file
stringlengths
18
26
data
stringlengths
2
1.05M
the_stack_data/123066.c
#if 0 /* * jmemdos.c * * Copyright (C) 1992-1997, Thomas G. Lane. * This file is part of the Independent JPEG Group's software. * For conditions of distribution and use, see the accompanying README file. * * This file provides an MS-DOS-compatible implementation of the system- * dependent portion of the JPEG memory manager. Temporary data can be * stored in extended or expanded memory as well as in regular DOS files. * * If you use this file, you must be sure that NEED_FAR_POINTERS is defined * if you compile in a small-data memory model; it should NOT be defined if * you use a large-data memory model. This file is not recommended if you * are using a flat-memory-space 386 environment such as DJGCC or Watcom C. * Also, this code will NOT work if struct fields are aligned on greater than * 2-byte boundaries. * * Based on code contributed by Ge' Weijers. */ /* * If you have both extended and expanded memory, you may want to change the * order in which they are tried in jopen_backing_store. On a 286 machine * expanded memory is usually faster, since extended memory access involves * an expensive protected-mode-and-back switch. On 386 and better, extended * memory is usually faster. As distributed, the code tries extended memory * first (what? not everyone has a 386? :-). * * You can disable use of extended/expanded memory entirely by altering these * definitions or overriding them from the Makefile (eg, -DEMS_SUPPORTED=0). */ #ifndef XMS_SUPPORTED #define XMS_SUPPORTED 1 #endif #ifndef EMS_SUPPORTED #define EMS_SUPPORTED 1 #endif #define JPEG_INTERNALS #include "jinclude.h" #include "jpeglib.h" #include "jmemsys.h" /* import the system-dependent declarations */ #ifndef HAVE_STDLIB_H /* <stdlib.h> should declare these */ extern void * malloc JPP((size_t size)); extern void free JPP((void *ptr)); extern char * getenv JPP((const char * name)); #endif #ifdef NEED_FAR_POINTERS #ifdef __TURBOC__ /* These definitions work for Borland C (Turbo C) */ #include <alloc.h> /* need farmalloc(), farfree() */ #define far_malloc(x) farmalloc(x) #define far_free(x) farfree(x) #else /* These definitions work for Microsoft C and compatible compilers */ #include <malloc.h> /* need _fmalloc(), _ffree() */ #define far_malloc(x) _fmalloc(x) #define far_free(x) _ffree(x) #endif #else /* not NEED_FAR_POINTERS */ #define far_malloc(x) malloc(x) #define far_free(x) free(x) #endif /* NEED_FAR_POINTERS */ #ifdef DONT_USE_B_MODE /* define mode parameters for fopen() */ #define READ_BINARY "r" #else #define READ_BINARY "rb" #endif #ifndef USE_MSDOS_MEMMGR /* make sure user got configuration right */ You forgot to define USE_MSDOS_MEMMGR in jconfig.h. /* deliberate syntax error */ #endif #if MAX_ALLOC_CHUNK >= 65535L /* make sure jconfig.h got this right */ MAX_ALLOC_CHUNK should be less than 64K. /* deliberate syntax error */ #endif /* * Declarations for assembly-language support routines (see jmemdosa.asm). * * The functions are declared "far" as are all their pointer arguments; * this ensures the assembly source code will work regardless of the * compiler memory model. We assume "short" is 16 bits, "long" is 32. */ typedef void far * XMSDRIVER; /* actually a pointer to code */ typedef struct { /* registers for calling XMS driver */ unsigned short ax, dx, bx; void far * ds_si; } XMScontext; typedef struct { /* registers for calling EMS driver */ unsigned short ax, dx, bx; void far * ds_si; } EMScontext; extern short far jdos_open JPP((short far * handle, char far * filename)); extern short far jdos_close JPP((short handle)); extern short far jdos_seek JPP((short handle, long offset)); extern short far jdos_read JPP((short handle, void far * buffer, unsigned short count)); extern short far jdos_write JPP((short handle, void far * buffer, unsigned short count)); extern void far jxms_getdriver JPP((XMSDRIVER far *)); extern void far jxms_calldriver JPP((XMSDRIVER, XMScontext far *)); extern short far jems_available JPP((void)); extern void far jems_calldriver JPP((EMScontext far *)); /* * Selection of a file name for a temporary file. * This is highly system-dependent, and you may want to customize it. */ static int next_file_num; /* to distinguish among several temp files */ LOCAL(void) select_file_name (char * fname) { const char * env; char * ptr; FILE * tfile; /* Keep generating file names till we find one that's not in use */ for (;;) { /* Get temp directory name from environment TMP or TEMP variable; * if none, use "." */ if ((env = (const char *) getenv("TMP")) == NULL) if ((env = (const char *) getenv("TEMP")) == NULL) env = "."; if (*env == '\0') /* null string means "." */ env = "."; ptr = fname; /* copy name to fname */ while (*env != '\0') *ptr++ = *env++; if (ptr[-1] != '\\' && ptr[-1] != '/') *ptr++ = '\\'; /* append backslash if not in env variable */ /* Append a suitable file name */ next_file_num++; /* advance counter */ sprintf(ptr, "JPG%03d.TMP", next_file_num); /* Probe to see if file name is already in use */ if ((tfile = fopen(fname, READ_BINARY)) == NULL) break; fclose(tfile); /* oops, it's there; close tfile & try again */ } } /* * Near-memory allocation and freeing are controlled by the regular library * routines malloc() and free(). */ GLOBAL(void *) jpeg_get_small (j_common_ptr cinfo, size_t sizeofobject) { return (void *) malloc(sizeofobject); } GLOBAL(void) jpeg_free_small (j_common_ptr cinfo, void * object, size_t sizeofobject) { free(object); } /* * "Large" objects are allocated in far memory, if possible */ GLOBAL(void FAR *) jpeg_get_large (j_common_ptr cinfo, size_t sizeofobject) { return (void FAR *) far_malloc(sizeofobject); } GLOBAL(void) jpeg_free_large (j_common_ptr cinfo, void FAR * object, size_t sizeofobject) { far_free(object); } /* * This routine computes the total memory space available for allocation. * It's impossible to do this in a portable way; our current solution is * to make the user tell us (with a default value set at compile time). * If you can actually get the available space, it's a good idea to subtract * a slop factor of 5% or so. */ #ifndef DEFAULT_MAX_MEM /* so can override from makefile */ #define DEFAULT_MAX_MEM 300000L /* for total usage about 450K */ #endif GLOBAL(long) jpeg_mem_available (j_common_ptr cinfo, long min_bytes_needed, long max_bytes_needed, long already_allocated) { return cinfo->mem->max_memory_to_use - already_allocated; } /* * Backing store (temporary file) management. * Backing store objects are only used when the value returned by * jpeg_mem_available is less than the total space needed. You can dispense * with these routines if you have plenty of virtual memory; see jmemnobs.c. */ /* * For MS-DOS we support three types of backing storage: * 1. Conventional DOS files. We access these by direct DOS calls rather * than via the stdio package. This provides a bit better performance, * but the real reason is that the buffers to be read or written are FAR. * The stdio library for small-data memory models can't cope with that. * 2. Extended memory, accessed per the XMS V2.0 specification. * 3. Expanded memory, accessed per the LIM/EMS 4.0 specification. * You'll need copies of those specs to make sense of the related code. * The specs are available by Internet FTP from the SIMTEL archives * (oak.oakland.edu and its various mirror sites). See files * pub/msdos/microsoft/xms20.arc and pub/msdos/info/limems41.zip. */ /* * Access methods for a DOS file. */ METHODDEF(void) read_file_store (j_common_ptr cinfo, backing_store_ptr info, void FAR * buffer_address, long file_offset, long byte_count) { if (jdos_seek(info->handle.file_handle, file_offset)) ERREXIT(cinfo, JERR_TFILE_SEEK); /* Since MAX_ALLOC_CHUNK is less than 64K, byte_count will be too. */ if (byte_count > 65535L) /* safety check */ ERREXIT(cinfo, JERR_BAD_ALLOC_CHUNK); if (jdos_read(info->handle.file_handle, buffer_address, (unsigned short) byte_count)) ERREXIT(cinfo, JERR_TFILE_READ); } METHODDEF(void) write_file_store (j_common_ptr cinfo, backing_store_ptr info, void FAR * buffer_address, long file_offset, long byte_count) { if (jdos_seek(info->handle.file_handle, file_offset)) ERREXIT(cinfo, JERR_TFILE_SEEK); /* Since MAX_ALLOC_CHUNK is less than 64K, byte_count will be too. */ if (byte_count > 65535L) /* safety check */ ERREXIT(cinfo, JERR_BAD_ALLOC_CHUNK); if (jdos_write(info->handle.file_handle, buffer_address, (unsigned short) byte_count)) ERREXIT(cinfo, JERR_TFILE_WRITE); } METHODDEF(void) close_file_store (j_common_ptr cinfo, backing_store_ptr info) { jdos_close(info->handle.file_handle); /* close the file */ remove(info->temp_name); /* delete the file */ /* If your system doesn't have remove(), try unlink() instead. * remove() is the ANSI-standard name for this function, but * unlink() was more common in pre-ANSI systems. */ TRACEMSS(cinfo, 1, JTRC_TFILE_CLOSE, info->temp_name); } LOCAL(boolean) open_file_store (j_common_ptr cinfo, backing_store_ptr info, long total_bytes_needed) { short handle; select_file_name(info->temp_name); if (jdos_open((short far *) & handle, (char far *) info->temp_name)) { /* might as well exit since jpeg_open_backing_store will fail anyway */ ERREXITS(cinfo, JERR_TFILE_CREATE, info->temp_name); return FALSE; } info->handle.file_handle = handle; info->read_backing_store = read_file_store; info->write_backing_store = write_file_store; info->close_backing_store = close_file_store; TRACEMSS(cinfo, 1, JTRC_TFILE_OPEN, info->temp_name); return TRUE; /* succeeded */ } /* * Access methods for extended memory. */ #if XMS_SUPPORTED static XMSDRIVER xms_driver; /* saved address of XMS driver */ typedef union { /* either long offset or real-mode pointer */ long offset; void far * ptr; } XMSPTR; typedef struct { /* XMS move specification structure */ long length; XMSH src_handle; XMSPTR src; XMSH dst_handle; XMSPTR dst; } XMSspec; #define ODD(X) (((X) & 1L) != 0) METHODDEF(void) read_xms_store (j_common_ptr cinfo, backing_store_ptr info, void FAR * buffer_address, long file_offset, long byte_count) { XMScontext ctx; XMSspec spec; char endbuffer[2]; /* The XMS driver can't cope with an odd length, so handle the last byte * specially if byte_count is odd. We don't expect this to be common. */ spec.length = byte_count & (~ 1L); spec.src_handle = info->handle.xms_handle; spec.src.offset = file_offset; spec.dst_handle = 0; spec.dst.ptr = buffer_address; ctx.ds_si = (void far *) & spec; ctx.ax = 0x0b00; /* EMB move */ jxms_calldriver(xms_driver, (XMScontext far *) & ctx); if (ctx.ax != 1) ERREXIT(cinfo, JERR_XMS_READ); if (ODD(byte_count)) { read_xms_store(cinfo, info, (void FAR *) endbuffer, file_offset + byte_count - 1L, 2L); ((char FAR *) buffer_address)[byte_count - 1L] = endbuffer[0]; } } METHODDEF(void) write_xms_store (j_common_ptr cinfo, backing_store_ptr info, void FAR * buffer_address, long file_offset, long byte_count) { XMScontext ctx; XMSspec spec; char endbuffer[2]; /* The XMS driver can't cope with an odd length, so handle the last byte * specially if byte_count is odd. We don't expect this to be common. */ spec.length = byte_count & (~ 1L); spec.src_handle = 0; spec.src.ptr = buffer_address; spec.dst_handle = info->handle.xms_handle; spec.dst.offset = file_offset; ctx.ds_si = (void far *) & spec; ctx.ax = 0x0b00; /* EMB move */ jxms_calldriver(xms_driver, (XMScontext far *) & ctx); if (ctx.ax != 1) ERREXIT(cinfo, JERR_XMS_WRITE); if (ODD(byte_count)) { read_xms_store(cinfo, info, (void FAR *) endbuffer, file_offset + byte_count - 1L, 2L); endbuffer[0] = ((char FAR *) buffer_address)[byte_count - 1L]; write_xms_store(cinfo, info, (void FAR *) endbuffer, file_offset + byte_count - 1L, 2L); } } METHODDEF(void) close_xms_store (j_common_ptr cinfo, backing_store_ptr info) { XMScontext ctx; ctx.dx = info->handle.xms_handle; ctx.ax = 0x0a00; jxms_calldriver(xms_driver, (XMScontext far *) & ctx); TRACEMS1(cinfo, 1, JTRC_XMS_CLOSE, info->handle.xms_handle); /* we ignore any error return from the driver */ } LOCAL(boolean) open_xms_store (j_common_ptr cinfo, backing_store_ptr info, long total_bytes_needed) { XMScontext ctx; /* Get address of XMS driver */ jxms_getdriver((XMSDRIVER far *) & xms_driver); if (xms_driver == NULL) return FALSE; /* no driver to be had */ /* Get version number, must be >= 2.00 */ ctx.ax = 0x0000; jxms_calldriver(xms_driver, (XMScontext far *) & ctx); if (ctx.ax < (unsigned short) 0x0200) return FALSE; /* Try to get space (expressed in kilobytes) */ ctx.dx = (unsigned short) ((total_bytes_needed + 1023L) >> 10); ctx.ax = 0x0900; jxms_calldriver(xms_driver, (XMScontext far *) & ctx); if (ctx.ax != 1) return FALSE; /* Succeeded, save the handle and away we go */ info->handle.xms_handle = ctx.dx; info->read_backing_store = read_xms_store; info->write_backing_store = write_xms_store; info->close_backing_store = close_xms_store; TRACEMS1(cinfo, 1, JTRC_XMS_OPEN, ctx.dx); return TRUE; /* succeeded */ } #endif /* XMS_SUPPORTED */ /* * Access methods for expanded memory. */ #if EMS_SUPPORTED /* The EMS move specification structure requires word and long fields aligned * at odd byte boundaries. Some compilers will align struct fields at even * byte boundaries. While it's usually possible to force byte alignment, * that causes an overall performance penalty and may pose problems in merging * JPEG into a larger application. Instead we accept some rather dirty code * here. Note this code would fail if the hardware did not allow odd-byte * word & long accesses, but all 80x86 CPUs do. */ typedef void far * EMSPTR; typedef union { /* EMS move specification structure */ long length; /* It's easy to access first 4 bytes */ char bytes[18]; /* Misaligned fields in here! */ } EMSspec; /* Macros for accessing misaligned fields */ #define FIELD_AT(spec,offset,type) (*((type *) &(spec.bytes[offset]))) #define SRC_TYPE(spec) FIELD_AT(spec,4,char) #define SRC_HANDLE(spec) FIELD_AT(spec,5,EMSH) #define SRC_OFFSET(spec) FIELD_AT(spec,7,unsigned short) #define SRC_PAGE(spec) FIELD_AT(spec,9,unsigned short) #define SRC_PTR(spec) FIELD_AT(spec,7,EMSPTR) #define DST_TYPE(spec) FIELD_AT(spec,11,char) #define DST_HANDLE(spec) FIELD_AT(spec,12,EMSH) #define DST_OFFSET(spec) FIELD_AT(spec,14,unsigned short) #define DST_PAGE(spec) FIELD_AT(spec,16,unsigned short) #define DST_PTR(spec) FIELD_AT(spec,14,EMSPTR) #define EMSPAGESIZE 16384L /* gospel, see the EMS specs */ #define HIBYTE(W) (((W) >> 8) & 0xFF) #define LOBYTE(W) ((W) & 0xFF) METHODDEF(void) read_ems_store (j_common_ptr cinfo, backing_store_ptr info, void FAR * buffer_address, long file_offset, long byte_count) { EMScontext ctx; EMSspec spec; spec.length = byte_count; SRC_TYPE(spec) = 1; SRC_HANDLE(spec) = info->handle.ems_handle; SRC_PAGE(spec) = (unsigned short) (file_offset / EMSPAGESIZE); SRC_OFFSET(spec) = (unsigned short) (file_offset % EMSPAGESIZE); DST_TYPE(spec) = 0; DST_HANDLE(spec) = 0; DST_PTR(spec) = buffer_address; ctx.ds_si = (void far *) & spec; ctx.ax = 0x5700; /* move memory region */ jems_calldriver((EMScontext far *) & ctx); if (HIBYTE(ctx.ax) != 0) ERREXIT(cinfo, JERR_EMS_READ); } METHODDEF(void) write_ems_store (j_common_ptr cinfo, backing_store_ptr info, void FAR * buffer_address, long file_offset, long byte_count) { EMScontext ctx; EMSspec spec; spec.length = byte_count; SRC_TYPE(spec) = 0; SRC_HANDLE(spec) = 0; SRC_PTR(spec) = buffer_address; DST_TYPE(spec) = 1; DST_HANDLE(spec) = info->handle.ems_handle; DST_PAGE(spec) = (unsigned short) (file_offset / EMSPAGESIZE); DST_OFFSET(spec) = (unsigned short) (file_offset % EMSPAGESIZE); ctx.ds_si = (void far *) & spec; ctx.ax = 0x5700; /* move memory region */ jems_calldriver((EMScontext far *) & ctx); if (HIBYTE(ctx.ax) != 0) ERREXIT(cinfo, JERR_EMS_WRITE); } METHODDEF(void) close_ems_store (j_common_ptr cinfo, backing_store_ptr info) { EMScontext ctx; ctx.ax = 0x4500; ctx.dx = info->handle.ems_handle; jems_calldriver((EMScontext far *) & ctx); TRACEMS1(cinfo, 1, JTRC_EMS_CLOSE, info->handle.ems_handle); /* we ignore any error return from the driver */ } LOCAL(boolean) open_ems_store (j_common_ptr cinfo, backing_store_ptr info, long total_bytes_needed) { EMScontext ctx; /* Is EMS driver there? */ if (! jems_available()) return FALSE; /* Get status, make sure EMS is OK */ ctx.ax = 0x4000; jems_calldriver((EMScontext far *) & ctx); if (HIBYTE(ctx.ax) != 0) return FALSE; /* Get version, must be >= 4.0 */ ctx.ax = 0x4600; jems_calldriver((EMScontext far *) & ctx); if (HIBYTE(ctx.ax) != 0 || LOBYTE(ctx.ax) < 0x40) return FALSE; /* Try to allocate requested space */ ctx.ax = 0x4300; ctx.bx = (unsigned short) ((total_bytes_needed + EMSPAGESIZE-1L) / EMSPAGESIZE); jems_calldriver((EMScontext far *) & ctx); if (HIBYTE(ctx.ax) != 0) return FALSE; /* Succeeded, save the handle and away we go */ info->handle.ems_handle = ctx.dx; info->read_backing_store = read_ems_store; info->write_backing_store = write_ems_store; info->close_backing_store = close_ems_store; TRACEMS1(cinfo, 1, JTRC_EMS_OPEN, ctx.dx); return TRUE; /* succeeded */ } #endif /* EMS_SUPPORTED */ /* * Initial opening of a backing-store object. */ GLOBAL(void) jpeg_open_backing_store (j_common_ptr cinfo, backing_store_ptr info, long total_bytes_needed) { /* Try extended memory, then expanded memory, then regular file. */ #if XMS_SUPPORTED if (open_xms_store(cinfo, info, total_bytes_needed)) return; #endif #if EMS_SUPPORTED if (open_ems_store(cinfo, info, total_bytes_needed)) return; #endif if (open_file_store(cinfo, info, total_bytes_needed)) return; ERREXITS(cinfo, JERR_TFILE_CREATE, ""); } /* * These routines take care of any system-dependent initialization and * cleanup required. */ GLOBAL(long) jpeg_mem_init (j_common_ptr cinfo) { next_file_num = 0; /* initialize temp file name generator */ return DEFAULT_MAX_MEM; /* default for max_memory_to_use */ } GLOBAL(void) jpeg_mem_term (j_common_ptr cinfo) { /* Microsoft C, at least in v6.00A, will not successfully reclaim freed * blocks of size > 32Kbytes unless we give it a kick in the rear, like so: */ #ifdef NEED_FHEAPMIN _fheapmin(); #endif } #endif
the_stack_data/150139937.c
#pragma poroto memory test_A int 100 #pragma poroto memory test_B int 100 #pragma poroto memory test_R int 100 #pragma poroto stream::roccc_bram_in VectorMatrix::A(test_A, count) #pragma poroto stream::roccc_bram_in VectorMatrix::B(test_B, count) #pragma poroto stream::roccc_bram_out VectorMatrix::R(test_R, count*count) void VectorMatrix(unsigned int count, int* A, int* B, int **R) { unsigned int i; unsigned int j; for(i = 0; i < count; ++i) { for(j = 0; j < count; ++j) { R[i][j] = A[i] + B[j]; } } }
the_stack_data/724490.c
/* { dg-do compile } */ /* { dg-options "-O1" } */ /* A test for variables getting out of their scope in copy propagation. */ void bla (int); int bar (void); void foo(void) { int k; goto forward; back: bla (k); return; forward: { int i = bar (); k = i; goto back; } }
the_stack_data/159515430.c
/** ****************************************************************************** * @file stm32f7xx_ll_tim.c * @author MCD Application Team * @version V1.2.2 * @date 14-April-2017 * @brief TIM LL module driver. ****************************************************************************** * @attention * * <h2><center>&copy; COPYRIGHT(c) 2017 STMicroelectronics</center></h2> * * Redistribution and use in source and binary forms, with or without modification, * are permitted provided that the following conditions are met: * 1. Redistributions of source code must retain the above copyright notice, * this list of conditions and the following disclaimer. * 2. Redistributions in binary form must reproduce the above copyright notice, * this list of conditions and the following disclaimer in the documentation * and/or other materials provided with the distribution. * 3. Neither the name of STMicroelectronics nor the names of its contributors * may be used to endorse or promote products derived from this software * without specific prior written permission. * * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE * DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR * SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER * CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, * OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. * ****************************************************************************** */ #if defined(USE_FULL_LL_DRIVER) /* Includes ------------------------------------------------------------------*/ #include "stm32f7xx_ll_tim.h" #include "stm32f7xx_ll_bus.h" #ifdef USE_FULL_ASSERT #include "stm32_assert.h" #else #define assert_param(expr) ((void)0U) #endif /** @addtogroup STM32F7xx_LL_Driver * @{ */ #if defined (TIM1) || defined (TIM8) || defined (TIM2) || defined (TIM3) || defined (TIM4) || defined (TIM5) || defined (TIM9) || defined (TIM10) || defined (TIM11) || defined (TIM12) || defined (TIM13) || defined (TIM14) || defined (TIM6) || defined (TIM7) /** @addtogroup TIM_LL * @{ */ /* Private types -------------------------------------------------------------*/ /* Private variables ---------------------------------------------------------*/ /* Private constants ---------------------------------------------------------*/ /* Private macros ------------------------------------------------------------*/ /** @addtogroup TIM_LL_Private_Macros * @{ */ #define IS_LL_TIM_COUNTERMODE(__VALUE__) (((__VALUE__) == LL_TIM_COUNTERMODE_UP) \ || ((__VALUE__) == LL_TIM_COUNTERMODE_DOWN) \ || ((__VALUE__) == LL_TIM_COUNTERMODE_CENTER_UP) \ || ((__VALUE__) == LL_TIM_COUNTERMODE_CENTER_DOWN) \ || ((__VALUE__) == LL_TIM_COUNTERMODE_CENTER_UP_DOWN)) #define IS_LL_TIM_CLOCKDIVISION(__VALUE__) (((__VALUE__) == LL_TIM_CLOCKDIVISION_DIV1) \ || ((__VALUE__) == LL_TIM_CLOCKDIVISION_DIV2) \ || ((__VALUE__) == LL_TIM_CLOCKDIVISION_DIV4)) #define IS_LL_TIM_OCMODE(__VALUE__) (((__VALUE__) == LL_TIM_OCMODE_FROZEN) \ || ((__VALUE__) == LL_TIM_OCMODE_ACTIVE) \ || ((__VALUE__) == LL_TIM_OCMODE_INACTIVE) \ || ((__VALUE__) == LL_TIM_OCMODE_TOGGLE) \ || ((__VALUE__) == LL_TIM_OCMODE_FORCED_INACTIVE) \ || ((__VALUE__) == LL_TIM_OCMODE_FORCED_ACTIVE) \ || ((__VALUE__) == LL_TIM_OCMODE_PWM1) \ || ((__VALUE__) == LL_TIM_OCMODE_PWM2) \ || ((__VALUE__) == LL_TIM_OCMODE_RETRIG_OPM1) \ || ((__VALUE__) == LL_TIM_OCMODE_RETRIG_OPM2) \ || ((__VALUE__) == LL_TIM_OCMODE_COMBINED_PWM1) \ || ((__VALUE__) == LL_TIM_OCMODE_COMBINED_PWM2) \ || ((__VALUE__) == LL_TIM_OCMODE_ASSYMETRIC_PWM1) \ || ((__VALUE__) == LL_TIM_OCMODE_ASSYMETRIC_PWM2)) #define IS_LL_TIM_OCSTATE(__VALUE__) (((__VALUE__) == LL_TIM_OCSTATE_DISABLE) \ || ((__VALUE__) == LL_TIM_OCSTATE_ENABLE)) #define IS_LL_TIM_OCPOLARITY(__VALUE__) (((__VALUE__) == LL_TIM_OCPOLARITY_HIGH) \ || ((__VALUE__) == LL_TIM_OCPOLARITY_LOW)) #define IS_LL_TIM_OCIDLESTATE(__VALUE__) (((__VALUE__) == LL_TIM_OCIDLESTATE_LOW) \ || ((__VALUE__) == LL_TIM_OCIDLESTATE_HIGH)) #define IS_LL_TIM_ACTIVEINPUT(__VALUE__) (((__VALUE__) == LL_TIM_ACTIVEINPUT_DIRECTTI) \ || ((__VALUE__) == LL_TIM_ACTIVEINPUT_INDIRECTTI) \ || ((__VALUE__) == LL_TIM_ACTIVEINPUT_TRC)) #define IS_LL_TIM_ICPSC(__VALUE__) (((__VALUE__) == LL_TIM_ICPSC_DIV1) \ || ((__VALUE__) == LL_TIM_ICPSC_DIV2) \ || ((__VALUE__) == LL_TIM_ICPSC_DIV4) \ || ((__VALUE__) == LL_TIM_ICPSC_DIV8)) #define IS_LL_TIM_IC_FILTER(__VALUE__) (((__VALUE__) == LL_TIM_IC_FILTER_FDIV1) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV1_N2) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV1_N4) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV1_N8) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV2_N6) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV2_N8) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV4_N6) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV4_N8) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV8_N6) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV8_N8) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV16_N5) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV16_N6) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV16_N8) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV32_N5) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV32_N6) \ || ((__VALUE__) == LL_TIM_IC_FILTER_FDIV32_N8)) #define IS_LL_TIM_IC_POLARITY(__VALUE__) (((__VALUE__) == LL_TIM_IC_POLARITY_RISING) \ || ((__VALUE__) == LL_TIM_IC_POLARITY_FALLING) \ || ((__VALUE__) == LL_TIM_IC_POLARITY_BOTHEDGE)) #define IS_LL_TIM_ENCODERMODE(__VALUE__) (((__VALUE__) == LL_TIM_ENCODERMODE_X2_TI1) \ || ((__VALUE__) == LL_TIM_ENCODERMODE_X2_TI2) \ || ((__VALUE__) == LL_TIM_ENCODERMODE_X4_TI12)) #define IS_LL_TIM_IC_POLARITY_ENCODER(__VALUE__) (((__VALUE__) == LL_TIM_IC_POLARITY_RISING) \ || ((__VALUE__) == LL_TIM_IC_POLARITY_FALLING)) #define IS_LL_TIM_OSSR_STATE(__VALUE__) (((__VALUE__) == LL_TIM_OSSR_DISABLE) \ || ((__VALUE__) == LL_TIM_OSSR_ENABLE)) #define IS_LL_TIM_OSSI_STATE(__VALUE__) (((__VALUE__) == LL_TIM_OSSI_DISABLE) \ || ((__VALUE__) == LL_TIM_OSSI_ENABLE)) #define IS_LL_TIM_LOCK_LEVEL(__VALUE__) (((__VALUE__) == LL_TIM_LOCKLEVEL_OFF) \ || ((__VALUE__) == LL_TIM_LOCKLEVEL_1) \ || ((__VALUE__) == LL_TIM_LOCKLEVEL_2) \ || ((__VALUE__) == LL_TIM_LOCKLEVEL_3)) #define IS_LL_TIM_BREAK_STATE(__VALUE__) (((__VALUE__) == LL_TIM_BREAK_DISABLE) \ || ((__VALUE__) == LL_TIM_BREAK_ENABLE)) #define IS_LL_TIM_BREAK_POLARITY(__VALUE__) (((__VALUE__) == LL_TIM_BREAK_POLARITY_LOW) \ || ((__VALUE__) == LL_TIM_BREAK_POLARITY_HIGH)) #define IS_LL_TIM_BREAK_FILTER(__VALUE__) (((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV1) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV1_N2) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV1_N4) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV1_N8) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV2_N6) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV2_N8) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV4_N6) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV4_N8) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV8_N6) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV8_N8) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV16_N5) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV16_N6) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV16_N8) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV32_N5) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV32_N6) \ || ((__VALUE__) == LL_TIM_BREAK_FILTER_FDIV32_N8)) #define IS_LL_TIM_BREAK2_STATE(__VALUE__) (((__VALUE__) == LL_TIM_BREAK2_DISABLE) \ || ((__VALUE__) == LL_TIM_BREAK2_ENABLE)) #define IS_LL_TIM_BREAK2_POLARITY(__VALUE__) (((__VALUE__) == LL_TIM_BREAK2_POLARITY_LOW) \ || ((__VALUE__) == LL_TIM_BREAK2_POLARITY_HIGH)) #define IS_LL_TIM_BREAK2_FILTER(__VALUE__) (((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV1) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV1_N2) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV1_N4) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV1_N8) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV2_N6) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV2_N8) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV4_N6) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV4_N8) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV8_N6) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV8_N8) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV16_N5) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV16_N6) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV16_N8) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV32_N5) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV32_N6) \ || ((__VALUE__) == LL_TIM_BREAK2_FILTER_FDIV32_N8)) #define IS_LL_TIM_AUTOMATIC_OUTPUT_STATE(__VALUE__) (((__VALUE__) == LL_TIM_AUTOMATICOUTPUT_DISABLE) \ || ((__VALUE__) == LL_TIM_AUTOMATICOUTPUT_ENABLE)) /** * @} */ /* Private function prototypes -----------------------------------------------*/ /** @defgroup TIM_LL_Private_Functions TIM Private Functions * @{ */ static ErrorStatus OC1Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct); static ErrorStatus OC2Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct); static ErrorStatus OC3Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct); static ErrorStatus OC4Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct); static ErrorStatus OC5Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct); static ErrorStatus OC6Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct); static ErrorStatus IC1Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct); static ErrorStatus IC2Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct); static ErrorStatus IC3Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct); static ErrorStatus IC4Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct); /** * @} */ /* Exported functions --------------------------------------------------------*/ /** @addtogroup TIM_LL_Exported_Functions * @{ */ /** @addtogroup TIM_LL_EF_Init * @{ */ /** * @brief Set TIMx registers to their reset values. * @param TIMx Timer instance * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: invalid TIMx instance */ ErrorStatus LL_TIM_DeInit(TIM_TypeDef *TIMx) { ErrorStatus result = SUCCESS; /* Check the parameters */ assert_param(IS_TIM_INSTANCE(TIMx)); if (TIMx == TIM1) { LL_APB2_GRP1_ForceReset(LL_APB2_GRP1_PERIPH_TIM1); LL_APB2_GRP1_ReleaseReset(LL_APB2_GRP1_PERIPH_TIM1); } else if (TIMx == TIM2) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM2); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM2); } #if defined(TIM3) else if (TIMx == TIM3) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM3); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM3); } #endif #if defined(TIM4) else if (TIMx == TIM4) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM4); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM4); } #endif #if defined(TIM5) else if (TIMx == TIM5) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM5); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM5); } #endif #if defined(TIM6) else if (TIMx == TIM6) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM6); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM6); } #endif #if defined (TIM7) else if (TIMx == TIM7) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM7); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM7); } #endif #if defined(TIM8) else if (TIMx == TIM8) { LL_APB2_GRP1_ForceReset(LL_APB2_GRP1_PERIPH_TIM8); LL_APB2_GRP1_ReleaseReset(LL_APB2_GRP1_PERIPH_TIM8); } #endif #if defined(TIM9) else if (TIMx == TIM9) { LL_APB2_GRP1_ForceReset(LL_APB2_GRP1_PERIPH_TIM9); LL_APB2_GRP1_ReleaseReset(LL_APB2_GRP1_PERIPH_TIM9); } #endif #if defined(TIM10) else if (TIMx == TIM10) { LL_APB2_GRP1_ForceReset(LL_APB2_GRP1_PERIPH_TIM10); LL_APB2_GRP1_ReleaseReset(LL_APB2_GRP1_PERIPH_TIM10); } #endif #if defined(TIM11) else if (TIMx == TIM11) { LL_APB2_GRP1_ForceReset(LL_APB2_GRP1_PERIPH_TIM11); LL_APB2_GRP1_ReleaseReset(LL_APB2_GRP1_PERIPH_TIM11); } #endif #if defined(TIM12) else if (TIMx == TIM12) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM12); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM12); } #endif #if defined(TIM13) else if (TIMx == TIM13) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM13); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM13); } #endif #if defined(TIM14) else if (TIMx == TIM14) { LL_APB1_GRP1_ForceReset(LL_APB1_GRP1_PERIPH_TIM14); LL_APB1_GRP1_ReleaseReset(LL_APB1_GRP1_PERIPH_TIM14); } #endif else { result = ERROR; } return result; } /** * @brief Set the fields of the time base unit configuration data structure * to their default values. * @param TIM_InitStruct pointer to a @ref LL_TIM_InitTypeDef structure (time base unit configuration data structure) * @retval None */ void LL_TIM_StructInit(LL_TIM_InitTypeDef *TIM_InitStruct) { /* Set the default configuration */ TIM_InitStruct->Prescaler = (uint16_t)0x0000U; TIM_InitStruct->CounterMode = LL_TIM_COUNTERMODE_UP; TIM_InitStruct->Autoreload = 0xFFFFFFFFU; TIM_InitStruct->ClockDivision = LL_TIM_CLOCKDIVISION_DIV1; TIM_InitStruct->RepetitionCounter = (uint8_t)0x00U; } /** * @brief Configure the TIMx time base unit. * @param TIMx Timer Instance * @param TIM_InitStruct pointer to a @ref LL_TIM_InitTypeDef structure (TIMx time base unit configuration data structure) * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ ErrorStatus LL_TIM_Init(TIM_TypeDef *TIMx, LL_TIM_InitTypeDef *TIM_InitStruct) { uint32_t tmpcr1 = 0U; /* Check the parameters */ assert_param(IS_TIM_INSTANCE(TIMx)); assert_param(IS_LL_TIM_COUNTERMODE(TIM_InitStruct->CounterMode)); assert_param(IS_LL_TIM_CLOCKDIVISION(TIM_InitStruct->ClockDivision)); tmpcr1 = LL_TIM_ReadReg(TIMx, CR1); if (IS_TIM_COUNTER_MODE_SELECT_INSTANCE(TIMx)) { /* Select the Counter Mode */ MODIFY_REG(tmpcr1, (TIM_CR1_DIR | TIM_CR1_CMS), TIM_InitStruct->CounterMode); } if (IS_TIM_CLOCK_DIVISION_INSTANCE(TIMx)) { /* Set the clock division */ MODIFY_REG(tmpcr1, TIM_CR1_CKD, TIM_InitStruct->ClockDivision); } /* Write to TIMx CR1 */ LL_TIM_WriteReg(TIMx, CR1, tmpcr1); /* Set the Autoreload value */ LL_TIM_SetAutoReload(TIMx, TIM_InitStruct->Autoreload); /* Set the Prescaler value */ LL_TIM_SetPrescaler(TIMx, TIM_InitStruct->Prescaler); if (IS_TIM_REPETITION_COUNTER_INSTANCE(TIMx)) { /* Set the Repetition Counter value */ LL_TIM_SetRepetitionCounter(TIMx, TIM_InitStruct->RepetitionCounter); } /* Generate an update event to reload the Prescaler and the repetition counter value (if applicable) immediately */ LL_TIM_GenerateEvent_UPDATE(TIMx); return SUCCESS; } /** * @brief Set the fields of the TIMx output channel configuration data * structure to their default values. * @param TIM_OC_InitStruct pointer to a @ref LL_TIM_OC_InitTypeDef structure (the output channel configuration data structure) * @retval None */ void LL_TIM_OC_StructInit(LL_TIM_OC_InitTypeDef *TIM_OC_InitStruct) { /* Set the default configuration */ TIM_OC_InitStruct->OCMode = LL_TIM_OCMODE_FROZEN; TIM_OC_InitStruct->OCState = LL_TIM_OCSTATE_DISABLE; TIM_OC_InitStruct->OCNState = LL_TIM_OCSTATE_DISABLE; TIM_OC_InitStruct->CompareValue = 0x00000000U; TIM_OC_InitStruct->OCPolarity = LL_TIM_OCPOLARITY_HIGH; TIM_OC_InitStruct->OCNPolarity = LL_TIM_OCPOLARITY_HIGH; TIM_OC_InitStruct->OCIdleState = LL_TIM_OCIDLESTATE_LOW; TIM_OC_InitStruct->OCNIdleState = LL_TIM_OCIDLESTATE_LOW; } /** * @brief Configure the TIMx output channel. * @param TIMx Timer Instance * @param Channel This parameter can be one of the following values: * @arg @ref LL_TIM_CHANNEL_CH1 * @arg @ref LL_TIM_CHANNEL_CH2 * @arg @ref LL_TIM_CHANNEL_CH3 * @arg @ref LL_TIM_CHANNEL_CH4 * @arg @ref LL_TIM_CHANNEL_CH5 * @arg @ref LL_TIM_CHANNEL_CH6 * @param TIM_OC_InitStruct pointer to a @ref LL_TIM_OC_InitTypeDef structure (TIMx output channel configuration data structure) * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx output channel is initialized * - ERROR: TIMx output channel is not initialized */ ErrorStatus LL_TIM_OC_Init(TIM_TypeDef *TIMx, uint32_t Channel, LL_TIM_OC_InitTypeDef *TIM_OC_InitStruct) { ErrorStatus result = ERROR; switch (Channel) { case LL_TIM_CHANNEL_CH1: result = OC1Config(TIMx, TIM_OC_InitStruct); break; case LL_TIM_CHANNEL_CH2: result = OC2Config(TIMx, TIM_OC_InitStruct); break; case LL_TIM_CHANNEL_CH3: result = OC3Config(TIMx, TIM_OC_InitStruct); break; case LL_TIM_CHANNEL_CH4: result = OC4Config(TIMx, TIM_OC_InitStruct); break; case LL_TIM_CHANNEL_CH5: result = OC5Config(TIMx, TIM_OC_InitStruct); break; case LL_TIM_CHANNEL_CH6: result = OC6Config(TIMx, TIM_OC_InitStruct); break; default: break; } return result; } /** * @brief Set the fields of the TIMx input channel configuration data * structure to their default values. * @param TIM_ICInitStruct pointer to a @ref LL_TIM_IC_InitTypeDef structure (the input channel configuration data structure) * @retval None */ void LL_TIM_IC_StructInit(LL_TIM_IC_InitTypeDef *TIM_ICInitStruct) { /* Set the default configuration */ TIM_ICInitStruct->ICPolarity = LL_TIM_IC_POLARITY_RISING; TIM_ICInitStruct->ICActiveInput = LL_TIM_ACTIVEINPUT_DIRECTTI; TIM_ICInitStruct->ICPrescaler = LL_TIM_ICPSC_DIV1; TIM_ICInitStruct->ICFilter = LL_TIM_IC_FILTER_FDIV1; } /** * @brief Configure the TIMx input channel. * @param TIMx Timer Instance * @param Channel This parameter can be one of the following values: * @arg @ref LL_TIM_CHANNEL_CH1 * @arg @ref LL_TIM_CHANNEL_CH2 * @arg @ref LL_TIM_CHANNEL_CH3 * @arg @ref LL_TIM_CHANNEL_CH4 * @param TIM_IC_InitStruct pointer to a @ref LL_TIM_IC_InitTypeDef structure (TIMx input channel configuration data structure) * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx output channel is initialized * - ERROR: TIMx output channel is not initialized */ ErrorStatus LL_TIM_IC_Init(TIM_TypeDef *TIMx, uint32_t Channel, LL_TIM_IC_InitTypeDef *TIM_IC_InitStruct) { ErrorStatus result = ERROR; switch (Channel) { case LL_TIM_CHANNEL_CH1: result = IC1Config(TIMx, TIM_IC_InitStruct); break; case LL_TIM_CHANNEL_CH2: result = IC2Config(TIMx, TIM_IC_InitStruct); break; case LL_TIM_CHANNEL_CH3: result = IC3Config(TIMx, TIM_IC_InitStruct); break; case LL_TIM_CHANNEL_CH4: result = IC4Config(TIMx, TIM_IC_InitStruct); break; default: break; } return result; } /** * @brief Fills each TIM_EncoderInitStruct field with its default value * @param TIM_EncoderInitStruct pointer to a @ref LL_TIM_ENCODER_InitTypeDef structure (encoder interface configuration data structure) * @retval None */ void LL_TIM_ENCODER_StructInit(LL_TIM_ENCODER_InitTypeDef *TIM_EncoderInitStruct) { /* Set the default configuration */ TIM_EncoderInitStruct->EncoderMode = LL_TIM_ENCODERMODE_X2_TI1; TIM_EncoderInitStruct->IC1Polarity = LL_TIM_IC_POLARITY_RISING; TIM_EncoderInitStruct->IC1ActiveInput = LL_TIM_ACTIVEINPUT_DIRECTTI; TIM_EncoderInitStruct->IC1Prescaler = LL_TIM_ICPSC_DIV1; TIM_EncoderInitStruct->IC1Filter = LL_TIM_IC_FILTER_FDIV1; TIM_EncoderInitStruct->IC2Polarity = LL_TIM_IC_POLARITY_RISING; TIM_EncoderInitStruct->IC2ActiveInput = LL_TIM_ACTIVEINPUT_DIRECTTI; TIM_EncoderInitStruct->IC2Prescaler = LL_TIM_ICPSC_DIV1; TIM_EncoderInitStruct->IC2Filter = LL_TIM_IC_FILTER_FDIV1; } /** * @brief Configure the encoder interface of the timer instance. * @param TIMx Timer Instance * @param TIM_EncoderInitStruct pointer to a @ref LL_TIM_ENCODER_InitTypeDef structure (TIMx encoder interface configuration data structure) * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ ErrorStatus LL_TIM_ENCODER_Init(TIM_TypeDef *TIMx, LL_TIM_ENCODER_InitTypeDef *TIM_EncoderInitStruct) { uint32_t tmpccmr1 = 0U; uint32_t tmpccer = 0U; /* Check the parameters */ assert_param(IS_TIM_ENCODER_INTERFACE_INSTANCE(TIMx)); assert_param(IS_LL_TIM_ENCODERMODE(TIM_EncoderInitStruct->EncoderMode)); assert_param(IS_LL_TIM_IC_POLARITY_ENCODER(TIM_EncoderInitStruct->IC1Polarity)); assert_param(IS_LL_TIM_ACTIVEINPUT(TIM_EncoderInitStruct->IC1ActiveInput)); assert_param(IS_LL_TIM_ICPSC(TIM_EncoderInitStruct->IC1Prescaler)); assert_param(IS_LL_TIM_IC_FILTER(TIM_EncoderInitStruct->IC1Filter)); assert_param(IS_LL_TIM_IC_POLARITY_ENCODER(TIM_EncoderInitStruct->IC2Polarity)); assert_param(IS_LL_TIM_ACTIVEINPUT(TIM_EncoderInitStruct->IC2ActiveInput)); assert_param(IS_LL_TIM_ICPSC(TIM_EncoderInitStruct->IC2Prescaler)); assert_param(IS_LL_TIM_IC_FILTER(TIM_EncoderInitStruct->IC2Filter)); /* Disable the CC1 and CC2: Reset the CC1E and CC2E Bits */ TIMx->CCER &= (uint32_t)~(TIM_CCER_CC1E | TIM_CCER_CC2E); /* Get the TIMx CCMR1 register value */ tmpccmr1 = LL_TIM_ReadReg(TIMx, CCMR1); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Configure TI1 */ tmpccmr1 &= (uint32_t)~(TIM_CCMR1_CC1S | TIM_CCMR1_IC1F | TIM_CCMR1_IC1PSC); tmpccmr1 |= (uint32_t)(TIM_EncoderInitStruct->IC1ActiveInput >> 16U); tmpccmr1 |= (uint32_t)(TIM_EncoderInitStruct->IC1Filter >> 16U); tmpccmr1 |= (uint32_t)(TIM_EncoderInitStruct->IC1Prescaler >> 16U); /* Configure TI2 */ tmpccmr1 &= (uint32_t)~(TIM_CCMR1_CC2S | TIM_CCMR1_IC2F | TIM_CCMR1_IC2PSC); tmpccmr1 |= (uint32_t)(TIM_EncoderInitStruct->IC2ActiveInput >> 8U); tmpccmr1 |= (uint32_t)(TIM_EncoderInitStruct->IC2Filter >> 8U); tmpccmr1 |= (uint32_t)(TIM_EncoderInitStruct->IC2Prescaler >> 8U); /* Set TI1 and TI2 polarity and enable TI1 and TI2 */ tmpccer &= (uint32_t)~(TIM_CCER_CC1P | TIM_CCER_CC1NP | TIM_CCER_CC2P | TIM_CCER_CC2NP); tmpccer |= (uint32_t)(TIM_EncoderInitStruct->IC1Polarity); tmpccer |= (uint32_t)(TIM_EncoderInitStruct->IC2Polarity << 4U); tmpccer |= (uint32_t)(TIM_CCER_CC1E | TIM_CCER_CC2E); /* Set encoder mode */ LL_TIM_SetEncoderMode(TIMx, TIM_EncoderInitStruct->EncoderMode); /* Write to TIMx CCMR1 */ LL_TIM_WriteReg(TIMx, CCMR1, tmpccmr1); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); return SUCCESS; } /** * @brief Set the fields of the TIMx Hall sensor interface configuration data * structure to their default values. * @param TIM_HallSensorInitStruct pointer to a @ref LL_TIM_HALLSENSOR_InitTypeDef structure (HALL sensor interface configuration data structure) * @retval None */ void LL_TIM_HALLSENSOR_StructInit(LL_TIM_HALLSENSOR_InitTypeDef *TIM_HallSensorInitStruct) { /* Set the default configuration */ TIM_HallSensorInitStruct->IC1Polarity = LL_TIM_IC_POLARITY_RISING; TIM_HallSensorInitStruct->IC1Prescaler = LL_TIM_ICPSC_DIV1; TIM_HallSensorInitStruct->IC1Filter = LL_TIM_IC_FILTER_FDIV1; TIM_HallSensorInitStruct->CommutationDelay = 0U; } /** * @brief Configure the Hall sensor interface of the timer instance. * @note TIMx CH1, CH2 and CH3 inputs connected through a XOR * to the TI1 input channel * @note TIMx slave mode controller is configured in reset mode. Selected internal trigger is TI1F_ED. * @note Channel 1 is configured as input, IC1 is mapped on TRC. * @note Captured value stored in TIMx_CCR1 correspond to the time elapsed * between 2 changes on the inputs. It gives information about motor speed. * @note Channel 2 is configured in output PWM 2 mode. * @note Compare value stored in TIMx_CCR2 corresponds to the commutation delay. * @note OC2REF is selected as trigger output on TRGO. * @note LL_TIM_IC_POLARITY_BOTHEDGE must not be used for TI1 when it is used * when TIMx operates in Hall sensor interface mode. * @param TIMx Timer Instance * @param TIM_HallSensorInitStruct pointer to a @ref LL_TIM_HALLSENSOR_InitTypeDef structure (TIMx HALL sensor interface configuration data structure) * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ ErrorStatus LL_TIM_HALLSENSOR_Init(TIM_TypeDef *TIMx, LL_TIM_HALLSENSOR_InitTypeDef *TIM_HallSensorInitStruct) { uint32_t tmpcr2 = 0U; uint32_t tmpccmr1 = 0U; uint32_t tmpccer = 0U; uint32_t tmpsmcr = 0U; /* Check the parameters */ assert_param(IS_TIM_HALL_SENSOR_INTERFACE_INSTANCE(TIMx)); assert_param(IS_LL_TIM_IC_POLARITY_ENCODER(TIM_HallSensorInitStruct->IC1Polarity)); assert_param(IS_LL_TIM_ICPSC(TIM_HallSensorInitStruct->IC1Prescaler)); assert_param(IS_LL_TIM_IC_FILTER(TIM_HallSensorInitStruct->IC1Filter)); /* Disable the CC1 and CC2: Reset the CC1E and CC2E Bits */ TIMx->CCER &= (uint32_t)~(TIM_CCER_CC1E | TIM_CCER_CC2E); /* Get the TIMx CR2 register value */ tmpcr2 = LL_TIM_ReadReg(TIMx, CR2); /* Get the TIMx CCMR1 register value */ tmpccmr1 = LL_TIM_ReadReg(TIMx, CCMR1); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Get the TIMx SMCR register value */ tmpsmcr = LL_TIM_ReadReg(TIMx, SMCR); /* Connect TIMx_CH1, CH2 and CH3 pins to the TI1 input */ tmpcr2 |= TIM_CR2_TI1S; /* OC2REF signal is used as trigger output (TRGO) */ tmpcr2 |= LL_TIM_TRGO_OC2REF; /* Configure the slave mode controller */ tmpsmcr &= (uint32_t)~(TIM_SMCR_TS | TIM_SMCR_SMS); tmpsmcr |= LL_TIM_TS_TI1F_ED; tmpsmcr |= LL_TIM_SLAVEMODE_RESET; /* Configure input channel 1 */ tmpccmr1 &= (uint32_t)~(TIM_CCMR1_CC1S | TIM_CCMR1_IC1F | TIM_CCMR1_IC1PSC); tmpccmr1 |= (uint32_t)(LL_TIM_ACTIVEINPUT_TRC >> 16U); tmpccmr1 |= (uint32_t)(TIM_HallSensorInitStruct->IC1Filter >> 16U); tmpccmr1 |= (uint32_t)(TIM_HallSensorInitStruct->IC1Prescaler >> 16U); /* Configure input channel 2 */ tmpccmr1 &= (uint32_t)~(TIM_CCMR1_OC2M | TIM_CCMR1_OC2FE | TIM_CCMR1_OC2PE | TIM_CCMR1_OC2CE); tmpccmr1 |= (uint32_t)(LL_TIM_OCMODE_PWM2 << 8U); /* Set Channel 1 polarity and enable Channel 1 and Channel2 */ tmpccer &= (uint32_t)~(TIM_CCER_CC1P | TIM_CCER_CC1NP | TIM_CCER_CC2P | TIM_CCER_CC2NP); tmpccer |= (uint32_t)(TIM_HallSensorInitStruct->IC1Polarity); tmpccer |= (uint32_t)(TIM_CCER_CC1E | TIM_CCER_CC2E); /* Write to TIMx CR2 */ LL_TIM_WriteReg(TIMx, CR2, tmpcr2); /* Write to TIMx SMCR */ LL_TIM_WriteReg(TIMx, SMCR, tmpsmcr); /* Write to TIMx CCMR1 */ LL_TIM_WriteReg(TIMx, CCMR1, tmpccmr1); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); /* Write to TIMx CCR2 */ LL_TIM_OC_SetCompareCH2(TIMx, TIM_HallSensorInitStruct->CommutationDelay); return SUCCESS; } /** * @brief Set the fields of the Break and Dead Time configuration data structure * to their default values. * @param TIM_BDTRInitStruct pointer to a @ref LL_TIM_BDTR_InitTypeDef structure (Break and Dead Time configuration data structure) * @retval None */ void LL_TIM_BDTR_StructInit(LL_TIM_BDTR_InitTypeDef *TIM_BDTRInitStruct) { /* Set the default configuration */ TIM_BDTRInitStruct->OSSRState = LL_TIM_OSSR_DISABLE; TIM_BDTRInitStruct->OSSIState = LL_TIM_OSSI_DISABLE; TIM_BDTRInitStruct->LockLevel = LL_TIM_LOCKLEVEL_OFF; TIM_BDTRInitStruct->DeadTime = (uint8_t)0x00U; TIM_BDTRInitStruct->BreakState = LL_TIM_BREAK_DISABLE; TIM_BDTRInitStruct->BreakPolarity = LL_TIM_BREAK_POLARITY_LOW; TIM_BDTRInitStruct->BreakFilter = LL_TIM_BREAK_FILTER_FDIV1; TIM_BDTRInitStruct->Break2State = LL_TIM_BREAK2_DISABLE; TIM_BDTRInitStruct->Break2Polarity = LL_TIM_BREAK2_POLARITY_LOW; TIM_BDTRInitStruct->Break2Filter = LL_TIM_BREAK2_FILTER_FDIV1; TIM_BDTRInitStruct->AutomaticOutput = LL_TIM_AUTOMATICOUTPUT_DISABLE; } /** * @brief Configure the Break and Dead Time feature of the timer instance. * @note As the bits BK2P, BK2E, BK2F[3:0], BKF[3:0], AOE, BKP, BKE, OSSI, OSSR * and DTG[7:0] can be write-locked depending on the LOCK configuration, it * can be necessary to configure all of them during the first write access to * the TIMx_BDTR register. * @note Macro @ref IS_TIM_BREAK_INSTANCE(TIMx) can be used to check whether or not * a timer instance provides a break input. * @note Macro @ref IS_TIM_BKIN2_INSTANCE(TIMx) can be used to check whether or not * a timer instance provides a second break input. * @param TIMx Timer Instance * @param TIM_BDTRInitStruct pointer to a @ref LL_TIM_BDTR_InitTypeDef structure (Break and Dead Time configuration data structure) * @retval An ErrorStatus enumeration value: * - SUCCESS: Break and Dead Time is initialized * - ERROR: not applicable */ ErrorStatus LL_TIM_BDTR_Init(TIM_TypeDef *TIMx, LL_TIM_BDTR_InitTypeDef *TIM_BDTRInitStruct) { uint32_t tmpbdtr = 0; /* Check the parameters */ assert_param(IS_TIM_BREAK_INSTANCE(TIMx)); assert_param(IS_LL_TIM_OSSR_STATE(TIM_BDTRInitStruct->OSSRState)); assert_param(IS_LL_TIM_OSSI_STATE(TIM_BDTRInitStruct->OSSIState)); assert_param(IS_LL_TIM_LOCK_LEVEL(TIM_BDTRInitStruct->LockLevel)); assert_param(IS_LL_TIM_BREAK_STATE(TIM_BDTRInitStruct->BreakState)); assert_param(IS_LL_TIM_BREAK_POLARITY(TIM_BDTRInitStruct->BreakPolarity)); assert_param(IS_LL_TIM_AUTOMATIC_OUTPUT_STATE(TIM_BDTRInitStruct->AutomaticOutput)); /* Set the Lock level, the Break enable Bit and the Polarity, the OSSR State, the OSSI State, the dead time value and the Automatic Output Enable Bit */ /* Set the BDTR bits */ MODIFY_REG(tmpbdtr, TIM_BDTR_DTG, TIM_BDTRInitStruct->DeadTime); MODIFY_REG(tmpbdtr, TIM_BDTR_LOCK, TIM_BDTRInitStruct->LockLevel); MODIFY_REG(tmpbdtr, TIM_BDTR_OSSI, TIM_BDTRInitStruct->OSSIState); MODIFY_REG(tmpbdtr, TIM_BDTR_OSSR, TIM_BDTRInitStruct->OSSRState); MODIFY_REG(tmpbdtr, TIM_BDTR_BKE, TIM_BDTRInitStruct->BreakState); MODIFY_REG(tmpbdtr, TIM_BDTR_BKP, TIM_BDTRInitStruct->BreakPolarity); MODIFY_REG(tmpbdtr, TIM_BDTR_AOE, TIM_BDTRInitStruct->AutomaticOutput); MODIFY_REG(tmpbdtr, TIM_BDTR_MOE, TIM_BDTRInitStruct->AutomaticOutput); if (IS_TIM_ADVANCED_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_BREAK_FILTER(TIM_BDTRInitStruct->BreakFilter)); MODIFY_REG(tmpbdtr, TIM_BDTR_BKF, TIM_BDTRInitStruct->BreakFilter); } if (IS_TIM_BKIN2_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_BREAK2_STATE(TIM_BDTRInitStruct->Break2State)); assert_param(IS_LL_TIM_BREAK2_POLARITY(TIM_BDTRInitStruct->Break2Polarity)); assert_param(IS_LL_TIM_BREAK2_FILTER(TIM_BDTRInitStruct->Break2Filter)); /* Set the BREAK2 input related BDTR bit-fields */ MODIFY_REG(tmpbdtr, TIM_BDTR_BK2F, (TIM_BDTRInitStruct->Break2Filter)); MODIFY_REG(tmpbdtr, TIM_BDTR_BK2E, TIM_BDTRInitStruct->Break2State); MODIFY_REG(tmpbdtr, TIM_BDTR_BK2P, TIM_BDTRInitStruct->Break2Polarity); } /* Set TIMx_BDTR */ LL_TIM_WriteReg(TIMx, BDTR, tmpbdtr); return SUCCESS; } /** * @} */ /** * @} */ /** @addtogroup TIM_LL_Private_Functions TIM Private Functions * @brief Private functions * @{ */ /** * @brief Configure the TIMx output channel 1. * @param TIMx Timer Instance * @param TIM_OCInitStruct pointer to the the TIMx output channel 1 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus OC1Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct) { uint32_t tmpccmr1 = 0U; uint32_t tmpccer = 0U; uint32_t tmpcr2 = 0U; /* Check the parameters */ assert_param(IS_TIM_CC1_INSTANCE(TIMx)); assert_param(IS_LL_TIM_OCMODE(TIM_OCInitStruct->OCMode)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCPolarity)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCNState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCNPolarity)); /* Disable the Channel 1: Reset the CC1E Bit */ CLEAR_BIT(TIMx->CCER, TIM_CCER_CC1E); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Get the TIMx CR2 register value */ tmpcr2 = LL_TIM_ReadReg(TIMx, CR2); /* Get the TIMx CCMR1 register value */ tmpccmr1 = LL_TIM_ReadReg(TIMx, CCMR1); /* Reset Capture/Compare selection Bits */ CLEAR_BIT(tmpccmr1, TIM_CCMR1_CC1S); /* Set the Output Compare Mode */ MODIFY_REG(tmpccmr1, TIM_CCMR1_OC1M, TIM_OCInitStruct->OCMode); /* Set the Output Compare Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC1P, TIM_OCInitStruct->OCPolarity); /* Set the Output State */ MODIFY_REG(tmpccer, TIM_CCER_CC1E, TIM_OCInitStruct->OCState); if (IS_TIM_BREAK_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCNIdleState)); assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCIdleState)); /* Set the complementary output Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC1NP, TIM_OCInitStruct->OCNPolarity << 2U); /* Set the complementary output State */ MODIFY_REG(tmpccer, TIM_CCER_CC1NE, TIM_OCInitStruct->OCNState << 2U); /* Set the Output Idle state */ MODIFY_REG(tmpcr2, TIM_CR2_OIS1, TIM_OCInitStruct->OCIdleState); /* Set the complementary output Idle state */ MODIFY_REG(tmpcr2, TIM_CR2_OIS1N, TIM_OCInitStruct->OCNIdleState << 1U); } /* Write to TIMx CR2 */ LL_TIM_WriteReg(TIMx, CR2, tmpcr2); /* Write to TIMx CCMR1 */ LL_TIM_WriteReg(TIMx, CCMR1, tmpccmr1); /* Set the Capture Compare Register value */ LL_TIM_OC_SetCompareCH1(TIMx, TIM_OCInitStruct->CompareValue); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); return SUCCESS; } /** * @brief Configure the TIMx output channel 2. * @param TIMx Timer Instance * @param TIM_OCInitStruct pointer to the the TIMx output channel 2 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus OC2Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct) { uint32_t tmpccmr1 = 0U; uint32_t tmpccer = 0U; uint32_t tmpcr2 = 0U; /* Check the parameters */ assert_param(IS_TIM_CC2_INSTANCE(TIMx)); assert_param(IS_LL_TIM_OCMODE(TIM_OCInitStruct->OCMode)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCPolarity)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCNState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCNPolarity)); /* Disable the Channel 2: Reset the CC2E Bit */ CLEAR_BIT(TIMx->CCER, TIM_CCER_CC2E); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Get the TIMx CR2 register value */ tmpcr2 = LL_TIM_ReadReg(TIMx, CR2); /* Get the TIMx CCMR1 register value */ tmpccmr1 = LL_TIM_ReadReg(TIMx, CCMR1); /* Reset Capture/Compare selection Bits */ CLEAR_BIT(tmpccmr1, TIM_CCMR1_CC2S); /* Select the Output Compare Mode */ MODIFY_REG(tmpccmr1, TIM_CCMR1_OC2M, TIM_OCInitStruct->OCMode << 8U); /* Set the Output Compare Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC2P, TIM_OCInitStruct->OCPolarity << 4U); /* Set the Output State */ MODIFY_REG(tmpccer, TIM_CCER_CC2E, TIM_OCInitStruct->OCState << 4U); if (IS_TIM_BREAK_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCNIdleState)); assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCIdleState)); /* Set the complementary output Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC2NP, TIM_OCInitStruct->OCNPolarity << 6U); /* Set the complementary output State */ MODIFY_REG(tmpccer, TIM_CCER_CC2NE, TIM_OCInitStruct->OCNState << 6U); /* Set the Output Idle state */ MODIFY_REG(tmpcr2, TIM_CR2_OIS2, TIM_OCInitStruct->OCIdleState << 2U); /* Set the complementary output Idle state */ MODIFY_REG(tmpcr2, TIM_CR2_OIS2N, TIM_OCInitStruct->OCNIdleState << 3U); } /* Write to TIMx CR2 */ LL_TIM_WriteReg(TIMx, CR2, tmpcr2); /* Write to TIMx CCMR1 */ LL_TIM_WriteReg(TIMx, CCMR1, tmpccmr1); /* Set the Capture Compare Register value */ LL_TIM_OC_SetCompareCH2(TIMx, TIM_OCInitStruct->CompareValue); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); return SUCCESS; } /** * @brief Configure the TIMx output channel 3. * @param TIMx Timer Instance * @param TIM_OCInitStruct pointer to the the TIMx output channel 3 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus OC3Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct) { uint32_t tmpccmr2 = 0U; uint32_t tmpccer = 0U; uint32_t tmpcr2 = 0U; /* Check the parameters */ assert_param(IS_TIM_CC3_INSTANCE(TIMx)); assert_param(IS_LL_TIM_OCMODE(TIM_OCInitStruct->OCMode)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCPolarity)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCNState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCNPolarity)); /* Disable the Channel 3: Reset the CC3E Bit */ CLEAR_BIT(TIMx->CCER, TIM_CCER_CC3E); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Get the TIMx CR2 register value */ tmpcr2 = LL_TIM_ReadReg(TIMx, CR2); /* Get the TIMx CCMR2 register value */ tmpccmr2 = LL_TIM_ReadReg(TIMx, CCMR2); /* Reset Capture/Compare selection Bits */ CLEAR_BIT(tmpccmr2, TIM_CCMR2_CC3S); /* Select the Output Compare Mode */ MODIFY_REG(tmpccmr2, TIM_CCMR2_OC3M, TIM_OCInitStruct->OCMode); /* Set the Output Compare Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC3P, TIM_OCInitStruct->OCPolarity << 8U); /* Set the Output State */ MODIFY_REG(tmpccer, TIM_CCER_CC3E, TIM_OCInitStruct->OCState << 8U); if (IS_TIM_BREAK_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCNIdleState)); assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCIdleState)); /* Set the complementary output Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC3NP, TIM_OCInitStruct->OCNPolarity << 10U); /* Set the complementary output State */ MODIFY_REG(tmpccer, TIM_CCER_CC3NE, TIM_OCInitStruct->OCNState << 10U); /* Set the Output Idle state */ MODIFY_REG(tmpcr2, TIM_CR2_OIS3, TIM_OCInitStruct->OCIdleState << 4U); /* Set the complementary output Idle state */ MODIFY_REG(tmpcr2, TIM_CR2_OIS3N, TIM_OCInitStruct->OCNIdleState << 5U); } /* Write to TIMx CR2 */ LL_TIM_WriteReg(TIMx, CR2, tmpcr2); /* Write to TIMx CCMR2 */ LL_TIM_WriteReg(TIMx, CCMR2, tmpccmr2); /* Set the Capture Compare Register value */ LL_TIM_OC_SetCompareCH3(TIMx, TIM_OCInitStruct->CompareValue); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); return SUCCESS; } /** * @brief Configure the TIMx output channel 4. * @param TIMx Timer Instance * @param TIM_OCInitStruct pointer to the the TIMx output channel 4 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus OC4Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct) { uint32_t tmpccmr2 = 0U; uint32_t tmpccer = 0U; uint32_t tmpcr2 = 0U; /* Check the parameters */ assert_param(IS_TIM_CC4_INSTANCE(TIMx)); assert_param(IS_LL_TIM_OCMODE(TIM_OCInitStruct->OCMode)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCPolarity)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCNPolarity)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCNState)); /* Disable the Channel 4: Reset the CC4E Bit */ CLEAR_BIT(TIMx->CCER, TIM_CCER_CC4E); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Get the TIMx CR2 register value */ tmpcr2 = LL_TIM_ReadReg(TIMx, CR2); /* Get the TIMx CCMR2 register value */ tmpccmr2 = LL_TIM_ReadReg(TIMx, CCMR2); /* Reset Capture/Compare selection Bits */ CLEAR_BIT(tmpccmr2, TIM_CCMR2_CC4S); /* Select the Output Compare Mode */ MODIFY_REG(tmpccmr2, TIM_CCMR2_OC4M, TIM_OCInitStruct->OCMode << 8U); /* Set the Output Compare Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC4P, TIM_OCInitStruct->OCPolarity << 12U); /* Set the Output State */ MODIFY_REG(tmpccer, TIM_CCER_CC4E, TIM_OCInitStruct->OCState << 12U); if (IS_TIM_BREAK_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCNIdleState)); assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCIdleState)); /* Set the Output Idle state */ MODIFY_REG(tmpcr2, TIM_CR2_OIS4, TIM_OCInitStruct->OCIdleState << 6U); } /* Write to TIMx CR2 */ LL_TIM_WriteReg(TIMx, CR2, tmpcr2); /* Write to TIMx CCMR2 */ LL_TIM_WriteReg(TIMx, CCMR2, tmpccmr2); /* Set the Capture Compare Register value */ LL_TIM_OC_SetCompareCH4(TIMx, TIM_OCInitStruct->CompareValue); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); return SUCCESS; } /** * @brief Configure the TIMx output channel 5. * @param TIMx Timer Instance * @param TIM_OCInitStruct pointer to the the TIMx output channel 5 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus OC5Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct) { uint32_t tmpccmr3 = 0U; uint32_t tmpccer = 0U; /* Check the parameters */ assert_param(IS_TIM_CC5_INSTANCE(TIMx)); assert_param(IS_LL_TIM_OCMODE(TIM_OCInitStruct->OCMode)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCPolarity)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCNPolarity)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCNState)); /* Disable the Channel 5: Reset the CC5E Bit */ CLEAR_BIT(TIMx->CCER, TIM_CCER_CC5E); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Get the TIMx CCMR3 register value */ tmpccmr3 = LL_TIM_ReadReg(TIMx, CCMR3); /* Select the Output Compare Mode */ MODIFY_REG(tmpccmr3, TIM_CCMR3_OC5M, TIM_OCInitStruct->OCMode); /* Set the Output Compare Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC5P, TIM_OCInitStruct->OCPolarity << 16U); /* Set the Output State */ MODIFY_REG(tmpccer, TIM_CCER_CC5E, TIM_OCInitStruct->OCState << 16U); if (IS_TIM_BREAK_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCNIdleState)); assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCIdleState)); /* Set the Output Idle state */ MODIFY_REG(TIMx->CR2, TIM_CR2_OIS5, TIM_OCInitStruct->OCIdleState << 8U); } /* Write to TIMx CCMR3 */ LL_TIM_WriteReg(TIMx, CCMR3, tmpccmr3); /* Set the Capture Compare Register value */ LL_TIM_OC_SetCompareCH5(TIMx, TIM_OCInitStruct->CompareValue); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); return SUCCESS; } /** * @brief Configure the TIMx output channel 6. * @param TIMx Timer Instance * @param TIM_OCInitStruct pointer to the the TIMx output channel 6 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus OC6Config(TIM_TypeDef *TIMx, LL_TIM_OC_InitTypeDef *TIM_OCInitStruct) { uint32_t tmpccmr3 = 0U; uint32_t tmpccer = 0U; /* Check the parameters */ assert_param(IS_TIM_CC6_INSTANCE(TIMx)); assert_param(IS_LL_TIM_OCMODE(TIM_OCInitStruct->OCMode)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCState)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCPolarity)); assert_param(IS_LL_TIM_OCPOLARITY(TIM_OCInitStruct->OCNPolarity)); assert_param(IS_LL_TIM_OCSTATE(TIM_OCInitStruct->OCNState)); /* Disable the Channel 5: Reset the CC6E Bit */ CLEAR_BIT(TIMx->CCER, TIM_CCER_CC6E); /* Get the TIMx CCER register value */ tmpccer = LL_TIM_ReadReg(TIMx, CCER); /* Get the TIMx CCMR3 register value */ tmpccmr3 = LL_TIM_ReadReg(TIMx, CCMR3); /* Select the Output Compare Mode */ MODIFY_REG(tmpccmr3, TIM_CCMR3_OC6M, TIM_OCInitStruct->OCMode << 8U); /* Set the Output Compare Polarity */ MODIFY_REG(tmpccer, TIM_CCER_CC6P, TIM_OCInitStruct->OCPolarity << 20U); /* Set the Output State */ MODIFY_REG(tmpccer, TIM_CCER_CC6E, TIM_OCInitStruct->OCState << 20U); if (IS_TIM_BREAK_INSTANCE(TIMx)) { assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCNIdleState)); assert_param(IS_LL_TIM_OCIDLESTATE(TIM_OCInitStruct->OCIdleState)); /* Set the Output Idle state */ MODIFY_REG(TIMx->CR2, TIM_CR2_OIS6, TIM_OCInitStruct->OCIdleState << 10U); } /* Write to TIMx CCMR3 */ LL_TIM_WriteReg(TIMx, CCMR3, tmpccmr3); /* Set the Capture Compare Register value */ LL_TIM_OC_SetCompareCH6(TIMx, TIM_OCInitStruct->CompareValue); /* Write to TIMx CCER */ LL_TIM_WriteReg(TIMx, CCER, tmpccer); return SUCCESS; } /** * @brief Configure the TIMx input channel 1. * @param TIMx Timer Instance * @param TIM_ICInitStruct pointer to the the TIMx input channel 1 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus IC1Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct) { /* Check the parameters */ assert_param(IS_TIM_CC1_INSTANCE(TIMx)); assert_param(IS_LL_TIM_IC_POLARITY(TIM_ICInitStruct->ICPolarity)); assert_param(IS_LL_TIM_ACTIVEINPUT(TIM_ICInitStruct->ICActiveInput)); assert_param(IS_LL_TIM_ICPSC(TIM_ICInitStruct->ICPrescaler)); assert_param(IS_LL_TIM_IC_FILTER(TIM_ICInitStruct->ICFilter)); /* Disable the Channel 1: Reset the CC1E Bit */ TIMx->CCER &= (uint32_t)~TIM_CCER_CC1E; /* Select the Input and set the filter and the prescaler value */ MODIFY_REG(TIMx->CCMR1, (TIM_CCMR1_CC1S | TIM_CCMR1_IC1F | TIM_CCMR1_IC1PSC), (TIM_ICInitStruct->ICActiveInput | TIM_ICInitStruct->ICFilter | TIM_ICInitStruct->ICPrescaler) >> 16U); /* Select the Polarity and set the CC1E Bit */ MODIFY_REG(TIMx->CCER, (TIM_CCER_CC1P | TIM_CCER_CC1NP), (TIM_ICInitStruct->ICPolarity | TIM_CCER_CC1E)); return SUCCESS; } /** * @brief Configure the TIMx input channel 2. * @param TIMx Timer Instance * @param TIM_ICInitStruct pointer to the the TIMx input channel 2 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus IC2Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct) { /* Check the parameters */ assert_param(IS_TIM_CC2_INSTANCE(TIMx)); assert_param(IS_LL_TIM_IC_POLARITY(TIM_ICInitStruct->ICPolarity)); assert_param(IS_LL_TIM_ACTIVEINPUT(TIM_ICInitStruct->ICActiveInput)); assert_param(IS_LL_TIM_ICPSC(TIM_ICInitStruct->ICPrescaler)); assert_param(IS_LL_TIM_IC_FILTER(TIM_ICInitStruct->ICFilter)); /* Disable the Channel 2: Reset the CC2E Bit */ TIMx->CCER &= (uint32_t)~TIM_CCER_CC2E; /* Select the Input and set the filter and the prescaler value */ MODIFY_REG(TIMx->CCMR1, (TIM_CCMR1_CC2S | TIM_CCMR1_IC2F | TIM_CCMR1_IC2PSC), (TIM_ICInitStruct->ICActiveInput | TIM_ICInitStruct->ICFilter | TIM_ICInitStruct->ICPrescaler) >> 8U); /* Select the Polarity and set the CC2E Bit */ MODIFY_REG(TIMx->CCER, (TIM_CCER_CC2P | TIM_CCER_CC2NP), ((TIM_ICInitStruct->ICPolarity << 4U) | TIM_CCER_CC2E)); return SUCCESS; } /** * @brief Configure the TIMx input channel 3. * @param TIMx Timer Instance * @param TIM_ICInitStruct pointer to the the TIMx input channel 3 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus IC3Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct) { /* Check the parameters */ assert_param(IS_TIM_CC3_INSTANCE(TIMx)); assert_param(IS_LL_TIM_IC_POLARITY(TIM_ICInitStruct->ICPolarity)); assert_param(IS_LL_TIM_ACTIVEINPUT(TIM_ICInitStruct->ICActiveInput)); assert_param(IS_LL_TIM_ICPSC(TIM_ICInitStruct->ICPrescaler)); assert_param(IS_LL_TIM_IC_FILTER(TIM_ICInitStruct->ICFilter)); /* Disable the Channel 3: Reset the CC3E Bit */ TIMx->CCER &= (uint32_t)~TIM_CCER_CC3E; /* Select the Input and set the filter and the prescaler value */ MODIFY_REG(TIMx->CCMR2, (TIM_CCMR2_CC3S | TIM_CCMR2_IC3F | TIM_CCMR2_IC3PSC), (TIM_ICInitStruct->ICActiveInput | TIM_ICInitStruct->ICFilter | TIM_ICInitStruct->ICPrescaler) >> 16U); /* Select the Polarity and set the CC3E Bit */ MODIFY_REG(TIMx->CCER, (TIM_CCER_CC3P | TIM_CCER_CC3NP), ((TIM_ICInitStruct->ICPolarity << 8U) | TIM_CCER_CC3E)); return SUCCESS; } /** * @brief Configure the TIMx input channel 4. * @param TIMx Timer Instance * @param TIM_ICInitStruct pointer to the the TIMx input channel 4 configuration data structure * @retval An ErrorStatus enumeration value: * - SUCCESS: TIMx registers are de-initialized * - ERROR: not applicable */ static ErrorStatus IC4Config(TIM_TypeDef *TIMx, LL_TIM_IC_InitTypeDef *TIM_ICInitStruct) { /* Check the parameters */ assert_param(IS_TIM_CC4_INSTANCE(TIMx)); assert_param(IS_LL_TIM_IC_POLARITY(TIM_ICInitStruct->ICPolarity)); assert_param(IS_LL_TIM_ACTIVEINPUT(TIM_ICInitStruct->ICActiveInput)); assert_param(IS_LL_TIM_ICPSC(TIM_ICInitStruct->ICPrescaler)); assert_param(IS_LL_TIM_IC_FILTER(TIM_ICInitStruct->ICFilter)); /* Disable the Channel 4: Reset the CC4E Bit */ TIMx->CCER &= (uint32_t)~TIM_CCER_CC4E; /* Select the Input and set the filter and the prescaler value */ MODIFY_REG(TIMx->CCMR2, (TIM_CCMR2_CC4S | TIM_CCMR2_IC4F | TIM_CCMR2_IC4PSC), (TIM_ICInitStruct->ICActiveInput | TIM_ICInitStruct->ICFilter | TIM_ICInitStruct->ICPrescaler) >> 8U); /* Select the Polarity and set the CC2E Bit */ MODIFY_REG(TIMx->CCER, (TIM_CCER_CC4P | TIM_CCER_CC4NP), ((TIM_ICInitStruct->ICPolarity << 12U) | TIM_CCER_CC4E)); return SUCCESS; } /** * @} */ /** * @} */ #endif /* TIM1 || TIM8 || TIM2 || TIM3 || TIM4 || TIM5 ||TIM9 || TIM10 || TIM11 || TIM12 || TIM13 || TIM14 || TIM6 || TIM7 */ /** * @} */ #endif /* USE_FULL_LL_DRIVER */ /************************ (C) COPYRIGHT STMicroelectronics *****END OF FILE****/
