 2 ) .
collagen is the most abundant component of ecm in the vascular wall and accounts for more than 50% of vascular wall with stenosis . to date
, 13 types of collagen have been identified of which 6 were found to be closely related to the vascular wall ( i , iii , iv , v , vi , and viii ) . among 6 types of collagen , types
i , iii , and iv have been found to be closely related the vascular rs .
type i and iii collagen belongs to the interstitial collagen and accounts for 80~90% of collagen in the blood vessels . in the present study
, our results showed , in vsmcs transfected with adenovirus expressing antisense smad3 , the tgf-1/smad3 expression was reduced , and type i and iii collagen expression also decreased ( figure 3 ) . further in vivo study revealed , at 2 weeks and 3 months after injury , the neointima area reduced but the lumen area increased after injection of adenovirus expressing antisense smad3 ( table 2 ) .
these findings suggest that to block the tgf-1/smad3 signaling pathway may reduce the neointimal hyperplasia to a certain extent , which may attribute to the reduced generation of ecm and type i and iii collagen .
madri et al . first noted increased immunostaining for tgf-1 in the intimal regions of rat carotid arteries 10 weeks after balloon catheter injury .
majesky et al . found that vsmcs had significantly enhanced tgf-1 levels 6 h after carotid injury in rats , being 57-fold above baseline within 24 h , and remaining elevated for 2 weeks as intimal thickening occurred . in porcine coronary arteries , balloon angioplasty injury resulted in significantly elevated active tgf-1 levels between 2 h and 7 days after intervention , returning to baseline 28 days later .
[ 5 , 32 ] found expression of transforming growth factor-1 is increased in human vascular rs lesions . at early stage of acute injury , the tgf-1 expression is significantly increased , which may be related to the thrombosis in the acute phase and release of a large amount of growth factors by platelets and local inflammation . at early stage of intima injury , the tgf-1 expression increases as a response involving in the repair of blood vessels . at 2 weeks after injury , the serum tgf-1 level decreased to a certain extent , but was still at a high level when compared with the control group . at this time , the tgf-1 further exerts biological effects to promote the proliferation of smcs and facilitate the deposition of ecm . in the present study ,
the type i and iii collagen was significantly reduced at 3 days and 2 weeks after injury ( figure 4 ) , but the changes in lumen area and intima area were the most evident at 2 weeks and 3 months after injury in the antisense smad3 group ( table 2 ) .
our findings suggest that the transfection with adenovirus expressing antisense smad3 can inhibit the smad3 expression , which then suppresses the collagen metabolism , reduces the ecm deposition , and inhibits the neointimal proliferation to a certain extent . | antisense smad3 adenoviral vectors were used to transfect vascular smooth muscle cells ( vsmcs ) from rats with balloon injury or infused into the rat balloon - catheter injured carotid arteries , and the role of tgf-1/smad3 signaling pathway in the secretion of type i and iii collagen by vsmcs following balloon injury was investigated .
antisense smad3 adenoviral vectors were used to transfect these vsmcs ( antisense smad3 group ) .
a total 90 rats were randomly assigned into blank control group , experiment group , negative control group . in the in vitro study , the expression of type i and iii collagen was markedly reduced in the antisense smad3 group when compared with the control groups ( p < 0.05 ) . in the in vivo study , the expression of type i and iii collagen was significantly lower than that in the negative control group at 3 days , 1 week and 2 weeks after injury ( p < 0.05 ) . at 2 weeks and 3 months after injury , the lumen area in the antisense smad3 group was markedly increased but the intimal area dramatically reduced when compared with the negative control ( p < 0.05 ) .
we conclude that transfection of vsmcs with antisense smad3 can reduce the secretion of type i and iii collagen which then inhibit intimal hyperplasia . |
amyloidosis is a multisystem disease of diverse causes characterized by the presence of extracellular deposits of an insoluble fibrillar protein , amyloid .
amyloid deposits are commonly found in the kidneys , nerves , vessels , liver , spleen , gastrointestinal tracts , heart and respiratory tracts .
the pulmonary involvement of amyloidosis is usually classified as being tracheobronchial , parenchymal nodular and diffuse alveolar septal types . among these , the diffuse alveolar septal type is by far the rarest , and ante - mortem diagnosis is very unusual .
the diagnosis of diffuse alveolar septal amyloidosis is usually by post - mortem examination or open lung biopsy .
only a small number of cases have been confirmed by transbronchial lung biopsy using a flexible fiberoptic bronchoscope . in korean literature , there have been many reports of primary amyloidosis but no documented case of pulmonary amyloidosis .
we describe a case of pulmonary diffuse alveolar septal amyloidosis confirmed by transbronchial lung biopsy , which also involved the kidneys , heart , nerves and gastrointestinal tracts , manifested by diffuse infiltration of the lung , nephrotic syndrome , cardiac arrhythmia and multiple nodules in the gastrointestinal tracts .
a 60-year - old woman presented with complaints of progressive dyspnea on exertion , epigastric pain and low anterior chest pain .
she was well until one year ago , when epigastric pain developed . at that time
one month later she underwent an appendectomy with an impression of acute appendicitis . at that time , a chest roentgenogram showed increased interstitial markings in both lower lung fields .
eight months ago , dyspnea on exertion and intermittent edema on her face and dorsum of the hands developed and progressed .
for the last three months she was almost in a bed - ridden state due to dyspnea on exertion and weakness . she also felt postural dizziness and a tingling sensation in both hands .
the blood pressure was 90/60 mmhg , the heart rate 60 beats / minute and respiration rate 24/min .
jugular venous engorgement was noted , and bilateral basal crackles were heard on the chest .
pitting edema was present on both dorsum of the feet , presacral and pretibial areas .
a chest roentgenogram revealed a bilateral diffuse ground - glass density , especially in the lower lung fields , with pleural effusion ( fig .
blood gas analysis showed ph 7.44 , paco2 33 mmhg , pao2 67 mmhg , hco3 22 meq / l .
the hemoglobin concentration was 11.8 g / dl , leukocyte count 6,300/mm , platelet count 410,000/mm and
the serum calcium level was 7.9 mg / dl , phosphorus 4.5 mg / dl , blood urea nitrogen 19 mg / dl and serum creatinine level 0.9 mg / dl .
the serum total protein concentration was 5.0 g / dl , albumin 2.6 g / dl and cholesterol level 388 mg / dl .
urinalysis showed specific gravity 1.025 , ph 6.0 , albumin 4 , rbc 23/high power field ( hpf ) , wbc 710/hpf , and 24-hour urine protein was 5,240 mg .
creatinine clearance was 66 ml / minute and the selectivity index of proteinuria was 0.12 .
in serum protein electrophoresis , albumin was 49.3% , alpha-1 globulin 4.0% , alpha-2 globulin 18.1% , beta globulin 17.5% and gamma globulin 11.3% .
urine protein electrophoresis showed albumin 66.2% , alpha-1 globulin 4.5% , alpha-2 globulin 5.7% , beta globulin 20.6% and gamma globulin 3.0% . in both electrophoresis
, there was no m - peak , and urine bence - jones protein was negative .
the ecg finding was sinus bradyarrhythmia with sinus pause , junctional escape beats and low voltage qrs complex in the limb leads .
a holter ecg recording showed frequent sinus bradyarrhythmia with junctional escape rhythm , a few episodes of paroxysmal supraventricular tachycardia ( sick sinus syndrome ) and multiform ventricular premature beats ( vpbs ) ( fig .
the left ventricular posterior wall , interventricular and interatrial septum were thickened , and the myocardium showed a hyperrefractile granular sparkling appearance ( fig .
3 ) . a tc - pyrophosphate myocardial scan revealed no hot uptake . in an upper gastrointestinal series and colon study , multiple polypoid lesions were suspected in the stomach , ascending colon , splenic flexure of the transverse colon and sigmoid colon . in a pulmonary function test ,
the forced vital capacity was 1.54l ( 68.1% of predicted value ) , and the forced expiratory volume in one second was 1 .
48 l / sec ( 85.5% of predicted value ) , showing mainly a restrictive pattern .
the carbon monoxide diffusing capacity corrected by alveolar volume ( dlco / va ) was 72.1% of the predicted value .
high resolution computed tomography ( hrct ) of the lung showed a diffuse thickening of the interlobular septal lines and prominence of bronchovascular core structure , suggesting a diffuse interstitial infiltrative process .
4 ) . because lymphangitic metastasis was suggested on chest ct and gastrointestinal tumor was also suspected , bronchoscopy with transbronchial lung biopsy was done .
after the procedure , the patient complained of dyspnea , and inspiratory crackle was heard on the entire lung field .
three days later , the patient suddenly experienced dizziness after standing up and loss of consciousness , and cardiac standstill developed . despite cardiopulmonary resuscitation ,
a transbronchial lung biopsy specimen revealed diffuse hyaline thickening of the alveolar septa and blood vessel walls .
polarizing microscopy following congo - red stain revealed apple - green birefringence at the vascular walls and along the alveolar septa ( fig .
electron microscopic observation revealed a massive deposit of fibrillar material in the alveolar septum ( fig .
thereafter three major types of pulmonary amyloidosis have been described : the tracheobronchial , parenchymal nodular and diffuse alveolar septal types .
minimal or moderate focal involvement of the lung by amyloid deposits have been reported in up to 88% of the patients with primary systemic amyloidosis .
a chest radiograph revealed bilateral diffuse interstitial infiltration which was aggravated during a period of one year , and high resolution ct of the lung showed diffuse thickening of the septal lines , prominence of bronchovascular core structure and bilateral pleural thickening with pleural effusion .
a pulmonary function test showed mainly a restrictive pattern and a mildly decreased diffusing capacity .
biopsy revealed diffuse hyaline thickening of the alveolar septum and blood vessel wall on light microscope , along with apple - green birefringence on polarizing microscope following congo - red staining . considering the clinical course and laboratory findings , it is certain that this case belongs to the category of diffuse alveolar septal amyloidosis .
the diagnosis of most patients is discovered at autopsy , and even if found while the patients is alive , most show an inexorable progression to respiratory failure within two years .
the cause of death in pulmonary amyloidosis is also related to cardiac involvement and there have been reports that cardiac involvement tends to parallel pulmonary involvement .
our case showed congestive heart failure , cardiac arrhythmia and a granular sparkling appearance of the myocardium on echocardiography .
although there was no pathologic confirmation , it is evident that this case involved the heart , and sudden death was related to cardiac amyloidosis , especially with conduction system involvement that was evident by ecg and holter monitoring .
diagnosis of systemic amyloidosis could be done by simple and safe methods , such as rectal biopsy or subcutaneous fat aspiration , if the clinician suspects that entity of disease .
but pulmonary amyloidosis , especially the diffuse alveolar septal type , is extremely rare and very difficult to confirm in living patients . in english literature
there are six cases reported of diffuse alveolar septal amyloidosis for which ante - mortem diagnosis was made by transbronchial lung biopsy up until 1987 . in our case ,
a roentgenogram of the gastrointestinal tracts showed multiple nodules , and a high resolution ct of the lung suggested the possibility of lymphangitic metastasis . in cases of amyloidosis ,
but since we could nt completely exclude the possibility of malignancy with systemic manifestations , we decided to perform fiberoptic bronchoscopy and transbronchial lung biopsy .
fortunately , we could confirm the diagnosis of diffuse alveolar septal amyloidosis without serious complication .
the dyspnea aggravated after bronchoscopy was probably due to congestive heart failure and soon improved .
kline et al . described three cases of pulmonary parenchymal amyloidosis diagnosed by transbronchial lung biopsy via the flexible fiberoptic bronchoscope .
although there was a report that serious complications appeared during bronchoscopy and transbronchial lung biopsy in one patient with amyloidosis , on the whole , bronchoscopy and transbronchial lung biopsy are considered relatively safe methods if carried out with caution .
we recommend that bronchoscopy be carried out under the monitoring of ecg and oxygen saturation and that an emergency operation team for open thoracotomy stand by during the procedure to control any massive bleeding .
some patients have masses that are interpreted roentgenographically as carcinoma or multiple polyps . in our case ,
a multiple polypoid lesion shown on a gastrointestinal roentgenogram was possibly due to amyloid deposits even though pathologically not proved .
our case also showed nephrotic syndrome , a tingling sensation in both hands , gastrointestinal disturbance and orthostatic hypotension suggesting involvement of the kidneys and peripheral nerves . in conclusion , this patient had pulmonary diffuse alveolar septal amyloidosis confirmed by transbronchial lung biopsy , which also involved the heart , kidneys , gastrointestinal tracts and peripheral nerves .
we suggest that when diffuse interstitial lung disease is present with systemic signs , such as nephrotic syndrome or cardiac arrhythmia , amyloidosis should be considered as a possible diagnosis and transbronchial lung biopsy be implemented as a useful confirmative diagnostic tool . | diffuse alveolar septal involvement is a rare form of pulmonary amyloidosis .
ante - mortem diagnosis is unusual , and most of the reported cases were diagnosed at autopsy .
it has recently been reported that transbronchial lung biopsy via a flexible fiberoptic bronchoscope was a relatively safe method to confirm diffuse alveolar septal amyloidosis.we report a case of pulmonary diffuse alveolar septal amyloidosis confirmed by transbronchial lung biopsy .
the patient s chief complaints were dyspnea on exertion and epigastric pain aggravated over a one - year period , while a chest roentgenogram showed bilateral diffuse interstitial infiltration .
this case also showed nephrotic syndrome , cardiac arrhythmia , congestive heart failure , a tingling sensation in both hands and multiple nodules in the gastrointestinal tracts , suggesting involvement of the kidney , heart , peripheral nerves and gastrointestinal tracts.we propose that when diffuse interstitial lung disease is present with systemic signs such as nephrotic syndrome or cardiac arrhythmia , amyloidosis should be considered as a possible diagnosis . also , transbronchial lung biopsy may be a useful confirmative diagnostic tool . |
delirium is a neuropsychiatric syndrome of acute onset and fluctuating course , clinically characterised by altered level of consciousness , attention , and disturbance in orientation , memory , thought , and behaviour .
the term delirium literally means , out of the track , and was firstly used by celsus , in the first century a.d . to describe either states of agitation or excessive somnolence .
gradually the term delirium started to be more consistently used to designate reversible states of acute brain dysfunction , associated with fever or medical and/or surgical conditions .
delirium is a common occurrence in medical or surgical wards and affects particularly elderly people with comorbidities and prior cognitive impairment .
thus , this syndrome affects 1142% of medically ill patients and complicates 2489% of hospitalizations for elderly patients with dementia .
the prevalent rates in the community are somewhat lower , ranging from 0.5% to 13% for older adults with dementia . in elective orthopaedic surgery ,
higher rates are seen in emergent hip fracture surgery , in which a large proportion of patients present with preoperative ( 4%36% ) or postoperative delirium ( up to 53% ) .
postoperative delirium after cardiac surgery varies from 2 to 57% , according to the procedure , type of patients and methodology of the study [ 1013 ] . in the context of sepsis ,
delirium is independently associated with adverse outcomes consisting not only of increased hospital stay , morbidity and mortality , but also long - term effects such as cognitive and functional deterioration and higher rates of institutionalization [ 1519 ] .
delirium , therefore , imposes a significant economic burden on health care systems , standing side by side with diabetes mellitus and falls as a major cause of increasing costs being directly responsible for an additional cost of more than $ 60,000 patient / year . despite its importance , health care professionals often fail to recognise the syndrome , and acute medical care has been found insufficient to meet the complex care needs of these frail older adult . also , more specialised clinical services , for example , acute care for the elderly ,
have been associated with a decreased incidence of delirium , suggesting that the multidisciplinary approaches may be more beneficial in both detecting and treating delirium .
the clinical relevance of delirium has led to the development of best practice guidelines by the american psychiatric association , [ 22 , 23 ] british geriatrics society ( bgs ) , and , more recently , by the national institute of clinical excellency ( nice ) which is a particularly exhaustive and cutting - edge document . since the publication of the nice guidelines , a number of additional pharmacological prophylaxis and treatment studies have followed and have contributed to further development of our understanding of best practice for delirium .
nurses are in a particularly relevant position in the healthcare system to improve detection rates , manage and provide necessary care to people with delirium , and prevent these episodes in those at high risk . in the current paper , we reflect on the clinical recognition and early diagnosis of delirium , as well as the available evidence addressing the most effective measures for prevention and treatment .
health care staff , including nurses , should be aware that different terms used in scientific literature and in clinical practice ( e.g. , acute confusional state , encephalopathy , acute brain failure , organic brain syndrome ) all refer to conditions that would meet the definition criteria of delirium . at present
, delirium is included in the two main classification systems : the revised fourth edition of the diagnostic and statistical manual of mental disorders ( dsm - iv - tr ) and the international classification of diseases ( icd-10 ) .
dsm - iv - tr diagnostic criteriain dms - iv - tr delirium is defined by the presence of disturbed consciousness ( i.e. , reduced clarity of awareness of the environment with reduced ability to focus , to sustain , or to shift attention ) and a change in cognition ( such as memory deficit , disorientation , or language disturbance ) or the development of a perceptual disturbance that is not better accounted for by a preexisting , established , or evolving dementia .
the disturbance develops over a short period of time ( usually hours to days ) and tends to fluctuate during the course of the day .
there should be evidence from clinical history , physical examination , and/or laboratory findings , that the disturbance is caused by direct physiological consequences of either a general medical condition , substance intoxication / withdrawal , or multiple etiologies .
in dms - iv - tr delirium
is defined by the presence of disturbed consciousness ( i.e. , reduced clarity of awareness of the environment with reduced ability to focus , to sustain , or to shift attention ) and a change in cognition ( such as memory deficit , disorientation , or language disturbance ) or the development of a perceptual disturbance that is not better accounted for by a preexisting , established , or evolving dementia .
the disturbance develops over a short period of time ( usually hours to days ) and tends to fluctuate during the course of the day .
there should be evidence from clinical history , physical examination , and/or laboratory findings , that the disturbance is caused by direct physiological consequences of either a general medical condition , substance intoxication / withdrawal , or multiple etiologies .
icd-10 diagnostic criteriathe diagnostic criteria for delirium provided by the icd-10 require the presence of five clinical features of the syndrome : impaired consciousness and attention , global disturbance of cognition as well as psychomotor , sleep and emotional disturbances .
this can probably explain why icd-10 has relatively lower sensitivity than dsm - iv .
the diagnostic criteria for delirium provided by the icd-10 require the presence of five clinical features of the syndrome : impaired consciousness and attention , global disturbance of cognition as well as psychomotor , sleep and emotional disturbances .
the fundamental psychopathological features of delirium are disturbed consciousness ( level of awareness or the ability to stay awake ) and reduced levels of attention ( capacity to recruit and maintain senses focused on relevant , stimuli ) which directly impair the capacity to monitor , select and integrate cognitive stimuli .
if severe enough , it can be detected during a clinical interview ( e.g. , the patient is unable to follow a conversation ) . in mild cases ,
impairment of attention is elicited only by formal cognitive testing ( e.g. , digit span , serial sevens , or naming the months in reverse order ) .
attention is impaired in early stages and throughout the course of a delirium episode , correlating with the severity of cognitive deficits [ 30 , 31 ] .
consciousness refers to the state of being awake and able to interact with the environment , allowing the integration of stimuli within the cognitive experience . in this sense
, disturbed consciousness can be considered as an impairment in alertness ( wakefulness ) , awareness , and arousal .
when present in a patient with an acute medical condition , the likelihood of delirium is high .
the sudden and global impairment in cognition characteristic of delirium is manifested as difficulty in orientation ( impaired awareness of oneself and one 's surroundings in terms of time , place and person ) ; memory ( impaired ability to learn new information or to recall previously learned information ) ; language and thought ( disturbance in the comprehension and/or expression of speech as well as abnormalities in the flow and connectivity of thought ) ; visuospatial abilities ( impaired capacity to construct and draw geometric configurations ) .
specific deficits in visual perception , not necessarily related with cognitive performance , have been described in people with delirium .
these may underlie perceptual disturbances , particularly of visual modality , such as illusions ( misinterpretations of real sensory stimuli , as when the patient in a dark environment sees a threatening figure emanating from shadows on the walls ) ( see figure 1 ) , hallucinations ( ranging from simple flashes or unstructured sounds to elaborate visions , that occur without corresponding sensory stimuli ) .
a range of behavioural and emotional symptoms , not specifically described in dsm - iv criteria but more adequately reflected in icd-10 , are frequently observed during delirium : sleep - wake disturbances , lability of affect , delusions , and motor disturbances .
disturbances in sleep - wake cycle are common in patients with delirium ranging from mild sleep continuity disturbance at night or occasional drowsiness during the day to severe circadian fragmentation with multiple periods of sleep and wakefulness . when present , delusional ideas consist of false beliefs usually of suspicious or persecutory content ( paranoid ideation ) poorly systematized and containing relatively few elements ( simple delusions ) .
patients often do not spontaneously verbalize these ideas as they are frightened and quite guarded .
instead , they are more likely to manifest a range of emotions associated with a sense of threat ( apprehension , worry , irritability , or distress as stated in nice guidelines ) . not surprisingly , lability of affect ( or mood ) is frequently observed in subjects with delirium and this
contrary to common belief , there is evidence that most patients will retain in the future , vivid and detailed memories about experiencing delirium .
acute confusion is remembered as a state dominated by mixed emotions associated with recent and distant memories of events , places , and people with dissolution of time and space which are organized in a dream - like narrative .
although this can sometimes be difficult to express in words , for most patients delirium is a negative experience , inducing discomfort even after recovery , originated by worries about what had happened to them .
changes in motor behaviour have been recognized for long in patients with delirium involving either overactivity ( e.g. , restlessness or agitation ) or underactivity ( motor retardation ) .
aggressive behaviour may occur as a consequence of increasing levels of paranoid ideation and irritability , potentiated by other factors ( e.g. , hunger , sleepiness , and pain ) . trying to reassure
the patient often increases suspiciousness as the interviewer may be perceived as being involved in the plot .
thus , it is usually more helpful to acknowledge the patient 's concerns and to follow a patient - centred interview in order to trace his beliefs .
overall , there is a lack of evidence about the different patterns of motor activity and their stability during a delirium episode .
particularly , there is a lack of agreement about whether motor features should be independently assessed or clustered with the associated neurobehavioural symptoms . in clinical practice ,
it is common to classify delirium into different subtypes , based on the predominance of these psychomotor features . thus , the hypoactive subtype is characterized by reduced alertness , sedation , and reduction of motor activity , whereas , the hyperactive form is associated with hypervigilance , overt psychotic features ( e.g. , hallucinations , delusions ) , and agitation .
please note that psychotic features are also present albeit less frequently in people with hypoactive delirium ( reviewed by friedlander et al .
2004 ) . as it became apparent that most cases of delirium have overlapping features of these two subtypes , a third , mixed
, subtype was proposed . however , in recent years , it has been noted that a small portion of delirium patients ( 322% ) do not have evidence of a motor component in their clinical symptomatology over the previous 24 hours , and thus do not meet the criteria for hypo- , hyper- , or mixed form of delirium [ 29 , 38 , 39 ] . in this context , a new subtyping scheme proposed by meagher et al . , designed for use by medical and nonmedical professionals , can be a useful tool to characterize the motor features of delirium .
interestingly , the hyperactive subtype is still considered as the predominant form of delirium ( up to 80% of medical students , mukaetova - ladinska , unpublished data ) , despite the lower prevalence rates . in fact , the mixed and hypoactive subtypes are more prevalent ( 55% and 46% , resp . , [ 40 , 41 ] ) .
in particular , the hypoactive delirium type is associated with higher mortality , older age ( 22% in adults versus 41% in elderly ) , palliative care needs , polycomorbidity , and severity of illness and is usually either overlooked and undiagnosed ( in particular in intensive care setting ) or misdiagnosed as depression or fatigue .
delirium is the clinical manifestation of an acute and global disruption in brain homeostasis , resulting in the failure of high integrative cognitive , behavioural , and emotional functions ( discussed above ) .
thus , any kind of insult affecting the neurophysiological processes of the central nervous system ( cns ) can elicit an episode of delirium . in the light of a diversity of medical or surgical conditions associated with delirium ,
it remains largely unknown how pathophysiological changes occurring in the periphery can result in the disruption of brain function .
yet , it is clear that some factors ( e.g. , increased age , dementia , high burden of comorbidities ) render the subject more prone to develop delirium when exposed to even minor insults ( e.g. , urinary tract infection ) .
also , numerous studies in different clinical settings have shown that delirium is a heterogeneous condition and can be elicited by the combined action of a diversity of factors ( table 1 ) .
thus , the pathophysiology of delirium is currently conceptualized as being the complex and dynamic interplay between predisposing , protecting , and precipitating factors in a given patient . most common precipitating factors of delirium are medication , metabolic disorders , infection , surgical procedures , and cns disorders ( table 2 ) .
several studies which have focused on identifying the neurochemical changes during delirium found an imbalance in all the main neurotransmitters ( acetylcholine , serotonin , dopamine , glutamate , gaba ) .
also , neuropeptides , catecolamines , cortisol , and inflammatory markers have been implicated in delirium pathophysiology .
currently , the two main theories for delirium pathophysiology are cholinergic deficiency and aberrant stress response / neuroinflammation . probably , the first evidence supporting the cholinergic deficiency hypothesis originated from the observation that delirium , cognitive impairment , and psychosis are induced by toxics ( atropa belladonna ) and drugs with anticholinergic action ( e.g. , tricyclic antidepressants , antihistamines ) .
in addition to direct pharmacological antagonism , failure of cholinergic system during delirium has been proposed to be also the result of disruption in acetylcholine ( ach ) synthesis , transport , and release . indeed ,
metabolism of ach is intimately related to energetic status of neurons as it of its steps are dependent on adenosine triphosphate ( atp , the major source of energy for most metabolic processes in living organisms and cells ) and its precursor acetyl - coenzyme a. any insult that affects the oxidative chain , such as hypoxia or inflammation , can then impair ach availability in the brain and disrupt several cognitive processes .
acetylcholine deficit , due to cholinergic neuronal loss , has been considered a potential mechanism explaining the recognized susceptibility of patients with dementia to develop delirium .
thus , despite being elicited by a wide number of causes , central cholinergic deficit has been proposed as a final pathway to delirium considering that its clinical presentation is relatively stereotyped [ 52 , 53 ] .
more recently , animal experiments , particularly those by cunningham et al . , have clearly shown that peripheral or local precipitating factors ( e.g. , lipopolysaccharide ) can evoke pathophysiological events within the central nervous system ( cns ) , with production of proinflammatory cytokines by microglial cells .
these neuroinflammatory changes are coupled with associated cognitive and behavioural disturbances , the so - called sickness behavioural syndrome similar to delirium [ 54 , 55 ] .
a related hypothesis postulates that an aberrant stress response with exaggerated production of cortisol underlies the pathophysiological features of delirium . in line with this evidence
, several studies in medical and surgical patients have shown that plasma levels of several inflammatory markers , particularly il-6 , and cortisol are altered before and/or during delirium supporting the aberrant stress response / neuroinflammatory hypothesis of delirium .
interestingly , a significant interaction exists between the cholinergic system and the innate immune response through the cholinergic anti - inflammatory pathway . although not presently available , pharmacological strategies that can modulate the aberrant stress response / neuroinflammatory pathway may well offer new therapeutic tools to be used in the management of delirium .
neurochemical and neuroimaging changes in deliriumfunctional neuroimaging studies report significant although nonspecific reductions in brain blood perfusion and white matter hyperintensities during delirium .
similarly , lower fractional anisotropy values ( determined by diffusion tensor imaging ) of deep white matter and thalamus have been identified in elderly with postoperative delirium . however , since many of the delirious patients in these studies had impairments in memory , executive function , and attention at three months , in absence of baseline cognitive impairment , further studies are now needed to examine the relationship between currently available imaging techniques and their usefulness in diagnosing and further characterisation of the delirium syndrome .
since dementia with lewy bodies and delirium share somewhat similar clinical phenotype , it would be of interest to see whether the currently available datscan ( ioflupane , 123-i fp - cit ) may find a role in the differential diagnosis of delirium .
functional neuroimaging studies report significant although nonspecific reductions in brain blood perfusion and white matter hyperintensities during delirium .
similarly , lower fractional anisotropy values ( determined by diffusion tensor imaging ) of deep white matter and thalamus have been identified in elderly with postoperative delirium . however , since many of the delirious patients in these studies had impairments in memory , executive function , and attention at three months , in absence of baseline cognitive impairment , further studies are now needed to examine the relationship between currently available imaging techniques and their usefulness in diagnosing and further characterisation of the delirium syndrome .
since dementia with lewy bodies and delirium share somewhat similar clinical phenotype , it would be of interest to see whether the currently available datscan ( ioflupane , 123-i fp - cit ) may find a role in the differential diagnosis of delirium .
considering that delirium has no pathognomonic features , central to the diagnosis is the identification of a cluster of nonspecific signs and symptoms ( described above ) within a temporal frame that links the onset or exacerbation of a general medical condition ( and/or substance use ) to the change in mental status .
thus , there is an overall agreement that delirium is far more frequent than it is recognized by medical or nursing staff . importantly , under or misrecognition of delirium is associated with adverse outcomes , including increased mortality . the first step to address
this problem is to increase the awareness of all healthcare providers , even nonspecialists , about the clinical relevance of delirium in clinical setting .
a high degree of clinical expertise is crucial to detect any acute change in patient 's mental status presenting as the early signs of delirium .
recognition of hypoactive delirium is particularly challenging and demands a careful monitoring of patient 's behaviour at the bedside in order to detect worsened concentration , reduced mobility or motor activity , changes in appetite or social withdrawal .
the presence of factors associated with increased risk of delirium ( age 65 , prior or present cognitive impairment , current hip fracture , and severe illness ) warrants a more close clinical monitoring .
irrespective of that , all patients admitted to the hospital should be regularly assessed for delirium ( at least daily ) .
some authors recommend daily chart reviews of patient status based on nursing and medical notes as a complementary method to detect delirium .
although this can be a source of misidentification of delirium ( especially when the patient has dementia , severe illness or high baseline delirium risk ) , chart - based detection associated with standard assessment has proved to be useful in some particular settings , such as in intensive care units .
use of predictive models can also be a cost - effective method of selecting patients with high - risk of delirium , in whom screening should be done as a routine practice .
the distinction between the longstanding cognitive impairment and the acute onset confusion relays on a good collateral information from relatives and carers . a simple question directed to a patient 's friend or relative (
do you feel that [ patient 's name ] has been more confused lately ? ) has shown to have a sensitivity of 80% , a specificity of 71% , and a high negative predictive value ( 91% ) in relation to the diagnosis of delirium based on a psychiatric interview . when assessing patients with delirium , it is necessary to use a more focused and structured interview when compared to other patients .
this can be achieved by using simple , closed - ended questions , redirecting the patient and do not allow long periods of silence .
a healthcare professional proficient in the diagnosis of delirium should carry out the assessment of patients presenting with warning signs .
although dms - iv or icd-10 criteria remain the gold - standard for diagnosis of delirium , confusion assessment method ( cam ) and cam - icu ( for critically ill patients ) are valid alternatives .
the cam is a simple instrument initially developed for screening of delirium by trained nonpsychiatrists .