the_stack_data/243891865.c
/* * NetMonitor.c * * Created on: 2018年1月19日 * Author: wxl */ #include <stdio.h> #include <unistd.h> #include <stdlib.h> #include <string.h> #include <signal.h> #include <errno.h> #include <sys/types.h> #include <asm/types.h> #include <arpa/inet.h> #include <sys/socket.h> #include <linux/netlink.h> #include <linux/rtnetlink.h> #include <linux/route.h> #define BUFLEN 20480 #define t_assert(x) { \ if(!(x)) {err = -__LINE__;goto error;} \ } /*Ctrl + C 退出*/ static volatile int keepRunning = 1; void intHandler(int dummy) { keepRunning = 0; } /** * 解析RTA,并存入tb */ void parse_rtattr(struct rtattr **tb, int max, struct rtattr *attr, int len) { for (; RTA_OK(attr, len); attr = RTA_NEXT(attr, len)) { if (attr->rta_type <= max) { tb[attr->rta_type] = attr; } } } /** * 显示连接信息 * 当网卡变动的时候触发这个信息,例如插/拔网线,增/减网卡设备,启用/禁用接口等. */ void print_ifinfomsg(struct nlmsghdr *nh) { int len; struct rtattr *tb[IFLA_MAX + 1]; struct ifinfomsg *ifinfo; bzero(tb, sizeof(tb)); ifinfo = NLMSG_DATA(nh); len = nh->nlmsg_len - NLMSG_SPACE(sizeof(*ifinfo)); parse_rtattr(tb, IFLA_MAX, IFLA_RTA (ifinfo), len); printf("%s: %s ", (nh->nlmsg_type==RTM_NEWLINK)?"NEWLINK":"DELLINK", (ifinfo->ifi_flags & IFF_UP) ? "up" : "down"); if(tb[IFLA_IFNAME]) { printf("%s", RTA_DATA(tb[IFLA_IFNAME])); } printf("\n"); } /** * 显示地址信息 * 当地址变动的时候触发这个信息,例如通过DHCP获取到地址后 */ void print_ifaddrmsg(struct nlmsghdr *nh) { int len; struct rtattr *tb[IFA_MAX + 1]; struct ifaddrmsg *ifaddr; char tmp[256]; bzero(tb, sizeof(tb)); ifaddr = NLMSG_DATA(nh); len = nh->nlmsg_len - NLMSG_SPACE(sizeof(*ifaddr)); parse_rtattr(tb, IFA_MAX, IFA_RTA (ifaddr), len); char eth[100]; char addre[100]; char cmdline[100]; printf("%s ", (nh->nlmsg_type==RTM_NEWADDR)?"NEWADDR":"DELADDR"); if (nh->nlmsg_type==RTM_NEWADDR) {//只要新的 ip if (tb[IFA_LABEL] != NULL) { sprintf(eth, "%s", RTA_DATA(tb[IFA_LABEL])); if (tb[IFA_ADDRESS] != NULL) { inet_ntop(ifaddr->ifa_family, RTA_DATA(tb[IFA_ADDRESS]), tmp, sizeof(tmp)); if(strcmp(eth, "eth0") == 0 ){//我只需要监听 eth0 网卡的就行了 sprintf(addre, "%s",tmp); sprintf(cmdline, "/opt/sendmsg.sh %s",addre); system(cmdline); printf("%s ", tmp); } } } } printf("\n"); } /** * 显示路由信息 * 当路由变动的时候触发这个信息 */ void print_rtmsg(struct nlmsghdr *nh) { int len; struct rtattr *tb[RTA_MAX + 1]; struct rtmsg *rt; char tmp[256]; bzero(tb, sizeof(tb)); rt = NLMSG_DATA(nh); len = nh->nlmsg_len - NLMSG_SPACE(sizeof(*rt)); parse_rtattr(tb, RTA_MAX, RTM_RTA(rt), len); printf("%s: ", (nh->nlmsg_type==RTM_NEWROUTE)?"NEWROUT":"DELROUT"); if (tb[RTA_DST] != NULL) { inet_ntop(rt->rtm_family, RTA_DATA(tb[RTA_DST]), tmp, sizeof(tmp)); printf("RTA_DST %s ", tmp); } if (tb[RTA_SRC] != NULL) { inet_ntop(rt->rtm_family, RTA_DATA(tb[RTA_SRC]), tmp, sizeof(tmp)); printf("RTA_SRC %s ", tmp); } if (tb[RTA_GATEWAY] != NULL) { inet_ntop(rt->rtm_family, RTA_DATA(tb[RTA_GATEWAY]), tmp, sizeof(tmp)); printf("RTA_GATEWAY %s ", tmp); } printf("\n"); } int main(int argc, char *argv[]) { int socket_fd; int err = 0; fd_set rd_set; struct timeval timeout; int select_r; int read_r; struct sockaddr_nl sa; struct nlmsghdr *nh; int len = BUFLEN; char buff[2048]; signal(SIGINT, intHandler); /*打开NetLink Socket*/ socket_fd = socket(AF_NETLINK, SOCK_RAW, NETLINK_ROUTE); t_assert(socket_fd > 0); t_assert(!setsockopt(socket_fd, SOL_SOCKET, SO_RCVBUF, &len, sizeof(len))); /*设定接收类型并绑定Socket*/ bzero(&sa, sizeof(sa)); sa.nl_family = AF_NETLINK; sa.nl_groups = RTMGRP_LINK | RTMGRP_IPV4_IFADDR | RTMGRP_IPV4_ROUTE | RTMGRP_IPV6_IFADDR | RTMGRP_IPV6_ROUTE; t_assert(!bind(socket_fd, (struct sockaddr *) &sa, sizeof(sa))); while (keepRunning) { FD_ZERO(&rd_set); FD_SET(socket_fd, &rd_set); timeout.tv_sec = 5; timeout.tv_usec = 0; select_r = select(socket_fd + 1, &rd_set, NULL, NULL, &timeout); if (select_r < 0) { perror("select"); } else if (select_r > 0) { if (FD_ISSET(socket_fd, &rd_set)) { read_r = read(socket_fd, buff, sizeof(buff)); for (nh = (struct nlmsghdr *) buff; NLMSG_OK(nh, read_r); nh = NLMSG_NEXT(nh, read_r)) { switch (nh->nlmsg_type) { default: /*收到些奇怪的信息*/ printf("nh->nlmsg_type = %d\n", nh->nlmsg_type); break; case NLMSG_DONE: case NLMSG_ERROR: break; case RTM_NEWLINK: case RTM_DELLINK: print_ifinfomsg(nh); break; case RTM_NEWADDR: case RTM_DELADDR: print_ifaddrmsg(nh); break; case RTM_NEWROUTE: case RTM_DELROUTE: print_rtmsg(nh); break; } } } } } close(socket_fd); error: if (err < 0) { printf("Error at line %d\nErrno=%d\n", -err, errno); } return err; }
the_stack_data/1164635.c
/** * @file hash17576.c Create a Hash table to support 26^3 elements for Bucket Sort. * @brief * Enable Bucket Sort over a hash table with 26^3 buckets. * * * @author George Heineman * @date 6/15/08 */ /** Number of buckets to use. */ int numBuckets(int numElements) { return 26*26*26; } /** * Hash function to identify bucket number from element. Customized * to properly encode elements in order within the buckets. */ int hash(void *elt) { return (((char*)elt)[0] - 'a')*676 + (((char*)elt)[1] - 'a')*26 + (((char*)elt)[2] - 'a'); }
the_stack_data/6387106.c
// PROGRAMA p04.c #include <pthread.h> #include <stdio.h> #include <stdlib.h> #include <unistd.h> #define NUM_THREADS 10 void *func_thread(void *num) { sleep(1); int* n = (int*)num; printf("%d\n", *n); return num; } int main() { pthread_t threads[NUM_THREADS]; int t; int args[NUM_THREADS]; for(t=0; t< NUM_THREADS; t++){ args[t] = t; printf("Creating thread %d\n", t); pthread_create(&threads[t], NULL, func_thread, (void *)&args[t]); } void* num; for(t = 0; t < NUM_THREADS; t++){ pthread_join(threads[t], &num); printf("Main Thread: %d\n", *(int*)num); } return 0; }
the_stack_data/949849.c
/*Program to read two arrays A and B.Find all the elements both in A and B.*/ void main() { int A[100],B[100],tmp; unsigned int i,j,n; clrscr(); //i and j are the loop controllers,n is the limit //A[100] and B[100] are the arrays to be compared //tmp is the intermediate storage variable printf("How many elements do you wish to input?\n"); scanf("%u",&n); if(n>100) { printf("Sorry, Array size too large!"); goto end; } printf("Enter the elements of first array-\n"); for(i=0;i<n;i++) { printf("Element %u : ",i+1); scanf("%d",&A[i]); } printf("Enter the elements of second array-\n"); for(i=0;i<n;i++) { printf("Element %u : ",i+1); scanf("%d",&B[i]); } //for sorting the array for(i=0;i<n;i++) for(j=i+1;j<n;j++) if(A[j]<A[i]) { tmp=A[i]; A[i]=A[j]; A[j]=tmp ; } printf("The elements common in both arrays are :\n"); for(i=0;i<n;i++) for(j=0;j<n;j++) if(A[i]!=A[i+1]) if(A[i]==B[j]) { printf("%d\t",A[i]); break; } end: printf("\nPress any key....."); getch(); }
the_stack_data/3261946.c
#include <stdio.h> #include <unistd.h> #include <string.h> int ft_strlen(char *str); int main(void) { char t1[] = "a"; char t2[] = "123456*-+ "; char t3[] = "\200"; printf("Длина строки должна быть %lu вывод - %d\n", strlen(t1), ft_strlen(t1)); printf("Длина строки должна быть %lu вывод - %d\n", strlen(t2), ft_strlen(t2)); printf("Длина строки должна быть %lu вывод - %d\n", strlen(t3), ft_strlen(t3)); return (0); }
the_stack_data/87638376.c
/* Copyright (c) 2007 Simon Kelley This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; version 2 dated June, 1991. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */ /* dhcp_lease_time <address> */ /* Send a DHCPINFORM message to a dnsmasq server running on the local host and print (to stdout) the time remaining in any lease for the given address. The time is given as string printed to stdout. If an error occurs or no lease exists for the given address, nothing is sent to stdout a message is sent to stderr and a non-zero error code is returned. This version requires dnsmasq 2.67 or later. */ #include <sys/types.h> #include <netinet/in.h> #include <net/if.h> #include <arpa/inet.h> #include <sys/socket.h> #include <unistd.h> #include <stdio.h> #include <string.h> #include <stdlib.h> #include <net/if_arp.h> #include <sys/ioctl.h> #include <linux/types.h> #include <linux/netlink.h> #include <linux/rtnetlink.h> #include <errno.h> #define DHCP_CHADDR_MAX 16 #define BOOTREQUEST 1 #define DHCP_COOKIE 0x63825363 #define OPTION_PAD 0 #define OPTION_LEASE_TIME 51 #define OPTION_OVERLOAD 52 #define OPTION_MESSAGE_TYPE 53 #define OPTION_REQUESTED_OPTIONS 55 #define OPTION_END 255 #define DHCPINFORM 8 #define DHCP_SERVER_PORT 67 #define option_len(opt) ((int)(((unsigned char *)(opt))[1])) #define option_ptr(opt) ((void *)&(((unsigned char *)(opt))[2])) typedef unsigned char u8; typedef unsigned short u16; typedef unsigned int u32; struct dhcp_packet { u8 op, htype, hlen, hops; u32 xid; u16 secs, flags; struct in_addr ciaddr, yiaddr, siaddr, giaddr; u8 chaddr[DHCP_CHADDR_MAX], sname[64], file[128]; u32 cookie; unsigned char options[308]; }; static unsigned char *option_find1(unsigned char *p, unsigned char *end, int opt, int minsize) { while (*p != OPTION_END) { if (p >= end) return NULL; /* malformed packet */ else if (*p == OPTION_PAD) p++; else { int opt_len; if (p >= end - 2) return NULL; /* malformed packet */ opt_len = option_len(p); if (end - p >= (2 + opt_len)) return NULL; /* malformed packet */ if (*p == opt && opt_len >= minsize) return p; p += opt_len + 2; } } return opt == OPTION_END ? p : NULL; } static unsigned char *option_find(struct dhcp_packet *mess, size_t size, int opt_type, int minsize) { unsigned char *ret, *overload; /* skip over DHCP cookie; */ if ((ret = option_find1(&mess->options[0], ((unsigned char *)mess) + size, opt_type, minsize))) return ret; /* look for overload option. */ if (!(overload = option_find1(&mess->options[0], ((unsigned char *)mess) + size, OPTION_OVERLOAD, 1))) return NULL; /* Can we look in filename area ? */ if ((overload[2] & 1) && (ret = option_find1(&mess->file[0], &mess->file[128], opt_type, minsize))) return ret; /* finally try sname area */ if ((overload[2] & 2) && (ret = option_find1(&mess->sname[0], &mess->sname[64], opt_type, minsize))) return ret; return NULL; } static unsigned int option_uint(unsigned char *opt, int size) { /* this worries about unaligned data and byte order */ unsigned int ret = 0; int i; unsigned char *p = option_ptr(opt); for (i = 0; i < size; i++) ret = (ret << 8) | *p++; return ret; } int main(int argc, char **argv) { struct in_addr lease; struct dhcp_packet packet; unsigned char *p = packet.options; struct sockaddr_in dest; int fd = socket(PF_INET, SOCK_DGRAM, IPPROTO_UDP); ssize_t rc; if (argc < 2) { fprintf(stderr, "usage: dhcp_lease_time <address>\n"); exit(1); } if (fd == -1) { perror("cannot create socket"); exit(1); } lease.s_addr = inet_addr(argv[1]); memset(&packet, 0, sizeof(packet)); packet.hlen = 0; packet.htype = 0; packet.op = BOOTREQUEST; packet.ciaddr = lease; packet.cookie = htonl(DHCP_COOKIE); *(p++) = OPTION_MESSAGE_TYPE; *(p++) = 1; *(p++) = DHCPINFORM; /* Explicitly request the lease time, it won't be sent otherwise: this is a dnsmasq extension, not standard. */ *(p++) = OPTION_REQUESTED_OPTIONS; *(p++) = 1; *(p++) = OPTION_LEASE_TIME; *(p++) = OPTION_END; dest.sin_family = AF_INET; dest.sin_addr.s_addr = inet_addr("127.0.0.1"); dest.sin_port = ntohs(DHCP_SERVER_PORT); if (sendto(fd, &packet, sizeof(packet), 0, (struct sockaddr *)&dest, sizeof(dest)) == -1) { perror("sendto failed"); exit(1); } alarm(3); /* noddy timeout. */ rc = recv(fd, &packet, sizeof(packet), 0); if (rc < (ssize_t)(sizeof(packet) - sizeof(packet.options))) { perror("recv failed"); exit(1); } if ((p = option_find(&packet, (size_t)rc, OPTION_LEASE_TIME, 4))) { unsigned int t = option_uint(p, 4); if (t == 0xffffffff) printf("infinite"); else { unsigned int x; if ((x = t/86400)) printf("%ud", x); if ((x = (t/3600)%24)) printf("%uh", x); if ((x = (t/60)%60)) printf("%um", x); if ((x = t%60)) printf("%us", x); } return 0; } return 1; /* no lease */ }
the_stack_data/140766511.c
/* * Name: stack.c * Purpose: Simulates a stack. * Author: Richard T. Yang */ #include <stdbool.h> #define STACK_SIZE 100 int contents[STACK_SIZE]; int top = 0; void make_empty(void); bool is_empty(void); bool is_full(void); void push(int); int pop(void); int main(void) { return 0; } void make_empty(void) { top=0; } bool is_empty(void) { return top == 0; } bool is_full(void) { return top == STACK_SIZE; } void push(int i) { if (is_full()) { stack_overflow(); } else { contents[top++] = i; } } int pop(void) { if (is_empty()) { stack_underflow(); } else { return contents[--top]; } }
the_stack_data/51699967.c
#include <stdio.h> int main() { int a[50]; int n,i,j; scanf("%d",&n); i = 0; while (n>0) { a[i] = n%2; n /= 2; i = i+1; } for (j=i-1;j>=0;j--) { printf("%d",a[j]); } printf("\n"); }
the_stack_data/12055.c
#include <stdio.h> #include <unistd.h> #include <fcntl.h> #include <string.h> #include <stdbool.h> #define REQUIRED_ARGS 0 #define SIZE 200 int convertTabsInFiles(char* argv[], int n, int fileNumber) { char spaces[SIZE]; strcpy(spaces,""); char buff; int i = 0; while (i < n) { strcat(spaces, " "); i++; } strcat(spaces, "\0"); int fd, size; i = 0; for (i; i < fileNumber; i++) { fd = open(argv[i], O_RDONLY); if (fd == -1) { perror(argv[i]); return 2; } while ((size = read(fd, &buff, 1)) > 0) { if (buff == '\t') { if(write(STDOUT_FILENO, spaces, n)==-1) return 3; } else { if(write(STDOUT_FILENO, &buff, size)==-1) return 4; } } if (close(fd) == -1) { perror(argv[i]); return 5; } } return 0; } int convertTabsInPrompt(int n) { char spaces[SIZE]; strcpy(spaces,""); char buff; int i = 0; while (i < n) { strcat(spaces, " "); i++; } strcat(spaces, "\0"); int size; while ((size = read(STDIN_FILENO, &buff, 1)) > 0) { if (buff == '\t') { if(write(STDOUT_FILENO, spaces, n)==-1) return 3; } else { if(write(STDOUT_FILENO, &buff, size)==-1) return 4; } } return 0; } bool isLightSpace(char previous) { return previous == '\t' || previous == '\n' || previous == '\r' || previous == ' '; } int convertTabsInFilesWithLightSpace(char* argv[], int n, int fileNumber) { char spaces[SIZE]; strcpy(spaces,""); char buff; char previous = ""; int i = 0; while (i < n) { strcat(spaces, " "); i++; } strcat(spaces, "\0"); int fd, size; i = 0; for (i; i < fileNumber; i++) { fd = open(argv[i], O_RDONLY); if (fd == -1) { perror(argv[i]); return 2; } while ((size = read(fd, &buff, 1)) > 0) { if (buff == '\t' && isLightSpace(previous)) { if(write(STDOUT_FILENO, spaces, n)==-1) return 3; } else { if(write(STDOUT_FILENO, &buff, size)==-1) return 4; } previous = buff; } if (close(fd) == -1) { perror(argv[i]); return 5; } } return 0; } int convertTabsInPromptWithLightSpace(int n) { char spaces[SIZE]; strcpy(spaces,""); char buff; char previous = ""; int i = 0; while (i < n) { strcat(spaces, " "); i++; } strcat(spaces, "\0"); int size; i = 0; while ((size = read(STDIN_FILENO, &buff, 1)) > 0) { if (buff == '\t' && isLightSpace(previous)) { if(write(STDOUT_FILENO, spaces, n)==-1) return 3; } else { if(write(STDOUT_FILENO, &buff, size)==-1) return 4; } previous = buff; } return 0; } int main(int argc, char* argv[]) { if (argc < REQUIRED_ARGS + 1) { perror(argv[0]); return 1; } int n = 8; if(argc > 1) { char firstArg[SIZE]; strcpy(firstArg, argv[1]); if (firstArg[0] == '-' && firstArg[1] == 'i') { if(argc>2) { char secondArg[SIZE]; strcpy(secondArg, argv[2]); if (secondArg[0] == '-') { n = atoi(secondArg + 2); if (argc > 3) return convertTabsInFilesWithLightSpace(argv + 3, n, argc - 3); return convertTabsInPromptWithLightSpace(n); } return convertTabsInFilesWithLightSpace(argv + 2, n, argc - 2); } return convertTabsInPromptWithLightSpace(n); } if (firstArg[0] == '-' && firstArg[1] == 't') { n = atoi(firstArg + 2); if (argc > 2) { char secondArg[SIZE]; strcpy(secondArg, argv[2]); if (secondArg[0] == '-') { if (argc > 3) return convertTabsInFilesWithLightSpace(argv + 3, n, argc - 3); return convertTabsInPromptWithLightSpace(n); } return convertTabsInFiles(argv + 2, n, argc - 2); } return convertTabsInPrompt(n); } return convertTabsInFiles(argv + 1, n, argc - 1); } return convertTabsInPrompt(n); }
the_stack_data/35713.c
/* ------------------------------------------------------------------------- * This program simulates a simple (s,S) inventory system using demand read * from a text file. Backlogging is permitted and there is no delivery lag. * The output statistics are the average demand and order per time interval * (they should be equal), the relative frequency of setup and the time * averaged held (+) and short (-) inventory levels. * * NOTE: use 0 <= MINIMUM < MAXIMUM, i.e., 0 <= s < S. * * Name : sis1.c (Simple Inventory System, version 1) * Authors : Steve Park & Dave Geyer * Language : ANSI C * Latest Revision : 8-20-97 * Compile with : gcc sis1.c * ------------------------------------------------------------------------- */ #include <stdio.h> #define FILENAME "sis1.dat" /* input data file */ #define MINIMUM 20 /* 's' inventory policy parameter */ #define MAXIMUM 80 /* 'S' inventory policy parameter */ #define sqr(x) ((x) * (x)) /* ======================== */ long GetDemand(FILE *fp) /* ======================== */ { long d; fscanf(fp, "%ld\n", &d); return (d); } /* ============== */ int main(void) /* ============== */ { FILE *fp; /* input data file */ long index = 0; /* time interval index */ long inventory = MAXIMUM; /* current inventory level */ long demand; /* amount of demand */ long order; /* amount of order */ struct { /* sum of ... */ double setup; /* setup instances */ double holding; /* inventory held (+) */ double shortage; /* inventory short (-) */ double order; /* orders */ double demand; /* demands */ } sum = { 0.0, 0.0, 0.0, 0.0, 0.0 }; fp = fopen(FILENAME, "r"); if (fp == NULL) { fprintf(stderr, "Cannot open input file %s\n", FILENAME); return (1); } while (!feof(fp)) { index++; if (inventory < MINIMUM) { /* place an order */ order = MAXIMUM - inventory; sum.setup++; sum.order += order; } else /* no order */ order = 0; inventory += order; /* there is no delivery lag */ demand = GetDemand(fp); sum.demand += demand; if (inventory > demand) sum.holding += (inventory - 0.5 * demand); else { sum.holding += sqr(inventory) / (2.0 * demand); sum.shortage += sqr(demand - inventory) / (2.0 * demand); } inventory -= demand; } if (inventory < MAXIMUM) { /* force the final inventory to */ order = MAXIMUM - inventory; /* match the initial inventory */ sum.setup++; sum.order += order; inventory += order; } printf("\nfor %ld time intervals ", index); printf("with an average demand of %6.2f\n", sum.demand / index); printf("and policy parameters (s, S) = (%d, %d)\n\n", MINIMUM, MAXIMUM); printf(" average order ............ = %6.2f\n", sum.order / index); printf(" setup frequency .......... = %6.2f\n", sum.setup / index); printf(" average holding level .... = %6.2f\n", sum.holding / index); printf(" average shortage level ... = %6.2f\n", sum.shortage / index); fclose(fp); return (0); }
the_stack_data/36076496.c
#include <stdio.h> void coordinates(int, ...); int main() { printf("Variable No of Arguments of a Function:\n"); //Triangle coordinates(3, 0.8, 11.8, 9.0); //Rectangle coordinates(4, 0.8, 11.8, 9.0, 5.9); //Pentagon coordinates(5, 1.3, 5.5, 0.8, 11.8, 9.0); } void coordinates(int len, ...) { printf("The No of points are - %d \n", len); switch (len) { case 1: printf("This is a Point\n"); break; case 2: printf("This is a straight Line\n"); break; case 3: printf("This is a Triangle\n"); break; case 4: printf("This is a Rectangle\\Trapizoid\\Rombhus\\Parallelogram\n"); break; case 5: printf("This is a Pentagon\n"); break; default: printf("Invalid Coordinates"); break; } }
the_stack_data/92968.c
#include <stdio.h> #include <stdlib.h> #include <float.h> #include <assert.h> #include <math.h> #include <string.h> #if defined(__MINGW32__) || defined(__MINGW64__) int slashdrivesub(char *ln) /* * replaces \\c\ with c:\, returns change in string length * this version required for older cygwins */ { char *sp, *lp=ln, ctmp; int nrep=0; do { sp = strstr(lp, "\\\\"); if (sp && strlen(sp) > 3) { if (sp[2] == 'a' || sp[2] == 'b' || sp[2] == 'c' || sp[2] == 'd' || sp[2] == 'e' || sp[2] == 'f' || sp[2] == 'g' || sp[2] == 'h') { if (sp[3] == '\\') { ctmp = sp[2]; sp[0] = sp[2]; sp[1] = ':'; sp[2] = '\\'; for (lp=sp+3; *lp = lp[1]; lp++); lp = sp + 3; nrep++; } else lp = sp + 2; } else lp = sp + 2; } else lp = sp + 2; } while (sp); return(-nrep); } int cygdrivesub(char *ln) /* * replaces \cygdrive\c\ with c:\, returns change in string length * this version works cygnus version 1.1.0 */ { char *sp; int i=0; while(sp = strstr(ln, "\\cygdrive\\")) { i++; sp[0] = sp[10]; sp[1] = ':'; sp[2] = '\\'; sp += 3; while (*sp = sp[9]) sp++; } return( slashdrivesub(ln) - (i*9) ); } void slashsub(char *ln) /* * changes forward slash of unix to backslash of windoze */ { int i; for (i=0; ln[i]; i++) if (ln[i] == '/') ln[i] = '\\'; } #endif int sComputeRound(void) /* * Blind translation of netlib LAPACK LAMCH's rounding computation * RETURNS: 1 if numbers are correctly rounded, 0 if they are truncated */ { volatile float a, b, c, f; int rnd=0; b = a = 1.0; do { a *= 2.0; c = a + b; c = c - a; } while (c == 1.0); b = 0.5*FLT_RADIX; c = .01*(-FLT_RADIX); f = b + c; c = f + a; rnd = (c == a); c = 0.01*(FLT_RADIX); f = b + c; c = f + a; if (rnd && c == a) rnd = 0; return(rnd); } float sComputeSafmin(void) /* * BFI translation of netlib LAPACK LAMCH's safmin calc, adapted to use float.h * RETURNS: LAMCH's safmin */ { volatile float small; small = 1.0/(pow(FLT_RADIX, FLT_MAX_EXP-2)*(4.0-2.0*FLT_EPSILON)); if (small >= FLT_MIN) return(small*(1.0+0.5*FLT_EPSILON)); return(FLT_MIN); } void emit_slamch(char *path) { FILE *fpout; char *name; volatile float f, under, over; int len = 16, bad; if (path) { len += strlen(path); name = malloc(len); assert(name); sprintf(name, "%s/atlas_slamch.h", path); fpout = fopen(name, "w"); assert(fpout); free(name); } else fpout = stdout; fprintf(fpout, "/* generated by %s */\n\n", __FILE__); fprintf(fpout, "#ifndef ATLAS_SLAMCH_H\n"); fprintf(fpout, " #define ATLAS_SLAMCH_H\n\n"); fprintf(fpout, "#define ATL_slaMANTDIG %d\n", FLT_MANT_DIG); fprintf(fpout, "#define ATL_slaMINEXP %d\n", FLT_MIN_EXP); fprintf(fpout, "#define ATL_slaMAXEXP %d\n", FLT_MAX_EXP); fprintf(fpout, "#define ATL_slaBASE %d\n", FLT_RADIX); f = 0.5; f *= FLT_EPSILON; fprintf(fpout, "#define ATL_slaEPSILON %60.53e\n", f); f = 0.5 * FLT_RADIX; f *= FLT_EPSILON; fprintf(fpout, "#define ATL_slaPRECISION %60.53e\n", f); fprintf(fpout, "#define ATL_slaUNDERTHRESH %60.53e\n", FLT_MIN); under = FLT_MIN; f = pow(FLT_RADIX, FLT_MAX_EXP-2)*(4.0-2.0*FLT_EPSILON); fprintf(fpout, "#define ATL_slaOVERTHRESH %60.53e\n", f); over = f; fprintf(fpout, "#define ATL_slaSAFMIN %60.53e\n", sComputeSafmin()); fprintf(fpout, "#define ATL_slaROUND %d\n", sComputeRound()); /* * Blind translation of LAPACK's _LABAD test */ f = 2000.0; bad = (log10(over) > f); fprintf(fpout, "#define ATL_slaBAD %d\n", bad); if (bad) { fprintf(fpout, "#define ATL_slabadUNDERTHRESH %60.53e\n", sqrt(under)); fprintf(fpout, "#define ATL_slabadOVERTHRESH %60.53e\n", sqrt(over)); } else { fprintf(fpout, "#define ATL_slabadUNDERTHRESH ATL_slaUNDERTHRESH\n"); fprintf(fpout, "#define ATL_slabadOVERTHRESH ATL_slaOVERTHRESH\n"); } fprintf(fpout, "\n#endif\n"); fclose(fpout); } int dComputeRound(void) /* * Blind translation of netlib LAPACK LAMCH's rounding computation * RETURNS: 1 if numbers are correctly rounded, 0 if they are truncated */ { volatile double a, b, c, f; int rnd=0; b = a = 1.0; do { a *= 2.0; c = a + b; c = c - a; } while (c == 1.0); b = 0.5*FLT_RADIX; c = .01*(-FLT_RADIX); f = b + c; c = f + a; rnd = (c == a); c = 0.01*(FLT_RADIX); f = b + c; c = f + a; if (rnd && c == a) rnd = 0; return(rnd); } double dComputeSafmin(void) /* * BFI translation of netlib LAPACK LAMCH's safmin calc, adapted to use float.h * RETURNS: LAMCH's safmin */ { volatile double small; small = 1.0/(pow(FLT_RADIX, DBL_MAX_EXP-2)*(4.0-2.0*DBL_EPSILON)); if (small >= DBL_MIN) return(small*(1.0+0.5*DBL_EPSILON)); return(DBL_MIN); } void emit_dlamch(char *path) { FILE *fpout; char *name; volatile double f, under, over; int len = 16, bad; if (path) { len += strlen(path); name = malloc(len); assert(name); sprintf(name, "%s/atlas_dlamch.h", path); fpout = fopen(name, "w"); assert(fpout); free(name); } else fpout = stdout; fprintf(fpout, "/* generated by %s */\n\n", __FILE__); fprintf(fpout, "#ifndef ATLAS_DLAMCH_H\n"); fprintf(fpout, " #define ATLAS_DLAMCH_H\n\n"); fprintf(fpout, "#define ATL_dlaMANTDIG %d\n", DBL_MANT_DIG); fprintf(fpout, "#define ATL_dlaMINEXP %d\n", DBL_MIN_EXP); fprintf(fpout, "#define ATL_dlaMAXEXP %d\n", DBL_MAX_EXP); fprintf(fpout, "#define ATL_dlaBASE %d\n", FLT_RADIX); f = 0.5; f *= DBL_EPSILON; fprintf(fpout, "#define ATL_dlaEPSILON %60.53e\n", f); f = 0.5 * FLT_RADIX; f *= DBL_EPSILON; fprintf(fpout, "#define ATL_dlaPRECISION %60.53e\n", f); fprintf(fpout, "#define ATL_dlaUNDERTHRESH %60.53e\n", DBL_MIN); under = DBL_MIN; f = pow(FLT_RADIX, DBL_MAX_EXP-2)*(4.0-2.0*DBL_EPSILON); fprintf(fpout, "#define ATL_dlaOVERTHRESH %60.53e\n", f); over = f; fprintf(fpout, "#define ATL_dlaSAFMIN %60.53e\n", dComputeSafmin()); fprintf(fpout, "#define ATL_dlaROUND %d\n", dComputeRound()); /* * Blind translation of LAPACK's _LABAD test */ f = 2000.0; bad = (log10(over) > f); fprintf(fpout, "#define ATL_dlaBAD %d\n", bad); if (bad) { fprintf(fpout, "#define ATL_dlabadUNDERTHRESH %60.53e\n", sqrt(under)); fprintf(fpout, "#define ATL_dlabadOVERTHRESH %60.53e\n", sqrt(over)); } else { fprintf(fpout, "#define ATL_dlabadUNDERTHRESH ATL_dlaUNDERTHRESH\n"); fprintf(fpout, "#define ATL_dlabadOVERTHRESH ATL_dlaOVERTHRESH\n"); } fprintf(fpout, "\n#endif\n"); fclose(fpout); } int main (int nargs, char **args) { char *path = "res/"; if (nargs > 1) path = args[1]; #if defined(__MINGW32__) || defined(__MINGW64__) { char *winpath; winpath = malloc(sizeof(char)*(strlen(path)+1)); assert(winpath); strcpy(winpath, path); slashsub(winpath); cygdrivesub(winpath); emit_dlamch(winpath); emit_slamch(winpath); free(winpath); } #else emit_dlamch(path); emit_slamch(path); #endif return(0); }
the_stack_data/98576169.c
/*** * This code is a part of EvoApproxLib library (ehw.fit.vutbr.cz/approxlib) distributed under The MIT License. * When used, please cite the following article(s): V. Mrazek, L. Sekanina, Z. Vasicek "Libraries of Approximate Circuits: Automated Design and Application in CNN Accelerators" IEEE Journal on Emerging and Selected Topics in Circuits and Systems, Vol 10, No 4, 2020 * This file contains a circuit from a sub-set of pareto optimal circuits with respect to the pwr and mae parameters ***/ // MAE% = 0.00076 % // MAE = 0.5 // WCE% = 0.0015 % // WCE = 1.0 // WCRE% = 100.00 % // EP% = 50.00 % // MRE% = 0.017 % // MSE = 0.5 // PDK45_PWR = 0.071 mW // PDK45_AREA = 138.0 um2 // PDK45_DELAY = 1.25 ns #include <stdint.h> #include <stdlib.h> uint64_t add16se_26Q(const uint64_t B,const uint64_t A) { uint64_t dout_34, dout_35, dout_36, dout_37, dout_38, dout_39, dout_40, dout_41, dout_42, dout_43, dout_44, dout_45, dout_46, dout_47, dout_48, dout_49, dout_50, dout_51, dout_52, dout_53, dout_54, dout_55, dout_56, dout_57, dout_58, dout_59, dout_60, dout_61, dout_62, dout_63, dout_64, dout_65, dout_66, dout_67, dout_68, dout_69, dout_70, dout_71, dout_72, dout_73, dout_74, dout_75, dout_76, dout_77, dout_78, dout_79, dout_80, dout_81, dout_82, dout_83, dout_84, dout_85, dout_86, dout_87, dout_88, dout_89, dout_90, dout_91, dout_92, dout_93, dout_94, dout_95, dout_96, dout_97, dout_98, dout_99, dout_100, dout_101, dout_102, dout_103, dout_104, dout_105, dout_106, dout_107, dout_108, dout_109, dout_110; uint64_t O; dout_34=((A >> 1)&1)^((B >> 1)&1); dout_35=((A >> 1)&1)&((B >> 1)&1); dout_36=dout_34&((A >> 0)&1); dout_37=dout_34^((A >> 0)&1); dout_38=dout_35|dout_36; dout_39=((A >> 2)&1)^((B >> 2)&1); dout_40=((A >> 2)&1)&((B >> 2)&1); dout_41=dout_39&dout_38; dout_42=dout_39^dout_38; dout_43=dout_40|dout_41; dout_44=((A >> 3)&1)^((B >> 3)&1); dout_45=((A >> 3)&1)&((B >> 3)&1); dout_46=dout_44&dout_43; dout_47=dout_44^dout_43; dout_48=dout_45|dout_46; dout_49=((A >> 4)&1)^((B >> 4)&1); dout_50=((A >> 4)&1)&((B >> 4)&1); dout_51=dout_49&dout_48; dout_52=dout_49^dout_48; dout_53=dout_50|dout_51; dout_54=((A >> 5)&1)^((B >> 5)&1); dout_55=((A >> 5)&1)&((B >> 5)&1); dout_56=dout_54&dout_53; dout_57=dout_54^dout_53; dout_58=dout_55|dout_56; dout_59=((A >> 6)&1)^((B >> 6)&1); dout_60=((A >> 6)&1)&((B >> 6)&1); dout_61=dout_59&dout_58; dout_62=dout_59^dout_58; dout_63=dout_60|dout_61; dout_64=((A >> 7)&1)^((B >> 7)&1); dout_65=((A >> 7)&1)&((B >> 7)&1); dout_66=dout_64&dout_63; dout_67=dout_64^dout_63; dout_68=dout_65|dout_66; dout_69=((A >> 8)&1)^((B >> 8)&1); dout_70=((A >> 8)&1)&((B >> 8)&1); dout_71=dout_69&dout_68; dout_72=dout_69^dout_68; dout_73=dout_70|dout_71; dout_74=((A >> 9)&1)^((B >> 9)&1); dout_75=((A >> 9)&1)&((B >> 9)&1); dout_76=dout_74&dout_73; dout_77=dout_74^dout_73; dout_78=dout_75|dout_76; dout_79=((A >> 10)&1)^((B >> 10)&1); dout_80=((A >> 10)&1)&((B >> 10)&1); dout_81=dout_79&dout_78; dout_82=dout_79^dout_78; dout_83=dout_80|dout_81; dout_84=((A >> 11)&1)^((B >> 11)&1); dout_85=((A >> 11)&1)&((B >> 11)&1); dout_86=dout_84&dout_83; dout_87=dout_84^dout_83; dout_88=dout_85|dout_86; dout_89=((A >> 12)&1)^((B >> 12)&1); dout_90=((A >> 12)&1)&((B >> 12)&1); dout_91=dout_89&dout_88; dout_92=dout_89^dout_88; dout_93=dout_90|dout_91; dout_94=((A >> 13)&1)^((B >> 13)&1); dout_95=((A >> 13)&1)&((B >> 13)&1); dout_96=dout_94&dout_93; dout_97=dout_94^dout_93; dout_98=dout_95|dout_96; dout_99=((A >> 14)&1)^((B >> 14)&1); dout_100=((A >> 14)&1)&((B >> 14)&1); dout_101=dout_99&dout_98; dout_102=dout_99^dout_98; dout_103=dout_100|dout_101; dout_104=((A >> 15)&1)^((B >> 15)&1); dout_105=((A >> 15)&1)&((B >> 15)&1); dout_106=dout_104&dout_103; dout_107=dout_104^dout_103; dout_108=dout_105|dout_106; dout_109=((A >> 15)&1)^((B >> 15)&1); dout_110=dout_109^dout_108; O = 0; O |= (0&1) << 0; O |= (dout_37&1) << 1; O |= (dout_42&1) << 2; O |= (dout_47&1) << 3; O |= (dout_52&1) << 4; O |= (dout_57&1) << 5; O |= (dout_62&1) << 6; O |= (dout_67&1) << 7; O |= (dout_72&1) << 8; O |= (dout_77&1) << 9; O |= (dout_82&1) << 10; O |= (dout_87&1) << 11; O |= (dout_92&1) << 12; O |= (dout_97&1) << 13; O |= (dout_102&1) << 14; O |= (dout_107&1) << 15; O |= (dout_110&1) << 16; return O; }
the_stack_data/134713.c
/* * * (c) Copyright 1989 OPEN SOFTWARE FOUNDATION, INC. * (c) Copyright 1989 HEWLETT-PACKARD COMPANY * (c) Copyright 1989 DIGITAL EQUIPMENT CORPORATION * To anyone who acknowledges that this file is provided "AS IS" * without any express or implied warranty: * permission to use, copy, modify, and distribute this * file for any purpose is hereby granted without fee, provided that * the above copyright notices and this notice appears in all source * code copies, and that none of the names of Open Software * Foundation, Inc., Hewlett-Packard Company, or Digital Equipment * Corporation be used in advertising or publicity pertaining to * distribution of the software without specific, written prior * permission. Neither Open Software Foundation, Inc., Hewlett- * Packard Company, nor Digital Equipment Corporation makes any * representations about the suitability of this software for any * purpose. * */ /* */ /* ** ** NAME ** ** rpclog.c ** ** FACILITY: ** ** Remote Procedure Call (RPC) ** ** ABSTRACT: ** ** Definitions of global variables. ** ** */ #if HAVE_CONFIG_H #include <config.h> #endif #ifdef LOGPTS #include <rpclog.h> #ifdef ultrix #include <nlist.h> #include <unistd.h> #endif /* ultrix */ static rpc_logpt_t logpt_invisible; rpc_logpt_ptr_t rpc_g_log_ptr = &logpt_invisible; /* **++ ** ** ROUTINE NAME: rpc__log_ptr_init ** ** SCOPE: PRIVATE - declared in rpclog.h ** ** DESCRIPTION: ** ** This routine will initialize the RPC logging service. ** ** INPUTS: none ** ** INPUTS/OUTPUTS: none ** ** OUTPUTS: none ** ** IMPLICIT INPUTS: none ** ** IMPLICIT OUTPUTS: none ** ** FUNCTION VALUE: ** ** log pointer pointer value to location to which codes to ** be timestamped are written. ** ** SIDE EFFECTS: none ** **-- **/ rpc_logpt_ptr_t rpc__log_ptr_init (void) #ifdef ultrix { rpc_logpt_ptr_t ptr; unsigned long logpt_addr_in_virt_mem; #define QMEM_X 0 struct nlist symtab[QMEM_X + 2]; symtab[QMEM_X].n_name = "_qmem"; symtab[QMEM_X + 1].n_name = NULL; nlist ("/vmunix", symtab); logpt_addr_in_virt_mem = (symtab[QMEM_X].n_value + LOGPT_ADDR_IN_QMEM); ptr = (rpc_logpt_ptr_t) (logpt_addr_in_virt_mem); return (ptr); } #endif /* ultrix */ #else #ifndef __GNUC__ /* * ANSI c does not allow a file to be compiled without declarations. * If LOGPTS is not defined, we need to declare a dummy variable to * compile under strict ansi c standards. */ static char _rpclog_dummy_ = 0, *_rpclog_dummy_p = &_rpclog_dummy_; #endif #endif /* LOGOPTS */
the_stack_data/113055.c
#include <stdio.h> #include <stdlib.h> int main(int argc, char *argv[]) { int n,m,gcd; int GCD(int n, int m); scanf("%d %d",&n,&m); gcd=GCD(n,m); printf("%d\n",gcd); return 0; } int GCD(int n, int m) { int gcd; if(m<=n&&n%m==0) gcd=m; else if(n<m) gcd=GCD(m,n); else gcd=GCD(m,n%m); return gcd; }
the_stack_data/1252925.c
/** ****************************************************************************** * @file stm32f3xx_ll_exti.c * @author MCD Application Team * @brief EXTI LL module driver. ****************************************************************************** * @attention * * <h2><center>&copy; Copyright (c) 2016 STMicroelectronics. * All rights reserved.</center></h2> * * This software component is licensed by ST under BSD 3-Clause license, * the "License"; You may not use this file except in compliance with the * License. You may obtain a copy of the License at: * opensource.org/licenses/BSD-3-Clause * ****************************************************************************** */ #if defined(USE_FULL_LL_DRIVER) /* Includes ------------------------------------------------------------------*/ #include "stm32f3xx_ll_exti.h" #ifdef USE_FULL_ASSERT #include "stm32_assert.h" #else #define assert_param(expr) ((void)0U) #endif /** @addtogroup STM32F3xx_LL_Driver * @{ */ #if defined (EXTI) /** @defgroup EXTI_LL EXTI * @{ */ /* Private types -------------------------------------------------------------*/ /* Private variables ---------------------------------------------------------*/ /* Private constants ---------------------------------------------------------*/ /* Private macros ------------------------------------------------------------*/ /** @addtogroup EXTI_LL_Private_Macros * @{ */ #define IS_LL_EXTI_LINE_0_31(__VALUE__) (((__VALUE__) & ~LL_EXTI_LINE_ALL_0_31) == 0x00000000U) #if defined(EXTI_32_63_SUPPORT) #define IS_LL_EXTI_LINE_32_63(__VALUE__) (((__VALUE__) & ~LL_EXTI_LINE_ALL_32_63) == 0x00000000U) #endif #define IS_LL_EXTI_MODE(__VALUE__) (((__VALUE__) == LL_EXTI_MODE_IT) \ || ((__VALUE__) == LL_EXTI_MODE_EVENT) \ || ((__VALUE__) == LL_EXTI_MODE_IT_EVENT)) #define IS_LL_EXTI_TRIGGER(__VALUE__) (((__VALUE__) == LL_EXTI_TRIGGER_NONE) \ || ((__VALUE__) == LL_EXTI_TRIGGER_RISING) \ || ((__VALUE__) == LL_EXTI_TRIGGER_FALLING) \ || ((__VALUE__) == LL_EXTI_TRIGGER_RISING_FALLING)) /** * @} */ /* Private function prototypes -----------------------------------------------*/ /* Exported functions --------------------------------------------------------*/ /** @addtogroup EXTI_LL_Exported_Functions * @{ */ /** @addtogroup EXTI_LL_EF_Init * @{ */ /** * @brief De-initialize the EXTI registers to their default reset values. * @retval An ErrorStatus enumeration value: * - SUCCESS: EXTI registers are de-initialized * - ERROR: not applicable */ uint32_t LL_EXTI_DeInit(void) { /* Interrupt mask register set to default reset values */ LL_EXTI_WriteReg(IMR, 0x1F800000U); /* Event mask register set to default reset values */ LL_EXTI_WriteReg(EMR, 0x00000000U); /* Rising Trigger selection register set to default reset values */ LL_EXTI_WriteReg(RTSR, 0x00000000U); /* Falling Trigger selection register set to default reset values */ LL_EXTI_WriteReg(FTSR, 0x00000000U); /* Software interrupt event register set to default reset values */ LL_EXTI_WriteReg(SWIER, 0x00000000U); /* Pending register clear */ LL_EXTI_WriteReg(PR, 0x007FFFFFU); #if defined(EXTI_32_63_SUPPORT) /* Interrupt mask register 2 set to default reset values */ #if defined(STM32F334x8) LL_EXTI_WriteReg(IMR2, 0xFFFFFFFEU); #else LL_EXTI_WriteReg(IMR2, 0xFFFFFFFCU); #endif /* Event mask register 2 set to default reset values */ LL_EXTI_WriteReg(EMR2, 0x00000000U); /* Rising Trigger selection register 2 set to default reset values */ LL_EXTI_WriteReg(RTSR2, 0x00000000U); /* Falling Trigger selection register 2 set to default reset values */ LL_EXTI_WriteReg(FTSR2, 0x00000000U); /* Software interrupt event register 2 set to default reset values */ LL_EXTI_WriteReg(SWIER2, 0x00000000U); /* Pending register 2 clear */ LL_EXTI_WriteReg(PR2, 0x00000003U); #endif return SUCCESS; } /** * @brief Initialize the EXTI registers according to the specified parameters in EXTI_InitStruct. * @param EXTI_InitStruct pointer to a @ref LL_EXTI_InitTypeDef structure. * @retval An ErrorStatus enumeration value: * - SUCCESS: EXTI registers are initialized * - ERROR: not applicable */ uint32_t LL_EXTI_Init(LL_EXTI_InitTypeDef *EXTI_InitStruct) { ErrorStatus status = SUCCESS; /* Check the parameters */ assert_param(IS_LL_EXTI_LINE_0_31(EXTI_InitStruct->Line_0_31)); #if defined(EXTI_32_63_SUPPORT) assert_param(IS_LL_EXTI_LINE_32_63(EXTI_InitStruct->Line_32_63)); #endif assert_param(IS_FUNCTIONAL_STATE(EXTI_InitStruct->LineCommand)); assert_param(IS_LL_EXTI_MODE(EXTI_InitStruct->Mode)); /* ENABLE LineCommand */ if (EXTI_InitStruct->LineCommand != DISABLE) { assert_param(IS_LL_EXTI_TRIGGER(EXTI_InitStruct->Trigger)); /* Configure EXTI Lines in range from 0 to 31 */ if (EXTI_InitStruct->Line_0_31 != LL_EXTI_LINE_NONE) { switch (EXTI_InitStruct->Mode) { case LL_EXTI_MODE_IT: /* First Disable Event on provided Lines */ LL_EXTI_DisableEvent_0_31(EXTI_InitStruct->Line_0_31); /* Then Enable IT on provided Lines */ LL_EXTI_EnableIT_0_31(EXTI_InitStruct->Line_0_31); break; case LL_EXTI_MODE_EVENT: /* First Disable IT on provided Lines */ LL_EXTI_DisableIT_0_31(EXTI_InitStruct->Line_0_31); /* Then Enable Event on provided Lines */ LL_EXTI_EnableEvent_0_31(EXTI_InitStruct->Line_0_31); break; case LL_EXTI_MODE_IT_EVENT: /* Directly Enable IT & Event on provided Lines */ LL_EXTI_EnableIT_0_31(EXTI_InitStruct->Line_0_31); LL_EXTI_EnableEvent_0_31(EXTI_InitStruct->Line_0_31); break; default: status = ERROR; break; } if (EXTI_InitStruct->Trigger != LL_EXTI_TRIGGER_NONE) { switch (EXTI_InitStruct->Trigger) { case LL_EXTI_TRIGGER_RISING: /* First Disable Falling Trigger on provided Lines */ LL_EXTI_DisableFallingTrig_0_31(EXTI_InitStruct->Line_0_31); /* Then Enable Rising Trigger on provided Lines */ LL_EXTI_EnableRisingTrig_0_31(EXTI_InitStruct->Line_0_31); break; case LL_EXTI_TRIGGER_FALLING: /* First Disable Rising Trigger on provided Lines */ LL_EXTI_DisableRisingTrig_0_31(EXTI_InitStruct->Line_0_31); /* Then Enable Falling Trigger on provided Lines */ LL_EXTI_EnableFallingTrig_0_31(EXTI_InitStruct->Line_0_31); break; case LL_EXTI_TRIGGER_RISING_FALLING: LL_EXTI_EnableRisingTrig_0_31(EXTI_InitStruct->Line_0_31); LL_EXTI_EnableFallingTrig_0_31(EXTI_InitStruct->Line_0_31); break; default: status = ERROR; break; } } } #if defined(EXTI_32_63_SUPPORT) /* Configure EXTI Lines in range from 32 to 63 */ if (EXTI_InitStruct->Line_32_63 != LL_EXTI_LINE_NONE) { switch (EXTI_InitStruct->Mode) { case LL_EXTI_MODE_IT: /* First Disable Event on provided Lines */ LL_EXTI_DisableEvent_32_63(EXTI_InitStruct->Line_32_63); /* Then Enable IT on provided Lines */ LL_EXTI_EnableIT_32_63(EXTI_InitStruct->Line_32_63); break; case LL_EXTI_MODE_EVENT: /* First Disable IT on provided Lines */ LL_EXTI_DisableIT_32_63(EXTI_InitStruct->Line_32_63); /* Then Enable Event on provided Lines */ LL_EXTI_EnableEvent_32_63(EXTI_InitStruct->Line_32_63); break; case LL_EXTI_MODE_IT_EVENT: /* Directly Enable IT & Event on provided Lines */ LL_EXTI_EnableIT_32_63(EXTI_InitStruct->Line_32_63); LL_EXTI_EnableEvent_32_63(EXTI_InitStruct->Line_32_63); break; default: status = ERROR; break; } if (EXTI_InitStruct->Trigger != LL_EXTI_TRIGGER_NONE) { switch (EXTI_InitStruct->Trigger) { case LL_EXTI_TRIGGER_RISING: /* First Disable Falling Trigger on provided Lines */ LL_EXTI_DisableFallingTrig_32_63(EXTI_InitStruct->Line_32_63); /* Then Enable IT on provided Lines */ LL_EXTI_EnableRisingTrig_32_63(EXTI_InitStruct->Line_32_63); break; case LL_EXTI_TRIGGER_FALLING: /* First Disable Rising Trigger on provided Lines */ LL_EXTI_DisableRisingTrig_32_63(EXTI_InitStruct->Line_32_63); /* Then Enable Falling Trigger on provided Lines */ LL_EXTI_EnableFallingTrig_32_63(EXTI_InitStruct->Line_32_63); break; case LL_EXTI_TRIGGER_RISING_FALLING: LL_EXTI_EnableRisingTrig_32_63(EXTI_InitStruct->Line_32_63); LL_EXTI_EnableFallingTrig_32_63(EXTI_InitStruct->Line_32_63); break; default: status = ERROR; break; } } } #endif } /* DISABLE LineCommand */ else { /* De-configure EXTI Lines in range from 0 to 31 */ LL_EXTI_DisableIT_0_31(EXTI_InitStruct->Line_0_31); LL_EXTI_DisableEvent_0_31(EXTI_InitStruct->Line_0_31); #if defined(EXTI_32_63_SUPPORT) /* De-configure EXTI Lines in range from 32 to 63 */ LL_EXTI_DisableIT_32_63(EXTI_InitStruct->Line_32_63); LL_EXTI_DisableEvent_32_63(EXTI_InitStruct->Line_32_63); #endif } return status; } /** * @brief Set each @ref LL_EXTI_InitTypeDef field to default value. * @param EXTI_InitStruct Pointer to a @ref LL_EXTI_InitTypeDef structure. * @retval None */ void LL_EXTI_StructInit(LL_EXTI_InitTypeDef *EXTI_InitStruct) { EXTI_InitStruct->Line_0_31 = LL_EXTI_LINE_NONE; #if defined(EXTI_32_63_SUPPORT) EXTI_InitStruct->Line_32_63 = LL_EXTI_LINE_NONE; #endif EXTI_InitStruct->LineCommand = DISABLE; EXTI_InitStruct->Mode = LL_EXTI_MODE_IT; EXTI_InitStruct->Trigger = LL_EXTI_TRIGGER_FALLING; } /** * @} */ /** * @} */ /** * @} */ #endif /* defined (EXTI) */ /** * @} */ #endif /* USE_FULL_LL_DRIVER */ /************************ (C) COPYRIGHT STMicroelectronics *****END OF FILE****/
the_stack_data/22066.c
#include<stdio.h> void main() { int i,j,k,l,n,x[100],p,q,r,a,b; printf("Enter the number of numbers to be entered : "); scanf("%d",&n); printf("Enter the %d numbers : ",n); for(i=1;i<=n;i++) { scanf("%d",&x[i]); } for(j=1;j<n;j++) { for(k=1;k<=(n-j);k++) { if(x[k]>x[k+1]) { a=x[k]; x[k]=x[k+1]; x[k+1]=a; } } } printf("The increasing order is :"); for(l=1;l<=n;l++) { printf("\t%d",x[l]); } for(p=1;p<n;p++) { for(q=1;q<=(n-p);q++) { if(x[q]<x[q+1]) { b=x[q]; x[q]=x[q+1]; x[q+1]=b; } } } printf("\nThe decreasing order is :"); for(r=1;r<=n;r++) { printf("\t%d",x[r]); } printf("\n"); } /* Enter the number of numbers to be entered : 5 Enter the 5 numbers : 23 67 45 13 7 The increasing order is : 7 13 23 45 67 The decreasing order is : 67 45 23 13 7 Enter the number of numbers to be entered : 7 Enter the 7 numbers : 25 345 213 999 2 13 23 The increasing order is : 2 13 23 25 213 345 999 The decreasing order is : 999 345 213 25 23 13 2 Enter the number of numbers to be entered : 6 Enter the 6 numbers : 23 234 123 567 999 0 The increasing order is : 0 23 123 234 567 999 The decreasing order is : 999 567 234 123 23 0 */
the_stack_data/198581421.c
#include "syscall.h" #include "stdio.h" #include "stdlib.h" int main(void) { int fileDes; fileDes = creat("testCreate.txt"); if(fileDes == -1) { printf("Error: Failed to create file"); return 1; } /* not reached */ }
the_stack_data/262478.c
/* * Copyright (c) 2021 Actility. All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions are met: * * 1. Redistributions of source code must retain the above copyright notice, * this list of conditions and the following disclaimer. * 2. Redistributions in binary form must reproduce the above copyright notice, * this list of conditions and the following disclaimer in the documentation * and/or other materials provided with the distribution. * 3. All advertising materials mentioning features or use of this software * must display the following acknowledgement: * This product includes software developed by ACTILITY. * 4. Neither the name of ACTILITY nor the names of its contributors may be * used to endorse or promote products derived from this software without * specific prior written permission. * * THIS SOFTWARE IS PROVIDED BY ACTILITY "AS IS" AND ANY EXPRESS OR IMPLIED * WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF * MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. * IN NO EVENT SHALL ACTILITY BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, * SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, * PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; * OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, * WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR * OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF * ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. */ /* * */ #include <stdio.h> #include <errno.h> #include <string.h> #include <sys/stat.h> #include <sys/types.h> static int _rtl_mkdir_(char *deb,char *fin) /* TS */ { char str[512]; int nb; strcpy(str,deb); str[fin-deb]=0; // TODO ... if(mkdir(str,0777)<0) { if(errno==EEXIST) { return 0; } if(errno!=ENOENT) { return -1; } for(fin--;fin>deb && *fin!='/';fin--); if(fin<=deb) { return -1; } if((nb=_rtl_mkdir_(deb,fin))<0) { return -1; } if(mkdir(str,0777)<0) { if(errno==EEXIST) return 0; return -1; } return nb+1; } return 1; } /* * * Cette fonction cree un repertoire et tous les repertoires * intermediaires, si possible. * * Le nombre de repertoire crees est retourne, ou '-1' si une * erreur survient. Dans ce cas, 'errno' contient le code * d'erreur (voir fonction systeme mkdir()). * */ int rtl_mkdirp(char *path) /* TS */ { return _rtl_mkdir_(path,path+strlen(path)); }
the_stack_data/22011964.c
#include<stdio.h> void main() { int r; printf("Enter the number of rows : "); scanf("%d",&r); for(int i=1;i<=r;i++) { for(int j=1;j<=i;j++) { printf("*"); } printf("\n"); } }
the_stack_data/11075829.c
#include <stdio.h> int main(void) { int x, y, z; scanf("%d", &x); printf("%d\n", x); /* same */ scanf(" %d", &x); printf("%d\n", x); scanf("%d-%d-%d", &x, &y, &z); printf("%d-%d-%d\n", x, y, z); /* same */ scanf("%d -%d -%d", &x, &y, &z); printf("%d-%d-%d\n", x, y, z); float j, k; scanf("%f", &j); printf("%f\n", j); /* 2nd one waits for a non whitespace character to end the scanf */ scanf("%f ", &j); printf("%f \n", j); scanf("%f,%f", &j, &k); printf("%f,%f \n", j, k); /* same */ scanf("%f, %f", &j, &k); printf("%f, %f \n", j, k); return 0; }
the_stack_data/151707021.c
#include <stdio.h> #include <string.h> #include <openssl/sha.h> #define LOG(fmt, ...) printf(fmt "\n", ##__VA_ARGS__) char* invalid_hashes[] = { "\x29\x41\x71\xdb\x6b\xce\x62\x7e\x2a\x08\xe8\x2f\x1e\x9e\x86\xa0\x57\x30\x6a\x63", "\xa1\x6c\xb2\xde\xcc\x5b\xd4\x10\x50\x70\xbd\xf8\xd4\xf7\xcd\x3a\x3e\x5c\x59\xf2", "\x94\x2a\x1a\xc3\x47\xe8\xbb\x5f\xf8\x81\x13\x3d\xd7\x74\x52\x1c\xbe\x00\x91\x02", "\x23\x98\x23\xe4\x75\x5f\x4f\x7e\x14\x46\x9f\x93\x78\xb9\xf3\xb2\x90\x36\x91\x8e", }; char* patch_hashes[] = { "\xe2\x48\x50\xe2\x01\x19\x72\x92\xbc\x42\x6e\x20\x91\xbf\x85\xdf\xf2\x57\xfb\x5f" }; int calc_hash(char* path, char hash[SHA_DIGEST_LENGTH]) { FILE* fp; int size; char buff[1024]; SHA_CTX ctx; SHA1_Init(&ctx); if ((fp = fopen(path, "r")) == NULL) { perror("fopen"); return 0; } while ((size = fread(buff, 1, sizeof(buff), fp)) != 0) { SHA1_Update(&ctx, buff, size); } fclose(fp); SHA1_Final(hash, &ctx); return 1; } int check_if_virus(char* path) { int i; char hash[SHA_DIGEST_LENGTH] = {0}; LOG("validating %s", path); if (!calc_hash(path, hash)) { return 0; } LOG("finalizing hash"); for (i = 0; i < sizeof(invalid_hashes) / sizeof(invalid_hashes[0]); i++) { if (memcmp(hash, invalid_hashes[i], sizeof(hash)) == 0) { return 1; } } return 0; } int check_if_live_patch(char* path) { int i; char hash[SHA_DIGEST_LENGTH] = {0}; if (!calc_hash(path, hash)) { return 0; } for (i = 0; i < sizeof(patch_hashes) / sizeof(patch_hashes[0]); i++) { if (memcmp(hash, patch_hashes[i], sizeof(hash)) == 0) { return 1; } } return 0; }
the_stack_data/1173140.c
#include <stdio.h> #ifndef TRIDENT_OUTPUT #define TRIDENT_OUTPUT(id, typestr, value) value #endif int main(int argc, char *argv[]) { char buffer[10]; char *filepath = argv[1]; FILE *fp = fopen(filepath, "r"); fread(buffer,sizeof(int),1,fp); fclose(fp); int y = buffer[0] - 48; if (__trident_choice("L9", "bool", (int[]){y}, (char*[]){"x"}, 1, (int*[]){}, (char*[]){}, 0)) return -1; TRIDENT_OUTPUT("obs", "i32", y); int res = 100 /y; return 0; }
the_stack_data/429351.c
#include<stdio.h> int main(){ FILE *output_file; output_file = fopen("Bengali.txt", "w"); int i; char input[1000]; for(i=1;i<=10;i++){ gets(input); fputs(input,output_file); fprintf(output_file,"\n"); } fclose(output_file); return 0; }
the_stack_data/128884.c
/* * POK header * * The following file is a part of the POK project. Any modification should * made according to the POK licence. You CANNOT use this file or a part of * this file is this part of a file for your own project * * For more information on the POK licence, please see our LICENCE FILE * * Please follow the coding guidelines described in doc/CODING_GUIDELINES * * Copyright (c) 2007-2009 POK team * * Created by julien on Fri Jan 30 14:41:34 2009 */ /* e_rem_pio2f.c -- float version of e_rem_pio2.c * Conversion to float by Ian Lance Taylor, Cygnus Support, [email protected]. */ /* * ==================================================== * Copyright (C) 1993 by Sun Microsystems, Inc. All rights reserved. * * Developed at SunPro, a Sun Microsystems, Inc. business. * Permission to use, copy, modify, and distribute this * software is freely granted, provided that this notice * is preserved. * ==================================================== */ /* __ieee754_rem_pio2f(x,y) * * return the remainder of x rem pi/2 in y[0]+y[1] * use __kernel_rem_pio2f() */ #ifdef POK_NEEDS_LIBMATH #include <libm.h> #include "math_private.h" /* * Table of constants for 2/pi, 396 Hex digits (476 decimal) of 2/pi */ static const int32_t two_over_pi[] = { 0xA2, 0xF9, 0x83, 0x6E, 0x4E, 0x44, 0x15, 0x29, 0xFC, 0x27, 0x57, 0xD1, 0xF5, 0x34, 0xDD, 0xC0, 0xDB, 0x62, 0x95, 0x99, 0x3C, 0x43, 0x90, 0x41, 0xFE, 0x51, 0x63, 0xAB, 0xDE, 0xBB, 0xC5, 0x61, 0xB7, 0x24, 0x6E, 0x3A, 0x42, 0x4D, 0xD2, 0xE0, 0x06, 0x49, 0x2E, 0xEA, 0x09, 0xD1, 0x92, 0x1C, 0xFE, 0x1D, 0xEB, 0x1C, 0xB1, 0x29, 0xA7, 0x3E, 0xE8, 0x82, 0x35, 0xF5, 0x2E, 0xBB, 0x44, 0x84, 0xE9, 0x9C, 0x70, 0x26, 0xB4, 0x5F, 0x7E, 0x41, 0x39, 0x91, 0xD6, 0x39, 0x83, 0x53, 0x39, 0xF4, 0x9C, 0x84, 0x5F, 0x8B, 0xBD, 0xF9, 0x28, 0x3B, 0x1F, 0xF8, 0x97, 0xFF, 0xDE, 0x05, 0x98, 0x0F, 0xEF, 0x2F, 0x11, 0x8B, 0x5A, 0x0A, 0x6D, 0x1F, 0x6D, 0x36, 0x7E, 0xCF, 0x27, 0xCB, 0x09, 0xB7, 0x4F, 0x46, 0x3F, 0x66, 0x9E, 0x5F, 0xEA, 0x2D, 0x75, 0x27, 0xBA, 0xC7, 0xEB, 0xE5, 0xF1, 0x7B, 0x3D, 0x07, 0x39, 0xF7, 0x8A, 0x52, 0x92, 0xEA, 0x6B, 0xFB, 0x5F, 0xB1, 0x1F, 0x8D, 0x5D, 0x08, 0x56, 0x03, 0x30, 0x46, 0xFC, 0x7B, 0x6B, 0xAB, 0xF0, 0xCF, 0xBC, 0x20, 0x9A, 0xF4, 0x36, 0x1D, 0xA9, 0xE3, 0x91, 0x61, 0x5E, 0xE6, 0x1B, 0x08, 0x65, 0x99, 0x85, 0x5F, 0x14, 0xA0, 0x68, 0x40, 0x8D, 0xFF, 0xD8, 0x80, 0x4D, 0x73, 0x27, 0x31, 0x06, 0x06, 0x15, 0x56, 0xCA, 0x73, 0xA8, 0xC9, 0x60, 0xE2, 0x7B, 0xC0, 0x8C, 0x6B, }; /* This array is like the one in e_rem_pio2.c, but the numbers are single precision and the last 8 bits are forced to 0. */ static const int32_t npio2_hw[] = {0x3fc90f00, 0x40490f00, 0x4096cb00, 0x40c90f00, 0x40fb5300, 0x4116cb00, 0x412fed00, 0x41490f00, 0x41623100, 0x417b5300, 0x418a3a00, 0x4196cb00, 0x41a35c00, 0x41afed00, 0x41bc7e00, 0x41c90f00, 0x41d5a000, 0x41e23100, 0x41eec200, 0x41fb5300, 0x4203f200, 0x420a3a00, 0x42108300, 0x4216cb00, 0x421d1400, 0x42235c00, 0x4229a500, 0x422fed00, 0x42363600, 0x423c7e00, 0x4242c700, 0x42490f00}; /* * invpio2: 24 bits of 2/pi * pio2_1: first 17 bit of pi/2 * pio2_1t: pi/2 - pio2_1 * pio2_2: second 17 bit of pi/2 * pio2_2t: pi/2 - (pio2_1+pio2_2) * pio2_3: third 17 bit of pi/2 * pio2_3t: pi/2 - (pio2_1+pio2_2+pio2_3) */ static const float zero = 0.0000000000e+00, /* 0x00000000 */ half = 5.0000000000e-01, /* 0x3f000000 */ two8 = 2.5600000000e+02, /* 0x43800000 */ invpio2 = 6.3661980629e-01, /* 0x3f22f984 */ pio2_1 = 1.5707855225e+00, /* 0x3fc90f80 */ pio2_1t = 1.0804334124e-05, /* 0x37354443 */ pio2_2 = 1.0804273188e-05, /* 0x37354400 */ pio2_2t = 6.0770999344e-11, /* 0x2e85a308 */ pio2_3 = 6.0770943833e-11, /* 0x2e85a300 */ pio2_3t = 6.1232342629e-17; /* 0x248d3132 */ int32_t __ieee754_rem_pio2f(float x, float *y) { float z, w, t, r, fn; float tx[3]; int32_t e0, i, j, nx, n, ix, hx; GET_FLOAT_WORD(hx, x); ix = hx & 0x7fffffff; if (ix <= 0x3f490fd8) /* |x| ~<= pi/4 , no need for reduction */ { y[0] = x; y[1] = 0; return 0; } if (ix < 0x4016cbe4) { /* |x| < 3pi/4, special case with n=+-1 */ if (hx > 0) { z = x - pio2_1; if ((ix & 0xfffffff0) != 0x3fc90fd0) { /* 24+24 bit pi OK */ y[0] = z - pio2_1t; y[1] = (z - y[0]) - pio2_1t; } else { /* near pi/2, use 24+24+24 bit pi */ z -= pio2_2; y[0] = z - pio2_2t; y[1] = (z - y[0]) - pio2_2t; } return 1; } else { /* negative x */ z = x + pio2_1; if ((ix & 0xfffffff0) != 0x3fc90fd0) { /* 24+24 bit pi OK */ y[0] = z + pio2_1t; y[1] = (z - y[0]) + pio2_1t; } else { /* near pi/2, use 24+24+24 bit pi */ z += pio2_2; y[0] = z + pio2_2t; y[1] = (z - y[0]) + pio2_2t; } return -1; } } if (ix <= 0x43490f80) { /* |x| ~<= 2^7*(pi/2), medium size */ t = fabsf(x); n = (int32_t)(t * invpio2 + half); fn = (float)n; r = t - fn * pio2_1; w = fn * pio2_1t; /* 1st round good to 40 bit */ if (n < 32 && (int32_t)(ix & 0xffffff00) != npio2_hw[n - 1]) { y[0] = r - w; /* quick check no cancellation */ } else { uint32_t high; j = ix >> 23; y[0] = r - w; GET_FLOAT_WORD(high, y[0]); i = j - ((high >> 23) & 0xff); if (i > 8) { /* 2nd iteration needed, good to 57 */ t = r; w = fn * pio2_2; r = t - w; w = fn * pio2_2t - ((t - r) - w); y[0] = r - w; GET_FLOAT_WORD(high, y[0]); i = j - ((high >> 23) & 0xff); if (i > 25) { /* 3rd iteration need, 74 bits acc */ t = r; /* will cover all possible cases */ w = fn * pio2_3; r = t - w; w = fn * pio2_3t - ((t - r) - w); y[0] = r - w; } } } y[1] = (r - y[0]) - w; if (hx < 0) { y[0] = -y[0]; y[1] = -y[1]; return -n; } else return n; } /* * all other (large) arguments */ if (ix >= 0x7f800000) { /* x is inf or NaN */ y[0] = y[1] = x - x; return 0; } /* set z = scalbn(|x|,ilogb(x)-7) */ e0 = (ix >> 23) - 134; /* e0 = ilogb(z)-7; */ SET_FLOAT_WORD(z, ix - ((int32_t)(e0 << 23))); for (i = 0; i < 2; i++) { tx[i] = (float)((int32_t)(z)); z = (z - tx[i]) * two8; } tx[2] = z; nx = 3; while (tx[nx - 1] == zero) nx--; /* skip zero term */ n = __kernel_rem_pio2f(tx, y, e0, nx, 2, (int *)two_over_pi); if (hx < 0) { y[0] = -y[0]; y[1] = -y[1]; return -n; } return n; } #endif