the diagnostic algorithm , based on dsm - iii - r criteria , assesses four features : ( 1 ) acute onset and fluctuating course ( 2 ) inattention ( 3 ) disorganized thinking ( 4 ) altered level of consciousness .
delirium is diagnosed when both acute onset / fluctuating course and inattention are present ( features 1 and 2 ) and at least one of other two features .
cam was first validated in a sample of 56 medical patients and found to have high sensitivity ( 94 to 100% ) specificity ( 9095% ) and inter - rater reliability when compared to psychiatric comprehensive assessment .
it is easy to administer and can be completed in 510 minutes based on observations made during an interview that should include some formal cognitive assessment ( e.g. , mini - mental state examination ) . in hospital
setting , the cam test has a sensitivity ranging from 43% to 90% and a specificity from 84% to 100% ( when using dsm - iv criteria as the reference ) .
the cam - icu assess on the presence or absence of the following features : acute onset or fluctuation course and inattention and either disorganized thinking or altered level of consciousness , and has a sensitivity to detect delirium of 93100% , and specificity of 98100% , and similarly , high inter - rater reliability .
when the cam is rated by untrained nurses and without any formal cognitive assessment , delirium is often unrecognized .
thus , although cam is currently the most widely used instrument for detection of delirium , adequate training is necessary to enhance its sensitivity and specificity .
furthermore , this training should involve nursing staff engaged in the care of people with delirium , to improve their clinical skills in detecting and monitoring these patients .
apart from cam , a large number of other instruments have been developed to improve detection rates of delirium and/or to measure its severity ( reviewed in adamis et al . ) . among those ,
a substantially revised version of drs was published in 1998 ( drs - r-98 ) , consisting of a 3-item diagnostic section and 13-item severity section to be scored in the first assessment . for longitudinal assessments only , the severity items should be rated from 0 to 3 points based on all sources of information available .
memorial delirium assessment scale ( mdas ) has been widely used in critical care and in patients with advanced cancer .
it consists of a 10-item scale assessing for cognition ( 3 items ) and neuropsychiatric symptoms and is best suited for quantification of delirium severity rather than for screening or diagnosis .
the neelon and champagne ( neecham ) confusion scale was developed by nurses in order to assess patients based on observations in the course of providing care to patients .
it contains nine items divided into three subscales ( responsiveness - information processing , behavior , and vital functions ) .
a score of 30 indicates normal function and 0 severe confusion with a cutoff point for delirium of 24 .
delirium observation screening scale ( dos ) was developed to rate nurses ' observations during regular care .
the scale has a good predictive validity against the diagnosis made by a geriatrician based on dsm - iv criteria and has a concurrent validity , as tested by comparison with cam , of 0.63 .
nonspecific tests for delirium ( e.g. , mmse , clock drawing test ) can also be useful for establishing the baseline cognitive level of the patients , which can be compared with the subsequent assessments .
dsm - iv - tr underscores the importance of considering a pre - existing , established or evolving dementia that can better explain the symptoms of delirium . yet
thus , delirium complicates 24 to 89% of inpatient stays for elderly patients with dementia .
inversely , the available evidence strongly suggests that delirium increases the risk of new - onset dementia at long term , as much as 6-fold at three - year followup .
also , people with pre - existing dementia suffer from an acceleration of cognitive decline following an episode of delirium .
delirium is said to be superimposed on a dementia when an acute change in mental status occurs in a subject with an ongoing dementia .
failure to differentiate delirium from pre - existing dementia is clinically relevant as it can lead to serious medical conditions being missed and thus not treated .
this may be particularly true when behavioural or cognitive changes in a patient with dementia are attributed to
while both delirium and dementia are characterized by a global impairment of cognition , they can be differentiated based on clinical features and natural course ( table 3 ) .
thus , in delirium the global cognitive impairment emerges rapidly in a patient with disturbed consciousness and attention in the context of a medical or surgical condition .
this contrasts with demented nondelirious subjects in whom cognitive impairments are primarily caused by the sustained , progressive brain disorder rather than by a dysfunction of consciousness and attention which are generally preserved .
however , there is a substantial clinical overlap between the two conditions and it may prove difficult to differentiate between the 2 syndromes .
there is no strong evidence that delirium has distinct features when occurring in people with prior dementia .
however , recent studies suggest that level of consciousness and hyperactive motor features can be more frequent among delirious demented patients than in nondemented patients with delirium [ 81 , 82 ] . the key issue in diagnosing delirium in demented patients is to determine whether there is a change in the baseline clinical picture or whether the presenting symptoms are only an expression of pre - existing cognitive disorder . for that , it is crucial to have knowledge of the premorbid mental status , which can be achieved by clinical evaluation and/or collateral information ( family caregivers , family practitioners , etc . ) .
clinical diagnosis of delirium in patients with dementia should focus , therefore , primarily on assessment of level of consciousness and attention rather than global cognitive impairment , which are common to both . nevertheless , the crucial issue in the clinical daily practice is not so much to classify a patient as having pure forms of delirium or dementia but , rather to identify and remove the reversible components of the clinical picture .
thus , in practical terms any confused patient should be considered to have delirium until proven otherwise .
the hypoactive form of delirium ( representing the majority of cases , as reviewed above ) and delirium in individuals with advanced age , sensorial deficits , prior cognitive impairment , or dementia and medical problems like infection or dehydration are the main reasons for the acute confusional sate not being recognised and diagnosed [ 69 , 84 , 85 ] .
hypoactive delirium and dementia comorbidity , appear to be the best predictors for overlooking delirium in the elderly with cognitive impairment .
similarly , presence of dementia influences the survival time and is associated with higher death risk , irrespectively of the delirium subtype [ 86 , 87 ]
. this may be due to the higher rates of polycomorbidities and use of neuroleptic medication in dementia subjects , already described to be associated with higher death risk .
all these findings indicate the need for further improvement of the medical status and care , especially for the elderly with dementia , in order to decrease the risk factors for a delirium episode in this frail population .
additional causes of underrecognition of delirium associated with healthcare providers include misinterpreting compliant behaviour as an indicator of intact cognition and normalization of behaviour changes ( e.g. , he 's only tired , it is normal to get confused during an infection ) .
a detailed medical history , preferably obtained from different sources , should assess comorbidities and must include a careful review of medication with particular attention to recently introduced or discontinued drugs and those with anticholinergic potential .
physical examination should evaluate major systems and vital signs searching for medical causes of delirium .
useful auxiliary exams generally include blood count , electrolytes , renal , hepatic function , urine analysis , chest x - ray and ecg . whenever considered necessary , other assessments should be requested , for a complete evaluation ( e.g. , toxicologic analysis , neuroimaging , lumbar puncture ) ( table 4 ) .
frequently , patients with dementia simultaneously have multiple subthreshold conditions whose conjugation can precipitate delirium ( e.g. , pressure ulcers , urinary retention , faecal impaction , dehydration ) .
so , although no sole predominant cause can be identified , all the potentially relevant precipitating factors should be corrected as possible .
once delirium is recognized in a patient ( with or without dementia ) , a prompt and thorough clinical and laboratorial evaluation should be made to identify precipitating causes , which must be corrected as soon as possible .
drug review is one of them , in order to minimize the potential risk factors contributing to a delirium episode .
it is essential to review urgently the medications , stop any non - essential drugs , and those with significant anticholinergic effect as well as address possible drug interactions ( reviewed in alagiakrishnan and wiens 2004 ) .
a recent systemic review highlighted several groups of drugs that increase the risk for delirium , such as opioids ( or 2.5 , 95% ci 1.252 ) , benzodiazepines ( or-3.0 , 95% ci 1.36.8 ) dihydropyrdines ( or = 2.4 , 95% ci 1.05.8 ) , and antihistamines ( or = 1.8 , 95% ci 0.74.5 ) , but not neuroleptics ( or-0.9 , 95% ci 0.61.3 ) or digoxin ( or = 0.5 , 95% ci 0.30.9 ) .
the findings from this review recommend considering reducing and/or stopping benzodiazepines in subjects who are already on them and avoid further new prescriptions of this group of drugs , whereas the opioids should be prescribed with caution , in people with unregulated pain .
multicomponent interventions targeting specific risk factors for delirium have been developed through training and educational programmes of health care staff , nonpharmacological intervention protocols and improvement of the environment of the patient .
globally , these interventions , dependent on the provision of high - quality nursing care , are effective in reducing the incidence , severity , and duration of delirium .
multicomponent interventions have been shown to be cost - effective in preventing delirium when applied to patients at risk of delirium in a hospital setting .
important risk factors do address and include cognitive impairment / disorientation , dehydration / constipation , hypoxia , infection , immobility , pain , medication , nutrition , sensory impairment , and sleep .
these nonpharmacological interventions should be also offered to every patient with delirium and include promoting day activity , maintaining quite , well - lit environment , staff continuity , avoiding room and bed changes , providing hearing and visual aids , encouraging personal items , limiting visits especially for hyperactive delirium patients , remove noxious stimuli ( e.g. , catheters , pumps , etc . ) , limiting medical monitoring and testing ( e.g. , measuring blood pressure , temperature , blood works ) .
a recent study on elderly with dementia also found improvement of severity and duration of delirium in those elderly randomized to cognitively stimulating activities .
preventive pharmacological studies have been published with different classes of medication ( typical antipsychotics , atypical antipsychotics , benzodiazepines , cholinesterase inhibitors ) .
two placebo - controlled trials reported a reduced incidence of delirium following administration of risperidone and olanzapine perioperatively in cardiac and orthopaedic surgery . despite this promising results ,
the use of medication is not a first - line strategy in the treatment of a patient with delirium . in some distressed patients with hyperactive symptoms , such as agitation or hallucinations , haloperidol or olanzapine
risperidone ( 0.51 mg ) and quetiapine ( 2550 mg ) are reasonable alternatives .
benzodiazepines are the mainstay pharmacological treatment for delirium associated with alcohol withdrawal ( delirium tremens ) but not for other causes .
although a number of case report studies have found benefits of use of cholinesterase inhibitors ( donepezil and rivastigmine ) in the treatment [ 9699 ] and prevention [ 98 , 100 ] of delirium , randomized control trials have failed to provide evidence for the effectiveness of either donepezil or rivastigmine [ 102 , 103 ] in the treatment or prevention of delirium .
furthermore , the most recent randomized control study in critically ill patients had to be halted , due to the higher mortality rate in the rivastigmine group compared to the control subjects ( p = .07 ) . furthermore , rivastigmine was associated with a more severe type of delirium , that is , a longer stay in intensive care unit . the reported differences between the outcomes in case reports and the open labelled trial and those in the randomized control trials may be attributable to the severity of medical illness , heterogeneous clinical samples and extent of polypharmacy . similarly , further work would be required to identify whether the effectiveness of cholinesterase inhibitors may be confined to a distinct subgroup of people with delirium , for example , elderly with cognitive impairment .
as reviewed above , delirium is a neuropsychiatric syndrome commonly observed in hospital setting being associated with a wide range of adverse outcomes .
the nursing care the delirium patients receive , as well as the nursing role within the multidisciplinary delivery of care is of upmost importance .
the nice guidelines for delirium ( 2010 ) clearly identify the important role of nursing staff not only in providing patient - centred care ( taking into account patients ' needs and preferences , facilitating good communication ) , but also in undertaking adequate interventions to prevent delirium ( management of environment , maintaining a familiar team of healthcare professionals ) , and delivering of nonpharmacological interventions ( ensuring effective communication and reorientation , providing reassurance , engaging family , friends and carers , so that stress and violence be avoided or reduced / minimised ) .
although the current nice guidelines for delirium do not mention the involvement of liaison team members , the multidisciplinary involvement should include the expertise of liaison old age psychiatry teams , that will enhance the delivery of effective nursing care , and facilitate educational approaches for dealing with the acutely medically confused elderly . | delirium is a neuropsychiatric syndrome characterized by altered consciousness and attention with cognitive , emotional and behavioural symptoms .
it is particularly frequent in elderly people with medical or surgical conditions and is associated with adverse outcomes .
predisposing factors render the subject more vulnerable to a congregation of precipitating factors which potentially affect brain function and induce an imbalance in all the major neurotransmitter systems
. early diagnosis of delirium is crucial to improve the prognosis of patients requiring the identification of subtle and fluctuating signs .
increased awareness of clinical staff , particularly nurses , and routine screening of cognitive function with standardized instruments , can be decisive to increase detection rates of delirium .
general measures to prevent delirium include the implementation of protocols to systematically identify and minimize all risk factors present in a particular clinical setting .
as soon as delirium is recognized , prompt removal of precipitating factors is warranted together with environmental changes and early mobilization of patients .
low doses of haloperidol or olanzapine can be used for brief periods , for the behavioural control of delirium .
all of these measures are a part of the multicomponent strategy for prevention and treatment of delirium , in which the nursing care plays a vital role . |
throughout the brain , there are functionallyorganized regions . of particular interest are sensory maps , which produce orderly representations of incoming sensory stimuli .
one important feature of such maps is that they are discontinuous , divided into discrete functional subregions .
for example , in primary somatosensory cortex ( s1 ) the map is divided into regions activated by a particular part of the body surface .
thus , a border represents a constraint on the spread of excitation through the cortical circuit . the balance of excitation and inhibition , along with the anatomical spread of connections ( axons and dendrites ) , will determine the overall spread of excitation .
horizontal connections within superficial cortex are known to participate in integrating information across cortical regions , primarily by connecting regions with similar response properties .
one manifestation of this adaptation is the remapping of cortical topography following sensory loss . in the somatosensory cortex
, peripheral nerve damage leads to shrinkage in the corresponding deprived cortical representation and an expansion of the adjacent cortical representations into the deprived cortical area .
this remapping of function occurs immediately and continues to progress in the subsequent weeks and months [ 28 ] .
while these connections play a role in sensory integration in the normal cortex , they can be modulated for the purpose of topographic remapping and by a process of axonal sprouting and synaptogenesis .
a significant aspect of circuitry that undergoes cortical reorganization in somatosensory cortex is the border region between the deprived and nondeprived cortical regions .
both the morphological and functional aspects of the circuitry surrounding a border are altered by the border 's presence [ 912 ] .
neurons located in close proximity of a border have both dendritic [ 11 , 13 ] and axonal [ 9 , 14 ] biases towards the center of their home column .
additionally , the presence of a border limits the spread of excitation and inhibition to adjacent representations [ 10 , 12 , 14 ] .
this phenomenon may be partially explained by the fewer axons projecting into discontinuous representations .
interestingly , the morphological and functional biases of the original border relocate with the reorganized border following sensory loss [ 13 , 1517 ] .
a key feature of cortical reorganization following sensory loss is the breakdown and/or shifting of the normal border and the creation of a new border that is located within the deprived cortical representation .
this shift of the border occurs rapidly following sensory loss [ 3 , 16 , 18 ] .
layer ii / iii horizontal connections are the first to undergo reorganization following sensory loss .
one proposed mechanism for this phenomenon is a change in synaptic efficacy of horizontal connections .
long - term potentiation ( ltp ) and long - term depression ( ltd ) , both well - studied forms of synaptic plasticity , are ideal candidates for this immediate phase of cortical reorganization because they are both quick to induce and their effects are long lasting . pairing postsynaptic depolarization with stimulation is a reliable way of inducing ltp in many circuits of the brain [ 2132 ] and low frequency stimulation ( lfs ) reliably yields ltd [ 3340 ] .
ltp and ltd have been extensively studied at isolated excitatory synapses ; however little is known about coordinated changes in excitation and inhibition in individual neurons resulting from pairing or lfs .
furthermore , ltp and ltd have been studied mostly in juvenile brain circuits , and some circuits lose their plastic abilities with age .
it is unknown whether the horizontal connections in adult layer ii / iii somatosensory cortex are capable of ltp and/or ltd when a border is present and the characteristics of such plasticity , particularly whether it is pathway specific . to explore the synaptic plasticity capabilities of superficial horizontal connections we combined an in vivo / in vitro approach to determine if horizontal axons traversing through continuous ( border absent ) or discontinuous ( border present ) regions of representations are capable of ltp and/or ltd and if they differ in their ability to undergo synaptic plasticity .
postsynaptic potentials ( psps ) that contained both excitation and inhibition were examined to determine possible coordinated changes in excitation and inhibition .
since a border represents a discontinuity in the circuit , the patterns of activation of connections that cross over the border will differ from those that are within a continuous representation .
we therefore hypothesized that the ability of synaptic responses to undergo ltp and ltd will differ in connections that cross the border versus those that do not .
all animal procedures followed nih institutional guidelines and were approved by the university of california at riverside iacuc .
adult female sprague dawley rats ( 280350 g ; age 3 months or older ) were anesthetized using pentobarbital ( administered intraperitoneally , 50 mg / kg ) until areflexic and placed in a stereotaxic frame .
temperature was maintained at 38 degrees c with a heating pad and rectal thermometer .
lidocaine ( 2% ) was administered subcutaneously to pressure points and at places of incision .
all chemicals were purchased from sigma - aldrich unless otherwise stated . to determine the location of the lower jaw / forepaw border , the region of s1 at the border was physiologically mapped .
a small incision was made slightly off center from the midline , the skin and temporalis muscle were reflected back , and a craniotomy made over the region of interest in s1 . a cisternal drain was performed to reduce edema of the cortex while recordings were performed .
multiunit responses were recorded with a custom made carbon fiber electrode ( 10 m fiber diameter ) .
carbon fibers were made by placing the carbon fiber into a glass pipette , and pulled on a flaming / brown puller ( sutter instruments ) so the carbon fiber extended beyond the tip of the glass pipette , and the glass pipette was filled with 3 m nacl .
recordings were taken between 600 and 700 m below the cortical surface , in response to stimulation of the periphery ( forepaw and lower jaw ) with a glass rod .
responses were amplified 10,000 times ( a - m systems microelectrode a.c . amplifier ) and then fed into an audio monitor ( grass am10 ) .
blood vessels were used to determine the location of the electrode in the cortex and to record the responses at each penetration ( paw , jaw , or both ) .
an image of the exposed cortex was taken using a pixera digital camera ( pixera corp ) .
responses were recorded on the image using canvas 5.0 ( deneba systems inc . ) and stored on a macintosh g4 computer .
electrode penetrations were spaced 50 m or less from each other in the medial - lateral dimension to precisely determine the location of the border .
three to four of these closely spaced series of penetrations were acquired at 500 m intervals ( in the rostral / caudal dimension ) .
after the mapping was complete , 3 - 4 sites with strong responses for both forepaw and lower jaw stimulation ( i.e. , at the border ) were marked by coating the recording electrode with 2% dii dissolved in ethanol .
then , the electrode was advanced into the cortex at border sites for 2 minutes to allow dii crystals to be deposited . after mapping and marking the border ,
coronal slices ( 400 m thick ) were cut on a vibratome ( leica vt1000s ) and sections were maintained in bicarbonate buffer ( in mm : nacl , 119 ; kcl , 2.5 ; nah2po4 , 1.25 ; mgso4 , 1.3 ; cacl2 , 2.5 ; nahco3 , 26.2 ; glucose , 11 ; saturated with 95%o2/5%co2 ) for intracellular recording .
slices were undercut at layer 4 ( 500700 m from the cortical surface ) to isolate supragranular responses .
the forepaw / lower jaw border marked with dii was detected using an epifluorescent microscope .
visible local landmarks , such as vasculature , were used to locate the dii mark .
blind whole cell recordings were made approximately 100 m from the marked border and within layer ii / iii .
patch electrodes were pulled on a flaming / brown puller ( sutter instruments ) , to a tip diameter of 1.52.5 m and filled with , in mm : koh , 128 ; kcl , 7 ; egta , 0.1 ; hepes , 10 ; mg - atp , 2 ; na - gtp , 0.2 ; biocytin 0.3%0.5% ; ph 7.07.4 using d - gluconic acid ; tip resistances were 38 m. stimulating electrodes were bipolar , parylene coated tungsten electrodes with tip separation of 50 m . furthermore , one pole of the electrode was shorter by ~75 m ; thus , when the active pole was placed in the tissue for stimulating , the other was slightly above the tissue .
stimulating electrodes were placed 300 m from the recording electrode on both sides and at the same distance from the cortical surface ( figure 1(b ) ) .
thus , one electrode stimulated fibers that crossed the border ( discontinuous representation pathway ) while the other stimulated fibers that were within the representation of the neuron that was being recorded from ( continuous representation pathway ) .
these pathways have also been referred to as cross border ( cb ) and noncross border ( ncb ) [ 912 , 15 , 16 ] .
all cells were recorded in current clamp mode and current was injected to keep the resting membrane potential at 70 mv , except during the pairing or depolarization protocol .
care was taken to prevent washout of cell , by using atp and gtp in the filling solution , collecting only 5 minutes of baseline and initiating the plasticity paradigm within 10 minutes of recording from the cell .
the pathways were stimulated at 0.1 hz alternating between the two stimulating electrodes throughout the entire experiment .
stimulation intensities of the two sites were adjusted to result in a postsynaptic potential ( psp ) of half the amplitude required to trigger a spike ( ~10 mv ) and of approximately equal amplitude between the two pathways . in a subset of cells , smaller psps ( 35 mv )
were used ; since there were no significant differences seen in the results between the two groups , both small and larger amplitudes were pooled in analysis .
five minutes of baseline data were followed by either the ltp paradigm or the ltd paradigm .
we are confident that this stimulation paradigm activated discrete populations of afferents for several reasons : the low intensity stimuli ( < 0.09 ma ) yielded psps with amplitudes of 35 mv . considering that single - fiber psps in these projections had a mean amplitude of ~0.7 mv , only a small number of fibers would be activated by these small stimuli .
the low stimulus intensity yielded identical results to the higher intensity , indicating that there was no difference in the populations of afferents activated by higher and lower stimuli .
previous data from single and multifiber [ 10 , 12 , 16 ] responses clearly demonstrate that the properties of psps differ considerably between discontinuous and continuous pathways .
thus , if there is overlap between the afferent populations , it is not sufficient to obscure differences between the pathways activated . given this specificity in afferent stimulation
, we refer to homosynaptic , heterosynaptic , and associative effects throughout this paper .
homosynaptic refers to changes in response that occur in the same pathway that was subject to pairing / lfs ( i.e. , continuous pathway pairing yielding continuous pathway change ) ; heterosynaptic refers to changes in response that occur in the pathway that was not subject to pairing / lfs ( i.e. , continuous pathway pairing yielding discontinuous pathway change ) ; associative refers to changes in response that occur in both pathways after pairing / lfs in one of the pathways ( i.e. , continuous pathway pairing yielding discontinuous and continuous pathway change ) . to induce ltp ,
the neuron was depolarized by current injection at a level where it fired ~10 spikes in the 200-milliseconds of depolarization .
this depolarization was paired 30 times with the psp resulting from stimulation of discontinuous representation and/or continuous representation pathways .
the alternation of the location of stimulation at 0.1 hz was maintained . in one set of experiments ,
both pathways were paired , in another set of experiments , only one pathway was paired . for these experiments the nonpaired pathway received the baseline stimulation during the pairing .
after the pairing paradigm , psps were recorded for at least 20 minutes . in another group of cells , only the 200 millisecond depolarization was given .
the current injected into the neuron was adjusted , so the neuron fired ~10 action potentials in the 200 millisecond , as in the pairing paradigm .
however , no synaptic stimulation ( including the 0.1 hz baseline stimulation ) was given for these neurons during the depolarization paradigm .
the appropriate stimulation intensity of each pathway to elicit half the amplitude to spike or lower intensity remained constant for the duration of the recording of each cell .
for all experiments ( except when noted ) psps were evoked by alternate stimulation of both horizontal pathways at 0.1 hz .
stimulation intensities were adjusted so that psps were of approximately the same amplitude , and half the amplitude required to elicit a spike for both continuous representation and discontinuous representation pathways .
after baseline recordings , ltd was elicited by low - frequency stimulation ( lfs ; 1 hz for 900 pulses ) .
lfs was applied to only one pathway ( continuous representation or discontinuous representation pathway ) due to the risk of washout of ltd because of the length of time necessary to apply lfs .
lfs stimulation was not given at the same time to both pathways in order to avoid summation of the stimulation from the two pathways . during the presentation of lfs
after lfs , the alternating 0.1 hz stimulation resumed for post - lfs responses .
once lfs was given to a slice , it was discarded after the termination of that neuron 's recording session .
recorded signals were amplified using an axoclamp 2b amplifier ( axon instruments ) , digitized at 10 khz , and saved on a macintosh g4 computer using igor pro ( wavemetrics , inc . ) data acquisition systems .
any cell whose input resistance changed by more than 15% over the course of the experiment was not included in the analysis . amplitudes ( from baseline to peak ) of psps were analyzed off line .
psps of five minute bins were averaged for baseline and postpairing . additionally , postpairing averaged responses
were compared to baseline responses to determine the magnitude of enhancement after the pairing .
this was done by finding the slope between the 20% and 80% points of the initial rise .
postpairing data were determined as a percentage by using the following formula : averaged post - psp amplitude ( or slope ) divided by averaged pre - psp amplitude ( or slope ) times 100 .
any deviation over 15 percent of baseline that persisted 20 minutes postpairing or lfs was considered ltp , and any deviation under 15 percent of baseline that persisted beyond 20 minutes postpairing or lfs was considered ltd .
twenty minutes postpairing / lfs was chosen to maximize the number of neurons sampled , as it was difficult to hold cells for long periods of time ( > 35 minutes for the entire experiment ) . for cells that were held longer , there was no significant difference in psp amplitude at 20 minutes and at 40 minutes ( not shown ) ; so the data at 20 minutes accurately represents long - term effects .
statistical significance was determined using one - way anovas , followed by individual comparisons using a student 's t - test .
data are presented as means standard error of the mean ( sem ) . during recording of most cells
, biocytin was allowed to diffuse into the neuron and general morphology was later examined ( data not shown ) because experiments were done using blind whole cell patch recordings .
the neurons also displayed regular spiking behaviors of typical layer ii / iii cells and had typical morphology of excitatory layer ii / iii pyramidal neurons .
a total of 110 neurons from 71 animals were studied ; the minimum duration of recording was 45 minutes .
based on the firing patterns of action potentials in these cells , 100% were regular spiking pyramidal cells .
we analyzed resting membrane potentials , input resistance , distance between the border and the cell recorded , and distance between the pia and the cell .
the mean initial psp amplitude for continuous representation pathway stimulated pathways was 9.14 0.004 mv , and for discontinuous representation pathways was 8.97 0.004 mv .
psps consisted of monosynaptic and polysynaptic components as well as excitatory and inhibitory components . in the absence of pairing ,
the amplitude and slope of the psp were stable for over 60 minutes ( n = 8 , data not shown ) ; therefore , the 0.1 hz stimulation had no affect on the psp response .
it is important to note that inhibition was not blocked so that the psps consisted of coordinated epsps and ipsps . using this paradigm
, we were able to view synaptic changes more similar to those that might occur in vivo . given the short range of stimulation ( ~300 m ) , measurements of the psp peak amplitude and rise time will be affected by both direct and indirect epsps and ipsps . to ensure that the initial size of the psp did not affect the ability to induce synaptic plasticity ,
some experiments were also done at lower amplitudes ( 4 - 5 mv ) .
the initial amplitude of the psp had no effect on the ability to induce ltp or the magnitude of enhancement .
since there was no effect of initial amplitude on the results , the data were pooled . by using our in vivo / in vitro approach
we were able to directly compare the potential for plasticity for horizontal connections crossing a functional border versus horizontal connections within a representation ( figure 1 ) .
we paired robust depolarization with stimulation of one of the two pathways to attempt to induce ltp ( figure 2 ) . by pairing depolarization with only one of the two pathways in a subset of cells we were able to determine what types of plasticity were possible in these connections and what were the differences in plasticity outcomes depending on the pathway subject to pairing ( n = 30 ) .
pairing was applied to either the continuous ( figure 2(a ) ) or discontinuous ( figure 2(b ) ) pathway .
there was no significant difference in the mean population psp amplitude ( wilcoxon test ; continuous p = .09 ; discontinuous p = .09 ) after pairing of either pathway .
however , individual neurons did undergo plasticity for both the paired ( homosynaptic plasticity ) and unpaired ( heterosynaptic plasticity ) pathways ( figures 4(a ) and 4(b ) ; table 2 ) . in order to examine possible interactions between homosynaptic ( input specific ) and heterosynaptic ( not input specific ) plasticity , the pairing paradigm was presented to both pathways onto a single target neuron ( figure 3 ) .
there was not a significant difference in the mean amplitudes before and after pairing for either pathway ( figure 4(c ) ; wilcoxon test ) .
however , the two pathways were significantly different in the percent change in psp amplitude ( wilcoxon test ; p = .01 ) .
this was due to a significant reduction in the mean percent change in the discontinuous pathway .
individual neurons exhibited a range of plasticity outcomes following dual pathway pairing ( figure 4(c ) ; table 2 ) .
figure 4 shows plots of the percent change in psp amplitude for the discontinuous and continuous pathways resulting from the 3 pairing protocols discussed above . from these plots , it is clear that , even though there was no significant change in the overall mean amplitude , pairing of psps with depolarization produced various examples of potentiation or depression of the discontinuous or continuous representation pathway .
we first attempted to group the data based on correlation analysis with several independent variables .
we found no correlation between the direction of plasticity and the following parameters : ( 1 ) the first inter - stimulus interval of the first two action potentials elicited from the depolarization in the pairing paradigm ( r = 0.128 continuous paired ; r = 0.469 discontinuous paired ; r = 0.170 continuous in both paired ; r = 0.122 discontinuous in both paired ) ; ( 2 ) the time from the first action potential of the depolarization to the paired psp ( r = 0.491 continuous paired ; r = 0.370 discontinuous paired ; r = 0.062 continuous in both paired ; r = 0.085 discontinuous in both paired ) ; ( 3 ) the amplitude of the after hyperpolarization ( ahp ) following the pairing paradigm ( r = 0.071 continuous paired ; r = 0.121 discontinuous paired ; r = 0.123 continuous in both paired ; r = 0.185 discontinuous in both paired ) ; or ( 4 ) the spiking pattern of the neuron ( e.g. , regular , fast spiking and bursting ) ( r = 0.473 continuous paired ; r = 0.079 discontinuous paired ; r = 0.176 continuous in both paired ; r = 0.229 discontinuous in both paired ) . therefore , we grouped the cells by their functional outcomes resulting from the pairing paradigm .
cells were functionally grouped by our standard + /15 percent criterion for potentiation and depression .
the majority of neurons showed a significant change in amplitude following pairing ( > 15% , dashed lines ) , indicated by their data points falling outside the dashed lines ( figure 4 ) .
the direction of plasticity ( enhancement , depression , or no change ) was significantly different for the two pathways following both pathway pairing ( chi - square , p < .001 ) .
this was not observed when only one pathway was paired ( homosynaptic inputs , chi - square , 0.63 ; heterosynaptic inputs , chi - square , 0.37 ) . by examining the data using functional outcomes interesting features of layer ii / iii plasticity emerged ( figure 4 , table 2 ) . for horizontal connections confined to a continuous representation , homosynaptic ( in 25% of neurons ) and heterosynaptic ltp ( in 28.6% , ) were both observed .
however , when a horizontal pathway encompassed discontinuous representations , only homosynaptic ltp was observed ( in 21.4% of neurons ) . additionally , a percentage of neurons underwent depression of both pathways following pairing of the pathway from the continuous representation ( 37.5% of neurons ) and discontinuous representation ( 21.4% of neurons ) .