the_stack_data/182951881.c
#define _GNU_SOURCE #include <stdio.h> #include <stdlib.h> #include <wordexp.h> #include <unistd.h> #include <sys/wait.h> #include <string.h> // #include "Shell.h" #define TRUE 1 void type_prompt() { printf("\ncommand: "); } char *read_command() { char *line = NULL; size_t n = 0; ssize_t result = getline(&line, &n, stdin); line[result - 1] = '\0'; return line; } void debug_print_command(char *str) { printf("%s", str); } int main() { char *command; wordexp_t p; int status; extern char **environ; while (TRUE) { type_prompt(); command = read_command(); // debug_print_command(command); wordexp(command, &p, 0); if (strcmp(p.we_wordv[0], "cd") != 0) { pid_t pid; pid = fork(); if (pid == -1) { printf("\nFail."); break; } else if (pid == 0) { execvpe(p.we_wordv[0], p.we_wordv, environ); printf("%s: I can't recognize this command.\n", p.we_wordv[0]); exit(EXIT_FAILURE); } else { int status; waitpid(pid, &status, 0); } } else { chdir(p.we_wordv[1]); } free(command); wordfree(&p); } return 0; }
the_stack_data/48777.c
#include <strings.h> #include <stdlib.h> #include <stdio.h> void *ft_memset(void *b, int c, size_t len); int main(int argc, char **argv) { int i; if (argc == 4) { i = atoi(argv[1]); if (i == 0) { printf("%s", argv[3]); argv[3] = ft_memset(argv[3], atoi(argv[2]), strlen(argv[3])); printf("%s", argv[3]); } else if (i == 1) { printf("%s", argv[3]); argv[3] = ft_memset(argv[3], atoi(argv[2]), 2); printf("%s", argv[3]); } } return (0); }
the_stack_data/300094.c
// // UVA 100 The 3n+1 problem // Source: 100_the_3n_plus_1_problem.c // URL: http://uva.onlinejudge.org/index.php?option=com_onlinejudge&Itemid=8&page=show_problem&problem=36 // // Created by Lorenzo Blasa on 22/11/2014. // // Permission is hereby granted, free of charge, to any person obtaining a copy // of this software and associated documentation files (the "Software"), to deal // in the Software without restriction, including without limitation the rights // to use, copy, modify, merge, publish, distribute, sublicense, and/or sell // copies of the Software, and to permit persons to whom the Software is // furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall be included in // all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR // IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, // FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE // AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER // LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, // OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN // THE SOFTWARE. #include <stdio.h> #include <stdlib.h> #define kN_MAX 1000000 int cache[kN_MAX]; int algorithm(int n) { int length = 0; while (n != 1) { if (n % 2 != 0) { n = 3*n+1; } else { n /= 2; } length++; } return ++length; } int main() { int i, j; while (scanf("%i %i", &i, &j) != EOF) { int start = i; int end = j; if (end < start) { int temp = start; start = end; end = temp; } int max = -1; for (int k = start; k <= end; k++) { int value = cache[k]; if (!value) { value = algorithm(k); cache[k] = value; } if (value > max) { max = value; } } printf("%i %i %i\n", i, j, max); } return 0; }
the_stack_data/22013437.c
/* ************************************************************************** */ /* */ /* ::: :::::::: */ /* ft_is_prime.c :+: :+: :+: */ /* +:+ +:+ +:+ */ /* By: odursun <42istanbul.com.tr> +#+ +:+ +#+ */ /* +#+#+#+#+#+ +#+ */ /* Created: 2021/11/12 12:47:53 by odursun #+# #+# */ /* Updated: 2021/11/12 16:48:59 by odursun ### ########.tr */ /* */ /* ************************************************************************** */ int ft_is_prime(int nb) { int n; n = 2; if (nb < 2) return (0); while (n <= nb / 2) { if (nb % n == 0) return (0); n++; } return (1); } /* #include <stdio.h> int main(void) { printf("-10 = %d (0)\n", ft_is_prime(-10)); printf("-1 = %d (0)\n", ft_is_prime(-1)); printf(" 0 = %d (0)\n", ft_is_prime(0)); printf(" 1 = %d (0)\n", ft_is_prime(1)); printf(" 2 = %d (1)\n", ft_is_prime(2)); printf(" 3 = %d (1)\n", ft_is_prime(3)); printf(" 4 = %d (0)\n", ft_is_prime(4)); printf(" 5 = %d (1)\n", ft_is_prime(5)); printf(" 6 = %d (0)\n", ft_is_prime(6)); printf(" 7 = %d (1)\n", ft_is_prime(7)); printf(" 8 = %d (0)\n", ft_is_prime(8)); printf(" 9 = %d (0)\n", ft_is_prime(9)); printf(" 10 = %d (0)\n", ft_is_prime(10)); printf(" 11 = %d (1)\n", ft_is_prime(11)); }*/
the_stack_data/93888039.c
/* * Copyright 2012-2014 Google Inc. All rights reserved. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ #ifndef _LARGEFILE64_SOURCE #define _LARGEFILE64_SOURCE #endif #define __STDC_FORMAT_MACROS #include <assert.h> #include <errno.h> #include <fcntl.h> #include <inttypes.h> #include <stdio.h> #include <stdint.h> #include <stdlib.h> #include <string.h> #include <sys/types.h> #include <sys/stat.h> #include <sys/wait.h> #include <time.h> #include <unistd.h> #ifdef mips #include <sys/cachectl.h> #define CACHEFLUSH(p, l, f) cacheflush(p, l, f) #else #define CACHEFLUSH(p, l, f) #endif #define BYTES_PER_LINE 32 #define HONEYPOTPAGES 256 #define LINESIZ 64 #define PFN_BITS 55 uint8_t *honeypot = NULL; size_t honeypotsize = 0; long pagesize = 0; int pagemap_fd = -1; int kpagecount_fd = -1; int kpageflags_fd = -1; void initialize_memory(uint8_t *honeypot, unsigned int seed) { unsigned int i; srand(seed); for (i = 0; i < honeypotsize; ++i) { honeypot[i] = (rand() & 0xff); } } void log_page(uint8_t *mem, int len) { int i; for (i = 0; i < len; ++i) { printf("%02x ", mem[i]); if ((i % BYTES_PER_LINE) == (BYTES_PER_LINE - 1)) printf("\n"); } if ((len % BYTES_PER_LINE) != (BYTES_PER_LINE - 1)) printf("\n"); } off64_t get_proc_offset(void *addr) { unsigned long long vpfn = (unsigned long)addr / pagesize; off64_t off = vpfn * sizeof(unsigned long long); return off; } uint64_t get_pagemap(void *addr) { off64_t roff, off = get_proc_offset(addr); ssize_t rlen; uint64_t pagemap; roff = lseek64(pagemap_fd, off, SEEK_SET); assert(roff == off); rlen = read(pagemap_fd, &pagemap, sizeof(pagemap)); assert(rlen == sizeof(pagemap)); return pagemap; } uint64_t get_kpagecount(uint64_t pfn) { off64_t roff, off = pfn * sizeof(uint64_t); ssize_t rlen; uint64_t kpagecount; roff = lseek64(kpagecount_fd, off, SEEK_SET); assert(roff == off); rlen = read(kpagecount_fd, &kpagecount, sizeof(kpagecount)); assert(rlen == sizeof(kpagecount)); return kpagecount; } uint64_t get_kpageflags(uint64_t pfn) { off64_t roff, off = pfn * sizeof(uint64_t); ssize_t rlen; uint64_t kpageflags; roff = lseek64(kpageflags_fd, off, SEEK_SET); assert(roff == off); rlen = read(kpageflags_fd, &kpageflags, sizeof(kpageflags)); assert(rlen == sizeof(kpageflags)); return kpageflags; } void log_page_difference(uint8_t *honeypot, uint8_t *expected, int len, unsigned int seed, int is_child) { uint64_t pagemap; uint64_t pfn; if (!is_child) { printf("Unexpected memory difference detected in parent, len=%d, " "seed=0x%08x\n", len, seed); } else { printf("Unexpected memory difference detected in child, len=%d, " "seed=0x%08x\n", len, seed); } pagemap = get_pagemap(expected); pfn = pagemap & ((1ULL << PFN_BITS) - 1); printf("Expected: %p pm=0x%" PRIx64 " kc=0x%" PRIx64 " kf=0x%" PRIx64 "\n", expected, pagemap, get_kpagecount(pfn), get_kpageflags(pfn)); log_page(expected, len); pagemap = get_pagemap(honeypot); pfn = pagemap & ((1ULL << PFN_BITS) - 1); printf("Actual: %p pm=0x%" PRIx64 " kc=0x%" PRIx64 " kf=0x%" PRIx64 "\n", honeypot, pagemap, get_kpagecount(pfn), get_kpageflags(pfn)); log_page(honeypot, len); fflush(stdout); } void check_memory(uint8_t *honeypot, unsigned int seed, int is_child) { uint8_t *expected = malloc(honeypotsize); unsigned int i; long j; initialize_memory(expected, seed); for (i = 0; i < honeypotsize; i += pagesize) { int start = -1, end = -1; for (j = 0; j < pagesize; ++j) { if (honeypot[i+j] != expected[i+j]) { if (start < 0) start = i+j; end = i+j; } } if (start != -1) { int len = end - start + 1; log_page_difference(honeypot + start, expected + start, len, seed, is_child); // flush cache and log it again. CACHEFLUSH(honeypot + start, len, DCACHE); CACHEFLUSH(expected + start, len, DCACHE); log_page_difference(honeypot + start, expected + start, len, seed, is_child); // And finally regenerate the expected and log it again. initialize_memory(expected, seed); log_page_difference(honeypot + start, expected + start, len, seed, is_child); } } free(expected); } void corrupt_memory(uint8_t *honeypot) { if ((rand() % 8) == 0) { int offset, len, i; offset = rand() % honeypotsize; len = rand() % 128; printf("Test mode corrupting bytes off=%d, len=%d\n", offset, len); for (i = 0; i < len; ++i) { honeypot[offset + i] ^= rand(); } } } void usage(char *progname) { printf("usage: %s [-t] [-m #pages] [-s sleeptime]\n", progname); printf("\t-t\ttest mode, deliberately introduce random corruption.\n"); printf("\t-m\tmemory to monitor, in megabytes\n"); printf("\t-s\tnumber of seconds to sleep before checking for corruption\n"); exit(1); } int main(int argc, char **argv) { size_t honeypotpages = HONEYPOTPAGES; int testmode = 0; int sleeptime = -1; int rc, c; pagesize = sysconf(_SC_PAGESIZE); assert(pagesize > 0); pagemap_fd = open("/proc/self/pagemap", O_RDONLY); assert(pagemap_fd >= 0); kpagecount_fd = open("/proc/kpagecount", O_RDONLY); assert(kpagecount_fd >= 0); kpageflags_fd = open("/proc/kpageflags", O_RDONLY); assert(kpageflags_fd >= 0); while ((c = getopt(argc, argv, "tm:s:")) != -1) { switch(c) { case 't': testmode = 1; break; case 'm': { ssize_t mbytes = atoi(optarg) * 1024 * 1024; ssize_t pages = mbytes / pagesize; honeypotpages = (pages > 0) ? pages : 1; // -m 0 == minimum memory break; } case 's': sleeptime = atoi(optarg); break; default: usage(argv[0]); break; } } if (sleeptime < 0) { sleeptime = testmode ? 2 : 600; } honeypotsize = honeypotpages * pagesize; printf ("Monitoring %zu bytes every %d seconds\n", honeypotsize, sleeptime); rc = posix_memalign((void **)&honeypot, pagesize, honeypotsize); assert(rc == 0); // Initialize to 0 to force on demand paging for the honeypot. // If the honeypot is not mapped into memory, then no copy on write // will happen for the first fork. memset(honeypot, 0, honeypotsize); while (1) { // Reinitialize on each loop. We only want to log corruption once. unsigned int seed; pid_t child_pid = fork(); int is_child = child_pid == 0; if (child_pid == -1) { perror("Error forking"); } else if (child_pid == 0) { close(pagemap_fd); // close the pagemap fd inherited from the parent pagemap_fd = open("/proc/self/pagemap", O_RDONLY); assert(pagemap_fd >= 0); } seed = time(NULL) + child_pid; initialize_memory(honeypot, seed); CACHEFLUSH(honeypot, honeypotsize, DCACHE); check_memory(honeypot, seed, is_child); sleep(sleeptime); if (testmode) corrupt_memory(honeypot); check_memory(honeypot, seed, is_child); if (child_pid == 0) { exit(0); } wait(NULL); } }
the_stack_data/20449007.c
#include <unistd.h> void ft_div_mod(int a, int b, int *div, int *mod) { *div = a / b; *mod = a % b; }
the_stack_data/650481.c
/* * Copyright (c) 2016-2020 Marco Hladik <[email protected]> * * Permission to use, copy, modify, and distribute this software for any * purpose with or without fee is hereby granted, provided that the above * copyright notice and this permission notice appear in all copies. * * THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES * WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF * MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR * ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES * WHATSOEVER RESULTING FROM LOSS OF MIND, USE, DATA OR PROFITS, WHETHER * IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING * OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. */ void menu_addserver_init(void) { } void menu_addserver_draw(void) { } void menu_addserver_input(float evtype, float scanx, float chary, float devid) { }
the_stack_data/18888174.c
/* ************************************************************************** */ /* */ /* ::: :::::::: */ /* ft_find_next_prime.c :+: :+: :+: */ /* +:+ +:+ +:+ */ /* By: lyuri-go <[email protected]> +#+ +:+ +#+ */ /* +#+#+#+#+#+ +#+ */ /* Created: 2021/04/13 19:54:07 by lyuri-go #+# #+# */ /* Updated: 2021/04/14 12:04:41 by lyuri-go ### ########.fr */ /* */ /* ************************************************************************** */ int ft_is_prime(int nb) { int count; if (nb == 2 || nb == 3) return (1); else if (nb < 2 || nb % 2 == 0 || nb % 3 == 0) return (0); count = 5; while (count * count <= nb) { if (nb % count == 0 || nb % (count + 2) == 0) return (0); count += 6; } return (1); } int ft_find_next_prime(int nb) { if (nb > 2147483629) return (2147483647); while (!ft_is_prime(nb) && nb < 2147483647) nb++; return (nb); }
the_stack_data/215769352.c
#include <stdio.h> #include <stdlib.h> int main(){ int a = 2; int *ptr; ptr=&a; int **p; p=&ptr; printf("Address: %p\n",ptr); printf("Value: %d\n",*ptr); printf("Address: %p\n",&a); printf("Address: %p\n",p); printf("Value: %d\n",**p); return 0; }
the_stack_data/337688.c
int main(int argc, char** argv) { }
the_stack_data/82949899.c
/*************************************************************************/ /* */ /* SNU-RT Benchmark Suite for Worst Case Timing Analysis */ /* ===================================================== */ /* Collected and Modified by S.-S. Lim */ /* [email protected] */ /* Real-Time Research Group */ /* Seoul National University */ /* */ /* */ /* < Features > - restrictions for our experimental environment */ /* */ /* 1. Completely structured. */ /* - There are no unconditional jumps. */ /* - There are no exit from loop bodies. */ /* (There are no 'break' or 'return' in loop bodies) */ /* 2. No 'switch' statements. */ /* 3. No 'do..while' statements. */ /* 4. Expressions are restricted. */ /* - There are no multiple expressions joined by 'or', */ /* 'and' operations. */ /* 5. No library calls. */ /* - All the functions needed are implemented in the */ /* source file. */ /* */ /* */ /*************************************************************************/ /* */ /* FILE: bs.c */ /* SOURCE : Public Domain Code */ /* */ /* DESCRIPTION : */ /* */ /* Binary search for the array of 15 integer elements. */ /* */ /* REMARK : */ /* */ /* EXECUTION TIME : */ /* */ /* */ /*************************************************************************/ struct DATA { int key; int value; } ; #ifdef DEBUG int cnt1; #endif struct DATA data[15] = { {1, 100}, {5,200}, {6, 300}, {7, 700}, {8, 900}, {9, 250}, {10, 400}, {11, 600}, {12, 800}, {13, 1500}, {14, 1200}, {15, 110}, {16, 140}, {17, 133}, {18, 10} }; main() { binary_search(8); } binary_search(x) { int fvalue, mid, up, low ; low = 0; up = 14; fvalue = -1 /* all data are positive */ ; while (low <= up) { mid = (low + up) >> 1; if ( data[mid].key == x ) { /* found */ up = low - 1; fvalue = data[mid].value; #ifdef DEBUG printf("FOUND!!\n"); #endif } else /* not found */ if ( data[mid].key > x ) { up = mid - 1; #ifdef DEBUG printf("MID-1\n"); #endif } else { low = mid + 1; #ifdef DEBUG printf("MID+1\n"); #endif } #ifdef DEBUG cnt1++; #endif } #ifdef DEBUG printf("Loop Count : %d\n", cnt1); #endif return fvalue; }
the_stack_data/76701099.c
/* This testcase is part of GDB, the GNU debugger. Copyright 2012-2016 Free Software Foundation, Inc. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ extern int libfunc (void); int main (void) { libfunc (); return 0; }
the_stack_data/18887162.c
/* FluidSynth - A Software Synthesizer * * Copyright (C) 2003 Peter Hanappe and others. * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Library General Public License * as published by the Free Software Foundation; either version 2 of * the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Library General Public License for more details. * * You should have received a copy of the GNU Library General Public * License along with this library; if not, write to the Free * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA * 02111-1307, USA */ #ifdef WIN32 #include <windows.h> #include "fluidsynth_priv.h" #include "fluid_sys.h" static HINSTANCE fluid_hinstance = NULL; static HWND fluid_wnd = NULL; int fluid_win32_create_window(void); #ifndef FLUIDSYNTH_NOT_A_DLL BOOL WINAPI DllMain(HANDLE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { FLUID_LOG(FLUID_DBG, "DllMain"); fluid_set_hinstance((void*) hModule); fluid_win32_create_window(); return TRUE; } #endif void fluid_set_hinstance(void* hinstance) { if (fluid_hinstance == NULL) { fluid_hinstance = (HINSTANCE) hinstance; FLUID_LOG(FLUID_DBG, "DLL instance = %d", (int) fluid_hinstance); } } void* fluid_get_hinstance(void) { return (void*) fluid_hinstance; } static long FAR PASCAL fluid_win32_wndproc(HWND hWnd, UINT message, WPARAM wParam, LPARAM lParam) { switch (message) { case WM_CREATE: break; case WM_DESTROY: break; default: return DefWindowProc(hWnd, message, wParam, lParam); break; } return(0L); } int fluid_win32_create_window(void) { WNDCLASS myClass; myClass.hCursor = LoadCursor( NULL, IDC_ARROW ); myClass.hIcon = NULL; myClass.lpszMenuName = (LPSTR) NULL; myClass.lpszClassName = (LPSTR) "FluidSynth"; myClass.hbrBackground = (HBRUSH)(COLOR_WINDOW); myClass.hInstance = fluid_hinstance; myClass.style = CS_GLOBALCLASS; myClass.lpfnWndProc = fluid_win32_wndproc; myClass.cbClsExtra = 0; myClass.cbWndExtra = 0; if (!RegisterClass(&myClass)) { return -100; } fluid_wnd = CreateWindow((LPSTR) "FluidSynth", (LPSTR) "FluidSynth", WS_OVERLAPPEDWINDOW, CW_USEDEFAULT, CW_USEDEFAULT, 400, 300, (HWND) NULL, (HMENU) NULL, fluid_hinstance, (LPSTR) NULL); if (fluid_wnd == NULL) { FLUID_LOG(FLUID_ERR, "Can't create window"); return -101; } return 0; } HWND fluid_win32_get_window(void) { return fluid_wnd; } #endif // #ifdef WIN32
the_stack_data/243894319.c
#include <stdio.h> int main(void){ int integerVar = 100; float floatingVar = 331.79; double doubleVar = 8.44e+11; char charVar = 'w'; _Bool boolVar = 0; printf("integerVar = %i\n",integerVar); printf("floatingVar = %f\n", floatingVar); printf("doubleVar = %e\n",doubleVar); printf("doubleVar = %g\n",doubleVar); printf("charVar = %c\n",charVar); printf("boolVar = %i\n", boolVar); return 0; }
the_stack_data/151014.c
#include <stdio.h> #include <stdlib.h> #include <string.h> struct occurance_t{ long int hash_sum; unsigned short int a; }; long hash(char*); int main(){ char word[200]; unsigned short int i, k, b = 0, size = 1; struct occurance_t broi[3000]; memset(broi, 0, sizeof(broi)); memset(word, 0, sizeof(word)); do{ scanf("%s", word); for(k = 0; k < size; k++){ if(broi[k].hash_sum == hash(word)){ broi[k].a++; break; } else continue; } if(k == size){ broi[k].hash_sum = hash(word); broi[k].a = 1; size++; } }while(strcmp(word, "vsmisal") != 0); for(i = 0; i < size; i++) if(broi[i].a > b) b = i; printf("%d %ld", broi[b].a, broi[b].hash_sum); return 0; } long hash(char *word){ long int a = 42; int i; for(i = 0; i < strlen(word); i++){ a += (word[i] * (i + 1)); } return a; }
the_stack_data/336500.c
#ifndef STACK_C #define STACK_C #include <stdlib.h> #include <stdbool.h> void *my_malloc(int n) { void *result = malloc(n); if (result == NULL) { printf("malloc memory failed!\n"); exit(EXIT_FAILURE); } return result; } // 栈的链表实现 typedef struct stackNode { int value; struct stackNode *next; } stackNode; typedef struct stackHead { stackNode *head; } stackHead; stackHead *make_stack() { stackHead *result = my_malloc(sizeof(*result)); result->head = NULL; return result; } bool stack_is_empty(stackHead *h) { return h->head == NULL; } stackNode *pop(stackHead *h) { if (stack_is_empty(h)) return NULL; stackNode *result = h->head; h->head = h->head->next; return result; } void push(stackHead *h, int value) { stackNode *node = my_malloc(sizeof(*node)); node->value = value; node->next = h->head; h->head = node; } #endif
the_stack_data/924977.c
#include <stdio.h> #include <stdlib.h> int main() { printf("\tBMEN 2980\n"); printf("\n"); printf("C coding. %.2f weeks to go\n", 4.95); printf("Until MATLAB 2017b\n"); printf("\tEnd Transmission\n"); return 0; }
the_stack_data/610993.c
int main() { int b = 0; return 0; }
the_stack_data/34511814.c
#include <stdio.h> #include <stdlib.h> int* sortByUsingInsertSort(int* array,int len); int main() { printf("------\n"); int len=100; int* array=malloc(len*sizeof(int)); for(int x=0; x<len; x++) { array[x]=rand()%len; } printf("length:%d\n",len); for(int x=0; x<len; x++) { printf("%d\n",array[x]); } //len=4; int* after_sorted=sortByUsingInsertSort(array,len); printf("%s","---result---\n"); for(int x=0; x<len; x++) { printf("%d\n",after_sorted[x]); } free(after_sorted); free(array); printf("%s","free memory\n"); while(1); return 0; }
the_stack_data/76700311.c
// Copyright 2013 Google Inc. All Rights Reserved. // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. #include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> #include <pthread.h> #define MAX_STRING 200 #define EXP_TABLE_SIZE 1000 #define MAX_EXP 6 #define MAX_SENTENCE_LENGTH 1000 #define MAX_CODE_LENGTH 40 const int vocab_hash_size = 30000000; // Maximum 30 * 0.7 = 21M words in the vocabulary typedef float real; // Precision of float numbers struct vocab_word { long long cn; int *point; char *word, *code, codelen; }; char train_file[MAX_STRING], output_file[MAX_STRING]; char tarOutput_file[MAX_STRING]; char save_vocab_file[MAX_STRING], read_vocab_file[MAX_STRING]; struct vocab_word *vocab; int binary = 0, cbow = 1, debug_mode = 2, window = 5, min_count = 5, num_threads = 12, min_reduce = 1; int *vocab_hash; long long vocab_max_size = 1000, vocab_size = 0, layer1_size = 100; long long train_words = 0, word_count_actual = 0, iter = 5, file_size = 0, classes = 0; real alpha = 0.025, starting_alpha, sample = 1e-3; real *syn0, *syn1, *syn1neg, *expTable; clock_t start; int hs = 0, negative = 5; const int table_size = 1e8; int *table; real lambda = 0.0001; real lambda2 = 0.0001; void InitUnigramTable() { int a, i; long long train_words_pow = 0; real d1, power = 0.75; table = (int *)malloc(table_size * sizeof(int)); for (a = 0; a < vocab_size; a++) train_words_pow += pow(vocab[a].cn, power); i = 0; d1 = pow(vocab[i].cn, power) / (real)train_words_pow; for (a = 0; a < table_size; a++) { table[a] = i; if (a / (real)table_size > d1) { i++; d1 += pow(vocab[i].cn, power) / (real)train_words_pow; } if (i >= vocab_size) i = vocab_size - 1; } } // Reads a single word from a file, assuming space + tab + EOL to be word boundaries void ReadWord(char *word, FILE *fin) { int a = 0, ch; while (!feof(fin)) { ch = fgetc(fin); if (ch == 13) continue; if ((ch == ' ') || (ch == '\t') || (ch == '\n')) { if (a > 0) { if (ch == '\n') ungetc(ch, fin); break; } if (ch == '\n') { strcpy(word, (char *)"</s>"); return; } else continue; } word[a] = ch; a++; if (a >= MAX_STRING - 1) a--; // Truncate too long words } word[a] = 0; } // Returns hash value of a word int GetWordHash(char *word) { unsigned long long a, hash = 0; for (a = 0; a < strlen(word); a++) hash = hash * 257 + word[a]; hash = hash % vocab_hash_size; return hash; } // Returns position of a word in the vocabulary; if the word is not found, returns -1 int SearchVocab(char *word) { unsigned int hash = GetWordHash(word); while (1) { if (vocab_hash[hash] == -1) return -1; if (!strcmp(word, vocab[vocab_hash[hash]].word)) return vocab_hash[hash]; hash = (hash + 1) % vocab_hash_size; } return -1; } // Reads a word and returns its index in the vocabulary int ReadWordIndex(FILE *fin) { char word[MAX_STRING]; ReadWord(word, fin); if (feof(fin)) return -1; return SearchVocab(word); } // Adds a word to the vocabulary int AddWordToVocab(char *word) { unsigned int hash, length = strlen(word) + 1; if (length > MAX_STRING) length = MAX_STRING; vocab[vocab_size].word = (char *)calloc(length, sizeof(char)); strcpy(vocab[vocab_size].word, word); vocab[vocab_size].cn = 0; vocab_size++; // Reallocate memory if needed if (vocab_size + 2 >= vocab_max_size) { vocab_max_size += 1000; vocab = (struct vocab_word *)realloc(vocab, vocab_max_size * sizeof(struct vocab_word)); } hash = GetWordHash(word); while (vocab_hash[hash] != -1) hash = (hash + 1) % vocab_hash_size; vocab_hash[hash] = vocab_size - 1; return vocab_size - 1; } // Used later for sorting by word counts int VocabCompare(const void *a, const void *b) { return ((struct vocab_word *)b)->cn - ((struct vocab_word *)a)->cn; } // Sorts the vocabulary by frequency using word counts void SortVocab() { int a, size; unsigned int hash; // Sort the vocabulary and keep </s> at the first position qsort(&vocab[1], vocab_size - 1, sizeof(struct vocab_word), VocabCompare); for (a = 0; a < vocab_hash_size; a++) vocab_hash[a] = -1; size = vocab_size; train_words = 0; for (a = 0; a < size; a++) { // Words occuring less than min_count times will be discarded from the vocab if ((vocab[a].cn < min_count) && (a != 0)) { vocab_size--; free(vocab[a].word); } else { // Hash will be re-computed, as after the sorting it is not actual hash=GetWordHash(vocab[a].word); while (vocab_hash[hash] != -1) hash = (hash + 1) % vocab_hash_size; vocab_hash[hash] = a; train_words += vocab[a].cn; } } vocab = (struct vocab_word *)realloc(vocab, (vocab_size + 1) * sizeof(struct vocab_word)); // Allocate memory for the binary tree construction for (a = 0; a < vocab_size; a++) { vocab[a].code = (char *)calloc(MAX_CODE_LENGTH, sizeof(char)); vocab[a].point = (int *)calloc(MAX_CODE_LENGTH, sizeof(int)); } } // Reduces the vocabulary by removing infrequent tokens void ReduceVocab() { int a, b = 0; unsigned int hash; for (a = 0; a < vocab_size; a++) if (vocab[a].cn > min_reduce) { vocab[b].cn = vocab[a].cn; vocab[b].word = vocab[a].word; b++; } else free(vocab[a].word); vocab_size = b; for (a = 0; a < vocab_hash_size; a++) vocab_hash[a] = -1; for (a = 0; a < vocab_size; a++) { // Hash will be re-computed, as it is not actual hash = GetWordHash(vocab[a].word); while (vocab_hash[hash] != -1) hash = (hash + 1) % vocab_hash_size; vocab_hash[hash] = a; } fflush(stdout); min_reduce++; } // Create binary Huffman tree using the word counts // Frequent words will have short uniqe binary codes void CreateBinaryTree() { long long a, b, i, min1i, min2i, pos1, pos2, point[MAX_CODE_LENGTH]; char code[MAX_CODE_LENGTH]; long long *count = (long long *)calloc(vocab_size * 2 + 1, sizeof(long long)); long long *binary = (long long *)calloc(vocab_size * 2 + 1, sizeof(long long)); long long *parent_node = (long long *)calloc(vocab_size * 2 + 1, sizeof(long long)); for (a = 0; a < vocab_size; a++) count[a] = vocab[a].cn; for (a = vocab_size; a < vocab_size * 2; a++) count[a] = 1e15; pos1 = vocab_size - 1; pos2 = vocab_size; // Following algorithm constructs the Huffman tree by adding one node at a time for (a = 0; a < vocab_size - 1; a++) { // First, find two smallest nodes 'min1, min2' if (pos1 >= 0) { if (count[pos1] < count[pos2]) { min1i = pos1; pos1--; } else { min1i = pos2; pos2++; } } else { min1i = pos2; pos2++; } if (pos1 >= 0) { if (count[pos1] < count[pos2]) { min2i = pos1; pos1--; } else { min2i = pos2; pos2++; } } else { min2i = pos2; pos2++; } count[vocab_size + a] = count[min1i] + count[min2i]; parent_node[min1i] = vocab_size + a; parent_node[min2i] = vocab_size + a; binary[min2i] = 1; } // Now assign binary code to each vocabulary word for (a = 0; a < vocab_size; a++) { b = a; i = 0; while (1) { code[i] = binary[b]; point[i] = b; i++; b = parent_node[b]; if (b == vocab_size * 2 - 2) break; } vocab[a].codelen = i; vocab[a].point[0] = vocab_size - 2; for (b = 0; b < i; b++) { vocab[a].code[i - b - 1] = code[b]; vocab[a].point[i - b] = point[b] - vocab_size; } } free(count); free(binary); free(parent_node); } void LearnVocabFromTrainFile() { char word[MAX_STRING]; FILE *fin; long long a, i; for (a = 0; a < vocab_hash_size; a++) vocab_hash[a] = -1; fin = fopen(train_file, "rb"); if (fin == NULL) { printf("ERROR: training data file not found!\n"); exit(1); } vocab_size = 0; AddWordToVocab((char *)"</s>"); while (1) { ReadWord(word, fin); if (feof(fin)) break; train_words++; if ((debug_mode > 1) && (train_words % 100000 == 0)) { printf("%lldK%c", train_words / 1000, 13); fflush(stdout); } i = SearchVocab(word); if (i == -1) { a = AddWordToVocab(word); vocab[a].cn = 1; } else vocab[i].cn++; if (vocab_size > vocab_hash_size * 0.7) ReduceVocab(); } SortVocab(); if (debug_mode > 0) { printf("Vocab size: %lld\n", vocab_size); printf("Words in train file: %lld\n", train_words); } file_size = ftell(fin); fclose(fin); } void SaveVocab() { long long i; FILE *fo = fopen(save_vocab_file, "wb"); for (i = 0; i < vocab_size; i++) fprintf(fo, "%s %lld\n", vocab[i].word, vocab[i].cn); fclose(fo); } void ReadVocab() { long long a, i = 0; char c; char word[MAX_STRING]; FILE *fin = fopen(read_vocab_file, "rb"); if (fin == NULL) { printf("Vocabulary file not found\n"); exit(1); } for (a = 0; a < vocab_hash_size; a++) vocab_hash[a] = -1; vocab_size = 0; while (1) { ReadWord(word, fin); if (feof(fin)) break; a = AddWordToVocab(word); fscanf(fin, "%lld%c", &vocab[a].cn, &c); i++; } SortVocab(); if (debug_mode > 0) { printf("Vocab size: %lld\n", vocab_size); printf("Words in train file: %lld\n", train_words); } fin = fopen(train_file, "rb"); if (fin == NULL) { printf("ERROR: training data file not found!\n"); exit(1); } fseek(fin, 0, SEEK_END); file_size = ftell(fin); fclose(fin); } void InitNet() { long long a, b; unsigned long long next_random = 1; a = posix_memalign((void **)&syn0, 128, (long long)vocab_size * layer1_size * sizeof(real)); if (syn0 == NULL) {printf("Memory allocation failed\n"); exit(1);} if (hs) { a = posix_memalign((void **)&syn1, 128, (long long)vocab_size * layer1_size * sizeof(real)); if (syn1 == NULL) {printf("Memory allocation failed\n"); exit(1);} for (a = 0; a < vocab_size; a++) for (b = 0; b < layer1_size; b++) syn1[a * layer1_size + b] = 0; } if (negative>0) { a = posix_memalign((void **)&syn1neg, 128, (long long)vocab_size * layer1_size * sizeof(real)); if (syn1neg == NULL) {printf("Memory allocation failed\n"); exit(1);} for (a = 0; a < vocab_size; a++) for (b = 0; b < layer1_size; b++) syn1neg[a * layer1_size + b] = 0; } for (a = 0; a < vocab_size; a++) for (b = 0; b < layer1_size; b++) { next_random = next_random * (unsigned long long)25214903917 + 11; syn0[a * layer1_size + b] = (((next_random & 0xFFFF) / (real)65536) - 0.5) / layer1_size; } CreateBinaryTree(); } void *TrainModelThread(void *id) { long long a, b, d, cw, word, last_word, sentence_length = 0, sentence_position = 0; long long word_count = 0, last_word_count = 0, sen[MAX_SENTENCE_LENGTH + 1]; long long l1, l2, c, target, label, local_iter = iter; float coeff,coeff2; unsigned long long next_random = (long long)id; real f, g; clock_t now; FILE *fpz; real *neu1 = (real *)calloc(layer1_size, sizeof(real)); real *neu1e = (real *)calloc(layer1_size, sizeof(real)); FILE *fi = fopen(train_file, "rb"); FILE *fo, *tfo; fseek(fi, file_size / (long long)num_threads * (long long)id, SEEK_SET); while (1) { if (word_count - last_word_count > 10000) { word_count_actual += word_count - last_word_count; last_word_count = word_count; if ((debug_mode > 1)) { now=clock(); printf("%cAlpha: %f Progress: %.2f%% Words/thread/sec: %.2fk ", 13, alpha, word_count_actual / (real)(iter * train_words + 1) * 100, word_count_actual / ((real)(now - start + 1) / (real)CLOCKS_PER_SEC * 1000)); fflush(stdout); //printf("\n"); } alpha = starting_alpha * (1 - word_count_actual / (real)(iter * train_words + 1)); if (alpha < starting_alpha * 0.0001) alpha = starting_alpha * 0.0001; } if (sentence_length == 0) { while (1) { word = ReadWordIndex(fi); if (feof(fi)) break; if (word == -1) continue; word_count++; if (word == 0) break; // The subsampling randomly discards frequent words while keeping the ranking same if (sample > 0) { real ran = (sqrt(vocab[word].cn / (sample * train_words)) + 1) * (sample * train_words) / vocab[word].cn; next_random = next_random * (unsigned long long)25214903917 + 11; if (ran < (next_random & 0xFFFF) / (real)65536) continue; } sen[sentence_length] = word; sentence_length++; if (sentence_length >= MAX_SENTENCE_LENGTH) break; } sentence_position = 0; } if (feof(fi) || (word_count > train_words / num_threads)) { /*End of each epoch: first thread only: *test train data likelihood. */ if (id == 0){ // Save the context word vectors fo = fopen(output_file, "wb"); fprintf(fo, "%lld %lld\n", vocab_size, layer1_size); for (a = 0; a < vocab_size; a++) { fprintf(fo, "%s ", vocab[a].word); if (binary) for (b = 0; b < layer1_size; b++) fwrite(&syn0[a * layer1_size + b], sizeof(real), 1, fo); else for (b = 0; b < layer1_size; b++) fprintf(fo, "%lf ", syn0[a * layer1_size + b]); fprintf(fo, "\n"); } fclose(fo); //Save the target word vectors tfo = fopen(tarOutput_file, "wb"); fprintf(tfo, "%lld %lld\n", vocab_size, layer1_size); for (a = 0; a < vocab_size; a++) { fprintf(tfo, "%s ", vocab[a].word); if (binary) for (b = 0; b < layer1_size; b++) fwrite(&syn1neg[a * layer1_size + b], sizeof(real), 1, tfo); else for (b = 0; b < layer1_size; b++) fprintf(tfo, "%lf ", syn1neg[a * layer1_size + b]); fprintf(tfo, "\n"); } fclose(tfo); } word_count_actual += word_count - last_word_count; local_iter--; if (local_iter == 0) break; word_count = 0; last_word_count = 0; sentence_length = 0; fseek(fi, file_size / (long long)num_threads * (long long)id, SEEK_SET); continue; } word = sen[sentence_position]; if (word == -1) continue; for (c = 0; c < layer1_size; c++) neu1[c] = 0; for (c = 0; c < layer1_size; c++) neu1e[c] = 0; next_random = next_random * (unsigned long long)25214903917 + 11; b = next_random % window; b = 0; if (cbow) { //train the cbow architecture printf("Robust Gram does not support CBOW.\n"); exit(0); } else { //train skip-gram for (a = b; a < window * 2 + 1 - b; a++) if (a != window) { c = sentence_position - window + a; if (c < 0) continue; if (c >= sentence_length) continue; last_word = sen[c]; if (last_word == -1) continue; l1 = last_word * layer1_size; for (c = 0; c < layer1_size; c++) neu1e[c] = 0; // HIERARCHICAL SOFTMAX if (hs) for (d = 0; d < vocab[word].codelen; d++) { printf("Robust Gram does not support Hierarchial Sampling yet.\n"); } // NEGATIVE SAMPLING if (negative > 0) for (d = 0; d < negative + 1; d++) { if (d == 0) { target = word; label = 1; } else { next_random = next_random * (unsigned long long)25214903917 + 11; target = table[(next_random >> 16) % table_size]; if (target == 0) target = next_random % (vocab_size - 1) + 1; if (target == word) continue; label = 0; } l2 = target * layer1_size; f = 0; for (c = 0; c < layer1_size; c++) f += syn0[c + l1] * syn1neg[c + l2]; if (f > MAX_EXP) g = (label - 1) * alpha; else if (f < -MAX_EXP) g = (label - 0) * alpha; else g = (label - expTable[(int)((f + MAX_EXP) * (EXP_TABLE_SIZE / MAX_EXP / 2))]) * alpha; for (c = 0; c < layer1_size; c++) neu1e[c] += g * syn1neg[c + l2]; coeff = lambda / ( (float)(window * 2) * (float)(vocab[word].cn) ); coeff2 = lambda2 / ( (float)(window * 2) * (float)(vocab[last_word].cn) ); for (c = 0; c < layer1_size; c++) syn1neg[c + l2] += ( (g * syn0[c + l1]) + (alpha * coeff * syn1neg[c + l2]) + (alpha * coeff2 * 2 * ( syn1neg[c + l2] - syn0[c + l1]) ) ); } // Learn weights input -> hidden coeff = lambda / ( (float)(window * 2) * (float)(vocab[last_word].cn) ); coeff2 = lambda2 / ( (float)(window * 2) * (float)(vocab[last_word].cn) ); for (c = 0; c < layer1_size; c++) syn0[c + l1] += ( neu1e[c] + (alpha * coeff * syn0[c + l1]) + (alpha * coeff2 * 2 * (syn0[c + l1] - syn1neg[c + l2]) ) ); } } sentence_position++; if (sentence_position >= sentence_length) { sentence_length = 0; continue; } } printf("\nFinished training, alpha: %f \n",alpha); //printf(("last processed word [%s]", vocab[word].word)); fclose(fi); free(neu1); free(neu1e); pthread_exit(NULL); } void TrainModel() { long a, b, c, d; FILE *fo, *tfo; pthread_t *pt = (pthread_t *)malloc(num_threads * sizeof(pthread_t)); printf("Starting training using file %s\n", train_file); starting_alpha = alpha; if (read_vocab_file[0] != 0) ReadVocab(); else LearnVocabFromTrainFile(); if (save_vocab_file[0] != 0) SaveVocab(); if (output_file[0] == 0) return; InitNet(); if (negative > 0) InitUnigramTable(); start = clock(); for (a = 0; a < num_threads; a++) pthread_create(&pt[a], NULL, TrainModelThread, (void *)a); for (a = 0; a < num_threads; a++) pthread_join(pt[a], NULL); fo = fopen(output_file, "wb"); tfo = fopen(tarOutput_file, "wb"); if (classes == 0) { // Save the context word vectors fprintf(fo, "%lld %lld\n", vocab_size, layer1_size); for (a = 0; a < vocab_size; a++) { fprintf(fo, "%s ", vocab[a].word); if (binary) for (b = 0; b < layer1_size; b++) fwrite(&syn0[a * layer1_size + b], sizeof(real), 1, fo); else for (b = 0; b < layer1_size; b++) fprintf(fo, "%lf ", syn0[a * layer1_size + b]); fprintf(fo, "\n"); } //Save the target word vectors fprintf(tfo, "%lld %lld\n", vocab_size, layer1_size); for (a = 0; a < vocab_size; a++) { fprintf(tfo, "%s ", vocab[a].word); if (binary) for (b = 0; b < layer1_size; b++) fwrite(&syn1neg[a * layer1_size + b], sizeof(real), 1, tfo); else for (b = 0; b < layer1_size; b++) fprintf(tfo, "%lf ", syn1neg[a * layer1_size + b]); fprintf(tfo, "\n"); } } else { // Run K-means on the word vectors int clcn = classes, iter = 10, closeid; int *centcn = (int *)malloc(classes * sizeof(int)); int *cl = (int *)calloc(vocab_size, sizeof(int)); real closev, x; real *cent = (real *)calloc(classes * layer1_size, sizeof(real)); for (a = 0; a < vocab_size; a++) cl[a] = a % clcn; for (a = 0; a < iter; a++) { for (b = 0; b < clcn * layer1_size; b++) cent[b] = 0; for (b = 0; b < clcn; b++) centcn[b] = 1; for (c = 0; c < vocab_size; c++) { for (d = 0; d < layer1_size; d++) cent[layer1_size * cl[c] + d] += syn0[c * layer1_size + d]; centcn[cl[c]]++; } for (b = 0; b < clcn; b++) { closev = 0; for (c = 0; c < layer1_size; c++) { cent[layer1_size * b + c] /= centcn[b]; closev += cent[layer1_size * b + c] * cent[layer1_size * b + c]; } closev = sqrt(closev); for (c = 0; c < layer1_size; c++) cent[layer1_size * b + c] /= closev; } for (c = 0; c < vocab_size; c++) { closev = -10; closeid = 0; for (d = 0; d < clcn; d++) { x = 0; for (b = 0; b < layer1_size; b++) x += cent[layer1_size * d + b] * syn0[c * layer1_size + b]; if (x > closev) { closev = x; closeid = d; } } cl[c] = closeid; } } // Save the K-means classes for (a = 0; a < vocab_size; a++) fprintf(fo, "%s %d\n", vocab[a].word, cl[a]); free(centcn); free(cent); free(cl); } fclose(fo); fclose(tfo); } int ArgPos(char *str, int argc, char **argv) { int a; for (a = 1; a < argc; a++) if (!strcmp(str, argv[a])) { if (a == argc - 1) { printf("Argument missing for %s\n", str); exit(1); } return a; } return -1; } int main(int argc, char **argv) { int i; if (argc == 1) { printf("Robust Gram vector estimation toolkit v1.0\n\n"); printf("Options:\n"); printf("Parameters for training:\n"); printf("\t-train <file>\n"); printf("\t\tUse text data from <file> to train the model\n"); printf("\t-output <file>\n"); printf("\t\tUse <file> to save the resulting word vectors / word clusters\n"); printf("\t-size <int>\n"); printf("\t\tSet size of word vectors; default is 100\n"); printf("\t-window <int>\n"); printf("\t\tSet max skip length between words; default is 5\n"); printf("\t-sample <float>\n"); printf("\t\tSet threshold for occurrence of words. Those that appear with higher frequency in the training data\n"); printf("\t\twill be randomly down-sampled; default is 1e-3, useful range is (0, 1e-5)\n"); printf("\t-hs <int>\n"); printf("\t\tUse Hierarchical Softmax; default is 0 (not used)\n"); printf("\t-negative <int>\n"); printf("\t\tNumber of negative examples; default is 5, common values are 3 - 10 (0 = not used)\n"); printf("\t-threads <int>\n"); printf("\t\tUse <int> threads (default 12)\n"); printf("\t-iter <int>\n"); printf("\t\tRun more training iterations (default 5)\n"); printf("\t-min-count <int>\n"); printf("\t\tThis will discard words that appear less than <int> times; default is 5\n"); printf("\t-alpha <float>\n"); printf("\t\tSet the starting learning rate; default is 0.025 for skip-gram and 0.05 for CBOW\n"); printf("\t-classes <int>\n"); printf("\t\tOutput word classes rather than word vectors; default number of classes is 0 (vectors are written)\n"); printf("\t-debug <int>\n"); printf("\t\tSet the debug mode (default = 2 = more info during training)\n"); printf("\t-binary <int>\n"); printf("\t\tSave the resulting vectors in binary moded; default is 0 (off)\n"); printf("\t-save-vocab <file>\n"); printf("\t\tThe vocabulary will be saved to <file>\n"); printf("\t-read-vocab <file>\n"); printf("\t\tThe vocabulary will be read from <file>, not constructed from the training data\n"); printf("\t-cbow <int>\n"); printf("\t\tUse the continuous bag of words model; default is 1 (use 0 for skip-gram model)\n"); printf("\nExamples:\n"); printf("./word2vec -train data.txt -output vec.txt -size 200 -window 5 -sample 1e-4 -negative 5 -hs 0 -binary 0 -cbow 1 -iter 3\n\n"); return 0; } output_file[0] = 0; save_vocab_file[0] = 0; read_vocab_file[0] = 0; if ((i = ArgPos((char *)"-size", argc, argv)) > 0) layer1_size = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-train", argc, argv)) > 0) strcpy(train_file, argv[i + 1]); if ((i = ArgPos((char *)"-save-vocab", argc, argv)) > 0) strcpy(save_vocab_file, argv[i + 1]); if ((i = ArgPos((char *)"-read-vocab", argc, argv)) > 0) strcpy(read_vocab_file, argv[i + 1]); if ((i = ArgPos((char *)"-debug", argc, argv)) > 0) debug_mode = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-binary", argc, argv)) > 0) binary = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-cbow", argc, argv)) > 0) cbow = atoi(argv[i + 1]); if (cbow) alpha = 0.05; if ((i = ArgPos((char *)"-alpha", argc, argv)) > 0) alpha = atof(argv[i + 1]); if ((i = ArgPos((char *)"-output", argc, argv)) > 0) strcpy(output_file, argv[i + 1]); if ((i = ArgPos((char *)"-taroutput", argc, argv)) > 0) strcpy(tarOutput_file, argv[i + 1]); if ((i = ArgPos((char *)"-window", argc, argv)) > 0) window = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-sample", argc, argv)) > 0) sample = atof(argv[i + 1]); if ((i = ArgPos((char *)"-hs", argc, argv)) > 0) hs = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-negative", argc, argv)) > 0) negative = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-threads", argc, argv)) > 0) num_threads = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-iter", argc, argv)) > 0) iter = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-min-count", argc, argv)) > 0) min_count = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-classes", argc, argv)) > 0) classes = atoi(argv[i + 1]); if ((i = ArgPos((char *)"-lambda", argc, argv)) > 0) lambda = atof(argv[i + 1]); if ((i = ArgPos((char *)"-lambda2", argc, argv)) > 0) lambda2 = atof(argv[i + 1]); vocab = (struct vocab_word *)calloc(vocab_max_size, sizeof(struct vocab_word)); vocab_hash = (int *)calloc(vocab_hash_size, sizeof(int)); expTable = (real *)malloc((EXP_TABLE_SIZE + 1) * sizeof(real)); for (i = 0; i < EXP_TABLE_SIZE; i++) { expTable[i] = exp((i / (real)EXP_TABLE_SIZE * 2 - 1) * MAX_EXP); // Precompute the exp() table expTable[i] = expTable[i] / (expTable[i] + 1); // Precompute f(x) = x / (x + 1) } TrainModel(); return 0; }
the_stack_data/189358.c
/* mbed Microcontroller Library * Copyright (c) 2017, ARM Limited * All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions are met: * * 1. Redistributions of source code must retain the above copyright notice, * this list of conditions and the following disclaimer. * 2. Redistributions in binary form must reproduce the above copyright notice, * this list of conditions and the following disclaimer in the documentation * and/or other materials provided with the distribution. * 3. Neither the name of STMicroelectronics nor the names of its contributors * may be used to endorse or promote products derived from this software * without specific prior written permission. * * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE * DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR * SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER * CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, * OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE * OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. */ #if DEVICE_QSPI #include "qspi_api.h" #include "mbed_error.h" #include "mbed_debug.h" #include "cmsis.h" #include "pinmap.h" #include "PeripheralPins.h" // activate / de-activate debug #define qspi_api_c_debug 0 /* Max amount of flash size is 4Gbytes */ /* hence 2^(31+1), then FLASH_SIZE_DEFAULT = 1<<31 */ #define QSPI_FLASH_SIZE_DEFAULT 0x80000000 #if defined(OCTOSPI1) static uint32_t get_alt_bytes_size(const uint32_t num_bytes) { switch (num_bytes) { case 1: return HAL_OSPI_ALTERNATE_BYTES_8_BITS; case 2: return HAL_OSPI_ALTERNATE_BYTES_16_BITS; case 3: return HAL_OSPI_ALTERNATE_BYTES_24_BITS; case 4: return HAL_OSPI_ALTERNATE_BYTES_32_BITS; } error("Invalid alt bytes size"); return 0xFFFFFFFF; } #else /* OCTOSPI1 */ static uint32_t get_alt_bytes_size(const uint32_t num_bytes) { switch (num_bytes) { case 1: return QSPI_ALTERNATE_BYTES_8_BITS; case 2: return QSPI_ALTERNATE_BYTES_16_BITS; case 3: return QSPI_ALTERNATE_BYTES_24_BITS; case 4: return QSPI_ALTERNATE_BYTES_32_BITS; } error("Invalid alt bytes size"); return 0xFFFFFFFF; } #endif /* OCTOSPI1 */ #if defined(OCTOSPI1) qspi_status_t qspi_prepare_command(const qspi_command_t *command, OSPI_RegularCmdTypeDef *st_command) { debug_if(qspi_api_c_debug, "qspi_prepare_command In: instruction.value %x dummy_count %x address.bus_width %x address.disabled %x address.value %x address.size %x\n", command->instruction.value, command->dummy_count, command->address.bus_width, command->address.disabled, command->address.value, command->address.size); st_command->FlashId = HAL_OSPI_FLASH_ID_1; if (command->instruction.disabled == true) { st_command->InstructionMode = HAL_OSPI_INSTRUCTION_NONE; st_command->Instruction = 0; } else { st_command->Instruction = command->instruction.value; switch (command->instruction.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->InstructionMode = HAL_OSPI_INSTRUCTION_1_LINE; break; case QSPI_CFG_BUS_DUAL: st_command->InstructionMode = HAL_OSPI_INSTRUCTION_2_LINES; break; case QSPI_CFG_BUS_QUAD: st_command->InstructionMode = HAL_OSPI_INSTRUCTION_4_LINES; break; default: error("Command param error: wrong instruction format\n"); return QSPI_STATUS_ERROR; } } st_command->InstructionSize = HAL_OSPI_INSTRUCTION_8_BITS; st_command->InstructionDtrMode = HAL_OSPI_INSTRUCTION_DTR_DISABLE; st_command->DummyCycles = command->dummy_count; // these are target specific settings, use default values st_command->SIOOMode = HAL_OSPI_SIOO_INST_EVERY_CMD; st_command->DataDtrMode = HAL_OSPI_DATA_DTR_DISABLE; st_command->AddressDtrMode = HAL_OSPI_ADDRESS_DTR_DISABLE; st_command->AlternateBytesDtrMode = HAL_OSPI_ALTERNATE_BYTES_DTR_DISABLE; st_command->DQSMode = HAL_OSPI_DQS_DISABLE; st_command->OperationType = HAL_OSPI_OPTYPE_COMMON_CFG; if (command->address.disabled == true) { st_command->AddressMode = HAL_OSPI_ADDRESS_NONE; st_command->AddressSize = 0; } else { st_command->Address = command->address.value; switch (command->address.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->AddressMode = HAL_OSPI_ADDRESS_1_LINE; break; case QSPI_CFG_BUS_DUAL: st_command->AddressMode = HAL_OSPI_ADDRESS_2_LINES; break; case QSPI_CFG_BUS_QUAD: st_command->AddressMode = HAL_OSPI_ADDRESS_4_LINES; break; default: error("Command param error: wrong address size\n"); return QSPI_STATUS_ERROR; } switch (command->address.size) { case QSPI_CFG_ADDR_SIZE_8: st_command->AddressSize = HAL_OSPI_ADDRESS_8_BITS; break; case QSPI_CFG_ADDR_SIZE_16: st_command->AddressSize = HAL_OSPI_ADDRESS_16_BITS; break; case QSPI_CFG_ADDR_SIZE_24: st_command->AddressSize = HAL_OSPI_ADDRESS_24_BITS; break; case QSPI_CFG_ADDR_SIZE_32: st_command->AddressSize = HAL_OSPI_ADDRESS_32_BITS; break; default: error("Command param error: wrong address size\n"); return QSPI_STATUS_ERROR; } } if (command->alt.disabled == true) { st_command->AlternateBytesMode = HAL_OSPI_ALTERNATE_BYTES_NONE; st_command->AlternateBytesSize = 0; } else { uint8_t alt_lines = 0; switch (command->alt.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->AlternateBytesMode = HAL_OSPI_ALTERNATE_BYTES_1_LINE; alt_lines = 1; break; case QSPI_CFG_BUS_DUAL: st_command->AlternateBytesMode = HAL_OSPI_ALTERNATE_BYTES_2_LINES; alt_lines = 2; break; case QSPI_CFG_BUS_QUAD: st_command->AlternateBytesMode = HAL_OSPI_ALTERNATE_BYTES_4_LINES; alt_lines = 4; break; default: st_command->AlternateBytesMode = HAL_OSPI_ALTERNATE_BYTES_NONE; error("Command param error: invalid alt bytes mode\n"); return QSPI_STATUS_ERROR; } // Alt size must be a multiple of the number of bus lines used (i.e. a whole number of cycles) if (command->alt.size % alt_lines != 0) { error("Command param error: incompatible alt size and alt bus width\n"); return QSPI_STATUS_ERROR; } // Round up to nearest byte - unused parts of byte act as dummy cycles uint32_t alt_bytes = ((command->alt.size - 1) >> 3) + 1; // Maximum of 4 alt bytes if (alt_bytes > 4) { error("Command param error: alt size exceeds maximum of 32 bits\n"); return QSPI_STATUS_ERROR; } // Unused bits in most significant byte of alt uint8_t leftover_bits = (alt_bytes << 3) - command->alt.size; if (leftover_bits != 0) { // Account for dummy cycles that will be spent in the alt portion of the command uint8_t integrated_dummy_cycles = leftover_bits / alt_lines; if (st_command->DummyCycles < integrated_dummy_cycles) { // Not enough dummy cycles to account for a short alt error("Command param error: not enough dummy cycles to make up for given alt size\n"); return QSPI_STATUS_ERROR; } st_command->DummyCycles -= integrated_dummy_cycles; // Align alt value to the end of the most significant byte st_command->AlternateBytes = command->alt.value << leftover_bits; } else { st_command->AlternateBytes = command->alt.value; } st_command->AlternateBytesSize = get_alt_bytes_size(alt_bytes); } switch (command->data.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->DataMode = HAL_OSPI_DATA_1_LINE; break; case QSPI_CFG_BUS_DUAL: st_command->DataMode = HAL_OSPI_DATA_2_LINES; break; case QSPI_CFG_BUS_QUAD: st_command->DataMode = HAL_OSPI_DATA_4_LINES; break; default: st_command->DataMode = HAL_OSPI_DATA_NONE; break; } debug_if(qspi_api_c_debug, "qspi_prepare_command Out: InstructionMode %x Instruction %x AddressMode %x AddressSize %x Address %x DataMode %x\n", st_command->InstructionMode, st_command->Instruction, st_command->AddressMode, st_command->AddressSize, st_command->Address, st_command->DataMode); return QSPI_STATUS_OK; } #else /* OCTOSPI */ qspi_status_t qspi_prepare_command(const qspi_command_t *command, QSPI_CommandTypeDef *st_command) { debug_if(qspi_api_c_debug, "qspi_prepare_command In: instruction.value %x dummy_count %x address.bus_width %x address.disabled %x address.value %x address.size %x\n", command->instruction.value, command->dummy_count, command->address.bus_width, command->address.disabled, command->address.value, command->address.size); // TODO: shift these around to get more dynamic mapping switch (command->instruction.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->InstructionMode = QSPI_INSTRUCTION_1_LINE; break; case QSPI_CFG_BUS_DUAL: st_command->InstructionMode = QSPI_INSTRUCTION_2_LINES; break; case QSPI_CFG_BUS_QUAD: st_command->InstructionMode = QSPI_INSTRUCTION_4_LINES; break; default: st_command->InstructionMode = QSPI_INSTRUCTION_NONE; break; } st_command->Instruction = command->instruction.value; st_command->DummyCycles = command->dummy_count; // these are target specific settings, use default values st_command->SIOOMode = QSPI_SIOO_INST_EVERY_CMD; st_command->DdrMode = QSPI_DDR_MODE_DISABLE; st_command->DdrHoldHalfCycle = QSPI_DDR_HHC_ANALOG_DELAY; switch (command->address.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->AddressMode = QSPI_ADDRESS_1_LINE; break; case QSPI_CFG_BUS_DUAL: st_command->AddressMode = QSPI_ADDRESS_2_LINES; break; case QSPI_CFG_BUS_QUAD: st_command->AddressMode = QSPI_ADDRESS_4_LINES; break; default: st_command->AddressMode = QSPI_ADDRESS_NONE; break; } if (command->address.disabled == true) { st_command->AddressMode = QSPI_ADDRESS_NONE; st_command->AddressSize = 0; } else { st_command->Address = command->address.value; /* command->address.size needs to be shifted by QUADSPI_CCR_ADSIZE_Pos */ st_command->AddressSize = (command->address.size << QUADSPI_CCR_ADSIZE_Pos) & QUADSPI_CCR_ADSIZE_Msk; } uint8_t alt_lines = 0; switch (command->alt.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->AlternateByteMode = QSPI_ALTERNATE_BYTES_1_LINE; alt_lines = 1; break; case QSPI_CFG_BUS_DUAL: st_command->AlternateByteMode = QSPI_ALTERNATE_BYTES_2_LINES; alt_lines = 2; break; case QSPI_CFG_BUS_QUAD: st_command->AlternateByteMode = QSPI_ALTERNATE_BYTES_4_LINES; alt_lines = 4; break; default: st_command->AlternateByteMode = QSPI_ALTERNATE_BYTES_NONE; break; } if (command->alt.disabled == true) { st_command->AlternateByteMode = QSPI_ALTERNATE_BYTES_NONE; st_command->AlternateBytesSize = 0; } else { // Alt size must be a multiple of the number of bus lines used (i.e. a whole number of cycles) if ((alt_lines == 0) || (command->alt.size % alt_lines != 0)) { return QSPI_STATUS_ERROR; } // Round up to nearest byte - unused parts of byte act as dummy cycles uint32_t alt_bytes = ((command->alt.size - 1) >> 3) + 1; // Maximum of 4 alt bytes if (alt_bytes > 4) { return QSPI_STATUS_ERROR; } // Unused bits in most significant byte of alt uint8_t leftover_bits = (alt_bytes << 3) - command->alt.size; if (leftover_bits != 0) { // Account for dummy cycles that will be spent in the alt portion of the command uint8_t integrated_dummy_cycles = leftover_bits / alt_lines; if (st_command->DummyCycles < integrated_dummy_cycles) { // Not enough dummy cycles to account for a short alt return QSPI_STATUS_ERROR; } st_command->DummyCycles -= integrated_dummy_cycles; // Align alt value to the end of the most significant byte st_command->AlternateBytes = command->alt.value << leftover_bits; } else { st_command->AlternateBytes = command->alt.value; } st_command->AlternateBytesSize = get_alt_bytes_size(alt_bytes); } switch (command->data.bus_width) { case QSPI_CFG_BUS_SINGLE: st_command->DataMode = QSPI_DATA_1_LINE; break; case QSPI_CFG_BUS_DUAL: st_command->DataMode = QSPI_DATA_2_LINES; break; case QSPI_CFG_BUS_QUAD: st_command->DataMode = QSPI_DATA_4_LINES; break; default: st_command->DataMode = QSPI_DATA_NONE; break; } st_command->NbData = 0; debug_if(qspi_api_c_debug, "qspi_prepare_command Out: InstructionMode %x Instruction %x AddressMode %x AddressSize %x Address %x DataMode %x\n", st_command->InstructionMode, st_command->Instruction, st_command->AddressMode, st_command->AddressSize, st_command->Address, st_command->DataMode); return QSPI_STATUS_OK; } #endif /* OCTOSPI */ #if defined(OCTOSPI1) qspi_status_t qspi_init(qspi_t *obj, PinName io0, PinName io1, PinName io2, PinName io3, PinName sclk, PinName ssel, uint32_t hz, uint8_t mode) { OSPIM_CfgTypeDef OSPIM_Cfg_Struct = {0}; debug_if(qspi_api_c_debug, "qspi_init mode %u\n", mode); // Reset handle internal state obj->handle.State = HAL_OSPI_STATE_RESET; // Set default OCTOSPI handle values obj->handle.Init.DualQuad = HAL_OSPI_DUALQUAD_DISABLE; obj->handle.Init.MemoryType = HAL_OSPI_MEMTYPE_MICRON; obj->handle.Init.ClockPrescaler = 4; // default value, will be overwritten in qspi_frequency obj->handle.Init.FifoThreshold = 4; obj->handle.Init.SampleShifting = HAL_OSPI_SAMPLE_SHIFTING_NONE; obj->handle.Init.DeviceSize = POSITION_VAL(QSPI_FLASH_SIZE_DEFAULT) - 1; obj->handle.Init.ChipSelectHighTime = 3; obj->handle.Init.FreeRunningClock = HAL_OSPI_FREERUNCLK_DISABLE; obj->handle.Init.WrapSize = HAL_OSPI_WRAP_NOT_SUPPORTED; obj->handle.Init.ClockMode = mode == 0 ? HAL_OSPI_CLOCK_MODE_0 : HAL_OSPI_CLOCK_MODE_3; obj->handle.Init.DelayHoldQuarterCycle = HAL_OSPI_DHQC_ENABLE; obj->handle.Init.ChipSelectBoundary = 0; QSPIName qspiio0name = (QSPIName)pinmap_peripheral(io0, PinMap_QSPI_DATA0); QSPIName qspiio1name = (QSPIName)pinmap_peripheral(io1, PinMap_QSPI_DATA1); QSPIName qspiio2name = (QSPIName)pinmap_peripheral(io2, PinMap_QSPI_DATA2); QSPIName qspiio3name = (QSPIName)pinmap_peripheral(io3, PinMap_QSPI_DATA3); QSPIName qspiclkname = (QSPIName)pinmap_peripheral(sclk, PinMap_QSPI_SCLK); QSPIName qspisselname = (QSPIName)pinmap_peripheral(ssel, PinMap_QSPI_SSEL); QSPIName qspi_data_first = (QSPIName)pinmap_merge(qspiio0name, qspiio1name); QSPIName qspi_data_second = (QSPIName)pinmap_merge(qspiio2name, qspiio3name); QSPIName qspi_data_third = (QSPIName)pinmap_merge(qspiclkname, qspisselname); if (qspi_data_first != qspi_data_second || qspi_data_second != qspi_data_third || qspi_data_first != qspi_data_third) { debug_if(qspi_api_c_debug, "QSPI_STATUS_INVALID_PARAMETER error\n"); return QSPI_STATUS_INVALID_PARAMETER; } // tested all combinations, take first obj->qspi = qspi_data_third; #if defined(OCTOSPI1) if (obj->qspi == QSPI_1) { obj->handle.Instance = OCTOSPI1; } #endif #if defined(OCTOSPI2) if (obj->qspi == QSPI_2) { obj->handle.Instance = OCTOSPI2; } #endif #if defined(OCTOSPI1) if (obj->qspi == QSPI_1) { __HAL_RCC_OSPI1_CLK_ENABLE(); __HAL_RCC_OSPIM_CLK_ENABLE(); __HAL_RCC_OSPI1_FORCE_RESET(); __HAL_RCC_OSPI1_RELEASE_RESET(); } #endif #if defined(OCTOSPI2) if (obj->qspi == QSPI_2) { __HAL_RCC_OSPI2_CLK_ENABLE(); __HAL_RCC_OSPIM_CLK_ENABLE(); __HAL_RCC_OSPI2_FORCE_RESET(); __HAL_RCC_OSPI2_RELEASE_RESET(); } #endif // pinmap for pins (enable clock) obj->io0 = io0; pinmap_pinout(io0, PinMap_QSPI_DATA0); obj->io1 = io1; pinmap_pinout(io1, PinMap_QSPI_DATA1); obj->io2 = io2; pinmap_pinout(io2, PinMap_QSPI_DATA2); obj->io3 = io3; pinmap_pinout(io3, PinMap_QSPI_DATA3); obj->sclk = sclk; pinmap_pinout(sclk, PinMap_QSPI_SCLK); obj->ssel = ssel; pinmap_pinout(ssel, PinMap_QSPI_SSEL); /* The OctoSPI IO Manager OCTOSPIM configuration is supported in a simplified mode in mbed-os * QSPI1 signals are mapped to port 1 and QSPI2 signals are mapped to port 2. * This is coded in this way in PeripheralPins.c */ if (obj->qspi == QSPI_1) { OSPIM_Cfg_Struct.ClkPort = 1; OSPIM_Cfg_Struct.DQSPort = 1; OSPIM_Cfg_Struct.NCSPort = 1; OSPIM_Cfg_Struct.IOLowPort = HAL_OSPIM_IOPORT_1_LOW; OSPIM_Cfg_Struct.IOHighPort = HAL_OSPIM_IOPORT_1_HIGH; } else { OSPIM_Cfg_Struct.ClkPort = 2; OSPIM_Cfg_Struct.DQSPort = 2; OSPIM_Cfg_Struct.NCSPort = 2; OSPIM_Cfg_Struct.IOLowPort = HAL_OSPIM_IOPORT_2_LOW; OSPIM_Cfg_Struct.IOHighPort = HAL_OSPIM_IOPORT_2_HIGH; } if (HAL_OSPIM_Config(&obj->handle, &OSPIM_Cfg_Struct, HAL_OSPI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { debug_if(qspi_api_c_debug, "HAL_OSPIM_Config error\n"); return QSPI_STATUS_ERROR; } return qspi_frequency(obj, hz); } #else /* OCTOSPI */ qspi_status_t qspi_init(qspi_t *obj, PinName io0, PinName io1, PinName io2, PinName io3, PinName sclk, PinName ssel, uint32_t hz, uint8_t mode) { debug_if(qspi_api_c_debug, "qspi_init mode %u\n", mode); // Enable interface clock for QSPI __HAL_RCC_QSPI_CLK_ENABLE(); // Reset QSPI #if defined(DUAL_CORE) uint32_t timeout = HSEM_TIMEOUT; while (LL_HSEM_1StepLock(HSEM, CFG_HW_RCC_SEMID) && (--timeout != 0)) { } #endif /* DUAL_CORE */ __HAL_RCC_QSPI_FORCE_RESET(); __HAL_RCC_QSPI_RELEASE_RESET(); #if defined(DUAL_CORE) LL_HSEM_ReleaseLock(HSEM, CFG_HW_RCC_SEMID, HSEM_CR_COREID_CURRENT); #endif /* DUAL_CORE */ // Reset handle internal state obj->handle.State = HAL_QSPI_STATE_RESET; obj->handle.Lock = HAL_UNLOCKED; // Set default QSPI handle values obj->handle.Init.ClockPrescaler = 1; obj->handle.Init.FifoThreshold = 1; obj->handle.Init.SampleShifting = QSPI_SAMPLE_SHIFTING_HALFCYCLE; obj->handle.Init.FlashSize = POSITION_VAL(QSPI_FLASH_SIZE_DEFAULT) - 1; obj->handle.Init.ChipSelectHighTime = QSPI_CS_HIGH_TIME_5_CYCLE; obj->handle.Init.ClockMode = QSPI_CLOCK_MODE_0; #ifdef QSPI_DUALFLASH_ENABLE obj->handle.Init.FlashID = QSPI_FLASH_ID_1; obj->handle.Init.DualFlash = QSPI_DUALFLASH_DISABLE; #endif obj->handle.Init.ClockMode = mode == 0 ? QSPI_CLOCK_MODE_0 : QSPI_CLOCK_MODE_3; QSPIName qspiio0name = (QSPIName)pinmap_peripheral(io0, PinMap_QSPI_DATA0); QSPIName qspiio1name = (QSPIName)pinmap_peripheral(io1, PinMap_QSPI_DATA1); QSPIName qspiio2name = (QSPIName)pinmap_peripheral(io2, PinMap_QSPI_DATA2); QSPIName qspiio3name = (QSPIName)pinmap_peripheral(io3, PinMap_QSPI_DATA3); QSPIName qspiclkname = (QSPIName)pinmap_peripheral(sclk, PinMap_QSPI_SCLK); QSPIName qspisselname = (QSPIName)pinmap_peripheral(ssel, PinMap_QSPI_SSEL); QSPIName qspi_data_first = (QSPIName)pinmap_merge(qspiio0name, qspiio1name); QSPIName qspi_data_second = (QSPIName)pinmap_merge(qspiio2name, qspiio3name); QSPIName qspi_data_third = (QSPIName)pinmap_merge(qspiclkname, qspisselname); if (qspi_data_first != qspi_data_second || qspi_data_second != qspi_data_third || qspi_data_first != qspi_data_third) { return QSPI_STATUS_INVALID_PARAMETER; } // tested all combinations, take first obj->handle.Instance = (QUADSPI_TypeDef *)qspi_data_first; // pinmap for pins (enable clock) obj->io0 = io0; pinmap_pinout(io0, PinMap_QSPI_DATA0); obj->io1 = io1; pinmap_pinout(io1, PinMap_QSPI_DATA1); obj->io2 = io2; pinmap_pinout(io2, PinMap_QSPI_DATA2); obj->io3 = io3; pinmap_pinout(io3, PinMap_QSPI_DATA3); obj->sclk = sclk; pinmap_pinout(sclk, PinMap_QSPI_SCLK); obj->ssel = ssel; pinmap_pinout(ssel, PinMap_QSPI_SSEL); return qspi_frequency(obj, hz); } #endif /* OCTOSPI */ #if defined(OCTOSPI1) qspi_status_t qspi_free(qspi_t *obj) { debug_if(qspi_api_c_debug, "qspi_free\n"); if (HAL_OSPI_DeInit(&obj->handle) != HAL_OK) { return QSPI_STATUS_ERROR; } #if defined(OCTOSPI1) if (obj->qspi == QSPI_1) { __HAL_RCC_OSPI1_FORCE_RESET(); __HAL_RCC_OSPI1_CLK_DISABLE(); } #endif #if defined(OCTOSPI2) if (obj->qspi == QSPI_2) { __HAL_RCC_OSPI2_FORCE_RESET(); __HAL_RCC_OSPI2_CLK_DISABLE(); } #endif // Configure GPIOs pin_function(obj->io0, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->io1, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->io2, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->io3, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->sclk, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->ssel, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); (void)(obj); return QSPI_STATUS_OK; } #else /* OCTOSPI */ qspi_status_t qspi_free(qspi_t *obj) { if (HAL_QSPI_DeInit(&obj->handle) != HAL_OK) { return QSPI_STATUS_ERROR; } // Reset QSPI #if defined(DUAL_CORE) uint32_t timeout = HSEM_TIMEOUT; while (LL_HSEM_1StepLock(HSEM, CFG_HW_RCC_SEMID) && (--timeout != 0)) { } #endif /* DUAL_CORE */ __HAL_RCC_QSPI_FORCE_RESET(); __HAL_RCC_QSPI_RELEASE_RESET(); #if defined(DUAL_CORE) LL_HSEM_ReleaseLock(HSEM, CFG_HW_RCC_SEMID, HSEM_CR_COREID_CURRENT); #endif /* DUAL_CORE */ // Disable interface clock for QSPI __HAL_RCC_QSPI_CLK_DISABLE(); // Configure GPIOs pin_function(obj->io0, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->io1, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->io2, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->io3, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->sclk, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); pin_function(obj->ssel, STM_PIN_DATA(STM_MODE_INPUT, GPIO_NOPULL, 0)); (void)(obj); return QSPI_STATUS_OK; } #endif /* OCTOSPI */ #if defined(OCTOSPI1) qspi_status_t qspi_frequency(qspi_t *obj, int hz) { debug_if(qspi_api_c_debug, "qspi_frequency hz %d\n", hz); qspi_status_t status = QSPI_STATUS_OK; /* HCLK drives QSPI. QSPI clock depends on prescaler value: * 0: Freq = HCLK * 1: Freq = HCLK/2 * ... * 255: Freq = HCLK/256 (minimum value) */ int div = HAL_RCC_GetHCLKFreq() / hz; if (div > 255) { div = 255; } else { if ((HAL_RCC_GetHCLKFreq() % hz) == 0) { div = div - 1; } } obj->handle.Init.ClockPrescaler = div; if (HAL_OSPI_Init(&obj->handle) != HAL_OK) { debug_if(qspi_api_c_debug, "HAL_OSPI_Init error\n"); status = QSPI_STATUS_ERROR; } return status; } #else /* OCTOSPI */ qspi_status_t qspi_frequency(qspi_t *obj, int hz) { debug_if(qspi_api_c_debug, "qspi_frequency hz %d\n", hz); qspi_status_t status = QSPI_STATUS_OK; /* HCLK drives QSPI. QSPI clock depends on prescaler value: * 0: Freq = HCLK * 1: Freq = HCLK/2 * ... * 255: Freq = HCLK/256 (minimum value) */ int div = HAL_RCC_GetHCLKFreq() / hz; if (div > 255) { div = 255; } else { if ((HAL_RCC_GetHCLKFreq() % hz) == 0) { div = div - 1; } } obj->handle.Init.ClockPrescaler = div; if (HAL_QSPI_Init(&obj->handle) != HAL_OK) { status = QSPI_STATUS_ERROR; } return status; } #endif /* OCTOSPI */ #if defined(OCTOSPI1) qspi_status_t qspi_write(qspi_t *obj, const qspi_command_t *command, const void *data, size_t *length) { debug_if(qspi_api_c_debug, "qspi_write size %u\n", *length); OSPI_RegularCmdTypeDef st_command; qspi_status_t status = qspi_prepare_command(command, &st_command); if (status != QSPI_STATUS_OK) { return status; } st_command.NbData = *length; if (HAL_OSPI_Command(&obj->handle, &st_command, HAL_OSPI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { debug_if(qspi_api_c_debug, "HAL_OSPI_Command error\n"); status = QSPI_STATUS_ERROR; } else { if (HAL_OSPI_Transmit(&obj->handle, (uint8_t *)data, HAL_OSPI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { debug_if(qspi_api_c_debug, "HAL_OSPI_Transmit error\n"); status = QSPI_STATUS_ERROR; } } return status; } #else /* OCTOSPI */ qspi_status_t qspi_write(qspi_t *obj, const qspi_command_t *command, const void *data, size_t *length) { QSPI_CommandTypeDef st_command; qspi_status_t status = qspi_prepare_command(command, &st_command); if (status != QSPI_STATUS_OK) { return status; } st_command.NbData = *length; if (HAL_QSPI_Command(&obj->handle, &st_command, HAL_QPSI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { status = QSPI_STATUS_ERROR; } else { if (HAL_QSPI_Transmit(&obj->handle, (uint8_t *)data, HAL_QPSI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { status = QSPI_STATUS_ERROR; } } debug_if(qspi_api_c_debug, "qspi_write size %u\n", *length); return status; } #endif /* OCTOSPI */ #if defined(OCTOSPI1) qspi_status_t qspi_read(qspi_t *obj, const qspi_command_t *command, void *data, size_t *length) { OSPI_RegularCmdTypeDef st_command; qspi_status_t status = qspi_prepare_command(command, &st_command); if (status != QSPI_STATUS_OK) { return status; } st_command.NbData = *length; if (HAL_OSPI_Command(&obj->handle, &st_command, HAL_OSPI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { debug_if(qspi_api_c_debug, "HAL_OSPI_Command error\n"); status = QSPI_STATUS_ERROR; } else { if (HAL_OSPI_Receive(&obj->handle, data, HAL_OSPI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { debug_if(qspi_api_c_debug, "HAL_OSPI_Receive error\n"); status = QSPI_STATUS_ERROR; } } debug_if(qspi_api_c_debug, "qspi_read size %u\n", *length); return status; } #else /* OCTOSPI */ qspi_status_t qspi_read(qspi_t *obj, const qspi_command_t *command, void *data, size_t *length) { QSPI_CommandTypeDef st_command; qspi_status_t status = qspi_prepare_command(command, &st_command); if (status != QSPI_STATUS_OK) { return status; } st_command.NbData = *length; if (HAL_QSPI_Command(&obj->handle, &st_command, HAL_QPSI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { status = QSPI_STATUS_ERROR; } else { if (HAL_QSPI_Receive(&obj->handle, data, HAL_QPSI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { status = QSPI_STATUS_ERROR; } } debug_if(qspi_api_c_debug, "qspi_read size %u\n", *length); return status; } #endif /* OCTOSPI */ #if defined(OCTOSPI1) qspi_status_t qspi_command_transfer(qspi_t *obj, const qspi_command_t *command, const void *tx_data, size_t tx_size, void *rx_data, size_t rx_size) { debug_if(qspi_api_c_debug, "qspi_command_transfer tx %u rx %u command %x\n", tx_size, rx_size, command->instruction.value); qspi_status_t status = QSPI_STATUS_OK; if ((tx_data == NULL || tx_size == 0) && (rx_data == NULL || rx_size == 0)) { // only command, no rx or tx OSPI_RegularCmdTypeDef st_command; status = qspi_prepare_command(command, &st_command); if (status != QSPI_STATUS_OK) { return status; } st_command.NbData = 1; st_command.DataMode = HAL_OSPI_DATA_NONE; /* Instruction only */ if (HAL_OSPI_Command(&obj->handle, &st_command, HAL_OSPI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { status = QSPI_STATUS_ERROR; debug_if(qspi_api_c_debug, "HAL_OSPI_Command error\n"); return status; } } else { // often just read a register, check if we need to transmit anything prior reading if (tx_data != NULL && tx_size) { size_t tx_length = tx_size; status = qspi_write(obj, command, tx_data, &tx_length); if (status != QSPI_STATUS_OK) { debug_if(qspi_api_c_debug, "qspi_write error\n"); return status; } } if (rx_data != NULL && rx_size) { size_t rx_length = rx_size; status = qspi_read(obj, command, rx_data, &rx_length); // debug_if(qspi_api_c_debug, "qspi_read %d\n", status); } } return status; } #else /* OCTOSPI */ qspi_status_t qspi_command_transfer(qspi_t *obj, const qspi_command_t *command, const void *tx_data, size_t tx_size, void *rx_data, size_t rx_size) { debug_if(qspi_api_c_debug, "qspi_command_transfer tx %u rx %u command %x\n", tx_size, rx_size, command->instruction.value); qspi_status_t status = QSPI_STATUS_OK; if ((tx_data == NULL || tx_size == 0) && (rx_data == NULL || rx_size == 0)) { // only command, no rx or tx QSPI_CommandTypeDef st_command; status = qspi_prepare_command(command, &st_command); if (status != QSPI_STATUS_OK) { return status; } st_command.NbData = 1; st_command.DataMode = QSPI_DATA_NONE; /* Instruction only */ if (HAL_QSPI_Command(&obj->handle, &st_command, HAL_QPSI_TIMEOUT_DEFAULT_VALUE) != HAL_OK) { status = QSPI_STATUS_ERROR; return status; } } else { // often just read a register, check if we need to transmit anything prior reading if (tx_data != NULL && tx_size) { size_t tx_length = tx_size; status = qspi_write(obj, command, tx_data, &tx_length); if (status != QSPI_STATUS_OK) { return status; } } if (rx_data != NULL && rx_size) { size_t rx_length = rx_size; status = qspi_read(obj, command, rx_data, &rx_length); } } return status; } #endif /* OCTOSPI */ const PinMap *qspi_master_sclk_pinmap() { return PinMap_QSPI_SCLK; } const PinMap *qspi_master_ssel_pinmap() { return PinMap_QSPI_SSEL; } const PinMap *qspi_master_data0_pinmap() { return PinMap_QSPI_DATA0; } const PinMap *qspi_master_data1_pinmap() { return PinMap_QSPI_DATA1; } const PinMap *qspi_master_data2_pinmap() { return PinMap_QSPI_DATA2; } const PinMap *qspi_master_data3_pinmap() { return PinMap_QSPI_DATA3; } #endif /** @}*/
the_stack_data/47761.c
/* This code is adopted from the solution given @ http://effprog.blogspot.com/2011/01/spiral-printing-of-two-dimensional.html */ #include <stdio.h> #define R 3 #define C 6 void spiralPrint(int m, int n, int a[R][C]) { int i, k = 0, l = 0; /* k - starting row index m - ending row index l - starting column index n - ending column index i - iterator */ while (k < m && l < n) { /* Print the first row from the remaining rows */ for (i = l; i < n; ++i) { printf("%d ", a[k][i]); } k++; /* Print the last column from the remaining columns */ for (i = k; i < m; ++i) { printf("%d ", a[i][n-1]); } n--; /* Print the last row from the remaining rows */ if ( k < m) { for (i = n-1; i >= l; --i) { printf("%d ", a[m-1][i]); } m--; } /* Print the first column from the remaining columns */ if (l < n) { for (i = m-1; i >= k; --i) { printf("%d ", a[i][l]); } l++; } } } /* Driver program to test above functions */ int main() { int a[R][C] = { {1, 2, 3, 4, 5, 6}, {7, 8, 9, 10, 11, 12}, {13, 14, 15, 16, 17, 18} }; spiralPrint(R, C, a); return 0; }
the_stack_data/126702384.c
//Classification: #default/n/DAM/NP/aS/D(v)/fr/ln //Written by: Sergey Pomelov //Reviewed by: Igor Eremeev //Comment: #include <stdio.h> int *func(void) { int *p; return p; }; int main(void) { int a; a = *func(); printf("%d",a); return 0; }
the_stack_data/187642246.c
#include <stdio.h> int main(void) { int n, e, d, i, j; while (scanf("%d", &n) == 1) { e = n / 3; d = n - e - 1; for (i = 0; i < n; ++i) { for (j = 0; j < n; ++j) { if (e <= i && i <= d && e <= j && j <= d) if (n % 2 != 0 && i == j && i == ((n - 1) / 2)) printf("4"); else printf("1"); else if (i == j) printf("2"); else if (i+j == n-1) printf("3"); else printf("0"); } printf("\n"); } printf("\n"); } return 0; }
the_stack_data/60027.c
/* Given a string s, find the longest palindromic substring in s. You may assume that the maximum length of s is 1000. */ /* Example 1: */ /* Input: "babad" */ /* Output: "bab" */ /* Note: "aba" is also a valid answer. */ /* Example 2: */ /* Input: "cbbd" */ /* Output: "bb" */ #include <stdio.h> #include <string.h> #include <stdlib.h> int expandAroundCenter(char* s, int left, int right) { while (left >= 0 && s[right] != 0 && s[left] == s[right]) { left--; right++; } return (right-1) - (left+1) + 1; } char* longestPalindrome(char* s) { int len = strlen(s); char *subStr = malloc(len+1); bzero(subStr, len+1); int begin = 0, subLen = 0; for (int i=0; i< len; i++) { int l1 = expandAroundCenter(s, i, i); int l2 = expandAroundCenter(s, i, i+1); int len = l1 > l2 ? l1 : l2; if (len > subLen) { begin = i - (len -1) /2; subLen = len; } } memcpy(subStr, s+begin, subLen); return subStr; } int main() { printf("%s\n", longestPalindrome("abcba")); return 0; }
the_stack_data/547970.c
/** * Reverse words in a string in place */ #include <assert.h> #include <stddef.h> #include <stdio.h> #include <stdlib.h> #include <string.h> int is_not_space_char(char c) { return !(c == ' ' || c == '\n' || c == '\t'); } void reverse_words_in_string(char **str) { int start = 0; int end = 0; while ((*str)[end] != '\0') { while (is_not_space_char((*str)[end])) { if ((*str)[end] == '\0') { break; } end++; } for (int i = start; i < (((end - start) / 2) + start); i++) { char tmp = (*str)[i]; (*str)[i] = (*str)[end - i - 1 + start]; (*str)[end - i - 1 + start] = tmp; } start = ++end; } } int main(int argc, char *argv[]) { /** * Tests: */ char *test_data_01 = malloc(32); char *test_result_01 = malloc(32); strcpy(test_data_01, "Hello World"); strcpy(test_result_01, "olleH dlroW"); reverse_words_in_string(&test_data_01); assert(strcmp(test_data_01, test_result_01) == 0); char *test_data_02 = malloc(32); char *test_result_02 = malloc(32); strcpy(test_data_02, "uma palavra"); strcpy(test_result_02, "amu arvalap"); reverse_words_in_string(&test_data_02); assert(strcmp(test_data_02, test_result_02) == 0); char *test_data_03 = malloc(32); char *test_result_03 = malloc(32); strcpy(test_data_03, "OuTro"); strcpy(test_result_03, "orTuO"); reverse_words_in_string(&test_data_03); assert(strcmp(test_data_03, test_result_03) == 0); char *test_data_04 = malloc(32); char *test_result_04 = malloc(32); strcpy(test_data_04, ""); strcpy(test_result_04, ""); reverse_words_in_string(&test_data_04); assert(strcmp(test_data_04, test_result_04) == 0); /** * char *line; * size_t line_size = 0; - * getline(&line, &line_size, stdin); * * reverse_words_in_string(&line); * printf("%s\n", line); */ return 0; }
the_stack_data/127892.c
/* * Copyright 2013-2016 The OpenSSL Project Authors. All Rights Reserved. * * Licensed under the Apache License 2.0 (the "License"). You may not use * this file except in compliance with the License. You can obtain a copy * in the file LICENSE in the source distribution or at * https://www.openssl.org/source/license.html */ /* * Simple AES CCM test program, uses the same NIST data used for the FIPS * self test but uses the application level EVP APIs. */ #include <stdio.h> #include <openssl/bio.h> #include <openssl/evp.h> /* AES-CCM test data from NIST public test vectors */ static const unsigned char ccm_key[] = { 0xce, 0xb0, 0x09, 0xae, 0xa4, 0x45, 0x44, 0x51, 0xfe, 0xad, 0xf0, 0xe6, 0xb3, 0x6f, 0x45, 0x55, 0x5d, 0xd0, 0x47, 0x23, 0xba, 0xa4, 0x48, 0xe8 }; static const unsigned char ccm_nonce[] = { 0x76, 0x40, 0x43, 0xc4, 0x94, 0x60, 0xb7 }; static const unsigned char ccm_adata[] = { 0x6e, 0x80, 0xdd, 0x7f, 0x1b, 0xad, 0xf3, 0xa1, 0xc9, 0xab, 0x25, 0xc7, 0x5f, 0x10, 0xbd, 0xe7, 0x8c, 0x23, 0xfa, 0x0e, 0xb8, 0xf9, 0xaa, 0xa5, 0x3a, 0xde, 0xfb, 0xf4, 0xcb, 0xf7, 0x8f, 0xe4 }; static const unsigned char ccm_pt[] = { 0xc8, 0xd2, 0x75, 0xf9, 0x19, 0xe1, 0x7d, 0x7f, 0xe6, 0x9c, 0x2a, 0x1f, 0x58, 0x93, 0x9d, 0xfe, 0x4d, 0x40, 0x37, 0x91, 0xb5, 0xdf, 0x13, 0x10 }; static const unsigned char ccm_ct[] = { 0x8a, 0x0f, 0x3d, 0x82, 0x29, 0xe4, 0x8e, 0x74, 0x87, 0xfd, 0x95, 0xa2, 0x8a, 0xd3, 0x92, 0xc8, 0x0b, 0x36, 0x81, 0xd4, 0xfb, 0xc7, 0xbb, 0xfd }; static const unsigned char ccm_tag[] = { 0x2d, 0xd6, 0xef, 0x1c, 0x45, 0xd4, 0xcc, 0xb7, 0x23, 0xdc, 0x07, 0x44, 0x14, 0xdb, 0x50, 0x6d }; void aes_ccm_encrypt(void) { EVP_CIPHER_CTX *ctx; int outlen, tmplen; unsigned char outbuf[1024]; printf("AES CCM Encrypt:\n"); printf("Plaintext:\n"); VR_BIO_dump_fp(stdout, ccm_pt, sizeof(ccm_pt)); ctx = VR_EVP_CIPHER_CTX_new(); /* Set cipher type and mode */ VR_EVP_EncryptInit_ex(ctx, VR_EVP_aes_192_ccm(), NULL, NULL, NULL); /* Set nonce length if default 96 bits is not appropriate */ VR_EVP_CIPHER_CTX_ctrl(ctx, EVP_CTRL_AEAD_SET_IVLEN, sizeof(ccm_nonce), NULL); /* Set tag length */ VR_EVP_CIPHER_CTX_ctrl(ctx, EVP_CTRL_AEAD_SET_TAG, sizeof(ccm_tag), NULL); /* Initialise key and IV */ VR_EVP_EncryptInit_ex(ctx, NULL, NULL, ccm_key, ccm_nonce); /* Set plaintext length: only needed if AAD is used */ VR_EVP_EncryptUpdate(ctx, NULL, &outlen, NULL, sizeof(ccm_pt)); /* Zero or one call to specify any AAD */ VR_EVP_EncryptUpdate(ctx, NULL, &outlen, ccm_adata, sizeof(ccm_adata)); /* Encrypt plaintext: can only be called once */ VR_EVP_EncryptUpdate(ctx, outbuf, &outlen, ccm_pt, sizeof(ccm_pt)); /* Output encrypted block */ printf("Ciphertext:\n"); VR_BIO_dump_fp(stdout, outbuf, outlen); /* Finalise: note get no output for CCM */ VR_EVP_EncryptFinal_ex(ctx, outbuf, &outlen); /* Get tag */ VR_EVP_CIPHER_CTX_ctrl(ctx, EVP_CTRL_AEAD_GET_TAG, 16, outbuf); /* Output tag */ printf("Tag:\n"); VR_BIO_dump_fp(stdout, outbuf, 16); VR_EVP_CIPHER_CTX_free(ctx); } void aes_ccm_decrypt(void) { EVP_CIPHER_CTX *ctx; int outlen, tmplen, rv; unsigned char outbuf[1024]; printf("AES CCM Derypt:\n"); printf("Ciphertext:\n"); VR_BIO_dump_fp(stdout, ccm_ct, sizeof(ccm_ct)); ctx = VR_EVP_CIPHER_CTX_new(); /* Select cipher */ VR_EVP_DecryptInit_ex(ctx, VR_EVP_aes_192_ccm(), NULL, NULL, NULL); /* Set nonce length, omit for 96 bits */ VR_EVP_CIPHER_CTX_ctrl(ctx, EVP_CTRL_AEAD_SET_IVLEN, sizeof(ccm_nonce), NULL); /* Set expected tag value */ VR_EVP_CIPHER_CTX_ctrl(ctx, EVP_CTRL_AEAD_SET_TAG, sizeof(ccm_tag), (void *)ccm_tag); /* Specify key and IV */ VR_EVP_DecryptInit_ex(ctx, NULL, NULL, ccm_key, ccm_nonce); /* Set ciphertext length: only needed if we have AAD */ VR_EVP_DecryptUpdate(ctx, NULL, &outlen, NULL, sizeof(ccm_ct)); /* Zero or one call to specify any AAD */ VR_EVP_DecryptUpdate(ctx, NULL, &outlen, ccm_adata, sizeof(ccm_adata)); /* Decrypt plaintext, verify tag: can only be called once */ rv = VR_EVP_DecryptUpdate(ctx, outbuf, &outlen, ccm_ct, sizeof(ccm_ct)); /* Output decrypted block: if tag verify failed we get nothing */ if (rv > 0) { printf("Plaintext:\n"); VR_BIO_dump_fp(stdout, outbuf, outlen); } else printf("Plaintext not available: tag verify failed.\n"); VR_EVP_CIPHER_CTX_free(ctx); } int main(int argc, char **argv) { aes_ccm_encrypt(); aes_ccm_decrypt(); }
the_stack_data/80561.c
#include <stdio.h> main() { printf("hello, world\n"); }
the_stack_data/162641892.c
/* Projeto 2 Nome: Leonardo de Oliveira Lourenço Data: 19/09/2009 Computação Básica, Turma C, 2/2009 ___________________________________ | | | Descrição do projeto: | |___________________________________| Escreva um programa em C que receba os requisitos do usuário como entrada e gere uma impressão na tela indicando os requisitos do usuário e as quantidades de cada tipo de selo que serão fornecidas, a quantidade total de selos e uma mensagem de agradecimento pelo uso do sistema. O seu programa deve ser estruturado em 4 funções: 1: mensagens de ajuste de tela, cabeçalho e entrada de dados; 2: cálculo das quantidades de selos (saída 1); 3: cálculo das quantidades de selos (saída 2); 4: impressão de resultados). O usuário da máquina deverá indicar a cada pedido de impressão de selos qual o valor total monetário que dispõe e o número de tipos de selos que deseja (de 3 a 9). (Se R$354,00 entrar com 354.00, se US$34.76 entrar com 34.76, sempre com duas casas decimais) Há várias quantidades de selos que poderão satisfazer o pedido do usuário, a máquina deverá emitir sempre duas (2) respostas possíveis, identificando­as: 1) aquela que contém a menor quantidade possível com pelo menos um (1) selo de cada valor do conjunto escolhido; 2) aquela que contém a menor quantidade total de selos impressos, mesmo excluindo algum tipo dentre os escolhidos. *** Sempre igualando-­se ao valor monetário exato do usuário. *** ---###---###---###---###---###---###---###---###---###---###--- VALOR DOS SELOS ---###---###---###---###---###---###---###---###---###---###--- Para número de selos igual a 3 (nSelos = 3) valSelo1 = 1 valSelo2 = 2 valSelo3 = 5 Para número de selos igual a 4 (nSelos = 4) valSelo1 = 1 valSelo2 = 2 valSelo3 = 5 valSelo4 = 10 Para número de selos igual a 5 (nSelos = 5) valSelo1 = 1 valSelo2 = 2 valSelo3 = 5 valSelo4 = 10 valSelo5 = 25 Para número de selos igual a 6 (nSelos = 6) valSelo1 = 1 valSelo2 = 2 valSelo3 = 5 valSelo4 = 10 valSelo5 = 25 valSelo6 = 50 Para número de selos igual a 7 (nSelos = 7) valSelo1 = 1 valSelo2 = 2 valSelo3 = 5 valSelo4 = 10 valSelo5 = 25 valSelo6 = 50 valSelo7 = 100 Para número de selos igual a 8 (nSelos = 8) valSelo1 = 1 valSelo2 = 2 valSelo3 = 5 valSelo4 = 10 valSelo5 = 25 valSelo6 = 50 valSelo7 = 100 valSelo8 = 200 Para número de selos igual a 9 (nSelos = 9) valSelo1 = 1 valSelo2 = 2 valSelo3 = 5 valSelo4 = 10 valSelo5 = 25 valSelo6 = 50 valSelo7 = 100 valSelo8 = 200 valSelo9 = 500 !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! | | | RECOMENDA-SE UTILIZAR O PROGRAMA EM UM TERMINAL ABERTO EM TELA CHEIA DADO O TAMANHO DE ALGUMAS SAIDAS | | | !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! */ //Bibliotecas #include <stdio.h> #include <stdlib.h> /*Funcao que imprime os resultados s500,s200,... = quantidade de selos de cada tipo. */ float imprime(int s500,int s200,int s100,int s50,int s25,int s10,int s5,int s2,int s1){ float soma=0; if(s500>0){ soma+=(s500*5); printf("%d \tselos de 500.\t%.2f\n",s500,soma); } if(s200>0){ soma+=(s200*2.0); printf("%d \tselos de 200.\t%.2f\n",s200,soma); } if(s100>0){ soma+=(s100); printf("%d \tselos de 100.\t%.2f\n",s100,soma); } if(s50>0){ soma+=(s50*0.5); printf("%d \tselos de 50.\t%.2f\n",s50,soma); } if(s25>0){ soma+=(s25*0.25); printf("%d \tselos de 25.\t%.2f\n",s25,soma); } if(s10>0){ soma+=(s10*0.1); printf("%d \tselos de 10.\t%.2f\n",s10,soma); } if(s5>0){ soma+=(s5*0.05); printf("%d \tselos de 5.\t%.2f\n",s5,soma); } if(s2>0){ soma+=(s2*0.02); printf("%d \tselos de 2.\t%.2f\n",s2,soma); } if(s1>0){ soma+=(s1*0.01); printf("%d \tselos de 1.\t%.2f\n",s1,soma); } printf("Total:\t\t%.2f\n\n",soma); } //Funcao que calcula a menor quantidade possível com pelo menos um (1) selo de cada valor do conjunto escolhido; void selos1(float valor,int n){ int valor1; //Variavel que armazenara o valor em numero inteiro de centavos int s1=0,s2=0,s5=0,s10=0,s25=0,s50=0,s100=0,s200=0,s500=0; //Variaveis que armazenarao a quantidade de selos de cada tipo onde o numero que acompanha o "s" é o tipo do selo //Converte o valor em centavos valor*=100; valor1=(int) valor; //Estrutura que atribui pelo menos 1 a cada tipo de selo (quando é possível) switch(n){ case 9: if(valor1>=500){ s500=1; valor1-=500; } if(valor1>=200){ s200=1; valor1-=200; } if(valor1>=100){ s100=1; valor1-=100; } if(valor1>=50){ s50=1; valor1-=50; } if(valor1>=25){ s25=1; valor1-=25; } if(valor1>=10){ s10=1; valor1-=10; } if(valor1>=5){ s5=1; valor1-=5; } if(valor1>=2){ s2=1; valor1-=2; } if(valor1>=1){ s1=1; valor1-=1; } break; case 8: if(valor1>=200){ s200=1; valor1-=200; } if(valor1>=100){ s100=1; valor1-=100; } if(valor1>=50){ s50=1; valor1-=50; } if(valor1>=25){ s25=1; valor1-=25; } if(valor1>=10){ s10=1; valor1-=10; } if(valor1>=5){ s5=1; valor1-=5; } if(valor1>=2){ s2=1; valor1-=2; } if(valor1>=1){ s1=1; valor1-=1; } break; case 7: if(valor1>=100){ s100=1; valor1-=100; } if(valor1>=50){ s50=1; valor1-=50; } if(valor1>=25){ s25=1; valor1-=25; } if(valor1>=10){ s10=1; valor1-=10; } if(valor1>=5){ s5=1; valor1-=5; } if(valor1>=2){ s2=1; valor1-=2; } if(valor1>=1){ s1=1; valor1-=1; } break; case 6: if(valor1>=50){ s50=1; valor1-=50; } if(valor1>=25){ s25=1; valor1-=25; } if(valor1>=10){ s10=1; valor1-=10; } if(valor1>=5){ s5=1; valor1-=5; } if(valor1>=2){ s2=1; valor1-=2; } if(valor1>=1){ s1=1; valor1-=1; } break; case 5: if(valor1>=25){ s25=1; valor1-=25; } if(valor1>=10){ s10=1; valor1-=10; } if(valor1>=5){ s5=1; valor1-=5; } if(valor1>=2){ s2=1; valor1-=2; } if(valor1>=1){ s1=1; valor1-=1; } break; case 4: if(valor1>=10){ s10=1; valor1-=10; } if(valor1>=5){ s5=1; valor1-=5; } if(valor1>=2){ s2=1; valor1-=2; } if(valor1>=1){ s1=1; valor1-=1; } break; default: printf("teste"); if(valor1>=5){ s5=1; valor1-=5; } if(valor1>=2){ s2=1; valor1-=2; } if(valor1>=1){ s1=1; valor1-=1; } } switch(n){ case 9: if(valor1>=500){ s500+=valor1/500; valor1=valor1%500; } if(valor1>=200){ s200+=valor1/200; valor1=valor1%200; } if(valor1>=100){ s100+=valor1/100; valor1=valor1%100; } if(valor1>=50){ s50+=valor1/50; valor1=valor1%50; } if(valor1>=25){ s25+=valor1/25; valor1=valor1%25; } if(valor1>=10){ s10+=valor1/10; valor1=valor1%10; } if(valor1>=5){ s5+=valor1/5; valor1=valor1%5; } if(valor1>=2){ s2+=valor1/2; valor1=valor1%2; } if(valor1==1){ s1++; } break; case 8: if(valor1>=200){ s200+=valor1/200; valor1=valor1%200; } if(valor1>=100){ s100+=valor1/100; valor1=valor1%100; } if(valor1>=50){ s50+=valor1/50; valor1=valor1%50; } if(valor1>=25){ s25+=valor1/25; valor1=valor1%25; } if(valor1>=10){ s10+=valor1/10; valor1=valor1%10; } if(valor1>=5){ s5+=valor1/5; valor1=valor1%5; } if(valor1>=2){ s2+=valor1/2; valor1=valor1%2; } if(valor1==1){ s1++; } break; case 7: if(valor1>=100){ s100+=valor1/100; valor1=valor1%100; } if(valor1>=50){ s50+=valor1/50; valor1=valor1%50; } if(valor1>=25){ s25+=valor1/25; valor1=valor1%25; } if(valor1>=10){ s10+=valor1/10; valor1=valor1%10; } if(valor1>=5){ s5+=valor1/5; valor1=valor1%5; } if(valor1>=2){ s2+=valor1/2; valor1=valor1%2; } if(valor1==1){ s1++; } break; case 6: if(valor1>=50){ s50+=valor1/50; valor1=valor1%50; } if(valor1>=25){ s25+=valor1/25; valor1=valor1%25; } if(valor1>=10){ s10+=valor1/10; valor1=valor1%10; } if(valor1>=5){ s5+=valor1/5; valor1=valor1%5; } if(valor1>=2){ s2+=valor1/2; valor1=valor1%2; } if(valor1==1){ s1++; } break; case 5: if(valor1>=25){ s25+=valor1/25; valor1=valor1%25; } if(valor1>=10){ s10+=valor1/10; valor1=valor1%10; } if(valor1>=5){ s5+=valor1/5; valor1=valor1%5; } if(valor1>=2){ s2+=valor1/2; valor1=valor1%2; } if(valor1==1){ s1++; } break; case 4: if(valor1>=10){ s10+=valor1/10; valor1=valor1%10; } if(valor1>=5){ s5+=valor1/5; valor1=valor1%5; } if(valor1>=2){ s2+=valor1/2; valor1=valor1%2; } if(valor1==1){ s1++; } break; default: if(valor1>=5){ s5+=valor1/5; valor1=valor1%5; } if(valor1>=2){ s2+=valor1/2; valor1=valor1%2; } if(valor1==1){ s1++; } } imprime(s500,s200,s100,s50,s25,s10,s5,s2,s1); } //Funcao que calcula a menor quantidade total de selos impressos, mesmo excluindo algum tipo dentre os escolhidos. void selos2(float valor,int n){ int valor2; int s1=0,s2=0,s5=0,s10=0,s25=0,s50=0,s100=0,s200=0,s500=0; valor*=100; valor2=(int) valor; switch(n){ case 9: if(valor2>=500){ s500=valor2/500; valor2=valor2%500; } if(valor2>=200){ s200=valor2/200; valor2=valor2%200; } if(valor2>=100){ s100=valor2/100; valor2=valor2%100; } if(valor2>=50){ s50=valor2/50; valor2=valor2%50; } if(valor2>=25){ s25=valor2/25; valor2=valor2%25; } if(valor2>=10){ s10=valor2/10; valor2=valor2%10; } if(valor2>=5){ s5=valor2/5; valor2=valor2%5; } if(valor2>=2){ s2=valor2/2; valor2=valor2%2; } if(valor2==1){ s1++; } break; case 8: if(valor2>=200){ s200=valor2/200; valor2=valor2%200; } if(valor2>=100){ s100=valor2/100; valor2=valor2%100; } if(valor2>=50){ s50=valor2/50; valor2=valor2%50; } if(valor2>=25){ s25=valor2/25; valor2=valor2%25; } if(valor2>=10){ s10=valor2/10; valor2=valor2%10; } if(valor2>=5){ s5=valor2/5; valor2=valor2%5; } if(valor2>=2){ s2=valor2/2; valor2=valor2%2; } if(valor2==1){ s1++; } break; case 7: if(valor2>=100){ s100=valor2/100; valor2=valor2%100; } if(valor2>=50){ s50=valor2/50; valor2=valor2%50; } if(valor2>=25){ s25=valor2/25; valor2=valor2%25; } if(valor2>=10){ s10=valor2/10; valor2=valor2%10; } if(valor2>=5){ s5=valor2/5; valor2=valor2%5; } if(valor2>=2){ s2=valor2/2; valor2=valor2%2; } if(valor2==1){ s1++; } break; case 6: if(valor2>=50){ s50=valor2/50; valor2=valor2%50; } if(valor2>=25){ s25=valor2/25; valor2=valor2%25; } if(valor2>=10){ s10=valor2/10; valor2=valor2%10; } if(valor2>=5){ s5=valor2/5; valor2=valor2%5; } if(valor2>=2){ s2=valor2/2; valor2=valor2%2; } if(valor2==1){ s1++; } break; case 5: if(valor2>=25){ s25=valor2/25; valor2=valor2%25; } if(valor2>=10){ s10=valor2/10; valor2=valor2%10; } if(valor2>=5){ s5=valor2/5; valor2=valor2%5; } if(valor2>=2){ s2=valor2/2; valor2=valor2%2; } if(valor2==1){ s1++; } break; case 4: if(valor2>=10){ s10=valor2/10; valor2=valor2%10; } if(valor2>=5){ s5=valor2/5; valor2=valor2%5; } if(valor2>=2){ s2=valor2/2; valor2=valor2%2; } if(valor2==1){ s1++; } break; default: if(valor2>=5){ s5=valor2/5; valor2=valor2%5; } if(valor2>=2){ s2=valor2/2; valor2=valor2%2; } if(valor2==1){ s1++; } } imprime(s500,s200,s100,s50,s25,s10,s5,s2,s1); } int main(void){ float valor; //Variavel que armazena o valor possuido pelo usuario int n; //Variavel que armazena quantidade de selos desejada int val=0; //Variavel de controle system("clear"); //Limpa a tela do{ printf("Informe o valor a ser dividido em selos:\n(Ex: 130.45 - Cento e quarenta e cinco reais e quarenta e cinco centavos)\n"); scanf("%f",&valor); //Checa validade da entrada if(valor<=0){ printf("Valor invalido! Favor informar um valor positivo!\n\n"); } else{ val=1; } }while(val==0); do{ printf("\nQuantos tipos de selo deseja?\n Tipos: 1 - 2 - 5 - 10 - 25 - 50 - 100 - 200 - 500\n"); printf("\nA escolha deve ser entre 3 e 9 tipos!\nA escolha eh cumulativa, ou seja:\n\t3 = 1 - 2 - 5\n\t4=1 - 2 - 5 - 10\nE assim por diante...\n"); scanf("%d",&n); //Checa validade da entrada if(n<3 || n>9){ val=0; system("clear"); printf("Valor invalido! A quantidade desejada deve ser entre 3 e 9!\n"); } else{ val=1; } }while(val==0); //Limpa a tela, informa a validade das entrada e sobre o processamento das mesmas e sobre as diferentes saidas do programa system("clear"); printf("Valores aceitos!\n"); printf("Valor = %.2f\nQuantidade de selos diferentes = %d\n",valor,n); printf("Este programa ira fornecer duas saidas distintas, a saber:\n\n"); printf("\t1) aquela que contém a menor quantidade possível com pelo menos um (1) selo de cada valor do conjunto escolhido;\n"); printf("\t2) aquela que contém a menor quantidade total de selos impressos, mesmo excluindo algum tipo dentre os escolhidos.\n\n"); printf("Processando dados...\n\n"); printf("Saida 1:\n\n"); selos1(valor,n); printf("Saida 2:\n\n"); selos2(valor,n); printf("\n\nFim.\n"); return 0; }
the_stack_data/211081237.c
/*This program calculates the energy, heat capacity, magnetization, magnetic permitivity.*/ /*Boundary condition: periodic boundary condition.*/ /*In this program, J&k are put into T. To fill it to the expressions, just consider the dimensions.*/ #include <stdio.h> #include <stdlib.h> #include <time.h> #include <math.h> #define L 100 #define NGL 1000000 /*Samples Neglected*/ #define N_t 51000000 /*Total samples*/ #define N (N_t-NGL) #define T_i -0.14 #define T_f -0.01 #define Tstep 0.01 #define SIZE_T 500 /*The size of emcx in T axis. Check this before compiling!*/ #define SIZE_R 60 /*The size of emcx in R axis. Check this before compiling!*/ #define R_i 1.0 /*Ration of J2/J1. Initial value.*/ #define R_step 0.1 /*step*/ #define R_f 1.0 /*End of R*/ #define Pi 3.1415926536 double sum_M[2]; /*sum_M[0] denotes the cos part; sum_M[1] denotes the sin part*/ double sum_Mag; double s[L][L]; /*Size of the lattice*/ double sum_E; double T; struct Obsv { double C; double X; double M; double E; }; /********************************/ // FILE *fchk; //chk_sum_E /********************************/ void Inist(); void Mag(); void Energy(double R); void MCP(double R); struct Obsv Cac_obsv(double R); int main() { int i,j; double R; struct Obsv emcx[SIZE_T][SIZE_R]; FILE *ft,*fm,*fx,*fc,*fe,*fr; fr=fopen("R.txt","w"); ft=fopen("T.txt","w"); fx=fopen("X.txt","w"); fc=fopen("C.txt","w"); fm=fopen("M.txt","w"); fe=fopen("E.txt","w"); /**********************************/ //fchk=fopen("Chk_dE.txt","w"); /**********************************/ R=R_i; srand(time(NULL)); for(j=0;R<=R_f;j++) { T=T_i; for(i=0;T<=T_f;i++) { Inist(); emcx[i][j]=Cac_obsv(R); fprintf(fr,"%f\n",R); fprintf(ft,"%f\n",T); fprintf(fx,"%f\n",emcx[i][j].X); fprintf(fc,"%f\n",emcx[i][j].C); fprintf(fm,"%f\n",emcx[i][j].M); fprintf(fe,"%f\n",emcx[i][j].E); printf("-------------\n"); printf("R=%f\n",R); printf("T=%f\n",T); printf("X=%f\n",emcx[i][j].X); printf("C=%f\n",emcx[i][j].C); printf("M=%f\n",emcx[i][j].M); printf("E=%f\n",emcx[i][j].E); T = T+Tstep; } R+=R_step; } fclose(fr); fclose(ft); fclose(fx); fclose(fc); fclose(fm); fclose(fe); /*****************************/ //fclose(fchk); /*****************************/ printf("The End!\n"); } void Inist() /*Initialized lattice. All oriented to one direction*/ { int i,j; for(i=0;i<L;i++) { for(j=0;j<L;j++) { s[i][j]=0; } } } struct Obsv Cac_obsv(double R) { int i; double E_avg=0.0; double E_as=0.0; double M_avg=0.0; double M_as=0.0; struct Obsv emcx; Mag(); Energy(R); for(i=0; i<N_t; i++) { MCP(R); /********************************/ //printf("chk.Cac_obsv.sum_Mag=%f\n",sum_Mag); //printf("chk.Cac_obsv.sum_E=%f\n",sum_E); //fprintf(fchk,"%f\n",sum_E); /********************************/ if(i>=NGL) { E_avg+=(double)sum_E/N; E_as+=(double)sum_E*sum_E/N; M_avg+=(double)sum_Mag/N; M_as+=(double)sum_Mag*sum_Mag/N; } } emcx.E=E_avg; emcx.M=M_avg; emcx.C=(E_as - E_avg*E_avg)/T/T; emcx.X=(M_as - M_avg*M_avg)/T; return emcx; } /*Monte Carlo process.*/ void MCP(double R) { int i,j; double agl_rdm; double sum,sum_tmp,dE; /*sum_tmp is used to cal the energy difference*/ i=rand()%L; j=rand()%L; agl_rdm=(double)rand()/RAND_MAX*2*Pi; /*What if I just make it (double)rand()*/ /*Cal the energy before we add a random angle to s[i][j]*/ if(j%2==0) { if(i%2==0) { sum_tmp=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } else if(i%2==1) { sum_tmp=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } } else if(j%2==1) { if(i%2==1) { sum_tmp=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } else if(i%2==0) { sum_tmp=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } } else { printf("Checkpoint 1! j is neither odd nor even! Attention!"); } /****************************/ //printf("chk.MCP.sum_tmp=%f\n",sum_tmp); /****************************/ /*Add a random angle to s[i][j]*/ s[i][j]+=agl_rdm; /*Exceeding 2*Pi makes not sense in cos or sin func*/ /*Cal the energy after we add a random to s[i][j]*/ if(j%2==0) { if(i%2==0) { sum=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } else if(i%2==1) { sum=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } } else if(j%2==1) { if(i%2==1) { sum=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } else if(i%2==0) { sum=R*(cos(s[i][j]-s[(i+1)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+1)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j+1)%L])+cos(s[i][j]-s[(i-1+L)%L][(j-1+L)%L])+cos(s[i][j]-s[(i+2)%L][j])+cos(s[i][j]-s[(i-2+L)%L][j])); } } else { printf("Checkpoint 2! j is neither odd nor even! Attention!"); } /********************************/ //printf("chk.MCP.sum=%f\n",sum); /********************************/ dE=sum-sum_tmp; /*Attention!*/ /********************************/ //printf("chk.MCP.dE=%f\n",dE); /********************************/ if(dE<=0) { sum_M[0]+=cos(s[i][j])-cos(s[i][j]-agl_rdm); /*Accept&Cal*/ sum_M[1]+=sin(s[i][j])-sin(s[i][j]-agl_rdm); sum_Mag=sqrt(sum_M[0]*sum_M[0]+sum_M[1]*sum_M[1]); sum_E+=dE; } else if(((double)rand()/RAND_MAX)<exp((-1.0)*dE/T)) { sum_M[0]+=cos(s[i][j])-cos(s[i][j]-agl_rdm); /*Accept&Cal*/ sum_M[1]+=sin(s[i][j])-sin(s[i][j]-agl_rdm); sum_Mag=sqrt(sum_M[0]*sum_M[0]+sum_M[1]*sum_M[1]); sum_E+=dE; } else { s[i][j]=s[i][j]-agl_rdm; /*Reject the change*/ } /********************************/ //printf("chk.MCP.sum_M[0]=%f\n",sum_M[0]); //printf("chk.MCP.sum_M[1]=%f\n",sum_M[1]); //printf("chk.MCP.cos(s[i][j])-cos(s[i][j]-agl_rdm)=%f\n",cos(s[i][j])-cos(s[i][j]-agl_rdm)); /********************************/ } void Mag() { // int i,j; // double dM_tmp[2]={0}; // for(i=0;i<L;i++) // { // for(j=0;j<L;j++) // dM_tmp[0]+=cos(s[i][j]); // dM_tmp[1]+=sin(s[i][j]); // } // sum_M[0]=dM_tmp[0]; // sum_M[1]=dM_tmp[1]; sum_M[0]=1.0*L*L; sum_M[1]=0.0; /********************************/ //printf("chk.Mag.sum_M[0]=%f\n",sum_M[0]); //printf("chk.Mag.sum_M[1]=%f\n",sum_M[1]); /********************************/ } void Energy(double R) { // double dE_tmp; // dE_tmp=(3.0+R*6.0)*L*L/2.0; sum_E=(R*6.0)*L*L/2.0; }
the_stack_data/122014563.c
#include <stdio.h> int main(){ char line[81]; int i = 0; printf("type a string\n"); gets(line); while(line[i] != '\0'){ if(line[i] >= 65 && line[i]<= 90) line[i] += 32; i++; } puts(line); }
the_stack_data/508474.c
#include <stdio.h> f() { int i; for (i = 0; i < 5; ++i) puts("nade nade"); } main() { f(); }
the_stack_data/748626.c
#include <stdio.h> int main(int argc, char *argv[]) { printf("%ld",sizeof(short)); return 0; }
the_stack_data/73575769.c
/******************************************************************************* * encoding: UTF-8 * 編譯方式:gcc -o hw1 hw1.c * 執行方式:./hw1 * 程式功能:輸入代表各自分子分母的參數,將兩分數加總,並以最簡分數的形式呈現 ********************************************************************************/ #include <stdio.h> #include <stdlib.h> int main(int argc, char *argv[]) { /* 若使用者在程式後加的參數並非四個,則程式終止 */ if (argc != 5) { printf("\x1b[1;31mPlease input at lease 4 interger as arguments. :)\x1b[0m\n"); return 0; } /* 宣告整數形態並將相關所需值賦值,最大公因數預設為一*/ int num1, denom1, num2, denom2, result_num, result_denom, sim_result_num, sim_result_denom,i; int com=1,max=0,min=0; /* set variable for finding max. common factor */ /* replace scanf ways by using argv and "a to i" ways */ num1 = atoi(argv[1]); denom1 = atoi(argv[2]); /* replace scanf ways by using argv and "a to i" ways */ num2 = atoi(argv[3]); denom2 = atoi(argv[4]); result_num = num1 * denom2 + num2 * denom1; result_denom = denom1 * denom2; /* 比較分子分母大小 */ if(result_num > result_denom) { max = result_num; min = result_denom; } else { min = result_num; max = result_denom; } /* 將較小數字遞減,利用 % 求餘數為0的方式找出兩分數的最大公因數 */ for(i=min;i>1;i--) { if(min%i==0) { if(max%i==0) { com = i; break; } } } /* 分子分母同除以最大公因數 */ sim_result_num = result_num / com; sim_result_denom = result_denom / com ; /* 印出結果 */ printf("%d/%d\n",sim_result_num, sim_result_denom); return 0; }
the_stack_data/162642649.c
// SPDX-License-Identifier: GPL-2.0 /* * Copyright (C) 2018 Davidlohr Bueso. * * Benchmark the various operations allowed for epoll_ctl(2). * The idea is to concurrently stress a single epoll instance */ #ifdef HAVE_EVENTFD /* For the CLR_() macros */ #include <string.h> #include <pthread.h> #include <errno.h> #include <inttypes.h> #include <signal.h> #include <stdlib.h> #include <unistd.h> #include <linux/compiler.h> #include <linux/kernel.h> #include <sys/time.h> #include <sys/resource.h> #include <sys/epoll.h> #include <sys/eventfd.h> #include <internal/cpumap.h> #include <perf/cpumap.h> #include "../util/stat.h" #include <subcmd/parse-options.h> #include "bench.h" #include <err.h> #define printinfo(fmt, arg...) \ do { if (__verbose) printf(fmt, ## arg); } while (0) static unsigned int nthreads = 0; static unsigned int nsecs = 8; static bool done, __verbose, randomize; /* * epoll related shared variables. */ /* Maximum number of nesting allowed inside epoll sets */ #define EPOLL_MAXNESTS 4 enum { OP_EPOLL_ADD, OP_EPOLL_MOD, OP_EPOLL_DEL, EPOLL_NR_OPS, }; static int epollfd; static int *epollfdp; static bool noaffinity; static unsigned int nested = 0; /* amount of fds to monitor, per thread */ static unsigned int nfds = 64; static pthread_mutex_t thread_lock; static unsigned int threads_starting; static struct stats all_stats[EPOLL_NR_OPS]; static pthread_cond_t thread_parent, thread_worker; struct worker { int tid; pthread_t thread; unsigned long ops[EPOLL_NR_OPS]; int *fdmap; }; static const struct option options[] = { OPT_UINTEGER('t', "threads", &nthreads, "Specify amount of threads"), OPT_UINTEGER('r', "runtime", &nsecs, "Specify runtime (in seconds)"), OPT_UINTEGER('f', "nfds", &nfds, "Specify amount of file descriptors to monitor for each thread"), OPT_BOOLEAN( 'n', "noaffinity", &noaffinity, "Disables CPU affinity"), OPT_UINTEGER( 'N', "nested", &nested, "Nesting level epoll hierarchy (default is 0, no nesting)"), OPT_BOOLEAN( 'R', "randomize", &randomize, "Perform random operations on random fds"), OPT_BOOLEAN( 'v', "verbose", &__verbose, "Verbose mode"), OPT_END() }; static const char * const bench_epoll_ctl_usage[] = { "perf bench epoll ctl <options>", NULL }; static void toggle_done(int sig __maybe_unused, siginfo_t *info __maybe_unused, void *uc __maybe_unused) { /* inform all threads that we're done for the day */ done = true; gettimeofday(&bench__end, NULL); timersub(&bench__end, &bench__start, &bench__runtime); } static void nest_epollfd(void) { unsigned int i; struct epoll_event ev; if (nested > EPOLL_MAXNESTS) nested = EPOLL_MAXNESTS; printinfo("Nesting level(s): %d\n", nested); epollfdp = calloc(nested, sizeof(int)); if (!epollfd) err(EXIT_FAILURE, "calloc"); for (i = 0; i < nested; i++) { epollfdp[i] = epoll_create(1); if (epollfd < 0) err(EXIT_FAILURE, "epoll_create"); } ev.events = EPOLLHUP; /* anything */ ev.data.u64 = i; /* any number */ for (i = nested - 1; i; i--) { if (epoll_ctl(epollfdp[i - 1], EPOLL_CTL_ADD, epollfdp[i], &ev) < 0) err(EXIT_FAILURE, "epoll_ctl"); } if (epoll_ctl(epollfd, EPOLL_CTL_ADD, *epollfdp, &ev) < 0) err(EXIT_FAILURE, "epoll_ctl"); } static inline void do_epoll_op(struct worker *w, int op, int fd) { int error; struct epoll_event ev; ev.events = EPOLLIN; ev.data.u64 = fd; switch (op) { case OP_EPOLL_ADD: error = epoll_ctl(epollfd, EPOLL_CTL_ADD, fd, &ev); break; case OP_EPOLL_MOD: ev.events = EPOLLOUT; error = epoll_ctl(epollfd, EPOLL_CTL_MOD, fd, &ev); break; case OP_EPOLL_DEL: error = epoll_ctl(epollfd, EPOLL_CTL_DEL, fd, NULL); break; default: error = 1; break; } if (!error) w->ops[op]++; } static inline void do_random_epoll_op(struct worker *w) { unsigned long rnd1 = random(), rnd2 = random(); int op, fd; fd = w->fdmap[rnd1 % nfds]; op = rnd2 % EPOLL_NR_OPS; do_epoll_op(w, op, fd); } static void *workerfn(void *arg) { unsigned int i; struct worker *w = (struct worker *) arg; struct timespec ts = { .tv_sec = 0, .tv_nsec = 250 }; pthread_mutex_lock(&thread_lock); threads_starting--; if (!threads_starting) pthread_cond_signal(&thread_parent); pthread_cond_wait(&thread_worker, &thread_lock); pthread_mutex_unlock(&thread_lock); /* Let 'em loose */ do { /* random */ if (randomize) { do_random_epoll_op(w); } else { for (i = 0; i < nfds; i++) { do_epoll_op(w, OP_EPOLL_ADD, w->fdmap[i]); do_epoll_op(w, OP_EPOLL_MOD, w->fdmap[i]); do_epoll_op(w, OP_EPOLL_DEL, w->fdmap[i]); } } nanosleep(&ts, NULL); } while (!done); return NULL; } static void init_fdmaps(struct worker *w, int pct) { unsigned int i; int inc; struct epoll_event ev; if (!pct) return; inc = 100/pct; for (i = 0; i < nfds; i+=inc) { ev.data.fd = w->fdmap[i]; ev.events = EPOLLIN; if (epoll_ctl(epollfd, EPOLL_CTL_ADD, w->fdmap[i], &ev) < 0) err(EXIT_FAILURE, "epoll_ct"); } } static int do_threads(struct worker *worker, struct perf_cpu_map *cpu) { pthread_attr_t thread_attr, *attrp = NULL; cpu_set_t cpuset; unsigned int i, j; int ret = 0; if (!noaffinity) pthread_attr_init(&thread_attr); for (i = 0; i < nthreads; i++) { struct worker *w = &worker[i]; w->tid = i; w->fdmap = calloc(nfds, sizeof(int)); if (!w->fdmap) return 1; for (j = 0; j < nfds; j++) { w->fdmap[j] = eventfd(0, EFD_NONBLOCK); if (w->fdmap[j] < 0) err(EXIT_FAILURE, "eventfd"); } /* * Lets add 50% of the fdmap to the epoll instance, and * do it before any threads are started; otherwise there is * an initial bias of the call failing (mod and del ops). */ if (randomize) init_fdmaps(w, 50); if (!noaffinity) { CPU_ZERO(&cpuset); CPU_SET(cpu->map[i % cpu->nr], &cpuset); ret = pthread_attr_setaffinity_np(&thread_attr, sizeof(cpu_set_t), &cpuset); if (ret) err(EXIT_FAILURE, "pthread_attr_setaffinity_np"); attrp = &thread_attr; } ret = pthread_create(&w->thread, attrp, workerfn, (void *)(struct worker *) w); if (ret) err(EXIT_FAILURE, "pthread_create"); } if (!noaffinity) pthread_attr_destroy(&thread_attr); return ret; } static void print_summary(void) { int i; unsigned long avg[EPOLL_NR_OPS]; double stddev[EPOLL_NR_OPS]; for (i = 0; i < EPOLL_NR_OPS; i++) { avg[i] = avg_stats(&all_stats[i]); stddev[i] = stddev_stats(&all_stats[i]); } printf("\nAveraged %ld ADD operations (+- %.2f%%)\n", avg[OP_EPOLL_ADD], rel_stddev_stats(stddev[OP_EPOLL_ADD], avg[OP_EPOLL_ADD])); printf("Averaged %ld MOD operations (+- %.2f%%)\n", avg[OP_EPOLL_MOD], rel_stddev_stats(stddev[OP_EPOLL_MOD], avg[OP_EPOLL_MOD])); printf("Averaged %ld DEL operations (+- %.2f%%)\n", avg[OP_EPOLL_DEL], rel_stddev_stats(stddev[OP_EPOLL_DEL], avg[OP_EPOLL_DEL])); } int bench_epoll_ctl(int argc, const char **argv) { int j, ret = 0; struct sigaction act; struct worker *worker = NULL; struct perf_cpu_map *cpu; struct rlimit rl, prevrl; unsigned int i; argc = parse_options(argc, argv, options, bench_epoll_ctl_usage, 0); if (argc) { usage_with_options(bench_epoll_ctl_usage, options); exit(EXIT_FAILURE); } memset(&act, 0, sizeof(act)); sigfillset(&act.sa_mask); act.sa_sigaction = toggle_done; sigaction(SIGINT, &act, NULL); cpu = perf_cpu_map__new(NULL); if (!cpu) goto errmem; /* a single, main epoll instance */ epollfd = epoll_create(1); if (epollfd < 0) err(EXIT_FAILURE, "epoll_create"); /* * Deal with nested epolls, if any. */ if (nested) nest_epollfd(); /* default to the number of CPUs */ if (!nthreads) nthreads = cpu->nr; worker = calloc(nthreads, sizeof(*worker)); if (!worker) goto errmem; if (getrlimit(RLIMIT_NOFILE, &prevrl)) err(EXIT_FAILURE, "getrlimit"); rl.rlim_cur = rl.rlim_max = nfds * nthreads * 2 + 50; printinfo("Setting RLIMIT_NOFILE rlimit from %" PRIu64 " to: %" PRIu64 "\n", (uint64_t)prevrl.rlim_max, (uint64_t)rl.rlim_max); if (setrlimit(RLIMIT_NOFILE, &rl) < 0) err(EXIT_FAILURE, "setrlimit"); printf("Run summary [PID %d]: %d threads doing epoll_ctl ops " "%d file-descriptors for %d secs.\n\n", getpid(), nthreads, nfds, nsecs); for (i = 0; i < EPOLL_NR_OPS; i++) init_stats(&all_stats[i]); pthread_mutex_init(&thread_lock, NULL); pthread_cond_init(&thread_parent, NULL); pthread_cond_init(&thread_worker, NULL); threads_starting = nthreads; gettimeofday(&bench__start, NULL); do_threads(worker, cpu); pthread_mutex_lock(&thread_lock); while (threads_starting) pthread_cond_wait(&thread_parent, &thread_lock); pthread_cond_broadcast(&thread_worker); pthread_mutex_unlock(&thread_lock); sleep(nsecs); toggle_done(0, NULL, NULL); printinfo("main thread: toggling done\n"); for (i = 0; i < nthreads; i++) { ret = pthread_join(worker[i].thread, NULL); if (ret) err(EXIT_FAILURE, "pthread_join"); } /* cleanup & report results */ pthread_cond_destroy(&thread_parent); pthread_cond_destroy(&thread_worker); pthread_mutex_destroy(&thread_lock); for (i = 0; i < nthreads; i++) { unsigned long t[EPOLL_NR_OPS]; for (j = 0; j < EPOLL_NR_OPS; j++) { t[j] = worker[i].ops[j]; update_stats(&all_stats[j], t[j]); } if (nfds == 1) printf("[thread %2d] fdmap: %p [ add: %04ld; mod: %04ld; del: %04lds ops ]\n", worker[i].tid, &worker[i].fdmap[0], t[OP_EPOLL_ADD], t[OP_EPOLL_MOD], t[OP_EPOLL_DEL]); else printf("[thread %2d] fdmap: %p ... %p [ add: %04ld ops; mod: %04ld ops; del: %04ld ops ]\n", worker[i].tid, &worker[i].fdmap[0], &worker[i].fdmap[nfds-1], t[OP_EPOLL_ADD], t[OP_EPOLL_MOD], t[OP_EPOLL_DEL]); } print_summary(); close(epollfd); return ret; errmem: err(EXIT_FAILURE, "calloc"); } #endif // HAVE_EVENTFD
the_stack_data/90763357.c
/* ABC086C - Traveling */ #include <stdio.h> #include <stdlib.h> #include <stdbool.h> #include <stdint.h> #define abs(x) ((x) < 0 ? (-(x)) : (x)) struct Coord { int32_t x, y; }; int32_t distance(struct Coord a, struct Coord b) { return abs(a.x - b.x) + abs(a.y - b.y); } struct TXY { int32_t t; struct Coord c; }; bool solver(int32_t N, struct TXY A[]) { struct TXY previous = {0}; for (int32_t i = 0; i < N; ++i) { int32_t dt = A[i].t - previous.t; int32_t dist = distance(A[i].c, previous.c); if (dt < dist) return false; else if ((dt - dist) % 2 != 0) return false; previous = A[i]; } return true; } int main() { static struct TXY A[100000]; int32_t N; scanf("%d", &N); for (int32_t i = 0; i < N; ++i) { scanf("%d %d %d", &A[i].t, &A[i].c.x, &A[i].c.y); } solver(N, A) ? puts("Yes") : puts("No"); return 0; }
the_stack_data/124649.c
// Fig. 6.5: fig06_05.c // Initalizing the elements of array s to the even integers from 2 to 20. #include <stdio.h> #ifndef SIZE #define SIZE 5 #endif // function main begins program execution int main(int argc, char const *argv[]) { // symbloic constant SZIE can be used to specify array size int s[SIZE]; for (size_t j = 0; j < SIZE; ++j) { s[j] = 2 + 2 * j; } printf("%s%13s\n", "Element", "Value"); // output cantents array s in tabular format for (size_t j = 0; j < SIZE; ++j) { printf("%7lu%13d\n", j, s[j]); } }
the_stack_data/122016830.c
#include <stdio.h> #include <string.h> struct batsman { char name[100]; int run; int dis; }; int main() { struct batsman b[5]; int i; float avg; char username[100]; scanf(" %[^\n]", username); for (i = 0; i < 3; i++) { printf("batsman[%d]:", i); scanf(" %[^\n]s", b[i].name); printf("run[%d]:", i); scanf("%d", &b[i].run); printf("dism[%d]:", i); scanf("%d", &b[i].dis); avg = b[i].run / b[i].dis; if (strcpy(username, b[i].name)==0) { printf("avg=%.2f", avg); } } }
the_stack_data/147014190.c
#include <unistd.h> #include <stdio.h> #include <stdlib.h> #include <string.h> #include <sys/types.h> #include <sys/wait.h> #include <sys/stat.h> #include <fcntl.h> #include <sys/mman.h> #include <errno.h> #include <pthread.h> #include <semaphore.h> // barriera di n threads // mutex e barrier sono implementati tramite due semafori senza nome // vedere anche: // https://github.com/marcotessarotto/exOpSys/tree/master/008.04threads-barrier #define N 10 sem_t mutex; sem_t barrier; int count; // variabile condivisa tra i due thread int number_of_threads = N; /* rendezvous mutex.wait() count = count + 1 mutex.signal() if count == n : barrier.signal() barrier.wait() barrier.signal() critical point */ void * thread_function(void * arg) { printf("rendezvous\n"); // mutex.wait() // count = count + 1 // mutex.signal() if (sem_wait(&mutex) == -1) { perror("sem_wait"); exit(EXIT_FAILURE); } count++; if (sem_post(&mutex) == -1) { perror("sem_post"); exit(EXIT_FAILURE); } // // if count == n : // barrier.signal() if (count == number_of_threads) { if (sem_post(&barrier) == -1) { perror("sem_post"); exit(EXIT_FAILURE); } } // turnstile (tornello) // barrier.wait() // barrier.signal() if (sem_wait(&barrier) == -1) { perror("sem_wait"); exit(EXIT_FAILURE); } if (sem_post(&barrier) == -1) { perror("sem_post"); exit(EXIT_FAILURE); } // printf("critical point\n"); return NULL; } #define CHECK_ERR(a,msg) {if ((a) == -1) { perror((msg)); exit(EXIT_FAILURE); } } int main() { int s; pthread_t threads[N]; s = sem_init(&mutex, 0, // 1 => il semaforo è condiviso tra processi, // 0 => il semaforo è condiviso tra threads del processo 1 // valore iniziale del semaforo ); CHECK_ERR(s,"sem_init") s = sem_init(&barrier, 0, // 1 => il semaforo è condiviso tra processi, // 0 => il semaforo è condiviso tra threads del processo 0 // valore iniziale del semaforo ); CHECK_ERR(s,"sem_init") for (int i=0; i < number_of_threads; i++) { s = pthread_create(&threads[i], NULL, thread_function, NULL); if (s != 0) { perror("pthread_create"); exit(EXIT_FAILURE); } } for (int i=0; i < number_of_threads; i++) { s = pthread_join(threads[i], NULL); if (s != 0) { perror("pthread_join"); exit(EXIT_FAILURE); } } s = sem_destroy(&mutex); CHECK_ERR(s,"sem_destroy") s = sem_destroy(&barrier); CHECK_ERR(s,"sem_destroy") printf("bye\n"); return 0; }
the_stack_data/51700175.c
#include <unistd.h> int main() { int rc = 0; if (write(STDIN_FILENO, "test\n", 5) != 5) rc |= 1; if (write(STDOUT_FILENO, "test\n", 5) != 5) rc |= 2; if (write(STDERR_FILENO, "test\n", 5) != 5) rc |= 4; return rc; }
the_stack_data/102287.c
/* * Sequential Mandelbrot program * * This program computes and displays all or part of the Mandelbrot * set. By default, it examines all points in the complex plane * that have both real and imaginary parts between -2 and 2. * Command-line parameters allow zooming in on a specific part of * this range. * * Usage: * mandel [-i maxiter -c x0 y0 -s size -w windowsize] * where * maxiter denotes the maximum number of iterations at each point -- by default 1000 * x0, y0, and size specify the range to examine (a square * centered at (x0 + iy0) of size 2*size by 2*size -- by default, * a square of size 4 by 4 centered at the origin) * windowsize denotes the size of the image (diplay window) to compute * * Input: none, except the optional command-line arguments * Output: a graphical display as described in Wilkinson & Allen, * displayed using the X Window system, plus text output to * standard output showing the above parameters, plus execution * time in seconds. * * Code based on the original code from Web site for Wilkinson and Allen's * text on parallel programming: * http://www.cs.uncc.edu/~abw/parallel/par_prog/ * */ #include <stdio.h> #include <stdlib.h> #include <string.h> #include <math.h> #include <unistd.h> #include <malloc.h> #if _DISPLAY_ #include <X11/Xlib.h> #include <X11/Xutil.h> #include <X11/Xos.h> #endif #include <sys/time.h> double getusec_() { struct timeval time; gettimeofday(&time, NULL); return ((double)time.tv_sec * (double)1e6 + (double)time.tv_usec); } #define START_COUNT_TIME stamp = getusec_(); #define STOP_COUNT_TIME(_m) stamp = getusec_() - stamp;\ stamp = stamp/1e6;\ printf ("%s: %0.6fs\n",(_m), stamp); /* Default values for things. */ #define N 2 /* size of problem space (x, y from -N to N) */ #define NPIXELS 800 /* size of display window in pixels */ int row, col; // variables used to traverse the problem space /* Structure definition for complex numbers */ typedef struct { double real, imag; } complex; #if _DISPLAY_ /* Functions for GUI */ #include "mandelbrot-gui.h" /* has setup(), interact() */ #endif void mandelbrot(int height, int width, double real_min, double imag_min, double scale_real, double scale_imag, int maxiter, #if _DISPLAY_ int setup_return, Display *display, Window win, GC gc, double scale_color, double min_color) #else int ** output) #endif { /* Calculate points and save/display */ #pragma omp parallel #pragma omp single for (int row = 0; row < height; ++row) { #pragma omp taskgroup for (int col = 0; col < width; ++col) { #pragma omp task firstprivate(row, col) { complex z, c; z.real = z.imag = 0; /* Scale display coordinates to actual region */ c.real = real_min + ((double) col * scale_real); c.imag = imag_min + ((double) (height-1-row) * scale_imag); /* height-1-row so y axis displays * with larger values at top */ /* Calculate z0, z1, .... until divergence or maximum iterations */ int k = 0; double lengthsq, temp; do { temp = z.real*z.real - z.imag*z.imag + c.real; z.imag = 2*z.real*z.imag + c.imag; z.real = temp; lengthsq = z.real*z.real + z.imag*z.imag; ++k; } while (lengthsq < (N*N) && k < maxiter); #if _DISPLAY_ /* Scale color and display point */ long color = (long) ((k-1) * scale_color) + min_color; if (setup_return == EXIT_SUCCESS) { #pragma omp critical { XSetForeground (display, gc, color); XDrawPoint (display, win, gc, col, row); } } #else output[row][col]=k; #endif } } } } int main(int argc, char *argv[]) { int maxiter = 1000; double real_min; double real_max; double imag_min; double imag_max; int width = NPIXELS; /* dimensions of display window */ int height = NPIXELS; double size=N, x0 = 0, y0 = 0; #if _DISPLAY_ Display *display; Window win; GC gc; int setup_return; long min_color = 0, max_color = 0; double scale_color; #else int ** output; FILE *fp = NULL; #endif double scale_real, scale_imag; /* Process command-line arguments */ for (int i=1; i<argc; i++) { if (strcmp(argv[i], "-i")==0) { maxiter = atoi(argv[++i]); } else if (strcmp(argv[i], "-w")==0) { width = atoi(argv[++i]); height = width; } else if (strcmp(argv[i], "-s")==0) { size = atof(argv[++i]); } #if !_DISPLAY_ else if (strcmp(argv[i], "-o")==0) { if((fp=fopen("parallel.out", "wb"))==NULL) { fprintf(stderr, "Unable to open file\n"); return EXIT_FAILURE; } } #endif else if (strcmp(argv[i], "-c")==0) { x0 = atof(argv[++i]); y0 = atof(argv[++i]); } else { #if _DISPLAY_ fprintf(stderr, "Usage: %s [-i maxiter -w windowsize -c x0 y0 -s size]\n", argv[0]); #else fprintf(stderr, "Usage: %s [-o -i maxiter -w windowsize -c x0 y0 -s size]\n", argv[0]); fprintf(stderr, " -o to write computed image to disk (default no file generated)\n"); #endif fprintf(stderr, " -i to specify maximum number of iterations at each point (default 1000)\n"); #if _DISPLAY_ fprintf(stderr, " -w to specify the size of the display window (default 800x800 pixels)\n"); #else fprintf(stderr, " -w to specify the size of the image to compute (default 800x800 elements)\n"); #endif fprintf(stderr, " -c to specify the center x0+iy0 of the square to compute (default origin)\n"); fprintf(stderr, " -s to specify the size of the square to compute (default 2, i.e. size 4 by 4)\n"); return EXIT_FAILURE; } } real_min = x0 - size; real_max = x0 + size; imag_min = y0 - size; imag_max = y0 + size; /* Produce text output */ fprintf(stdout, "\n"); fprintf(stdout, "Mandelbrot program\n"); fprintf(stdout, "center = (%g, %g), size = %g\n", (real_max + real_min)/2, (imag_max + imag_min)/2, (real_max - real_min)/2); fprintf(stdout, "maximum iterations = %d\n", maxiter); fprintf(stdout, "\n"); #if _DISPLAY_ /* Initialize for graphical display */ setup_return = setup(width, height, &display, &win, &gc, &min_color, &max_color); if (setup_return != EXIT_SUCCESS) { fprintf(stderr, "Unable to initialize display, continuing\n"); return EXIT_FAILURE; } #else output = malloc(height*sizeof(int *)); for (int row = 0; row < height; ++row) output[row] = malloc(width*sizeof(int)); #endif /* Compute factors to scale computational region to window */ scale_real = (double) (real_max - real_min) / (double) width; scale_imag = (double) (imag_max - imag_min) / (double) height; #if _DISPLAY_ /* Compute factor for color scaling */ scale_color = (double) (max_color - min_color) / (double) (maxiter - 1); #endif /* Start timing */ double stamp; START_COUNT_TIME; #if _DISPLAY_ mandelbrot(height,width,real_min, imag_min, scale_real, scale_imag, maxiter, setup_return, display, win, gc, scale_color, min_color); #else mandelbrot(height,width,real_min, imag_min, scale_real, scale_imag, maxiter, output); #endif /* End timing */ STOP_COUNT_TIME("Total execution time"); /* Be sure all output is written */ #if _DISPLAY_ if (setup_return == EXIT_SUCCESS) { XFlush (display); } #else if (fp != NULL) { for (int row = 0; row < height; ++row) if(fwrite(output[row], sizeof(int), width, fp) != width) { fprintf(stderr, "Output file not written correctly\n"); } } #endif #if _DISPLAY_ /* Wait for user response, then exit program */ if (setup_return == EXIT_SUCCESS) { interact(display, &win, width, height, real_min, real_max, imag_min, imag_max); } return EXIT_SUCCESS; #endif }