when both pathways were paired the discontinuous pathway only underwent plasticity when the continuous pathway underwent plasticity .
interestingly , the overall pattern of change for two - pathway pairing looked very similar to the pattern obtained by pairing of the continuous representation ( figures 4(a ) and 4(c ) , table 2 ) .
this suggests that when both pathways are paired the discontinuous representation does not contribute .
for all three pairing paradigms , the continuous pathway was more likely to undergo potentiation ( in 62.5% , 57.2% , and 44% of cases for pairing of the continuous , discontinuous and both pathways ) than the discontinuous ( in 37.5% , 50% , and 12% of cases for pairing of the continuous , discontinuous , and both pathways ) .
the continuous pathway plasticity was also not input specific since ltp was induced when only the other pathway was paired ( in 28.6% of cases ) .
this was never observed for the discontinuous pathway . in order to test if the synaptic plasticity induced here was nmdar dependent , we bath applied a well - known nmdar antagonist , dl-2-amino-5-phosphonovaleric acid ( apv ) . in a subset of neurons ( 7 cells )
pairing was performed on both pathways in the presence of apv ( 100 m ) .
thus , the enhancements and depressions observed via the pairing paradigm were nmda receptor - dependent . in order to examine possible nonspecific effects of depolarization on inputs , cells ( 14 cells in 9 animals ) were subject to the depolarization paradigm ( 200-milliseconds of current to yield ~10 action potentials , repeated 30 times ) , but the inputs to the cell were not stimulated during the depolarizations ( figure 6 ) .
twenty minutes after this series of depolarizations , the psps evoked by discontinuous and continuous pathway stimulation did not significantly differ from baseline , as measured by mean percent change in amplitude ( one - sample t - test ; p = .09 ) . although the pattern of changes for individual cases varied ( figure 6(d ) , table 2 ) , the plasticity outcome induced just by depolarization was significantly different from those obtained by pairing of the continuous pathway or both pathways ( chi - square : depolarization versus discontinuous p = .77 ; depolarization versus continuous p = .026 ; depolarization versus both paired p < .0001 ) . apv ( 100 m ) was bath applied to determine if this enhancement was mediated through nmda receptors .
apv did not block the effects of depolarization on the psps ( n = 5 ; table 2 ) .
thus , enhancements observed via the depolarization paradigm are not dependent on similar mechanisms to those of the pairing paradigm .
lfs , a standard way of inducing ltd in neural circuits , was presented to one of the two pathways for a subset of cells .
presentation of lfs to both pathways was never performed as the length of time needed to deliver lfs would result in washout of the cell and plasticity would likely not occur .
additionally , we did not want to stagger the stimulation between the two pathways and create a possible additive effect .
figure 7 shows the results of lfs to the continuous pathway ( n = 14 ; figure 7(a ) ) and to the discontinuous ( n = 12 ; figure 7(b ) ) .
the mean amplitudes of psps from either pathway showed no significant changes after either lfs paradigm ( wilcoxon - sign test : discontinuous lfs p = .95 ; continuous lfs p = .61 ; figure 7 ) .
as demonstrated for pairing , however , individual neurons exhibited a variety of plasticity outcomes in response to lfs ( 4 in figures 7(a ) and 7(b ) ; table 3(b ) ) .
these outcomes were significantly different from each other and also different from the outcomes resulting from pairing ( chi - square test : p = .006 ) .
like the results from pairing , lfs of the discontinuous pathway was more likely ( 100% of cases ) to cause a long - lasting change in synaptic efficacy , either ltd or ltp , than lfs to the continuous ( 78.6% of cases ; table 3 ) .
the likelihood of ltd and ltp was approximately equal when the lfs was presented . unlike the results for pairing , the continuous and the discontinuous pathway underwent ltd and ltp with approximately equal probability after lfs ( table 3(b ) ) .
heterosynaptic ltd could be observed in approximately equal numbers of cases ( 14.5% for continuous - pathway lfs and 16.7% for discontinuous pathway lfs ; table 3(b ) ) .
however , continuous - pathway lfs induced no heterosynaptic ltp ( 0% ) , while discontinuous - pathway lfs did exhibit heterosynaptic ltp ( 16.7% ) .
thus , as for pairing - induced plasticity , the discontinuous pathway was less able to affect the continuous than vice versa . in order to determine if the depression observed in these horizontal pathways was typical nmdar - dependent ltd ,
we bath applied apv ( 100 m ; n = 6 ) while presenting lfs to the continuous representation pathway ( table 3(b ) ) .
long - lasting changes in synaptic amplitude were still observed in 83.3% of cells : in 33.3% of cases both pathways depressed and in 50% of cases both pathways enhanced .
the pattern of change was not significantly altered in the presence of apv ( chi - square test lfs apv versus discontinuous lfs p = .6 ; chi - square test lfs apv versus continuous lfs p = .4 ) , although there was a notable enhancement of ltp as an outcome and a reduction in pathway - specific effects .
one - way circuits in the brain can undergo change is via ltp and ltd .
both have been linked to learning and memory [ 4648 ] and have been proposed to underlie circuit changes following sensory loss and remapping of function in the brain .
the experiments detailed here demonstrate that the horizontal connections in somatosensory cortex are plastic , even in the adult , and that the functional organization of the cortex may influence the susceptibility of connections to synaptic plasticity .
we located the forepaw / lower jaw border in vivo and then probed the circuitry surrounding this border in vitro .
the psps elicited by horizontal stimulation were similar to those previously recorded [ 10 , 16 ] .
previous control studies from our lab demonstrate that the circuitry is not altered due to in vivo mapping or the marking of the border [ 10 , 12 ] .
the pairing paradigm used in these experiments is not the same pairing paradigm used in spike time dependent plasticity since the cell is depolarized to a point where it fires 710 action potentials for the duration of the 200-millisecond depolarization .
the pairing paradigm has been extensively studied and usually yields potentiation in juvenile cortex and the hippocampus [ 14 , 21 , 25 , 32 ] . when examined as a population
, there was little apparent long - lasting synaptic change induced by this paradigm .
however , examination of individual neurons revealed significant and diverse forms of synaptic plasticity for both continuous and discontinuous pathways ( table 2 ) .
we report that the pairing paradigm yielded all three forms of synaptic plasticity when pairing was presented to the discontinuous representation pathway : associative ( both pathways paired , both enhance ) , homosynaptic ( discontinuous paired and enhances ) and heterosynaptic ( discontinuous paired , continuous enhances ) . however , when continuous representation pathways was presented with plasticity paradigms , only homosynaptic plasticity ( continuous paired and enhances ) and associative plasticity ( continuous paired and both enhance ) were observed ( figures 2(a ) and 4 ) . in general connections that crossed map discontinuities were less likely to undergo plasticity when adjacent horizontal connections received changes in activity ( table 2 )
furthermore , when the discontinuous pathway did potentiate , it was a result of homosynaptic plasticity ( i.e. , when pairing was provided to the discontinuous pathway ) ; by contrast , pairing of the continuous pathway also exhibited heterosynaptic effects ( i.e. , enhancement of the discontinuous pathway ; table 2 ) .
clearly , continuous pathway stimulation was able to engage pairing - induced synaptic plasticity to a greater extent than discontinuous . for both pathways , the potentiation observed was dependent on nmdar activation , as has been reported previously .
this pattern of plasticity is consistent with our previous data that the discontinuous pathway is less able to excite its targets than the continuous , because it provides fewer axons to its targets and its individual excitatory synapses are weaker than those of the continuous . in a hebbian system ,
weaker pathways onto a target are less able to induce homosynaptic plasticity but can be potentiated by association with concurrent plasticity in stronger inputs .
the results from lfs stimulation of the two pathways showed significant similarities and differences from the results from pairing . for lfs stimulation ,
discontinuous pathway lfs was more able to induce synaptic plasticity in either direction than continuous pathway lfs ( table 3(b ) ) . however , lfs to the continuous pathway was more likely to affect the discontinuous pathway ( i.e. , heterosynaptic plasticity ) than vice versa ( table 3(b ) ) , which was similar to the results of pairing .
the synaptic plasticity induced by lfs was not dependent on nmdar activation , which is different than previously reported for cortex .
however , blocking nmdar did alter the characteristics of synaptic plasticity induced by lfs ; in particular it increased the likelihood that the lfs paradigm would result in enhancement of the responses to either pathway ( table 3(b ) ) . one possible explanation may be the ltd induced here is dependent on endocannabinoid signaling which has been reported in young rats .
additionally , homosynaptic nmdar - independent ltd has also been observed previously in the neocortex .
we also found unexpected plasticity outcomes in these pathways ; the pairing paradigm , which typically generates ltp in other systems , induced depression in a subset of cells in this study , while the lfs paradigm induced potentiation in some cells .
unexpected plasticity outcomes were observed in both continuous and discontinuous pathway synapses ( tables 2 and figure 2(b ) ) .
as mentioned above , ltp induction in one set of inputs can lead to endocannabinoid - dependent ltd in other pathways .
furthermore , in young rats , a pairing paradigm presented to connected pairs of layer ii / iii pyramidal neurons can yield enhancement , depression , or no change in the epsp amplitude , depending upon the probability of release for that synapse and its location on the target .
furthermore , connections with low release probabilities and those made onto more distal dendrites were more likely to enhance . thus , it is clear that pairing protocols can yield both homosynaptic and heterosynaptic depression in young rats .
another factor that controls the direction of synaptic plasticity is the size of the calcium signal in the target cell . in cortex , small rises in intracellular ca
our data indicate that similar processes can occur in adult rat cortex , although the precise mechanisms underlying them remain to be determined .
unexpected plasticity outcomes may also be a result of the complex horizontal cortical circuitry in superficial cortex .
the vast majority of what we know about ltp and ltd is derived from studies examining hippocampal ltp [ 24 , 25 , 56 ] . in hippocampal slices ,
in contrast , psps examined here are more complex and are derived from monosynaptic and polysynaptic activity , as well as having both excitatory and inhibitory components .
it is important to note that inhibitory synapses were not blocked during any of the recordings in this study . therefore , any enhancement or depression seen in these experiments was in the presence of intact excitation and inhibition .
it has been demonstrated that inhibitory synapses are susceptible to both ltp and ltd based on a variety of induction protocols , including lfs , tetanus , and pairing .
our results are consistent with those of other laboratories using a pairing paradigm in adult cortex where inhibition was not blocked [ 58 , 59 ] . thus , some of the diversity of plasticity outcomes that we observed may be explained by the diverse connection patterns of single layer ii / iii neurons , the balance of excitation and inhibition , and the amplitude and time course of the calcium transients present in the neuron during various synaptic plasticity induction protocols .
we observed enhancement following robust depolarization without any pairing with synaptic stimulation ( figure 6 ; table 2 ) .
this enhancement was not nmda receptor dependent and thus operated via different mechanisms than the ltp observed following pairing .
other studies have shown similar phenomena of long lasting enhancement or ltp induced by long depolarizing steps with no presynaptic stimulation in both the cortex and hippocampus .
evidence suggests that this type of depolarization - induced enhancement is due to calcium influx from depolarization , which is most probably mediated through voltage - dependent calcium channels ( vdccs ) .
data using photolysis of caged ca in hippocampal neurons directly demonstrated that this process depends on intracellular ca and that it can induce either ltp or ltd of synapses onto the target neurons .
one potential source for the variability in plasticity outcome for individual cells is the use of only female rats of unknown estrous state in these studies .
it has been demonstrated that female rats change in their susceptibility to ltp and ltd during the estrous cycle . in particular , during proestrous when estrogen levels are high ,
the ability to induce ltp was enhanced and the ability to induce ltd was depressed in the hippocampus [ 64 , 65 ] .
it has been hypothesized that the effects on synaptic plasticity are due to the modulation of nmda or gaba receptors or by an increase in dendritic spine density induced by estrogen .
since the rats in our studies came from random points in their estrous cycles , some would be in this high - estrogen state . however , proestrus is short in the rat , lasting less than 18 hours , which makes it approximately 15% of the entire cycle .
thus , only about 15% of our rats would show this effect , which is insufficient to explain the observed variance .
this effect on ltp and ltd has not explicitly been demonstrated in the neocortex , although the increase in spine density during proestrous has been observed in both hippocampus and neocortex .
furthermore , the mechanism by which estrogen modulates synaptic plasticity is also an important issue .
for example , if estrogen modulates ltp and ltd via nmda or gaba receptors , the effect would not be observed in our in vitro system since any acute estrogen effect would be washed out ; if the modulation depends on the increase in spines , this would still be observed in the slices used .
overall , given the short period of time that the animals are in proestrus , and the use of cortical slices for this study , we do not believe that the differences observed in synaptic plasticity can be accounted for by the use of female rats . in summary
, the present study demonstrates that synapses of intracortical connections of s1 can undergo synaptic plasticity .
furthermore , the presence of a representational border affects the capacity of these synapses to undergo plasticity .
in general , connections from an adjacent representation are less able to undergo plasticity on their own .
nonassociative synaptic plasticity was also observed following robust depolarization of layer ii / iii neurons .
these results suggest that synapses originating from the different representations have different characteristics , for example , various locations of synapses on postsynaptic targets .
additionally , the results also suggest that there are multiple forms and loci ( i.e. , excitatory and inhibitory synapses ) of synaptic plasticity that affect the expression of plasticity in a complex circuit , such as supragranular s1 . while the plasticity that was seen here was diffuse and not all neurons responded to the plasticity paradigms uniformly , large - scale alterations of activity due to deafferentation would still have the capacity to alter the circuit .
the net result would depend on the specific interaction of these varied plasticity mechanisms in layer ii / iii with processes occurring in other layers and the extent of the change in activity .
the data here indicate that ltp and/or ltd have the potential to play roles in cortical reorganization following sensory loss . | horizontal connections in superficial cortical layers integrate information across sensory maps by connecting related functional columns . it has been hypothesized that these connections mediate cortical reorganization via synaptic plasticity . however , it is not known if the horizontal connections from discontinuous cortical regions can undergo plasticity in the adult .
here we located the border between two discontinuous cortical representations in vivo and used either pairing or low - frequency stimulation to induce synaptic plasticity in the horizontal connections surrounding this border in vitro .
individual neurons revealed significant and diverse forms of synaptic plasticity for horizontal connections within a continuous representation and discontinuous representations .
interestingly , both enhancement and depression were observed following both plasticity paradigms .
furthermore , plasticity was not restricted by the border 's presence .
depolarization in the absence of synaptic stimulation also produced synaptic plasticity , but with different characteristics .
these experiments suggest that plasticity of horizontal connections may mediate functional reorganization . |
although dna methylation is one of the critical ways for silencing tumor suppressor and dna repair genes during tumor initiation and progression , the mechanisms underlying dna methylation in cancer remain unclear .
here we show that prostaglandin e2 ( pge2 ) silences certain tumor suppressor and dna repair genes via dna methylation to promote tumor growth .
these findings uncover a previously unrecognized role for pge2 in the promotion of tumor progression . |
|
asthma is the most outstanding allergic disease especially in developed countries [ 1 , 2 ] .
however , in developing countries the frequency of asthma is much lower , particularly in rural areas , where the prevalence of parasite infection is high [ 35 ] .
factors associated with protection against atopy in rural populations include reduced socioeconomic level , poor living conditions , and increased overcrowding .
moreover , several studies have shown a protective role of different parasites in the development of asthma or atopy [ 610 ] .
studies conducted in venezuela have shown that geohelminth infections is associated with high levels of total ige and low levels of allergen - specific ige , as well as suppression of allergic reactivity , which is reversible by anthelmintic treatment [ 11 , 12 ] .
other authors have also shown low prevalence of positive skin prick test ( spt ) for aeroallergens in endemic areas for geohelminths [ 7 , 13 ] or schistosoma spp . [ 9 , 14 ] . we have previously reported that asthmatic individuals living in regions with high frequency of s. mansoni infection have a mild course of asthma , and that treatment for schistosomiasis leads to a worsening of the clinical manifestations of asthma .
it is noteworthy that in these previous studies conducted with s. mansoni infected patients , symptoms of asthma or frequency of positive spt was compared to individuals from outside schistosomiasis endemic areas .
the immunological mechanisms involved with protection against the development of asthma are not well known , although it has been proposed the participation of regulatory molecules [ 3 , 14 , 1620 ] .
moreover , risk or protective factors associated with asthma in helminth endemic areas remain still not well established . despite a fair amount of epidemiological information is available on risk factors for asthma in developed countries , scant attention has been given to risk factors associated with asthma in rural communities from developing countries , especially in regions endemic for schistosomiasis .
we conducted a cross - sectional study in a rural area endemic for helminths , including s. mansoni , to evaluate possible risk and protective factors associated with the presence of asthma .
in addition to demographic , socioeconomic and environmental factors , we also evaluated the influence of current s. mansoni , a lumbricoides , trichuris trichiura , and hookworm infections with the presence of asthma in individuals living in the region .
this study was carried out at gua preta , a rural community in the district of gandu , south of bahia brazil , 300 km distant from salvador , the capital of the state .
this village is composed of about 500 inhabitants , who live in poor sanitary conditions . using a standard questionnaire , age , sex , income , housing conditions , and exposure to pollutants were registered .
additionally , information on water contact was obtained individually or from guardians in case of children under 10 years old .
the international study of asthma and allergies in childhood ( isaac ) questionnaire , which assess the personal history of bronchial asthma and rhinitis in the past 12 months , as well as family history of atopy and concomitant pathologies , was applied to each individual aging from 6 to 50 years old . in order to exclude individuals with chronic obstructive pulmonary disease ( copd ) ,
a clinical evaluation , chest x - ray and spirometry were performed in all asthmatic individuals .
subjects who presented personal history of asthma in the past 12 months according to isaac questionnaire underwent a skin prick test ( spt ) for aeroallergens .
interviews were carried out initially at the health post of the region , located at the center of gua preta . the recruitment strategy consisted in household visits to invite subjects to the health post . during the last days of the recruitment , when the number of subjects who spontaneously went to the health post were lower ,
new household visits were done in order to invite and perform a home - based interview for each individual who agreed in participate in this study .
the ethical committee of the maternity climrio de oliveira , federal university of bahia , approved the present study and informed consent was obtained from individual or their legal guardians .
all participants who tested positive for parasites were treated at the end of the study .
those who had complaints of allergy were properly instructed regarding indoor environmental control and drug treatment .
the water contact questionnaire was developed based on previous observations carried out on site about habits of the population regarding the use of local rivers .
each participant was asked to provide the frequency and duration of the exposure to the main seven activities ( farming , bathing , washing clothes , washing hair , washing dishes , fishing , and playing ) .
subjects were classified across all activities into four categories to reflect the level of exposure : no exposure , low exposure ( < 1 h / week ) , medium exposure ( 13 h / week ) , or high exposure ( 13 h / day ) .
all participants received a plastic container for fecal samples at three time points 230 days apart .
participants were instructed to deposit stool sample and return the container immediately to the collection point , where samples were stored at 4c .
each stool sample had a slide prepared and tested by using the kato - katz method to estimate the number of s. mansoni , a. lumbricoides and t. trichiura eggs per gram of feces ( epg ) .
additionally , the hoffmann - pons - janer method was used to qualitatively investigate the presence of hookworm infection .
glycerinated allergens tested included dermatophagoides pteronyssinus , d. farinae , blomia tropicalis , periplaneta americana , and blatella germanica ( ipi - asac ) .
we also used histamine ( 1 : 1000 ) and saline as positive and negative controls , respectively .
spt results were obtained 20 minutes after application , and a positive skin reaction was defined as a wheal with a mean diameter greater than 3 mm .
the variable age are expressed as arithmetic mean and standard deviation ( sd ) , whereas parasite load are expressed as geometric mean and 95% of confidence interval .
helminth infections were classified into low , moderate , or high intensity of infection according to world health organization ( who ) criteria .
parasite load ranging from 1 to 99 epg for s. mansoni is classified as low , 100 to 300 epg moderate , and equal or greater than 400 epg high intensity of infection .
for a. lumbricoides low intensity of infection is defined as 1 to 4,999 epg , moderate 5,000 to 49,999 epg , and high intensity of infection is equal or greater than 50,000 epg .
light t. trichiura infection is considered as parasite load ranging from 1 to 999 epg , moderate 1,000 to 9,999 , and high intensity of infection equal or greater than 10,000 epg .
the intensity of hookworm infection was not assessed since the kato - katz technique is not adequate for quantifying hookworm eggs .
statistical analyses were performed by using the stata statistical package version 11.2 ( stata corp . , college station , tx ) .
a logistic regression model was used to test association between asthma and covariates in a univariate and multivariate way . the alpha level for statistical significance
was established as 0.05 for all analyses and odds ratio ( or ) was obtained at a 95% of confidence interval ( ci ) . in order to reduce the chance of type i error
multivariate analyses were adjusted for age , gender , number of stool samples evaluated , and/or smoking status . adjustment for age and gender
was performed because these could be possible confounding factors , since depending on gender or age lifestyle could be significantly different .
the adjustment for number of stool samples analyzed was done because 82.8% of subjects who had three samples evaluated were asthmatics , and it is well known that the kato - katz sensitivity is influenced by the number of samples evaluated , reaching a sensitivity of 91.7% for the diagnosis of schistosomiasis when four samples are analyzed . for investigating the influence of helminth infections on asthma ,
the smoking status was taken into account since this was positively associated with asthma in this region , which could be responsible for the underestimation of the real effect that helminth infections have on asthma .
the mean age was 26.9 19.0 years , ranging from 1 to 92 years .
approximately 95% of participants reported an average income less than the brazilian national minimum wage ( $250.00 ) per month . regarding the presence of pollutants 94.4% of the population uses wood burning stove and
the frequency of intestinal parasites was investigated in 406 ( 95.1% ) individuals , 214 ( 52.7% ) of whom had only one sample analyzed , whereas 160 ( 39.4% ) and 32 ( 7.9% ) subjects had two and three samples evaluated , respectively .
the helminth most frequently identified in the region was s. mansoni , affecting 57.4% of the population , followed by t. trichiura ( 36.9% ) , hookworm ( 31.8% ) , and a. lumbricoides ( 30.8% ) .
intensity of infection was assessed for s. mansoni ( 89 [ 75105 ] epg ) , a. lumbricoides ( 1,946 [ 1,2782,963 ] epg ) , and t. trichiura ( 120 [ 97149 ] epg ) .
history of exposure to contaminated water was reported by 332 ( 77.8% ) subjects , 34.3% of whom had a low level of exposure , 18.7% medium , and 47.0% were highly exposed .
the group highly exposed was composed mainly of female ( 67.9% ) , whereas the group with low level of exposure was represented mostly by men ( 68.4% ) . despite the evident influence of gender on the intensity of exposure
the group classified as highly exposed had a mean age of 27 17 years , while the groups of medium and low level of exposure had a mean age of 26 18 and 27 20 ( p > 0.05 ) , respectively .
as expected , the group that reported higher level of exposure also showed higher frequency of schistosomiasis , when compared to the nonexposed group ( table 1 ) .
the prevalence of asthma and rhinitis was evaluated by the isaac questionnaire in 335 individuals , representing all subjects who were 6 to 50 years old .
the prevalence of self - reported wheezing in the past 12 months ( here designated as asthma ) was 13.1% .
skin prick test for aeroallergens was performed on 37 out of 44 ( 84.1% ) asthmatic individuals .
false positive result , defined as presence of skin reaction in the negative control saline , was found in only one subject ( 2.3% ) . on the other hand , false negative result , defined as no skin reaction detected , even to histamine ,
was found in four ( 9.1% ) asthmatic individuals . among those 32 individuals who had a validated skin prick test result , 13 ( 35.1% )
was positive for at least one allergen , whereas 19 ( 64.9% ) of them had a negative spt result .
univariate and multivariate analysis for the association between asthma and possible risk or protector factors are presented in table 2 .
evaluated variables included gender , age , income , passive or active smoking , family history of allergy , housing quality , number of people per household , use of wood burning stoves , and level of exposure to fresh water .
the frequency of asthmatic individuals living in the endemic area who are active smokers was higher ( 26.2% ) than the prevalence of active smokers among those nonasthmatic subjects ( 11.8% ) . in order to obtain the power of this difference
, we performed a sample size calculation based on these data and found that 42 individuals in the
group have 76.1% power to detect a difference with a significance alpha level of 0.05 .
only active or passive smoking was positively associated with the presence of personal history of asthma in the past 12 months , even after adjustment for confounding factors ( table 2 ) . after controlling for
age and gender the prevalence of asthma was 5.45 ( ci 95% : 2.0914.24 ; p = 0.001 ) and 3.67 ( ci 95% : 1.837.34 ; p < 0.001 ) times higher among active and passive smokers , respectively , than nonsmokers .
the association between helminth infection or intensity of infection and asthma is shown in table 3 .
univariate analysis indicates that hookworm infection ( or = 2.54 [ 1.324.91 ] ; p = 0.005 ) , moderate intensity of a. lumbricoides infection ( or = 4.01 [ 1.749.28 ] ; p = 0.001 ) , t. trichiura ( or = 2.18 [ 1.134.20 ] ; p = 0.020 ) , and s. mansoni ( or = 2.89 [ 1.296.48 ] ; p = 0.010 ) infection were positively associated with asthma .
however when adjusting for the confounding factors age , gender , number of stool samples evaluated , and smoking status , no significant association was observed between hookworm ( or = 1.41 [ 0.543.72 ] ; p = 0.486 ) , t. trichiura ( or = 0.95 [ 0.362.54 ] ; p = 0.918 ) , s. mansoni ( or = 1.44 [ 0.484.29 ] ; p = 0.517 ) , or any helminth infection ( or = 0.94 [ 0.194.56 ] ; p = 0.935 ) and asthma .
moreover , no significant association was found between number of helminth infections and asthma ( data not shown ) .
multivariate analysis showed that a. lumbricoides infection is negatively associated with asthma ( or = 0.26 [ 0.070.94 ] ; p = 0.041 ) .
when the bonferroni correction was performed this association became nonsignificant ( p = 0.984 ) .
nevertheless , we found a significant association between a. lumbricoides infection and asthma when controlling for other helminth infections ( data not shown ) .
the association between asthma and parasite load was also assessed and we found that low ( or = 0.27 [ 0.070.94 ] p = 0.071 ) or moderate ( or = 0.29 [ 0.051.83 ] ; p = 0.187 ) intensity of a. lumbricoides infection was not associated with asthma . since only three individuals , all nonasthmatic , showed high intensity of a. lumbricoides infection in the region , we were not able to test the association between high ascariasis parasite load and asthma .
this study assessed possible risk or protective factors associated with presence of asthma in a population living in a rural poor area of bahia , brazil .
our results showed that the main risk factor associated with presence of asthma is smoking .
additionally , we demonstrated that current a. lumbricoides infection is associated with protection against asthma when adjusting for confounding factors .
the cross - sectional design , the use of questionnaires to access information on the presence of asthma , and risk factors were the major limitations of this study . the study design did not allow us to make causal inferences , and
however , we performed statistical analysis taking into account the confounding factors , and reverse causality is not possible for most of the risk factors evaluated .
we are also aware that the use of questionnaires makes the study open to information bias since it depends on the interviewed response .
also , we call attention that we did not evaluate past helminth infections and that the parasitological technique used here is not sensitive for very low parasite burden . the differentiation between asthma and copd was one of our major concerns when planning this study .
one way to reduce this possible misdiagnose was the exclusion of individuals over 50 years of age .
many authors have reported that copd rarely presents clinically before the 5th decade of life and that the prevalence of copd occurs primarily in smokers over 40 years of age [ 26 , 27 ] . according to the platino study the prevalence of copd in individuals aging from 40 to 49 years in a metropolitan area of brazil is 8.4% . in our study
only 4 ( 9% ) asthmatic individuals aged between 41 and 50 years old . therefore ,
moreover , only 1 out of 4 ( 25% ) asthmatic individual over 40 years of age was active smoker .
although we did not observe association between socioeconomic variables and asthma , other authors have demonstrated that reduced socioeconomic level and overcrowding are associated with protection against atopy in a rural region .
this phenomenon was probably not detected in our study because the overall population was homogeneous in regard to socioeconomic level , being identified only subjects with an average income less than $ 500 per month .
additionally , several other studies have showed an association between smoking and risk of asthma , which is consistent with our data [ 2932 ] .
even though this association is well known , its interpretation must be made cautiously , especially when using a questionnaire - based diagnosis of asthma .
because smokers have been reported to have more severe asthma than nonsmokers , it is expected that the use of self - reported questionnaires , such as the isaac questionnaire , may overestimate the risk of asthma among smokers . however , this bias probably did not interfere in our study since it has been shown that individuals from endemic areas for schistosomiasis have mild asthma . in order to evaluate the effect of helminth infections in the presence of asthma statistical analyses
were adjusted for smoking status , given that this is an independent determinant factor for asthma . in the last years researchers showed an increased interest in evaluating the role of helminth infections in the development of allergic diseases .
although several studies show that in endemic areas for helminths , infection with a. lumbricoides or other helminths has a negative association with atopy , possibly acting as a protective factor against the development of asthma , none of these studies was conducted in endemic area for schistosomiasis [ 68 , 12 , 34 ] .
studies carried out with individuals from endemic areas infected with s. mansoni have showed low reactivity to the skin prick test ( spt ) to aeroallergens and fewer symptoms of asthma compared to asthmatics without infection [ 10 , 15 ] , and an inverse correlation between spt and presence of infection .
it is worth noting that none of these previous studies evaluated the association between spt or symptoms of asthma and current s. mansoni infection within asthmatic subjects living in the same region .
the prevalence of positive spt to aeroallergens in asthmatic individuals included in this study was 35.1% , which is far below what is found in urban regions from brazil [ 10 , 35 , 36 ] .
nevertheless , we found no significant difference in the frequency of positive spt among asthmatics currently infected or not by any helminth ( data not shown ) . despite the frequency of positive skin test
has been low , asthmatic subjects from these regions probably have atopic asthma , demonstrated by the presence of aeroallergen - specific ige .
the presence of asthma was not associated with current infection by s. mansoni in the studied population .
however , the prevalence of asthma in the site was only 13.1% , which is much lower than the frequency observed in adolescents of 13 and 14 years old from urban areas of salvador ( 24.6% ) , feira de santana ( 21.5% ) or vitoria da conquista ( 30.5% ) , bahia , when using the same criteria for defining asthma .
the prevalence of asthma was representative of the entire study population , including individuals from 6 to 50 years old .
however , when analyzing only the age of 13 and 14 years of age , the prevalence was 15% , which is very close to the frequency observed in the general population in the endemic area and still far from that observed in other centers evaluated in bahia , brazil .
this is in agreement with other study conducted in different regions of brazil , which showed lower prevalence of asthma and rhinitis in rural than in urban areas .
thus , the presence of a protective factor for the development of asthma in an endemic community for helminths including schistosomiasis is evident , which could not be explained only by the presence of current s. mansoni infection .
the fact that these individuals inhabit a region of high endemicity , constantly exposed to s. mansoni reinfection , might be responsible for the low prevalence of asthma observed on site , with no significant difference in the frequency of asthma among currently infected or not .
on the other hand , we found in this schistosomiasis endemic area that individuals currently infected with a. lumbricoides have a lower prevalence of asthma when compared to noninfected subjects , which was not observed for the presence of t. trichiura , hookworm , any helminth infection , or even for different intensity of infection .