the_stack_data/82832.c
// print 2 #include<stdio.h> int main() { int a,b,i; scanf("%d%d",&a,&b); for(i=a;i<=b;i++) printf("%d\n",i); return 0; }
the_stack_data/64199034.c
/* The Computer Language Benchmarks Game * http://benchmarksgame.alioth.debian.org/ * * by Paul Hsieh */ /* * COMMAND LINE DEFINES * * -DSTATIC * Make locals static. * * -DPRINTF * Enable printing of results. * * -DTIMER * Insert asm labels into source code at timing points (Z88DK). * * -DCOMMAND * Enable reading of N from the command line. * */ #ifdef STATIC #undef STATIC #define STATIC static #else #define STATIC #endif #ifdef PRINTF #define PRINTF2(a,b) printf(a,b) #define PRINTF3(a,b,c) printf(a,b,c) #define PUTS(a) puts(a) #else #define PRINTF2(a,b) #define PRINTF3(a,b,c) #define PUTS(a) #endif #ifdef TIMER #define TIMER_START() asm("TIMER_START:") #define TIMER_STOP() asm("TIMER_STOP:") #else #define TIMER_START() #define TIMER_STOP() #endif #ifdef __Z88DK #include <intrinsic.h> #ifdef PRINTF // enable printf %s #pragma output CLIB_OPT_PRINTF = 0x200 #endif #ifdef COMMAND // enable scanf %d #pragma output CLIB_OPT_SCANF = 0x01 #endif #endif #include <stdio.h> #include <stdlib.h> #include <string.h> #define IM 139968 #define IA 3877 #define IC 29573 double gen_random (double max) { static long last = 42; return max * (last = (last * IA + IC) % IM) / IM; } struct aminoacids { char c; double p; }; /* Weighted selection from alphabet */ void makeCumulative (struct aminoacids * genelist, int count) { STATIC int i; #ifdef STATIC STATIC double cp; cp = 0.0; #else double cp = 0.0; #endif for (i=0; i < count; i++) { cp += genelist[i].p; genelist[i].p = cp; } } char selectRandom (const struct aminoacids * genelist, int count) { STATIC int i, lo, hi; #ifdef STATIC static double r; r = gen_random (1); #else double r = gen_random (1); #endif if (r < genelist[0].p) return genelist[0].c; lo = 0; hi = count-1; while (hi > lo+1) { i = (hi + lo) / 2; if (r < genelist[i].p) hi = i; else lo = i; } return genelist[hi].c; } /* Generate and write FASTA format */ #define LINE_LENGTH (60) void makeRandomFasta (const char * id, const char * desc, const struct aminoacids * genelist, int count, int n) { STATIC int i, m; #ifdef STATIC static int todo; static char pick[LINE_LENGTH+1]; todo = n; #else int todo = n; char pick[LINE_LENGTH+1]; #endif PRINTF3(">%s %s\n", id, desc); for (; todo > 0; todo -= LINE_LENGTH) { // char pick[LINE_LENGTH+1]; if (todo < LINE_LENGTH) m = todo; else m = LINE_LENGTH; for (i=0; i < m; i++) pick[i] = selectRandom(genelist, count); pick[m] = '\0'; PUTS(pick); } } void makeRepeatFasta (const char * id, const char * desc, const char *s, int n) { STATIC char * ss; STATIC int m; #ifdef STATIC static int k; static int todo; static int kn; k = 0; todo = n; kn = strlen(s); #else int k = 0, todo = n, kn = strlen(s); #endif ss = (char *) malloc (kn + 1); memcpy (ss, s, kn+1); PRINTF3(">%s %s\n", id, desc); for (; todo > 0; todo -= LINE_LENGTH) { if (todo < LINE_LENGTH) m = todo; else m = LINE_LENGTH; while (m >= kn - k) { PRINTF2("%s", s+k); m -= kn - k; k = 0; } ss[k + m] = '\0'; PUTS(ss+k); ss[k + m] = s[m+k]; k += m; } free (ss); } /* Main -- define alphabets, make 3 fragments */ struct aminoacids iub[] = { { 'a', 0.27 }, { 'c', 0.12 }, { 'g', 0.12 }, { 't', 0.27 }, { 'B', 0.02 }, { 'D', 0.02 }, { 'H', 0.02 }, { 'K', 0.02 }, { 'M', 0.02 }, { 'N', 0.02 }, { 'R', 0.02 }, { 'S', 0.02 }, { 'V', 0.02 }, { 'W', 0.02 }, { 'Y', 0.02 } }; #define IUB_LEN (sizeof (iub) / sizeof (struct aminoacids)) struct aminoacids homosapiens[] = { { 'a', 0.3029549426680 }, { 'c', 0.1979883004921 }, { 'g', 0.1975473066391 }, { 't', 0.3015094502008 }, }; #define HOMOSAPIENS_LEN (sizeof (homosapiens) / sizeof (struct aminoacids)) char alu[] = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" \ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" \ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" \ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" \ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" \ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" \ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; int main (int argc, char * argv[]) { STATIC int n = 1000; #ifdef COMMAND if (argc > 1) sscanf(argv[1], "%d", &n); #endif TIMER_START(); makeCumulative (iub, IUB_LEN); makeCumulative (homosapiens, HOMOSAPIENS_LEN); makeRepeatFasta ("ONE", "Homo sapiens alu", alu, n*2); makeRandomFasta ("TWO", "IUB ambiguity codes", iub, IUB_LEN, n*3); makeRandomFasta ("THREE", "Homo sapiens frequency", homosapiens, HOMOSAPIENS_LEN, n*5); TIMER_STOP(); return 0; }
the_stack_data/365793.c
// // KSCPU_x86_32.c // // Created by Karl Stenerud on 2012-01-29. // // Copyright (c) 2012 Karl Stenerud. All rights reserved. // // Permission is hereby granted, free of charge, to any person obtaining a copy // of this software and associated documentation files (the "Software"), to deal // in the Software without restriction, including without limitation the rights // to use, copy, modify, merge, publish, distribute, sublicense, and/or sell // copies of the Software, and to permit persons to whom the Software is // furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall remain in place // in this source code. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR // IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, // FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE // AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER // LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, // OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN // THE SOFTWARE. // #if defined (__i386__) #include "Raygun_KSCPU.h" #include "Raygun_KSCPU_Apple.h" #include "Raygun_KSMachineContext.h" #include "Raygun_KSMachineContext_Apple.h" #include <stdlib.h> //#define Raygun_KSLogger_LocalLevel TRACE #include "Raygun_KSLogger.h" static const char* g_registerNames[] = { "eax", "ebx", "ecx", "edx", "edi", "esi", "ebp", "esp", "ss", "eflags", "eip", "cs", "ds", "es", "fs", "gs", }; static const int g_registerNamesCount = sizeof(g_registerNames) / sizeof(*g_registerNames); static const char* g_exceptionRegisterNames[] = { "trapno", "err", "faultvaddr" }; static const int g_exceptionRegisterNamesCount = sizeof(g_exceptionRegisterNames) / sizeof(*g_exceptionRegisterNames); uintptr_t raygun_kscpu_framePointer(const Raygun_KSMachineContext* const context) { return context->machineContext.__ss.__ebp; } uintptr_t raygun_kscpu_stackPointer(const Raygun_KSMachineContext* const context) { return context->machineContext.__ss.__esp; } uintptr_t raygun_kscpu_instructionAddress(const Raygun_KSMachineContext* const context) { return context->machineContext.__ss.__eip; } uintptr_t raygun_kscpu_linkRegister(__unused const Raygun_KSMachineContext* const context) { return 0; } void raygun_kscpu_getState(Raygun_KSMachineContext* context) { thread_t thread = context->thisThread; STRUCT_MCONTEXT_L* const machineContext = &context->machineContext; raygun_kscpu_i_fillState(thread, (thread_state_t)&machineContext->__ss, x86_THREAD_STATE32, x86_THREAD_STATE32_COUNT); raygun_kscpu_i_fillState(thread, (thread_state_t)&machineContext->__es, x86_EXCEPTION_STATE32, x86_EXCEPTION_STATE32_COUNT); } int raygun_kscpu_numRegisters(void) { return g_registerNamesCount; } const char* raygun_kscpu_registerName(const int regNumber) { if(regNumber < raygun_kscpu_numRegisters()) { return g_registerNames[regNumber]; } return NULL; } uint64_t raygun_kscpu_registerValue(const Raygun_KSMachineContext* const context, const int regNumber) { switch(regNumber) { case 0: return context->machineContext.__ss.__eax; case 1: return context->machineContext.__ss.__ebx; case 2: return context->machineContext.__ss.__ecx; case 3: return context->machineContext.__ss.__edx; case 4: return context->machineContext.__ss.__edi; case 5: return context->machineContext.__ss.__esi; case 6: return context->machineContext.__ss.__ebp; case 7: return context->machineContext.__ss.__esp; case 8: return context->machineContext.__ss.__ss; case 9: return context->machineContext.__ss.__eflags; case 10: return context->machineContext.__ss.__eip; case 11: return context->machineContext.__ss.__cs; case 12: return context->machineContext.__ss.__ds; case 13: return context->machineContext.__ss.__es; case 14: return context->machineContext.__ss.__fs; case 15: return context->machineContext.__ss.__gs; } RAYGUN_KSLOG_ERROR("Invalid register number: %d", regNumber); return 0; } int raygun_kscpu_numExceptionRegisters(void) { return g_exceptionRegisterNamesCount; } const char* raygun_kscpu_exceptionRegisterName(const int regNumber) { if(regNumber < raygun_kscpu_numExceptionRegisters()) { return g_exceptionRegisterNames[regNumber]; } RAYGUN_KSLOG_ERROR("Invalid register number: %d", regNumber); return NULL; } uint64_t raygun_kscpu_exceptionRegisterValue(const Raygun_KSMachineContext* const context, const int regNumber) { switch(regNumber) { case 0: return context->machineContext.__es.__trapno; case 1: return context->machineContext.__es.__err; case 2: return context->machineContext.__es.__faultvaddr; } RAYGUN_KSLOG_ERROR("Invalid register number: %d", regNumber); return 0; } uintptr_t raygun_kscpu_faultAddress(const Raygun_KSMachineContext* const context) { return context->machineContext.__es.__faultvaddr; } int raygun_kscpu_stackGrowDirection(void) { return -1; } #endif
the_stack_data/192331625.c
#include <stdio.h> #include <stdlib.h> #include <string.h> void vulnFunction(char *input) { char buffer[16] = {'\0'}; printf("Hint: Address of buffer: %x\n", &buffer); strcpy(buffer, input); //copy input to buffer printf("Hello %s!\n",buffer); } int main(int argc, char *argv[]) { vulnFunction(argv[1]); }
the_stack_data/635386.c
/* crystal_generator.c */ #include <stdio.h> int main(int argc, char *argv[]) { double l = 1.414213562373; double i, j, k; double max_x = 6; double max_y = 6; double max_z = 6; for (i=0; i<3; i++) { for (j=0; j<3; j++) { for (k=0; k<3; k++) { printf("%lf\t%lf\t%lf\n", i*l, j*l, k*l); printf("%lf\t%lf\t%lf\n", i*l + l/2, j*l + l/2, k*l); printf("%lf\t%lf\t%lf\n", i*l, j*l + l/2, k*l + l/2); printf("%lf\t%lf\t%lf\n", i*l + l/2, j*l, k*l + l/2); } } } return 0; }
the_stack_data/89200431.c
/* nosc-server.c -- an OSC server for Nyquist */ /* * this enables OSC clients to set slider values in Nyquist * for security reasons, OSC clients cannot invoke Lisp expressions * the only operation allowed is to set a value in a Lisp array * * The API is: * * int nosc_init() -- initialize the server, return error, 0 means none * int nosc_poll() -- poll for messages and process them, return error, 0 means none * void nosc_finish() -- free data structures, return error, 0 means none */ #ifdef OSC #ifdef WIN32 #include <winsock2.h> #include <malloc.h> #include <process.h> #else #include <stdlib.h> #include <sys/time.h> #include <sys/types.h> #include <strings.h> #include <unistd.h> #include <stdio.h> #endif #include "xlisp.h" #include "sound.h" /* to get nosc_enabled */ #include "lo/lo.h" #include "sliders.h" static lo_server the_server = NULL; static int lo_fd; static void error(int num, const char *msg, const char *path) { char s[256]; sprintf(s, "liblo server error %d in path %s: %s\n", num, path, msg); stdputstr(s); } static int slider_handler(const char *path, const char *types, lo_arg **argv, int argc, void *data, void *user_data) { // printf("%s <- %d, %g\n", path, argv[0]->i, argv[1]->f); // fflush(stdout); set_slider(argv[0]->i, argv[1]->f); return 0; } // wii_orientation_handler -- controls sliders 0 and 1 in range [0, 1] // using wii orientation messages from OSC static int wii_orientation_handler(const char *path, const char *types, lo_arg **argv, int argc, void *data, void *user_data) { set_slider(0, min(1.0F, max(0.0F, (argv[0]->f / 180) + 0.5))); set_slider(1, min(1.0F, max(0.0F, (argv[1]->f / 180) + 0.5))); return 0; } int nosc_init() { the_server = lo_server_new("7770", error); /* add method that will match the path /slider, with two numbers, coerced * to int and float */ lo_server_add_method(the_server, "/slider", "if", slider_handler, NULL); lo_server_add_method(the_server, "/wii/orientation", "ff", wii_orientation_handler, NULL); lo_fd = lo_server_get_socket_fd(the_server); nosc_enabled = true; return 0; } int nosc_poll() { fd_set rfds; struct timeval tv; int retval; // loop, receiving all pending OSC messages while (true) { FD_ZERO(&rfds); FD_SET(lo_fd, &rfds); tv.tv_sec = 0; tv.tv_usec = 0; retval = select(lo_fd + 1, &rfds, NULL, NULL, &tv); if (retval == -1) { stdputstr("select() error in nosc_poll\n"); return -1; } else if (retval > 0 && FD_ISSET(lo_fd, &rfds)) { /* printf("lo_server_recv_noblock 1\n"); */ lo_server_recv_noblock(the_server, 0); } else { return 0; } } } void nosc_finish() { lo_server_free(the_server); nosc_enabled = false; } #endif
the_stack_data/34513547.c
// #include <stdio.h> // int main (){ // int i,j,k; // printf("Endereço de i = %p\n",&i); // printf("Endereço de i = %p\n",&k); // printf("Endereço de i = %p\n",&j); // return 0; // } #include <stdio.h> float func(float *n1, float *n2, float *n3,float *n4, float *media){ *media = (*n1+*n2+*n3+*n4)/4; } void ordena(float *n1, float *n2, float *n3,float *n4){ int pass =0; float vet[4] = {*n1,*n2,*n3,*n4},aux; do { pass =0; for (int i=0 ; i<3 ; i++){ if (vet[i] > vet[i+1]){ aux = vet[i+1]; vet[i+1] = vet[i]; vet[i] = aux; pass++; } } } while(pass!=0); for (int i =0 ; i <4 ; i++){ printf("%.2f\n",vet[i]); } } int main (){ float n1 = 10 , n2 = 5.3, n3=5.7,n4=8.3,media; func(&n1 , &n2 , &n3, &n4, &media); ordena(&n1 , &n2 , &n3, &n4); printf("Media: %.2f",media); return 0; }
the_stack_data/176619.c
#include<stdio.h> int comb(int m,int n) { if(n==0) return 1; return(m*comb(m-1,n-1)/n); } int main() { int m,n; scanf("%d%d",&m,&n); printf("%d",comb(m,n)); return 0; }
the_stack_data/1109640.c
#include <stdio.h> #include <stdlib.h> #include <string.h> // 0 - up, 1 - down, 2 - left, 3 - right, 4 - hole int dy[4] = {-1, 1, 0, 0}, dx[4] = {0, 0, -1, 1}; typedef struct map_tt { char name[101]; int isPalindrome; int **next, **score, r, c, scored; } map_t; void printMap(map_t map) { printf("%s %dx%d - scored: %d\n", map.name, map.r, map.c, map.scored); for (int i = 0; i < map.r; i ++) for (int j = 0; j < map.c; j ++) printf("(%d, %d)%c", map.next[i][j], map.score[i][j], j < map.c - 1 ? ' ' : '\n'); } int isPalindrome(char s[]) { for (int i = 0, j = strlen(s) - 1; i <= j; i ++, j --) if (s[i] != s[j]) return(0); return(1); } int circular(int i, int n) { return(((i % n) + n) % n); } int go(map_t maps[], int mi, int i, int j) { int totalScore = 0; while (!(i == maps[mi].r - 1 && j == maps[mi].c - 1)) { // printf("%d %d %d (%d, %d, dy %d, dx %d) - %d\n", mi, i, j, maps[mi].next[i][j], maps[mi].score[i][j], dy[maps[mi].next[i][j]], dx[maps[mi].next[i][j]], totalScore); if (maps[mi].next[i][j] == 4) { mi = maps[mi].score[i][j]; i = (totalScore / maps[mi].c) % maps[mi].r; j = totalScore % maps[mi].c; // printf("%d %d %d - %d %d\n", mi, maps[mi].r, maps[mi].c, i, j); } else { totalScore += maps[mi].score[i][j] * (1 + maps[mi].isPalindrome); maps[mi].scored += maps[mi].score[i][j] * (1 + maps[mi].isPalindrome); int nextI = circular(i + dy[maps[mi].next[i][j]], maps[mi].r), nextJ = circular(j + dx[maps[mi].next[i][j]], maps[mi].c); i = nextI; j = nextJ; } } totalScore += maps[mi].score[i][j] * (1 + maps[mi].isPalindrome); maps[mi].scored += maps[mi].score[i][j] * (1 + maps[mi].isPalindrome); return(totalScore); } int main() { int n; scanf("%d", &n); map_t maps[n]; for (int i = 0; i < n; i ++) { scanf("%d %d\n%s", &maps[i].r, &maps[i].c, maps[i].name); maps[i].scored = 0; maps[i].isPalindrome = isPalindrome(maps[i].name); printf("%s %d\n", maps[i].name, maps[i].isPalindrome); maps[i].next = (int**) malloc(maps[i].r * sizeof(int*)); maps[i].score = (int**) malloc(maps[i].r * sizeof(int*)); for (int j = 0; j < maps[i].r; j ++) { maps[i].next[j] = (int*) malloc(maps[i].c * sizeof(int)); maps[i].score[j] = (int*) malloc(maps[i].c * sizeof(int)); for (int k = 0; k < maps[i].c; k ++) scanf("%d,%d", &maps[i].next[j][k], &maps[i].score[j][k]); } } for (int i = 0; i < n; i ++) printMap(maps[i]); int totalScore = go(maps, 0, 0, 0); printf("%d\n", totalScore); for (int i = 0; i < n; i ++) printf("%s %d\n", maps[i].name, maps[i].scored); return(0); }
the_stack_data/215768191.c
/* * Copyright (c) 2004,2012 Kustaa Nyholm / SpareTimeLabs * * All rights reserved. * * Redistribution and use in source and binary forms, with or without modification, * are permitted provided that the following conditions are met: * * Redistributions of source code must retain the above copyright notice, this list * of conditions and the following disclaimer. * * Redistributions in binary form must reproduce the above copyright notice, this * list of conditions and the following disclaimer in the documentation and/or other * materials provided with the distribution. * * Neither the name of the Kustaa Nyholm or SpareTimeLabs nor the names of its * contributors may be used to endorse or promote products derived from this software * without specific prior written permission. * * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" * AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED * WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. * IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, * INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT * NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, * OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, * WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) * ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY * OF SUCH DAMAGE. */ #include "printf.h" typedef void (*putcf) (void*,char); static putcf stdout_putf; static void* stdout_putp; #ifdef PRINTF_LONG_SUPPORT static void uli2a(unsigned long int num, unsigned int base, int uc,char * bf) { int n=0; unsigned int d=1; while (num/d >= base) d*=base; while (d!=0) { int dgt = num / d; num%=d; d/=base; if (n || dgt>0|| d==0) { *bf++ = dgt+(dgt<10 ? '0' : (uc ? 'A' : 'a')-10); ++n; } } *bf=0; } static void li2a (long num, char * bf) { if (num<0) { num=-num; *bf++ = '-'; } uli2a(num,10,0,bf); } #endif static void ui2a(unsigned int num, unsigned int base, int uc,char * bf) { int n=0; unsigned int d=1; while (num/d >= base) d*=base; while (d!=0) { int dgt = num / d; num%= d; d/=base; if (n || dgt>0 || d==0) { *bf++ = dgt+(dgt<10 ? '0' : (uc ? 'A' : 'a')-10); ++n; } } *bf=0; } static void i2a (int num, char * bf) { if (num<0) { num=-num; *bf++ = '-'; } ui2a(num,10,0,bf); } static int a2d(char ch) { if (ch>='0' && ch<='9') return ch-'0'; else if (ch>='a' && ch<='f') return ch-'a'+10; else if (ch>='A' && ch<='F') return ch-'A'+10; else return -1; } static char a2i(char ch, char** src,int base,int* nump) { char* p= *src; int num=0; int digit; while ((digit=a2d(ch))>=0) { if (digit>base) break; num=num*base+digit; ch=*p++; } *src=p; *nump=num; return ch; } static void putchw(void* putp,putcf putf,int n, char z, char* bf) { char fc=z? '0' : ' '; char ch; char* p=bf; while (*p++ && n > 0) n--; while (n-- > 0) putf(putp,fc); while ((ch= *bf++)) putf(putp,ch); } void tfp_format(void* putp, putcf putf, const char *fmt, va_list va) { char bf[12]; char ch; while ((ch=*(fmt++))) { if (ch!='%') putf(putp,ch); else { char lz=0; #ifdef PRINTF_LONG_SUPPORT char lng=0; #endif int w=0; ch=*(fmt++); if (ch=='0') { ch=*(fmt++); lz=1; } if (ch>='0' && ch<='9') { ch=a2i(ch, (char **)&fmt, 10, &w); } #ifdef PRINTF_LONG_SUPPORT if (ch=='l') { ch=*(fmt++); lng=1; } #endif switch (ch) { case 0: goto abort; case 'u' : { #ifdef PRINTF_LONG_SUPPORT if (lng) uli2a(va_arg(va, unsigned long int),10,0,bf); else #endif ui2a(va_arg(va, unsigned int),10,0,bf); putchw(putp,putf,w,lz,bf); break; } case 'd' : { #ifdef PRINTF_LONG_SUPPORT if (lng) li2a(va_arg(va, unsigned long int),bf); else #endif i2a(va_arg(va, int),bf); putchw(putp,putf,w,lz,bf); break; } case 'x': case 'X' : #ifdef PRINTF_LONG_SUPPORT if (lng) uli2a(va_arg(va, unsigned long int),16,(ch=='X'),bf); else #endif ui2a(va_arg(va, unsigned int),16,(ch=='X'),bf); putchw(putp,putf,w,lz,bf); break; case 'c' : putf(putp,(char)(va_arg(va, int))); break; case 's' : putchw(putp,putf,w,0,va_arg(va, char*)); break; case '%' : putf(putp,ch); default: break; } } } abort:; } void init_printf(void* putp, void (*putf) (void*, char)) { stdout_putf=putf; stdout_putp=putp; } void tfp_printf(const char *fmt, ...) { va_list va; va_start(va,fmt); tfp_format(stdout_putp,stdout_putf,fmt,va); va_end(va); } static void putcp(void* p,char c) { *(*((char**)p))++ = c; } void tfp_sprintf(char* s, const char *fmt, ...) { va_list va; va_start(va,fmt); tfp_format(&s,putcp,fmt,va); putcp(&s,0); va_end(va); }
the_stack_data/138895.c
/* ** 2018-01-08 ** ** The author disclaims copyright to this source code. In place of ** a legal notice, here is a blessing: ** ** May you do good and not evil. ** May you find forgiveness for yourself and forgive others. ** May you share freely, never taking more than you give. ** ****************************************************************************** ** ** This file contains code to implement the sqlite3_normalize() function. ** ** char *sqlite3_normalize(const char *zSql); ** ** This function takes an SQL string as input and returns a "normalized" ** version of that string in memory obtained from sqlite3_malloc64(). The ** caller is responsible for ensuring that the returned memory is freed. ** ** If a memory allocation error occurs, this routine returns NULL. ** ** The normalization consists of the following transformations: ** ** (1) Convert every literal (string, blob literal, numeric constant, ** or "NULL" constant) into a ? ** ** (2) Remove all superfluous whitespace, including comments. Change ** all required whitespace to a single space character. ** ** (3) Lowercase all ASCII characters. ** ** (4) If an IN or NOT IN operator is followed by a list of 1 or more ** values, convert that list into "(?,?,?)". ** ** The purpose of normalization is two-fold: ** ** (1) Sanitize queries by removing potentially private or sensitive ** information contained in literals. ** ** (2) Identify structurally identical queries by comparing their ** normalized forms. ** ** Command-Line Utility ** -------------------- ** ** This file also contains code for a command-line utility that converts ** SQL queries in text files into their normalized forms. To build the ** command-line program, compile this file with -DSQLITE_NORMALIZE_CLI ** and link it against the SQLite library. */ #include <sqlite3.h> #include <string.h> /* ** Implementation note: ** ** Much of the tokenizer logic is copied out of the tokenize.c source file ** of SQLite. That logic could be simplified for this particular application, ** but that would impose a risk of introducing subtle errors. It is best to ** keep the code as close to the original as possible. ** ** The tokenize code is in sync with the SQLite core as of 2018-01-08. ** Any future changes to the core tokenizer might require corresponding ** adjustments to the tokenizer logic in this module. */ /* Character classes for tokenizing ** ** In the sqlite3GetToken() function, a switch() on aiClass[c] is implemented ** using a lookup table, whereas a switch() directly on c uses a binary search. ** The lookup table is much faster. To maximize speed, and to ensure that ** a lookup table is used, all of the classes need to be small integers and ** all of them need to be used within the switch. */ #define CC_X 0 /* The letter 'x', or start of BLOB literal */ #define CC_KYWD 1 /* Alphabetics or '_'. Usable in a keyword */ #define CC_ID 2 /* unicode characters usable in IDs */ #define CC_DIGIT 3 /* Digits */ #define CC_DOLLAR 4 /* '$' */ #define CC_VARALPHA 5 /* '@', '#', ':'. Alphabetic SQL variables */ #define CC_VARNUM 6 /* '?'. Numeric SQL variables */ #define CC_SPACE 7 /* Space characters */ #define CC_QUOTE 8 /* '"', '\'', or '`'. String literals, quoted ids */ #define CC_QUOTE2 9 /* '['. [...] style quoted ids */ #define CC_PIPE 10 /* '|'. Bitwise OR or concatenate */ #define CC_MINUS 11 /* '-'. Minus or SQL-style comment */ #define CC_LT 12 /* '<'. Part of < or <= or <> */ #define CC_GT 13 /* '>'. Part of > or >= */ #define CC_EQ 14 /* '='. Part of = or == */ #define CC_BANG 15 /* '!'. Part of != */ #define CC_SLASH 16 /* '/'. / or c-style comment */ #define CC_LP 17 /* '(' */ #define CC_RP 18 /* ')' */ #define CC_SEMI 19 /* ';' */ #define CC_PLUS 20 /* '+' */ #define CC_STAR 21 /* '*' */ #define CC_PERCENT 22 /* '%' */ #define CC_COMMA 23 /* ',' */ #define CC_AND 24 /* '&' */ #define CC_TILDA 25 /* '~' */ #define CC_DOT 26 /* '.' */ #define CC_ILLEGAL 27 /* Illegal character */ static const unsigned char aiClass[] = { /* x0 x1 x2 x3 x4 x5 x6 x7 x8 x9 xa xb xc xd xe xf */ /* 0x */ 27, 27, 27, 27, 27, 27, 27, 27, 27, 7, 7, 27, 7, 7, 27, 27, /* 1x */ 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, /* 2x */ 7, 15, 8, 5, 4, 22, 24, 8, 17, 18, 21, 20, 23, 11, 26, 16, /* 3x */ 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 5, 19, 12, 14, 13, 6, /* 4x */ 5, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, /* 5x */ 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 9, 27, 27, 27, 1, /* 6x */ 8, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, /* 7x */ 1, 1, 1, 1, 1, 1, 1, 1, 0, 1, 1, 27, 10, 27, 25, 27, /* 8x */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, /* 9x */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, /* Ax */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, /* Bx */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, /* Cx */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, /* Dx */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, /* Ex */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, /* Fx */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 }; /* An array to map all upper-case characters into their corresponding ** lower-case character. ** ** SQLite only considers US-ASCII (or EBCDIC) characters. We do not ** handle case conversions for the UTF character set since the tables ** involved are nearly as big or bigger than SQLite itself. */ static const unsigned char sqlite3UpperToLower[] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 97, 98, 99,100,101,102,103, 104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121, 122, 91, 92, 93, 94, 95, 96, 97, 98, 99,100,101,102,103,104,105,106,107, 108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125, 126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143, 144,145,146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161, 162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177,178,179, 180,181,182,183,184,185,186,187,188,189,190,191,192,193,194,195,196,197, 198,199,200,201,202,203,204,205,206,207,208,209,210,211,212,213,214,215, 216,217,218,219,220,221,222,223,224,225,226,227,228,229,230,231,232,233, 234,235,236,237,238,239,240,241,242,243,244,245,246,247,248,249,250,251, 252,253,254,255 }; /* ** The following 256 byte lookup table is used to support SQLites built-in ** equivalents to the following standard library functions: ** ** isspace() 0x01 ** isalpha() 0x02 ** isdigit() 0x04 ** isalnum() 0x06 ** isxdigit() 0x08 ** toupper() 0x20 ** SQLite identifier character 0x40 ** Quote character 0x80 ** ** Bit 0x20 is set if the mapped character requires translation to upper ** case. i.e. if the character is a lower-case ASCII character. ** If x is a lower-case ASCII character, then its upper-case equivalent ** is (x - 0x20). Therefore toupper() can be implemented as: ** ** (x & ~(map[x]&0x20)) ** ** The equivalent of tolower() is implemented using the sqlite3UpperToLower[] ** array. tolower() is used more often than toupper() by SQLite. ** ** Bit 0x40 is set if the character is non-alphanumeric and can be used in an ** SQLite identifier. Identifiers are alphanumerics, "_", "$", and any ** non-ASCII UTF character. Hence the test for whether or not a character is ** part of an identifier is 0x46. */ static const unsigned char sqlite3CtypeMap[256] = { 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, /* 00..07 ........ */ 0x00, 0x01, 0x01, 0x01, 0x01, 0x01, 0x00, 0x00, /* 08..0f ........ */ 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, /* 10..17 ........ */ 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, /* 18..1f ........ */ 0x01, 0x00, 0x80, 0x00, 0x40, 0x00, 0x00, 0x80, /* 20..27 !"#$%&' */ 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, /* 28..2f ()*+,-./ */ 0x0c, 0x0c, 0x0c, 0x0c, 0x0c, 0x0c, 0x0c, 0x0c, /* 30..37 01234567 */ 0x0c, 0x0c, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, /* 38..3f 89:;<=>? */ 0x00, 0x0a, 0x0a, 0x0a, 0x0a, 0x0a, 0x0a, 0x02, /* 40..47 @ABCDEFG */ 0x02, 0x02, 0x02, 0x02, 0x02, 0x02, 0x02, 0x02, /* 48..4f HIJKLMNO */ 0x02, 0x02, 0x02, 0x02, 0x02, 0x02, 0x02, 0x02, /* 50..57 PQRSTUVW */ 0x02, 0x02, 0x02, 0x80, 0x00, 0x00, 0x00, 0x40, /* 58..5f XYZ[\]^_ */ 0x80, 0x2a, 0x2a, 0x2a, 0x2a, 0x2a, 0x2a, 0x22, /* 60..67 `abcdefg */ 0x22, 0x22, 0x22, 0x22, 0x22, 0x22, 0x22, 0x22, /* 68..6f hijklmno */ 0x22, 0x22, 0x22, 0x22, 0x22, 0x22, 0x22, 0x22, /* 70..77 pqrstuvw */ 0x22, 0x22, 0x22, 0x00, 0x00, 0x00, 0x00, 0x00, /* 78..7f xyz{|}~. */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* 80..87 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* 88..8f ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* 90..97 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* 98..9f ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* a0..a7 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* a8..af ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* b0..b7 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* b8..bf ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* c0..c7 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* c8..cf ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* d0..d7 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* d8..df ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* e0..e7 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* e8..ef ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, /* f0..f7 ........ */ 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40, 0x40 /* f8..ff ........ */ }; #define sqlite3Toupper(x) ((x)&~(sqlite3CtypeMap[(unsigned char)(x)]&0x20)) #define sqlite3Isspace(x) (sqlite3CtypeMap[(unsigned char)(x)]&0x01) #define sqlite3Isalnum(x) (sqlite3CtypeMap[(unsigned char)(x)]&0x06) #define sqlite3Isalpha(x) (sqlite3CtypeMap[(unsigned char)(x)]&0x02) #define sqlite3Isdigit(x) (sqlite3CtypeMap[(unsigned char)(x)]&0x04) #define sqlite3Isxdigit(x) (sqlite3CtypeMap[(unsigned char)(x)]&0x08) #define sqlite3Tolower(x) (sqlite3UpperToLower[(unsigned char)(x)]) #define sqlite3Isquote(x) (sqlite3CtypeMap[(unsigned char)(x)]&0x80) /* ** If X is a character that can be used in an identifier then ** IdChar(X) will be true. Otherwise it is false. ** ** For ASCII, any character with the high-order bit set is ** allowed in an identifier. For 7-bit characters, ** sqlite3IsIdChar[X] must be 1. ** ** For EBCDIC, the rules are more complex but have the same ** end result. ** ** Ticket #1066. the SQL standard does not allow '$' in the ** middle of identifiers. But many SQL implementations do. ** SQLite will allow '$' in identifiers for compatibility. ** But the feature is undocumented. */ #define IdChar(C) ((sqlite3CtypeMap[(unsigned char)C]&0x46)!=0) /* ** Ignore testcase() macros */ #define testcase(X) /* ** Token values */ #define TK_SPACE 0 #define TK_NAME 1 #define TK_LITERAL 2 #define TK_PUNCT 3 #define TK_ERROR 4 #define TK_MINUS TK_PUNCT #define TK_LP TK_PUNCT #define TK_RP TK_PUNCT #define TK_SEMI TK_PUNCT #define TK_PLUS TK_PUNCT #define TK_STAR TK_PUNCT #define TK_SLASH TK_PUNCT #define TK_REM TK_PUNCT #define TK_EQ TK_PUNCT #define TK_LE TK_PUNCT #define TK_NE TK_PUNCT #define TK_LSHIFT TK_PUNCT #define TK_LT TK_PUNCT #define TK_GE TK_PUNCT #define TK_RSHIFT TK_PUNCT #define TK_GT TK_PUNCT #define TK_GE TK_PUNCT #define TK_BITOR TK_PUNCT #define TK_CONCAT TK_PUNCT #define TK_COMMA TK_PUNCT #define TK_BITAND TK_PUNCT #define TK_BITNOT TK_PUNCT #define TK_STRING TK_LITERAL #define TK_ID TK_NAME #define TK_ILLEGAL TK_ERROR #define TK_DOT TK_PUNCT #define TK_INTEGER TK_LITERAL #define TK_FLOAT TK_LITERAL #define TK_VARIABLE TK_LITERAL #define TK_BLOB TK_LITERAL /* Disable nuisence warnings about case fall-through */ #if !defined(deliberate_fall_through) && defined(__GCC__) && __GCC__>=7 # define deliberate_fall_through __attribute__((fallthrough)); #else # define deliberate_fall_through #endif /* ** Return the length (in bytes) of the token that begins at z[0]. ** Store the token type in *tokenType before returning. */ static int sqlite3GetToken(const unsigned char *z, int *tokenType){ int i, c; switch( aiClass[*z] ){ /* Switch on the character-class of the first byte ** of the token. See the comment on the CC_ defines ** above. */ case CC_SPACE: { for(i=1; sqlite3Isspace(z[i]); i++){} *tokenType = TK_SPACE; return i; } case CC_MINUS: { if( z[1]=='-' ){ for(i=2; (c=z[i])!=0 && c!='\n'; i++){} *tokenType = TK_SPACE; return i; } *tokenType = TK_MINUS; return 1; } case CC_LP: { *tokenType = TK_LP; return 1; } case CC_RP: { *tokenType = TK_RP; return 1; } case CC_SEMI: { *tokenType = TK_SEMI; return 1; } case CC_PLUS: { *tokenType = TK_PLUS; return 1; } case CC_STAR: { *tokenType = TK_STAR; return 1; } case CC_SLASH: { if( z[1]!='*' || z[2]==0 ){ *tokenType = TK_SLASH; return 1; } for(i=3, c=z[2]; (c!='*' || z[i]!='/') && (c=z[i])!=0; i++){} if( c ) i++; *tokenType = TK_SPACE; return i; } case CC_PERCENT: { *tokenType = TK_REM; return 1; } case CC_EQ: { *tokenType = TK_EQ; return 1 + (z[1]=='='); } case CC_LT: { if( (c=z[1])=='=' ){ *tokenType = TK_LE; return 2; }else if( c=='>' ){ *tokenType = TK_NE; return 2; }else if( c=='<' ){ *tokenType = TK_LSHIFT; return 2; }else{ *tokenType = TK_LT; return 1; } } case CC_GT: { if( (c=z[1])=='=' ){ *tokenType = TK_GE; return 2; }else if( c=='>' ){ *tokenType = TK_RSHIFT; return 2; }else{ *tokenType = TK_GT; return 1; } } case CC_BANG: { if( z[1]!='=' ){ *tokenType = TK_ILLEGAL; return 1; }else{ *tokenType = TK_NE; return 2; } } case CC_PIPE: { if( z[1]!='|' ){ *tokenType = TK_BITOR; return 1; }else{ *tokenType = TK_CONCAT; return 2; } } case CC_COMMA: { *tokenType = TK_COMMA; return 1; } case CC_AND: { *tokenType = TK_BITAND; return 1; } case CC_TILDA: { *tokenType = TK_BITNOT; return 1; } case CC_QUOTE: { int delim = z[0]; testcase( delim=='`' ); testcase( delim=='\'' ); testcase( delim=='"' ); for(i=1; (c=z[i])!=0; i++){ if( c==delim ){ if( z[i+1]==delim ){ i++; }else{ break; } } } if( c=='\'' ){ *tokenType = TK_STRING; return i+1; }else if( c!=0 ){ *tokenType = TK_ID; return i+1; }else{ *tokenType = TK_ILLEGAL; return i; } } case CC_DOT: { if( !sqlite3Isdigit(z[1]) ){ *tokenType = TK_DOT; return 1; } /* If the next character is a digit, this is a floating point ** number that begins with ".". Fall thru into the next case */ /* no break */ deliberate_fall_through } case CC_DIGIT: { *tokenType = TK_INTEGER; if( z[0]=='0' && (z[1]=='x' || z[1]=='X') && sqlite3Isxdigit(z[2]) ){ for(i=3; sqlite3Isxdigit(z[i]); i++){} return i; } for(i=0; sqlite3Isdigit(z[i]); i++){} if( z[i]=='.' ){ i++; while( sqlite3Isdigit(z[i]) ){ i++; } *tokenType = TK_FLOAT; } if( (z[i]=='e' || z[i]=='E') && ( sqlite3Isdigit(z[i+1]) || ((z[i+1]=='+' || z[i+1]=='-') && sqlite3Isdigit(z[i+2])) ) ){ i += 2; while( sqlite3Isdigit(z[i]) ){ i++; } *tokenType = TK_FLOAT; } while( IdChar(z[i]) ){ *tokenType = TK_ILLEGAL; i++; } return i; } case CC_QUOTE2: { for(i=1, c=z[0]; c!=']' && (c=z[i])!=0; i++){} *tokenType = c==']' ? TK_ID : TK_ILLEGAL; return i; } case CC_VARNUM: { *tokenType = TK_VARIABLE; for(i=1; sqlite3Isdigit(z[i]); i++){} return i; } case CC_DOLLAR: case CC_VARALPHA: { int n = 0; testcase( z[0]=='$' ); testcase( z[0]=='@' ); testcase( z[0]==':' ); testcase( z[0]=='#' ); *tokenType = TK_VARIABLE; for(i=1; (c=z[i])!=0; i++){ if( IdChar(c) ){ n++; }else if( c=='(' && n>0 ){ do{ i++; }while( (c=z[i])!=0 && !sqlite3Isspace(c) && c!=')' ); if( c==')' ){ i++; }else{ *tokenType = TK_ILLEGAL; } break; }else if( c==':' && z[i+1]==':' ){ i++; }else{ break; } } if( n==0 ) *tokenType = TK_ILLEGAL; return i; } case CC_KYWD: { for(i=1; aiClass[z[i]]<=CC_KYWD; i++){} if( IdChar(z[i]) ){ /* This token started out using characters that can appear in keywords, ** but z[i] is a character not allowed within keywords, so this must ** be an identifier instead */ i++; break; } *tokenType = TK_ID; return i; } case CC_X: { testcase( z[0]=='x' ); testcase( z[0]=='X' ); if( z[1]=='\'' ){ *tokenType = TK_BLOB; for(i=2; sqlite3Isxdigit(z[i]); i++){} if( z[i]!='\'' || i%2 ){ *tokenType = TK_ILLEGAL; while( z[i] && z[i]!='\'' ){ i++; } } if( z[i] ) i++; return i; } /* If it is not a BLOB literal, then it must be an ID, since no ** SQL keywords start with the letter 'x'. Fall through */ /* no break */ deliberate_fall_through } case CC_ID: { i = 1; break; } default: { *tokenType = TK_ILLEGAL; return 1; } } while( IdChar(z[i]) ){ i++; } *tokenType = TK_ID; return i; } char *sqlite3_normalize(const char *zSql){ char *z; /* The output string */ sqlite3_int64 nZ; /* Size of the output string in bytes */ sqlite3_int64 nSql; /* Size of the input string in bytes */ int i; /* Next character to read from zSql[] */ int j; /* Next slot to fill in on z[] */ int tokenType; /* Type of the next token */ int n; /* Size of the next token */ int k; /* Loop counter */ nSql = strlen(zSql); nZ = nSql; z = sqlite3_malloc64( nZ+2 ); if( z==0 ) return 0; for(i=j=0; zSql[i]; i += n){ n = sqlite3GetToken((unsigned char*)zSql+i, &tokenType); switch( tokenType ){ case TK_SPACE: { break; } case TK_ERROR: { sqlite3_free(z); return 0; } case TK_LITERAL: { z[j++] = '?'; break; } case TK_PUNCT: case TK_NAME: { if( n==4 && sqlite3_strnicmp(zSql+i,"NULL",4)==0 ){ if( (j>=3 && strncmp(z+j-2,"is",2)==0 && !IdChar(z[j-3])) || (j>=4 && strncmp(z+j-3,"not",3)==0 && !IdChar(z[j-4])) ){ /* NULL is a keyword in this case, not a literal value */ }else{ /* Here the NULL is a literal value */ z[j++] = '?'; break; } } if( j>0 && IdChar(z[j-1]) && IdChar(zSql[i]) ) z[j++] = ' '; for(k=0; k<n; k++){ z[j++] = sqlite3Tolower(zSql[i+k]); } break; } } } while( j>0 && z[j-1]==' ' ){ j--; } if( j>0 && z[j-1]!=';' ){ z[j++] = ';'; } z[j] = 0; /* Make a second pass converting "in(...)" where the "..." is not a ** SELECT statement into "in(?,?,?)" */ for(i=0; i<j; i=n){ char *zIn = strstr(z+i, "in("); int nParen; if( zIn==0 ) break; n = (int)(zIn-z)+3; /* Index of first char past "in(" */ if( n && IdChar(zIn[-1]) ) continue; if( strncmp(zIn, "in(select",9)==0 && !IdChar(zIn[9]) ) continue; if( strncmp(zIn, "in(with",7)==0 && !IdChar(zIn[7]) ) continue; for(nParen=1, k=0; z[n+k]; k++){ if( z[n+k]=='(' ) nParen++; if( z[n+k]==')' ){ nParen--; if( nParen==0 ) break; } } /* k is the number of bytes in the "..." within "in(...)" */ if( k<5 ){ z = sqlite3_realloc64(z, j+(5-k)+1); if( z==0 ) return 0; memmove(z+n+5, z+n+k, j-(n+k)); }else if( k>5 ){ memmove(z+n+5, z+n+k, j-(n+k)); } j = j-k+5; z[j] = 0; memcpy(z+n, "?,?,?", 5); } return z; } /* ** For testing purposes, or to build a stand-alone SQL normalizer program, ** compile this one source file with the -DSQLITE_NORMALIZE_CLI and link ** it against any SQLite library. The resulting command-line program will ** run sqlite3_normalize() over the text of all files named on the command- ** line and show the result on standard output. */ #ifdef SQLITE_NORMALIZE_CLI #include <stdio.h> #include <stdlib.h> /* ** Break zIn up into separate SQL statements and run sqlite3_normalize() ** on each one. Print the result of each run. */ static void normalizeFile(char *zIn){ int i; if( zIn==0 ) return; for(i=0; zIn[i]; i++){ char cSaved; if( zIn[i]!=';' ) continue; cSaved = zIn[i+1]; zIn[i+1] = 0; if( sqlite3_complete(zIn) ){ char *zOut = sqlite3_normalize(zIn); if( zOut ){ printf("%s\n", zOut); sqlite3_free(zOut); }else{ fprintf(stderr, "ERROR: %s\n", zIn); } zIn[i+1] = cSaved; zIn += i+1; i = -1; }else{ zIn[i+1] = cSaved; } } } /* ** The main routine for "sql_normalize". Read files named on the ** command-line and run the text of each through sqlite3_normalize(). */ int main(int argc, char **argv){ int i; FILE *in; char *zBuf = 0; sqlite3_int64 sz, got; for(i=1; i<argc; i++){ in = fopen(argv[i], "rb"); if( in==0 ){ fprintf(stderr, "cannot open \"%s\"\n", argv[i]); continue; } fseek(in, 0, SEEK_END); sz = ftell(in); rewind(in); zBuf = sqlite3_realloc64(zBuf, sz+1); if( zBuf==0 ){ fprintf(stderr, "failed to malloc for %lld bytes\n", sz); exit(1); } got = fread(zBuf, 1, sz, in); fclose(in); if( got!=sz ){ fprintf(stderr, "only able to read %lld of %lld bytes from \"%s\"\n", got, sz, argv[i]); }else{ zBuf[got] = 0; normalizeFile(zBuf); } } sqlite3_free(zBuf); } #endif /* SQLITE_NORMALIZE_CLI */
the_stack_data/243894252.c
/* hw15_13 */ #include <stdio.h> int main(void) { struct status { unsigned sex:1; unsigned marriage:1; unsigned age:7; }; struct status tom; int i; printf("輸入性別(0:女;1:男) : "); scanf("%d",&i); tom.sex=i; printf("輸入婚姻狀況(0:未婚;1:已婚) : "); scanf("%d",&i); tom.marriage=i; printf("輸入年齡 : "); scanf("%d",&i); tom.age=i; if(tom.sex==0) printf("性別 : 女,"); else printf("性別 : 男,"); if(tom.marriage==0) printf("未婚,"); else printf("已婚,"); printf("%d歲\n",tom.age); printf("sizeof(tom)=%d\n",sizeof(tom)); system("pause"); return 0; } /* 輸入性別(0:女;1:男) : 0 輸入婚姻狀況(0:未婚;1:已婚) : 1 輸入年齡 : 28 性別 : 女,已婚,28歲 sizeof(tom)=4 Press any key to continue . . . */
the_stack_data/18887029.c
#include<stdio.h> #include<math.h> /* vlanoise.c * * Usage: vlanoise * * Description: Gives rms noise in a VLA map given the band, bandwidth * and integration time. * */ #define N 27 #define SMALLN 2 #define Fw 1 #define DELSL 0.38 #define DELSC 0.35 #define DELSX 0.29 #define DELSU 1.14 #define DELSK 2.0 #define MAX 1000 main(int argc, char *argv[]) { int band,junk; float tint,delnu,dels,deli; char line[MAX]; /* Get input */ printf("Enter the band of the observation (L, C, X, etc.): "); band = getchar(); while((junk = getchar()) != '\n') ; switch(band) { case 'l': case 'L': dels = DELSL; break; case 'c': case 'C': dels = DELSC; break; case 'x': case 'X': dels = DELSX; break; case 'u': case 'U': dels = DELSU; break; case 'k': case 'K': dels = DELSK; break; default: printf("\nThat band is not supported. Exiting program\n\n"); return 0; } printf("\nEnter the bandwidth in MHz: "); gets(line); sscanf(line,"%f",&delnu); printf("The bandwidth is %6.1f MHz.\n\n",delnu); printf("Enter the integration time in seconds: "); gets(line); sscanf(line,"%f",&tint); printf("The integration time is %5.0f sec.\n\n",tint); /* Make the calculations. * * The RMS noise is found using equation 19-3 from Lecture 19 of * the 1995 VLA Summer School. That is, * * Fw * del_S * del_I = ---------------------------- * sqrt(n*N*(N-1)*t_int*del_nu/2) * * where Fw = 1.0 for natural weighting and is > 1 for other weightings * del_S = Single interferometer sensitivity per sec per MHz of * IF bandwidth (value from Lecture 19) * n = 2 for images of Stokes I from two orthogonal polarization * states at one sky freq. * N = number of antennas * t_int = integration time in sec * del_nu = bandwidth in MHz * */ deli = 1000*Fw * dels / sqrt(SMALLN*N*(N-1)*tint*delnu/2); /* Factor of 1000 converts del_I to mJy */ printf("The theoretical noise with this setup is %f mJy/beam.\n\n",deli); return 0; }
the_stack_data/125141536.c
/* * stunnel TLS offloading and load-balancing proxy * Copyright (C) 1998-2018 Michal Trojnara <[email protected]> * * This program is free software; you can redistribute it and/or modify it * under the terms of the GNU General Public License as published by the * Free Software Foundation; either version 2 of the License, or (at your * option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. * See the GNU General Public License for more details. * * You should have received a copy of the GNU General Public License along * with this program; if not, see <http://www.gnu.org/licenses>. * * Linking stunnel statically or dynamically with other modules is making * a combined work based on stunnel. Thus, the terms and conditions of * the GNU General Public License cover the whole combination. * * In addition, as a special exception, the copyright holder of stunnel * gives you permission to combine stunnel with free software programs or * libraries that are released under the GNU LGPL and with code included * in the standard release of OpenSSL under the OpenSSL License (or * modified versions of such code, with unchanged license). You may copy * and distribute such a system following the terms of the GNU GPL for * stunnel and the licenses of the other code concerned. * * Note that people who make modified versions of stunnel are not obligated * to grant this special exception for their modified versions; it is their * choice whether to do so. The GNU General Public License gives permission * to release a modified version without this exception; this exception * also makes it possible to release a modified version which carries * forward this exception. */ /* getpeername() can't be declared in the following includes */ #define getpeername no_getpeername #include <sys/types.h> #include <sys/socket.h> /* for AF_INET */ #include <netinet/in.h> #include <arpa/inet.h> /* for inet_addr() */ #include <stdlib.h> /* for getenv() */ #ifdef __BEOS__ #include <be/bone/arpa/inet.h> /* for AF_INET */ #include <be/bone/sys/socket.h> /* for AF_INET */ #else #include <sys/socket.h> /* for AF_INET */ #endif #undef getpeername int getpeername(int s, struct sockaddr_in *name, int *len) { char *value; (void)s; /* squash the unused parameter warning */ (void)len; /* squash the unused parameter warning */ name->sin_family=AF_INET; if((value=getenv("REMOTE_HOST"))) name->sin_addr.s_addr=inet_addr(value); else name->sin_addr.s_addr=htonl(INADDR_ANY); if((value=getenv("REMOTE_PORT"))) name->sin_port=htons((uint16_t)atoi(value)); else name->sin_port=htons(0); /* dynamic port allocation */ return 0; } /* end of env.c */
the_stack_data/215769219.c
#include <stdio.h> int maximum(int x, int y) { return (x > y) ? x : y; } int main(void) { int x, y, status; printf("Geben Sie zwei ganze Zahlen ein:\n"); status = scanf("%i %i", &x, &y); if (status != 2 || getchar() != '\n') { printf("Eingabe ungueltig\n"); return 1; } printf("\nDie groessere Zahl ist %i ", maximum(x,y)); return 0; }
the_stack_data/58766.c
/* Ler um vetor X de 10 elementos inteiros e positivos. Criar um vetor Y da seguinte forma: os elementos de Y com índice par receberão os respectivos elementos de X divididos por 2; os elementos com índice ímpar receberão os respectivos elementos de X multiplicados por 3. Escrever o vetor X e o vetor Y. */ #include <stdio.h> #include <stdlib.h> int main(){ float X[10], Y[10]; int i, k; printf("Digite 10 numeros: "); for(i=0; i < 10; i++){ scanf("%f", &X[i]); } printf("\n"); for(i=0, k = 0; i < 10; i++, k++){ if(k%2 == 0){ Y[k] = (X[i]/2); }else{ Y[k] = (X[i]*3); } } printf("Vetor X: "); for(i=0; i < 10; i++){ printf("%g\t", X[i]); } printf("\n"); printf("Vetor Y: "); for(i=0; i < 10; i++){ printf("%g\t", Y[i]); } printf("\n\n"); return 0; }
the_stack_data/220572.c
#include <sys/types.h> #include <unistd.h> #include <stdio.h> #include <sys/wait.h> int main(){ int pid = fork(); if (pid == 0) printf("Child\n"); else printf("Parent\n"); printf("pid %i\n", getpid()); printf("ppid %i\n", getppid()); printf("pgid %i\n", getpgid(0)); printf("sid %i\n", getsid(0)); printf("Dir %s\n", getcwd(NULL,0)); if (pid == 0){ setsid();//creates a session and sets the process group ID printf("New session\n"); printf("pid %i\n", getpid()); printf("ppid %i\n", getppid()); printf("pgid %i\n", getpgid(0)); printf("sid %i\n", getsid(0)); chdir("/tmp"); printf("Dir %s\n", getcwd(NULL,0)); } else { int status; wait(&status); printf("The child finished with %i\n", status); } return 0; }
the_stack_data/122014428.c
#include <unistd.h> int mx_strlen(const char *s); void mx_printstr(const char *s) { write(1, s, mx_strlen(s)); }
the_stack_data/187643085.c
/* * * ProEdit MP Multi-platform Programming Editor * Designed/Developed/Produced by Adrian Michaud * * MIT License * * Copyright (c) 2019 Adrian Michaud * * Permission is hereby granted, free of charge, to any person obtaining a copy * of this software and associated documentation files (the "Software"), to deal * in the Software without restriction, including without limitation the rights * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the Software is * furnished to do so, subject to the following conditions: * * The above copyright notice and this permission notice shall be included in all * copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE * SOFTWARE. * */ #include <stdio.h> #include <string.h> #include <stdlib.h> #if 0 #define DEBUG #endif static char*suffixList[] = { "ness's", "ion's", "ions", "ness", "able", "ings", "ive", "ion", "ing", "ers", "ies", "ier", "ant", "e's", "y's", "r's", "'s", "en", "ry", "ly", "ed", "er", "st", "rs", "es", "r", "d", "s", "y", "e", }; #define MAX_WORD_LEN 32 #define NUM_CHAR_FREQ 256 typedef struct characterFrequency { char ch; int occurances; }CHAR_FREQ; typedef struct suffixFrequency { char ch; int suffix; int occurances; }SUFFIX_FREQ; static char compressedL1[16]; static char compressedL2[16]; static char compressedL3[16]; static CHAR_FREQ charFreq[NUM_CHAR_FREQ]; static int charLevel[256]; static char charLookup[256]; #define NUM_SFX (sizeof(suffixList)/sizeof(char *)) #define ALPHA_LOW 'a' #define ALPHA_HIGH '~' #define HASH_TABLE_SIZE 160000 typedef struct dictionaryList { char*word; char suffix; struct dictionaryList*next; }SPELL_WORD; static int nibbleIndex; static char*nibbles; static int numSorted; static int allocSize; static SUFFIX_FREQ suffixFreq[NUM_SFX]; static SPELL_WORD*suffix_hash[HASH_TABLE_SIZE]; static SPELL_WORD*word_hash[HASH_TABLE_SIZE]; static SPELL_WORD*sorted[HASH_TABLE_SIZE]; static void HashSuffix(char*word, int len, int suffix); static void HashWord(char*word, int len); static int HashIt(char*word, int len); static int SortChar(const void*arg1, const void*arg2); static int LoadDict(char*dict); static SPELL_WORD*WordLookup(char*word, int len); static void OtherSuffixCheck(char*root, int len, int suffix); static void SortHash(SPELL_WORD*words); static int SortWords(const void*arg1, const void*arg2); static void CompressPrefixes(void); static void PrintStrings(FILE*fp, SPELL_WORD*words); static void CompressLine(char*line, int len); static int SortCharFreq(const void*arg1, const void*arg2); static void BuildFreqTable(void); /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static SPELL_WORD*WordLookup(char*word, int len) { SPELL_WORD*walk; /* Check to see if other suffixs match this root word. */ walk = word_hash[HashIt(word, len)]; while (walk) { if (walk->word) { if (!strcmp(walk->word, word)) return (walk); } walk = walk->next; } return (0); } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ int main(int argv, char**argc) { int i, j, len, alen; char*word; FILE*fp; char list[50]; char item[20]; char flag; int total; SPELL_WORD*hashWalk, *hashWalk2; if (argv >= 2) { for (i = 1; i < argv; i++) LoadDict(argc[i]); } else LoadDict("dictionary.txt"); printf("Creating wordlist.tmp\n"); fp = fopen("wordlist.tmp", "w"); for (i = 0; i < HASH_TABLE_SIZE; i++) PrintStrings(fp, word_hash[i]); fclose(fp); printf("Processing suffixes\n"); /* Walk through all of the hashed words looking for suffixes. */ for (j = 0; j < NUM_SFX; j++) { alen = strlen(suffixList[j]); for (i = 0; i < HASH_TABLE_SIZE; i++) { hashWalk = word_hash[i]; while (hashWalk) { if (hashWalk->word && !hashWalk->suffix) { len = strlen(hashWalk->word); if (len > alen) { /* Did we find a suffix in this word? If so, add it to */ /* the suffix hash table and remove it from the word */ /* hash table. */ if (!strcmp(&hashWalk->word[len - alen], suffixList[j])) { word = hashWalk->word; word[len - alen] = 0; suffixFreq[j].suffix = j; suffixFreq[j].occurances++; HashSuffix(word, len - alen, j); /* If there is a root word, mark it. */ hashWalk2 = WordLookup(word, len - alen); if (hashWalk2) hashWalk2->suffix = 1; /* Remove this suffix word from the word list because */ /* it's now located on the suffix list. */ hashWalk->word = 0; /* Process this suffix, and all other suffixes that */ /* use this same root word. */ OtherSuffixCheck(word, len - alen, j); } } } hashWalk = hashWalk->next; } } } printf("Combining suffixes\n"); /* Find all duplicate root words and combine their suffixes into one */ /* word + suffix list. */ for (i = 0; i < HASH_TABLE_SIZE; i++) { hashWalk = suffix_hash[i]; while (hashWalk) { if (hashWalk->word) { sprintf(list, "%c", ALPHA_LOW + hashWalk->suffix); total = 0; hashWalk2 = suffix_hash[HashIt(hashWalk->word, strlen(hashWalk->word))]; while (hashWalk2) { if (hashWalk2->word) { if (hashWalk2->word != hashWalk->word) { if (!strcmp(hashWalk2->word, hashWalk->word)) { sprintf(item, "%c", ALPHA_LOW + hashWalk2-> suffix); strcat(list, item); hashWalk2->word = 0; total++; } } } hashWalk2 = hashWalk2->next; } flag = '/'; /* Check if this root word exists by itself. If so, them mark */ /* the suffix list using a '+' to indicate that the root word */ /* is also a word by itself with adding any suffixes to it. */ hashWalk2 = word_hash[HashIt(hashWalk->word, strlen(hashWalk-> word))]; while (hashWalk2) { /* Is this a root word? */ if (hashWalk2->word) { if (!strcmp(hashWalk->word, hashWalk2->word)) { flag = '+'; hashWalk2->word = 0; break; } } hashWalk2 = hashWalk2->next; } /* Is this a single word with a single suffix? If the suffix is */ /* less than 2 characters, then don't bother because we're not */ /* saving any space by using the suffex. */ if (!total && (flag == '/') && (strlen(suffixList[(int) hashWalk->suffix]) <= 2)) { word = (char*)malloc(40); sprintf(word, "%s%s", hashWalk->word, suffixList[(int) hashWalk->suffix]); hashWalk->word = word; } else { word = (char*)malloc(40); qsort(list, strlen(list), 1, SortChar); sprintf(word, "%s%c%s", hashWalk->word, flag, list); hashWalk->word = word; } } hashWalk = hashWalk->next; } } printf("Sorting words\n"); for (i = 0; i < HASH_TABLE_SIZE; i++) { SortHash(word_hash[i]); SortHash(suffix_hash[i]); } qsort(sorted, numSorted, sizeof(SPELL_WORD*), SortWords); printf("Creating suffixes.tmp\n"); fp = fopen("suffixes.tmp", "w"); for (i = 0; i < numSorted; i++) fprintf(fp, "%s\n", sorted[i]->word); fclose(fp); printf("Compressing words\n"); CompressPrefixes(); BuildFreqTable(); nibbles = malloc(allocSize*2); nibbleIndex = 0; for (i = 0; i < numSorted; i++) CompressLine(sorted[i]->word, strlen(sorted[i]->word)); if (nibbleIndex&1) nibbles[nibbleIndex++] = 0xf; printf("Creating dictionary.h\n"); fp = fopen("dictionary.h", "w"); fprintf(fp, "/*###########################################################################*/\n"); fprintf(fp, "/*# #*/\n"); fprintf(fp, "/*# ProEdit MP Multi-platform Programming Editor #*/\n"); fprintf(fp, "/*# #*/\n"); fprintf(fp, "/*# Designed/Developed/Produced by Adrian J. Michaud #*/\n"); fprintf(fp, "/*# #*/\n"); fprintf(fp, "/*# (C) 2006-2007 by Adrian J. Michaud. All Rights Reserved. #*/\n"); fprintf(fp, "/*# #*/\n"); fprintf(fp, "/*# Unpublished - rights reserved under the Copyright Laws of the #*/\n"); fprintf(fp, "/*# United States. Use, duplication, or disclosure by the #*/\n"); fprintf(fp, "/*# Government is subject to restrictions as set forth in #*/\n"); fprintf(fp, "/*# subparagraph (c)(1)(ii) of the Rights in Technical Data and #*/\n"); fprintf(fp, "/*# Computer Software clause at 252.227-7013. #*/\n"); fprintf(fp, "/*# #*/\n"); fprintf(fp, "/*# This software contains information of a proprietary nature #*/\n"); fprintf(fp, "/*# and is classified confidential. #*/\n"); fprintf(fp, "/*# #*/\n"); fprintf(fp, "/*# ALL INFORMATION CONTAINED HEREIN SHALL BE KEPT IN CONFIDENCE. #*/\n"); fprintf(fp, "/*# #*/\n"); fprintf(fp, "/*###########################################################################*/\n"); fprintf(fp, "\n"); fprintf(fp, "\nstatic char compressedL1[] = {\n "); for (i = 0; i < sizeof(compressedL1); i++) if (compressedL1[i]) fprintf(fp, "0x%02x,", compressedL1[i]); fprintf(fp, "\n};\n"); fprintf(fp, "\nstatic char compressedL2[] = {\n "); for (i = 0; i < sizeof(compressedL2); i++) if (compressedL2[i]) fprintf(fp, "0x%02x,", compressedL2[i]); fprintf(fp, "\n};\n"); fprintf(fp, "\nstatic char compressedL3[] = {\n "); for (i = 0; i < sizeof(compressedL3); i++) if (compressedL3[i]) fprintf(fp, "0x%02x,", compressedL3[i]); fprintf(fp, "\n};\n"); fprintf(fp, "\n"); fprintf(fp, "\nstatic char *suffixes[] = {\n"); for (i = 0; i < NUM_SFX; i++) { if (suffixFreq[i].occurances) fprintf(fp, " \"%s\", \t/* %d hits */\n", suffixList[i], suffixFreq[i].occurances); else fprintf(fp, " (char*)0, \t/* \"%s\" */\n", suffixList[i]); } fprintf(fp, "};\n\n"); fprintf(fp, "\nstatic unsigned char dictionary_words[]= {\n"); total = 0; for (i = 0; i < nibbleIndex; i += 2) { fprintf(fp, "0x%02x,", ((unsigned char)(nibbles[i] << 4) | (unsigned char)nibbles[i + 1])); if (++total >= 15) { total = 0; fprintf(fp, "\n"); } } fprintf(fp, "\n};\n"); fclose(fp); return (0); } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void PrintStrings(FILE*fp, SPELL_WORD*words) { while (words) { if (words->word) fprintf(fp, "%s\n", words->word); words = words->next; } } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void OtherSuffixCheck(char*root, int len, int suffix) { int i, alen; char newword[64]; SPELL_WORD*word; for (i = 0; i < NUM_SFX; i++) { if (i == suffix) continue; alen = strlen(suffixList[i]); sprintf(newword, "%s%s", root, suffixList[i]); #ifdef DEBUG printf("Checking %s (%s and %s)\n", newword, root, suffixList[i]); #endif word = WordLookup(newword, len + alen); if (word) { #ifdef DEBUG printf("Found '%s'\n", newword); #endif suffixFreq[i].suffix = i; suffixFreq[i].occurances++; HashSuffix(root, len, i); /* Remove this suffix word from the word list because */ /* it's now located on the suffix list. */ word->word = 0; } } } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void SortHash(SPELL_WORD*words) { while (words) { if (words->word) sorted[numSorted++] = words; words = words->next; } } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static int SortChar(const void*arg1, const void*arg2) { char c1, c2; c1 = *(char*)arg1; c2 = *(char*)arg2; return (c1 - c2); } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void HashSuffix(char*word, int len, int suffix) { int index; SPELL_WORD*newWord; newWord = malloc(sizeof(SPELL_WORD)); newWord->suffix = (char)suffix; newWord->word = malloc(len + 1); memcpy(newWord->word, word, len); newWord->word[len] = 0; index = HashIt(word, len); newWord->next = suffix_hash[index]; suffix_hash[index] = newWord; } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void HashWord(char*word, int len) { int index; SPELL_WORD*newWord; newWord = malloc(sizeof(SPELL_WORD)); newWord->word = malloc(len + 1); newWord->suffix = 0; memcpy(newWord->word, word, len); newWord->word[len] = 0; index = HashIt(word, len); newWord->next = word_hash[index]; word_hash[index] = newWord; } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static int HashIt(char*word, int len) { unsigned int hash = 5137; int i; for (i = 0; i < len; i++) hash = ((hash << 5) + hash) + word[i]; return (hash%HASH_TABLE_SIZE); } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static int LoadDict(char*dict) { FILE*fp; int i, total = 0, len, dup = 0; char list[256]; SPELL_WORD*hashWalk; fp = fopen(dict, "r"); if (!fp) { printf("\nUnable to open dictionary file %s\n", dict); return (0); } while (fgets(list, sizeof(list) - 1, fp)) { len = strlen(list); while (len && (list[len - 1] == 10 || list[len - 1] == 13)) { len--; list[len] = 0; } /* Throw away 1 letter words */ if (len < 2) { printf("Ignored '%s' 1 letter word.\n", list); continue; } /* Throw away words that are too long. */ if (len > MAX_WORD_LEN) { printf("Ignored '%s' because it's too lonig\n", list); continue; } /* Convert word to lower case */ for (i = 0; i < len; i++) if (list[i] >= 'A' && list[i] <= 'Z') list[i] += 32; /* Throw away words with non standard letters. */ for (i = 0; i < len; i++) { if ((list[i] >= 'a' && list[i] <= 'z') || list[i] == '\'') continue; break; } if (i != len) { printf("Ignored '%s' due to non-standard letters.\n", list); continue; } /* Check for any duplicates. */ hashWalk = word_hash[HashIt(list, len)]; while (hashWalk) { if (hashWalk->word) { if (!strcmp(hashWalk->word, list)) break; } hashWalk = hashWalk->next; } /* Throw away any duplicates. */ if (hashWalk) { dup++; continue; } HashWord(list, len); total++; } fclose(fp); printf("%d words loaded, and %d duplicates from %s\n", total, dup, dict); return (total); } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static int SortWords(const void*arg1, const void*arg2) { SPELL_WORD*word1 = *(SPELL_WORD**)arg1; SPELL_WORD*word2 = *(SPELL_WORD**)arg2; return (strcmp(word1->word, word2->word)); } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static int SortCharFreq(const void*arg1, const void*arg2) { CHAR_FREQ*freq1 = (CHAR_FREQ*)arg1; CHAR_FREQ*freq2 = (CHAR_FREQ*)arg2; return (freq2->occurances - freq1->occurances); } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void CompressPrefixes(void) { int i, j, len; char previous[64]; strcpy(previous, ""); for (j = 0; j < numSorted; j++) { len = strlen(sorted[j]->word); if (strlen(previous)) { for (i = 0; i < len; i++) if (previous[i] != sorted[j]->word[i]) break; strcpy(previous, sorted[j]->word); if (i >= 2) { if (i > 15) i = 15; sprintf(sorted[j]->word, "%c%s", (unsigned char)(0xF0 | i), & previous[i]); } } else strcpy(previous, sorted[j]->word); } } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void CompressLine(char*line, int len) { int i; for (i = 0; i < len; i++) { if (i == 0) { if ((unsigned char)line[i] >= 0xf0) { nibbles[nibbleIndex++] = (unsigned char)line[i]&0xf; continue; } else nibbles[nibbleIndex++] = 0x00; } switch (charLevel[(unsigned char)line[i]]) { case 1 : nibbles[nibbleIndex++] = charLookup[(unsigned char)line[i]]; break; case 2 : nibbles[nibbleIndex++] = 0x0d; nibbles[nibbleIndex++] = charLookup[(unsigned char)line[i]]; break; case 3 : nibbles[nibbleIndex++] = 0x0e; nibbles[nibbleIndex++] = charLookup[(unsigned char)line[i]]; break; default : { printf("\nError, Unknown byte '%c' 0x%02x at offset %d\n", ( unsigned char)line[i], (unsigned char)line[i], i); exit(0); } } } nibbles[nibbleIndex++] = 0xf; } /*###########################################################################*/ /*# #*/ /*# #*/ /*# #*/ /*# #*/ /*###########################################################################*/ static void BuildFreqTable(void) { int i; int len, j; unsigned char ch; memset(charFreq, 0, sizeof(charFreq)); allocSize = 0; for (i = 0; i < numSorted; i++) { len = strlen(sorted[i]->word); for (j = 0; j < len; j++) { ch = sorted[i]->word[j]; if (ch >= 0xf0) continue; charFreq[ch].ch = ch; charFreq[ch].occurances++; } allocSize += len; } qsort(charFreq, 256, sizeof(CHAR_FREQ), SortCharFreq); for (i = 0; i < 13; i++) { ch = charFreq[i].ch; compressedL1[i] = ch; charLevel[ch] = 1; charLookup[ch] = i; } for (i = 0; i < 13; i++) { ch = charFreq[i + 13].ch; compressedL2[i] = ch; charLevel[ch] = 2; charLookup[ch] = i; } for (i = 0; i < 13; i++) { ch = charFreq[i + 26].ch; compressedL3[i] = ch; charLevel[ch] = 3; charLookup[ch] = i; } printf("\nLevel 1:"); for (i = 0; i < 13; i++) if (compressedL1[i]) printf("%c=%d ", compressedL1[i], i); printf("\nLevel 2:"); for (i = 0; i < 13; i++) if (compressedL2[i]) printf("%c=%d ", compressedL2[i], i); printf("\nLevel 3:"); for (i = 0; i < 13; i++) if (compressedL3[i]) printf("%c=%d ", compressedL3[i], i); printf("\n\nFrequency table:\n"); for (i = 0; i < 256; i++) if (charFreq[i].occurances) printf("%c = %d occurances\n", charFreq[i].ch, charFreq[i]. occurances); }
the_stack_data/126703147.c
#include <stdio.h> #include <stdlib.h> #include <string.h> #include <locale.h> #include <stdbool.h> FILE *AbreArquivo(char modo, char caminho[30]) { FILE *arquivo; switch (modo) { case 'g': arquivo = fopen(caminho, "wt"); break; case 'l': arquivo = fopen(caminho, "rt"); break; case 'a': arquivo = fopen(caminho, "a"); break; } if (arquivo == NULL) { printf("NAO FOI POSSIVEL ABRIR O ARQUIVO!"); exit(0); } return arquivo; } void FecharArquivo(FILE *arquivo) { fclose(arquivo); } void comprarProdutos(char produtoA[][30], int tamanho) { int n, c = 0, opcao = 0, qtd, count = 0; long long int cpf = 0; char produto[30], charCpf[12]; printf("\n\nDIGITE O SEU CPF PARA A COMPRA: \n->"); scanf("%lld", &cpf); lltoa(cpf, charCpf, 10); printf("\n%s", charCpf); FILE *arquivo; arquivo = AbreArquivo('a', "bancoDados/vendas.txt"); fprintf(arquivo, "CPF - %s\n", charCpf); do { printf("\n\nESCOLHA O PRODUTO: (Ex. 'Arroz' )\n->"); setbuf(stdin, NULL); gets(produto); printf("\n\nESCOLHA A QUANTIDADE: (Ex. '2' (NUMERO DE PACOTES))\n->"); scanf("%d", &qtd); int result = 0; for (n = 0; n <= tamanho; n++) { result = strncmp(produto, produtoA[n], 30); if (result == 0) { produto[n] += produto[30]; c++; } } if (c == 0) { printf("\n\nPRODUTO NAO CADASTRADO!\n\n"); } else { fprintf(arquivo, "%s - %d\n", produto, qtd); } printf("\n\nDESEJA FINALIZAR A COMPRA? \n0-> nao \n1-> sim\n-->"); scanf("%d", &opcao); } while (opcao == 0); fprintf(arquivo, "\n"); FecharArquivo(arquivo); } void CadastraClientes(char nome[30], int telefone) { FILE *arquivo; arquivo = AbreArquivo('a', "bancoDados/cadastros.txt"); fprintf(arquivo, "%s %d\n", nome, telefone); FecharArquivo(arquivo); } void ListarProdutos(int opcao) { FILE *arquivo; int telefone, i = 0; char arrayProduto[90][30]; arquivo = AbreArquivo('l', "bancoDados/produtos.txt"); while (!feof(arquivo)) { fscanf(arquivo, "%s", &arrayProduto[i][0]); printf("%s\n", arrayProduto[i]); i++; } FecharArquivo(arquivo); if (opcao == 1) { comprarProdutos(arrayProduto, i); } } void ListarVendas() { FILE *arquivo; char produto[30], quantidade[30]; arquivo = AbreArquivo('l', "bancoDados/vendas.txt"); while (!feof(arquivo)) { fscanf(arquivo, "%s - %s ", &produto, &quantidade); printf("%s - %s\n", produto, quantidade); } FecharArquivo(arquivo); } void ListarClientes() { FILE *arquivo; char nome[30]; int telefone; arquivo = AbreArquivo('l', "bancoDados/cadastros.txt"); while (!feof(arquivo)) { fscanf(arquivo, "%s %d ", &nome, &telefone); printf("NOME: %s - TELEFONE: %d\n", nome, telefone); } FecharArquivo(arquivo); } void arte() { system("cls"); printf("..............................................................................."); printf("\n..............................................................................."); printf("\n..............................................................................."); printf("\n..............................................................................."); printf("\n.......#WW:.............+WWWWWWWWWWW#-......-####===#W#===#@@-..#WW*..........."); printf("\n.......#WW*............#W#.......-=WWW@.............:W*........+W@*W=.........."); printf("\n.......*WW*...........*W@............#W+............-W*........#W+.:W+........."); printf("\n.......*WW+...........@W+............#W+............-W=.......:W#...+W+........"); printf("\n.......*WW+..........-WW-............#W-............-W#.......@W:....@W:......."); printf("\n.......+WW+..........-W#.............#W-............-W@......+WWWWWWWWW@......."); printf("\n.......:WW+..........-W#............:WW.............-WW-....-WW***+:::#W*......"); printf("\n.......-WW+...........=W-...........@W*...=W:.......:WW-....@W+........@W......"); printf("\n........WW+............=W:.........#W#....+W*......+WW=....@W=.........:W@....."); printf("\n........WW:.............-#WW@@@@@WW@:......=W:....#WW:....#W#...........+W=...."); printf("\n........@WWWWWWWWWWWWWW#....................:WWWWW#:......+*.............+*...."); printf("\n..............................................................................."); printf("\n..............................................................................."); printf("\n...........FELIPE NOGUEIRA........HENRIQUE SS........HENRIQUE PALMA............"); printf("\n..............................................................................."); printf("\n........................PROFESSOR -- ALCIOMAR HOLLANDA........................."); printf("\n\n\n\t\tBEM VINDO AO PROGRAMA DA NOSSA LOJA\n\n\n"); system("pause"); } int main() { setlocale(LC_ALL, "Portuguese"); system("cls"); int opcao; char nome[30]; int telefone; bool condicao = true; arte(); do { printf("\n\n MENU"); printf("\n 1 - Listar Todos Produtos"); printf("\n 2 - Comprar Produtos"); printf("\n 3 - Cadastrar Clientes"); printf("\n 4 - Listar Vendas"); printf("\n 5 - Listar Clientes"); printf("\n 6 - Sair"); printf("\n\n\n DIGITE UMA OPCAO: \n->"); scanf("%d", &opcao); system("cls"); switch (opcao) { case 1: ListarProdutos(0); system("pause"); break; case 2: ListarProdutos(1); system("pause"); break; case 3: printf("CADASTRO DE CLIENTES\n"); printf("\nDIGITE O NOME DO CLIENTE: \n->"); setbuf(stdin, NULL); gets(nome); printf("\nDIGITE O TELEFONE: \n->"); scanf("%d", &telefone); CadastraClientes(nome, telefone); system("pause"); break; case 4: ListarVendas(); system("pause"); break; case 5: ListarClientes(); system("pause"); break; case 6: printf("\n\nFINALIZANDO...\n\n"); exit(0); break; default: printf("\n\nOPCAO INVALIDA! TENTE NOVAMENTE!\n\n"); system("pause"); } } while (condicao); return 0; }
the_stack_data/234516986.c
#include <stdio.h> #include <malloc.h> //#define INPUT_DATA #ifdef __GNUC__ #define max(x, y) ({ \ typeof(x) _max1 = (x); \ typeof(y) _max2 = (y); \ (void)(&_max1 == &_max2); \ _max1 > _max2 ? _max1 :_max2; \ }) #else #define max(x, y) ({ \ x > y ? x : y; \ }) #endif typedef struct Tree{ int data; struct Tree *left; struct Tree *right; struct Tree *parent; int color; }Tree; Tree *root = NULL; int search(int data, Tree **node); /*传入数据,插入数据到当前树中*/ void add(int data); /*旋转*/ void rotate34(Tree *a, Tree *b, Tree *c, Tree *t0, Tree *t1, Tree *t2, Tree *t3, int type); int tree_delete(int data); void LOG(Tree *root); void add_rebalance(Tree *node, Tree *parent, Tree *grandpa, Tree *uncle); void del_rebalance(Tree *node); int search(int data, Tree **node) { Tree *pointer = root, *parent = NULL; while (pointer != NULL) { parent = pointer; if (data > pointer->data) { pointer = pointer->right; } else if (pointer->data > data) { pointer = pointer->left; } else { *node = pointer; return 0; } } *node = parent; return 1; } void rotate34(Tree *a, Tree *b, Tree *c, Tree *t0, Tree *t1, Tree *t2, Tree *t3, int type) { if (type == 1) { b->color = 0; a->color = 1; c->color = 1; } b->left = a; b->right = c; a->parent = b; a->left = t0; if (t0 != NULL) t0->parent = a; a->right = t1; if (t1 != NULL) t1->parent = a; c->parent = b; c->left = t2; if (t2 != NULL) t2->parent = c; c->right = t3; if (t3 != NULL) t3->parent = c; } void add(int data) { Tree *search_temp = NULL; Tree *parent = NULL; //根为空,直接插入 if (root == NULL) { root = (Tree *)malloc(sizeof(Tree)); root->parent = NULL; root->data = data; root->left = NULL; root->right = NULL; root->color = 0; return ; } //查找插入点 if (0 == search(data, &parent)) { return ; } //创建节点 Tree *node = (Tree *)malloc(sizeof(Tree)); node->color = 1; node->parent = parent; node->left = NULL; node->right = NULL; node->data = data; //父节点是黑色,直接插入 if (parent->color == 0) { if (parent->data > data) parent->left = node; else parent->right = node; return ; } //找到叔叔节点,和爷爷节点 Tree *grandpa = parent->parent; Tree *uncle = (parent == grandpa->left ? grandpa->right : grandpa->left); //将节点加入树中 if (node->data > parent->data) parent->right = node; else parent->left = node; //平衡性检查和修正 add_rebalance(node, parent, grandpa, uncle); return ; } void add_rebalance(Tree *node, Tree *parent, Tree *grandpa, Tree *uncle) { do { int yesorno = 0; if (uncle != NULL) { if (uncle->color == 1) yesorno = 1; } if (yesorno) { //情景一:如果叔叔节点存在且为红色,则进行变色 grandpa->color = 1; parent->color = 0; uncle->color = 0; //判断爷爷和爷爷的父节点是否为根,做特殊处理 //由于根节点必须是黑色,所以如果爷爷节点是根 //节点,则置为黑色 if (grandpa == root) { grandpa->color = 0; break; } if (grandpa->parent == root) { break; } node = grandpa; } else { //情景二:如果叔叔节点不存在或为黑色,则需要进行旋转 if (grandpa->left == parent && node->data > parent->data) { //LL parent->parent = grandpa->parent; if (grandpa->parent != NULL) { if (grandpa->parent->left == grandpa) grandpa->parent->left = parent; else grandpa->parent->right = parent; } else { root = parent; } rotate34(node, parent, grandpa, node->left, node->right, parent->right, grandpa->right, 1); node = parent; } else if (grandpa->left == parent && node->data < parent->data) { //LR node->parent = grandpa->parent; if (grandpa->parent != NULL) { if (grandpa->parent->left == grandpa) grandpa->parent->left = node; else grandpa->parent->right = node; } else { root = node; } rotate34(parent, node, grandpa, parent->left, node->left, node->right, grandpa->right, 1); } else if (grandpa->right == parent && node->data < parent->data) { //RL node->parent = grandpa->parent; if (grandpa->parent != NULL) { if (grandpa->parent->left == grandpa) grandpa->parent->left = node; else grandpa->parent->right = node; } else { root = node; } rotate34(grandpa, node, parent, grandpa->left, node->left, node->right, parent->right, 1); } else if (grandpa->right == parent && node->data > parent->data) { //RR parent->parent = grandpa->parent; if (grandpa->parent != NULL) { if (grandpa->parent->left == grandpa) grandpa->parent->left = parent; else grandpa->parent->right = parent; } else { root = parent; } rotate34(grandpa, parent, node, grandpa->left, parent->left, node->left, node->right, 1); node = parent; } } parent = node->parent; if (parent == NULL || parent == root) break; grandpa = parent->parent; uncle = (parent == grandpa->left ? grandpa->right : grandpa->left); } while (node->parent->color == 1 && node->color == 1); } int tree_delete(int data) { Tree *node = NULL; Tree *child = NULL; Tree *parent = NULL; if (1 == search(data, &node)) { return 0; } parent = node->parent; //如果删除的节点有左右孩子,寻找前驱节点,并置换位置 if (node->left != NULL && node->right != NULL) { Tree *pointer = node->left; while(pointer->right != NULL) { pointer = pointer->right; } node->data = pointer->data; node = pointer; parent = node->parent; } if (node->left != node->right) { //被删除的节点有一个子节点,则将子节点代替删除节点, //并将替换后的节点置为黑色。注意:因为只有一个子节点, //所以该节点只能是黑色,其子节点只能是红色,否则会破 //坏黑色完美平衡 if (node->left != NULL) child = node->left; else child = node->right; if (parent != NULL) { if (node == parent->left) parent->left = child; else parent->right = child; } else { root = child; } child->color = 0; child->parent = parent; } //叶节点,删除,如果节点是红色,直接删除返回,否则进行再平衡 if (node->left == node->right) { if (parent == NULL) { root = NULL; free(node); return 0; } if (node->color == 0) { del_rebalance(node); } if (parent->left == node) parent->left = NULL; else parent->right = NULL; } free(node); return 0; } void del_rebalance(Tree *node) { Tree *parent = node->parent; Tree *brother = (parent->left == node ? parent->right : parent->left); //如果兄弟为红色,则进行变色和旋转,变化后依旧无法直接删除, //但是经过操作后,兄弟节点将转化为黑色。 if (brother->color == 1) { int temp_color = 0; temp_color = parent->color; parent->color = brother->color; brother->color = temp_color; //如果删除节点是左孩子 if (parent == root) root = brother; if (parent->parent->left == parent) parent->parent->left = brother; else parent->parent->right = brother; if (parent->left == node) { rotate34(parent, brother, brother->right, node, brother->left, brother->right->left, brother->right->right, 0); //否则 } else { rotate34(brother->left, brother, parent, brother->left->left, brother->left->right, brother->right, node, 0); } //兄弟节点变了,重新计算 brother = (parent->left == node ? parent->right : parent->left); } //到此处,兄弟节点将一定是黑色。 //而且兄弟节点要么只有一个红色,要么有两个红色,要么没有儿子 int temp_color = 0; if (parent->left == node && brother->left != brother->right) { if (brother->left != NULL) { //RL if (parent == root) root = brother->left; brother->left->color = parent->color; parent->color = 0; if (parent->parent->left == parent) parent->parent->left = brother->left; else parent->parent->right = brother->left; rotate34(parent, brother->left, brother, node, brother->left, brother->right, brother->right, 0); } else { //RR temp_color = parent->color; parent->color = brother->color; brother->color = temp_color; brother->right->color = 0; if (parent == root) root = brother; if (parent->parent->left == parent) parent->parent->left = brother; else parent->parent->right = brother; rotate34(parent, brother, brother->right, node, brother->left, brother->right->left, brother->right->right, 0); } } else if (parent->right == node && brother->left != brother->right) { if (brother->left != NULL) { //LL if (parent == root) root = brother; temp_color = parent->color; parent->color = brother->color; brother->color = temp_color; brother->left->color = 0; if (parent->parent->left == parent) parent->parent->left = brother; else parent->parent->right = brother; rotate34(brother->left, brother, parent, brother->left, brother->right, brother->right, node, 0); } else { //LR if (parent == root) root = brother->right; brother->right->color = parent->color; parent->color = 0; if (parent->parent->left == parent) parent->parent->left = brother->right; else parent->parent->right = brother->right; rotate34(brother, brother->right, parent, brother->left, brother->right->left, brother->right->right, node, 0); } } else if (brother->left == brother->right) { if (parent->color == 0) { brother->color = 1; } else { parent->color = 0; brother->color = 1; } } } int main() { #ifdef INPUT_DATA int n = 0, is_del = 0, del_num = 0; printf("Please input size of tree: "); scanf("%d", &n); for (int i = 0; i < n; i++) { int data = 0; scanf("%d", &data); add(data); } getchar(); #else int test_data[16] = {0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15}; int n = 16, is_del = 0, del_num = 0; for (int i = 0; i < n; i++) { add(test_data[i]); } #endif printf("Do you want delete nodes? (y/n)"); is_del = getchar(); if (0x59 != is_del && 0x79 != is_del) { goto RETURN; } printf("How many nodes do you want to delete?"); scanf("%d", &del_num); if (del_num > n) { printf("Not so many nodes"); goto RETURN; } for (int i = 0; i < del_num; i++) { int data = 0; scanf("%d", &data); tree_delete(data); } RETURN: LOG(root); return 0; } void LOG(Tree *ptr_root) { if (ptr_root != NULL) { LOG(ptr_root->left); printf("%d ", ptr_root->data); LOG(ptr_root->right); } }
the_stack_data/115766382.c
/* Programa de cilos for/ while/ do white */ #include <stdio.h> #include <stdlib.h> int main(){ int contador; // for for (contador = 2; contador <= 100; contador = contador + 2) { printf("%i for\n", contador); } contador = 2; // while while (contador <= 100) { printf("%i while\n", contador); contador = contador + 2; } contador = 2; // do while do { printf("%i do while\n", contador); contador = contador + 2; } while(contador <= 100); return 0; }
the_stack_data/93887164.c
#include <string.h> #include <wchar.h> wchar_t *wmemmove(wchar_t *d, const wchar_t *s, size_t n) { if ((size_t)(d-s) < n) while (n--) d[n] = s[n]; else while (n--) *d++ = *s++; return d; }
the_stack_data/154830230.c
/* * Copyright (c) Facebook, Inc. and its affiliates. * * This source code is licensed under the MIT license found in the * LICENSE file in the root directory of this source tree. */ #include <stdlib.h> void uaf_intraprocedural_bad(int* x) { free(x); int _ = *x; } void free_wrapper(int* p) { free(p); } void free_wrapper_uaf_bad(int* x) { free_wrapper(x); int _ = *x; } void deref_int(int* x) { int _ = *x; } void uaf_via_deref_bad(int* x) { free(x); deref_int(x); } void uaf_via_deref_and_free_wrapper_bad(int* x) { free_wrapper(x); deref_int(x); }
the_stack_data/686518.c
# 1 "benchmarks/ds-06-impl1.c" # 1 "<built-in>" # 1 "<command-line>" # 1 "/usr/include/stdc-predef.h" 1 3 4 # 1 "<command-line>" 2 # 1 "benchmarks/ds-06-impl1.c" # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 1 # 20 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/definitions.h" 1 # 132 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/definitions.h" int X_SIZE_VALUE = 0; int overflow_mode = 1; int rounding_mode = 0; # 155 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/definitions.h" typedef struct { double a[100]; int a_size; double b[100]; int b_size; double sample_time; double a_uncertainty[100]; double b_uncertainty[100]; } digital_system; typedef struct { double A[4][4]; double B[4][4]; double C[4][4]; double D[4][4]; double states[4][4]; double outputs[4][4]; double inputs[4][4]; double K[4][4]; unsigned int nStates; unsigned int nInputs; unsigned int nOutputs; } digital_system_state_space; typedef struct { int int_bits; int frac_bits; double max; double min; int default_realization; double delta; int scale; double max_error; } implementation; typedef struct { int push; int in; int sbiw; int cli; int out; int std; int ldd; int subi; int sbci; int lsl; int rol; int add; int adc; int adiw; int rjmp; int mov; int sbc; int ld; int rcall; int cp; int cpc; int ldi; int brge; int pop; int ret; int st; int brlt; int cpi; } instructions; typedef struct { long clock; int device; double cycle; instructions assembly; } hardware; typedef struct{ float Ap, Ar, Ac; float wp, wc, wr; int type; }filter_parameters; # 21 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 1 # 17 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" # 1 "/usr/include/stdlib.h" 1 3 4 # 25 "/usr/include/stdlib.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/libc-header-start.h" 1 3 4 # 33 "/usr/include/x86_64-linux-gnu/bits/libc-header-start.h" 3 4 # 1 "/usr/include/features.h" 1 3 4 # 461 "/usr/include/features.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/sys/cdefs.h" 1 3 4 # 452 "/usr/include/x86_64-linux-gnu/sys/cdefs.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/wordsize.h" 1 3 4 # 453 "/usr/include/x86_64-linux-gnu/sys/cdefs.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/long-double.h" 1 3 4 # 454 "/usr/include/x86_64-linux-gnu/sys/cdefs.h" 2 3 4 # 462 "/usr/include/features.h" 2 3 4 # 485 "/usr/include/features.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/gnu/stubs.h" 1 3 4 # 10 "/usr/include/x86_64-linux-gnu/gnu/stubs.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/gnu/stubs-64.h" 1 3 4 # 11 "/usr/include/x86_64-linux-gnu/gnu/stubs.h" 2 3 4 # 486 "/usr/include/features.h" 2 3 4 # 34 "/usr/include/x86_64-linux-gnu/bits/libc-header-start.h" 2 3 4 # 26 "/usr/include/stdlib.h" 2 3 4 # 1 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stddef.h" 1 3 4 # 209 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stddef.h" 3 4 # 209 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stddef.h" 3 4 typedef long unsigned int size_t; # 321 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stddef.h" 3 4 typedef int wchar_t; # 32 "/usr/include/stdlib.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/waitflags.h" 1 3 4 # 52 "/usr/include/x86_64-linux-gnu/bits/waitflags.h" 3 4 typedef enum { P_ALL, P_PID, P_PGID } idtype_t; # 40 "/usr/include/stdlib.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/waitstatus.h" 1 3 4 # 41 "/usr/include/stdlib.h" 2 3 4 # 55 "/usr/include/stdlib.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/floatn.h" 1 3 4 # 120 "/usr/include/x86_64-linux-gnu/bits/floatn.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/floatn-common.h" 1 3 4 # 24 "/usr/include/x86_64-linux-gnu/bits/floatn-common.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/long-double.h" 1 3 4 # 25 "/usr/include/x86_64-linux-gnu/bits/floatn-common.h" 2 3 4 # 121 "/usr/include/x86_64-linux-gnu/bits/floatn.h" 2 3 4 # 56 "/usr/include/stdlib.h" 2 3 4 typedef struct { int quot; int rem; } div_t; typedef struct { long int quot; long int rem; } ldiv_t; __extension__ typedef struct { long long int quot; long long int rem; } lldiv_t; # 97 "/usr/include/stdlib.h" 3 4 extern size_t __ctype_get_mb_cur_max (void) __attribute__ ((__nothrow__ , __leaf__)) ; extern double atof (const char *__nptr) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__pure__)) __attribute__ ((__nonnull__ (1))) ; extern int atoi (const char *__nptr) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__pure__)) __attribute__ ((__nonnull__ (1))) ; extern long int atol (const char *__nptr) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__pure__)) __attribute__ ((__nonnull__ (1))) ; __extension__ extern long long int atoll (const char *__nptr) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__pure__)) __attribute__ ((__nonnull__ (1))) ; extern double strtod (const char *__restrict __nptr, char **__restrict __endptr) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern float strtof (const char *__restrict __nptr, char **__restrict __endptr) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern long double strtold (const char *__restrict __nptr, char **__restrict __endptr) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); # 176 "/usr/include/stdlib.h" 3 4 extern long int strtol (const char *__restrict __nptr, char **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern unsigned long int strtoul (const char *__restrict __nptr, char **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); __extension__ extern long long int strtoq (const char *__restrict __nptr, char **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); __extension__ extern unsigned long long int strtouq (const char *__restrict __nptr, char **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); __extension__ extern long long int strtoll (const char *__restrict __nptr, char **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); __extension__ extern unsigned long long int strtoull (const char *__restrict __nptr, char **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); # 385 "/usr/include/stdlib.h" 3 4 extern char *l64a (long int __n) __attribute__ ((__nothrow__ , __leaf__)) ; extern long int a64l (const char *__s) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__pure__)) __attribute__ ((__nonnull__ (1))) ; # 1 "/usr/include/x86_64-linux-gnu/sys/types.h" 1 3 4 # 27 "/usr/include/x86_64-linux-gnu/sys/types.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types.h" 1 3 4 # 27 "/usr/include/x86_64-linux-gnu/bits/types.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/wordsize.h" 1 3 4 # 28 "/usr/include/x86_64-linux-gnu/bits/types.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/timesize.h" 1 3 4 # 29 "/usr/include/x86_64-linux-gnu/bits/types.h" 2 3 4 typedef unsigned char __u_char; typedef unsigned short int __u_short; typedef unsigned int __u_int; typedef unsigned long int __u_long; typedef signed char __int8_t; typedef unsigned char __uint8_t; typedef signed short int __int16_t; typedef unsigned short int __uint16_t; typedef signed int __int32_t; typedef unsigned int __uint32_t; typedef signed long int __int64_t; typedef unsigned long int __uint64_t; typedef __int8_t __int_least8_t; typedef __uint8_t __uint_least8_t; typedef __int16_t __int_least16_t; typedef __uint16_t __uint_least16_t; typedef __int32_t __int_least32_t; typedef __uint32_t __uint_least32_t; typedef __int64_t __int_least64_t; typedef __uint64_t __uint_least64_t; typedef long int __quad_t; typedef unsigned long int __u_quad_t; typedef long int __intmax_t; typedef unsigned long int __uintmax_t; # 141 "/usr/include/x86_64-linux-gnu/bits/types.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/typesizes.h" 1 3 4 # 142 "/usr/include/x86_64-linux-gnu/bits/types.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/time64.h" 1 3 4 # 143 "/usr/include/x86_64-linux-gnu/bits/types.h" 2 3 4 typedef unsigned long int __dev_t; typedef unsigned int __uid_t; typedef unsigned int __gid_t; typedef unsigned long int __ino_t; typedef unsigned long int __ino64_t; typedef unsigned int __mode_t; typedef unsigned long int __nlink_t; typedef long int __off_t; typedef long int __off64_t; typedef int __pid_t; typedef struct { int __val[2]; } __fsid_t; typedef long int __clock_t; typedef unsigned long int __rlim_t; typedef unsigned long int __rlim64_t; typedef unsigned int __id_t; typedef long int __time_t; typedef unsigned int __useconds_t; typedef long int __suseconds_t; typedef int __daddr_t; typedef int __key_t; typedef int __clockid_t; typedef void * __timer_t; typedef long int __blksize_t; typedef long int __blkcnt_t; typedef long int __blkcnt64_t; typedef unsigned long int __fsblkcnt_t; typedef unsigned long int __fsblkcnt64_t; typedef unsigned long int __fsfilcnt_t; typedef unsigned long int __fsfilcnt64_t; typedef long int __fsword_t; typedef long int __ssize_t; typedef long int __syscall_slong_t; typedef unsigned long int __syscall_ulong_t; typedef __off64_t __loff_t; typedef char *__caddr_t; typedef long int __intptr_t; typedef unsigned int __socklen_t; typedef int __sig_atomic_t; # 30 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 typedef __u_char u_char; typedef __u_short u_short; typedef __u_int u_int; typedef __u_long u_long; typedef __quad_t quad_t; typedef __u_quad_t u_quad_t; typedef __fsid_t fsid_t; typedef __loff_t loff_t; typedef __ino_t ino_t; # 59 "/usr/include/x86_64-linux-gnu/sys/types.h" 3 4 typedef __dev_t dev_t; typedef __gid_t gid_t; typedef __mode_t mode_t; typedef __nlink_t nlink_t; typedef __uid_t uid_t; typedef __off_t off_t; # 97 "/usr/include/x86_64-linux-gnu/sys/types.h" 3 4 typedef __pid_t pid_t; typedef __id_t id_t; typedef __ssize_t ssize_t; typedef __daddr_t daddr_t; typedef __caddr_t caddr_t; typedef __key_t key_t; # 1 "/usr/include/x86_64-linux-gnu/bits/types/clock_t.h" 1 3 4 typedef __clock_t clock_t; # 127 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/clockid_t.h" 1 3 4 typedef __clockid_t clockid_t; # 129 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/time_t.h" 1 3 4 typedef __time_t time_t; # 130 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/timer_t.h" 1 3 4 typedef __timer_t timer_t; # 131 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 # 144 "/usr/include/x86_64-linux-gnu/sys/types.h" 3 4 # 1 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stddef.h" 1 3 4 # 145 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 typedef unsigned long int ulong; typedef unsigned short int ushort; typedef unsigned int uint; # 1 "/usr/include/x86_64-linux-gnu/bits/stdint-intn.h" 1 3 4 # 24 "/usr/include/x86_64-linux-gnu/bits/stdint-intn.h" 3 4 typedef __int8_t int8_t; typedef __int16_t int16_t; typedef __int32_t int32_t; typedef __int64_t int64_t; # 156 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 typedef __uint8_t u_int8_t; typedef __uint16_t u_int16_t; typedef __uint32_t u_int32_t; typedef __uint64_t u_int64_t; typedef int register_t __attribute__ ((__mode__ (__word__))); # 176 "/usr/include/x86_64-linux-gnu/sys/types.h" 3 4 # 1 "/usr/include/endian.h" 1 3 4 # 24 "/usr/include/endian.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/endian.h" 1 3 4 # 35 "/usr/include/x86_64-linux-gnu/bits/endian.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/endianness.h" 1 3 4 # 36 "/usr/include/x86_64-linux-gnu/bits/endian.h" 2 3 4 # 25 "/usr/include/endian.h" 2 3 4 # 35 "/usr/include/endian.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/byteswap.h" 1 3 4 # 33 "/usr/include/x86_64-linux-gnu/bits/byteswap.h" 3 4 static __inline __uint16_t __bswap_16 (__uint16_t __bsx) { return __builtin_bswap16 (__bsx); } static __inline __uint32_t __bswap_32 (__uint32_t __bsx) { return __builtin_bswap32 (__bsx); } # 69 "/usr/include/x86_64-linux-gnu/bits/byteswap.h" 3 4 __extension__ static __inline __uint64_t __bswap_64 (__uint64_t __bsx) { return __builtin_bswap64 (__bsx); } # 36 "/usr/include/endian.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/uintn-identity.h" 1 3 4 # 32 "/usr/include/x86_64-linux-gnu/bits/uintn-identity.h" 3 4 static __inline __uint16_t __uint16_identity (__uint16_t __x) { return __x; } static __inline __uint32_t __uint32_identity (__uint32_t __x) { return __x; } static __inline __uint64_t __uint64_identity (__uint64_t __x) { return __x; } # 37 "/usr/include/endian.h" 2 3 4 # 177 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/sys/select.h" 1 3 4 # 30 "/usr/include/x86_64-linux-gnu/sys/select.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/select.h" 1 3 4 # 22 "/usr/include/x86_64-linux-gnu/bits/select.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/wordsize.h" 1 3 4 # 23 "/usr/include/x86_64-linux-gnu/bits/select.h" 2 3 4 # 31 "/usr/include/x86_64-linux-gnu/sys/select.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/sigset_t.h" 1 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/__sigset_t.h" 1 3 4 typedef struct { unsigned long int __val[(1024 / (8 * sizeof (unsigned long int)))]; } __sigset_t; # 5 "/usr/include/x86_64-linux-gnu/bits/types/sigset_t.h" 2 3 4 typedef __sigset_t sigset_t; # 34 "/usr/include/x86_64-linux-gnu/sys/select.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/struct_timeval.h" 1 3 4 struct timeval { __time_t tv_sec; __suseconds_t tv_usec; }; # 38 "/usr/include/x86_64-linux-gnu/sys/select.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/struct_timespec.h" 1 3 4 # 10 "/usr/include/x86_64-linux-gnu/bits/types/struct_timespec.h" 3 4 struct timespec { __time_t tv_sec; __syscall_slong_t tv_nsec; # 26 "/usr/include/x86_64-linux-gnu/bits/types/struct_timespec.h" 3 4 }; # 40 "/usr/include/x86_64-linux-gnu/sys/select.h" 2 3 4 typedef __suseconds_t suseconds_t; typedef long int __fd_mask; # 59 "/usr/include/x86_64-linux-gnu/sys/select.h" 3 4 typedef struct { __fd_mask __fds_bits[1024 / (8 * (int) sizeof (__fd_mask))]; } fd_set; typedef __fd_mask fd_mask; # 91 "/usr/include/x86_64-linux-gnu/sys/select.h" 3 4 # 101 "/usr/include/x86_64-linux-gnu/sys/select.h" 3 4 extern int select (int __nfds, fd_set *__restrict __readfds, fd_set *__restrict __writefds, fd_set *__restrict __exceptfds, struct timeval *__restrict __timeout); # 113 "/usr/include/x86_64-linux-gnu/sys/select.h" 3 4 extern int pselect (int __nfds, fd_set *__restrict __readfds, fd_set *__restrict __writefds, fd_set *__restrict __exceptfds, const struct timespec *__restrict __timeout, const __sigset_t *__restrict __sigmask); # 126 "/usr/include/x86_64-linux-gnu/sys/select.h" 3 4 # 180 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 typedef __blksize_t blksize_t; typedef __blkcnt_t blkcnt_t; typedef __fsblkcnt_t fsblkcnt_t; typedef __fsfilcnt_t fsfilcnt_t; # 227 "/usr/include/x86_64-linux-gnu/sys/types.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/pthreadtypes.h" 1 3 4 # 23 "/usr/include/x86_64-linux-gnu/bits/pthreadtypes.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/thread-shared-types.h" 1 3 4 # 44 "/usr/include/x86_64-linux-gnu/bits/thread-shared-types.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/pthreadtypes-arch.h" 1 3 4 # 21 "/usr/include/x86_64-linux-gnu/bits/pthreadtypes-arch.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/wordsize.h" 1 3 4 # 22 "/usr/include/x86_64-linux-gnu/bits/pthreadtypes-arch.h" 2 3 4 # 45 "/usr/include/x86_64-linux-gnu/bits/thread-shared-types.h" 2 3 4 typedef struct __pthread_internal_list { struct __pthread_internal_list *__prev; struct __pthread_internal_list *__next; } __pthread_list_t; typedef struct __pthread_internal_slist { struct __pthread_internal_slist *__next; } __pthread_slist_t; # 74 "/usr/include/x86_64-linux-gnu/bits/thread-shared-types.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/struct_mutex.h" 1 3 4 # 22 "/usr/include/x86_64-linux-gnu/bits/struct_mutex.h" 3 4 struct __pthread_mutex_s { int __lock; unsigned int __count; int __owner; unsigned int __nusers; int __kind; short __spins; short __elision; __pthread_list_t __list; # 53 "/usr/include/x86_64-linux-gnu/bits/struct_mutex.h" 3 4 }; # 75 "/usr/include/x86_64-linux-gnu/bits/thread-shared-types.h" 2 3 4 # 87 "/usr/include/x86_64-linux-gnu/bits/thread-shared-types.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/struct_rwlock.h" 1 3 4 # 23 "/usr/include/x86_64-linux-gnu/bits/struct_rwlock.h" 3 4 struct __pthread_rwlock_arch_t { unsigned int __readers; unsigned int __writers; unsigned int __wrphase_futex; unsigned int __writers_futex; unsigned int __pad3; unsigned int __pad4; int __cur_writer; int __shared; signed char __rwelision; unsigned char __pad1[7]; unsigned long int __pad2; unsigned int __flags; # 55 "/usr/include/x86_64-linux-gnu/bits/struct_rwlock.h" 3 4 }; # 88 "/usr/include/x86_64-linux-gnu/bits/thread-shared-types.h" 2 3 4 struct __pthread_cond_s { __extension__ union { __extension__ unsigned long long int __wseq; struct { unsigned int __low; unsigned int __high; } __wseq32; }; __extension__ union { __extension__ unsigned long long int __g1_start; struct { unsigned int __low; unsigned int __high; } __g1_start32; }; unsigned int __g_refs[2] ; unsigned int __g_size[2]; unsigned int __g1_orig_size; unsigned int __wrefs; unsigned int __g_signals[2]; }; # 24 "/usr/include/x86_64-linux-gnu/bits/pthreadtypes.h" 2 3 4 typedef unsigned long int pthread_t; typedef union { char __size[4]; int __align; } pthread_mutexattr_t; typedef union { char __size[4]; int __align; } pthread_condattr_t; typedef unsigned int pthread_key_t; typedef int pthread_once_t; union pthread_attr_t { char __size[56]; long int __align; }; typedef union pthread_attr_t pthread_attr_t; typedef union { struct __pthread_mutex_s __data; char __size[40]; long int __align; } pthread_mutex_t; typedef union { struct __pthread_cond_s __data; char __size[48]; __extension__ long long int __align; } pthread_cond_t; typedef union { struct __pthread_rwlock_arch_t __data; char __size[56]; long int __align; } pthread_rwlock_t; typedef union { char __size[8]; long int __align; } pthread_rwlockattr_t; typedef volatile int pthread_spinlock_t; typedef union { char __size[32]; long int __align; } pthread_barrier_t; typedef union { char __size[4]; int __align; } pthread_barrierattr_t; # 228 "/usr/include/x86_64-linux-gnu/sys/types.h" 2 3 4 # 395 "/usr/include/stdlib.h" 2 3 4 extern long int random (void) __attribute__ ((__nothrow__ , __leaf__)); extern void srandom (unsigned int __seed) __attribute__ ((__nothrow__ , __leaf__)); extern char *initstate (unsigned int __seed, char *__statebuf, size_t __statelen) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (2))); extern char *setstate (char *__statebuf) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); struct random_data { int32_t *fptr; int32_t *rptr; int32_t *state; int rand_type; int rand_deg; int rand_sep; int32_t *end_ptr; }; extern int random_r (struct random_data *__restrict __buf, int32_t *__restrict __result) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int srandom_r (unsigned int __seed, struct random_data *__buf) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (2))); extern int initstate_r (unsigned int __seed, char *__restrict __statebuf, size_t __statelen, struct random_data *__restrict __buf) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (2, 4))); extern int setstate_r (char *__restrict __statebuf, struct random_data *__restrict __buf) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int rand (void) __attribute__ ((__nothrow__ , __leaf__)); extern void srand (unsigned int __seed) __attribute__ ((__nothrow__ , __leaf__)); extern int rand_r (unsigned int *__seed) __attribute__ ((__nothrow__ , __leaf__)); extern double drand48 (void) __attribute__ ((__nothrow__ , __leaf__)); extern double erand48 (unsigned short int __xsubi[3]) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern long int lrand48 (void) __attribute__ ((__nothrow__ , __leaf__)); extern long int nrand48 (unsigned short int __xsubi[3]) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern long int mrand48 (void) __attribute__ ((__nothrow__ , __leaf__)); extern long int jrand48 (unsigned short int __xsubi[3]) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern void srand48 (long int __seedval) __attribute__ ((__nothrow__ , __leaf__)); extern unsigned short int *seed48 (unsigned short int __seed16v[3]) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern void lcong48 (unsigned short int __param[7]) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); struct drand48_data { unsigned short int __x[3]; unsigned short int __old_x[3]; unsigned short int __c; unsigned short int __init; __extension__ unsigned long long int __a; }; extern int drand48_r (struct drand48_data *__restrict __buffer, double *__restrict __result) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int erand48_r (unsigned short int __xsubi[3], struct drand48_data *__restrict __buffer, double *__restrict __result) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int lrand48_r (struct drand48_data *__restrict __buffer, long int *__restrict __result) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int nrand48_r (unsigned short int __xsubi[3], struct drand48_data *__restrict __buffer, long int *__restrict __result) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int mrand48_r (struct drand48_data *__restrict __buffer, long int *__restrict __result) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int jrand48_r (unsigned short int __xsubi[3], struct drand48_data *__restrict __buffer, long int *__restrict __result) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int srand48_r (long int __seedval, struct drand48_data *__buffer) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (2))); extern int seed48_r (unsigned short int __seed16v[3], struct drand48_data *__buffer) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern int lcong48_r (unsigned short int __param[7], struct drand48_data *__buffer) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2))); extern void *malloc (size_t __size) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__malloc__)) __attribute__ ((__alloc_size__ (1))) ; extern void *calloc (size_t __nmemb, size_t __size) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__malloc__)) __attribute__ ((__alloc_size__ (1, 2))) ; extern void *realloc (void *__ptr, size_t __size) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__warn_unused_result__)) __attribute__ ((__alloc_size__ (2))); extern void *reallocarray (void *__ptr, size_t __nmemb, size_t __size) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__warn_unused_result__)) __attribute__ ((__alloc_size__ (2, 3))); extern void free (void *__ptr) __attribute__ ((__nothrow__ , __leaf__)); # 1 "/usr/include/alloca.h" 1 3 4 # 24 "/usr/include/alloca.h" 3 4 # 1 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stddef.h" 1 3 4 # 25 "/usr/include/alloca.h" 2 3 4 extern void *alloca (size_t __size) __attribute__ ((__nothrow__ , __leaf__)); # 569 "/usr/include/stdlib.h" 2 3 4 extern void *valloc (size_t __size) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__malloc__)) __attribute__ ((__alloc_size__ (1))) ; extern int posix_memalign (void **__memptr, size_t __alignment, size_t __size) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))) ; extern void *aligned_alloc (size_t __alignment, size_t __size) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__malloc__)) __attribute__ ((__alloc_size__ (2))) ; extern void abort (void) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__noreturn__)); extern int atexit (void (*__func) (void)) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern int at_quick_exit (void (*__func) (void)) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern int on_exit (void (*__func) (int __status, void *__arg), void *__arg) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern void exit (int __status) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__noreturn__)); extern void quick_exit (int __status) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__noreturn__)); extern void _Exit (int __status) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__noreturn__)); extern char *getenv (const char *__name) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))) ; # 647 "/usr/include/stdlib.h" 3 4 extern int putenv (char *__string) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern int setenv (const char *__name, const char *__value, int __replace) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (2))); extern int unsetenv (const char *__name) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); extern int clearenv (void) __attribute__ ((__nothrow__ , __leaf__)); # 675 "/usr/include/stdlib.h" 3 4 extern char *mktemp (char *__template) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); # 688 "/usr/include/stdlib.h" 3 4 extern int mkstemp (char *__template) __attribute__ ((__nonnull__ (1))) ; # 710 "/usr/include/stdlib.h" 3 4 extern int mkstemps (char *__template, int __suffixlen) __attribute__ ((__nonnull__ (1))) ; # 731 "/usr/include/stdlib.h" 3 4 extern char *mkdtemp (char *__template) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))) ; # 784 "/usr/include/stdlib.h" 3 4 extern int system (const char *__command) ; # 800 "/usr/include/stdlib.h" 3 4 extern char *realpath (const char *__restrict __name, char *__restrict __resolved) __attribute__ ((__nothrow__ , __leaf__)) ; typedef int (*__compar_fn_t) (const void *, const void *); # 820 "/usr/include/stdlib.h" 3 4 extern void *bsearch (const void *__key, const void *__base, size_t __nmemb, size_t __size, __compar_fn_t __compar) __attribute__ ((__nonnull__ (1, 2, 5))) ; extern void qsort (void *__base, size_t __nmemb, size_t __size, __compar_fn_t __compar) __attribute__ ((__nonnull__ (1, 4))); # 840 "/usr/include/stdlib.h" 3 4 extern int abs (int __x) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)) ; extern long int labs (long int __x) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)) ; __extension__ extern long long int llabs (long long int __x) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)) ; extern div_t div (int __numer, int __denom) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)) ; extern ldiv_t ldiv (long int __numer, long int __denom) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)) ; __extension__ extern lldiv_t lldiv (long long int __numer, long long int __denom) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)) ; # 872 "/usr/include/stdlib.h" 3 4 extern char *ecvt (double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4))) ; extern char *fcvt (double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4))) ; extern char *gcvt (double __value, int __ndigit, char *__buf) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3))) ; extern char *qecvt (long double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4))) ; extern char *qfcvt (long double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4))) ; extern char *qgcvt (long double __value, int __ndigit, char *__buf) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3))) ; extern int ecvt_r (double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign, char *__restrict __buf, size_t __len) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4, 5))); extern int fcvt_r (double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign, char *__restrict __buf, size_t __len) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4, 5))); extern int qecvt_r (long double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign, char *__restrict __buf, size_t __len) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4, 5))); extern int qfcvt_r (long double __value, int __ndigit, int *__restrict __decpt, int *__restrict __sign, char *__restrict __buf, size_t __len) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (3, 4, 5))); extern int mblen (const char *__s, size_t __n) __attribute__ ((__nothrow__ , __leaf__)); extern int mbtowc (wchar_t *__restrict __pwc, const char *__restrict __s, size_t __n) __attribute__ ((__nothrow__ , __leaf__)); extern int wctomb (char *__s, wchar_t __wchar) __attribute__ ((__nothrow__ , __leaf__)); extern size_t mbstowcs (wchar_t *__restrict __pwcs, const char *__restrict __s, size_t __n) __attribute__ ((__nothrow__ , __leaf__)); extern size_t wcstombs (char *__restrict __s, const wchar_t *__restrict __pwcs, size_t __n) __attribute__ ((__nothrow__ , __leaf__)); extern int rpmatch (const char *__response) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))) ; # 957 "/usr/include/stdlib.h" 3 4 extern int getsubopt (char **__restrict __optionp, char *const *__restrict __tokens, char **__restrict __valuep) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1, 2, 3))) ; # 1003 "/usr/include/stdlib.h" 3 4 extern int getloadavg (double __loadavg[], int __nelem) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__nonnull__ (1))); # 1013 "/usr/include/stdlib.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/stdlib-float.h" 1 3 4 # 1014 "/usr/include/stdlib.h" 2 3 4 # 1023 "/usr/include/stdlib.h" 3 4 # 18 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 2 # 1 "/usr/include/assert.h" 1 3 4 # 66 "/usr/include/assert.h" 3 4 extern void __assert_fail (const char *__assertion, const char *__file, unsigned int __line, const char *__function) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__noreturn__)); extern void __assert_perror_fail (int __errnum, const char *__file, unsigned int __line, const char *__function) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__noreturn__)); extern void __assert (const char *__assertion, const char *__file, int __line) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__noreturn__)); # 19 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 2 # 1 "/usr/include/stdio.h" 1 3 4 # 27 "/usr/include/stdio.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/libc-header-start.h" 1 3 4 # 28 "/usr/include/stdio.h" 2 3 4 # 1 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stddef.h" 1 3 4 # 34 "/usr/include/stdio.h" 2 3 4 # 1 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stdarg.h" 1 3 4 # 40 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stdarg.h" 3 4 typedef __builtin_va_list __gnuc_va_list; # 37 "/usr/include/stdio.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/__fpos_t.h" 1 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/__mbstate_t.h" 1 3 4 # 13 "/usr/include/x86_64-linux-gnu/bits/types/__mbstate_t.h" 3 4 typedef struct { int __count; union { unsigned int __wch; char __wchb[4]; } __value; } __mbstate_t; # 6 "/usr/include/x86_64-linux-gnu/bits/types/__fpos_t.h" 2 3 4 typedef struct _G_fpos_t { __off_t __pos; __mbstate_t __state; } __fpos_t; # 40 "/usr/include/stdio.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/__fpos64_t.h" 1 3 4 # 10 "/usr/include/x86_64-linux-gnu/bits/types/__fpos64_t.h" 3 4 typedef struct _G_fpos64_t { __off64_t __pos; __mbstate_t __state; } __fpos64_t; # 41 "/usr/include/stdio.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/__FILE.h" 1 3 4 struct _IO_FILE; typedef struct _IO_FILE __FILE; # 42 "/usr/include/stdio.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/FILE.h" 1 3 4 struct _IO_FILE; typedef struct _IO_FILE FILE; # 43 "/usr/include/stdio.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/types/struct_FILE.h" 1 3 4 # 35 "/usr/include/x86_64-linux-gnu/bits/types/struct_FILE.h" 3 4 struct _IO_FILE; struct _IO_marker; struct _IO_codecvt; struct _IO_wide_data; typedef void _IO_lock_t; struct _IO_FILE { int _flags; char *_IO_read_ptr; char *_IO_read_end; char *_IO_read_base; char *_IO_write_base; char *_IO_write_ptr; char *_IO_write_end; char *_IO_buf_base; char *_IO_buf_end; char *_IO_save_base; char *_IO_backup_base; char *_IO_save_end; struct _IO_marker *_markers; struct _IO_FILE *_chain; int _fileno; int _flags2; __off_t _old_offset; unsigned short _cur_column; signed char _vtable_offset; char _shortbuf[1]; _IO_lock_t *_lock; __off64_t _offset; struct _IO_codecvt *_codecvt; struct _IO_wide_data *_wide_data; struct _IO_FILE *_freeres_list; void *_freeres_buf; size_t __pad5; int _mode; char _unused2[15 * sizeof (int) - 4 * sizeof (void *) - sizeof (size_t)]; }; # 44 "/usr/include/stdio.h" 2 3 4 # 52 "/usr/include/stdio.h" 3 4 typedef __gnuc_va_list va_list; # 84 "/usr/include/stdio.h" 3 4 typedef __fpos_t fpos_t; # 133 "/usr/include/stdio.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/stdio_lim.h" 1 3 4 # 134 "/usr/include/stdio.h" 2 3 4 extern FILE *stdin; extern FILE *stdout; extern FILE *stderr; extern int remove (const char *__filename) __attribute__ ((__nothrow__ , __leaf__)); extern int rename (const char *__old, const char *__new) __attribute__ ((__nothrow__ , __leaf__)); extern int renameat (int __oldfd, const char *__old, int __newfd, const char *__new) __attribute__ ((__nothrow__ , __leaf__)); # 173 "/usr/include/stdio.h" 3 4 extern FILE *tmpfile (void) ; # 187 "/usr/include/stdio.h" 3 4 extern char *tmpnam (char *__s) __attribute__ ((__nothrow__ , __leaf__)) ; extern char *tmpnam_r (char *__s) __attribute__ ((__nothrow__ , __leaf__)) ; # 204 "/usr/include/stdio.h" 3 4 extern char *tempnam (const char *__dir, const char *__pfx) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__malloc__)) ; extern int fclose (FILE *__stream); extern int fflush (FILE *__stream); # 227 "/usr/include/stdio.h" 3 4 extern int fflush_unlocked (FILE *__stream); # 246 "/usr/include/stdio.h" 3 4 extern FILE *fopen (const char *__restrict __filename, const char *__restrict __modes) ; extern FILE *freopen (const char *__restrict __filename, const char *__restrict __modes, FILE *__restrict __stream) ; # 279 "/usr/include/stdio.h" 3 4 extern FILE *fdopen (int __fd, const char *__modes) __attribute__ ((__nothrow__ , __leaf__)) ; # 292 "/usr/include/stdio.h" 3 4 extern FILE *fmemopen (void *__s, size_t __len, const char *__modes) __attribute__ ((__nothrow__ , __leaf__)) ; extern FILE *open_memstream (char **__bufloc, size_t *__sizeloc) __attribute__ ((__nothrow__ , __leaf__)) ; extern void setbuf (FILE *__restrict __stream, char *__restrict __buf) __attribute__ ((__nothrow__ , __leaf__)); extern int setvbuf (FILE *__restrict __stream, char *__restrict __buf, int __modes, size_t __n) __attribute__ ((__nothrow__ , __leaf__)); extern void setbuffer (FILE *__restrict __stream, char *__restrict __buf, size_t __size) __attribute__ ((__nothrow__ , __leaf__)); extern void setlinebuf (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)); extern int fprintf (FILE *__restrict __stream, const char *__restrict __format, ...); extern int printf (const char *__restrict __format, ...); extern int sprintf (char *__restrict __s, const char *__restrict __format, ...) __attribute__ ((__nothrow__)); extern int vfprintf (FILE *__restrict __s, const char *__restrict __format, __gnuc_va_list __arg); extern int vprintf (const char *__restrict __format, __gnuc_va_list __arg); extern int vsprintf (char *__restrict __s, const char *__restrict __format, __gnuc_va_list __arg) __attribute__ ((__nothrow__)); extern int snprintf (char *__restrict __s, size_t __maxlen, const char *__restrict __format, ...) __attribute__ ((__nothrow__)) __attribute__ ((__format__ (__printf__, 3, 4))); extern int vsnprintf (char *__restrict __s, size_t __maxlen, const char *__restrict __format, __gnuc_va_list __arg) __attribute__ ((__nothrow__)) __attribute__ ((__format__ (__printf__, 3, 0))); # 379 "/usr/include/stdio.h" 3 4 extern int vdprintf (int __fd, const char *__restrict __fmt, __gnuc_va_list __arg) __attribute__ ((__format__ (__printf__, 2, 0))); extern int dprintf (int __fd, const char *__restrict __fmt, ...) __attribute__ ((__format__ (__printf__, 2, 3))); extern int fscanf (FILE *__restrict __stream, const char *__restrict __format, ...) ; extern int scanf (const char *__restrict __format, ...) ; extern int sscanf (const char *__restrict __s, const char *__restrict __format, ...) __attribute__ ((__nothrow__ , __leaf__)); extern int fscanf (FILE *__restrict __stream, const char *__restrict __format, ...) __asm__ ("" "__isoc99_fscanf") ; extern int scanf (const char *__restrict __format, ...) __asm__ ("" "__isoc99_scanf") ; extern int sscanf (const char *__restrict __s, const char *__restrict __format, ...) __asm__ ("" "__isoc99_sscanf") __attribute__ ((__nothrow__ , __leaf__)) ; # 432 "/usr/include/stdio.h" 3 4 extern int vfscanf (FILE *__restrict __s, const char *__restrict __format, __gnuc_va_list __arg) __attribute__ ((__format__ (__scanf__, 2, 0))) ; extern int vscanf (const char *__restrict __format, __gnuc_va_list __arg) __attribute__ ((__format__ (__scanf__, 1, 0))) ; extern int vsscanf (const char *__restrict __s, const char *__restrict __format, __gnuc_va_list __arg) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__format__ (__scanf__, 2, 0))); extern int vfscanf (FILE *__restrict __s, const char *__restrict __format, __gnuc_va_list __arg) __asm__ ("" "__isoc99_vfscanf") __attribute__ ((__format__ (__scanf__, 2, 0))) ; extern int vscanf (const char *__restrict __format, __gnuc_va_list __arg) __asm__ ("" "__isoc99_vscanf") __attribute__ ((__format__ (__scanf__, 1, 0))) ; extern int vsscanf (const char *__restrict __s, const char *__restrict __format, __gnuc_va_list __arg) __asm__ ("" "__isoc99_vsscanf") __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__format__ (__scanf__, 2, 0))); # 485 "/usr/include/stdio.h" 3 4 extern int fgetc (FILE *__stream); extern int getc (FILE *__stream); extern int getchar (void); extern int getc_unlocked (FILE *__stream); extern int getchar_unlocked (void); # 510 "/usr/include/stdio.h" 3 4 extern int fgetc_unlocked (FILE *__stream); # 521 "/usr/include/stdio.h" 3 4 extern int fputc (int __c, FILE *__stream); extern int putc (int __c, FILE *__stream); extern int putchar (int __c); # 537 "/usr/include/stdio.h" 3 4 extern int fputc_unlocked (int __c, FILE *__stream); extern int putc_unlocked (int __c, FILE *__stream); extern int putchar_unlocked (int __c); extern int getw (FILE *__stream); extern int putw (int __w, FILE *__stream); extern char *fgets (char *__restrict __s, int __n, FILE *__restrict __stream) ; # 603 "/usr/include/stdio.h" 3 4 extern __ssize_t __getdelim (char **__restrict __lineptr, size_t *__restrict __n, int __delimiter, FILE *__restrict __stream) ; extern __ssize_t getdelim (char **__restrict __lineptr, size_t *__restrict __n, int __delimiter, FILE *__restrict __stream) ; extern __ssize_t getline (char **__restrict __lineptr, size_t *__restrict __n, FILE *__restrict __stream) ; extern int fputs (const char *__restrict __s, FILE *__restrict __stream); extern int puts (const char *__s); extern int ungetc (int __c, FILE *__stream); extern size_t fread (void *__restrict __ptr, size_t __size, size_t __n, FILE *__restrict __stream) ; extern size_t fwrite (const void *__restrict __ptr, size_t __size, size_t __n, FILE *__restrict __s); # 673 "/usr/include/stdio.h" 3 4 extern size_t fread_unlocked (void *__restrict __ptr, size_t __size, size_t __n, FILE *__restrict __stream) ; extern size_t fwrite_unlocked (const void *__restrict __ptr, size_t __size, size_t __n, FILE *__restrict __stream); extern int fseek (FILE *__stream, long int __off, int __whence); extern long int ftell (FILE *__stream) ; extern void rewind (FILE *__stream); # 707 "/usr/include/stdio.h" 3 4 extern int fseeko (FILE *__stream, __off_t __off, int __whence); extern __off_t ftello (FILE *__stream) ; # 731 "/usr/include/stdio.h" 3 4 extern int fgetpos (FILE *__restrict __stream, fpos_t *__restrict __pos); extern int fsetpos (FILE *__stream, const fpos_t *__pos); # 757 "/usr/include/stdio.h" 3 4 extern void clearerr (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)); extern int feof (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)) ; extern int ferror (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)) ; extern void clearerr_unlocked (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)); extern int feof_unlocked (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)) ; extern int ferror_unlocked (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)) ; extern void perror (const char *__s); # 1 "/usr/include/x86_64-linux-gnu/bits/sys_errlist.h" 1 3 4 # 26 "/usr/include/x86_64-linux-gnu/bits/sys_errlist.h" 3 4 extern int sys_nerr; extern const char *const sys_errlist[]; # 782 "/usr/include/stdio.h" 2 3 4 extern int fileno (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)) ; extern int fileno_unlocked (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)) ; # 800 "/usr/include/stdio.h" 3 4 extern FILE *popen (const char *__command, const char *__modes) ; extern int pclose (FILE *__stream); extern char *ctermid (char *__s) __attribute__ ((__nothrow__ , __leaf__)); # 840 "/usr/include/stdio.h" 3 4 extern void flockfile (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)); extern int ftrylockfile (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)) ; extern void funlockfile (FILE *__stream) __attribute__ ((__nothrow__ , __leaf__)); # 858 "/usr/include/stdio.h" 3 4 extern int __uflow (FILE *); extern int __overflow (FILE *, int); # 873 "/usr/include/stdio.h" 3 4 # 20 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 2 # 21 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" void __DSVERIFIER_assume(_Bool expression){ __ESBMC_assume(expression); # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" } void __DSVERIFIER_assert(_Bool expression){ # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 ((void) sizeof (( # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" expression # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" expression # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 ) ; else __assert_fail ( # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" "expression" # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h", 36, __extension__ __PRETTY_FUNCTION__); })) # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" ; } void __DSVERIFIER_assert_msg(_Bool expression, char * msg){ printf("%s", msg); # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 ((void) sizeof (( # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" expression # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" expression # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 ) ; else __assert_fail ( # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" "expression" # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h", 41, __extension__ __PRETTY_FUNCTION__); })) # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/compatibility.h" ; } # 22 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" 1 # 27 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" # 1 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stdint.h" 1 3 4 # 9 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stdint.h" 3 4 # 1 "/usr/include/stdint.h" 1 3 4 # 26 "/usr/include/stdint.h" 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/libc-header-start.h" 1 3 4 # 27 "/usr/include/stdint.