although this association has been lost when performing the bonferroni correction , it is well established that reducing type i error by p value adjustments increases the probability of type ii error for those association that are not null .
the formal premise for such adjustments is the much wider hypothesis that there is no association between any variables under observation , and that only random processes govern the variability of all observations .
null hypothesis presumes that all observed associations reflect only random variation that could be obtained particularly in empiric situations [ 37 , 38 ] .
once this study evaluated associations that are not empiric , but instead evidence - based , such as the association between a. lumbricoides infection and asthma , we are confident that this association was not due to random variation , and therefore it would be better to take the risk of making type i error and call attention to a possible beneficial association for asthma .
studies conducted in urban areas in brazil have showed controversial results for the association between a. lumbricoides infection and atopy [ 8 , 39 ] .
although no association between spt response and a. lumbricoides infection was found in asthmatic individuals , a recent study showed that the presence of a. lumbricoides infection is able to reduce the prevalence of positive spt response but do not affect the prevalence of asthma .
overall , helminth infection is associated with reduced risk of asthma or atopy in regions with high frequency of parasite infections [ 7 , 11 , 13 ] , whereas in areas with low endemicity , a. lumbricoides infection is associated with increased risk of atopy and asthma [ 40 , 41 ] .
although a. lumbricoides is a recognized cause of tropical pulmonary eosinophilia , chronic infection induces a regulatory immune response which includes interleukin-10- and transforming growth factor--secreting cells [ 42 , 43 ] .
in addition to the suppression of allergic inflammation , activation of the regulatory immune response induced by helminths is responsible for preventing the elimination of parasites and protects the host from damage that could be caused by excessive inflammatory response .
our findings support the hypothesis that exposure to a. lumbricoides induces a generalized suppression on the immune response , which seems to be able to reduce the risk of asthma without additive effect by helminth coinfection .
this effect was not observed for other helminth infections probably because a. lumbricoides was the less frequently helminth found in the region , which results in less exposure and lower rates of reinfection , allowing thereby the detection of differences in asthma prevalence between individuals currently infected or not . in conclusion ,
our findings indicate that smoking is the major risk factors associated with asthma in a rural population endemic for schistosomiasis .
however , in rural endemic areas for helminth infections the prevalence of asthma is much lower than what is observed in urban regions , and a. lumbricoides infection is negatively associated with the presence of asthma within the population . although we were unable to show a protective association between current s. mansoni infection and asthma , we can not rule out the possible participation of s. mansoni in modulating the immune response of allergic diseases , probably because this is a hyperendemic region where individuals are constantly reinfected .
this study contribute to a better understanding of the role of helminth infections in allergies . | protective factors associated with atopy or asthma in rural areas include socioeconomic level , overcrowding , and helminth infection . however , little epidemiological information was originated from schistosomiasis areas .
this study aimed to investigate factors associated with asthma in a schistosomiasis endemic area . a questionnaire was used to obtain information on demographics , socioeconomic , and environmental features .
the isaac questionnaire was used to identify individuals with asthma .
parasitological exam was done in all participants and skin prick test to aeroallergens in all asthmatics .
prevalence of schistosoma mansoni infection was 57.4% and ascaris lumbricoides , 30.8% .
asthma was found in 13.1% of the population , and 35.1% of them had a positive spt .
active and passive smoking was positively associated with asthma , whereas a. lumbricoides was negatively associated . in a schistosomiasis hyperendemic region ,
current infection with a. lumbricoides is protective against asthma .
however , we can not rule out the involvement of s. mansoni infection in this process . |
the term composite lymphoma ( cl ) was introduced by custer in the mid-1950s to describe cases of 2 distinct lymphomas concurrently arising in a single patient .
the incidence of cl is low with an estimated 14.7% of lymphoma cases representing cl .
typically , cl consists of 2 distinct non - hodgkin lymphomas ( nhl ) or a classic hodgkin lymphoma with an nhl ; however , case reports of 2 hodgkin lymphomas also exist . in cases of lymphoma
, diagnostic accuracy relies heavily on a pathologist 's expertise and is of great clinical consequence as it determines prognosis and selection of treatment regimen .
cl presents a unique challenge to clinicians as little data exist in regards to treatment protocols and outcomes .
here we discuss a case of a cl involving both a t - cell and a b - cell nhl and we will review the literature on the diagnostic evaluation and treatment of such a cl .
a 49-year - old woman recently diagnosed with anemia presented to the university of california irvine medical center with a chief complaint of progressively worsening cough .
she described her cough , which began a month prior to her admission , as initially mild and dry ; however , 2 days prior to admission , her symptoms changed and her cough became both more intense and productive of white sputum . on the day of admission , she began experiencing shortness of breath associated with subjective fevers and chills , prompting her to seek medical attention .
upon further questioning , she disclosed decreased appetite and approximately 13 pounds of weight loss over the last month .
anemia had been diagnosed 1 month ago by her primary care physician ; at that time , her hemoglobin level was 9 mg / dl and this was attributed to heavy menses .
the patient also denied a history of smoking , radiation exposure , or a personal or family history of malignancy . on admission ,
initial blood work revealed a hemoglobin level of 6 mg / dl with an mcv of 71.0 fl , but no leukocytosis .
there was moderate anisocytosis , slight polychromasia , multiple microcytes , and rouleaux formation on peripheral blood smear .
her chemistries were notable for hyponatremia ( 129 meq / l ) , and she had a creatinine level of 1.1 mg / dl , total bilirubin of 2.6 mg / dl , and ldh of 179 iu / l .
further chemistries revealed a total protein level of 10.0 g / dl and notably elevated kappa ( 61 mg / l ) levels but normal lambda ( 12.80
chest radiograph showed a soft tissue density in the left hilum concerning for lymphadenopathy ( fig 1a , b ) .
the patient was started on empiric antibiotics and a work - up for tuberculosis was begun . given the significantly elevated protein levels on her serum protein electrophoresis , urine protein electrophoresis , and immunofixation
serum protein electrophoresis revealed a band with restricted mobility in the gamma region as well as a band in the beta region .
urine protein electrophoresis also showed 2 bands , both with restricted mobility in the gamma region .
serum immunofixation revealed 2 iga kappa proteins and 1 free kappa light chain monoclonal protein .
urine immunofixation showed 1 iga kappa protein and 1 free kappa light chain monoclonal protein .
a chest computed tomography ( ct ) to further characterize chest radiographic findings demonstrated extensive anterior and middle mediastinal lymphadenopathy as well as bilateral supraclavicular lymphadenopathy .
in addition , mildly prominent left hilar and right axillary lymph nodes as well as bilateral pleural effusions were seen .
microscopically , lymph node staining with hematoxylin and eosin stain revealed a sinus histiocytosis pattern where mixed b - cells were found forming aggregates and both t - cells and plasma cells were found arranged in clusters and sheets around vessels ( fig 2 ) .
in addition , there were patchy ebv - positive cells , mostly around the follicles .
t - cells formed the dominant population which did not show any aberrant loss of surface antigen expression and were positive for cd2 , cd3 , cd4 , cd5 , cd7 , and cd8 both on immunohistochemistry ( ihc ) and flow cytometry .
the b - cells were positive for cd20 and pax-5 and some were notably enlarged and positive for ish - ebv .
cd138 and mum-1 were used to highlight numerous plasma cells which appeared to be kappa light chain restricted .
myd88 l265p mutation was negative , and pcr confirmed the b - cell immunoglobulin heavy change to be clonally rearranged , although t - cell beta and gamma clonal rearrangement was not detected .
the histologic features of hypervascularity with dominant t - cell population that showed aberrant loss of bcl-2 are consistent with a t - cell lymphoma , most likely peripheral t - cell lymphoma .
the presence of monotypic plasmacytic proliferation with mixed small and large b - cells is consistent with a low - grade b - cell lymphoma with exuberant plasmacytic differentiation .
the differential diagnosis includes marginal zone b - cell lymphoma with increased plasma cells and lymphoplasmacytic lymphoma the latter of which was suspected in this case .
given these findings , the patient was diagnosed with cl consisting of peripheral t - cell lymphoma not otherwise specified and lymphoplasmacytic lymphoma .
the patient underwent staging bone marrow biopsy which revealed a hypercellular marrow with active trilineage hematopoiesis and moderate myeloid hyperplasia but no evidence of b - cell or t - cell lymphomatous involvement .
dose - adjusted epoch - r ( etoposide , prednisone , vincristine , cyclophosphamide , doxorubicin , and rituximab ) with monthly prophylactic intrathecal hydrocortisone , methotrexate , and cytarabine was administered and to date the patient has received a total of 5 cycles .
pet - ct after the second cycle showed a partial response to therapy with significant reductions in both level iv node , and anterior mediastinal lymph node conglomerate ( fig 1c , d ) .
given the aggressive nature of her disease including the t cell component of her lymphoma , she was referred to a bone marrow transplant center and planned for autologous bone marrow transplant after completion of her sixth cycle of chemotherapy .
cl is increasingly being recognized in part due to the greater use of adjunctive laboratory techniques such as flow cytometry , ihc , and molecular and cytogenetic assays . to date combinations of nearly all common lymphomas
the most commonly reported cases involve 2 b - cell nhl or a b - cell nhl with a hodgkin lymphoma .
what makes this case unique is the bilineage involvement of both a t - cell nhl and a b - cell nhl . to date
less than 100 such cases have been described , representing less than 1% of all reported lymphoid malignancies . among these cases , the most frequent b - cell nhl identified was diffuse large b - cell lymphoma , whereas peripheral t - cell lymphoma not otherwise specified and angioimmunoblastic t - cell lymphoma were the most commonly identified t - cell nhl .
the diagnosis of cl is primarily based on histology and given the complexity of biopsy tissue architecture , where mixtures of infiltrates of different lymphoma types can occur , many cases of cl are likely missed .
the application of ihc adds considerable diagnostic specificity being able to both confirm clonality and cell subtype .
newer molecular techniques using pcr to detect immunoglobulin heavy chain ( igh ) and t - cell receptor gene rearrangements can confirm clonalities of both b- and t - cell components and further aid in the diagnosis of a cl .
flow cytometry is another ancillary method proven to have certain advantages such as the ability to distinguish between different cell phenotypes simultaneously and determine clonality of different cell populations .
this was demonstrated in a study by demurtas et al . who used flow cytometry to successfully identify 17 cl cases among a total of 1,332 lymphomas .
lastly , ebv testing , as was performed in this case , has been shown to be a useful adjunct .
the pathogenesis of cl is poorly understood and , given its rarity , even less is known about the formation of composite t - cell and b - cell lymphomas . although it is possible that some cases are due to mere coincidence , the majority is likely not , and multiple mechanisms have been proposed to explain how these 2 lymphomas arise simultaneously .
one theory involves transformative mutations occurring in pluripotent stem cells destined to give rise to both b and t lymphocytes .
this theory is supported by the discovery of syngeneic mutations present in both b - cell and t - cell populations in several cl cases .
an example of this is the discovery of loss - of - function mutations in tet ( ten - eleven translocation ) 2 , a tumor suppressor gene , which has been found to predispose both mice and humans to the development of a mixed b / t - cell cl .
has further supported this hypothesis with the discovery of the ccnd1 gene ( cyclin d1 ) mutations in both b- and t - cell populations .
some have suggested that chronic stimulation of b- and t - cells with either common antigens or cytokines could mediate transformation of both lineages .
lastly , virally induced transformation has been suggested as a possible etiology , specifically in ebv - positive lymphomas . a study by zettl et al . which investigated 17 cases of t - cell lymphoma suggested that immunosuppression induced by a t - cell lymphoma may lead to ebv - associated b - cell lymphoma .
cases of cl present a unique challenge to clinicians since , aside from case reports and small case series , no large therapeutic studies have been conducted .
a further complicating matter is the uncertainty that often arises when interpreting imaging studies . in cases of metastatic disease ,
it is often not feasible to determine which lymphoma component has spread , therefore making it difficult to stage properly . nevertheless , the focus of therapy should be directed towards the more aggressive component of the cl .
specifically , in cases of mixed t - cell and b - cell lymphoma , some data exist to support the role of anti - cd20 antibodies in regimens ; however , this again is limited to case reports .
schmitz et al . analyzed 320 patients with t - cell lymphomas treated within trials of the german high - grade non - hodgkin lymphoma study group and found a significant benefit of chop plus etoposide in patients aged < 60 years with a normal ldh level .
as this case demonstrates , cl presents similarly to most lymphomas ; however , it presents new challenges with regards to the management and prognosis .
much remains to be learned and more studies are needed to help develop treatment protocols not only for combined b - cell and t - cell cl but cl as a whole .
all authors have been personally and actively involved in substantive work leading to the manuscript and will hold themselves jointly and individually responsible for its content .
a.r . was the primary author documenting the patient 's care and composing the case report .
j.j . and d.j . are the attending hematologists who follow the patient regularly as an outpatient and contributed to the editing of the manuscript .
was also involved in the patient 's inpatient care and editing process of the manuscript . | composite lymphoma ( cl ) is a rare disease with 2 distinct lymphomas concurrently arising in a single patient with an estimated incidence of 14.7% of newly diagnosed lymphomas per year .
cl most commonly involves 2 b - cell non - hodgkin lymphomas ( nhl ) or a b - cell nhl with a hodgkin lymphoma .
our case is unique in that it was a bilineage cl with both a t - cell and b - cell nhl , which has only been reported in a few case reports . a 49-year - old woman presented with several months of progressive cough , weight loss , dyspnea , and supraclavicular lymphadenopathy .
computed tomographic imaging done upon admission to the hospital found that she had extensive anterior and middle mediastinal lymphadenopathy as well as bilateral supraclavicular lymphadenopathy .
the patient underwent an excisional biopsy on the supraclavicular lymph node and was found to have a composite lymphoma involving both a t - cell and b - cell nhl .
her final pathological diagnosis was peripheral t - cell lymphoma and lymphoplasmacytic lymphoma .
the patient was found to have stage iiib disease .
her hiv , hepatitis panel , and tuberculosis tests were all negative .
she then underwent chemotherapy with dose - adjusted epoch - r ( etoposide , prednisone , vincristine , cyclophosphamide , doxorubicin , and rituximab ) .
the patient showed a complete response and was then referred to a bone marrow transplant center for an autologous hematopoietic stem cell transplant .
cl is a rare disease composed of at least 2 distinct lymphomas concurrently arising in a single patient .
due to the complexity in having to treat multiple types of lymphoma simultaneously cl presents challenges with treatment and assessing prognosis . |
the word fall refers to an accident in which an individual falls on the floor or to a lower
location and is injured regardless of his / her own will , except for cases caused by acute
paralysis or external forces1 , 2 . according to the world health organization , falling is a
critical health problem , ranking second after traffic accidents interms of factors causing
death due to unintentional injury accidents around the globe3 .
falling occurs in all age groups but occurs frequently in older
individuals , with 3050% of those aged over 65 years experiencing a fall4 . with the older population gradually
increasing in modern society , falling and subsequent injury
are common5 ; one - third of older people living in the community
experience a fall every day , and more than 90% of pelvic fractures are associated with
injury caused by falling6 .
it has been reported that 1025% of elderly individuals who sustain a bruise from a fall
report falling due to a decline in balance and abnormal gait7 .
the body maintains its balance by continually collecting
information about its position and environment through the sensory system and then
initiating appropriate joint and muscle action by performing appropriate and effective
central processing based on this information .
if even only one of these factors has a
defect , it is difficult to maintain balance , which may lead to falling8 . after falling
, physical activity can deteriorate even if
falling results in a nonserious injury , which may cause social isolation , thus leading to
deteriorated overall quality of life9 . in
addition , falling not only causes physical damage , but fear of falling again may limit one s
physical activities10 .
for this reason ,
prevention of falling in the older population is important above all11 .
in particular , training that
provides vibration to the body can minimize injuries that may occur in difficult or intense
exercise and can be a safe , low - intensity intervention for patients who have limitations in
movement12 .
lam et al.13 reported that whole body vibration ( wbv )
exercise improves elderly individuals balance and gait and is an effective intervention for
fall prevention .
other researchers have reported that wbv exercise is effective in improving
bone strength , muscle strength of the lower extremities , and functional mobility14 , 15 .
in addition , pollock et al.16 conducted an 8-week intervention of wbv exercise in participants
over 80 years of age and found that balance , gait , and fall efficacy improved significantly
in this group compared with a control group .
cheung et al.17 reported that 3 months of wbv exercise in an older female
population significantly improved direction adjustment , speed of movement , and balance
control .
however ,
previous studies have reported that vibration applied rotationally or vertically may cause
adverse effects , such as erythema18 , knee
pain without objective clinical signs18 ,
headache19 , and soreness or itching in
the first session19 , 20 .
many attempts to compensate for such limitations have been made ,
including the development of training equipment that provides vibration horizontally .
however , we have little information on the positive or adverse effects of such a wbv method
because no studies have been conducted on horizontally applied vibration .
therefore , this study aimed to apply wbv exercise in the horizontal direction in elderly
individuals to investigate its impact on balance and fear of falling .
seventeen community - dwelling adults over 65 years of
age were recruited for this study .
participants with medical conditions that limited daily
activities or were likely to cause sensory or motor impairments ( e.g. , stroke , diabetes )
were excluded .
we also excluded participants taking medications that affected balance and
those with knee or hip joint replacement .
all participants provided their informed consent
after receiving a detailed explanation of the study , and all procedures were approved by the
institutional review board of kyungnam university .
before and after the intervention , participants were evaluated for balance function
and fall efficacy .
dynamic balance was measured using the berg balance scale ( bbs ) and timed up and go ( tug )
test .
the interrater reliability coefficients for the bbs and tug test range from 0.83 to
0.96 and 0.83 to 0.96 , respectively21 , 22 .
wbv exercise was performed using a wbv device ( extream 1000 ; amh international co. , ltd .
,
incheon , republic of korea ) at frequency of 1827 hz for a duration of 15 minutes , 3 times a
week , for 6 weeks .
the device is a
slide - alternating vibrator working as a platform with an amplitude of 30 mm ( anterior to
posterior ) and a frequency of 136 hz . before the intervention , procedures for using the
device and its safety issues
,
participants stood with their knees and hips slightly bent on a platform that alternately
moved anteriorly and posteriorly .
null hypotheses of no difference were
rejected if p values were less than 0.05 .
the
average height and weight were 159.88 cm and 55.18 kg , respectively ( table 1table 1 .
the bbs score increased from 52.94 2.11 at baseline 53.76 2.02 after the
intervention , while the tug test score decreased from 11.02 1.14 to 9.70 1.77 .
there
were significant improvements in the bbs and tug test scores for dynamic balance compared
with the baseline ( p < 0.05 ) . also , the fes score for fall efficacy decreased
significantly from 23.00 19.16 at baseline to 11.18 10.41 at the follow - up ( p < 0.01 )
( table 2table 2 .
the comparison of bbs , tug , and fes between before and after the
interventionbeforeafterbbs ( score)52.92.153.82.0*tug test ( sec)11.01.19.71.8*fes ( score)23.019.211.210.4*values are means . * significant , p < 0.05 .
bbs , berg balance scale ; tug test , timed
up and go test ; fes , fall efficacy scale ) .
bbs , berg balance scale ; tug test , timed
up and go test ; fes , fall efficacy scale
this study was performed to investigate the effects of wbv training on dynamic balance and
fall efficacy in elderly individuals .
we found that dynamic balance and fall efficacy
improved significantly after the intervention compared with the baseline .
there were significant improvements in the bbs and tug test scores in terms of dynamic
balance compared with the baseline ( p < 0.05 ) .
pollock et al.16 reported that , in an 8-week study of wbv exercise in participants
over 80 years of age , there were significant improvements in the tug test and bbs scores
from the fourth week .
bautmans et al.14
reported that , in a 6-week study of wbv exercise in individuals over 70 years of age , there
was a significant improvement in the tug test scores .
in addition , bruyere et al.24 reported a significant improvement in the
tug test scores after 6 weeks of wbv exercise in participants over 80 years of age . through
wbv exercise , lower limb power and strength may increase , which may improve balance and
functional mobility16 .
improvements in
such factors seem to have caused significant improvements in the bbs and tug test scores ,
which assess dynamic balance , even though lower limb sensations and muscle strength of the
participants were not assessed in this study . actual existence of muscle strength
improvement was not identified because lower extremity strength was not evaluated .
further
studies are needed to determine the impact of wbv exercise on such variables as muscle
strength and sensation at the level of damage .
furthermore , existing studies have reported
that the fes score improved significantly after wbv exercise16 .
this study also reported that the fes scores of participants
improved significantly after the intervention compared with the baseline .
fall - related
self - efficacy is an expression of each individual s confidence in performing activities of
daily living without loss of balance or fall25,26,27 .
many previous researchers have already reported that fear of falling is closely related to
balance and mobility28 , 29 .
the elderly individuals who participated in this study
showed reduced fear of falling with improvement in balance .
ankle strategy , hip strategy , and a combined strategy can be used to maintain body balance .
ankle strategy refers to moving the ankle back and forth to maintain balance without
extension of the hip joint .
hip strategy refers to moving the hip back and forth to maintain
balance . in general , these 2 strategies are mobilized together30 .
it has been reported that if a platform shakes when a
person stands , he / she moves his / her ankle without extension of the hip joint to maintain
balance , and if a platform shakes at a rapid speed , he / she largely uses a combined strategy
to maintain balance31 . in particular , the
center of gravity of the head and body moves in the same direction as the ankle strategy or
moves back and forth to deal with shaking in the forward / backward direction .
if sufficient
compensation is not achieved with only the ankle strategy , the hip strategy is used32 .
it has been reported that wbv exercise
activates muscle spindles and strengthens proprioceptive sense and lower limb muscles for
postural stability33 .
in particular ,
horizontal wbv exercise provides a form of ankle strategy training when the platform moves
back and forth that increases muscle strength , which may improve balance .
studies have been conducted on various interventions to improve balance and prevent
falling , but few have been performed on wbv exercise in which vibration has been provided
horizontally .
this is the first study to investigate the effects of horizontal wbv exercise .
through this study
, we were able to confirm the potential of wbv in the horizontal direction
as a device to improve balance in elderly people .
however , we were no less certain
advantages of horizontal wbv compared with rotational or vertical wbv . and this study has a
few limitations .
first , it did not have a control group , which would be necessary for
comparison with the experimental group that underwent wbv exercise . since this study did not
have a control group , it is difficult to confirm the significant improvements in the
experimental group .
in addition , there was no follow - up regarding on the effects of wbv
exercise ; thus the length of time for which the effects of wbv exercise lasted was not
identified .
in addition , this study did not investigate the kinds of improvement that
appeared at the level of damage , such as in muscle strength or senses .
this is why we were
not able to accurately identify the factors that were improved by balance improvement .
finally ,
although no serious adverse effects were noted in the study , the adverse effects
caused by horizontal vibration were not identified .
therefore , future studies are necessary
to investigate the long - term effects of wbv exercise through follow - up with a high - quality
research design , and to examine the variables at the level of damage . | [ purpose ] the purpose of the present study was to investigate the effects of whole body
vibration exercise in the horizontal direction on balance and fear of falling in the
elderly .
[ methods ] this study was a case series of 17 elderly individuals .
participants
performed whole body vibration exercise in the horizontal direction using a whole body
vibration device for 15 minutes a day , 3 times a week , for 6 weeks . at baseline and after
the 6-week intervention , balance was measured using the berg balance scale and timed up
and go test , and fear of falling was assessed using the falls efficacy scale . [ results ]
after the intervention , significant improvements from baseline values in the berg balance
scale , timed up and go test , and falls efficacy scale were observed in the study
participants .
[ conclusion ] elderly individuals who performed whole body vibration exercise
in the horizontal direction showed significant improvements in balance and fear of
falling .
however , the observed benefits of whole body vibration exercise in the horizontal
direction need to be confirmed by additional studies . |
tracheobronchial tear refers to a mucosal tear or complete transection of the trachea or bronchi .
it is a challenging diagnosis for the emergency physician and needs a high index of suspicion .
most of these injuries can be missed in the emergency room ( er ) unless the physician suspects its possibility .
on 1 september 2009 , a 25-year - old man was referred to our department as a case of road traffic accident ( rta ) with right - sided tension pneumothorax with completely collapsed right lung . an intercostal chest drain ( icd )
date and time of injury : 30 august 2009 at 11 p.m. mode of injury : patient was travelling in an auto , which overturned . on arrival to our emergency department ( ed ) the patient was conscious and oriented , haemodynamically stable , but very dyspnoeic and his oxygen saturation was 80% on non - rebreathing mask .
there was extensive subcutaneous emphysema and absent breath sounds on the right side , with tracheal deviation to the left .
a bedside chest radiograph was done immediately , which showed features of right - sided tension pneumothorax with completely collapsed right lung ( fig . 1 ) .
1plain chest radiograph showing right - sided tension pneumothorax , collapsed right lung , icd in situ , mediastinum and tracheal shift to left plain chest radiograph showing right - sided tension pneumothorax , collapsed right lung , icd in situ , mediastinum and tracheal shift to left when the icd tube was connected to low - pressure suction the patient had symptomatic relief transiently .
hence , the possibility of bronchial injury was suspected and computed tomography ( ct ) of the chest was done , which showed right - sided tension pneumothorax , with icd in situ , a large tear in the right main bronchus , multiple traumatic contusions of the left lung and multiple rib fractures ( fig . 2 ) .
cardiothoracic surgeons opinion was sought and they advised immediate surgical repair with a possibility of right pneumonectomy as the bronchial defect was large .
it was a case with high risk and poor prognosis , as the left lung too was contused extensively .
the need for emergency surgery and prognosis were explained to the patient s relatives , but they were not willing to give consent for further management ; hence , the patient was discharged against medical advice .
2coronal section of ct of chest showing ruptured lateral wall of right main bronchus , collapsed lung and severe pneumothorax coronal section of ct of chest showing ruptured lateral wall of right main bronchus , collapsed lung and severe pneumothorax
a tracheal or bronchial rupture is a life - threatening lesion with non - specific presenting symptoms ; hence , it is frequently unnoticed during the initial trauma assessment .
approximately 75% of the injuries occur within 2 cm from the carina ; the right main bronchus is more commonly injured than the trachea or left main bronchus .
bronchial tear causing tension pneumothorax is an extremely rare case which can occur due to massive escape of air from a large bronchial tear as seen in this case .
an unresolved pneumothorax after icd insertion should immediately alert the treating physician to look for bronchial injuries .
the signs and symptoms are non - specific which include dyspnoea , desaturation , hyper - resonance on percussion , decreased / absent breath sounds , hypotension , tracheal shift and distended neck veins .
tracheal or bronchial injury should be suspected in patients with persistent or increasing pneumothorax , despite continuous intercostal drainage .
the best results in the treatment of such ruptures are obtained by the earliest possible restoration of the continuity of the air passages ; hence , early diagnosis is vital for survival .
injuries to the trachea or proximal left main bronchus typically result in pneumomediastinum and not pneumothorax .
the possible mechanisms for tracheobronchial injury are :
injuries to bronchi occur due to rapid deceleration and shearing of mobile lung and bronchi from relatively fixed proximal structures.forced expiration against a closed glottis causes a sudden rise in airway pressure and can cause a longitudinal tear in the bronchi.compression between the sternum and vertebral column may cause bursting of these structures .
injuries to bronchi occur due to rapid deceleration and shearing of mobile lung and bronchi from relatively fixed proximal structures . forced expiration against a closed glottis
causes a sudden rise in airway pressure and can cause a longitudinal tear in the bronchi .
the diagnosis is based on :
the chest radiograph is the standard initial screening test in thoracic trauma .
the radiographic manifestations of tracheobronchial injury are usually non - specific and include pneumomediastinum , pneumothorax , pneumoretroperitoneum , deep cervical emphysema and subcutaneous emphysema.the fallen lung sign is specific for complete bronchial transection .
this sign describes the lung falling dependently , rather than collapsing centrally toward the hilum in the presence of a pneumothorax ( fig .
3).ct of the chest is the imaging modality of choice in tracheobronchial injuries ; it not only confirms the diagnosis but also adds unique information .
it has some limitations in detecting minor tears.fibreoptic bronchoscopy is the best diagnostic tool for determining the location and extent of airway injuries , and one should have a low threshold to perform it when the diagnosis is suspected.fig .
fallen lung sign the chest radiograph is the standard initial screening test in thoracic trauma .
the radiographic manifestations of tracheobronchial injury are usually non - specific and include pneumomediastinum , pneumothorax , pneumoretroperitoneum , deep cervical emphysema and subcutaneous emphysema .
this sign describes the lung falling dependently , rather than collapsing centrally toward the hilum in the presence of a pneumothorax ( fig .
ct of the chest is the imaging modality of choice in tracheobronchial injuries ; it not only confirms the diagnosis but also adds unique information .
fibreoptic bronchoscopy is the best diagnostic tool for determining the location and extent of airway injuries , and one should have a low threshold to perform it when the diagnosis is suspected .
fallen lung sign laceration of the bronchus involving more than one third of the circumference needs surgical repair as it tends to cause severe stenosis with repeated lung infections and collapse .
the prognosis after surgery depends on other associated injuries and the previous condition of the patient .
the signs and symptoms are non - specific which include dyspnoea , desaturation , hyper - resonance on percussion , decreased / absent breath sounds , hypotension , tracheal shift and distended neck veins .
tracheal or bronchial injury should be suspected in patients with persistent or increasing pneumothorax , despite continuous intercostal drainage .
the best results in the treatment of such ruptures are obtained by the earliest possible restoration of the continuity of the air passages ; hence , early diagnosis is vital for survival .
injuries to the trachea or proximal left main bronchus typically result in pneumomediastinum and not pneumothorax .
the possible mechanisms for tracheobronchial injury are :
injuries to bronchi occur due to rapid deceleration and shearing of mobile lung and bronchi from relatively fixed proximal structures.forced expiration against a closed glottis causes a sudden rise in airway pressure and can cause a longitudinal tear in the bronchi.compression between the sternum and vertebral column may cause bursting of these structures .
injuries to bronchi occur due to rapid deceleration and shearing of mobile lung and bronchi from relatively fixed proximal structures . forced expiration against a closed glottis
causes a sudden rise in airway pressure and can cause a longitudinal tear in the bronchi .
the diagnosis is based on :
the chest radiograph is the standard initial screening test in thoracic trauma .
the radiographic manifestations of tracheobronchial injury are usually non - specific and include pneumomediastinum , pneumothorax , pneumoretroperitoneum , deep cervical emphysema and subcutaneous emphysema.the fallen lung sign is specific for complete bronchial transection .
this sign describes the lung falling dependently , rather than collapsing centrally toward the hilum in the presence of a pneumothorax ( fig .