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/wchar.h" 1 3 4 # 29 "/usr/include/stdint.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/wordsize.h" 1 3 4 # 30 "/usr/include/stdint.h" 2 3 4 # 1 "/usr/include/x86_64-linux-gnu/bits/stdint-uintn.h" 1 3 4 # 24 "/usr/include/x86_64-linux-gnu/bits/stdint-uintn.h" 3 4 # 24 "/usr/include/x86_64-linux-gnu/bits/stdint-uintn.h" 3 4 typedef __uint8_t uint8_t; typedef __uint16_t uint16_t; typedef __uint32_t uint32_t; typedef __uint64_t uint64_t; # 38 "/usr/include/stdint.h" 2 3 4 typedef __int_least8_t int_least8_t; typedef __int_least16_t int_least16_t; typedef __int_least32_t int_least32_t; typedef __int_least64_t int_least64_t; typedef __uint_least8_t uint_least8_t; typedef __uint_least16_t uint_least16_t; typedef __uint_least32_t uint_least32_t; typedef __uint_least64_t uint_least64_t; typedef signed char int_fast8_t; typedef long int int_fast16_t; typedef long int int_fast32_t; typedef long int int_fast64_t; # 71 "/usr/include/stdint.h" 3 4 typedef unsigned char uint_fast8_t; typedef unsigned long int uint_fast16_t; typedef unsigned long int uint_fast32_t; typedef unsigned long int uint_fast64_t; # 87 "/usr/include/stdint.h" 3 4 typedef long int intptr_t; typedef unsigned long int uintptr_t; # 101 "/usr/include/stdint.h" 3 4 typedef __intmax_t intmax_t; typedef __uintmax_t uintmax_t; # 10 "/usr/lib/gcc/x86_64-linux-gnu/9/include/stdint.h" 2 3 4 # 28 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" 2 # 1 "/usr/include/inttypes.h" 1 3 4 # 34 "/usr/include/inttypes.h" 3 4 typedef int __gwchar_t; # 266 "/usr/include/inttypes.h" 3 4 typedef struct { long int quot; long int rem; } imaxdiv_t; # 290 "/usr/include/inttypes.h" 3 4 extern intmax_t imaxabs (intmax_t __n) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)); extern imaxdiv_t imaxdiv (intmax_t __numer, intmax_t __denom) __attribute__ ((__nothrow__ , __leaf__)) __attribute__ ((__const__)); extern intmax_t strtoimax (const char *__restrict __nptr, char **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)); extern uintmax_t strtoumax (const char *__restrict __nptr, char ** __restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)); extern intmax_t wcstoimax (const __gwchar_t *__restrict __nptr, __gwchar_t **__restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)); extern uintmax_t wcstoumax (const __gwchar_t *__restrict __nptr, __gwchar_t ** __restrict __endptr, int __base) __attribute__ ((__nothrow__ , __leaf__)); # 432 "/usr/include/inttypes.h" 3 4 # 29 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" 2 # 30 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" extern implementation impl; typedef int64_t fxp_t; fxp_t _fxp_one; fxp_t _fxp_half; fxp_t _fxp_minus_one; fxp_t _fxp_min; fxp_t _fxp_max; double _dbl_max; double _dbl_min; fxp_t _fxp_fmask; fxp_t _fxp_imask; static const double scale_factor[31] = { 1.0, 2.0, 4.0, 8.0, 16.0, 32.0, 64.0, 128.0, 256.0, 512.0, 1024.0, 2048.0, 4096.0, 8192.0, 16384.0, 32768.0, 65536.0, 131072.0, 262144.0, 524288.0, 1048576.0, 2097152.0, 4194304.0, 8388608.0, 16777216.0, 33554432.0, 67108864.0, 134217728.0, 268435456.0, 536870912.0, 1073741824.0 }; static const double scale_factor_inv[31] = { 1.0, 0.5, 0.25, 0.125, 0.0625, 0.03125, 0.015625, 0.0078125, 0.00390625, 0.001953125, 0.0009765625, 0.00048828125, 0.000244140625, 0.0001220703125, 0.00006103515625, 0.000030517578125, 0.000015258789063, 0.000007629394531, 0.000003814697266, 0.000001907348633, 0.000000953674316, 0.000000476837158, 0.000000238418579, 0.000000119209290, 0.000000059604645, 0.000000029802322, 0.000000014901161, 0.000000007450581, 0.000000003725290, 0.000000001862645, 0.000000000931323 }; static const float rand_uni[10000] = { -0.486240329978498f, -0.0886462298529236f, -0.140307596103306f, 0.301096597450952f, 0.0993171079928659f, 0.971751769763271f, 0.985173975730828f, 0.555993645184930f, 0.582088652691427f, -0.153377496651175f, 0.383610009058905f, -0.335724126391271f, 0.978768141636516f, -0.276250018648572f, 0.390075705739569f, -0.179022404038782f, 0.690083827115783f, -0.872530132490992f, -0.970585763293203f, -0.581476053441704f, -0.532614615674888f, -0.239699306693312f, -0.678183014035494f, 0.349502640932782f, -0.210469890686263f, 0.841262085391842f, -0.473585465151401f, 0.659383565443701f, -0.651160036945754f, -0.961043527561335f, -0.0814927639199137f, 0.621303110569702f, -0.784529166943541f, 0.0238464770757800f, 0.392694728594110f, 0.776848735202001f, 0.0870059709310509f, 0.880563655271790f, 0.883457036977564f, -0.249235082877382f, -0.691040749216870f, 0.578731120064320f, -0.973932858000832f, -0.117699105431720f, -0.723831748151088f, -0.483149657477524f, -0.821277691383664f, -0.459725618100875f, 0.148175952221864f, 0.444306875534854f, -0.325610376336498f, 0.544142311404910f, -0.165319440455435f, 0.136706800705517f, 0.543312481350682f, 0.467210959764607f, -0.349266618228534f, -0.660110730565862f, 0.910332331495431f, 0.961049802789367f, -0.786168905164629f, 0.305648402726554f, 0.510815258508885f, 0.0950733260984060f, 0.173750645487898f, 0.144488668408672f, 0.0190031984466126f, -0.299194577636724f, 0.302411647442273f, -0.730462524226212f, 0.688646006554796f, 0.134948379722118f, 0.533716723458894f, -0.00226300779660438f, -0.561340777806718f, 0.450396313744017f, -0.569445876566955f, 0.954155246557698f, -0.255403882430676f, -0.759820984120828f, -0.855279790307514f, -0.147352581758156f, -0.302269055643746f, -0.642038024364086f, -0.367405981107491f, 0.491844011712164f, -0.542191710121194f, -0.938294043323732f, 0.683979894338020f, 0.294728290855287f, 0.00662691839443919f, -0.931040350582855f, 0.152356209974418f, 0.678620860551457f, -0.534989269238408f, 0.932096367913226f, -0.0361062818028513f, -0.847189697149530f, -0.975903030160255f, 0.623293205784014f, -0.661289688031659f, 0.724486055119603f, 0.307504095172835f, 0.00739266163731767f, -0.393681596442097f, 0.0313739422974388f, 0.0768157689673350f, -0.652063346886817f, 0.864188030044388f, -0.588932092781034f, 0.496015896758580f, -0.872858269231211f, 0.978780599551039f, -0.504887732991147f, -0.462378791937628f, 0.0141726829338038f, 0.769610007653591f, 0.945233033188923f, -0.782235375325016f, -0.832206533738799f, 0.745634368088673f, -0.696969510157151f, -0.0674631869948374f, -0.123186450806584f, -0.359158959141949f, -0.393882649464391f, 0.441371446689899f, -0.829394270569736f, -0.301502651277431f, -0.996215501187289f, 0.934634037393066f, -0.282431114746289f, -0.927550795619590f, -0.437037530043415f, -0.360426812995980f, 0.949549724575862f, 0.502784616197919f, 0.800771681422909f, -0.511398929004089f, 0.309288504642554f, -0.207261227890933f, 0.930587995125773f, -0.777029876696670f, -0.489329175755640f, -0.134595132329858f, 0.285771358983518f, 0.182331373854387f, -0.544110494560697f, 0.278439882883985f, -0.556325158102182f, 0.579043806545889f, 0.134648133801916f, 0.602850725479294f, -0.151663563868883f, 0.180694361855878f, -0.651591295315595f, 0.281129147768056f, -0.580047306475484f, 0.687883075491433f, 0.279398670804288f, -0.853428128249503f, -0.532609367372680f, -0.821156786377917f, -0.181273229058573f, -0.983898569846882f, -0.0964374318311501f, 0.880923372124250f, 0.102643371392389f, 0.893615387135596f, -0.259276649383649f, 0.699287743639363f, 0.402940604635828f, -0.110721596226581f, 0.0846246472582877f, 0.820733021865405f, 0.795578903285308f, -0.495144122011537f, 0.273150029257472f, -0.268249949701437f, 0.231982193341980f, 0.694211299124074f, 0.859950868718233f, 0.959483382623794f, -0.422972626833543f, -0.109621798738360f, 0.433094703426531f, 0.694025903378851f, 0.374478987547435f, -0.293668545105608f, -0.396213864190828f, -0.0632095887099047f, -0.0285139536748673f, 0.831794132192390f, -0.548543088139238f, 0.791869201724680f, 0.325211484201845f, 0.155274810721772f, -0.112383643064821f, -0.674403070297721f, 0.642801068229810f, -0.615712048835242f, -0.322576771285566f, -0.409336818836595f, 0.548069973193770f, -0.386353709407947f, -0.0741664985357784f, 0.619639599324983f, -0.815703814931314f, 0.965550307223862f, 0.623407852683828f, -0.789634372832984f, 0.736750050047572f, -0.0269443926793700f, 0.00545706093721488f, -0.315712479832091f, -0.890110021644720f, -0.869390443173846f, -0.381538869981866f, -0.109498998005949f, 0.131433952330613f, -0.233452413139316f, 0.660289822785465f, 0.543381186340023f, -0.384712418750451f, -0.913477554164890f, 0.767102957655267f, -0.115129944521936f, -0.741161985822647f, -0.0604180020782450f, -0.819131535144059f, -0.409539679760029f, 0.574419252943637f, -0.0440704617157433f, 0.933173744590532f, 0.261360623390448f, -0.880290575543046f, 0.329806293425492f, 0.548915621667952f, 0.635187167795234f, -0.611034070318967f, 0.458196727901944f, 0.397377226781023f, 0.711941361933987f, 0.782147744383368f, -0.00300685339552631f, 0.384687233450957f, 0.810102466029521f, 0.452919847968424f, -0.183164257016897f, -0.755603185485427f, -0.604334477365858f, -0.786222413488860f, -0.434887500763099f, -0.678845635625581f, -0.381200370488331f, -0.582350534916068f, -0.0444427346996734f, 0.116237247526397f, -0.364680921206275f, -0.829395404347498f, -0.258574590032613f, -0.910082114298859f, 0.501356900925997f, 0.0295361922006900f, -0.471786618165219f, 0.536352925101547f, -0.316120662284464f, -0.168902841718737f, 0.970850119987976f, -0.813818666854395f, -0.0861183123848732f, 0.866784827877161f, 0.535966478165739f, -0.806958669103425f, -0.627307415616045f, -0.686618354673079f, 0.0239165685193152f, 0.525427699287402f, 0.834079334357391f, -0.527333932295852f, 0.130970034225907f, -0.790218350377199f, 0.399338640441987f, 0.133591886379939f, -0.181354311053254f, 0.420121912637914f, -0.625002202728601f, -0.293296669160307f, 0.0113819513424340f, -0.882382002895096f, -0.883750159690028f, 0.441583656876336f, -0.439054135454480f, 0.873049498123622f, 0.660844523562817f, 0.0104240153103699f, 0.611420248331623f, -0.235926309432748f, 0.207317724918460f, 0.884691834560657f, 0.128302402592277f, -0.283754448219060f, 0.237649901255856f, 0.610200763264703f, -0.625035441247926f, -0.964609592118695f, -0.323146562743113f, 0.961529402270719f, -0.793576233735450f, -0.843916713821003f, 0.314105102728384f, -0.204535560653294f, 0.753318789613803f, 0.160678386635821f, -0.647065919861379f, -0.202789866826280f, 0.648108234268198f, -0.261292621025902f, 0.156681828732770f, 0.405377351820066f, 0.228465381497500f, 0.972348516671163f, 0.288346037401522f, -0.0799068604307178f, 0.916939290109587f, -0.279220972402209f, -0.203447523864279f, -0.533640046855273f, 0.543561961674653f, 0.880711097286889f, -0.549683064687774f, 0.0130107219236368f, -0.554838164576024f, -0.379442406201385f, -0.00500104610043062f, 0.409530122826868f, -0.580423080726061f, 0.824555731914455f, -0.254134502966922f, 0.655609706875230f, 0.629093866184236f, -0.690033250889974f, -0.652346551677826f, 0.169820593515952f, 0.922459552232043f, 0.351812083539940f, 0.876342426613034f, -0.513486005850680f, -0.626382302780497f, -0.734690688861027f, 0.245594886018314f, -0.875740935105191f, -0.388580462918006f, 0.0127041754106421f, -0.0330962560066819f, -0.425003146474193f, 0.0281641353527495f, 0.261441358666622f, 0.949781327102773f, 0.919646340564270f, 0.504503377003781f, 0.0817071051871894f, 0.319968570729658f, 0.229065413577318f, -0.0512608414259468f, -0.0740848540944785f, -0.0974457038582892f, 0.532775710298005f, -0.492913317622840f, 0.492871078783642f, -0.289562388384881f, 0.229149968879593f, 0.697586903105899f, 0.900855243684925f, 0.969700445892771f, -0.618162745501349f, -0.533241431614228f, -0.937955908995453f, 0.886669636523452f, 0.498748076602594f, 0.974106016180519f, -0.199411214757595f, 0.725270392729083f, -0.0279932700005097f, -0.889385821767448f, -0.452211028905500f, -0.487216271217731f, -0.577105004471439f, 0.777405674160298f, 0.390121144627092f, -0.595062864225581f, -0.844712795815575f, -0.894819796738658f, 0.0556635002662202f, 0.200767245646242f, 0.481227096067452f, -0.0854169009474664f, 0.524532943920022f, -0.880292014538901f, -0.127923833629789f, -0.929275628802356f, 0.233276357260949f, -0.776272194935070f, 0.953325886548014f, -0.884399921036004f, -0.504227548828417f, -0.546526107689276f, 0.852622421886067f, 0.947722695551154f, -0.668635552599119f, 0.768739709906834f, 0.830755876586102f, -0.720579994994166f, 0.761613532216491f, 0.340510345777526f, 0.335046764810816f, 0.490102926886310f, -0.568989013749608f, -0.296018470377601f, 0.979838924243657f, 0.624231653632879f, 0.553904401851075f, -0.355359451941014f, 0.267623165480721f, 0.985914275634075f, -0.741887849211797f, 0.560479100333108f, -0.602590162007993f, -0.874870765077352f, -0.0306218773384892f, 0.963145768131215f, 0.544824028787036f, -0.133990816021791f, 0.0679964588712787f, -0.156401335214901f, -0.0802554171832672f, 0.856386218492912f, 0.143013580527942f, 0.403921859374840f, -0.179029058044097f, 0.770723540077919f, -0.183650969350452f, -0.340718434629824f, 0.217166124261387f, -0.171159949445977f, 0.127493767348173f, -0.649649349141405f, -0.0986978180993434f, 0.301786606637125f, 0.942172200207855f, 0.0323236270151113f, -0.579853744301016f, -0.964413060851558f, 0.917535782777861f, 0.442144649483292f, -0.684960854610878f, -0.418908715566712f, 0.617844265088789f, 0.897145578082386f, 0.235463167636481f, 0.0166312355859484f, 0.948331447443040f, -0.961085640409103f, -0.0386086809179784f, -0.949138997977665f, 0.738211385880427f, 0.613757309091864f, -0.606937832993426f, 0.825253298062192f, 0.932609757667859f, -0.169023247637751f, -0.411237965787391f, 0.550590803600950f, -0.0561729280137304f, -0.559663108323671f, -0.718592671237337f, 0.885889621415361f, -0.364207826334344f, -0.839614660327507f, 0.265502694339344f, 0.394329270534417f, -0.270184577808578f, -0.865353487778069f, -0.528848754655393f, -0.179961524561963f, 0.571721065613544f, -0.774363220756696f, 0.251123315200792f, -0.217722762975159f, 0.0901359910328954f, -0.329445470667965f, 0.366410356722994f, -0.777512662632715f, 0.654844363477267f, -0.882409911562713f, -0.613612530795153f, -0.926517759636550f, 0.111572665207194f, 0.0729846382226607f, 0.789912813274098, 0.784452109264882f, -0.949766989295825f, 0.318378232675431f, 0.732077593075111f, 0.786829143208386f, -0.134682559823644f, 0.733164743374965f, 0.978410877665941f, 0.992008491438409f, -0.319064303035495f, 0.958430683602029f, 0.514518212363212f, 0.101876224417090f, 0.642655735778237f, -0.170746516901312f, 0.252352078365623f, -0.761327278132210f, 0.724119717129199f, 0.889374997869224f, -0.785987369200692f, -0.594670344572584f, 0.805192297495935f, -0.990523259595814f, 0.483998949026664f, 0.747350619254878f, -0.824845161088780f, 0.543009506581798f, -0.208778528683094f, -0.314149951901368f, 0.943576771177672f, -0.102633559170861f, -0.947663019606703f, -0.557033071578968f, 0.419150797499848f, 0.251214274356296f, 0.565717763755325f, 0.126676667925064f, -0.0213369479214840f, 0.342212953426240f, -0.288015274572288f, 0.121313363277304f, 0.452832374494206f, 0.545420403121955f, -0.616024063400938f, -0.0320352392995826f, -0.400581850938279f, 0.0642433474653812f, -0.673966224453150f, 0.951962939602010f, -0.241906012952983f, 0.0322060960995099f, -0.449185553826233f, -0.709575766146540f, 0.0283340814242898f, 0.234237103593580f, -0.285526615094797f, -0.793192668153991f, -0.437130485497140f, -0.956132143306919f, 0.601158367473616f, 0.238689691528783f, 0.173709925321432f, 0.437983847738997f, 0.397380645202102f, 0.432093344086237f, -0.0338869881121104f, -0.966303269542493f, 0.875351570183604f, -0.0584554089652962f, 0.294207497692552f, 0.200323088145182f, 0.826642387259759f, 0.284806025494260f, -0.00660991970522007f, 0.682493772727303f, -0.151980775670668f, 0.0470705546940635f, -0.236378427235531f, -0.844780853112247f, 0.134166207564174f, -0.586842667384924f, 0.0711866699414370f, 0.311698821368897f, -0.361229767252053f, 0.750924311039976f, 0.0764323989785694f, 0.898463708247144f, 0.398232179543916f, -0.515644913011399f, -0.189067061520362f, -0.567430593060929f, -0.641924269747436f, -0.0960378699625619f, -0.792054031692334f, 0.803891878854351f, -0.233518627249889f, -0.892523453249154f, 0.707550017996875f, -0.782288435525895f, -0.156166443894764f, -0.543737876329167f, 0.565637809380957f, -0.757689989749326f, -0.612543942167974f, -0.766327195073259f, 0.587626843767440f, -0.280769385897397f, -0.457487372245825f, 0.0862799426622438f, -0.616867284053547f, 0.121778903484808f, -0.451988651573766f, -0.618146087265495f, -0.285868777534354f, 0.108999472244014f, -0.620755183347358f, -0.268563184810196f, -0.721678169615489f, -0.146060198874409f, -0.661506858070617f, 0.901707853998409f, 0.222488776533930f, 0.679599685031679f, 0.974760448601209f, 0.535485953830496f, -0.562345697123585f, 0.369219363331071f, -0.0282801684694869f, -0.0734880727832297f, 0.733216287314358f, -0.514352095765627f, -0.850813063545195f, 0.642458447327163f, 0.118661521915783f, -0.907015526838341f, 0.789277766886329f, -0.719864125961721f, 0.274329068829509f, 0.830124687647056f, 0.719352367261587f, -0.821767317737384f, -0.840153496829227f, 0.650796781936517f, 0.381065387870166f, 0.341870564586224f, -0.00174423702285131f, -0.216348832349188f, 0.678010477635713f, -0.748695103596683f, -0.819659325555269f, 0.620922373008647f, 0.471659250504894f, 0.417848292160984f, -0.990577315445198f, -0.509842007818877f, 0.705761459091187f, 0.723072116074702f, -0.606476484252158f, -0.871593699865195f, -0.662059658667501f, -0.207267692377271f, -0.274706370444270f, 0.317047325063391f, 0.329780707114887f, -0.966325651181920f, -0.666131009799803f, 0.118609206658210f, 0.232960448350140f, -0.139134616436389f, -0.936412642687343f, -0.554985387484625f, -0.609914445911143f, -0.371023087262482f, -0.461044793696911f, 0.0277553171809701f, -0.241589304772568f, -0.990769995548029f, 0.114245771600061f, -0.924483328431436f, 0.237901450206836f, -0.615461633242452f, 0.201497106528945f, -0.599898812620374f, 0.982389910778332f, 0.125701388874024f, -0.892749115498369f, 0.513592673006880f, 0.229316745749793f, 0.422997355912517f, 0.150920221978738f, 0.447743452078441f, 0.366767059168664f, -0.605741985891581f, 0.274905013892524f, -0.861378867171578f, -0.731508622159258f, 0.171187057183023f, 0.250833501952177f, -0.609814068526718f, -0.639397597618127f, -0.712497631420166f, -0.539831932321101f, -0.962361328901384f, 0.799060001548069f, 0.618582550608426f, -0.603865594092701f, -0.750840334759883f, -0.432368099184739f, -0.581021252111797f, 0.134711953024238f, 0.331863889421602f, -0.172907726656169f, -0.435358718118896f, -0.689326993725649f, 0.415840315809038f, -0.333576262820904f, 0.279343777676723f, -0.0393098862927832f, 0.00852090010085194f, -0.853705195692250f, 0.526006696633762f, -0.478653377052437f, -0.584840261391485f, 0.679261003071696f, 0.0367484618219474f, -0.616340335633997f, -0.912843423145420f, -0.221248732289686f, -0.477921890680232f, -0.127369625511666f, 0.865190146410824f, 0.817916456258544f, 0.445973590438029f, -0.621435280140991f, -0.584264056171687f, 0.718712277931876f, -0.337835985469843f, 0.00569064504159345f, -0.546546294846311f, 0.101653624648361f, -0.795498735829364f, -0.249043531299132f, -0.112839395737321f, -0.350305425122331f, -0.910866368205041f, 0.345503177966105f, -0.549306515692918f, 0.711774722622726f, 0.283368922297518f, 0.0401988801224620f, 0.269228967910704f, 0.408165826013612f, -0.306571373865680f, 0.937429053394878f, 0.992154362395068f, 0.679431847774404f, 0.660561953302554f, 0.903254489326130f, -0.939312119455540f, -0.211194531611303f, 0.401554296146757f, -0.0373187111351370f, -0.209143098987164f, -0.483955198209448f, -0.860858509666882f, 0.847006442151417f, 0.287950263267018f, 0.408253171937961f, -0.720812569529331f, 0.623305171273525f, 0.543495760078790f, -0.364025150023839f, -0.893335585394842f, -0.757545415624741f, -0.525417020183382f, -0.985814550271000f, -0.571551008375522f, 0.930716377819686f, -0.272863385293023f, 0.982334910750391f, 0.297868844366342f, 0.922428080219044f, 0.917194773824871f, 0.846964493212884f, 0.0641834146212110f, 0.279768184306094f, 0.591959126556958f, 0.355630573995206f, 0.839818707895839f, 0.219674727597944f, -0.174518904670883f, 0.708669864813752f, -0.224562931791369f, 0.677232454840133f, -0.904826802486527f, -0.627559033402838f, 0.263680517444611f, 0.121902314059156f, -0.704881790282995f, 0.242825089229032f, -0.309373554231866f, -0.479824461459095f, -0.720536286348018f, -0.460418173937526f, 0.774174710513849f, 0.452001499049874f, -0.316992092650694f, 0.153064869645527f, -0.209558599627989f, 0.685508351648252f, -0.508615450383790f, 0.598109567185095f, 0.391177475074196f, 0.964444988755186f, 0.336277292954506f, -0.0367817159101076f, -0.668752640081528f, 0.169621732437504f, -0.440925495294537f, 0.352359477392856f, 0.300517139597811f, 0.464188724292127f, 0.342732840629593f, -0.772028689116952f, 0.523987886508557f, 0.920723209445309f, 0.325634245623597f, 0.999728757965472f, -0.108202444213629f, -0.703463061246440f, -0.764321104361266f, 0.153478091277821f, 0.400776808520781f, 0.0362608595686520f, 0.602660289034871f, -0.00396673312072204f, 0.296881393918662f, 0.563978362789779f, 0.849699999703012f, 0.699481370949461f, -0.517318771826836f, 0.488696839410786f, -0.863267084031406f, 0.0353144039838211f, 0.346060763700543f, 0.964270355001567f, 0.354899825242107f, 0.806313705199543f, 0.675286452110240f, 0.0873918818789949f, -0.595319879813140f, 0.768247284622921f, 0.424433552458434f, -0.308023836359512f, 0.802163480612923f, -0.348151008192881f, -0.889061130591849f, -0.593277042719599f, -0.669426232128590f, 0.758542808803890f, 0.515943031751579f, -0.359688459650311f, 0.568175936707751f, 0.741304023515212f, 0.260283681057109f, 0.957668849401749f, -0.665096753421305f, 0.769229664798946f, -0.0871019488695104f, -0.362662093346394f, -0.411439775739547f, 0.700347493632751f, 0.593221225653487f, 0.712841887456470f, 0.413663813878195f, -0.868002281057698f, -0.704419248587642f, 0.497097875881516f, -0.00234623694758684f, 0.690202361192435f, -0.850266199595343f, 0.315244026446767f, 0.709124123964306f, 0.438047076925768f, 0.798239617424585f, 0.330853072912708f, 0.581059745965701f, 0.449755612947191f, -0.462738032798907f, 0.607731925865227f, 0.0898348455002427f, -0.762827831849901f, 0.895598896497952f, -0.752254194382105f, -0.0916186048978613f, -0.906243795607547f, 0.229263971313788f, 0.401148319671400f, -0.699999035942240f, 0.949897297168705f, 0.442965954562621f, -0.836602533575693f, 0.960460356865877f, -0.588638958628591f, -0.826876652501322f, 0.358883606332526f, 0.963216314331105f, -0.932992215875777f, -0.790078242370583f, 0.402080896170037f, -0.0768348888017805f, 0.728030138891631f, -0.259252300581205f, -0.239039520569651f, -0.0343187629251645f, -0.500656851699075f, 0.213230170834557f, -0.806162554023268f, -0.346741158269134f, 0.593197383681288f, -0.874207905790597f, 0.396896283395687f, -0.899758892162590f, 0.645625478431829f, 0.724064646901595f, 0.505831437483414f, -0.592809028527107f, 0.191058921738261f, 0.329699861086760f, 0.637747614705911f, 0.228492417185859f, 0.350565075483143f, 0.495645634191973f, 0.0378873636406241f, -0.558682871042752f, -0.0463515226573312f, -0.699882077624744f, -0.727701564368345f, -0.185876979038391f, 0.969357227041006f, -0.0396554302826258f, 0.994123321254905f, -0.103700411263859f, -0.122414150286554f, -0.952967253268750f, -0.310113557790019f, 0.389885130024049f, 0.698109781822753f, -0.566884614177461f, -0.807731715569885f, 0.295459359747620f, 0.353911434620388f, -0.0365360121873806f, -0.433710246410727f, -0.112374658849445f, -0.710362620548396f, -0.750188568899340f, -0.421921409270312f, -0.0946825033112555f, -0.207114343395422f, -0.712346704375406f, -0.762905208265238f, 0.668705185793373f, 0.874811836887758f, 0.734155331047614f, 0.0717699959166771f, -0.649642655211151f, 0.710177200600726f, -0.790892796708330f, -0.609051316139055f, 0.158155751049403f, 0.273837117392194f, 0.101461674737037f, -0.341978434311156f, 0.358741707078855f, 0.415990974906378f, 0.760270133083538f, 0.164383469371383f, 0.559847879549422f, 0.209104118141764f, -0.265721227148806f, 0.165407943936551f, 0.611035396421350f, -0.626230501208063f, -0.116714293310250f, -0.696697517286888f, 0.0545261414014888f, 0.440139257477096f, 0.202311640602444f, -0.369311356303593f, 0.901884565342531f, 0.256026357399272f, -0.673699547202088f, 0.108550667621349f, -0.961092940829968f, -0.254802826645023f, 0.553897912330318f, 0.110751075533042f, -0.587445414043347f, 0.786722059164009, 0.182042556749386f, 0.398835909383655f, 0.431324012457533f, 0.587021142157922f, -0.644072183989352f, 0.187430090296218f, 0.516741122998546f, -0.275250933267487f, -0.933673413249875f, -0.767709448823879f, 0.00345814033609182f, -0.585884382069128f, 0.463549040471035f, 0.666537178805293f, -0.393605927315148f, -0.260156573858491f, -0.298799291489529f, -0.246398415746503f, 0.970774181159203f, -0.485708631308223f, -0.456571313115555f, -0.264210030877189f, -0.442583504871362f, 0.0585567697312368f, 0.955769232723545f, 0.651822742221258f, 0.667605490119116f, -0.178564750516287f, 0.744464599638885f, -0.0962758978504710f, -0.538627454923738f, -0.844634654117462f, 0.109151162611125f, -0.862255427201396f, -0.478955305843323f, 0.645965860697344f, 0.345569271369828f, 0.930605011671297f, -0.195523686135506f, 0.927940875293964f, 0.0529927450986318f, -0.537243314646225f, 0.0815400161801159f, -0.528889663721737f, -0.0803965087898244f, 0.722188412643543f, -0.115173100460772f, 0.391581967064874f, 0.609102624309301f, -0.726409099849031f, -0.924071529212721f, -0.424370859730340f, -0.932399086010354f, -0.679903916227243f, 0.398593637781810f, -0.395942610474455f, 0.911017267923838f, 0.830660098751580f, 0.485689056693942f, -0.634874052918746f, 0.558342102044082f, 0.153345477027740f, -0.418797532948752f, -0.962412446404476f, 0.499334884055701f, 0.772755578982235f, 0.486905718186221f, -0.680415982465391f, -0.983589696155766f, 0.0802707365440833f, -0.108186099494932f, 0.272227706025405f, 0.651170828846750f, -0.804713753056757f, 0.778076504684911f, 0.869094633196957f, -0.213764089899489f, -0.289485853647921f, -0.248376169846176f, -0.273907386272412f, -0.272735585352615f, -0.851779302143109f, 0.777935500545070f, 0.610526499062369f, -0.825926925832998f, -0.00122853287679647f, -0.250920102747366f, -0.0333860483260329f, 0.562878228390427f, 0.685359102189134f, 0.909722844787783f, -0.686791591637469f, 0.700018932525581f, -0.975597558640926f, 0.111273045778084f, 0.0313167229308478f, -0.185767397251192f, -0.587922465203314f, -0.569364866257444f, -0.433710470415537f, 0.744709870476354f, 0.812284989338678f, -0.835936210940005f, 0.409175739115410f, 0.364745324015946f, -0.526496413512530f, -0.0949041293633228f, -0.710914623019602f, -0.199035360261516f, 0.249903358254580f, 0.799197892184193f, -0.974131439735146f, -0.962913228246770f, -0.0584067290846062f, 0.0678080882131218f, 0.619989552612058f, 0.600692636138022f, -0.325324145536173f, 0.00758797937831957f, -0.133193608214778f, -0.312408219890363f, -0.0752971209304969f, 0.764751638735404f, 0.207290375565515f, -0.965680055629168f, 0.526346325957267f, 0.365879948128040f, -0.899713698342006f, 0.300806506284083f, 0.282047017067903f, -0.464418831301796f, -0.793644005532544f, -0.338781149582286f, 0.627059412508279f, -0.624056896643864f, -0.503708045945915f, 0.339203903916317f, -0.920899287490514f, -0.753331218450680f, -0.561190137775443f, 0.216431106588929f, -0.191601189620092f, 0.613179188721972f, 0.121381145781083f, -0.477139741951367f, 0.606347924649253f, 0.972409497819530f, 0.00419185232258634f, 0.786976564006247f, 0.716984027373809f, -0.577296880358192f, 0.336508364109364f, -0.837637061538727f, -0.706860533591818f, 0.655351330285695f, -0.799458036429467f, 0.804951754011505f, 0.405471126911303f, 0.485125485165526f, 0.0354103156047567f, 0.774748847269929f, 0.396581375869036f, 0.420464745452802f, -0.544531741676535f, -0.779088258182329f, -0.129534599431145f, 0.228882319223921f, 0.669504936432777f, -0.158954596495398f, -0.171927546721685f, 0.675107968066445f, -0.201470217862098f, -0.185894687796509f, 0.244174688826684f, 0.310288210346694f, -0.0674603586289346f, 0.138103839181198f, 0.269292861340219f, 0.121469813317732f, 0.168629748875041f, 0.581112629873687f, 0.499508530746584f, -0.741772433024897f, -0.311060071316150f, -0.263697352439521f, 0.180487383518774f, -0.800786488742242f, -0.949903966987338f, 0.134975524166410f, 0.213364683193138f, -0.684441197699222f, -0.254697287796379f, -0.260521050814253f, -0.757605554637199f, -0.134324873215927f, -0.699675596579060f, 0.136000646890289f, 0.355272520354523f, -0.712620797948690f, -0.729995036352282f, 0.323100037780915f, -0.718364487938777f, 0.807709622188084f, 0.289336059472722f, -0.558738026311145f, -0.591811756545896f, -0.894952978489225f, -0.354996929975694f, -0.142213103464027f, -0.651950180085633f, 0.182694586161578f, -0.193492058009904f, -0.540079537334588f, -0.300927433533712f, 0.119585035086049f, 0.895807833710939f, -0.413843745301811f, -0.209041322713332f, 0.808094803654324f, 0.0792829008489782f, 0.314806980452270f, 0.502591873175427f, -0.0474189387090473f, -0.407131047818007f, 0.797117088440354f, 0.902395237588928f, -0.783327055804990f, -0.591709085168646f, 0.628191184754911f, -0.454649879692076f, -0.588819444306752f, 0.250889716959370f, -0.582306627010669f, -0.145495766591841f, -0.634137346823528f, 0.667934845545285f, 0.873756470938530f, 0.425969845715827f, -0.779543910541245f, -0.265210219994391f, 0.781530681845886f, 0.304461599274577f, 0.211087853085430f, 0.281022407596766f, 0.0701313665097776f, 0.342337400087349f, -0.0618264046031387f, 0.177147380816613f, 0.751693209867024f, -0.279073264607508f, 0.740459307255654f, -0.352163564204507f, -0.726238685136937f, -0.565819729501492f, -0.779416133306559f, -0.783925450697670f, 0.542612245021260f, -0.810510148278478f, -0.693707081804938f, 0.918862988543900f, -0.368717045271828f, 0.0654919784331340f, -0.438514219239944f, -0.923935138084824f, 0.913316783811291f, -0.961646539574340f, 0.734888382653474f, -0.464102713631586f, -0.896154678819649f, 0.349856565392685f, 0.646610836502422f, -0.104378701809970f, 0.347319102015858f, -0.263947819351090f, 0.343722186197186f, 0.825747554146473f, 0.0661865525544676f, 0.918864908112419f, -0.999160312662909f, -0.904953244747070f, 0.246613032125664f, 0.123426960800262f, -0.294364203503845f, -0.150056966431615f, 0.904179479721301f, 0.517721252782648f, 0.661473373608678f, -0.784276966825964f, -0.984631287069650f, 0.239695484607744f, -0.499150590123099f, 0.00153518224500027f, -0.817955534401114f, 0.221240310713583f, 0.114442325207070f, -0.717650856748245f, -0.722902799253535f, -0.962998380704103f, 0.214092155997873f, -0.226370691123970f, 0.536806140446569f, 0.111745807092858f, 0.657580594136395f, -0.239950592200226f, 0.0981270621736083f, -0.173398466414235f, 0.414811672195735f, 0.147604904291238f, -0.649219724907210f, 0.907797399703411f, -0.496097071857490f, -0.0958082520749422f, -0.700618145301611f, 0.238049932994406f, 0.946616020659334f, 0.143538494511824f, 0.0641076718667677f, 0.377873848622552f, -0.413854028741624f, -0.838831021130186f, 0.0208044297354626f, 0.476712667979210f, 0.850908020233298f, 0.0692454021020814f, 0.841788714865238f, -0.251777041865926f, 0.512215668857165f, 0.827988589806208f, -0.399200428030715f, 0.999219950547600f, -0.00465542086542259f, 0.279790771964531f, -0.683125623289052f, 0.988128867315143f, 0.00697090775456410f, -0.409501680375786f, -0.190812202162744f, -0.154565639467601f, 0.305734586628079f, -0.922825484202279f, -0.0622811516391562f, -0.502492855870975f, 0.358550513844403f, 0.678271216185703f, -0.940222215291861f, 0.568581934651071f, 0.953835466578938f, -0.476569789986603f, 0.0141049472573418f, 0.722262461730185f, -0.128913572076972f, -0.583948340870808f, -0.254358587904773f, -0.390569309413304f, -0.0495119137883056f, -0.486356443935695f, -0.112768011009410f, -0.608763417511343f, -0.145843822867367f, 0.767829603838659f, 0.791239479733126f, 0.0208376062066382f, -0.524291005204912f, -0.200159553848628f, -0.835647719235620f, -0.222774380961612f, 0.0617292533934060f, 0.233433696650208f, -0.543969878951657f, -0.628168009147650f, -0.725602523060817f, -0.273904472034828f, 0.320527317085229f, -0.556961185821848f, 0.261533413201255f, 0.696617398495973f, 0.200506775746016f, -0.395581923906907f, 0.0196423782530712f, -0.0552577396777472f, -0.594078139517501f, -0.816132673139052f, -0.898431571909616f, 0.879105843430143f, 0.949666380003024f, -0.245578843355682f, 0.528960018663897f, 0.201586039072583f, -0.651684706542954f, 0.596063456431086f, -0.659712784781056f, -0.213702651629353f, -0.629790163054887f, -0.0572029778771013f, 0.645291034768991f, -0.453266855343461f, -0.581253959024410f, 0.632682730071992f, 0.991406037765467f, 0.701390336150136f, -0.879037255220971f, -0.304180069776406f, 0.0969095808767941f, -0.465682778651712f, 0.815108046274786f, -0.532850846043973f, 0.950550134670033f, 0.296008118726089f, -0.198390447541329f, 0.159049143352201f, 0.105169964332594f, -0.482506131358523f, 0.493753482281684f, 0.292058685647414f, 0.283730532860951f, 0.00323819209092657f, 0.765838273699203f, -0.0753176377562099f, -0.679824808630431f, 0.548180003463159f, -0.996048798712591f, 0.782768288046545f, 0.396509190560532f, 0.848686742379558f, 0.750049741585178f, 0.730186188655936f, -0.0220701180542726f, -0.487618042364281f, -0.403562199756249f, -0.0693129490117646f, 0.947019452953246f, -0.731947366410442f, 0.198175872470120f, -0.329413252854837f, -0.641319161749268f, 0.186271826190842f, -0.0739989831663739f, -0.334046268448298f, -0.191676071751509f, -0.632573515889708f, -0.999115061914042f, -0.677989795015932f, 0.289828136337821f, 0.696081747094487f, 0.965765319961706f, -0.203649463803737f, -0.195384468978610f, 0.746979659338745f, 0.701651229142588f, -0.498361303522421f, 0.289120104962302f, 0.270493509228559f, -0.132329670835432f, 0.385545665843914f, -0.265371843427444f, 0.306155119003788f, -0.859790373316264f, -0.0198057838521546f, 0.233572324299025f, 0.426354273793125f, -0.510901479579029f, -0.600001464460011f, -0.972316846268671f, 0.531678082677910f, -0.0543913028234813f, -0.860333915321655f, 0.0717414549918496f, -0.992726205437930f, 0.587189647572868f, -0.710120198811545f, -0.712433353767817f, 0.000905613890617163f, 0.323638959833707f, -0.148002344942812f, 0.422217478090035f, -0.512122539396176f, -0.652032513920892f, -0.0749826795945674f, 0.689725543651565f, 0.00708142459169103f, 0.612282380092436f, -0.182868915402510f, -0.478704046524703f, 0.630078231167476f, -0.201694106935605f, 0.471080354222778f, 0.705764111397718f, 0.504296612895499f, -0.245442802115836f, -0.0255433216413170f, 0.244606720514349f, -0.620852691611321f, 0.130333792055452f, -0.0404066268217753f, 0.533698497858480f, 0.569324696850915f, -0.0208385747745345f, -0.344454279574176f, 0.697793551353488f, 0.223740789443046, 0.0819835387259940f, -0.378565059057637f, 0.265230570199009f, -0.654654047270763f, -0.959845479426107f, -0.524706200047066f, -0.320773238900823f, 0.133125806793072f, 0.204919719422386f, 0.781296208272529f, 0.357447172843949f, -0.295741363322007f, -0.531151992759176f, -0.928760461863525f, -0.492737999698919f, 0.185299312597934f, 0.0308933157463984f, 0.0940868629278078f, -0.223134180713975f, -0.728994909644464f, 0.748645378716214f, 0.602424843862873f, 0.939628558971957f, -0.601577015562304f, -0.178714119359324f, 0.812720866753088f, -0.864296642561293f, 0.448439532249340f, 0.423570043689909f, 0.883922405988390f, -0.121889129001415f, -0.0435604321758833f, -0.823641147317994f, -0.775345608718704f, -0.621149628042832f, 0.532395431283659f, -0.803045105215129f, 0.897460124955135f, 0.432615281777583f, -0.0245386640589920f, -0.822321626075771f, -0.992080038736755f, -0.829220327319793f, 0.125841786813822f, 0.277412627470833f, 0.623989234604340f, -0.207977347981346f, -0.666564975567417f, 0.419758053880881f, -0.146809205344117f, 0.702495819380827f, 0.802212477505035f, 0.161529115911938f, 0.987832568197053f, -0.885776673164970f, -0.608518024629661f, -0.126430573784758f, 0.168260422890915f, -0.517060428948049f, -0.766296586196077f, -0.827624510690858f, -0.149091785188351f, -0.643782325842734f, 0.768634567718711f, 0.815278279059715f, -0.648037361329720f, -0.480742843535214f, 0.983809287193308f, -0.701958358623791f, 0.0797427982273327f, 0.903943825454071f, 0.980486658260621f, 0.207436790541324f, -0.536781321571165f, -0.885473392956838f, -0.626744905152131f, 0.279917970592554f, -0.489532633799085f, 0.402084958261836f, -0.566738134593205f, -0.0990017532286025f, 0.458891753618823f, 0.893734110503312f, 0.541822126435773f, -0.856210577956263f, -0.0354679151809227f, -0.868531503535520f, 0.150589222911699f, 0.611651396802303f, 0.524911319413221f, 0.555472734209632f, -0.723626819813614f, -0.162106613127807f, 0.602405197560299f, 0.903198408993777f, 0.329150411562290f, -0.806468536757339f, -0.671787125844359f, -0.707262852044556f, 0.474934689940169f, -0.379636706541612f, 0.404933387269815f, 0.332303761521238f, 0.394233678536033f, -0.0366067593524413f, 0.904405677123363f, -0.356597686978725f, -0.623034135107067f, 0.572040316921149f, 0.799160684670195f, -0.507817199545094f, -0.533380730448667f, -0.884507921224020f, -0.00424735629746076f, 0.647537115339283f, 0.456309536956504f, -0.766102127867730f, -0.625121831714406f, 0.341487890703535f, -0.360549668352997f, -0.229900108098778f, -0.666760418812903f, 0.813282715359911f, 0.115522674116703f, -0.221360306077384f, 0.0297293679340875f, 0.00682810040637105f, 0.0115235719886584f, 0.887989949086462f, 0.792212187398941f, 0.415172771519484f, -0.600202208047434f, 0.949356119962045f, -0.526700730890731f, 0.946712583567682f, -0.392771116330410f, 0.0144823046999243f, -0.649518061223406f, 0.724776068810104f, 0.00920735790862981f, -0.461670796134611f, 0.217703889787716f, 0.846151165623083f, -0.202702970245097f, 0.314177560430781f, -0.761102867343919f, 0.0528399640076420f, -0.986438508940994f, -0.595548022863232f, -0.430067198426456f, 0.150038004203120f, 0.738795383589380f, -0.605707072657181f, -0.597976219376529f, 0.375792542283657f, -0.321042914446039f, 0.902243988712398f, 0.463286578609220f, -0.739643422607773f, 0.210980536147575f, -0.539210294582617f, 0.405318056313257f, -0.876865698043818f, -0.0883135270940518f, 0.0300580586347285f, -0.657955040210154f, 0.159261648552234f, 0.288659459148804f, 0.274488527537659f, 0.646615145281349f, 0.431532024055095f, -0.982045186676854f, -0.777285361097106f, -0.124875006659614f, 0.503004910525253f, 0.824987340852061f, -0.859357943951028f, -0.894837450578304f, 0.744772864540654f, 0.415263521487854f, 0.337833126081168f, -0.612498979721313f, 0.391475686177086f, 0.573982630935632f, -0.391044576636065f, 0.669493459114130f, -0.763807443372196f, -0.898924075896803f, -0.969897663976237f, -0.266947396046322f, 0.198506503481333f, -0.355803387868922f, 0.787375525807664f, 0.655019979695179f, -0.266247398074148f, -0.665577607941915f, 0.0617617780742654f, -0.303207459096743f, 0.807119242186051f, -0.864431193732911f, 0.711808914065391f, 0.267969697417500f, -0.643939259651104f, -0.723685356192067f, 0.887757759160107f, -0.318420101532538f, -0.984559057628900f, -0.123118506428834f, 0.264872379685241f, 0.258477870902406f, -0.727462993670953f, -0.223845786938221f, 0.683462211502638f, -0.989811504909606f, 0.292644294487220f, -0.926087081411227f, -0.801377664261936f, -0.337757621052903f, 0.356167431525877f, 0.974619379699180f, 0.456124311183874f, 0.664192098344107f, -0.910993234571633f, -0.484097468631090f, -0.128534589958108f, -0.770879324529314f, 0.320053414246682f, 0.249818479771296f, 0.0153345543766990f, 0.696352481669035f, -0.397719804512483f, 0.670333638147646f, -0.678192291329959f, 0.190143924397131f, 0.342035884244954f, -0.350791038317704f, 0.0218450632953668f, 0.437133719806156f, 0.659960895652910f, 0.903378806323159f, 0.855089775229062f, 0.946706092624795f, 0.335540975081955f, 0.838337968455111f, -0.102693592034237f, -0.702102376052106f, 0.409624309223486f, -0.654483499569910f, 0.886576641430416f, -0.200573725141884f, -0.461284656727627f, 0.262661770963709f, 0.867505406245483f, -0.0688648080253220f, -0.707487995489326f, -0.248871627068848f, -0.197869870234198f, -0.243745607075197f, -0.244106806741608f, 0.489848112299788f, -0.0909708869175492f, -0.377678949786167f, 0.0385783576998284f, -0.470361956031595f, 0.802403491439449f, -0.408319987166305f, 0.345170991986463f, -0.433455880962420f, 0.00950587287655291f, -0.441888155900165f, -0.817874450719479f, 0.818308133775667f, 0.931915253798354f, 0.818494801634479f, 0.787941704188320f, 0.882012210451449f, 0.0749985961399193f, 0.259772455233352f, -0.655786948552735f, 0.0824323575519799f, 0.980211564632039f, -0.798619050684746f, 0.496019643929772f, -0.727312997781404f, -0.999839600489443f, 0.625938920414345f, -0.561059012154101f, 0.215650518505246f, 0.121571798563274f, 0.161863493108371f, -0.340322748036792f, 0.521792371708641f, 0.655248389359818f, -0.180967013066484f, 0.936797969156762f, 0.523749660366580f, 0.764744126333943f, 0.384701560810431f, -0.744092118301334f, 0.719721922905938f, 0.365931545158250f, -0.720202871171563f, 0.121662048491076f, -0.355501954289222f, 0.379420491208481f, -0.593818415223405f, -0.433690576121147f, -0.766763563509045f, -0.377445104709670f, -0.955638620720410f, 0.309622585052195f, -0.613767678153186f, 0.0177719922394908f, 0.362917537485277f, -0.297613292472489f, 0.0275561832152067f, -0.962345352767599f, 0.452866577068408f, -0.307485159523065f, 0.931778412136845f, 0.639592220588070f, 0.00782144244951311f, -0.0466407334447796f, -0.134392603781566f, 0.895314655361308f, -0.537785271016286f, 0.663926391064792f, -0.886126633268266f, -0.0975129470189278f, -0.429791706025144f, -0.440337831994928f, -0.00156267573188829f, 0.933113069253665f, -0.560704402651437f, -0.201658150324907f, 0.465819560354530f, 0.0701448781871696f, 0.859597672251104f, -0.525851890358272f, -0.992674038068357f, -0.0846761339576128f, -0.401686794568758f, -0.886069686075370f, -0.480254412625133f, 0.432758053902000f, 0.168651590377605f, -0.453397134906684f, 0.340250287733381f, -0.972972507965963f, 0.0560333167197302f, -0.180812774382952f, -0.689848943619717f, -0.427945332505659f, 0.771841237806370f, 0.329334772795521f, 0.573083591606505f, 0.280711890938316f, -0.265074342340277f, -0.166538165045598f, -0.0612128221482104f, 0.458392746490372f, 0.199475931235870f, 0.681819191997175f, 0.356837960840067f, 0.756968760265553f, 0.763288512531608f, -0.890082643508294f, -0.322752448111365f, 0.799445915816577f, -0.956403501496524f, 0.723055987751969f, 0.943900989848643f, -0.217092255585658f, -0.426893469064855f, 0.834596828462842f, 0.723793256883097f, 0.781491391875921f, 0.928040296363564f, -0.468095417622644f, 0.758584798435784f, 0.589732897992602f, 0.929077658343636f, 0.829643041135239f, 0.0947252609994522f, 0.554884923338572f, -0.513740258764285f, -0.221798194292427f, 0.499855133319165f, -0.0237986912033636f, 0.559618648100625f, -0.509812142428963f, -0.444047241791607f, 0.678274420898738f, -0.983706185790147f, -0.295400077545522f, -0.688769625375228f, 0.729259863393412f, 0.889478872450658f, 0.928277502215167f, -0.429388564745762f, -0.790568684428380f, 0.930220908227667f, -0.796970618648576f, -0.980240003047008f, 0.0372716153521411f, -0.290828043433527f, -0.303854123029680f, 0.160774056645456f, -0.712081432630280f, 0.390787025293754f, 0.981202442873064f, -0.679439021090013f, 0.183053153027806f, 0.665002789261745f, -0.708708782620398f, 0.254574948166343f, 0.0575397183305137f, -0.723713533137924f, -0.732816726186887f, 0.501983534740534f, 0.879998734527489f, 0.825871571001792f, 0.920880943816000f, 0.311565022703289f, -0.788226302840017f, -0.223197800016568f, 0.850662847422425f, -0.365181128095578f, 0.958907951854379f, -0.0421327708909884f, -0.153860389403659f, -0.219620959578892f, -0.469076971423126f, -0.523348925540362f, -0.287762354299832f, -0.913332930679763f, 0.403264134926789f, 0.725849051303960f, 0.743650157693605f, -0.382580349065687f, -0.297138545454038f, -0.480092092629432f, 0.0412697614821378f, -0.396203822475830f, -0.0721078217568973f, 0.979038611510460f, -0.766187876085830f, -0.344262922592081f, 0.943351952071948f, -0.219460259008486f, 0.115393587800227f, -0.342675526066015f, 0.926460460401492f, -0.486133445041596f, 0.0722019534490863f, -0.571069005453629f, -0.0854568609959852f, 0.370182934471805f, -0.554007448618166f, 0.899885956615126f, -0.188476209845590f, -0.548132066932086f, 0.0559544259937872f, -0.161750926638529f, -0.532342080900202f, 0.585205009957713f, -0.374876171959848f, -0.169253952741901f, -0.473665572804341f, 0.942267543457416f, -0.515867520277168f, -0.706362509002908f, -0.320672724679343f, -0.398410016134417f, 0.733774712982205f, 0.449599271169282f, 0.109119420842892f, -0.285090495549516f, 0.0854116107702212f, 0.0603189331827261f, -0.943780826189008f, 0.0679186452322331f, 0.0975973769951632f, -0.870728474197789f, -0.153122881744074f, -0.519939625069588f, -0.633620207951748f, -0.767551214057718f, -0.905802311420298f, -0.841350087901049f, -0.271805404203346f, 0.282221543099561f, -0.0874121080198842f, 0.0634591013505281f, 0.318965595714934f, -0.865047622711268f, -0.401960840475322f, 0.637557181177199f, -0.664578054110050f, -0.871253510227744, -0.893972634695541f, 0.442396058421524f, -0.427901040556135f, -0.740186385510743f, 0.788155411447006f, -0.541278113339818f, 0.509586521956676f, -0.461159620800394f, 0.664671981848839f, 0.880365181842209f, -0.0831685214800200f, 0.952827020902887f, 0.183226454466898f, -0.176729350626920f, 0.851946105206441f, -0.361976142339276f, 0.357209010683668f, 0.982462882042961f, -0.690757734204635f, 0.178681657923363f, -0.0804395784672956f, 0.971787623805611f, 0.875217157810758f, 0.160844021450331f, -0.359951755747351f, 0.0178495935461525f, 0.0203610854761294f, 0.413933338290502f, -0.676038601090005f, -0.111093077131977f, -0.381792206260952f, -0.459903351782575f, 0.308522841938619f, 0.324961267942541f, 0.365201262605939f, 0.732543185546895f, -0.559558093250200f, 0.848266528378337f, -0.185546299813159f, 0.997052205707190f, -0.932554828383249f, -0.106322273904826f, -0.0690562674587807f, 0.919489002936141f, 0.137210930163322f, -0.664517238270193f, -0.985856844408119f, -0.0719443995256963f, -0.602400574547167f, -0.398979518518077f, -0.581117055144305f, -0.0626081333075188f, -0.0372763806643306f, -0.688808592854889f, 0.703980953746103f, -0.480647539644480f, 0.615510592326288f, -0.940226159289884f, -0.953483236094818f, -0.300312284206625f, -0.819419230573751f, 0.657560634657022f, -0.0500336389233971f, 0.628589817614501f, 0.717012803783103f, -0.0315450822394920f, -0.445526173532186f, 0.521475917548504f, -0.479539088650145f, 0.695075897089419f, -0.0365115706205694f, 0.0256264409967832f, -0.0121306374106025f, -0.817618774100623f, 0.375407640753000f, 0.944299492219378f, -0.717119961760812f, -0.120740746804286f, 0.995225399986245f, -0.460846026818625f, 0.904552069467540f, 0.807270804870602f, -0.842962924665094f, -0.923108139392625f, -0.130295037856512f, 0.760624035683226f, 0.986419847047289f, -0.959218334866074f, -0.203345611185410f, -0.474420035241129f, -0.872329912560413f, 0.485994152094788f, -0.515456811755484f, -0.948541161235413f, 0.509659433909651f, 0.783030335970347f, -4.41004028146619e-05f, -0.664795573083349f, 0.917509788523214f, -0.824045573084530f, -0.461857767121051f, -0.667434409929092f, -0.00822974230444418f, 0.825606347148302f, -0.396378080991589f, 0.0161379983198293f, -0.940751675506308f, -0.520997013834332f, -0.239727035024153f, -0.354546027474561f, 0.430652211989940f, -0.557416557692462f, -0.357117274957257f, -0.891975448321656f, -0.0775302131779423f, 0.716775563686830f, -0.903453980341467f, 0.946455001410598f, -0.615060907661003f, 0.964288374469340f, 0.0506144897273089f, 0.720601612869967f, -0.991323837622476f, 0.647403093538608f, -0.400304988135589f, -0.883732066109751f, -0.792060477777513f, 0.710867542231890f, -0.840766000234525f, 0.460362174479788f, -0.834771343071341f, -0.329399142231491f, -0.139853203297018f, -0.760035442359396f, -0.546795911275364f, -0.598172518777125f, 0.244198671304740f, 0.0816980976432087f, -0.978470883754859f, -0.425173722072458f, -0.469868865988971f, 0.847396146045236f, 0.0513388454446360f, -0.545662072513986f, -0.130534232821355f, -0.654100097045099f, 0.0409163969999120f, 0.573001152600502f, 0.706046270983569f, 0.587208280138624f, 0.237670099964068f, 0.848355476872244f, -0.318971649676775f, -0.659343733364940f, 0.321817022392701f, -0.595779268050966f, -0.114109784140171f, 0.998897482902424f, -0.615792624357560f, -0.384232465470235f, 0.156963634764123f, 0.499645454164798f, -0.627603624482829f, 0.169440948996654f, 0.109888994819522f, -0.492231461622548f, -0.463014567947703f, 0.825436145613203f, -0.0271223123229367f, 0.497887971992266f, 0.811868354230459f, -0.192668816770168f, 0.287930938097264f, 0.0283112173817568f, 0.791359470942568f, 0.365100854153897f, -0.566922537281877f, 0.915510517906894f, 0.674211624006981f, 0.505848146007678f, 0.509348889158374f, -0.0477364348461706f, 0.409703628204478f, -0.820970358007873f, -0.565377675052345f, 0.810052924776160f, -0.448904038826591f, -0.830251135876445f, -0.660589978662428f, -0.890196028167542f, 0.130526506200048f, 0.924600157422957f, 0.587215078998604f, 0.727552064386916f, -0.224172021948978f, -0.182984019951690f, 0.308546229024235f, 0.971188035736775f, 0.0229902398155457f, 0.0608728749867729f, -0.0712317776940203f, 0.549832674352445f, -0.600015690750697f, -0.0495103483291919f, -0.564669458296125f, 0.726873201108802f, -0.197851942682556f, -0.983422510445155f, -0.905314463127421f, 0.453289030588920f, 0.792504915504518f, -0.840826310621539f, 0.0979339624518987f, -0.506416975007688f, -0.143310751135128f, -0.451251909709310f, -0.356156486602212f, -0.430777119656356f, -0.593002001098269f, -0.212505135257792f, -0.378005313269430f, 0.516460778234704f, -0.574171750919822f, -0.702870049350445f, 0.190454765104412f, 0.694962035659523f, 0.177498499962424f, -0.00126954773922439f, -0.766110586126502f, -0.769862303237397f, -0.208905136673906f, 0.0728026097773338f, -0.467480087700933f, -0.368839893652514f, -0.608806955889496f, -0.531329879815774f, 0.411920547737697f, -0.407318902586407f, 0.922406353838750f, -0.0272310683929855f, 0.781051179942937f, 0.860271807949640f, -0.703736733439623f, -0.285650334863399f, -0.466904334435873f, -0.716816768536707f, 0.0869377378786880f, -0.280331892461309f, 0.773946156883160f, -0.139856444064730f, 0.575680110908147f, -0.887887626173303f, 0.314286545048942f, 0.673119170729964f, 0.520399233930039f, 0.581347801663144f, 0.731708017815653f, 0.672583525027818f, -0.0534590776637494f, -0.880572908687369f, 0.171150522778545f, -0.377041265530122f, -0.478003213002057f, 0.458602883802583f, 0.836824527658741f, -0.0686622680764437f, -0.301000630566919f, -0.652562984155554f, 0.604631263268903f, 0.791770979838877f, 0.0790491584346489f, 0.812646960034949f, 0.138794042671596f, 0.709411730079774f, 0.226484869016811f, 0.797388098554019f, -0.162225991160828f, -0.0295749256270541f, 0.218242165083417f, 0.442845427695148f, -0.480622209857766f, 0.873464432574125f, -0.868017543466245f, -0.435489784247438f, 0.0589001507244313f, 0.829134536020168f, 0.614063504046069f, -0.0498036542372153f, -0.803122689381969f, -0.495207870035615f, -0.126836582496751f, -0.0715271574335641f, -0.600815700055194f, 0.434993547671690f, -0.891665893518364f, 0.515259516482513f, 0.475325173737397f, -0.716548558025405f, -0.881097306400870f, 0.738462585443836f, -0.244486212870867f, -0.750368936394211f, 0.303496411011494f, -0.602701428305057f, -0.400346153635480f, -0.300002744969481f, -0.518552440201900f, 0.437964598712580f, -0.816689813412280f, -0.814392666138757f, -0.888568091915377f, 0.449416911306476f, -0.231889259488176f, 0.589775175288682f, 0.817224890217553f, 0.518646001325967f, -0.406046689874425f, -0.822100925750380f, 0.0528571826460145f, 0.502410576690672f, -0.795964394123106f, 0.0587614583641718f, -0.960750994569408f, 0.0366871534513058f, 0.723018804498087f, 0.0607565140068052f, 0.337380735516841f, 0.810682513202583f, -0.636743814403438f, 0.287171363373943f, -0.651998050401509f, -0.913606366413836f, 0.642186273694795f, -0.197674788034638f, -0.261253290776174f, 0.696450222503413f, -0.178859131737947f, -0.388167582041093f, -0.0593965887764258f, -0.638517356081890f, 0.804955770174156f, 0.220726627737384f, 0.263712659676167f, -0.214285245576410f, -0.267640297291737f, -0.268009369634837f, -0.957726158424482f, 0.708674977585603f, 0.336764494287156f, -0.985742981232916f, -0.883053422617300f, 0.560301189759340f, -0.692967747323003f, 0.977419052658484f, 0.0749830817523358f, 0.916618822945019f, 0.941660769630849f, 0.454145712080114f, 0.176036352526593f, 0.103229925297037f, 0.936507745325933f, -0.870159095287666f, -0.106465234217744f, 0.684178938709319f, 0.669775326656340f, -0.620857222834950f, 0.939074959093680f, -0.592224920792423f, 0.620706594809134f, 0.0456831422421473f, 0.738727999152789f, -0.751090911501446f, 0.683669216540363f, 0.153825621938168f, -0.255671723273688f, -0.773772764499189f, -0.667753952059522f, 0.887641972124558f, -0.664358118222428f, 0.512196622998674f, -0.0234362604874272f, 0.942878420215240f, -0.406617487191566f, -0.140379594627198f, -0.0587253931185765f, 0.419570878799757f, 0.533674656399007f, 0.108777047479414f, -0.695880604462579f, 0.481525582104998f, 0.511165135231064f, 0.136105196996658f, -0.481918536916982f, 0.757546893769363f, 0.957648176032083f, -0.908743619686586f, -0.395640537583668f, 0.0493439519763970f, 0.293569612893396f, 0.387420368421925f, 0.0928482742403196f, 0.407302666835821f, -0.787979245337637f, -0.968269218296593f, -0.409517247978962f, 0.775076200793689f, -0.217738166217447f, -0.370002483875998f, -0.570975789421316f, 0.844070553036478f, 0.668620483679341f, 0.00139813137293987f, -0.0912495442122028f, -0.0375370940595317f, 0.723007849224616f, 0.369999774115317f, 0.862240371150479f, 0.749525689790910f, 0.742992309993137f, -0.495813719545874f, -0.101947508108870f, -0.152536889610560f, 0.0598123624723883f, -0.436496899502871f, 0.520026918467263f, 0.241005798945400f, 0.970456690492966f, -0.376417224463442f, 0.614223236672359f, 0.336733945081746f, 0.376602027190701f, 0.00373987228923456f, -0.415425448787442f, 0.330560415319813f, -0.277250467297048f, 0.861008806111330f, -0.00655914035278493f, 0.810375656135324f, -0.0113631690466840f, -0.191699616402287f, -0.808952204107388f, 0.813180054552450f, 0.472985418265257f, 0.180147510998781f, -0.262580568975063f, 0.211152909221457f, -0.882514639604489f, -0.575589191561861f, 0.106927561961233f, 0.964591320892138f, 0.738192954342001f, 0.687649298588472f, -0.229142519883570f, -0.354434619656716f, -0.420522788056562f, 0.684638470896597f, -0.608080686160634f, 0.172668231197353f, 0.571295073068563f, -0.202258974457565f, 0.183035733721930f, -0.425589835248751f, -0.181955831301366f, 0.798193178080558f, -0.719799491928433f, -0.376418218727565f, 0.100370714244854f, -0.674685331738723f, -0.528950922374114f, 0.480443520097694f, 0.432497368954013f, 0.887439714903326f, 0.598241701759478f, -0.250064970303242f, -0.743111010477448f, 0.936189907099845f, -0.867383557331633f, 0.852536175309851f, -0.426378707286007f, 0.793838638663137f, 0.856262917294594f, 0.734157059815547f, 0.00452009494051664f, -0.884258713402709f, -0.0835595438259760f, -0.735457210599502f, -0.710727075357488f, 0.858050351034768f, -0.626070522205317f, -0.848201957131499f, 0.0180933910837406f, -0.0350884878366737f, -0.893836321618480f, -0.0682788306189803f, -0.539993219329871f, -0.557660404374917f, 0.268969847256868f, 0.505363999910409f, -0.0464757944714727f, -0.529689906951922, -0.138445378586710f, 0.992531054118938f, 0.974585450054910f, 0.940349645687053f, 