3).ct of the chest is the imaging modality of choice in tracheobronchial injuries ; it not only confirms the diagnosis but also adds unique information .
it has some limitations in detecting minor tears.fibreoptic bronchoscopy is the best diagnostic tool for determining the location and extent of airway injuries , and one should have a low threshold to perform it when the diagnosis is suspected.fig .
fallen lung sign the chest radiograph is the standard initial screening test in thoracic trauma .
the radiographic manifestations of tracheobronchial injury are usually non - specific and include pneumomediastinum , pneumothorax , pneumoretroperitoneum , deep cervical emphysema and subcutaneous emphysema .
this sign describes the lung falling dependently , rather than collapsing centrally toward the hilum in the presence of a pneumothorax ( fig .
ct of the chest is the imaging modality of choice in tracheobronchial injuries ; it not only confirms the diagnosis but also adds unique information .
fibreoptic bronchoscopy is the best diagnostic tool for determining the location and extent of airway injuries , and one should have a low threshold to perform it when the diagnosis is suspected .
laceration of the bronchus involving more than one third of the circumference needs surgical repair as it tends to cause severe stenosis with repeated lung infections and collapse .
the prognosis after surgery depends on other associated injuries and the previous condition of the patient .
airway injury following blunt thoracic trauma is rare but can be life-threatening.bronchial tear causing tension pneumothorax is very unusual.early diagnosis in the ed is challenging as all the signs and symptoms are non - specific.a high index of suspicion is key for prompt diagnosis.the role of ct is vital in thoracic trauma .
early diagnosis in the ed is challenging as all the signs and symptoms are non - specific . | bronchial rupture is a rare and serious complication of blunt chest trauma , which can be easily overlooked on initial evaluation in the emergency room ( er ) as the focus of the attending physician is diverted to more obvious external injuries which may not be of much significance .
we present one such patient referred to us as a case of unresolved right - sided pneumothorax 2 days after intercostal drainage ( icd ) tube placement . |
type 2 diabetes arises when beta cells produce insufficient insulin to meet the increased hormone demand , caused by insulin resistance .
impaired insulin plasma level is the consequence of reduced capacity for secreting insulin in response to nutrients and insufficient beta cells number .
lifestyle changes together with excessive visceral adiposity and genetic factors predispose to the diabetes risk , and thereby to beta cell dysfunction [ 1 , 2 ] . these factors promote low chronic grade inflammation , which affects beta cell function and mass .
several reports have shown that treatment of beta cells with histone deacetylase ( hdac ) inhibitors can prevent the adverse effects of cytokines [ 4 , 5 ] .
these inhibitors include the hdac1 and hdac3 ms-275 compound also called entinostat [ 4 , 5 ] .
the latter is undergoing clinical trials for treatment of cancers including breast , lymphoma , and lung .
coexposure of islets and beta cell line to the ms-275 prevents death caused by cytokines .
chronic elevation of saturated free fatty acids may be the link between visceral adiposity and low grade inflammation in type 2 diabetes [ 79 ] .
numerous studies underline the diabetogenic effect of palmitate in eliciting beta cell death in the pathogenesis of type 2 diabetes [ 917 ] .
the harmful effects of palmitate are achieved by activation of some important signalling pathways , including activation of endoplasmic reticulum ( er ) stress [ 1822 ] .
activation of er stress triggers the unfolded protein response ( upr ) [ 23 , 24 ] . in response to prolonged exposure to palmitate
, upr promotes the expression of caat / enhancer - binding protein homologous protein-10 ( chop , also known as the dna - damage - inducible transcription factor 3 ) and activates transcription factor 3 ( atf3 ) , thus leading to apoptosis [ 25 , 26 ] .
changes in chop and atf3 expression have been associated with beta cell dysfunction in diabetes [ 22 , 2730 ] . in this study
louis , mo ) was coupled to bovine serum albumin - fatty acid free by 1 h agitation at 37c and freshly prepared for each experiment .
this procedure yielded bsa - coupled fatty acids in a molar ratio of 5 : 1 .
the ms-275 was purchased from sigma - aldrich ( st . louis , mo ) .
the antibodies against chop , atf3 , tata box binding protein ( tbp ) , and hdac1 were obtained from santa cruz biotechnology ( ca , usa ) .
the anti - hdac3 and anti--actin antibodies were from cell signaling technology ( ma , usa ) and sigma ( saint quentin , france ) , respectively .
the sirna duplexes directed against hdac1 ( si - hdac1 ) , hdac3 ( si - hdac3 ) , and gfp ( si - gfp ) were introduced using the lipofectamine 2000 ( invitrogen ag ) exactly as described .
human pancreases were harvested from adult brain - dead donors in accordance with french regulations and with the local institutional ethical committee from the centre hospitalier rgional et universitaire de lille .
pancreatic islets were isolated after ductal distension of the pancreas and digestion of the tissue as described previously .
purified islets were cultured in cmrl 1066 medium ( gibco brl , life technologies ) containing 0.625% free fatty acid hsa ( roche diagnostics ) , penicillin ( 100 ui / ml ) , and streptomycin ( 100 g / ml )
. a pool of 4 sirnas was used to knock down hdac1 and hdac3 expression ( on - targetplus smartpool , thermo scientific dharmacon ) .
total rna was extracted using guanidinium thiocyanate - phenol - chloroform and converted to cdna as described .
real - time quantitative pcr assays were carried out on the bio - rad myiq real - time pcr detection system using iq sybr green supermix ( bio - rad ) as the amplification system with 100 nm primers and 2 l of template ( rt product ) in 20 l of pcr volume and annealing temperature of 59c .
primers sequences were human atf3 ; forward 5-ctcctgggtcactggtgttt-3 and reverse 5-gttctctgctgctgggattc-3 ; mouse atf3 ; forward 5-aagacagagtgcctgcagaa-3 and reverse 5-gtgccacctctgcttagctc-3 ; human chop forward 5-gtgaatctgcaccaagcatga-3 and reverse 5-aaggtgggtagtgtggccc-3 ; mouse chop forward 5-ttcactactcttgaccctgcgt-3 and reverse 5-cactgaccactctgtttccgtttc-3 ; human and mouse rplp0/rplp0 forward 5-acctcctttttccaggcttt-3 and reverse 5-cccactttgtctccagtcttg-3. nuclear protein extracts from cells were prepared exactly as previously described . for western blotting experiments , 2540 g of protein extracts was separated on 10% sds - polyacrylamide gel and electrically blotted to nitrocellulose membrane .
the proteins were detected after an overnight incubation of the membrane at 4c with the specific primary antibodies against hdac1 ( dilution 1 : 1000 ) , tata box binding protein ( tbp , dilution 1 : 1000 ) , -actin ( dilution 1 : 5000 ) , hdac3 ( dilution 1 : 1000 ) , and chop ( dilution 1 : 500 ) in buffer containing 0.1% tween 20 with either 5% milk ( for hdac1 , chop , -actin , and tbp ) or 5% bsa ( for hdac3 and atf3 ) .
proteins were visualized with irdye800 or irdye700 ( eurobio , les ulis , france ) as secondary antibodies .
apoptosis was determined by determining mono- and oligonucleosomes in the cytoplasmic fraction by elisa kit ( roche molecular biochemicals ) and by scoring cells displaying pyknotic or fragmented nuclei ( visualized with hoechst 33342 ) .
anova was used for statistical significance , followed by the post hoc bonferroni test ( dunnett 's test ) when experiments included more than two groups .
previous studies including ours have found that palmitate increases death in different insulin - secreting cells including min6 cells and isolated human islets cultured with palmitate for 48 hrs [ 13 , 16 , 18 , 20 , 37 ] .
palmitate triggers some adverse effects under normal glucose concentration in human and mouse beta cells [ 13 , 38 ] .
we confirmed that exposure of min6 and isolated human islets cells to 0.5 mm palmitate for 48 hrs caused a 3- and 4-fold increase in apoptosis , respectively ( figure 1 ) .
preliminary studies showed that concentrations of ms-275 above 1 m were deleterious for cell viability ( data not shown ) .
however culture of min6 cells with 1 m ms-275 did not affect cell survival under normal culture condition ( figure 1(a ) ) whereas , as expected , it caused a 3040% significant reduction in the total hdac activity ( supplementary figure 1(a ) available online at http://dx.doi.org/10.1155/2014/195739 ) .
a previous study reports that prolonged exposure of insulin - producing cells to palmitate did not change total hdac activity . in line with this observation , chronic culture of min6 cells with
the saturated fatty acid did affect neither total hdac activity nor hdac1 and hdac3 mrna levels ( supplementary figures 1(a ) and 1(b ) ) .
in fact , we found that the drop of hdac activity caused by the ms-275 was associated with an increase in survival of min6 and isolated human islets cells in response to palmitate ( figures 1(a ) and 1(b ) ) . while chronic exposure of min6 cells to palmitate reduces preproinsulin mrna level
, we confirmed that the lipid did not affect the hormone mrna level in isolated human islets ( supplementary figure 2(a ) ) as previously described .
however , insulin content is diminished in islets from different species and min6 cells chronically exposed to palmitate [ 4042 ] .
the ms-275 improved the preproinsulin mrna ( supplementary figure 2(a ) ) and insulin content ( supplementary figure 2(b ) ) of cells chronically cultured with palmitate .
however , the ms-275 was insufficient for antagonizing the harmful effect of the lipid on glucose - induced insulin secretion in min6 cells ( supplementary figure 2(c ) ) .
all these data indicate that the cytoprotective effect of ms-275 is associated with an improved insulin expression .
elevation of atf3 and chop contributes to the upr - induced death caused by palmitate .
we next investigated whether the protective effect triggered by ms-275 is associated with reduced level of the two er stress markers .
quantitative pcr showed that ms-275 attenuated induction of atf3/atf3 and chop / chop by palmitate in min6 cells and human islets ( figure 2(a ) ) .
western blotting experiments confirmed the antagonist effects of ms-275 on the increase of atf3 and chop evoked by palmitate ( figure 2(b ) ) .
ms-275 is a class i hdac inhibitor that selectively inhibits hdac1 and hdac3 activities . silencing of hdac1 and hdac3 by sirna duplexes ( sih1 and sih3 ) was performed to determine which of the two hdacs was involved in the effect of ms-275 .
western blotting experiments confirmed the efficiency of the two sirna duplexes for reducing the hdac1 and hdac3 abundances in min6 cells ( figure 3(a ) ) . while the decrease of hdac1 did not protect min6 cells against apoptosis caused by palmitate , suppression of hdac3 did ( figure 3(b ) ) .
in addition , sih3 , but not sih1 , mimicked the effect of ms-275 by alleviating the elevation of atf3 and chop mrna and protein levels provoked by the fatty acid ( figures 4(a ) and 4(b ) ) , suggesting a role for hdac3 as the target of ms-275 for triggering the protective effect .
the saturated fatty acid palmitate is deemed to be an important diabetogenic factor that links obesity , insulin resistance , and reduced functional beta cell mass [ 2 , 9 ] .
one of the harmful effects triggered by palmitate on beta cells is the reduction of cell survival [ 19 , 20 , 37 ] .
this is in part achieved by inducing the expression of chop and atf3 through upr [ 25 , 26 ] .
herein , we show that ms-275 prevents the increase of the two transcription factors and apoptosis caused by palmitate . silencing of hdac3 , but not hdac1 , mimicked the effects of the compound .
palmitate did not impinge the hdac3 expression , supporting a role for the lipid in triggering the activity of this hdac .
hdac3 activity produces some changes in the chromatin structure through histone deacetylation , leading to silencing of gene expression .
based on this function , a direct binding of hdac3 to the chop / chop and atf3/atf3 promoters in response to palmitate seems unlikely .
the most likely scenario is that hdac3 directly regulates the expression of negative regulatory factor such as transcriptional repressor(s ) or micrornas .
reduced activity of these negative regulators by hdac3 may elevate the chop / chop and atf3/atf3 mrna and protein levels in response to palmitate , thus leading to apoptosis . inversely ,
ms-275 or silencing of hdac3 may prevent the silencing of the negative regulators caused by palmitate .
the consequence of such derepression would lead to reduction of chop / chop and atf3/atf3 mrna and protein expression .
future experiments plan to identify the repressor(s ) through which hdac3 controls the elevation of the two er stress markers level and apoptosis caused by lipotoxicity .
there is increasing evidence supporting the therapeutic use of hdac inhibition as novel drugs for neurodegenerative and other inflammatory diseases . at present , a growing number of reports indicate beneficial effects of hdac inhibitors in metabolic diseases .
treatment with the pan - hdacs inhibitors sodium butyrate or the class i hdac inhibitor ms-275 improves insulin sensitivity in mice with diet - induced obesity and obese db / db mice , respectively .
a protective role of class i hdac inhibition against beta cell apoptosis and dysfunction elicited by cytokines has been further reported [ 5 , 48 ] , thus underlining the potential interest of hdac inhibition for diabetes care . in this
in this study we provide additional evidence that hdac3 could also be a potential drug target for preserving pancreatic beta cells against apoptosis induced by lipotoxicity in type 2 diabetes . | elevation of the dietary saturated fatty acid palmitate contributes to the reduction of functional beta cell mass in the pathogenesis of type 2 diabetes .
the diabetogenic effect of palmitate is achieved by increasing beta cell death through induction of the endoplasmic reticulum ( er ) stress markers including activating transcription factor 3 ( atf3 ) and caat / enhancer - binding protein homologous protein-10 ( chop ) . in this study
, we investigated whether treatment of beta cells with the ms-275 , a hdac1 and hdac3 activity inhibitor which prevents beta cell death elicited by cytokines , is beneficial for combating beta cell dysfunction caused by palmitate . we show that culture of isolated human islets and min6 cells with ms-275 reduced apoptosis evoked by palmitate .
the protective effect of ms-275 was associated with the attenuation of the expression of atf3 and chop .
silencing of hdac3 , but not of hdac1 , mimicked the effects of ms-275 on the expression of the two er stress markers and apoptosis .
these data point to hdac3 as a potential drug target for preserving beta cells against lipotoxicity in diabetes . |
a 71-year - old woman presented with pain of the right knee with 2 year duration .
she had been involved in a slip down and sustained right femur shaft fracture 3 years earlier , as well as a left femur shaft fracture 5 years ago .
preoperative radiographs of the right knee in the anteroposterior and lateral views showed tricompartment osteoarthritis and a retained intramedullary nail .
the femoro - tibial angle that formed between the mechanical axis of the femur and tibia axis was 25 varus ( figs . 1 and 2 ) .
the patient underwent a right tka with computer navigation using the stryker 4.0 system ( stryker co. , allendale , nj , usa ) , cemented , and posterior cruciate ligament sacrificing type ( scorpio , stryker co. , ) .
a 6.5 mm bicortical self - tapping anchoring screw was inserted 10 cm below the tibiofemoral joint line .
another type anchoring pin for the femur was used to avoid a collision with the intramedullary nail .
this type of anchoring pin is smaller ( 3.0 mm ) than a anchoring screw , and unicortical anchoring is available ( fig .
a femur and tibia resection were performed according to the light - emitting diode tracker of a navigation system and cutting jig .
the ligamentous release and balance were also performed based on a trial reduction of the prosthesis and guide in a navigation system .
both components were centered to the midline of the joint , and the overall knee alignment was 5 valgus ( fig .
after tka , the patient could walk with partial weight bearing and full weight bearing 1 day and 7 days after surgery respectively .
a 79-year - old woman presented with pain of the left knee with a 3 year duration . the patient was involved in a traffic accident 15 years earlier and sustained a left distal femur fracture .
preoperative radiographs of the left knee in the anteroposterior
and lateral views revealed tricompartment osteoarthritis and a containing plate and screws on lateral side of the femur ( fig . 5 ) .
the femoro - tibial angle that formed between the mechanical axis of the femur and tibia axis was 15 varus .
the patient underwent right tka performed with computer navigation using a stryker 4.0 system , cemented , posterior cruciate ligament sacrificing type ( scorpio ) .
a midline skin incision was performed . a 6.5 mm bicortical self - tapping anchoring screw
another type of anchoring pin was used on the femur to avoid a collision with the screws .
the lateral epicondyle , which was covered with a plate , could not be checked . a multiple checking system ,
a femur and tibia resection were performed depending on the light - emitting diode tracker of the navigation system and cutting jig .
the most distal screw impinged on the box cutting for the posterior cruciate ligament sacrificing type and one screw was removed .
ligamentous release and balance were also performed based on a trial reduction of the prosthesis and guide in the navigation system .
both components were centered to the midline of the joint , and overall knee alignment was 6 valgus ( figs . 6 and 7 ) .
after tka , the patient could walk with partial weight bearing and full weight bearing 1 day and 7 days after surgery respectively .
a 71-year - old woman presented with pain of the right knee with 2 year duration .
she had been involved in a slip down and sustained right femur shaft fracture 3 years earlier , as well as a left femur shaft fracture 5 years ago .
preoperative radiographs of the right knee in the anteroposterior and lateral views showed tricompartment osteoarthritis and a retained intramedullary nail .
the femoro - tibial angle that formed between the mechanical axis of the femur and tibia axis was 25 varus ( figs . 1 and 2 ) .
the patient underwent a right tka with computer navigation using the stryker 4.0 system ( stryker co. , allendale , nj , usa ) , cemented , and posterior cruciate ligament sacrificing type ( scorpio , stryker co. , ) .
a 6.5 mm bicortical self - tapping anchoring screw was inserted 10 cm below the tibiofemoral joint line .
another type anchoring pin for the femur was used to avoid a collision with the intramedullary nail .
this type of anchoring pin is smaller ( 3.0 mm ) than a anchoring screw , and unicortical anchoring is available ( fig .
a femur and tibia resection were performed according to the light - emitting diode tracker of a navigation system and cutting jig .
the ligamentous release and balance were also performed based on a trial reduction of the prosthesis and guide in a navigation system .
both components were centered to the midline of the joint , and the overall knee alignment was 5 valgus ( fig .
after tka , the patient could walk with partial weight bearing and full weight bearing 1 day and 7 days after surgery respectively .
a 79-year - old woman presented with pain of the left knee with a 3 year duration . the patient was involved in a traffic accident 15 years earlier and sustained a left distal femur fracture .
preoperative radiographs of the left knee in the anteroposterior
and lateral views revealed tricompartment osteoarthritis and a containing plate and screws on lateral side of the femur ( fig . 5 ) .
the femoro - tibial angle that formed between the mechanical axis of the femur and tibia axis was 15 varus .
the patient underwent right tka performed with computer navigation using a stryker 4.0 system , cemented , posterior cruciate ligament sacrificing type ( scorpio ) .
a midline skin incision was performed . a 6.5 mm bicortical self - tapping anchoring screw
another type of anchoring pin was used on the femur to avoid a collision with the screws .
the lateral epicondyle , which was covered with a plate , could not be checked . a multiple checking system ,
a femur and tibia resection were performed depending on the light - emitting diode tracker of the navigation system and cutting jig .
the most distal screw impinged on the box cutting for the posterior cruciate ligament sacrificing type and one screw was removed .
ligamentous release and balance were also performed based on a trial reduction of the prosthesis and guide in the navigation system .
both components were centered to the midline of the joint , and overall knee alignment was 6 valgus ( figs . 6 and 7 ) .
after tka , the patient could walk with partial weight bearing and full weight bearing 1 day and 7 days after surgery respectively .
a navigation system has been reported to improve the accuracy of bony cuts and restore the mechanical axis in tka.4 - 6 ) computer - assisted tka using a surgical navigation system provides accurate cuts of the distal femur and proximal tibia without the need for intramedullary instrumentation .
intramedullary instruments can not be used in patients with previous trauma and substantial residual bony deformities , or retained hardware that can not be removed . in old age , bone is usually osteoporotic and the fractured bone fixed with an implant may be more osteoporotic . in conventional tka , when removing the implant , the space where the implant had been removed can be stress riser for a given load after tka.7,8 ) early ambulation and early continuous passive motion should be performed more carefully . in these 2 cases ,
partial weight bearing walking and full weight bearing walking was possible 1 day and 7 days after surgery , respectively .
the pins were smaller ( 3.0 mm ) than used at the tibia and could be anchored unicortically .
the reasons for changing the anchoring screw to pins were to reduce the anecdotal fracture and collision with retained hardware .
however , a unicortical pin at the metaphysis for the tracker often has insecure fixation that can cause poor registration during navigation - assisted tka .
two anchoring pins were inserted for the femur but three pins can be inserted for more secure fixation . some cases with an anecdotal fractures have been reported after the placement of navigation tracker pins.9,10 ) there are a few reports that a smaller size and unicortical fixation pin is safer . in one anatomic study ,
the findings indicated the close proximity of the popliteal vessel to potential injury with the bicortical placement of tracker pins in the anteroposterior direction in a typical total knee approach .
navigation - assisted tka is feasible and less invasive for tka of a retained implant of the distal femur after a fracture . | proper ligament balancing , restoration of the mechanical axis and component alignment are essential for the success and longevity of a prosthesis . in conventional total knee arthroplasty ( tka ) , an intramedullary guide is used to improve the alignment .
an extramedullary guide can be used in cases of severe femoral bowing or intramedullary nailing but its use is more subjective and relies on the surgeon 's experience . this paper reports two successful cases of navigation - assisted tka for severe right knee osteoarthritis retaining a femoral intrameullary nail , and left knee osteoarthritis retaining a distal femoral plate . |
animals : female and male c57bl/6n mice were purchased from japan slc , inc .
the animals used for the experiments were bred in a
laboratory at the department of animal science at kobe university , under a 12-hr light / dark
cycle at 2124c and 4060% humidity . a laboratory diet ( lab mr stock ;
nihon nosan co. ,
yokohama , japan ) and filtered water were available ad libitum .
this
experiment was approved by the institutional animal care and used committee ( permission
number : 24 - 10 - 03 ) and carried out according to the kobe university animal experimentation
regulation .
,
osaka , japan ) was based on the dose associated with the lowest observed adverse effect level
( loael ) [ 200 ng / kg body weight ( bw ) ] [ 11 , 12 ] .
the volumes for oral administration were adjusted to
25 l/30 g bw of sesame oil .
female mice in proestrus were mated 1:1 with
males overnight , and females that had a vaginal plug on the following morning were
designated as being at e0.5 .
vehicle or tcdd ( 20 , 200 , 2,000 or 5,000 ng / kg
bw ) was orally administered on e8.5 .
these groups were defined as the control , t20 , t200 ,
t2000 and t5000 groups , respectively .
tissue preparation : at the time of necropsy , all dams were deeply
anesthetized with diethyl ether .
they were then fixed in 4%
paraformaldehyde in 0.1 m phosphate buffer overnight at 4c , dehydrated through a graded
series of ethanol followed by xylene and embedded in paraffin .
coronal serial sections of 10
m thickness were then cut and mounted on a glass slide ( platinum pro ;
matsunami glass ind . , ltd .
, kishiwada , japan ) , and a series of semi - serial sections was made
by collection at 100-m intervals ( one of every 10 tissue sections ) .
cresyl fast violet staining : after deparaffinization and rehydration , the
sections were stained with 0.1% cresyl fast violet solution for 5 min .
they were then placed
in distilled water and a graded series of ethanol for appropriate bleaching of dye ,
dehydrated with ethanol and coverslipped with eukitt ( o. kindler , gmbh , freiburg ,
germany ) .
immunohistochemistry and immunohistoplanimetry : the combination of
blocking agents and antibodies used for the detection of each protein by
immunohistochemistry is listed in table
1table 1.the combination of blocking agents and antibodies used for
immunohistochemistrydetectionblocking reagentprimary antibodysecondary antibodygfapblocking one histo(nacalai tesque , inc . ,
kyoto ,
japan)mouse monoclonal antibody against gfap(ne1015 ;
1:1,000)(merck , kgaa , darmstadt , germany)histofine max - po ( m)(histofine simplestain system)(nichirei bioscience , inc . ,
tokyo , japan)pcnablocking reagent a and b(nichirei bioscience ,
inc.)mouse monoclonal antibody against pcna(na03 ; 1:100)(merck , kgaa)histofine max - po ( m)(nichirei bioscience , inc.)dcxblocking one histo(nacalai tesque , inc.)goat polyclonal antibody against dcx(sc-8066 ; 1:100)(santa cruz biotechnology , inc . , dallas , tx , u.s.a.)horseradish peroxidase - conjugated antigoat igg mouse
igg ( ap186p ; 1:100)(merck , kgaa)gfap : glial fibrillary acidic protein , pcna : proliferating cell nuclear antigen , dcx :
doublecortin .. the sections were deparaffinized and rehydrated and were heated at 121c for
20 min in 10 mm sodium citrate buffer ( ph 6.0 ) for antigen retrieval .
after cooling , they
were immersed in absolute methanol and 0.5% h2o2 for 30 min each at
room temperature ( rt ) to quench the endogenous peroxidase activity .
the specimens were
incubated with each blocking agent for 1 hr at rt and then with each primary antibody for 18
hr at 4c ( table 1 ) . after washing with
phosphate buffered saline ( pbs ) , each secondary antibody was reacted for 1 hr at rt ( table 1 ) .
the excess antibodies were rinsed in pbs ,
and the immunoreactivities were detected by incubation with 3,3-diaminobenzidine solution
( envision+ kit / hrp [ dab ] ; dako , glostrup , denmark ) .
the sections were counterstained lightly
with hematoxylin . finally , they were dehydrated and cleared through an ethanol - xylene series
and coverslipped with eukitt ( o. kindler , gmbh ) .
gfap : glial fibrillary acidic protein , pcna : proliferating cell nuclear antigen , dcx :
doublecortin .
immunohistoplanimetry : coronal sections containing the hippocampus stained
immunohistochemically were observed under a light microscope ( nikon , corp . ,
the granular immunoreactivities of glial fibrillary acidic protein ( gfap ) and proliferating
cell nuclear antigen ( pcna)-positive cells were counted in 3 sections per 100
m . statistical analysis : statistical analysis was performed with excel
statistics 2012 for windows ( ssri , co. , ltd . ,
values were considered statistically significant if p<0.05 .
the tukey - kramer or steel - dwass test after one - way anova analysis was used to determine
differences between groups .
body and brain weights : no significant differences in bw or brain weight
were found between the control and tcdd - exposed groups ( data not shown ) .
the dg at e18.5 was immature , and the granular cell
layer could not be clearly distinguished from the molecular layer and polymorphic layer
based on its morphology ( fig .
( a e ) the cell density in the dg was decreased in the t5000 compared with the
control group , whereas no obvious changes were observed in the shape or somatic size
of cells ( e ) .
( f j ) the fibrous immunoreactivities of gfap were detected , but were
decreased in the t5000 group ( j ) .
( k o ) the numbers of pcna - positive cells were
smaller in the t5000 ( o ) than the other groups ( k n ) .
( p t ) the intensity of dcx
staining did not differ between the control and tcdd - exposed groups .
mol : molecular
layer ; gcl : granule cell layer ; pia : pia mater ; bar=50 m . ) .
the cell density in the dg appeared to be decreased slightly in the t5000 group
compared with the control group , whereas no obvious changes were observed in the shape or
somatic size of cells .
however , no notable differences in the hippocampal fimbria were found
between the control and tcdd - exposed groups ( fig .
2 . representative histology and immunohistochemistry in the hippocampal fimbria in the
hippocampus at e18.5 .
( a e ) no notable differences were found between the control and
tcdd - exposed groups based on cresyl fast violet staining .
( f j ) the fibrous and
granular immunoreactivities of gfap were observed , and the latter was reduced in the
t5000 group ( j ) .
lv : lateral ventricle ; bar=50 m ( inset : 20
m ) . ) .
( a e ) the cell density in the dg was decreased in the t5000 compared with the
control group , whereas no obvious changes were observed in the shape or somatic size
of cells ( e ) .
( f j ) the fibrous immunoreactivities of gfap were detected , but were
decreased in the t5000 group ( j ) .
( k o ) the numbers of pcna - positive cells were
smaller in the t5000 ( o ) than the other groups ( k n ) .
( p t ) the intensity of dcx
staining did not differ between the control and tcdd - exposed groups .
mol : molecular
layer ; gcl : granule cell layer ; pia : pia mater ; bar=50 m . .
( a e ) no notable differences were found between the control and
tcdd - exposed groups based on cresyl fast violet staining .
( f j ) the fibrous and
granular immunoreactivities of gfap were observed , and the latter was reduced in the
t5000 group ( j ) .
immunohistological findings : the fibrous immunoreactivities of gfap were
detected in the cell body and process of neural stem cells ( nscs ) and astrocytes in the dg .
gfap - immunoreactive nscs and astrocytes were localized in the molecular layer , granular cell
layer and next to the pia mater ( fig .
, the fibrous and granular gfap
immunoreactivities were observed in the cell body and process of nscs and astrocytes ( fig .
the granular immunoreactivities of gfap
appeared to be reduced in the t5000 group , and in fact , the number of them was significantly
decreased ( figs .
3.the results of immunohistoplanimetry for the number of pcna - positive cells in the dg
( a ) and the granular immunoreactivities of gfap in the hippocampal fimbria ( b ) .
( a )
the number of pcna - positive cells was decreased in all tcdd - exposed groups and
significantly reduced in the t20 , t200 and t5000 groups .
( b ) the number of the
granular immunoreactivities of gfap was significantly decreased in the t5000 group .
the number of pcna - positive cells was decreased in all
tcdd - exposed groups and significantly reduced in the t20 , t200 and t5000 groups ( figs . 1k1o
and 3b ) .
doublecortin ( dcx ) immunoreactivity was
detected in axons and dendrites of the immature neurons .
the intensity of dcx staining did
not differ between the control and tcdd - exposed groups ( fig .
the results of immunohistoplanimetry for the number of pcna - positive cells in the dg
( a ) and the granular immunoreactivities of gfap in the hippocampal fimbria ( b ) .
( a )
the number of pcna - positive cells was decreased in all tcdd - exposed groups and
significantly reduced in the t20 , t200 and t5000 groups .
( b ) the number of the
granular immunoreactivities of gfap was significantly decreased in the t5000 group .
this study demonstrated maternal tcdd exposure in c57bl/6n mice disrupted the fetal
hippocampal development at e18.5 . to our knowledge , this is the first in
vivo study reporting the effect of maternal exposure to tcdd on the dg and the
hippocampal fimbria in fetal mice in which the decreases of the gfap immunoreactivities and
the number of pcna positive cells in the dg , and the reduction of the number of granular
gfap immunoreactivities in the hippocampal fimbria were shown .
these results suggest that
the cumulative dioxins in fetus mediated via the placenta already affect the cells in the dg
and the hippocampal fimbria in the fetal period and result in an adverse effect on the
development of the hippocampus .
neurons and glial cells in the dg derive from a pseudostratified neuroepithelium of
ectodermal origin during early embryonic development . at around e910 in mice , cortical
neurogenesis begins , and neuroepithelial cells begin to differentiate into radial glia ( rg ) ,
which are nscs and express gfap .
the rg
generates neurons directly or indirectly through neural precursor cells ( npcs ) . in the
present study ,
the gfap immunoreactivities were reduced in the dg of the t5000 group at
e18.5 , and the number of pcna - positive cells was significantly reduced in the dg of the t20 ,
t200 and t5000 groups at e18.5 . moreover ,
the cell density in the dg was decreased in the
t5000 group compared with the control group .
these results suggest that tcdd exposure
impairs nscs , npcs or granular cells , resulting in a disruption of neuronal development in
the fetal dg .
tcdd exposure is
known to affect cell proliferation via the activation of mitogen - activated protein kinases
( mapks ) , such as erk or jnk , and the induction of p21 or
p27 , which are involved in the cell cycle [ 3 , 22 , 33 , 38 ] .
moreover , tcdd also
inhibits dna synthesis in rat primary hepatocytes , and the proliferation of primary npcs is
arrested in the g1 phase of the cell cycle by tcdd exposure [ 18 , 25 ] . considering that the ahr is
present in proliferating nscs and npcs in vivo , tcdd exposure likely altered the proliferation of nscs or npcs in the
present study , resulting in a reduction in the number of pcna - positive cells .
another possibility is that the number of cells in the hippocampus was reduced through the
promotion of apoptosis . during the developmental period ,
a surplus of new neurons is
produced , and the inappropriate neurons are excluded by apoptosis [ 7 , 31 ] . as a result , the net number
of neurons is properly retained .
it has been reported that ahr - mediated oxidative
stress generated by the induction of cytochrome p450 enzymes may be an upstream event in the
apoptosis cascade .
in addition , tcdd exposure
has been shown to increase apoptosis of granule neuron precursor cells in the developing
cerebellum . in this study , it is possible that the
mechanism for regulating the number of cells in the hippocampus was disrupted via
tcdd - induced promotion of nsc , npc or granular cell apoptosis . in the hippocampus , astrocytes and nscs express an astroglial intermediate filament , gfap
[ 4 , 49 ] .
immunoreactivities of gfap were observed fibrously and granularly in the hippocampal fimbria
at e18.5 .
the former is considered as the cell processes of astrocytes and nscs and the
latter as the branching point of the cell process .
the number of granular gfap
immunoreactivities was significantly decreased in the t5000 group , which may indicate the
delay of astrogenesis . during embryonic development , rgs give rise to neurons first and
glial cells later . at the end of embryonic
development ,
the basic helix - loop - helix genes hes1 and
hes5 are known notch signaling genes , and hes1 and hes5 keep nscs
undifferentiated during early development and promote differentiation into glial cells
.
these data
suggest that the toxicity of tcdd mediated via the ahr disrupts the maintenance of nscs at
the point of their differentiation into astrocytes , resulting in the induction of
developmental delay of astrogenesis in the hippocampal fimbria .
the hippocampal fimbria is
mainly composed of a band of efferent axons that forms part of the cerebral fornix .
ca3
subcortical efferents in the hippocampal fimbria support the acquisition of contextual fear
.
it is known that astrocytes surrounding the
synapses participate in neurotransmission and that astrocytes are also an important
component in glutamate uptake and metabolism .
therefore , astrocytes are also considered to support neural activity in the hippocampal
fimbria .
these facts suggest that the developmental delay of astrocytes by tcdd exposure
disrupts neuronal activity in the hippocampal fimbria . in adult mice ,
new neurons are produced in the subgranular zone ( sgz ) of the dg . unlike in fetal mice , radial astrocytes in the adult
sgz
play a role as the primary precursors of new neurons in the adult hippocampus and increased in sgz differentiation into granular
cells at 14 weeks .
neurogenesis in the dg
becomes persistent throughout postnatal life and is regulated by behavior and the
environment .
the hippocampus is functionally
engaged in learning and memory , and newborn cells are increased by hippocampal - dependent
learning tasks [ 41 , 47 ] .
therefore , it is suggested that neurogenesis exerts an influence on learning
and memory .
it has been reported that in utero and lactational exposure to
dioxin deficit the fear memory of male offspring in adulthood , and latency in the active
avoidance learning was longer in the tcdd exposed male offspring in the 4144 postnatal day
[ 13 , 30 ] .
considering these reports , the effects of tcdd observed in the fetal period , such as the
decrease in the numbers of gfap- and pcna - positive cells , may persist into adulthood , or
neurogenesis in the dg may be negatively affected by tcdd exposure - mediated lactation .
based on the present data , we conclude that maternal tcdd exposure has adverse impacts on
nscs , npcs , granular cells or astrocytes in the dg or hippocampal fimbria , resulting in a
disturbance of neuronal development in future generations of mice .
it is possible that these
effects remain until adulthood , and so , whether the influences of tcdd toxicity on the
developing hippocampus persist and impair learning and memory in adulthood is needed to be
examined as a further study . | dioxins are widespread persistent environmental contaminants with adverse
impacts on humans and experimental animals .
behavioral and cognitive functions are
impaired by 2,3,7,8-tetrachlorodibenzo - p - dioxin ( tcdd ) exposure .
tcdd
exerts its toxicity via the aryl hydrocarbon receptor ( ahr ) , a ligand - activated
transcription factor .
the hippocampus , which plays important roles in episodic memory and
spatial function , is considered vulnerable to tcdd - induced neurotoxicity , because it
contains the ahr .
we herein investigated the effects of tcdd toxicity on hippocampal
development in embryonic mice .
tcdd was administered to dams at 8.5 days postcoitum with a
single dose of 20 , 200 , 2,000 and 5,000 ng / kg body weight ( groups t20 ,
t200 , t2000 and t5000 , respectively ) , and the brains were dissected from their pups at
embryonic day 18.5 .
immunohistochemical analysis demonstrated that the glial fibrillary
acidic protein ( gfap ) immunoreactivities in the dentate gyrus ( dg ) were reduced in the
t5000 group .
granular gfap immunoreactivity was observed in the hippocampal fimbria , and
the number of immunoreactive fimbria was significantly decreased in the t5000 group .
the
number of proliferating cell nuclear antigen ( pcna)-positive cells was decreased in all
tcdd - exposed groups and significantly reduced in the t20 , t200 and t5000 groups . together ,
these results demonstrate that maternal tcdd exposure has adverse impacts on neural stem
cells ( nscs ) , neural precursor cells ( npcs ) and granular cells in the dg and disrupts the
nsc maintenance and timing of differentiation in the hippocampal fimbria , which in turn
interrupt neuronal development in future generations of mice . |
during the last years the research in the restorative - prosthodontic field has led to the development to post - and - core metal free system for the post - endodontic treated teeth .
the use of reinforced fiber posts has showed excellent performance in many studies due to its elastic modulus similar to teeth 's dentinal substratum [ 113 ] .
the retention is therefore guaranteed by the cementation system [ 1 , 3 , 6 ] .
the weak point of the whole tooth - posts - restoration system may be identified in the adhesion between the substratum and the resinous cements [ 2 , 14 ] .
many in vivo and in vitro studies have showed how the fiber post reconstruction failure is dependent on the bonding - dentin interface [ 10 , 11 , 15 , 16 ] . to achieve the best adhesion the optimal interface preparation is related to the bonding agents .
the bonding mechanism exploits the dentinal tubules penetration by the resin and the collagen fiber exposition . by this way
, the canal surface should be cleaned and conditioned to let the formation of the hybrid layer and resin tags [ 1 , 3 , 14 , 17 , 18 ] .
recently the dentin surface conditioning consisting in a treatment of partial or complete smear layer removal in order to preserve the smear plugs was proposed .
however , in the literature it is not clear how to modify the dentin post space before the cementations procedure .
the etching using the orthophosphoric acid 30% to 40% is the most common technique for the enamel conditioning and for the smear layer removal [ 2 , 2023 ] .
other authors suggest that other irrigants such as edta and sodium hypochlorite at different concentrations may be variously alternated among them [ 24 , 25 ] .
the introduction of ultrasonic technology in endodontics has led to proposing new irrigation protocols for cleaning the post space [ 3 , 26 ] . however , the literature results are contradictory and low debated regarding the quality of endodontic and post - space cleaning with this activation system [ 3 , 21 , 2628 ] .
serafino et al . have shown that the cleansing of the post space made with 17% edta and ultrasound , followed by etching , seems to be the most efficient method compared to using only orthophosphoric acid .
the purpose of this in vitro study is to evaluate the degree of the post - space dentin cleaning .
the research evaluated different irrigation systems that combine the use of 17% edta and etching by orthophosphoric acid at 37% with or without ultrasonic activation .
28 sound monoradicular dental elements , extracted for periodontal reasons and without previous conservative , endodontic , and/or prosthetic treatment , were used .
the presence of a single channel was verified by digital radiographic evaluation in mesiodistal and buccolingual projections . in order to prevent deterioration ,
each dental element has been preserved after the extraction in 1% thymol solution for a period not exceeding thirty days . before being subjected to endodontic treatment
, the all elements were cut at the cej level using a truncated - conical shape diamond bur 0.16 medium .
the access cavity was then created ; the patency of the root canal was confirmed by k - file # 10 . to check the working length ,
4x magnification binocular glasses were used ( eyemag pro s zeiss , carl zeiss s.p.a .
it was possible to control that the endodontic instrument did not exceed the apical foramen [ 2931 ] .
the endodontic treatment was performed using the base sequence of the protaper system ( s1 , s2 , f1 , and f2 ) , alternating washes with naocl ( 3 ml to 5.25% ) conveyed by a needle with a lateral opening ( 27 gauges ) and positioned at a distances between 1 and 2 mm from the predetermined working length for each sample .
after the cleaning and shaping phase , the channels were dried using sterile paper cones .
then the channels were filled with gutta - percha cones and zinc oxide and eugenol cement ( pulp canal sealer ewt kerr ) using the continuous wave of condensation technique ( system b ) for the downpacking and obtura syringe for backfilling .
the next phase consisted in the creation of two parallels to the channel grooves on the mesial and distal surface of the roots using a tungsten carbide disc to achieve a predetermined fracture plane of the sample .
this phase was carried out after the root filling , to avoid possible contamination of channel with the debris produced by the milling dental element .
then the gutta - percha was removed for the creating of the post space . extending the preparation up to 4 mm from the working length to ensure apical seal in gutta - percha used largo cutters from # 1 to # 4 .
the samples were divided into four groups of observation ( a , b , c , and d ) .
each group was subjected to a different system of irrigation and of dentin conditioning : group a : irrigation with 17% edta for 15 seconds with ultrasonic activation.group b : etching with phosphoric acid 37% liquid for 15 seconds with ultrasonic activation.group c : irrigation with 17% edta for 15 seconds with ultrasonic activation and subsequent etching with phosphoric acid 37% liquid with ultrasonic activation.group d ( control group ) : irrigation with 17% edta for 15 seconds and subsequent etching with phosphoric acid liquid to 37% for 15 seconds .
group b : etching with phosphoric acid 37% liquid for 15 seconds with ultrasonic activation .
group c : irrigation with 17% edta for 15 seconds with ultrasonic activation and subsequent etching with phosphoric acid 37% liquid with ultrasonic activation .
group d ( control group ) : irrigation with 17% edta for 15 seconds and subsequent etching with phosphoric acid liquid to 37% for 15 seconds .
the irrigating agents were conveyed in the post space with a side opening needle ( 27 gauges ) ; the ultrasonic activation was performed with endodontic files steel # 20 ems inserted in endochuck 120 mounted on an ultrasonic handpiece ems castellini .
washing was performed with demineralized h2o in the c and d groups samples between irrigation and etching . during the ultrasonic activation phase ,
specific attention was paid to ensure that the files worked passively in the channel . at the end of each procedure
the channels were irrigated with distilled water and then sterile paper cones were used for drying .
once the samples were prepared the buccolingual direction fracture was performed for exploiting the previously performed incisions .
the root canals surface was observed with a scanning electron microscope phenom g2 pro ( phenom - world bv , eindhoven , netherland ) ( magnification range 2045,000x , resolution 25 nm ) ( figure 1 ) .
this microscope investigation let the observation of the sample in the absence of metallization procedures .
the observations were conducted at 1.000x and 2.000x at the apical third , middle third , and the coronal third of the endocanalar root region . to achieve an adequate observation field ,
it was preferred to perform multiple observations in each third in order to obtain a continuous band of extended dentin in the mesiodistal direction . in each band of observations
there were three areas of 16.910 m randomly identified in which the evaluation was carried out of each group of samples , using the score according to serafino et al . .
according to this evaluation method , the amount of debris is identified with a score between 0 and 2:score 0 : no debris , patency of dentinal tubules.score 1 : debris with a diameter smaller than 20 m and in limited quantities.score 2 : debris with a diameter greater than 20 m and in high numbers , impossible to display the entrance of dentinal tubules ( figure 2 ) .
score 1 : debris with a diameter smaller than 20 m and in limited quantities .
score 2 : debris with a diameter greater than 20 m and in high numbers , impossible to display the entrance of dentinal tubules ( figure 2 ) .
so the results could not be influenced by the conscious or unconscious expectation effects that would lead to invalidation of the results .
the evaluation was followed by a statistical analysis of the results obtained on the control sample and the experimental groups , in order to highlight any significant differences .
scores related to zones and groups were expressed as mean and standard deviation . in order to perform comparisons among zones ( coronal , middle , and apical )
, kruskal wallis test was performed for each group ( a , b , c , and d ) ; since the results were statistically significant , we performed pairwise comparisons between zones for each group , applying the mann whitney test ; especially for these multiple comparisons , we applied bonferroni 's correction , through which the significance level = 0.050 has to be divided by the number of the three possible pairwise comparisons , so the new adjusted " significance level for this analysis is equal to 0.050/3 = 0.017 . in order to compare the scores among groups ( a , b , c , and d ) , the same kruskal wallis test was performed for each zone ( coronal , middle , and apical ) and globally ( in toto ) ; the test results are significant and for this reason we performed pairwise comparisons between groups , applying mann whitney test ; after bonferroni 's correction , the adjusted " significance level for this analysis is equal to 0.050/6 = 0.008 .
the results of our research show the best average score 0.81 0.72 obtained in group c ( 37% phosphoric acid and edta 17% ultrasonically activated ) . in groups
a and b , respectively , characterized by edta and phosphoric acid ultrasonic activation , lower average values were obtained than the control group ( resp .
, 1.06 0.69 and 1.08 0.77 ) but higher than group c. the control group ( group d ) registered the lowest level of cleansing among the four groups , with an average score of 1.30 0.69 ( figure 3 ) . the comparison , within each group of samples ( a
, b , c , and d ) in the 3 observation areas proceeding in crown - apical direction showed how the score gradually increases . in group
a , the average values were 0.86 0.65 in the coronal third , 0.90 0.70 in the middle third , and 1.43 1.58 in the apical third . in group
b the values were 0.58 0.60 in the coronal third ; 1.00 0.71 in the middle third , and 1.67 0.58 in the apical third .
group c showed average values of 0.38 0.59 and then moves to 0.80 0.68 and 1.23 0.62 .
group d ( control ) showed the values 0.71 0.56 for coronal third , 1.48 0.60 for middle third , and 1.71 0.46 for the apical third ( figure 3 ) .
the statistical evaluation showed significant differences between the 3 observational zones ( coronal , middle , and apical ) within each group of samples ( a , b , c , and d ) .
group d has the highest degree of significance with a p value ( p = 0.00001 ) , following group b with p = 0.0002 , group c with p = 0.00041 , and group a with p = 0.01203 . in pairwise comparison between the observation areas within the same group ,
a significant difference is evident in all groups between the coronal area and the apical area .
group a and group b showed significant difference between the middle third and apical third ( p = 0.016 e p = 0.002 , resp . ) ; in group d ( control ) , the difference was significant between the coronal third and middle third ( p = 0.0003 ) .
comparing the four examined groups , a significant difference is shown between the middle third and apical third , respectively , with a p value equal to 0.012 and 0.027 .
the pairwise comparison between the different groups highlights a high statistical significance linked to the different score of the middle third cleansing in the comparison between a and d ( control ) groups ( p = 0.007 ) and in the comparison between c and d ( control ) groups ( p = 0.003 ) ; the differences described are highly significant , being lower than p = 0.008 after bonferroni 's correction .
regarding the coronal area , the comparison between a and c groups ( p = 0.015 ) shows a tendency to significance , with the p value being superior to the corrected significance level itself ; same considerations could be done for the apical area in comparison between b and c groups ( p = 0.019 ) , for the middle area in comparison between b and d groups ( p = 0.028 ) , and for the coronal and apical areas in comparison between c and d groups ( p = 0.047 and p = 0.010 , resp . ) . in pairwise comparison between groups , considering all the zones , there are statistically significant differences between groups c and d ( p = to 0.0002 ) .
the data emerging from the research have shown that the different treatment of post - space results in a significant quality difference of the cleaning of the dentin surface .
several irrigation protocols have been proposed , although studies in the literature are contradictory and not very numerous [ 3 , 26 ] .
chemical agents , such as naocl , h2o2 , edta , chlorhexidine digluconate , citric acid ( 10% , 20% , and 50% ) , orthophosphoric acid ( h3po4 ) , and combinations of these , have been proposed for the removal of the smear layer [ 2 , 17 ] .
the experimental design of our research involved the use of 17% edta and 37% phosphoric acid in various combinations .
have shown that different treatments for the removal of cement residues and smear layer from root canal surface affect the adhesion strength of a fiber post .
in particular , the presence of the smear layer potentially interferes with the polymerization of the resinous adhesive 11 materials [ 2 , 8 ] for the production of free oxygen radical .
the same aa have shown that the use of 17% edta followed by 5% naocl produces a complete removal of the smear layer by determining superficial erosions with full opening of the dentinal tubules .
numerous other studies recorded the alternating irrigation with edta and naocl effectively responsible of the smear layer removal [ 24 , 25 , 32 ] .
however , the use of 17% edta for 5 minutes alone could cause a severe erosion of the dentin root surface due to excessive demineralization [ 8 , 13 , 16 , 25 ] .
claim that reducing the irrigation time with edta below 1 minute can significantly decrease the smear layer removal .
our research analyzed the effectiveness of the cleansing carried out with the activation of irrigating with ultrasound .
gu et al . have reported that a 1-minute time edta irrigation can effectively remove the smear layer , while the naocl can remove the smear layer on a larger part of the dentin surface but the apical portion of the post space .
even hlsmann et al . have reported that the additional use of ultrasound does not increase the cleansing ability of irrigating solutions . in another study ,
highlighted the possibility of reaching an adequate level of cleaning due to the combination of ultrasonic tips and 17% edta .
this is in accordance with what is shown by plotino et al . , according to which the ultrasonic vibration would increase the effectiveness of irrigating solutions in removing debris .
argue that the activation of ultrasonic irrigating solution followed by etching provides effective cleaning even on the apical third of the post space .
the differences between the irrigation protocols used in our research are highlighted by different amount and distribution of debris on the surface of the post space .
the statistical analysis shows significant differences between the 3 observational zones ( coronal , middle , and apical ) within each group of samples ( a , b , c , and d ) .
taking into account the three levels of observation , the average score within each group shows a descending cleaning level towards the apical direction . in particular , the d control group ( irrigation with edta / orthophosphoric acid without ultrasonic activation ) is characterized by a significant difference between the areas ( lowest p value ) .
this condition indicates the lack of ultrasonic activation and a consequent lack in cleansing of root canal surface moving in the apical direction .
group b also shows a significant difference between the areas ; the action of orthophosphoric acid with ultrasonic activation is not clearly effective to obtain a homogeneous cleaning .
groups c and a , respectively , characterized by the activation of the orthophosphoric acid / edta and only edta showed higher p value , a sign that the edta activation would ensure a more uniform cleaning of the root canal surface . in an average comparison of the last few groups it is evident that the best value was found in group c , which also shows the lowest absolute values .
the pairwise comparison between the observation areas , as part of the samples treated with the same protocol , showed a significant difference between the coronal area and the apical area in all groups , confirming that cleaning would become less effective moving apically . in group a and group
b there is a significant difference in the comparison between the middle third and apical third ; it is therefore assumed that the action of the two individually activated irrigants is more likely to lead to a lower degree of cleansing when compared with group c where the irrigant action tends to be more uniform . in group
d ( control ) , the absence of activation determines a significant difference also between the coronal area and average . in the comparison between groups
there was a significant difference between the middle third and apical third ; cleaning was more difficult moving apically , it is evident that the strengthen action of ultrasounds causes significant differences more in the middle zone ( p value = 0.012 ) rather than the apical ( p value = 0.027 ) of the post space . regarding the areas in paired groups , it is evident that comparing the middle zone of group a versus d and the middle zone c versus d demonstrated the increased efficacy of activated edta . evaluating significance trends can highlight that the samples of group c are generally more cleansed then those of group a and group b , but it should be emphasized especially that there is a tendency to statistical significance in the comparison between groups a and d , to further confirm the effectiveness of edta ultrasonic activation .
the data analysis shows how the different post - space irrigation protocols correspond to different types of cleaning . however , the amount of debris remaining tends to increase from coronal to apical area .
the protocols that used ultrasound activated edta alone or in association orthophosphoric acid were the most effective . the worst performances shown by the protocol consisted in the use of the two solutions without activation , showing that the ultrasonic activation can significantly improve the efficiency of the post - space cleaning procedures .
the different dentin surface obtained with the various protocols is functional to the different methods of adhesion mandatory for post cementation .
if the technique requires the use of a total - etch adhesive , the use of an association of activated irrigants that determine a smearless layer surface is preferred .
when self - etch bonding is used , in which the adhesion interface is made by the smear layer , a less aggressive treatment of the post space is indicated . in this case | aim .
purpose of the present paper is to analyze the efficiency of different post - space irrigation protocols .
methods .
28 single rooted teeth were endodontically treated .
after post - space preparation every sample was assigned to one of three experimental groups and to one control group . in each group
different irrigation protocols were performed as follows : edta ( group a ) , 37% orthophosphoric acid ( group b ) , and edta + 37% orthophosphoric acid with ultrasounds activation ( group c ) . in the control group ( group d ) the irrigate association was not activated by ultrasounds .
three zones ( coronal , middle , and apical ) of each sample were analyzed by using scan electron microscopy ( sem ) without any metallization procedures .
the presence of smear layer on the canal surface was qualitatively evaluated by applying serafino 's score with values included between 0 and 2 .
results .
the results of the research showed how group c recorded the better results ( 0.81 0.72 ) .
group a and group b showed lower mean scores ( 1.06 0.69 and 1.08 0.77 ) ; group d showed the lowest mean score of 1.30 0.69 .
the sem observation analysis demonstrated how the smear layer presence decreased in the crown - apical direction .
conclusions .
the different post - space treatments statistically determine significant differences on the dentinal surfaces cleansing .
the absence of ultrasonic activation lowers the cleansing efficacy of endocanalar irrigants , showing sensible differences among each post - space zone . |
the term quality of life ( qol ) has been used in a variety of different ways to characterize our daily life .
quality of life is a crucial expression of individual wellbeing and a valuable goal for societies .
it is a multidimensional concept , affected in complex ways by a person s physical health , psychological health , personal views , social and environmental relationships ( 1 ) . according to who , quality of life is determined by how individuals view their own position in life .
an individual 's perception is under the influence of the value system they relate to , their culture and goals they follow in life as well as the standards of their society ( 2 ) . since the late 1990s , research on qol
has gained more attention in different health related disciplines such as medicine , social sciences , health services and health promotion ( 3 ) .
the study of quality of life is the examination of factors that contribute to the goodness and well - being of life , as well as people s happiness .
the ideological thrust of studying quality of life is to understand and promote the means for people , within their environments , to live in ways that are best for them ( 4 ) .
a review of the literature suggests that the usefulness of qol as an outcome measure associated with medical interventions has facilitated its acceptance as worthy of periodic national surveillance ( 5 ) and it has been used increasingly in clinical research to measure improvement in perceived well - being ( 6 ) .
qol should be linked with not only clinical variables ( 6 ) , but also lifestyle behaviors .
such linkage would offer opportunity for broader interpretations of the role of qol , which would be of potential value to policy makers .
however , to date there have been few studies that have examined the link between quality of life and engagement in lifestyle behaviors .
most of the studies oriented on the connection between lifestyle behaviors and quality of life have been conducted in highly industrialized capitalist societies ( 7 , 8) .
therefore , in countries like iran in the middle east , where social systems mean women may experience reduced opportunities ( 9 ) , understanding how their qol links with lifestyle behaviors could be important in securing social changes .
the specific objectives of this study are to : a ) describe qol and life satisfaction of young iranian women ; b ) examine the associations between qol including identified qol domains , with socio - demographic variables , satisfaction with life ( swl ) and lifestyle behaviors and ; c ) examine the predictive role of lifestyle behavior variables such as drinking , smoking and physical activity for quality of life .
locations in shiraz , iran were selected in 2014 from public and private universities , public and private workplaces , religious communities , health care centers , hospitals and public places .
the researcher administered the paper - based survey . to encourage completion of the surveys , a researcher who had the same language as the participants was available to answer questions and provide assistance ( 10 ) .
the whoqol - bref as the instrument to measure the dependent variable of qol was of interest to the present study for the following reasons .
first , it has been developed and validated across diverse cultures , thus overcoming the difficulties associated with using an instrument created for a particular cultural group or country ( 11 ) .
second , the whoqol - bref consists of three parts . the first part , which is the general facet on health & and qol , represents the issues of subjective well - being , general life satisfaction and global qol .
the general facet on health & and qol is the scale that forms the first level of deconstruction of the whoqol - bref construct of life quality ( 12 ) .
the second part of the whoqol - bref concerns health related quality of life issues ( hrqol ) and consists of the physical health and psychological health domains .
the third part of the questionnaire , which deals with contextual issues , is constituted by the social relations and environment domains . from the point of view of qol quality of life theory , it would be interesting to see how the scores differ in these three parts of the questionnaire ( 11 ) . the third reason for choosing
the whoqol - bref is that its persian / farsi version has strong validity and reliability indices ( 13 , 14 ) .
the whoqol - bref comprises 26 items with 24 items across the four domains of physical ( seven items ) , psychological ( six items ) , social ( three items ) and environmental ( eight items ) qol ( 15 ) .
response options range from 1 ( very dissatisfied / very poor ) to 5 ( very satisfied / very good ) .
two additional items on overall rating of qol ( oqol ) and subjective satisfaction with health are used to represent the general facet on health & qol ( 11 ) .
the first is a simple summation of the raw scores of items under each of the four domains .
the second and third methods require the raw scores to be transformed . in the second method ,
the third method is a standardized conversion of likert scale data onto a 0100 scale . in this study
guidelines for these conversions are provided by the whoqol - bref group ( 16 ) .
there are a number of demographic and personal characteristics measured in this study that may influence one s level of quality of life .
socio demographic variables examined included age , ethnicity , level of religiosity , marital status , parental status , and number of children .
level of religiosity was measured through a single question about how religious participants consider themselves to be with response options ranging from 1 ( not religious at all ; never following religious practices ) to 4 ( very religious ; following religious practices very often / often ) ( 17 ) .
this five item self - report scale uses a 7 point response format ( strongly disagree to strongly agree ) to measure whether the person is content with their life .
total scores range from 5 ( low satisfaction ) to 35 ( high satisfaction ) ( 18 ) .
the reliability and validity of this scale has been confirmed with an iranian population ( 19 ) .
lifestyle behaviors the international health and behavior survey was used for measuring lifestyle behaviors such as smoking , alcohol consumption and physical activity ( 20 ) .
the response options of smoking range from 1 ( never smoke ) to 8 ( usually smoke more than 20 cigarettes per day ) .
for drinking the response options range from 1 ( a non - drinker ) to 4 ( a regular - drinker ) and for physical activity the response options range from 1 ( never ) to 5 ( every day ) ( 20 ) . in preparing the questionnaire for the current study
, a process of item review through a panel of australian and iranian public health experts was conducted to assess the face and content validity of questions .
in addition , a pilot study was conducted in order to ensure that the instrument was population appropriate .
data analysis was completed using the statistical package for the social sciences ( spss ) version 20.0 .
qol domain scores ( range : 420 and 0100% ) were calculated using the methodology stipulated by the whoqol - bref study group ( 16 ) .
mean scores between - groups were compared using t - test and anova with pairwise comparisons based on tukey s method .
correlations between the qol , swl , lifestyle behaviors , income and age were calculated using pearson s correlation coefficients .
multiple regression analysis was used to measure the predictive strength of lifestyle behaviors indicator scores and socio - demographic factors ( independent variables ) on qol ( with scores on the general facet on health & qol , and each of the domains .
this technique has been utilized in similar studies particularly when there is only a few missing data like the present study ( 21 ) . ethical approval for this study
was granted by the researchers home university human research ethics committee and a partnering local university human research ethics committee .
locations in shiraz , iran were selected in 2014 from public and private universities , public and private workplaces , religious communities , health care centers , hospitals and public places .
the researcher administered the paper - based survey . to encourage completion of the surveys , a researcher who had the same language as the participants was available to answer questions and provide assistance ( 10 ) .
the whoqol - bref as the instrument to measure the dependent variable of qol was of interest to the present study for the following reasons .
first , it has been developed and validated across diverse cultures , thus overcoming the difficulties associated with using an instrument created for a particular cultural group or country ( 11 ) .
second , the whoqol - bref consists of three parts . the first part , which is the general facet on health & and qol , represents the issues of subjective well - being , general life satisfaction and global qol .
the general facet on health & and qol is the scale that forms the first level of deconstruction of the whoqol - bref construct of life quality ( 12 ) .
the second part of the whoqol - bref concerns health related quality of life issues ( hrqol ) and consists of the physical health and psychological health domains .
the third part of the questionnaire , which deals with contextual issues , is constituted by the social relations and environment domains . from the point of view of qol quality of life theory , it would be interesting to see how the scores differ in these three parts of the questionnaire ( 11 ) .
the third reason for choosing the whoqol - bref is that its persian / farsi version has strong validity and reliability indices ( 13 , 14 ) .
the whoqol - bref comprises 26 items with 24 items across the four domains of physical ( seven items ) , psychological ( six items ) , social ( three items ) and environmental ( eight items ) qol ( 15 ) .
response options range from 1 ( very dissatisfied / very poor ) to 5 ( very satisfied / very good ) .
two additional items on overall rating of qol ( oqol ) and subjective satisfaction with health are used to represent the general facet on health & qol ( 11 ) .
the first is a simple summation of the raw scores of items under each of the four domains .
the second and third methods require the raw scores to be transformed . in the second method ,
the third method is a standardized conversion of likert scale data onto a 0100 scale . in this study
guidelines for these conversions are provided by the whoqol - bref group ( 16 ) .
there are a number of demographic and personal characteristics measured in this study that may influence one s level of quality of life .
socio demographic variables examined included age , ethnicity , level of religiosity , marital status , parental status , and number of children .
socio economic variables measured were education , education of partner , occupation and income . level of religiosity was measured through a single question about how religious participants consider themselves to be with response options ranging from 1 ( not religious at all ; never following religious practices ) to 4 ( very religious ; following religious practices very often / often ) ( 17 ) .
the whoqol - bref as the instrument to measure the dependent variable of qol was of interest to the present study for the following reasons .
first , it has been developed and validated across diverse cultures , thus overcoming the difficulties associated with using an instrument created for a particular cultural group or country ( 11 ) .
second , the whoqol - bref consists of three parts . the first part , which is the general facet on health & and qol , represents the issues of subjective well - being , general life satisfaction and global qol .
the general facet on health & and qol is the scale that forms the first level of deconstruction of the whoqol - bref construct of life quality ( 12 ) .
the second part of the whoqol - bref concerns health related quality of life issues ( hrqol ) and consists of the physical health and psychological health domains .
the third part of the questionnaire , which deals with contextual issues , is constituted by the social relations and environment domains . from the point of view of qol quality of life theory , it would be interesting to see how the scores differ in these three parts of the questionnaire ( 11 ) .
the third reason for choosing the whoqol - bref is that its persian / farsi version has strong validity and reliability indices ( 13 , 14 ) .
the whoqol - bref comprises 26 items with 24 items across the four domains of physical ( seven items ) , psychological ( six items ) , social ( three items ) and environmental ( eight items ) qol ( 15 ) .
response options range from 1 ( very dissatisfied / very poor ) to 5 ( very satisfied / very good ) .
two additional items on overall rating of qol ( oqol ) and subjective satisfaction with health are used to represent the general facet on health & qol ( 11 ) .
the first is a simple summation of the raw scores of items under each of the four domains .
the second and third methods require the raw scores to be transformed . in the second method ,
the third method is a standardized conversion of likert scale data onto a 0100 scale . in this study
guidelines for these conversions are provided by the whoqol - bref group ( 16 ) .
there are a number of demographic and personal characteristics measured in this study that may influence one s level of quality of life .
socio demographic variables examined included age , ethnicity , level of religiosity , marital status , parental status , and number of children .
socio economic variables measured were education , education of partner , occupation and income . level of religiosity was measured through a single question about how religious participants consider themselves to be with response options ranging from 1 ( not religious at all ; never following religious practices ) to 4 ( very religious ; following religious practices very often / often ) ( 17 ) .
there are a number of demographic and personal characteristics measured in this study that may influence one s level of quality of life .
socio demographic variables examined included age , ethnicity , level of religiosity , marital status , parental status , and number of children .
socio economic variables measured were education , education of partner , occupation and income . level of religiosity was measured through a single question about how religious participants consider themselves to be with response options ranging from 1 ( not religious at all ; never following religious practices ) to 4 ( very religious ; following religious practices very often / often ) ( 17 ) .
this five item self - report scale uses a 7 point response format ( strongly disagree to strongly agree ) to measure whether the person is content with their life .
total scores range from 5 ( low satisfaction ) to 35 ( high satisfaction ) ( 18 ) .
the reliability and validity of this scale has been confirmed with an iranian population ( 19 ) .
lifestyle behaviors the international health and behavior survey was used for measuring lifestyle behaviors such as smoking , alcohol consumption and physical activity ( 20 ) .
the response options of smoking range from 1 ( never smoke ) to 8 ( usually smoke more than 20 cigarettes per day ) . for drinking the response options range from 1 ( a non - drinker ) to 4 ( a regular - drinker ) and for physical activity the response options range from 1 ( never ) to 5 ( every day ) ( 20 ) .
in preparing the questionnaire for the current study , a process of item review through a panel of australian and iranian public health experts was conducted to assess the face and content validity of questions .
in addition , a pilot study was conducted in order to ensure that the instrument was population appropriate .
data analysis was completed using the statistical package for the social sciences ( spss ) version 20.0 .
qol domain scores ( range : 420 and 0100% ) were calculated using the methodology stipulated by the whoqol - bref study group ( 16 ) .
mean scores between - groups were compared using t - test and anova with pairwise comparisons based on tukey s method .
correlations between the qol , swl , lifestyle behaviors , income and age were calculated using pearson s correlation coefficients .
multiple regression analysis was used to measure the predictive strength of lifestyle behaviors indicator scores and socio - demographic factors ( independent variables ) on qol ( with scores on the general facet on health & qol , and each of the domains .
this technique has been utilized in similar studies particularly when there is only a few missing data like the present study ( 21 ) . ethical approval for this study
was granted by the researchers home university human research ethics committee and a partnering local university human research ethics committee .
the average age of responders was 27 ( sd : 4.8 ) , with 78% of fars ethnicity .
the majority of participants were muslim ( 96% ) of which 40.4% had an average level of religiosity .
about half of the participants were single ( 49.1% ) with the large majority of the remainder being married ( 45.4% ) .
sociodemographic and socio economic variables of participants table 2 shows the level of satisfaction with all 26 items of qol . according to this table , just one item in the physical qol domain
in addition , there was moderate satisfaction ( 66%74% ) for only five items out of 26 , which all related to physical qol . in terms of psychological qol , social and environmental qol , participants were either dissatisfied ( < 50% ) with most of the items or barely satisfied with a few of them ( 50%65% ) .
level of group satisfaction with qol items : whoqol - bref ( n=391 ) group satisfaction defined as 50% of subjects rated the item as : good / very good .
group dissatisfaction : < 50% of subjects rated the item as : good / very good ( 11 ) the domain mean scores for physical qol ( 75.7% ) and environmental qol ( 60.5% ) fall within the average range indicated by the who 23-country report ( 15 ) . while psychological qol ( 60% ) , social qol ( 50.7% ) , and the general facet on health & qol score ( 71.6% ) were below the average range of the who 23-country report ( 15 ) .
the data shows that physical qol is significantly higher than all other domains ( table 3 ) .
bivariate correlations , means and standard deviations with regard to correlations , as table 3 shows there are positive correlations between all domains of qol and swl .
in addition , a positive correlation was found between social qol and income per household .
however there were negative correlations between physical qol , psychological qol , and the general facet on health & qol with smoking .
furthermore , negative correlations were found between psychological qol , and the general facet on health & qol with age , and positive correlations were found between psychological qol , and the general facet on health & qol with level of religiosity .
analysis by t - test and anova indicates that there is a significant difference between some domains of quality of life with ethnicity , marital and parental status .
greater psychological qol was found among participants without children ( vs. women with children ) .
multiple regression analysis was used to assess the predictors of qol and swl ( with scores on different domains of qol as dependent variables ) by including lifestyle behavior scores and socio - demographic factors as independent variables .
table 4 displays the final model of relationships between domains of qol , swl , lifestyle behaviors , and socio - demographic factors such as age , education , and income . according to the findings ,
lifestyle behaviors such as smoking , and physical activity were the main predictors of qol . among socio - demographic factors ,
predictors of quality of life in regression analyses : swl and domains of qol as dependent variables
this study was the first to be conducted on qol among healthy young iranian women .
the investigation of quality of life of young women in iran has provided insights into the perceived quality of life in this age group including how lifestyle behaviors influence their qol .
much of the previous studies on quality of life have oriented on understanding the factors that contribute to self - perceptions of well - being among patient population ( 6 ) .
in contrast , the present study evidenced a strong link between qol , swl and lifestyle behaviors in a population , which does not identify with a health adversity .
therefore , this study adds to our understanding of the relationship between qol and lifestyle behaviors .
this finding has potential to be used to broaden interpretations of qol and its application in policymaking .
the present study shows that young iranian women are averagely dissatisfied with life circumstances particularly social , psychological and environmental domains of qol .
the connection between qol and higher physical health was expected given the age range of the women .
ohaeri and colleagues study , conducted among 3303 general participants from both genders ( 1687 years ) , also identified concern regarding self - reported qol in kuwait ( 11 ) .
considered together , the current study and ohaeri s study suggest that qol could be an issue in middle east countries such as iran and kuwait and may affect or be associated with other aspects of life . according to the current study ,
lifestyle behaviors predict qol with healthy lifestyle behaviors such as not smoking and regular physical activity predicting a higher quality of life .
the findings in the current study are interesting as they relate to a socially restricted population with the chosen lifestyle behaviors potentially representing self - expression of lifestyle control and choice . yet
, the identified link between lifestyle behaviors and self - reported qol is consistent with studies conducted in other less restricted societies ( 8 , 22 ) .
for example , the positive association between qol and physical activity ( 22 ) and negative associations between quality of life and smoking ( 7 ) and alcohol consumption ( 8) .
socio - demographic and socio - economic variables influenced the qol domains in the present study . in terms of the socio - demographic variables ,
findings show that with increasing age the psychological qol , and the general facet on health & qol decreases .
this finding is in line with other studies which all found that qol diminishes with age ( 11 , 23 , 24 ) .
in addition , the current study found married women report higher social qol than single women .
interestingly , ohaeri s study showed no significant difference in terms of marital status and qol ( 11 ) .
the possible reason for significant difference in the current study in terms of marital status and social qol could be related to the cultural restrictions on social participation of young iranian women .
the finding suggests that married iranian women have increased access to social groups , events and social opportunities and consequently have better social qol .
a significant positive association was found between the level of religiosity , psychological qol , and the general facet on health & qol .
empirical evidence confirms the protective role of spirituality and religious involvement for psychological and mental health ( 25 , 26 ) .
practicing a religion and having strong religious beliefs improves both cognitive and affective perceptions of qol ( 27 ) . with respect to psychological health
hence , in an islamic society like iran , religious / spiritual beliefs and practices contribute to psychological quality of life and coping for religious iranian women both day - to - day and during adversity and challenging situations . in terms of socio - economic variables ,
findings of the present study demonstrate a positive correlation between social qol and household income .
for example , research by kenny ( 23 ) and stewart ( 29 ) reported that in middle - income countries and across 15 european countries , there was little evidence of a connection between economic growth and gdp per capita and subjective well - being ( swb ) .
in addition , the relatively high socio - economic indices in kuwait may not be reflected in a high level of subjective wellbeing in the general population ( 11 ) .
the association identified in the present study is likely to be linked with the focus on young women and this population s particular social circumstances in iran .
young women who are part of wealthier families in iran may have greater access to social facilities / services that enhance their social participation and consequently their social qol .
there were no correlations or significant differences between other socio - economic factors such as education , education of partner , employment and qol domains . in terms of employment and qol
, this is consistent with the asadi sadeghi azar ( 2008 ) and saravi and colleagues ( 2012 ) studies in iran , which showed no significant differences between employed women and housewives .
the current study was conducted in one of the biggest cities of iran ( shiraz ) in 10 different areas .
however , the sample may not have been representative of other cities in iran and should be extrapolated to other cities and locations with caution .
this shows that higher levels of healthier lifestyle behaviors lead to improved qol among young iranian women . in order to improve the situation of young iranian women ,
the findings that should be of particular interest to policy makers include the average dissatisfaction with circumstances of life particularly in terms of psychological and social qol .
policy makers need to consider how restrictions on lifestyle affec qol , highlighting the need for interventions to increase opportunities for women to engage in positive lifestyle behaviors .
qol measurements for women in less industrialized societies have to be considered by researchers and become a routine part of understanding health and wellbeing .
the health policy - makers may also consider qol measurements in their national health data systems as part of population level health surveillance .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors . | background : limited studies have examined the relationship between quality of life and lifestyle behaviors . the purpose of this study is to examine the perceptions of quality of life among young iranian women and its association with lifestyle behaviors.methods:this cross - sectional study was conducted among 391 young women selected through a cluster convenience sampling strategy in shiraz , iran .
whoqol - bref and satisfaction with life scales were used to measure subjective well - being .
the international health and behavior survey was used for measuring lifestyle behaviors.results:young iranian women were averagely dissatisfied with their life circumstances .
the score of psychological quality of life , and social quality of life were below average . according to the findings , higher quality of life
is positively related to healthier lifestyle behaviors .
multiple regression analysis showed that smoking and physical activity are the main predictors of quality of life .
findings also demonstrate that diminished quality of life was significantly associated with older age , low income , being single , low level of religiosity , smoking and low levels of physical activity.conclusion:in order to improve the situation of young iranian women , the findings that should be sources of concern to policy makers include the average dissatisfaction with circumstances of life particularly in terms of psychological , social and environmental quality of life .
while the health system focus is often upon addressing unhealthy lifestyle behaviors , policy initiatives aimed at improving these circumstances of life for young iranian women would be of substantial medium to long - term benefit to their wellbeing . |
the thyroid elements may be benign or malignant in histology , the latter most commonly appearing as papillary and less frequently follicular thyroid - type carcinoma .
extra - ovarian spread of struma ovarii is rare , but when it does occur , it is usually intra - abdominal and the majority of cases are diagnosed post - operatively .
the extra - ovarian tissue can have a histologically benign appearance or can demonstrate features seen in thyroid - type carcinoma .
although more recent literature recognizes these cases as neoplastic , terming them highly differentiated follicular carcinoma of ovarian origin ( hdfco ) .
our literature search reveals only two documented cases of hdfco with spread to the peritoneum , making this a rare but important entity to consider in cases with appropriate pathological findings .
here we report a gravida 3 , para 2 caucasian 70-year - old female patient who was evaluated at an outside institution for persistently elevated alkaline phosphatase levels with no clinical complaints .
a bone scan was obtained at that time and demonstrated abnormal uptake in the cranium , long bones and pelvis , raising the possibility of metastatic disease and the patient was referred to our institution .
the patient demonstrated an elevated thyroglobulin level of 101.5 ng / ml ( normal 0 - 33.0 ng / ml ) .
in addition , the tumor marker ca 15 - 3 was also elevated at 34.7 u / ml ( normal 10 - 19.9 u / ml ) .
contrast enhanced computed tomography scan of the chest , abdomen and pelvis demonstrated multiple peritoneal nodules , the largest of which measured 3.2 cm 2.2 cm [ figure 1 ] .
biopsy of one of the peritoneal lesions revealed thyroid tissue without atypia and we investigated whether struma ovarii was possible . the patient had undergone an elective total abdominal hysterectomy and bilateral salpingo - oophorectomy for endometriosis at age 39 years .
the patient reported being told of a left ovarian cyst without the need for follow - up .
computed tomography image of the pelvis demonstrating multiple peritoneal lesions , the largest of which is demonstrated above hyperenhancing epicardial nodules given the number of lesions associated with the omentum , the patient underwent a diagnostic laparoscopy and partial omentectomy .
pathology from the excised omental nodules demonstrated histologically benign appearing thyroid tissue with multiple thyroid follicles of various sizes [ figure 3 ] .
papillary thyroid carcinoma , with characteristic nuclear grooves ( arrowheads ) and a nuclear inclusion ( arrow ) ( h and e , 400 ) as part of the diagnostic evaluation a bone marrow biopsy was performed and was negative for malignancy .
in addition , a thyroid ultrasound was performed that demonstrated multiple small nodules with a dominant nodule in the right upper thyroid lobe .
three of the nodules were biopsied and the cytologic findings were consistent with benign nodules .
given the patient 's extensive extra - ovarian struma ovarii , a total thyroidectomy was recommended prior to radioiodine therapy
. pathological evaluation of the thyroid revealed a 0.5 cm focus of well - differentiated papillary carcinoma ( a microcarcinoma ) without lymphovascular invasion , stage pt1 [ figure 4 ] .
abdominal thyroid tissue characterized by histologically bland thyroid tissue including follicles and colloid ( h and e , 400 ) total body i-123 uptake scan was performed for treatment planning purposes and demonstrated innumerable areas of uptake within the chest , abdomen and pelvis [ figure 5 ] .
a discussion was held regarding the appropriate i-131 treatment dose . given concerns about bowel radiation injury , the patient was treated with 30.5 mci of radioiodine 131 .
total body radioactive iodine scan prior to therapy shows uptake in the abdomen as well as small foci in the mediastinum . at 24 h i-123 uptake in the cervical thyroid bed was measured at 1.4% ( normal = 8%-29% ) a follow - up i-123 uptake scan 4 months later showed resolution of the chest uptake and significant decline in the number of lesions throughout the abdomen and pelvis that were consistent with a short - term positive response [ figure 6 ] .
thyroglobulin tumor marker at the follow - up scan was elevated at 91 ng / ml .
follow - up total body radioactive iodine scan demonstrates resolution mediastinal uptake and significantly decreased uptake in multiple abdominal and pelvic nodules
struma ovarii occurs when thyroid tissue is the predominant element in an ovarian teratoma . in a small percentage of these cases ,
the thyroid tissue has a malignant histology and is capable of spreading to the peritoneum , bones , cranium and multiple organs .
there are less than thirty reports of struma ovarii metastasizing to distant sites and even fewer that demonstrate the significantly delayed presentation that was seen in this case .
we could find only one reported case in which peritoneal dissemination was discovered 26 years after initial operation ; however , several cases of delayed dissemination to other organ systems exist . for example mcdougall et al .
reported the discovery of vertebral and liver metastases in a patient 41 years after oophorectomy for ovarian tumor .
this term has been applied to patients with metastases of ovarian struma that have a bland , nonmalignant histologic appearance .
the current case is complicated by the lack of any significant ovarian pathology from the patient 's hysterectomy and bilateral oophorectomy 31 years ago .
after pathology review of the omentectomy specimens confirmed thyroid tissue without atypia , the location of the primary tumor remained unclear - thyroid versus ovarian .
the histologic features of the papillary thyroid microcarcinoma in this case were distinctly different from the histology of the omental nodules .
the possibility of distant metastases from the papillary thyroid microcarcinoma was felt to be highly unlikely due to its small size and lack of cervical lymph node metastases .
although we were unable to review the original ovarian pathology from 31 years ago , which was reported as benign , our investigation supports this case as a likely additional example of hdfco and illustrates the insidious nature of struma ovarii and the importance of maintaining a high degree of suspicion , even in patients who have had remote oophorectomy . | a 70-year - old female patient presented to her primary care doctor with persistent elevated alkaline phosphatase of suspected metastatic etiology .
computed tomography demonstrated epicardial and peritoneal nodules .
biopsy of one of the peritoneal nodules revealed thyroid tissue and extraovarian struma ovarii was considered .
the patient had a history of remote total abdominal hysterectomy and bilateral salpingo - oophorectomy 31 years prior for endometriosis with no available pathology from that surgery .
the patient recalls being told that she had a left ovarian cyst .
a thyroid ultrasound was performed that demonstrated multiple nodules without concerning features ; however , due to high clinical suspicion , a total thyroidectomy was performed . upon full histological evaluation a
0.5 cm papillary microcarcinoma was found .
given the rarity of metastatic papillary cancer to the peritoneum and the small size and grade of the tumor , a diagnosis of highly differentiated follicular carcinoma of ovarian origin was favored .
the patient was subsequently treated with radioiodine therapy . |
tremor is a common movement disorder that can interfere with daily living and impair the quality of life9 ) .
medical treatment may help relieve the symptoms , but many patients either become unresponsive to the medication or suffer side effects from the medication .
ventralis intermedius ( vim ) nucleus of the thalamus has been known to play an important role in the development of tremor , and various surgical modalities resulting in the destruction or modulation of the vim nucleus have been used to control the symptoms .
radiofrequency thalamotomy ( rft ) and deep brain stimulation ( dbs ) are representative of the surgical modalities which provide effective and sustained control of the tremor6,7 ) .
however , in some patients surgical treatment may not be feasible because they have predisposing factors for high risk of procedure - related complications , although surgery is the best choice in terms of the therapeutic effect .
gamma knife radiosurgery , the most commonly used method of stereotactic radiosurgery , has been used as an alternative to destructive surgery in patients who can not undergo an invasive procedure .
prior reports have shown gamma knife thalamotomy ( gkt ) to be an effective treatment for tremor , with clinical improvement rates between 70% and 80% , comparable to those of stereotactic rft4,10 ) .
the purpose of the present study was to investigate the clinical outcome of gkt in elderly patients with disabling tremor .
we retrospectively reviewed the medical records of patients with tremor who were treated with gkt from june 2012 to august 2013 .
seven patients underwent gkt ( 5 males and 2 females ) and their mean age was 72.9 years ( range , 70 - 75 years ) .
six patients were diagnosed with essential tremor , and one patient was diagnosed with parkinson 's disease in whom tremor was the predominant and disabling symptom .
all of the patients had tremor duration of more than 5 years ( range , 8 - 43 years ) with tremors having a progressive or unresponsive clinical course despite sufficient medical treatment by the neurologists .
gkt was considered in patients aged 70 years or older when rft or dbs was not suitable due to medical comorbidities that prohibited invasive procedure ( 4 patients ) or the patient refused to undergo traditional surgery ( 3 patients ) .
informed consent was obtained from all of the patients after explaining the procedure , benefits , risks , and alternatives ( continued medical therapy , rft , dbs , and no treatment ) to radiosurgery . although all of the patients had a bilateral tremor , they underwent left sided unilateral gkt .
each patient underwent 1.5 tesla high - resolution mr imaging , with a stereotactic coordinate frame fixed to their head .
mr imaging study included contrast - enhanced t1 images and t2 images taken at 2 mm intervals .
mri of the cranium including the thalamus and midbrain was performed to identify the anterior commissure ( ac ) , the posterior commissure ( pc ) , and the third ventricle .
stereotactic radiosurgical thalamotomy was performed using the leksell gamma knife perfexion model ( elekta instruments , norcross , ga , usa ) .
the intended target was the posterior and inferior part of the left vim which was thought to be involved in the development of tremor .
the target was set as follows to locate the isocenter of irradiation : 15 - 17 mm lateral to the ac - pc line ; 7 - 8 mm anterior to the pc ; and 3 - 4 mm superior to the ac - pc line .
the laterality of the isocenter was carefully adjusted so as to keep it medial to the internal capsule .
a maximum dose of 130 gy was delivered with a single 4-mm isocenter and selective beam blocking was used to restrict the dose towards the internal capsule .
the 20% isodose line of the 4-mm collimator was kept medial to the internal capsule and prescribed isodose volume was 94.7 mm in average ( range , 93.1 - 96.2 mm ) . the modified fahn - tolosa - marin tremor rating scale ( trs ) scores3 )
were evaluated before and after gkt by neurologists who were not involved with the gkt procedure .
patient 's handwriting , drinking from a glass of water , and tremors were evaluated separately ( resting , postural , and action tremors ) . writing short words such as the name and sentences like home address was evaluated , and drawing a straight line and a helical figure was also evaluated for both hands .
clinical follow - up with the modified trs score was performed every 3 to 6 months .
follow - up brain mri was performed at 3 to 8 months ( median , 4 months ) after gkt .
preoperative and postoperative trs scores were compared using the nonparametric wilcoxon signed rank test ( spss for windows version 18.0 statistical software ; spss inc . , chicago , il , usa ) .
the median follow - up period after gkt was 7.3 months ( range , 3.3 - 12.1 months ) .
baseline modified trs score and follow - up trs scores are shown in table 1 .
median baseline trs score checked before gkt was 64 ( range , 53 - 80 ) , initial writing score for the right hand was 4 ( range , 2 - 4 ) , drinking score was 3 ( range , 3 - 4 ) , and tremor score for the right upper extremity was separately evaluated for resting , postural , and action tremors .
the median resting , postural , and action tremor scores were 0 , 2 , and 3 , respectively .
the follow - up trs score at less than 4 months after gkt was available in 6 patients .
the median follow - up trs score was 58 ( range , 29 - 78 ) , writing score was 3.5 ( range , 1 - 4 ) , drinking score was 3 ( range , 1 - 4 ) , and the median resting , postural , and action tremor scores in the right upper extremity were 0 , 1.5 , and 2.5 , respectively . until 4 months ,
3 among these 6 patients showed improvement in the trs score . on comparing between the pre - operative and post - operative trs scores
, there was no statistically significant difference in all of the values ; total trs score ( p=0.674 ) , writing score ( p=0.317 ) , tremor score ( p=1.000 ) , and drinking score ( p=0.414 ) .
follow - up trs score at 4 months and above after gkt was measured in five patients .
the writing score was 3 ( range , 2 - 4 ) , drinking score was 3 ( range , 0 - 4 ) and the median resting , postural , and action tremor scores in the right upper extremity were 0 , 1 , and 2 , respectively .
all five patients showed improvements in the trs score , and of the remaining 2 patients who were not followed up after 4 months , one patient had already showed marked improvement within 4 months . finally , 6 of the 7 patients showed objective improvement in the trs score .
there was 18.8% improvement in the follow - up trs score in these 7 patients , and after excluding one patient who demonstrated progressive tremor and increase in the trs score , there was 28.9% improvement in trs scores in these 6 patients .
meanwhile , one patient reported no improvement in subjective symptoms despite objective improvement in the trs score .
another patient did not show any objective and subjective improvement in the trs score and symptoms , respectively after gkt until 4 months .
contrary to the trs scores measured within 4 months after gkt , the follow - up trs scores measured after 4 months of gkt showed statistically significant improvements .
improvement in the total trs score ( p=0.043 ) and tremor score ( p=0.041 ) was found to be significant .
but , the writing and drinking scores did not reach statistical significance ( p=0.059 , 0.189 , respectively ) . the changes in trs scores between before and after gkt measured within and after 4 months of gkt are shown in table 1 and 2 .
there was no neurological deficit related to the treatment or other procedure - related complications .
all of the patients underwent follow - up mri after 3 to 8 months ( median , 4 months ) of gkt .
radiosurgical changes at the intended target site after gkt were seen in 5 patients . a well - circumscribed lesion with peripheral contrast enhancement around a low - signal region was detected .
mean diameter of the enhancing lesion was 4.77 mm ( range , 3.8 to 5.63 mm ) .
four among these five patients showed symptom improvement at the time of mri and the remaining one patient underwent mri at 1 month after treatment and did not show any radiosurgical changes at that time and improvement in the symptoms .
but , this patient showed delayed improvement at 8 months after gkt and follow - up mri showed that the maximum diameter of the enhancing lesion was 5.63 mm .
therefore , mri changes post - gkt were accompanied by symptom improvement in all five patients .
his hands had started shaking since 1990 and the action tremor was worse than the postural or resting tremor .
the tremor aggravated gradually , and recently his voice too had started trembling especially when he was nervous .
he received numerous medications at other hospitals , but the tremor could not be controlled effectively .
a maximal dose of 130 gy was applied to the left vim nucleus ( fig .
the drawing of a helical figure and the address written by the patient before gkt are shown in fig .
the follow - up trs score was 65 ( 81% of that at baseline ) . at 10 months after gkt , the trs score
mri scan with contrast enhancement was performed after 4 months of gkt . a peripheral enhancing rim - like lesion at the intended target site
the drawing of a helical figure and the address written by the patient at the last follow - up visit are shown in fig .
his hands had started shaking since 1990 and the action tremor was worse than the postural or resting tremor .
the tremor aggravated gradually , and recently his voice too had started trembling especially when he was nervous .
he received numerous medications at other hospitals , but the tremor could not be controlled effectively .
a maximal dose of 130 gy was applied to the left vim nucleus ( fig .
the drawing of a helical figure and the address written by the patient before gkt are shown in fig .
the follow - up trs score was 65 ( 81% of that at baseline ) . at 10 months after gkt , the trs score
mri scan with contrast enhancement was performed after 4 months of gkt . a peripheral enhancing rim - like lesion at the intended target site
the drawing of a helical figure and the address written by the patient at the last follow - up visit are shown in fig .
dbs has been commonly used for the treatment of tremor since its introduction in 1980s due to advantages over other surgical treatments such as reversibility , individual modifiability , and non - destructive nature in terms of neuromodulation . however , in certain patients ( including the elderly , those taking anticoagulants or with coagulopathy , those with medical comorbidities , and who refuse to undergo invasive surgical treatment ) , invasive procedures such as rft and dbs are not a feasible option . in this study
, gkt proved to be effective in improving medically refractory tremor in patients and very safe in predominantly elderly patients . in our case series ,
young et al.17 ) , reported long - term results of gkt for the treatment of essential tremor . at 1 year post
gkt , results in 51 patients were evaluated , and in this series 78% of patients were tremor free , 18% of patients were nearly tremor free , and in 8% of patients , the tremor had not improved . at 4 years post gkt ,
71% of patients were tremor free , 18% of patients were nearly tremor free , and treatment had failed in 6% of patients .
the use of a higher dose seemed to be associated with a relatively early clinical efficacy but treatment - related complications such as hemiparesis or dysarthria were frequently noted with the use of a high radiation dosage , especially when the dose was more than 150 gy , and after considering the efficacy and the complications , the optimal dose for gkt has recently been reported as 130 gy11 ) . although the size of the cohort was small and the follow - up period was short , the finding that there were no procedure - related complications in our study confirms the safety of the radiation dose of 130 gy to the vim . in our study , the number of cases included was small ( n=7 ) and the follow - up period ( median , 7.3 months ) was also short in order to evaluate the long - term outcome and the occurrence of complete arrest of the tremor .
but on com - paring between the follow - up trs scores before and after 4 months of gkt , we observed that the trs score was improved during the follow - up period after gkt . also , the follow - up trs score at more than 4 months after gkt reach - ed statistical significance , while the follow - up trs score within 4 months of gkt failed to reach statistical significance .
the follow - up trs scores within 4 months and at more than 4 months of gkt were compared , and the results are shown in table 2 . although we performed a rather short - term follow - up and included a small cohort , we could achieve an improvement in the tremor in 85.7% of the patients without any significant complications . unlike the immediate outcome that can be observed after dbs or rft , the minimal interval from gkt to achieving an effective outcome seems to be more than 4 months .
benabid et al.2 ) , implanted thalamic dbs units in 20 patients with a tremor , and at the 3-month follow - up they found that complete or near complete relief of tremor had been achieved in 75% of patients , and this outcome was apparently better than that of gkt including that in the present study .
other groups have documented improved outcomes with dbs for essential tremor by performing an at least 2-year follow - up5,9,16 ) .
complications after the dbs procedure include lead breakage , wound infection , electrode migration , and intracranial hemorrhage1,18 ) .
furthermore , side effects of stimulation include dysarthria , paresthesia , dystonia , balance disturbance , ataxia , and limb weakness8,13 ) . finally , the overall complication rate was more than 30% .
stereotactic rft for essential tremor has a reported success rate of 73 - 93% , which again is comparable to that of gkt4,6,15 ) .
compared with dbs , however , open thalamotomy may be associated with a poorer functional outcome and more adverse effects14 ) .
meanwhile , no procedure - related complications and no neurological deficit occurred after gkt in the present study . the most critical factor related to complications after gkt is the prescribed dose , and a report of complications in a previous literature demonstrates a dose - dependent risk of gkt .
therefore , it can be suggested that gkt with prescribed maximal dose of 130 gy is safer than the other surgical procedures although its therapeutic efficacy may not be similar to that of rft or dbs .
gkt with maximal dose of 130 gy to the target site of vim is a very safe procedure for patients who can not tolerate invasive surgical procedures .
although the short - term outcome of gkt may not be similar to that of dbs or rft , gkt can be considered to be a superior modality in terms of safety . | objectivetremor is a common movement disorder that interferes with daily living .
since the medication for tremor has some limitations , surgical intervention is needed in many patients . in certain patients who can not undergo aggressive surgical intervention , gamma knife thalamotomy ( gkt )
is a safe and effective alternative.methodsfrom june 2012 to august 2013 , 7 patients with an intractable tremor underwent gkt .
four of these 7 patients had medical comorbidities , and 3 patients refused to undergo traditional surgery .
each patient was evaluated with the modified fahn - tolosa - marin tremor rating scale ( trs ) along with analysis of handwriting samples .
all of the patients underwent gkt with a maximal dose of 130 gy to the left ventralis intermedius ( vim ) nucleus of the thalamus .
follow - up brain mri was performed after 3 to 8 months of gkt , and evaluation with the trs was also performed.resultssix patients showed objective improvement in the trs score . excluding one patient who demonstrated tremor progression , there was 28.9% improvement in the trs score . however , five patients showed subjective improvement in their symptoms . on comparing the trs scores between follow - up periods of more and less than 4 months ,
the follow - up trs score at more than 4 months of gkt was significantly improved compared to that at less than 4 months of gkt .
follow - up mri showed radiosurgical changes in 5 patients.conclusiongkt with a maximal dose of 130 gy to the vim is a safe procedure that can replace other surgical procedures . |
parry - romberg syndrome ( prs ) is a rare neurocutaneous disorder of unknown origin first described by parry in 1825 and romberg in 1846 .
it is characterized by progressive facial hemiatrophy of the skin , subcutaneous tissue and sometimes the adjacent craniofacial bones , sparing facial muscles , that affects mainly the maxillary region but may extend to the chin and forehead .
the onset is subtle , affecting mostly women before the age of 20 years , and disease usually progresses over 2 to 20 years and then enters a stable phase .
patients with early onset tend to be more severely affected [ 2 , 3 ] .
prs can be a distinct disease entity but frequently overlaps with a condition known as linear scleroderma en coup de sabre. scleroderma en coup de sabre is a linear localized form of morphea , affecting the frontoparietal scalp and forehead in stripe - like sclerotic plaques .
the skin of this area appears hard , hyperpigmented , shiny and with alopecia . the differential diagnosis between progressive facial hemiatrophy and linear scleroderma is mainly based on clinical and histopathological findings .
hemiatrophy of the arm , trunk or leg ipsilaterally or contralaterally may be present in these patients , while some may have tongue atrophy and dental abnormalities .
there are reports regarding ocular features , such as enophthalmos , uveitis and heterochromia , and participation of skin and hair disorders including hyperpigmentation , vitiligo and alopecia .
migraine and facial pain ( trigeminal neuralgia ) are the commonest neurological conditions , and epilepsy has been described in 10% of the patients , sometimes associated with brain abnormalities ipsilaterally to the skin lesions [ 2 , 4 ] .
neuroimaging findings when apparent may include hyperintense ipsilateral cortical and subcortical lesions , intraparenchymal calcifications and localized cerebral hemiatrophy , corresponding to the affected side .
patients with cerebral hemiatrophy may show continuous slowing and multifocal sharp waves during eeg recording [ 5 , 6 ] .
there is an ongoing debate on whether localized scleroderma and prs are two different disorders or belong to the same disease spectrum . here
we present a case of a patient with a history of localized scleroderma who was referred to us because of neurological complications and was found to have progressive facial hemiatrophy as well .
a 38-year - old white woman with an 8-year history of localized scleroderma diagnosed by biopsy and no previous neurological complaints was admitted to our department in order to investigate frequent headaches that she developed over the last 6 months .
the patient had a mild left facial hemiatrophy , jaw symptoms , including hemimasticatory spasms coexisting with linear scleroderma affecting the forehead en coup de sabre ( fig . 1 ) and sclerotic plaques on the lower back ( fig .
the brain mri did not reveal any abnormalities affecting the ipsilateral grey or white matter , but the eeg recording showed paroxysmal , slow , polymorphic , sharp activity of 4 - 5 hz frequency , localized in the right temporal region .
progressive facial hemiatrophy ( or prs ) and localized scleroderma en coup de sabre are rare pathological entities of uncertain etiology , with a heterogenic spectrum of associated neurological complications .
the origin of prs varies from face or body trauma [ 2 , 7 ] , especially in childhood onset disease , alteration of the sympathetic ganglion or trigeminal nerve , infections including borrelia burgdorferi [ 2 , 10 , 11 ] , to autoimmune mechanisms .
the latter is supported by the coexistence of prs with other autoimmune disorders , such as thyroid disease , vitiligo , rheumatoid arthritis , ankylosing spondylitis and lupus erythematosus [ 1 , 12 ] and by the elevated titers of one or more autoantibodies .
we present a case of a 38-year - old woman suffering from headaches with unusual characteristics regarding her age , with a known history of localized scleroderma and newly revealed progressive facial hemiatrophy . according to reports ,
females have a higher prevalence of both prs and morphea with initial presentation in early childhood , but late onset , as in our case , is also described .
the patient had left facial hemiatrophy with forehead involvement ( en coup de sabre ) and left hemimasticatory spasms , which affect approximately one third of prs patients .
headache , the most frequent neurological presentation , was the reason of her referral to the neurological department .
this is consistent with the general view that localized scleroderma predates the neurological symptoms by several years . although mri did not reveal any structural brain lesions , her eeg findings had contralateral abnormal activity , without a clinical presentation of epilepsy .
although there are different diagnostic criteria based on distinct clinical and histopathological findings related to the different pathophysiological mechanisms attributed to these two entities , there are many reports about their coexistence and their common extracutaneous features .
sommer et al . reported that 42% of the patients with prs had also en coup de sabre lesions .
also stress the close relationship of morphea and prs based on their mutual central nervous system involvement .
tollefson and witman confirmed these results , and they also reported that 36.6% of patients with linear scleroderma also had prs .
it was also described that biopsy specimens from prs patients who did not have cutaneous sclerosis showed findings consistent with morphea .
migraine and trigeminal neuralgia are the commonest neurological features of prs with a frequency reaching 52% [ 1 , 2 ] . there are reports associating these neurological symptoms with peripheral sympathetic nervous system or trigeminal nerve abnormalities [ 11 , 12 ] and others support the presence of vascular dysgenesis .
prs is generally considered as a self - limited disease and the need for treatment arises from the coexistence of localized scleroderma or other autoimmune disorders . in case of localized scleroderma , methotrexate and corticosteroids
are the treatment of choice , while other immunosuppressant agents like cyclophosphamide , cyclosporine , d - penicillamine and hydroxychloroquine are used when more aggressive therapy is required [ 4 , 21 ] .
reconstructive surgery , which includes fat injections , silicon implants , dermis - fat grafts , galeal flaps and bone and cartilage grafts , is beneficial in the cases of disfiguring facial atrophy [ 7 , 22 , 23 ] . in conclusion ,
linear scleroderma and progressive facial hemiatrophy are closely related forms of cranial facial scleroderma with common neurological manifestations , but their sole existence in some cases and their different histopathological characteristics and treatment approach make the definite thesis of disease overlapping still part of a continuous debate . | parry - romberg syndrome is a rare neurocutaneous disorder of unknown origin .
it is characterized by progressive facial hemiatrophy and frequently overlaps with a condition known as linear scleroderma en coup de sabre. neurological involvement is frequently described in these patients , including migraine , facial pain and epilepsy , which represent the commonest neurological conditions , sometimes associated with brain abnormalities ipsilaterally to the skin lesions .
we present a case of parry - romberg syndrome with neurological involvement in a patient with diagnosed localized scleroderma ( morphea ) . |
biologically functional proteins and/or protein domains / regions that appear to exist as an ensemble of reversible conformers with only little or no well defined secondary / tertiary structures , and are being recognized to contain amino acid sequences that fail to automatically fold into their fully compact functional conformations under physiological conditions , have grown exponentially in last decade or so [ 110 ] .
these are often known as intrinsically disordered ( i d ) proteins , which possess protein surfaces with largely unstructured and dynamic conformations [ 110 ] .
one common characteristic of many i d protein regions is high number of charged amino acids and low hydrophobicity , which acts to destabilize an ordered conformation .
importance of i d regions / domains in cell signaling and regulation can be easily judged by the fact that these i d containing regions / domains are reported to be much higher in eukaryotic genomes when compared with prokaryotes [ 1215 ] .
the abundance of such i d protein regions / domains in eukaryotes could be due to the fact that their flexible and dynamic conformation promotes recognition of target molecules or functional binding partners , by creating large interaction surfaces suitable for macromolecular interactions [ 911 ] . there are reports showing that transcription factors with modular structures commonly possess one or more of i d regions / domains , and it is believed that nature has created such flexibility for specific functions that may require large structural flexibility under physiological conditions [ 12 , 16 ] . in spite of having common characteristics of i d nature , these regions / domains often do not share sequence homology with other members and are quite variable in size compared to other similar domains within the transcription factors [ 1720 ] .
for example , steroid receptors , which possess an i d activation domain located in their n - terminal domain , are quite variable in size and sequence homology . due to unstructured nature of these
i d domains it has been quite difficult to study their three - dimensional structures , and only in the recent years , we have begun to understand their structural basis [ 2123 ] .
however , compared to proteins with globular structures , still not much is known about their three - dimensional structures . as we have begun to understand their physical and functional characteristics ,
it is now well accepted that in order to function optimally , these i d regions need to acquire well defined conformations under physiological conditions [ 2426 ] . to fully understand how precisely a transcription factor
transmits the signal to regulate the expression of its specific target gene(s ) , it is pivotal to gain structural and functional information about i d regions , particularly those within the activation domain .
it is likely that conformational flexibility of i d region allows it to adopt protein surfaces such that an efficient interaction can be established with other target binding partners that can result in i d sequences to achieve ordered conformation(s ) to carry out their functions [ 17 , 2832 ] .
are the conformational transitions taking place during folding / unfolding of these i d regions , highly dynamic process
? how do internal and external factors influence their structural dynamics in a particular cellular environment ?
these and several other fundamental questions warrant an answer to understand this complex yet extremely important phenomenon with far reaching biological consequences .
therefore it is important to address the underlying structural and functional correlations that govern this critical , yet not fully understood process .
some studies have shown that transcription factors remodel chromatin structure in an extremely dynamic situation such that they have the capacity to rapidly form and reform multiprotein complexes involving critical coregulatory proteins including those from the fundamental initiation complex machinery .
thus , the role of their i d region / domain(s ) with flexible conformations becomes much more important , and in fact this could provide a mechanism for inclusion or exclusion of specific protein complexes that may ultimately influence the final outcome responsible for regulation of target gene either through activation or repression [ 3336 ] .
it is now well accepted fact that transcriptional regulation is a highly complex and dynamic process that allows relatively small number of transcription factors to generate a huge variety of gene expression through various permutations and combinations of their interactions with target binding partners [ 3745 ] .
thus , the notion that i d domains / regions of transcription factors must have significantly ordered conformation in their normal cellular milieu under physiological conditions pose a paradox that must be solved before we can fully understand their role in gene regulation .
it is important to note that under physiological conditions , there are several cellular events including molecular crowding , both due to the presence of small molecules and/or macromolecules that could influence the structure formation in such i d proteins .
since transcription factors function through interactions with a network of gene assembly at the level of protein expression , these kinds of conditional folding become much more relevant for them .
in the recent years , data from both experimental and computational approaches are supporting this theory , and are helping us in gaining knowledge about the functional structures of i d proteins / peptides [ 5 , 6 ] . in this paper , we have discussed various ways by which these i d regions / domains of the transcription factors could acquire functionally ordered conformation(s ) , essential for their optimal functions under physiological conditions .
for years , we have been relying on the theory that according to thermodynamic hypothesis of anfinsen , the amino acid sequences can provide all information needed to determine the fold of a protein , and only one collapsed folded state is possible for a specific sequence . until recently
, no data challenged this concept ; however , more and more we learn about characteristics of protein folding process , it becomes clearer that it is not possible to predict with certainty the folded form of a protein from its primary sequence , and recent progresses made with the class of proteins that are i d or contain i d regions seem to challenge this hypothesis [ 17 ] . in our opinion ,
the biggest drawback with such a theory is that it does not consider the highly dynamic and mobile nature of protein conformation that gives such a profound flexibility to protein to adopt a number of conformations in a given cellular environment in a rapid manner .
i d proteins can be divided into two classes ( at least ) ; those that can adopt a unique native conformation when subjected to stabilizing conditions ( i.e. , the addition of natural ligands such as proteins and dna or stabilizing osmolytes ) , and those that apparently have no stable native state [ 7 , 17 ] . the i d regions of many transcription factors fall into the category of those i d proteins that can fold into unique structures , suggesting that if functional properties of the transcription factors are coupled to folding / unfolding in the i d region , thermodynamic analysis of the equilibrium should provide a quantitative characterization of their function [ 7 , 12 , 34 ] . in this situation , the change in free energy should be reflected to favor folding process due to the factors responsible for folding .
in fact , we and others have discovered several ways to make the i d portion of several transcription factors to fold into a functionally active form that can facilitate transcriptional activity of related protein [ 4753 ] .
thus , the knowledge we have gained so far supports the idea that the conditional binding / folding of the i d regions of the transcription factors may be an important requirement for its role in gene regulation .
since transcription factors work in a very selective manner to regulate specific sets of genes , conformational flexibility of i d region / domain may set up appropriate assembly of coregulatory proteins in an efficient and selective manner to regulate the target gene .
it is no secret that i d stretches are quite common in proteins with essential basic cellular functions ( including many transcription factors ) , and thus may be recognized as a separate functional and structural entity based upon the basis of structure and function within the protein classes [ 13 ] .
however , it may be premature to do so , unless more structural and functional characterization of such proteins becomes available . due to their differential structural and functional characteristics from those of ordered proteins ,
i d proteins require special experimental and computational tools for their characterization [ 1 , 3 ] . in a number of signaling proteins , sites of posttranslational modifications ( such as site - specific phosphorylation ) are located within i d region / domain [ 6 , 54 ] . one of the main reasons for such propensity is to facilitate extensive formation of hydrogen binding between the backbones and/or side chains that can occur through disorder - order transition within the i d region . the structural flexibility of i d proteins helps them to more easily and specifically adapt to protein : protein and protein : dna interaction cascades and possibly in gene regulation including alternative splicing .
knowledge of these factors and the kind of conformations adopted by the i d regions / domains within the transcription factors will lead to an understanding of the role of order / disorder transition in the transcription process .
details of some of the possible events that might lead to functionally folded conformations in the i d regions / domains under physiological conditions are discussed in the sections below in detail .
organic osmolytes are found widely in nature to protect cellular proteins against harsh conditions such as the effects of dehydrating conditions , other hypertonic states , or the build - up of potentially denaturing metabolites , and are known to interact with the peptide backbone of proteins [ 5669 ] .
osmolytes are synthesized by microorganisms , plants , and animals in response to environmental stress to protect proteins against denaturation [ 5669 ] .
the free energy of these interactions corresponds to the propensity of protein to either fold or unfold due to presence of osmolytes [ 6466 ] . in spite of small energy magnitude of such interactions , peptide bonds are by far the most numerous structural component of a protein [ 6264 ] .
it is the balance between osmolyte - backbone interactions and amino acid side chain - solvent interactions that determines the outcome on protein folding . in most cases ,
i d regions do not contain sufficient hydrophobic residues to fold spontaneously , thus addition of an osmolyte shifts the balance to a favorable negative free energy for folding .
the unfavorable interaction of the osmolyte with the peptide backbone causes the preferential exclusion of the osmolyte from the protein - water interface , and it dominates over any favorable interaction of the osmolyte with the side chains of amino acids of the protein .
it is the balance between osmolyte - backbone interactions and amino acid side chain - solvent interactions that determines the outcome on folding .
the quantity of osmolyte required depends on both its inherent solvophobic interaction with peptide backbone and the free energy balance provided by the sum of all backbone - osmolyte interactions and the sum of all amino acid side chain - solvent interactions [ 68 , 69 ] .
it has recently been shown that the effects of differing osmolytes are additive , so that under physiological conditions , cellular profolding molecules ( such as osmolytes ) may reach even higher summative concentrations [ 6466 ] .
certain plants , animals , and microorganisms have adapted to environmental stresses that change the intracellular water activity by producing small organic osmolyte molecules [ 61 , 62 ] .
indeed , in some organisms and in mammalian cells , certain class of osmolytes arise to counteract the effects of high intracellular concentrations of urea or other denaturing conditions on the biological activity of relevant proteins [ 61 , 62 ] .
osmolytes are known to perform vital functions in many different tissues in the human body , particularly kidney and brain . without presence of relatively large quantities of osmolytes
for example , urea tends to decrease the kcat and increase the km of enzymatic reactions , while the counteracting osmolyte tmao tends to have the opposite effects , that is , increasing kcat and decreasing km .
furthermore , it has been shown that urea and osmolyte , trimethylamine - n - oxide have opposite effects alone or in combination .
it is therefore logical to believe that many other osmolytes could have similar effects depending upon the environmental conditions and cellular effects .
studies undertaken in last several years from various laboratories on osmolytes suggest that osmolyte - induced structures are in fact native - like with functional activities under physiological conditions [ 6164 ] .
osmolytes are natural substances , used by many organisms to enhance proper protein folding [ 6164 ] . human kidney , for example
, contains several osmolytes , and it has been calculated that osmolyte concentrations in whole tissues often reaches quite high relative to cell water content , suggesting that in certain cells / tissues , their concentrations are almost surely much higher [ 61 , 62 ] .
it is well accepted fact that when a protein folds into a cooperative manner , it should result in a native - like functional species , and the consensus is that when cooperative folding in the presence of an osmolyte occurs , it is to the native folded structure [ 61 , 62 ] .
osmolytes can force i d protein to fold into native - like functional species with significant secondary and tertiary structural contents in it .
we have used several osmolytes to cooperatively fold an i d activation region ( af1 ) located in the n - terminal domain of the glucocorticoid receptor .
we have shown that when af1 is incubated in increasing concentrations of natural organic osmolytes representative of three classes : certain amino acids ( proline ) , methylamines ( sarcosine ) , and polyols ( sorbitol ) , the i d af1 peptide folds into functionally active conformation(s ) that selectively binds several critical coregulatory proteins , and subsequent transcriptional transactivation activity .
a study has shown that oral administration of an osmolyte , trehalose can inhibit polyglutamine - mediated protein aggregation in cerebrum of transgenic mouse model of huntington disease and increased life span .
it has been suggested that these beneficial effects of trehalose are due to stabilizing the partially unfolded polyglutamine - containing huntingtin protein .
this protein aggregation / misfolding process constitutes a hallmark of neurodegenerative pathologies , including alzheimer 's , huntington 's , and parkinson 's diseases , and if osmolytes can provide a unifying mechanism of action , this may have far reaching consequences in developing better therapeutic tools for the management of such diseases .
such effects of osmolytes on protein folding pathways have become important to study . under physiological conditions ,
the cellular compositions of osmolytes may vary significantly ; therefore , different protein folding pathways utilized in the cell may depend upon the cellular environment within it .
understanding the role of osmolytes in cell regulation will not only allow to predict the action of osmolytes on macromolecular interactions in stressed and crowded environments typical of cellular conditions , but will also provide insights on how osmolytes may be involved in pathologies or in their prevention .
it is well established that to regulate transcription , transcription factors act on specific genes by binding to regulatory element sites in the dna , generally located upstream from the relevant transcription start site , and termed as response element . once bound to its specific response element through high
affinity and specificity for the relatively short dna sequences contained therein , the dna bound transcription factor collects a variety of other coregulators that modify chromatin structure and/or interact with the proteins from the primary transcription initiation complex to regulate transcription from the relevant promoter [ 73 , 74 ] .
thus , both protein - dna and protein : protein recognition are central processes in transcription factors function , and several reports indicate that these interactions are often accompanied by conformational changes leading to folding of the i d region(s ) in a protein molecule [ 21 , 73 , 74 ]
. there are reports that dna binding stabilizes the overall global fold of protein in a manner that is consistent with folding - coupled target recognition as a mechanism to control site - specific recombination , and protein flexibility is involved in such induced - fit recognition particularly in i d dna binding proteins .
it is an established fact that transient interactions between transcription factors and site - specific dna sequences are common and fundamental to many cellular processes , and protein flexibility is found to play a major role in protein : dna binding where conformational flexibility of protein acts to maximize efficiency of protein : dna binding . for transcription factors ,
protein first binds dna nonspecifically ( with low affinity ) in a partially or fully unfolded state and undergoes folding of i d sequences when it finds specific dna site to which it binds tightly with high affinity .
an important biological implication of this binding / folding phenomenon is that in early events protein backbone mobility may play an important role in a specific binding with target molecule ; whereas later events may lead to specific signals being passed to the target gene(s ) from the complex of proteins , which emerges only after appropriate conformational changes take place .
based on these observations , it is logical to hypothesize that site - specific nucleotide sequence of the regulatory element sites affects not only the overall affinity of the transcription factor for its regulatory element site , but also influences its overall conformation such that the i d region(s ) of these proteins can acquire much needed ordered conformation(s ) . as a result of such events i d
surfaces on the protein molecule can be modified to accommodate various critical ancillary factors [ 73 , 74 ] .
since transcriptional regulation for a specific gene depends upon the interactions of these coregulatory proteins , the exact dna sequences of the available sites in the regulatory region of the dna of the gene could help determine gene regulation [ 73 , 74 ] .
biophysical studies ( using circular dichroism and fluorescence emissions ) carried out by us have shown that stoichiometric binding to a consensus response element of the glucocorticoid receptor ( an intracellular transcription factor , belonging to the nuclear hormone receptors superfamily ) results in a considerable amount of binding energy being devoted to intramolecular rearrangement in its n - terminal domain where a powerful i d transactivation domain is located .
similar studies from other groups using the progesterone receptor have also been reported that its site - specific dna binding results in additional structure in its i d n - terminal domain .
together , these results suggest that one of the reasons why sequence specific dna binding has such a profound effect on function of the transcription factors in general and the steroid receptors in particular may be so that their i d sequences may acquire an ordered conformation(s ) .
since many transcription factors possess i d activation domain that is responsible for their transcriptional transactivation activity , and this activation domain provides a platform for interaction with other coregulatory proteins , dna binding induced conformational alterations in transcription factors is of immense importance in regulating the expression of target genes [ 5 , 12 , 17 ] .
of course , conformational changes in other parts of the molecule can not be ruled out .
for example , in case of the steroid receptors , dna - binding induced structural changes in the n - terminal i d domain may be influenced by other intramolecular cross communications such as interactions between n- and c - terminal domains , and/or due to binding of specific ligands . though these studies certainly provide a reasonable explanation of why such a specific protein : dna interaction takes place in a promoter region involving transcription factor , resolution of these models will require further future experiments . of course , availability of three - dimensional structure of such i d containing region bound to dna through their dna binding domain will provide much needed information . since gene regulation is an essential function in all organisms and provides the ability to respond to signals that reflect intra- and extra - cellular environmental conditions , understanding the role of protein : dna interactions involved in the regulation of gene expression has been a major challenge . in the recent years , a broad range of techniques
have been used to explore the molecular and energetic basis of dna recognition , assembly , and allosteric changes within regulatory proteins that involves transcription factors .
it is a well established fact that there are a number of proteins often known as coregulatory proteins that make physical and functional interactions with dna - bound transcription factors and participate in their transcriptional activation function .
these coregulators act as coactivators or corepressors depending upon the up- or down - regulation of the target gene by specific transcription factor .
of course , addition of several additional cofactors can not be ruled out that may be involved either directly or indirectly ; some of them are ubiquitous , while others cell - specific .
in fact , for many transcription factors , it has been reported that their effects on transcriptional activity may be cell- and promoter - specific and potential explanation for these effects can be attributed to the formation of the assembly of transcription factor with other coregulatory proteins in a particular cellular setup .
thus , specific combination of transcription factor and coactivators / corepressors results in the specific control of particular genes .
but the obvious questions then come to mind : how is the choice of coregulator interaction with specific transcription factor made ?
some of the explanation for this can be provided from the fact that differing surfaces of the transcription factor are important for regulation of various genes .
there are several reports showing that protein : protein interactions may result in induced - fit alterations in the structure formation in i d region of the transcription factors . in figure 1
, we have illustrated a model of binding / folding for i d domains / regions under physiological conditions .
many i d regions are known to undergo to more ordered conformational transition after interacting with their protein binding targets .
for example , i d kinase - inducible transcriptional - activation domain ( kid ) of creb folds into a more ordered conformation on binding to its target peptide in cbp .
i d activation domain of c - myc ( another transcription factor known to regulate the transcription of genes involved in normal cell growth , differentiation , and apoptosis ) selectively binds to proteins from the basal transcription factors , and undergoes induction of protein conformation in the i d domain of c - myc during this interaction with the target factor .
similar studies have been shown involving the activation domain and its target protein for other transcription factors [ 3032 ] .
we and others have shown that when an i d regulatory region of steroid receptor binds to its coregulatory protein from basal transcription machinery , structure is formed in the i d activation domain of the steroid receptor [ 27 , 29 ] .
dyson and wright have suggested that the binding of i d regions to their targets is often regulated by covalent modifications , which leads to simple biological switches . applied to the i d region of transcription factors , this induced - fit model of folding hypothesizes that these i d regions do not adopt fully ordered conformation(s ) until they bind to one or more of their key target partner proteins .
it appears that many transcription factors need to be more flexible in order to be efficient in carrying out their functions .
because specific region(s ) of these transcription factors act by interacting with specific binding partner proteins , it is likely that their flexible structure helps them create a favorable surface for these interactions [ 5 , 12 ] . in the recent years
, much attention has been focused on the role of protein : protein interactions in gene regulation by transcription factors , although a systematic analysis of all possible interactions and underlying mechanisms is still lacking . due to varied expression patterns ,
many cell types contain an assortment of different factors that can interact with a single transcription factor .
it seems likely that the precise protein assembly , based on relative affinities combined with the allosteric effects , largely define the final transcriptional potential of each transcription factor in a given cell [ 5 , 17 ] .
thus , coregulatory proteins may influence or modulate the activity of a transcription factor through multiple mechanisms [ 5 , 7476 ] . in order to fully understand the mechanisms of gene regulation by transcription
as we learn more and more about the role of binding / folding events in gene regulation by transcription factors , it becomes clearer that highly flexible and dynamic nature of i d regions / domains is an inherent advantage in these molecules that exploits its protein surfaces for critical interactions with various coregulatory proteins in order to achieve desired targets in an efficient and highly specific manner . under physiological conditions ,
the ultimate composition of the assembly and kind of induced folding in the i d regions / domain may dictate the final outcome of the signals to be passed by specific transcription factor to the target gene . as we start to understand more about folded functional conformations of these i d stretches and the sequence of events that lead to such folding , we should have answers to many questions that regulate the expression of gene .
in addition to protein : protein interactions , for some transcription factors , rnas are also known to function as cofactors , therefore id - rich transcription factors may offer a platform of rna binding .
it is also important to note that structural flexibility is a common phenomenon in several protein : rna recognition processes , and these interactions often involve conformational changes in the structure of the rna , protein , or both .
no doubt the elucidation of the human genome has provided us an incredible opportunity to find out an immense amount of structural information that may be contained within the human genome , yet our efforts must be devoted to understand how the expression of this genetic information is regulated and how the interactions between the vast array of expressed proteins are controlled . with large data generated from various research groups on protein : protein interactions involving transcription factor and its relationship with target gene regulations , it has become possible to visualize a global view of biological networks .
dynamic macromolecular interactions are key elements in the regulation of many biological systems , particularly in gene regulations by transcription factors . in addition to other factors , the dynamic nature of such protein : protein interactions
in the recent years , many observations led us to believe that direct protein : protein interaction may be an essential step in realizing properly folded and functionally active structure in their i d region .
though limited , data indicate that the i d sequences may be adopting functionally folded conformation(s ) under physiological conditions through these interactions .
however , it remains to be determined what kind of functional ordered conformation(s ) these i d domains adopt , and whether there are multiple folded conformations generated depending upon the nature of binding partner(s ) involved .
the resulting structurally modified conformation(s ) of these i d regions may further be providing protein surfaces to attract other target molecules , essential for functions .
available knowledge so far on how these i d domains of transcription factors adopt ordered conformation(s ) under physiological conditions supports this notion .
however , more studies are needed to determine precise mechanisms through which these i d regions / domains acquire a well defined structure .
it is now recognized that the conformational flexibility of i d domains / regions is a general feature of most transcription factor proteins , we must take into account their structural features in a network sense as recently described .
since several small molecules as potential drug targets have been found to act by blocking specific protein : protein interactions , and that i d regions of transcription factors are known to form the platform for many such protein : protein interactions , a better structural and functional understanding of i d proteins will be a potent tool for drug designing .
the utilization of various drug delivery systems such as nanotechnology - based products is anticipated to revolutionize treatments for diseases in future .
thus , rapidly growing field of i d proteins ' structural analyses combined with their functional behavior will allow cross - disciplinary researchers the opportunity to design and develop multifunctional approaches to develop better therapeutic tools that will generate novel ideas and help accelerate critical advances in the field of biomedical research . | a number of proteins with intrinsically disordered ( i d ) regions / domains are reported to be found disproportionately higher in transcription factors .
available evidences suggest that presence of i d region / domain within a transcription factor plays an important role in its biological functions .
these i d sequences provide large flexible surfaces that can allow them to make more efficient physical and functional interactions with their target partners .
since transcription factors regulate expression of target genes by interacting with specific coregulatory proteins , these i d regions / domains can be used as a platform for such large macromolecular interactions , and may represent a mechanism for regulation of cellular processes .
the precise structural basis for the function of these i d regions / domains of the transcription factors remains to be determined .
in the recent years there has been growing evidence suggesting that an induced fit - like process leads to imposition of folded functional structure in these i d domains on which large multiprotein complexes are built .
these multiprotein complexes may eventually dictate the final outcome of the gene regulation by the transcription factors . |
lap - protector was developed as a safe and useful device that may help to prevent infections and cancer cell contamination of minilaparotomy wounds .
we applied this device to the gastric anterior wall of the incision in the first step of surgical transgastric cystogastrostomy for a patient with an infected pancreatic pseudocyst . recently
, disposable circular stapler is very popular in digestive organ anastomosis . in 1999 , yunoki et al .
a 69-year - old man presented to our hospital with a 5-day history of high fever , loss of appetite , and hiccups .
laboratory data on arrival were as follows : white blood cell count , 24,800/l ; c - reactive protein , 13.8 mg / dl . computed tomography ( ct ) showed an infected pancreatic pseudocyst which compressed the gastric wall ( fig .
we made a preoperative diagnosis of the recurrence of infected pancreatic pseudocyst ; therefore , emergency operation was performed .
according to the jedlicka 's method , transgastric cystogastrostomy was selected . after performing minilaparotomy with upper median incision ,
a small incision with a length of 3.0 cm was made on the anterior gastric wall . placing the lap - protector over the incision
, the bottom ring is pushed into the lumen of the stomach through the incision .
the top and bottom rings of the lap - protector formed a sandwich around the anterior gastric wall ( fig .
the posterior gastric wall was punctured toward the retrogastric space by a sheath of needle .
a small incision was made on the posterior wall to reach the abscess wall ( fig .
while preventing pollution in the peritoneal cavity , the abscess space was irrigated with saline .
using an auto suture pceea 25 , an anastomosis was approximated between the abscess wall and the posterior gastric wall ( fig .
four days after the operation , upper gastrointestinal examination and ct using a water - soluble contrast agent showed no anastomotic leakage and complete drainage ( fig .
two months after discharge , follow - up evaluation with upper endoscopy and ct revealed no sign of recurrence ( fig .
a variety of treatments in infectious pancreatic pseudocyst have been reported , such as percutaneous drainage , endoscopic cystogastrostomy , and conventional surgical cystogastrostomy .
however , we believe that surgical cystogastrostomy still plays an important role in the management of selected cases of pseudocyst of the pancreas . in this case , we performed cystogastrostomy easily without any contamination using lap - protector and circular stapler . | lap - protector , which is an abdominal wall sealing device , is usually used for wound protection from implantation of malignant cells or pyogenic fluid .
a circular stapler is a common easy - to - use device for anastomosis of the digestive tract .
we report the case of an infected pancreatic pseudocyst which was treated by surgical procedure using these useful devices .
a 69-year - old man was followed up in our hospital after severe acute pancreatitis .
he had undergone drainage surgeries twice for intractable pancreatic abscess followed by severe acute pancreatitis .
he was admitted to our hospital complaining of loss of appetite , hiccups , and high fever .
computed tomography of the abdomen revealed an infected pancreatic pseudocyst which compressed the gastric wall .
internal drainage into the stomach was performed using lap - protector and circular stapler .
the patient recovered uneventfully . recently many endoscopic or laparoscopic procedures in cystogastrostomy
are reported ; however , a conventional open surgical approach is also important
. this easy method may be useful for operative cystogastrostomy . |
Subsets and Splits