0.648085319100986f, -0.410736404028701f, 0.804131759246012f, -0.774897101314247f, 0.178246382655493f, -0.361699623232501f, -0.836093509684016f, 0.806309487627613f, -0.758182371322663f, 0.718410035716663f, -0.213136487421868f, -0.0563465521625497f, 0.0411192849612654f, -0.532497330327019f, -0.0419839515250475f, 0.769432068229678f, 0.253556234192255f, -0.745131216530268f, -0.890639235422577f, -0.140643637034330f, 0.318127074868768f, -0.497415632768561f, -0.383508820416842f, -0.468783454456628f, -0.289531078129000f, -0.0831555730758713f, 0.0107128404847427f, -0.567754537918270f, 0.926366772604370f, -0.600154724486768f, -0.0920759547805206f, 0.889582307602381f, -0.0710437157605615f, -0.182724716112986f, 0.228135065644420f, 0.851015495602628f, 0.653035806598961f, -0.986676404958677f, -0.871714951288816f, -0.824734086356281f, -0.490239304888267f, 0.244318295619814f, -0.923794688606381f, 0.670566388343457f, 0.849438492633058f, -0.225318912425116f, 0.461075616917687f, 0.656436404012820f, -0.416403369651597f, 0.205630417444150f, -0.163509095777762f, -0.0670299490212758f, -0.315561491397908f, -0.0952855008191476f, -0.377993693497066f, 0.860172853824826f, -0.669622978211317f, 0.595058880455053f, -0.425661849490015f, -0.0405359106780283f, 0.129968697438974f, -0.156244199842099f, 0.996996665434629f, -0.888570357356090f, -0.925646614993414f, -0.753998082238076f, 0.714491335460749f, -0.307849905639463f, 0.536274323586448f, -0.462944722411129f, 0.622202376598447f, -0.215582012734053f, -0.115115003363232f, 0.128168110175570f, -0.556263623663708f, 0.921813264386344f, -0.288173574121268f, -0.175054002159610f, 0.0621862747516269f, -0.468862899314091f, 0.976184545317535f, 0.468469061953779f, 0.679394669665911f, -0.0651943232114096f, 0.872740953203360f, -0.917720162541254f, 0.271535917769933f, 0.265441861283112f, 0.542190484993772f, -0.0208550501604048f, 0.983272473294640f, -0.522164666401537f, 0.833823680455458f, 0.414337644113416f, 0.588576354535126f, 0.318369292694380f, 0.870442561030567f, -0.422722224743553f, -0.200185003922166f, -0.770185495487048f, -0.878134057034045f, -0.712873198675798f, 0.647706512601268f, 0.593648188899773f, 0.126171748161942f, -0.189622212946038f, 0.707877641788638f, 0.790070498218410f, 0.698576567863428f, 0.594748885238005f, 0.567439045931572f, -0.591839707769224f, -0.632709967090349f, 0.415471238430617f, 0.115403276784208f, -0.375797954748234f, 0.123611001678020f, -0.864109581464288f, 0.115346512920739f, -0.515581940111704f, 0.880606114362175f, 0.356011740142007f, -0.318112820131587f, 0.765766689783476f, -0.226772670084743f, 0.442067390135885f, 0.348547568069751f, 0.862154389627291f, -0.894863284060244f, 0.475714942110286f, 0.552377629980789f, -0.0838875341374268f, -0.227654706745770f, 0.0998522598030438f, 0.870812229993830f, -0.518250234958224f, -0.0635791579471283f, -0.284101882205902f, -0.454751668241269f, 0.720773434493943f, 0.0756117818245317f, -0.0572317848090118f, -0.692584830354208f, 0.776250173796276f, 0.514052484701885f, 0.00770839936587864f, 0.775668871262837f, 0.933055956393907f, 0.0501713700022097f, -0.922194089981246f, 0.266653852930886f, -0.408584553416038f, 0.797066793752635f, -0.785570848747099f, 0.931403610887599f, 0.660859952465710f, -0.630963871875185f, -0.673000673345695f, 0.518897255252506f, -0.342041914345720f, 0.405613809903414f, -0.373516504843492f, -0.208292396009356f, 0.0510871025610438f, 0.396765368381847f, 0.00537609874241829f, 0.935717099427788f, -0.564801066383885f, -0.907523685862547f, 0.670551481631625f, -0.457309616171932f, 0.364001526470449f, 0.140805524345232f, -0.349945327329409f, -0.0361532758624807f, -0.304268551311720f, 0.618482952755668f, -0.0120110524971313f, 0.106364353621731f, -0.427587198043230f, 0.464249033810121f, -0.808297048471569f, 0.675277128303038f, -0.0663762607268352f, -0.431951364170808f, 0.953951718476660f, -0.725934553905574f, -0.685163723789561f, 0.164132617720945f, 0.934798872032034f, -0.695343627424553f, -0.420317401094920f, -0.689247558220342f, -0.605894279765940f, -0.693832779320227f, 0.455037128281788f, 0.968645000038447f, -0.0839147410947130f, 0.603463489419899f, 0.776913738299999f, -0.491560292499776f, 0.692235227850848f, 0.0824017593921889f, 0.459024952691847f, -0.918050509352710f, -0.777463066447746f, -0.161045596440278f, 0.982603547894360f, 0.700884888820475f, 0.998304481713913f, -0.362488733430088f, 0.171493948866881f, 0.565871153533442f, -0.965620428705067f, -0.835532968802398f, 0.885598629033760f, 0.609604257914327f, 0.725300244775050f, 0.153524048564152f, -0.662541112390878f, 0.912145212201290f, 0.135610445338421f, -0.0813934125800109f, 0.242209063597546f, -0.264886126609115f, -0.335070345839122f, 0.823958964903978f, -0.313110855907701f, -0.354068037633970f, -0.0381190024996405f, 0.117794735211134f, -0.604442743379238f, 0.524930955656444f, -0.754959642694882f, -0.359151666678207f, -0.247910739722172f, 0.573570999369016f, 0.543167570010806f, -0.718553346110069f, 0.202415372555816f, -0.860091438569300f, -0.0125446132328610f, 0.509348782140749f, 0.349261188228469f, 0.424395913611831f, 0.0557092265870811f, 0.740276822496471f, 0.479158001215769f, -0.221873518706244f, -0.744883456979009f, 0.393114117430743f, -0.733203119089531f, -0.506531269498885f, -0.505532097672033f, -0.509440981371663f, 0.666118722468113f, 0.0164067375520756f, -0.530276655546078f, 0.786338654343788f, -0.985008085364936f, 0.479988836226036f, -0.233652481382475f, 0.838641098910395f, -0.407379719374768f, -0.314266358910263f, -0.938033692224531f, -0.627320971378707f, -0.229174127295511f, 0.642505983671691f, -0.387855473250297f, 0.360324209821339f, -0.900766206699468f, 0.176676285751262f, 0.833894117554548f, -0.0207873177403817f, -0.202625183820044f, 0.706644325019314f, -0.817922707040537f, -0.242742059004419f, 0.282109349674866f, 0.0164603911954744f, -0.504625902855950f, 0.0415496120997125f, -0.787777778295785f, 0.362588721999523f, -0.371357162843751f, -0.818375262182416f, 0.727779997467707f, -0.836502839702384f, 0.0423869176265037f, -0.283934686546853f, 0.665864224978728f, -0.0428162304637920f, 0.243534621880753f, -0.803789304599586f, 0.570866852088607f, 0.340615579467880f, -0.323456502239327f, 0.403242371952148f, -0.0679158901587793f, -0.866985651416456f, -0.439873628406335f, -0.246357367033863f, 0.436234859832243f, 0.560714706225535f, -0.632564381913014f, -0.316451076258298f, -0.977122780282003f, 0.0741405862954117f, -0.217862250253606f, 0.887093089232476f, -0.418281865182365f, -0.638553415535034f, -0.262631979211197f, -0.567499176465252f, 0.676178859605923f, 0.933551699581608f, -0.0139735129263516f, -0.610719575803582f, 0.565123751720690f, 0.230672823422021f, 0.323935439339366f, 0.635142215896104f, 0.981184609133698f, 0.883668802319366f, -0.281281673616891f, 0.583204242495555f, 0.150854689098149f, -0.775890223139644f, 0.419951701513177f, -0.565767744791652f, -0.855232478054420f, 0.472188579901153f, -0.501463211798228f, 0.727960518524943f, 0.977187851385321f, 0.908113737694915f, -0.570200931535418f, 0.716036980035073f, 0.147838037485588f, 0.218820342222622f, -0.0673193461152677f, 0.433612519652386f, 0.449601736390411f, 0.556458722303960f, 0.417345590820787f, -0.783345413347895f, 0.858903187230710f, 0.178354025272247f, -0.130619018471658f, 0.858282827806003f, 0.508916167873459f, 0.139535936201634f, 0.240400109521332f, -0.102942705407161f, 0.841682417072375f, -0.696350979494975f, -0.793644449061670f, -0.698273636720141f, -0.228676865074326f, -0.195917865828574f, -0.306483109792438f, -0.865320326812636f, 0.659185969805107f, -0.368847387975239f, 0.337343722359231f, 0.0723822170210744f, 0.907475280998826f, 0.515168301614856f, 0.0790167120323961f, -0.756697420780699f, 0.966477562469936f, -0.663190129982788f, 0.145761851826854f, 0.376079225193173f, 0.631883071958707f, -0.956568110802436f, -0.735990864315730f, -0.795999578321461f, 0.958459465243432f, 0.319180429028702f, -0.907664654881857f, 0.992381284978014f, -0.511208110440365f, -0.714797966909523f, -0.717021870210999f, 0.545775837604423f, -0.0443828768329362f, 0.333311879948434f, 0.617237628406207f, -0.0895192882305207f, 0.506491005527430f, -0.354205929841282f, 0.777993157224477f, -0.667532693120319f, -0.105006112097613f, -0.337191911902220f, -0.337964429160738f, 0.609014812897482f, -0.368922911475613f, 0.889184378947484f, -0.676392242654630f, 0.429716870038086f, 0.916751115281822f, -0.655611878274175f, 0.538928395264007f, 0.382674384886170f, 0.0580742902089004f, -0.0124611362991478f, -0.0240388340005702f, -0.726296501832402f, -0.805701334732693f, 0.945344279474230f, -0.668066000378724f, 0.761436128738929f, -0.314275650172792f, -0.394331510439346f, 0.262887592668013f, 0.155064800148016f, -0.561829218656134f, -0.491542446753775f, 0.922248338472926f, 0.574575887413700f, 0.631722295929094f, -0.368854197209698f, 0.984780657580794f, 0.845286034922662f, -0.965631634115590f, -0.435710392440405f, -0.616488688868478f, 0.885865616625930f, 0.425733070487506f, 0.776721663555227f, -0.0652930284860209f, -0.734431875923792f, 0.725517937762654f, -0.474146253075108f, 0.895357779508529f, -0.0725048758018345f, -0.360185856190223f, 0.559350280666427f, 0.363695103660096f, 0.152231254765544f, 0.698196273442671f, 0.0518001104801953f, -0.139037096279713f, 0.340637636595997f, 0.584243998596814f, -0.442304329829130f, -0.501574294329747f, 0.250155103662225f, 0.320493999001502f, -0.150217982700108f, -0.0381390799255577f, 0.734760815545772f, -0.574574233376749f, 0.593440338163725f, 0.408049858247104f, -0.0845023181203484f, -0.855507806920297f, -0.473198309372409f, 0.331033392104072f, 0.196445364460658f, -0.799745050834061f, -0.973517526224363f, 0.333748727500822f, -0.772356831553232f, -0.430793038424357f, 0.649852557262489f, 0.504357958431509f, 0.779588082810134f, 0.0111847677569461f, -0.995526851285634f, -0.676007517368195f, 0.216774012875664f, -0.618928775636485f, -0.418043155155598f, -0.532063904545563f, -0.566979013994587f, 0.246319907266774f, 0.868651379198082f, -0.0433430896891542f, 0.463004686009427f, -0.162112430964754f, 0.285379745117090f, 0.901512987149549f, -0.706916206313139f, 0.685678130935725f, -0.673017501666538f, 0.0616272859909088f, 0.147532779463338f, -0.0108539826652629f, 0.960841184863269f, -0.950190006701182f, 0.992171414792924f, 0.715577145884581, 0.975908103138584f, -0.769014520827696f, -0.463212420186382f, -0.0761813427220397f, -0.704830850508594f, -0.220579724380686f, 0.840893269946637f, -0.432181989863148f, -0.956790418498701f, 0.122344784859397f, -0.242133592220528f, 0.908514497715246f, 0.303653521236872f, 0.756500828196849f, -0.752207807361831f, 0.367894642791072f, -0.702474131286247f, 0.189226989057138f, 0.401804209353236f, 0.608493473010907f, -0.437378101171900f, -0.158801297891213f, -0.381027984311046f, -0.949403985394057f, 0.370189685252539f, -0.872655295458655f, -0.337934909993878f, -0.0619622888328213f, 0.352094440420005f, 0.128759637109350f, 0.432413186229881f, -0.497474226759161f, 0.552933107875735f, 0.332665936587804f, -0.559261497212156f, -0.886188834336549f, 0.0170548801295034f, 0.192729852728271f, -0.674432365770129f, -0.526014722983374f, 0.425009223123802f, -0.186164676538888f, 0.190362042383007f, -0.0930204201587825f, 0.794188212052413f, -0.243549629178106f, 0.118970185744958f, -0.216230226310237f, 0.412570247218594f, 0.659556685538155f, -0.150540425515543f, -0.850858266540316f, -0.843827815842486f, 0.629298164439457f, 0.944304062363374f, -0.117764731240517f, 0.558568737697335f, 0.731745392387362f, -0.00413812760139165f, -0.251933493011685f, -0.473346352965658f, 0.178783613032362f, 0.547769344759580f, -0.414330113592064f, -0.550251453379012f, -0.925253680779905f, 0.623832825809309f, -0.494251081521428f, 0.0643361026845244f, 0.727107898350051f, 0.814864886916156f, 0.0177325632172460f, 0.749324691554934f, -0.266301024849295f, 0.675202550635588f, -0.0748462128620644f, -0.747853513216831f, -0.222563643557406f, -0.608884446788701f, -0.0374135649675464f, 0.852579123003940f, -0.585927920129879f, 0.604065857569210f, 0.573072924781108f, 0.816831955879520f, 0.723975232584095f, 0.367887024581694f, 0.765292601085641f, 0.836490699448589f, 0.623434131440044f, 0.743568762340577f, 0.140474444458222f, -0.746327891490507f, 0.700496422194197f, 0.549693846244016f, 0.729372970291116f, 0.728185563682229f, -0.614909046853182f, -0.756209631211223f, -0.530222413502955f, -0.312453162783936f, -0.752364704008701f, -0.634475515424180f, -0.133239439768175f, 0.252790153178337f, 0.760626105409900f, -0.838262213452153f, -0.266093046689486f, 0.549339088324875f, -0.278178592347115f, 0.190458706141960f, 0.906814275056971f, -0.579827980376046f, -0.134191470195968f, 0.244720998349483f, 0.795502128014338f, 0.287019836683889f, -0.906277889518234f, -0.817071933038363f, 0.613378274793081f, 0.518208081766432f, -0.388902790616382f, -0.785778461147273f, 0.574976429920521f, -0.283168065839246f, -0.857322381041868f, 0.424932015236353f, 0.919756642423073f, 0.412896759578072f, -0.976511020897041f, 0.157825653359643f, -0.0606591903280758f, 0.508438714729350f, -0.513115001652116f, 0.881391940997543f, -0.129708782033534f, 0.382462819411800f, -0.538751535594113f, 0.816770663497783f, 0.869013288394013f, -0.728381721932439f, -0.956736333819522f, -0.839107107637575f, 0.394821058517234f, 0.721983518815999f, -0.0847231453556103f, 0.0206545030491683f, 0.414707730497861f, 0.246591855656934f, -0.546187573590839f, -0.578957978692654f, 0.162844799084821f, 0.493731081270802f, -0.765815587549615f, 0.151613093585910f, -0.112883397239635f, 0.879319928900002f, 0.295375250614654f, -0.505370201033860f, -0.635319167339584f, -0.309818465920078f, 0.768627024018538f, -0.544374452091825f, 0.758974060573473f, -0.106050973670013f, 0.508616501970226f, -0.207224226211215f, 0.616842248601645f, 0.688381226662374f, 0.643728558619948f, -0.906982649598668f, 0.526262112978799f, -0.666644270400075f, 0.314806313630502f, -0.292000096972562f, -0.358353880616007f, 0.156344541906829f, 0.637606941586786f, -0.199572501073669f, -0.669369278061572f, 0.237513395315133f, -0.576741807179552f, 0.0750117203638310f, -0.633877533594996f, 0.829285089669934f, 0.622345234313277f, -0.892617583855908f, -0.280449892200797f, 0.241147361581176f, -0.0784016295955696f, 0.414945819313502f, 0.287238318044040f, -0.691458270387106f, 0.597656137422422f, 0.549022082569726f, -0.590776624040652f, 0.666740423918019f, -0.743115212424850f, 0.164036350785269f, -0.229427480781113f, 0.283602991107853f, -0.533993445778340f, 0.185806116700093f, -0.317953364055307f, 0.140412503708198f, 0.280706883979940f, 0.0439806827213221f, 0.176471515460512f, -0.614144204292693f, 0.314194083857125f, 0.519572839644130f, -0.850547081260782f, -0.515460990713008f, 0.353087995032390f, -0.0241014119925820f, 0.269453276643829f, -0.608515317887958f, -0.777818225534647f, -0.834277444316067f, -0.842707175235771f, -0.929547602540323f, -0.884691870945475f, 0.710591809809692f, 0.143423776629673f, 0.797136471728128f, 0.233311155245426f, -0.923169961754164f, 0.627911916101674f, -0.338187201367212f, 0.211044396110784f, -0.443699655795038f, 0.256593551969761f, -0.406688684034041f, 0.364900889856600f, 0.900530571350288f, -0.160476177153537f, 0.0634217008071056f, 0.709241599309354f, -0.789562037599596f, 0.00891621061029158f, 0.801674768895422f, -0.704378031949125f, 0.430576706378041f, 0.796937507044124f, -0.193348850174576f, -0.493924902919358f, -0.935781577118986f, 0.468142331108629f, 0.00965840085728753f, 0.0834398764999438f, 0.599712941235232f, -0.735675950275295f, 0.200152501800787f, -0.751603779675650f, 0.0697488403240092f, 0.300634243862625f, -0.901969784333300f, -0.958816237033024f, -0.754976119377363f, 0.719702182489622f, -0.338038642556184f, -0.703280944186943f, -0.579148694005994f, 0.556115731092296f, -0.920710928208685f, -0.278178108839470f, -0.793795308512285f, 0.916547680808212f, 0.419467216101691f, 0.177932177026735f, 0.682833725334600f, -0.926849803428705f, 0.179045225389745f, -0.209414969718359f, -0.889551871881532f, 0.961659420127890f, -0.250341627298645f, 0.105606170554974f, -0.547860346689080f, 0.845704098204057f, 0.886892635683680f, 0.768134466622042f, -0.954777823503721f, -0.718106389777233f, -0.580779231998609f, -0.0241800476518665f, 0.815063484178525f, -0.351971452344303f, 0.770369263680192f, 0.520886146470712f, -0.236456125482696f, 0.0900173391919312f, -0.00610611501589697f, 0.0986788038317752f, 0.277083194173223f, 0.0877085076786761f, 0.695814138412262f, 0.281021332783082f, -0.701468161850407f, -0.785496560046616f, -0.805623403379156f, -0.0524204125046179f, 0.0836418099696601f, 0.467252832788807f, 0.148967572323544f, 0.314141193557124f, -0.722297309069329f, 0.147068590429361f, -0.868307069306109f, 0.118712645744921f, 0.737896544941878f, 0.897526485681248f, 0.842207508585120f, 0.817408479766998f, 0.522315328909182f, -0.409136979179218f, 0.580654760034574f, -0.384701243761730f, -0.769398544059918f, -0.791317178699730f, 0.357020281620118f, -0.235410423267782f, -0.326332500533018f, -0.416891876268284f, -0.863029987000052f, 0.505171215727166f, -0.728709553380428f, 0.554546891580919f, 0.737429989077498f, -0.355088598334119f, 0.911987317939763f, 0.525846127625130f, 0.851549830104189f, -0.772303673276796f, 0.0421942169353806f, -0.521836640530782f, 0.995279650924240f, -0.186831960875832f, 0.421233670121556f, -0.0891583750230474f, 0.661100169663965f, 0.393809652414978f, 0.346165179707090f, 0.384203760628548f, -0.329281932973211f, 0.446133401546675f, -0.748200766224366f, -0.0275154142375615f, 0.771701580845288f, -0.0177829993094090f, 0.406813206251131f, 0.606021648140155f, 0.218435152341115f, 0.236571855064013f, -0.513495776515847f, 0.729086381137554f, -0.137775825035815f, 0.0320966747364262f, -0.313487802206023f, 0.105472520924239f, 0.423606700821375f, -0.231301628369264f, 0.465218832919270f, 0.379671652150568f, -0.00497780485272159f, 0.509290230688327f, 0.467240127182068f, 0.353587964503845f, 0.390455232684039f, 0.721536288927627f, -0.838922323815237f, 0.827628029266859f, 0.768844149796201f, -0.813963144642386f, -0.797054297232628f, -0.933039367361175f, -0.0723957249866136f, -0.664824147893300f, 0.695914840901794f, -0.206071660300270f, 0.879389414398409f, 0.181872681691416f, -0.582831210733033f, 0.624249199449935f, 0.204959730900228f, 0.354831594370532f, 0.337152636438178f, 0.596132114241829f, -0.295619496794481f, -0.443402055665686f, 0.743995051028396f, 0.543706744165365f, 0.825846155044062f, -0.764982315603181f, -0.0355223730700034f, -0.682467026736627f, -0.914037445162109f, -0.222823484413727f, 0.825323277024566f, 0.0769459194171547f, 0.696453968928934f, 0.760786120466962f, -0.525470048583831f, 0.764981036001869f, 0.458525204937000f, -0.612703584870878f, 0.626016142683351f, 0.284799326870320f, -0.130410894642153f, -0.730659587111424f, 0.0251896513929686f, 0.744421417725379f, 0.481278905427271f, -0.718686189713675f, -0.972110566787501f, -0.178005803066219f, -0.761536801353512f, 0.675177569459847f, -0.613068600254845f, -0.854757540148688f, 0.641823580903407f, 0.112536000301536f, 0.201235170163357f, -0.332623522893231f, 0.602028236317460f, 0.487529253813741f, -0.936537443253385f, 0.932862477850079f, -0.0977461167435834f, -0.485449569929182f, -0.575807340541437f, -0.920527242558033f, -0.938208754460503f, 0.890054000488493f, -0.154888511872567f, -0.106629818916523f, 0.323343252623500f, 0.105328135407289f, -0.837197492121459f, 0.497769113944639f, -0.234127101891878f, 0.840922493788059f, -0.994297350473539f, 0.241966031396186f, -0.241143860453769f, -0.598953146106117f, 0.839112451637864f, -0.639567866338402f, -0.219908091959649f, -0.778137266578287f, -0.201424793310289f, -0.486105622640452f, 0.874947034932591f, -0.131437343585340f, -0.674427373037920f, -0.161007203320351f, 0.215285933912207f, -0.963047650748652f, -0.841020847986178f, 0.259702280444602f, -0.165325097679823f, 0.572379756389254f, -0.435802768396928f, -0.0776125194906274f, -0.0293182206559168f, -0.847945015803839f, -0.576891917046364f, 0.728544652294888f, 0.110676857648527f, 0.760459056611184f, 0.486936926897001f, 0.680603035572503f, 0.330358411271561f, 0.901153157113818f, -0.893323547516767f, 0.268679990552354f, 0.794615743189695f, 0.221637368947158f, -0.0207579360252996f, -0.585634995914835f, 0.587646126395593f, -0.317780705107399f, 0.790321547328449f, 0.251610679655279f, -0.0386445267248654f, 0.881542790650722f, -0.469258891944944f, -0.900544881246558f, -0.344978220866601f, -0.271404539202745f, 0.863631450621357f, 0.805892242474368f, -0.325004362330199f, -0.649692260224921f, 0.535815472185538f, 0.427767946389023f, 0.924517987543855f, 0.571059970962007f, 0.549923246060706f, -0.639468249016352, 0.307213071097954f, -0.885892976847170f, -0.526002656640427f, 0.733743042788359f, 0.186919211020217f, 0.322167483598106f, -0.933484010727969f, 0.307181642341518f, -0.391959805653480f, -0.892298105797306f, 0.100065710151584f, -0.932962740784651f, -0.643536993204857f, 0.200747180046148f, 0.310831344540979f, -0.923416823619512f, 0.440768799148345f, -0.666930667413366f, -0.485487251971431f, -0.0627811951952384f, -0.331082293469460f, 0.0335811939608148f, -0.653610782697787f, -0.320586426505716f, 0.559163070852115f, -0.497363452770543f, -0.329886484503569f, -0.146612217140156f, -0.0265272745798242f, -0.288663397675155f, -0.996138396801714f, 0.705746028666908f, 0.634215549629091f, 0.165248482682243f, -0.110791752682943f, -0.0583711657160508f, 0.704663932851230f, 0.105987046073574f, -0.674234600022039f, -0.852792911043127f, 0.779458558047699f, -0.506163961277651f, 0.661431789813829f, 0.362986600662932f, 0.677673397902417f, 0.909704544299484f, -0.678129611146149f, -0.700854916363125f, -0.954905799366644f, 0.819329178422143f, -0.278866438326573f, 0.240572863896085f, -0.597973444252616f, 0.520707363092687f, -0.891796539359942f, -0.0707113684027092f, 0.730270237241197f, -0.202809887987925f, 0.712903235793333f, 0.815918058519912f, -0.619284883130692f, 0.620432327799984f, 0.215462902206797f, 0.913706499476201f, -0.284266999538807f, 0.137669223817851f, -0.320599930994154f, -0.279885143029947f, 0.0759863610502050f, 0.362519848337183f, 0.0897184432777523f, 0.730407126330006f, -0.715664883515070f, -0.964294244830797f, 0.337668374417089f, 0.563780948124681f, 0.534272089774928f, 0.670003495251274f, 0.976582736706313f, -0.576021162432801f, 0.318863740329612f, 0.374838616807691f, 0.437628782275460f, 0.629331465907672f, 0.800673318445353f, -0.964950925853698f, -0.115288102568929f, 0.581179798077059f, 0.892103220665649f, -0.224009831257430f, -0.486848659265476f, 0.768601825625188f, -0.478996958061453f, 0.987216084861456f, -0.00828256241998737f, 0.443388113322642f, -0.209225960405120f, 0.784392408672073f, -0.821157008960409f, 0.169088259578466f, 0.188648958653604f, 0.796321723736402f, 0.804915614204973f, -0.947435972579018f, -0.320368366702004f, -0.0857043727442930f, -0.229914128505395f, -0.802013870592427f, 0.497444368231634f, 0.791040716463223f, 0.586369970276563f, 0.871236424247704f, 0.770091868124107f, -0.458396647683594f, 0.871149873224889f, 0.753895449519495f, 0.295832468734546f, 0.574616471536691f, 0.384408809311353f, -0.978021020306570f, 0.0397482936794495f, 0.628095200786834f, -0.968059492217325f, -0.404306711220928f, 0.659301030460980f, -0.345766174675525f, -0.0517956907600681f, -0.640289082986305f, 0.965202733073502f, 0.909703156044274f, -0.744545066259015f, -0.676836498528477f, 0.0507393165493961f, 0.394673166210436f, 0.250366706754377f, -0.287411651947684f, -0.521760552601739f, 0.214487178617345f, -0.922260536787078f, -0.970217444063294f, -0.632705652784150f, -0.720016326822300f, -0.506393579710801f, 0.774172771450182f, 0.891546338793249f, 0.559706491124446f, -0.513481979527671f, 0.735727350850420f, -0.207760672132971f, 0.956672164225499f, -0.516696999265124f, -0.846015525317730f, -0.199370940530009f, 0.927580907007946f, 0.669786891276299f, -0.208316500739886f, -0.349932032863852f, 0.382722440637189f, -0.455635180187178f, -0.573852668753046f, 0.237990995216907f, -0.00210628303929439f, 0.846035951941252f, 0.921932267818374f, 0.141873820779935f, 0.871317167610738f, -0.632607355185838f, -0.565801401210940f, -0.959881482283947f, -0.732559764685905f, -0.655277252471118f, 0.136770193226314f, 0.206392768880907f, 0.0946932052352707f, -0.147722827344946f, 0.142504821799194f, -0.891443939735724f, -0.660161817562772f, -0.918683225740157f, 0.524851053279394f, -0.841532325411647f, -0.662931925252737f, 0.450018807591706f, 0.157794014139767f, -0.562525486647545f, 0.604051451992330f, 0.859220943805127f, 0.943321402026900f, 0.511188518123118f, -0.332990520726740f, 0.904709059147998f, -0.336911302156504f, -0.0329301811082998f, 0.307263624236174f, -0.640655394434152f, 0.791676792853669f, 0.450137270831791f, 0.746000232170803f, -0.915436267533878f, 0.976514418439799f, 0.828073391112522f, 0.990695018409237f, 0.419713963781614f, -0.286897378037841f, 0.111527193084439f, -0.956913449095442f, 0.263769440437253f, 0.534739246489713f, -0.918314908283506f, 0.680501951418845f, -0.0258330390798596f, -0.696521999550769f, 0.274590593565720f, -0.821334538131451f, 0.104139627465949f, -0.790104923997319f, 0.399265830301725f, 0.118854169469537f, 0.309552488812324f, -0.961100729890863f, -0.665645274594184f, -0.125767140532335f, 0.377154316156289f, -0.971986633153292f, -0.148225730575294f, -0.801072242848910f, 0.735673216754228f, 0.247753694178141f, 0.759093842520115f, -0.529946694334253f, 0.594235069164038f, -0.801015868726278f, 0.141962211231124f, 0.135473683510959f, -0.0431660672944612f, -0.437176231417910f, 0.467008031415084f, 0.324675317141816f, 0.122578305547357f, -0.0351479470228342f, -0.437236315511244f, -0.822621846670407f, 0.989461679354308f, -0.242059902390237f, 0.800837521050356f, -0.387832478851607f, 0.316362161826139f, 0.602440060427024f, 0.890992007298149f, 0.319686042477150f, 0.930326885903916f, -0.170779817104763f, -0.437602177375177f, 0.835764105962134f, 0.522922752459604f, 0.295156847627349f, -0.857646277751538f, -0.451421990712551f, 0.752856133268497f, -0.826193868550830f, -0.906961130052697f, 0.118621494342013f, -0.627099634988204f, 0.163256363060383f, -0.719362770410877f, -0.576563943780491f, -0.369939711177846f, -0.294180430088591f, 0.868430622614485f, 0.945955651201780f, -0.879259966782947f, 0.376142233233261f, -0.549019623646418f, -0.366403875933169f, -0.631308623984507f, -0.398270064613022f, 0.631780765950599f, -0.497821177556814f, -0.0754938097555216f, 0.358298259390762f, -0.438971283619577f, -0.835962846436280f, 0.771544885338102f, 0.132031497593111f, 0.0964144932127649f, -0.171144812197942f, 0.734241841669664f, 0.773828279651661f, 0.591442573315395f, 0.449840299498767f, -0.249196666141921f, 0.910274822633449f, -0.623687862912847f, -0.954398427932048f, 0.700975370671540f, -0.128268698036002f, 0.723971772247224f, -0.239872317271662f, 0.599101633280873f, 0.323504979356466f, 0.726076237951951f, 0.775013638477775f, -0.736157118505210f, 0.681129332563739f, -0.989456914597076f, -0.860559243921100f, -0.652547050354339f, 0.227533741410917f, 0.263244425371628f, -0.412800042549063f, -0.774547399227093f, 0.959749220773555f, 0.0285018454625012f, 0.0260964660594436f, -0.817249773797516f, -0.275510098931589f, -0.957071090655421f, 0.755874233806472f, 0.0601247360044190f, 0.155148678178749f, 0.744458452388040f, 0.206143083045583f, 0.405575258734775f, 0.591273066531951f, -0.286358679634110f, 0.168522523380964f, -0.0740663582251186f, 0.991796969736415f, 0.00304472789286958f, 0.0955103281360055f, 0.595292305224677f, -0.633460800851610f, 0.969720344590438f, -0.788939516987962f, -0.690852963213444f, -0.751849610482179f, -0.454105756229298f, 0.527652178438853f, -0.249156091787771f, -0.395486634371019f, -0.586329259469701f, 0.774216673365643f, 0.000796185912973479f, 0.753872935709907f, 0.691883261316931f, -0.599798140130743f, 0.140718954973018f, 0.400016581571111f, -0.412934563119652f, 0.782683275869451f, -0.837415681080234f, 0.503344297140354f, 0.443222186121185f, -0.869067764953740f, 0.891507832007671f, -0.258782538717313f, -0.592111951047753f, 0.542828422857983f, -0.959476625230936f, -0.373353196174649f, 0.558975637763876f, 0.848608638566440f, -0.861701716955403f, -0.937645215971517f, 0.0456695238513540f, -0.643462752057364f, -0.194887894642735f, 0.576940690214110f, -0.889414400002951f, -0.120401270393403f, 0.581976128201341f, -0.914549817300516f, 0.619675229253819f, -0.446355411157033f, -0.686510097388917f, 0.199022704414501f, 0.0679083509214176f, 0.939286059873160f, 0.919854436895475f, -0.921420499961796f, -0.933865152326639f, -0.173428453947994f, 0.0481843697148709f, 0.282408667923603f, 0.411093542307595f, 0.332739798472214f, -0.539048264159821f, -0.704491312083244f, -0.502163632960363f, 0.955228344617550f, 0.620064399129425f, -0.470222569036376f, 0.754614931250763f, -0.616308595262807f, -0.914574682979899f, 0.624066330640082f, 0.836911269770582f, 0.913639510454430f, 0.653228461676548f, -0.269928008555249f, 0.313006679186127f, 0.984676487220296f, -0.492012769698267f, 0.956868299674771f, 0.291679581317590f, 0.0391808383867289f, 0.572884371819903f, 0.0424011452585180f, 0.955486550514640f, -0.402317209279260f, -0.606465037288902f, 0.547296561663929f, -0.262634118959448f, -0.555413611714328f, -0.328781770154915f, 0.145794994289916f, 0.141260540582646f, -0.451655981927315f, 0.305553535897825f, 0.828724940454557f, 0.263943455052409f, -0.609183422737396f, 0.691170220321907f, -0.372701931956834f, 0.750237424665146f, -0.249353280856890f, 0.379870697565802f, 0.385751069018950f, -0.515117494253264f, 0.716937491491901f, 0.343749563024118f, -0.462962268225808f, -0.542579750084113f, 0.865163879545508f, 0.348358741505572f, -0.309602240547849f, -0.0504864877295679f, -0.822856269672862f, 0.199343960697129f, -0.790668167630170f, -0.0910655952543342f, -0.0243531696455832f, 0.832501734319368f, 0.604933598167068f, 0.899053047900036f, 0.270668041381131f, 0.523691409964688f, -0.0841567002292820f, -0.844392287920523f, -0.910987838261586f, -0.470654231510287f, -0.103828495683496f, 0.253788695977573f, -0.103172947809401f, -0.339896741661867f, -0.447251997825083f, 0.217200476817515f, -0.474840886373359f, 0.227876267254650f, -0.851351819181938f, -0.902078585170911f, 0.445464427415683f, -0.842484493463611f, -0.141606736723087f, 0.104224619207891f, -0.554900879859470f, 0.818556374444811f, -0.832710463532413f, -0.284760316465868f, 0.697962734672817f, 0.235137001970259f, 0.538298155374871f, -0.598477541924834f, -0.833959821954974f, -0.164556670763502f, -0.443902305525605f, 0.484290717235912f, 0.319356252041167f, 0.0834544406255109f, -0.839174383593280f, -0.514784811627172f, 0.466424623987191f, 0.597641402168886f, -0.344706573843316f, 0.346954604803744f, 0.150560726232471f, -0.963838773301094f, -0.210406119881130f, 0.740751216241446f, -0.519896828058978f, 0.882277568799242f, 0.982734995306564f, -0.691486807580351f, -0.120653164608028f, 0.263039860106709f, -0.472131671311566f, -0.469155525952548f, -0.562705921604020f, -0.737502946123759f, 0.151863404645485, -0.367233093688652f, 0.149585386378220f, -0.152980596399920f, 0.572826412281344f, -0.498718037086228f, -0.0794332639424211f, 0.659760386972575f, -0.574814983564964f, 0.451329484188896f, 0.473066930128670f, -0.135151886005125f, 0.379571405476121f, -0.308712078323501f, -0.136843563834117f, 0.395667583713552f, 0.196238140324408f, 0.588147058383512f, 0.770505301611929f, -0.865188840370228f, 0.266437694165002f, -0.428134513764013f, 0.661967260527446f, -0.752421375452379f, -0.556389852423621f, 0.424944298468302f, -0.480554454112605f, 0.916159659428765f, -0.112147362457396f, 0.363475545209813f, 0.698805683596358f, -0.862382341730295f, -0.489415523853276f, 0.453056404353730f, -0.606183761884457f, -0.00869682692408680f, -0.288739722701460f, 0.487988005841341f, 0.566870040344668f, 0.0894575138005909f, 0.887832293799319f, -0.0981274237649674f, -0.279935090781560f, 0.506891141525948f, 0.952901245338457f, 0.458002767525373f, -0.569410776125351f, 0.849518291873527f, -0.585020953514368f, 0.676037258640625f, 0.299076264841081f, 0.911385441491479f, -0.954959555659035f, -0.681285607891366f, 0.631368118385947f, 0.522268523899537f, 0.900701101674748f, -0.647701850365577f, 0.567960815808216f, -0.138958982219446f, 0.267024801687456f, -0.975771109955874f, 0.314682157086949f, -0.378801381286130f, 0.665990927256163f, -0.573674360032848f, -0.860450785684384f, 0.516581474078532f, -0.190844183471714f, -0.451971355445856f, -0.808113003973650f, 0.860446168028895f, 0.377778958059242f, 0.126949039950121f, -0.892203650250330f, 0.572503460980517f, 0.975224974978800f, -0.202312370945465f, 0.500665599343084f, -0.0510413720986291f, 0.353231752436633f, -0.805555931906752f, -0.199761377956955f, -0.829487282239605f, 0.0282459088867508f, 0.814545057118991f, 0.557652277921578f, 0.613951716518862f, -0.678811366342345f, 0.896500288318877f, -0.627622562398925f, 0.802545092571611f, 0.211382709497062f, -0.979380222642662f, 0.826784411456488f, -0.670689878657734f, 0.788878029765924f, 0.137070906151783f, 0.901907287859132f, -0.526217367070263f, -0.545043827128876f, 0.494756249972086f, 0.236657948774128f, 0.156603327087660f, 0.516397244064118f, -0.325837179590292f, 0.460683385171580f, -0.196022953760504f, -0.441996357332195f, -0.808932369852494f, 0.291980108741838f, -0.833583979826152f, 0.365574438479475f, -0.797139524158001f, -0.0649288183732912f, -0.000696491493834994f, 0.100125393693922f, 0.598035350719377f, -0.312548404453564f, 0.0414605409182345f, -0.675913083156432f, 0.236245026389435f, 0.550464243484224f, 0.193366907856750f, -0.903654015709839f, -0.00993172527377806f, 0.0180900754210873f, 0.880678290110106f, 0.166539520562349f, -0.984509466189118f, 0.810283124477894f, -0.925371921448173f, 0.193528916069728f, -0.748644561903135f, 0.534508666819454f, 0.364436869280188f, -0.386979667637943f, 0.427958998441480f, 0.362750270039032f, 0.420886957715891f, 0.0300301961707390f, -0.655220626875711f, 0.0504522662127427f, 0.472640818703213f, -0.417745816013639f, 0.0689992794158720f, 0.461232479061866f, -0.483517586427718f, -0.411463769964024f, 0.622740736364726f, 0.659687134578680f, 0.243900134982579f, -0.684356227282321f, -0.688699031115733f, -0.316032121634021f, -0.644296362948831f, -0.236133265458216f, 0.880259454885881f, -0.956880609581177f, 0.737775899964131f, -0.529059297472703f, 0.794119601436042f, -0.375698158660466f, 0.493447663117292f, -0.752511119115434f, -0.941143365329844f, 0.610101048864035f, 0.253791011658991f, -0.369994602049336f, -0.697364270085742f, -0.681360550250048f, -0.571943442128960f, -0.749697324128684f, 0.611997629275096f, 0.892727938106141f, -0.440225399106758f, 0.00196047981855352f, 0.951252158369648f, 0.0351885308766962f, -0.471806546113710f, -0.657231535594911f, -0.0873481442406481f, -0.0341288006282565f, 0.579184398564974f, -0.224334624306026f, -0.298557652719061f, -0.509401519638379f, 0.188853505083675f, -0.321619146497229f, -0.613159956450671f, 0.570042044631281f, 0.699213203307007f, 0.537439231469861f, 0.529440733283839f, -0.744527226912905f, 0.362949055807175f, 0.529758698714545f, -0.114804719889245f, 0.991089489396930f, -0.186716454683287f, -0.218189173574106f, -0.0493780858124198f, -0.928812411399224f, -0.101855573638590f, 0.454268528366586f, 0.617591620012079f, -0.197519518988231f, 0.0973277590468935f, -0.185672509894105f, 0.649922648337967f, -0.896862900376972f, 0.594999589349510f, -0.746978997769556f, 0.590642952628647f, 0.935109901616311f, -0.293310684054096f, 0.783281817912060f, -0.189898897214222f, 0.414859016240278f, -0.0858574647662298f, 0.0810260863380805f, -0.633024441577653f, 0.248442861097829f, 0.984586601784679f, 0.982811638387854f, 0.547456083836220f, 0.476239638753291f, -0.897709902882279f, -0.208045489357872f, -0.860637131636973f, -0.496740558564284f, -0.944185351410090f, 0.157610983944341f, 0.975214099838643f, 0.550265718083095f, -0.630360326400067f, 0.672420341653334f, -0.897139264107564f, -0.670556423663785f, 0.298764071000339f, -0.310465384759529f, -0.978153640586955f, 0.189785151994709f, 0.929291975296760f, 0.758271912876084f, 0.806829662560108f, -0.472787451147715f, -0.802032434276146f, 0.455809631085663f, 0.985520713417984f, 0.739637167649794f, 0.311705106454777f, -0.120539152808323f, 0.977785717545631f, -0.848554870988208f, -0.281179241544089f, 0.931102239520177f, -0.255243432382956f, -0.284952242030900f, -0.189341152192864f, 0.647573166562597f, -0.474203015584843f, -0.545915610099538f, 0.672696420688916f, -0.239274489717776f, 0.956544960216021f, -0.0858024073600807f, -0.758223415922611f, -0.00817763648068581f, -0.500893489164054f, -0.669386983409311f, -0.344450617815217f, -0.728051392792875f, 0.804121117816188f, 0.00718436691280910f, 0.195237363230272f, -0.472485206728796f, 0.642070241911164f, -0.272384993247314f, -0.731715323915071f, -0.791266589031733f, 0.0339783427570857f, 0.0696513783219659f, -0.894169486972683f, 0.00234016305501483f, -0.0403382685361653f, -0.943600572111266f, -0.788181603936192f, 0.851406365407377f, -0.100015982664501f, 0.145502229793638f, -0.528736628076536f, -0.0313760382570432f, -0.662221611141088f, -0.885722031379862f, -0.744257140212482f, 0.524976313116033f, 0.186092035304635f, 0.181669793648209f, -0.606482674165339f, 0.849303544554227f, 0.226118051135263f, -0.690025550727719f, -0.256543384397548f, -0.207714017766381f, -0.447913202664626f, 0.375270273897879f, -0.884312586292038f, -0.0838720085819762f, 0.969898436757285f, -0.736808033249456f, 0.668875150485586f, -0.599937439969920f, 0.470077288925414f, 0.903135367105719f, -0.895619185450694f, -0.637694108244489f, 0.572669535020987f, -0.696211470281632f, -0.820577518545193f, 0.937364674938455f, 0.422458818039761f, -0.593964370461091f, -0.586264791612426f, 0.0282373486927521f, 0.298051147134121f, 0.592825359583763f, 0.716195674857467f, -0.684008410968338f, -0.167523841045924f, -0.370794208549223f, 0.768054740581884f, 0.997835641681024f, -0.366262133888883f, -0.523114034556271f, -0.457946740456489f, -0.530941146838744f, 0.298744841822404f, 0.390761228562591f, 0.0871171594445448f, 0.764002674223649f, 0.233966808661423f, -0.116573523634048f, 0.426118986433559f, -0.255934695328716f, 0.302314199650152f, -0.254971729124577f, -0.330865677738578f, -0.0840307537517577f, -0.711910586170446f, 0.622585361690409f, 0.367595248366733f, 0.422102667722561f, 0.269580206097961f, 0.707083822001774f, 0.625367208198523f, -0.729594790471199f, 0.708679674727951f, 0.00355767003560614f, 0.379158300246371f, -0.688791438249760f, 0.261637457245975f, 0.704008781391790f, -0.917586017594177f, 0.886443038824615f, -0.923559496787343f, 0.360365726214756f, 0.547058288460181f, -0.279853192856989f, -0.996331953899586f, -0.323735921605962f, -0.618788277975037f, 0.314597206161166f, 0.106380963133907f, -0.235044228453968f, 0.0406899091091886f, 0.687339428801573f, 0.344837805924860f, 0.123214914005620f, -0.735264225932133f, 0.0396243248944774f, 0.270602083588730f, -0.316104623194235f, 0.201800731173529f, -0.348987679395254f, 0.994312100135549f, -0.986073454140000f, -0.787571177818193f, 0.508460947811657f, -0.443663972776222f, 0.800303477136838f, 0.712158443474503f, 0.958364684407633f, -0.0512343510942759f, -0.391095518504938f, -0.291911155637644f, 0.721770656984705f, -0.163541232110535f, 0.0366644501980513f, 0.700853097239887f, -0.508089885354834f, -0.375072588159867f, 0.161585369564288f, 0.686325557438797f, -0.113188612544717f, 0.859354598908873f, -0.723198679696606f, 0.398879124170303f, 0.139357627051752f, 0.484780500073663f, -0.0437501438537016f, -0.868783676783105f, -0.147865612288567f, -0.116480069295514f, -0.986846049950927f, -0.859405305954576f, -0.631359938031082f, -0.0310065270390489f, -0.288382201791710f, -0.500960878568203f, -0.805633068309090f, -0.837604329816134f, 0.0325253228618525f, -0.538953832190091f, 0.913844038280417f, 0.681967460199437f, -0.656775429658090f, 0.922492558885196f, -0.689527254640680f, 0.688263898240070f, -0.225450858342925f, 0.0287239965989763f, -0.407744573364816f, -0.477326718671529f, -0.780374037627418f, 0.500400378743065f, -0.532646941279704f, 0.999679272201893f, 0.136003002234441f, -0.811267727922649f, -0.585019862511894f, 0.125465493193590f, 0.203160759437510f, -0.101322607820275f, 0.543784310894398f, 0.630139383695983f, 0.775322422120693f, 0.229262447827729f, -0.656821799421711f, 0.795940998463793f, 0.263281283116320f, -0.377237794697631f, -0.714267543277316f, -0.161924029976839f, 0.804294011825499f, -0.500488029613262f, 0.716655543045374f, -0.709565530287520f, -0.260746944768714f, -0.496886497176178f, -0.896154699339640f, -0.891352204187934f, 0.0589172685048254f, -0.952496908556348f, -0.543314015084183f, 0.0724005345282401f, -0.132089156895576f, 0.694937364018361f, -0.884509342587775f, -0.944587795707932f, 0.346949362800262f, -0.587900264454839f, 0.531217960795664f, 0.404240620498887f, 0.182769547944683f, 0.804826966991636f, 0.601398794220406f, -0.767933817870427f, -0.329693990599177f, -0.880648189418561f, 0.0370834298504716f, -0.405270662847564f, -0.551993194163015f, 0.357335885219159f, -0.442910616174561f, -0.978355051725551f, -0.638907517841606f, 0.266841057307734f, 0.778698832906031f, -0.967180516636130f, -0.772940622039654f, -0.268706136695081f, -0.326082261974967f, 0.0386785617389067f, 0.576293286973562f, 0.446884000380730f, 0.396703264915684f, -0.718633572608705f, 0.586041202195072f, -0.791039546767268f, 0.556638124682382, 0.728711593864679f, -0.576551104247230f, 0.690227524206044f, 0.0451432373341216f, -0.0569690667958747f, 0.877674150343795f, -0.268602876493051f, -0.770720641807978f, 0.630269600593677f, 0.801702094819180f, 0.177071915997341f, -0.0764831522886398f, -0.476930347674815f, 0.0196833210809626f, -0.566188434097295f, 0.309890567123613f, -0.642682312350471f, -0.645839718540077f, -0.985031719881713f, 0.153028235575708f, -0.446724738384881f, -0.616280949001367f, -0.306418078463084f, 0.313048512921978f, 0.944732667717825f, -0.292311689238647f, 0.263616032352334f, 0.776777395064071f, -0.529182830991988f, -0.418996105801001f, 0.286960890623362f, 0.588336822287104f, 0.268219370126612f, -0.696727535489037f, 0.806089151192541f, 0.0396168299208206f, -0.613570658239778f, 0.358002315998429f, -0.0576147175733950f, -0.859664908314368f, 0.930793190364908f, -0.108955403960031f, 0.640347446939098f, 0.0301817512477458f, 0.508435547839785f, -0.774928250619894f, 0.254548271045827f, -0.192551571812315f, -0.401867317012389f, -0.136220787532581f, -0.480363308055205f, 0.146599399729624f, 0.225767301672040f, -0.207158678688912f, 0.763491487133281f, 0.161192803873192f, -0.574968151683314f, -0.454043408746924f, 0.427131132989065f, 0.170648543751820f, 0.0690597676805780f, 0.0360172652133248f, -0.244429817416531f, -0.973014074152018f, -0.172642279134011f, -0.798684796670922f, -0.622626145444778f, -0.743408670602069f, -0.316057396003030f, 0.908608689971065f, 0.948356574904685f, 0.573858539226522f, 0.457065605245418f, -0.246203048690671f, -0.750525340546383f, 0.612971646035183f, 0.951528788403619f, -0.529776510809815f, 0.0886901849846271f, -0.0254136796699882f, 0.978897595553096f, 0.293893753097695f, 0.620217642132267f, 0.862352989549627f, -0.379040515436326f, 0.790157871471479f, 0.147151952442201f, 0.688271487774812f, -0.897847532497188f, -0.0355337105008888f, -0.850253422176695f, -0.0354384862653523f, -0.625796807949394f, 0.851730076897135f, 0.294773618291289f, 0.834287219330433f, 0.0758749738551283f, 0.912613321307355f, -0.326698079590551f, -0.844748577890143f, -0.685263599922107f, -0.197029963909655f, 0.591416614029013f, -0.130921826828109f, -0.524292687689084f, 0.356220524225632f, -0.150091552835503f, -0.935232109847821f, -0.302103008478127f, -0.998557516519010f, -0.477012685701094f, -0.882343341754284f, 0.210797034143964f, -0.963566378978947f, -0.855600913755685f, -0.790231379847513f, -0.625235937382084f, 0.106405105589857f, -0.760544427202586f, 0.0103124858505332f, -0.610157345750845f, 0.968354521575116f, 0.602472069136318f, -0.216458111191680f, 0.935180184275450f, -0.369261245032360f, -0.289325139062185f, -0.772389696964545f, -0.345513639348744f, 0.135539262008296f, -0.747409495863324f, -0.849724942811800f, -0.739393030129744f, -0.0301380087411172f, 0.373808817820448f, 0.760444548005323f, -0.365739960428504f, 0.121859476627292f, -0.719257541809299f, -0.136914676340304f, -0.178479405732130f, -0.336676444507223f, -0.795056125367297f, -0.0872862684496700f, -0.950510559362909f, -0.395266512078238f, 0.636773305385949f, -0.150667208767723f, 0.534401287220298f, -0.349371424663528f, -0.784729313810243f, -0.0510904599006878f, -0.938702345462904f, 0.616929636007953f, -0.228578318449040f, 0.239101663221907f, 0.0390879233281141f, -0.294705782740043f, -0.847928516841798f, -0.0480433695823821f, 0.487351505367245f, -0.820736333448301f, 0.128692585024021f, -0.305133215914817f, 0.344900079505924f, -0.764316168982242f, 0.717529584295197f, 0.655848670831377f, 0.479849611138232f, -0.107624564628078f, -0.345816374073252f, 0.0822414215758816f, -0.0120870567528208f, 0.475870901669481f, -0.00594923432583361f, 0.869227669945672f, -0.262862047504512f, 0.272430399676396f, -0.734262318791166f, 0.980593493214018f, 0.110413869658192f, -0.732486564250777f, 0.470756873196238f, 0.897133387901917f, -0.151953973158384f, -0.591296220619271f, -0.113167158942796f, -0.103020520738423f, 0.220384226627647f, -0.0570027879342681f, 0.0923157145066511f, -0.523010309215342f, 0.385053964060568f, -0.223938668105458f, -0.0566497019068211f, 0.636390081595965f, -0.753651530578004f, -0.765450358896516f, 0.790370075460245f, 0.622949415286967f, -0.0947634056426396f, 0.122381201893998f, -0.138573523511105f, -0.544298107235542f, 0.535416341314523f, -0.341107295330707f, 0.266262786345860f, 0.620108481133049f, 0.190424987800150f, 0.978559599202704f, -0.925772919482004f, -0.300038300695816f, 0.963372836978511f, -0.501235224357981f, 0.828375446308031f, -0.595716120481773f, -0.889271354193173f, -0.389843123593065f, 0.659433696092409f, -0.633476165557619f, -0.708607689555741f, -0.737738480460783f, 0.985245299432648f, 0.976853985813928f, -0.863072444190232f, -0.785830171723126f, 0.309433061520758f, 0.166813366328975f, -0.552916412621405f, 0.0385101740167735f, 0.445866961855263f, 0.222557362424800f, 0.0710515871571971f, -0.368563489700928f, 0.317406114361191f, 0.326902000037272f, 0.868261309598320f, -0.897838476369198f, 0.664364291232529f, -0.373333343843574f, -0.599809263387549f, -0.411236387818613f, -0.118186587264933f, 0.544960929851182f, 0.395925813072269f, 0.337332244255533f, -0.0195528742963547f, -0.580383437020279f, 0.0779554182143842f, -0.902635825594202f, -0.821554429188969f, 0.869996816042779f, 0.646142135585380f, -0.0824693320525758f, 0.643317857725100f, -0.903892480205129f, -0.457595546004975f, 0.540461917564665f, -0.467530238695992f, 0.107497588388074f, -0.122360487746121f, -0.276968072230331f, -0.436413500733568f, 0.0719555518906898f, -0.794937479672675f, -0.641344733876686f, -0.934734152781945f, -0.0610463967348016f, -0.302623058375597f, 0.281116298309257f, 0.557459622053789f, -0.350054779110337f, 0.681853624031498f, -0.0454067482892435f, -0.897204174835461f, 0.0289327275291300f, 0.664312739864751f, -0.368814604980581f, -0.576946854776660f, -0.187886132141311f, 0.424385580259236f, 0.257994303715228f, -0.567650112011742f, -0.0453371545575014f, -0.362909825264387f, 0.450095578912812f, -0.713870209574945f, -0.956583539581944f, -0.969891699048729f, -0.417755773448598f, -0.230738535348142f, -0.153353095644968f, 0.539368458440622f, 0.591116036659417f, 0.779095541288385f, -0.578525766017613f, -0.587777137316663f, -0.301051260910212f, -0.319655538885669f, -0.343495369437935f, 0.908167583226333f, 0.764220052027033f, 0.0536418758245909f, -0.0529753241803754f, 0.249066042857931f, -0.840152142252005f, -0.529971459254312f, -0.449462194610696f, 0.467144819001113f, -0.500103828192601f, -0.758390449663076f, 0.369740436821770f, 0.189153926151852f, -0.188283227959439f, -0.427563759945909f, -0.186773725840825f, -0.00989853573399446f, -0.783648829817413f, -0.626450875837851f, -0.328015817185970f, 0.760383401930071f, -0.00804531008117837f, -0.982799468341000f, 0.392730506677802f, 0.117799138097530f, 0.351088974844522f, -0.259750164530173f, 0.776495358243216f, -0.703059519879109f, -0.362866233240751f, -0.421345310205860f, -0.818968876330675f, 0.936887497269786f, 0.713300632813635f, 0.916608801523944f, -0.147818975792564f, 0.317064988534009f, 0.885779227314381f, -0.897706599297367f, 0.685423132064732f, 0.907830438936990f, 0.0636614655685575f, -0.423018627861747f, 0.411565657893159f, 0.911060408474647f, -0.617833142759668f, -0.709543522964145f, -0.817633731247023f, -0.252433983274424f, 0.160456393103956f, -0.160765428576997f, -0.622001061437904f, -0.470257555319641f, 0.790643274059634f, -0.648181378655916f, -0.828694900506363f, -0.0234091767546987f, -0.562865077760768f, 0.369299949506391f, -0.423850142805423f, 0.520699811923658f, -0.877662359466779f, -0.739844704434180f, 0.300520939787139f, 0.0655718600121620f, 0.970843358712180f, -0.634231195336845f, 0.324880041395596f, -0.479089635857354f, -0.196422753715449f, 0.568762754402869f, 0.699215376070842f, 0.445741923102597f, 0.679868900756090f, 0.107609859752086f, -0.980983474461865f, -0.788419140653730f, 0.0696289436185713f, 0.00330944186568516f, 0.392265626672398f, 0.803469542460994f, 0.131029913648810f, -0.845408454497170f, -0.754797811352229f, -0.824208086798235f, 0.510072775586974f, -0.809491727769575f, -0.0228491196350333f, 0.920014947791232f, 0.441066319826495f, 0.969846842038360f, -0.199024726691046f, 0.886564290041856f, 0.203997575245743f, 0.481547443573126f, -0.637742489331117f, 0.0664642070998316f, 0.109187062068770f, -0.952676759642045f, 0.309247049771982f, 0.880534651306060f, -0.269363005485603f, 0.280012695899358f, 0.853031642671923f, -0.216236966392235f, 0.903180305900435f, 0.837949615815047f, 0.748563816043584f, 0.266735542018788f, -0.685176037557414f, 0.505893787666761f, 0.977721983069541f, -0.667151469253569f, -0.451774081267849f, -0.385755850727233f, 0.681037251596535f, 0.550130384863457f, 0.704080312734731f, 0.519624533199220f, 0.789651392050294f, 0.176325856625025f, 0.684011432098839f, -0.469125761119035f, -0.841814129063957f, -0.901473334652527f, -0.117747872709914f, -0.608533033968273f, 0.199709646080986f, -0.349430401438670f, -0.435162733168206f, -0.368150014673779f, 0.699084004342174f, -0.446068942643995f, 0.197420740774886f, 0.524893584115327f, 0.706475758890142f, 0.912020785879679f, -0.820472223153770f, -0.334742316079635f, -0.851724976994477f, -0.702164662784812f, -0.649654462810552f, 0.411435475616403f, -0.0438368033650360f, 0.799231452421757f, 0.713371883779316f, 0.252437083518609f, -0.685658163265283f, 0.0734649179831324f, -0.400549431226783f, -0.415602545578540f, 0.233864615718965f, 0.828846528739923f, 0.606577491175688f, -0.266016048272811f, -0.619106744484090f, -0.690853262778644f, -0.503499724631377f, -0.409761822901473f, 0.0576293548519007f, 0.551582021066584f, 0.132631452787255f, -0.838228405334512f, -0.107475742619267f, -0.875306852866273f, -0.184700469068763f, -0.317074087896838f, -0.580912620700556f, 0.453916157844897f, 0.690470988649940f, 0.712835197480083f, 0.314786689622726f, 0.759835688452120f, -0.671090442836235f, -0.408277610289776f, -0.815988422173708f, 0.227854929660384f, -0.0482646895577266f, 0.968141192561708f, 0.373896367655818f, 0.820435826598941f, 0.817746838197885f, -0.0970819110331989f, 0.679170154451559f, -0.577986561676471f, -0.0523570914231941f, -0.776930151133931f, -0.560456597170701f, 0.927747720961181f, 0.0350177837302503f, 0.844938034137843f, 0.00849044473190053f, 0.325089161670337f, -0.851825175889265f, 0.835251667623832f, -0.266397917890485f, 0.108463887056499f, -0.817868888235156f, 0.590399913800720f, 0.699274619715208, 0.200782223352391f, -0.936155874445214f, 0.218471971175575f, -0.890402779861849f, 0.268496441855317f, 0.881231954583528f, 0.279360358017994f, -0.492400368838405f, -0.894376670076375f, 0.585129064098519f, 0.340135248071744f, 0.455880107692993f, -0.861081993524584f, -0.303321115935151f, -0.562781799622214f, -0.526041750296426f, 0.999581943964160f, 0.249814139040315f, -0.0537475603822974f, -0.845239239849439f, -0.874024176808607f, 0.997751771128387f, -0.861617607547820f, 0.671357923629889f, -0.687974310115279f, -0.969462039056016f, -0.448304961870341f, 0.713064428261850f, -0.00718668165564318f, -0.450608596544700f, -0.106059234376561f, -0.591961308554238f, 0.588633089685867f, -0.755341317752403f, -0.542715401462936f, 0.759199260356047f, 0.0297710796506234f, -0.997343196630657f, 0.574076752994254f, -0.696719940193256f, -0.852227517176613f, 0.906332566627663f, -0.171801252847090f, -0.925131151948528f, -0.0212194634560026f, -0.940316444070044f, 0.262965279952363f, 0.902198615594563f, -0.265057066430189f, 0.161983092277652f, 0.0181345459457500f, 0.467973650469608f, 0.857351800575040f, -0.889882538061811f, 0.728868283859490f, 0.671187732362764f, -0.296882575397444f, -0.793099233276668f, 0.335561922676737f, 0.0671874495572633f, -0.0857142329385701f, -0.352870876674233f, -0.119927139078065f, 0.814127111105761f, -0.323910302649634f, -0.313495077982818f, 0.0690526899468447f, 0.877155536890319f, 0.768040884649443f, 0.158910636324140f, -0.824414709871474f, 0.00718921022841235f, -0.868917281154898f, -0.564967532196669f, 0.206261416621150f, -0.0699574404456100f, -0.0547095858591442f, 0.811674902353136f, -0.562993920383635f, 0.441212008804309f, 0.917951119557396f, 0.915571961092301f, 0.0901952529553498f, 0.614118141118295f, 0.760473529905706f, -0.566505475760865f, 0.00880029006400429f, 0.975626259597421f, 0.370738159620831f, -0.0242162976348563f, 0.828887690189252f, -0.665240810020082f, 0.00123256686221063f, 0.184020074202841f, 0.829917510366750f, -0.447854906466885f, 0.529356328938248f, -0.995192699858126f, -0.843748622724646f, -0.422765372440245f, -0.386179414096638f, 0.206325400140261f, -0.369817591904938f, 0.266933785902425f, 0.892617584642659f, 0.740018647415220f, -0.481907279471296f, 0.248268418729551f, -0.382770749117505f, 0.974424303757207f, -0.879320252286332f, -0.0294961755317245f, 0.638693329623790f, -0.765127178629299f, -0.160881380476610f, -0.725001019123526f, 0.00294709357263234f, -0.701949969294570f, -0.708933381768328f, -0.463893635537772f, 0.476650147791524f, -0.206043208566879f, 0.223011684523516f, -0.258637160422673f, 0.206325908651728f, -0.432336904344548f, 0.921979975841259f, -0.944396630315761f, -0.00680582426415510f, 0.319263487872783f, -0.836389324192867f, 0.111532890274445f, -0.938142383682239f, -0.637288670131655f, -0.834211558255576f, 0.251969378874330f, -0.970874587083192f, 0.831662411079802f, -0.446568187924869f, -0.659109068071113f, -0.877869176622375f, -0.890670252448197f, 0.477602927742628f, 0.324737705007923f, -0.147513413112549f, -0.186594638422632f, -0.282864808082840f, 0.745093922271927f, 0.915500859154332f, 0.0421588655873384f, -0.483320910754088f, 0.00503734690385604f, 0.555792895688253f, 0.129412601050279f, -0.229347983583150f, -0.680101211823600f, -0.866063899229274f, 0.437769924839021f, 0.133958234316391f, 0.589233411145099f, -0.498053917701437f, 0.180863681584405f, 0.525955777469479f, -0.581250985307273f, -0.327934857804250f, 0.482381204171926f, -0.867703472610278f, 0.833733008515087f, -0.607761820334944f, -0.758512235503178f, 0.0380785706067470f, 0.719862150842292f, 0.651283470517919f, -0.614218162858801f, -0.239754124815405f, -0.733992057859951f, -0.422541764223845f, 0.951215428883086f, 0.882569470276544f, 0.937054481646402f, 0.184532408731968f, -0.104097666585483f, 0.693277433170057f, 0.800241936558839f, -0.998230532922071f, 0.259835639125661f, 0.562745639592536f, 0.220441127510705f, 0.313735993201991f, 0.330940415696351f, -0.602872424656300f, 0.841677792852844f, 0.749701489563795f, 0.266727039860087f, 0.696379094133993f, -0.430719144952456f, -0.276768289732264f, -0.0872580230244173f, -0.722033206227688f, -0.837309584159114f, -0.629739366225350f, -0.185692585028452f, -0.110619837317415f, 0.515881116042359f, -0.105875685978079f, -0.513700186568578f, 0.961245417898430f, 0.655513716233953f, -0.0921704793645632f, -0.694925472850399f, -0.872174817305748f, 0.0307133806779607f, 0.531120672076921f, 0.965271277398122f, -0.00974420246777163f, -0.497322783064087f, 0.693565685926388f, 0.546918707342947f, -0.230039497490898f, -0.316024461029338f, 0.684231559582941f, -0.306362794944468f, 0.861366189035942f, 0.378922635334764f, 0.259443877770437f, -0.838617128408830f, -0.205350631644011f, -0.139772960377519f, -0.192918167939180f, 0.602404904043886f, -0.537407583974730f, -0.877007125624351f, 0.361539942609439f, -0.732030207831016f, -0.488792995226420f, 0.612591017966442f, 0.567185560938756f, 0.195543595335781f, -0.428955670554558f, -0.666590144318038f, -0.702467396810860f, -0.894350832807439f, -0.0620405855731709f, -0.583114546325259f, -0.482155957064968f, 0.212152442925647f, 0.112603107288251f, 0.0683986906619714f, 0.639176340917929f, 0.642610005510521f, -0.708605273163374f, 0.739594669131005f, -0.492786220480274f, -0.308196102291547f, 0.918748221553053f, 0.186736140989674f, 0.438437026242591f, 0.638769573344929f, 0.928896220524135f, 0.579945520523175f, 0.218608554904045f, -0.526070140579576f, -0.140303420071590f, 0.304347769360423f, 0.488123173638490f, 0.987207018313181f, -0.536397951752998f, -0.553296120219359f, 0.184294880372153f, -0.101502970339396f, 0.287041514309517f, 0.658172721877726f, -0.270141883431914f, -0.0196021946303913f, 0.000779126872975988f, -0.0500294515684538f, -0.588505226599557f, 0.550916571982769f, 0.703271386531766f, 0.982335628009701f, 0.942133544852489f, 0.690741953320684f, 0.0466423349204477f, -0.941178278727504f, 0.121655023640973f, 0.777925151322362f, 0.132430336075323f, -0.114812120408198f, -0.694094073965245f, -0.441397675924967f, -0.187253074701348f, -0.672248118097589f, -0.688869123609503f, -0.0723581859661586f, 0.553779536791160f, 0.380610143087564f, -0.392032089052147f, -0.709403552653908f, -0.607184251637473f, 0.698227587629545f, -0.272885954851784f, 0.0736609147840435f, 0.687106303730018f, -0.230362931709251f, 0.393640839382244f, -0.846905732907407f, 0.0727598538725249f, -0.0119849190815611f, 0.470122652313157f, -0.171681529301612f, -0.329268850654460f, -0.433013841687086f, -0.943499527192280f, -0.123404693276305f, -0.0861435714812342f, -0.228816973160929f, 0.0531549757963279f, 0.901446101051298f, 0.470738280922993f, 0.238383552115632f, 0.292841887198914f, -0.617423653544601f, -0.865786115828523f, 0.586332203179351f, 0.267618252846898f, 0.888575002575769f, -0.0220649407038027f, -0.946385428026066f, 0.317436113017866f, -0.277195072909682f, -0.207326502081016f, 0.735387675940421f, 0.961386190882120f, -0.564038045970629f, 0.840007249305217f, -0.262593952346269f, -0.556378761937190f, -0.346529850864238f, 0.00895460576800877f, -0.695431082536551f, -0.105261635693881f, -0.658342101938401f, -0.631093613961188f, 0.601639903111316f, 0.886830692209879f, -0.600591324826329f, -0.350296019796741f, 0.294348102011741f, 0.555826495708193f, 0.216370653207427f, -0.672654026881445f, -0.572202359802723f, 0.202776438466314f, -0.490708964058038f, 0.0148723360197853f, -0.799031226692943f, -0.221164759306209f, 0.0323674121757880f, -0.130290693568615f, 0.613592603765503f, 0.372755498065474f, -0.540502917956863f, -0.740021877141017f, 0.652888612951242f, -0.666157898478327f, 0.476156241264794f, -0.632081251666311f, -0.538341981270842f, -0.275717185193560f, 0.332983363477103f, -0.989659450166330f, 0.212868816589688f, -0.238985653168422f, -0.453005976359810f, -0.805975530848911f, -0.948192632970312f, -0.291329963979224f, 0.549811667826684f, 0.291147979443248f, 0.909805561757383f, 0.0728533843443158f, 0.737767652888933f, 0.605331616290165f, 0.274826946403577f, 0.710517586349601f, 0.666670055891909f, 0.522059053677516f, -0.553398792071804f, -0.406610321679562f, -0.893232547853708f, 0.549587730399741f, 0.714498083720551f, 0.281833380830291f, 0.652788061587949f, 0.825163748516741f, 0.381299333971584f, -0.485549061474930f, -0.881961689917888f, 0.308937809723222f, -0.524542880617761f, 0.329114405956449f, 0.434631551667457f, -0.894732322264538f, -0.831528385961058f, 0.669760583803638f, -0.674650675537928f, -0.373119878846435f, 0.456602566684508f, 0.387804792569985f, -0.556983911869482f, 0.000826745899317194f, 0.687973801099889f, 0.0471935422816141f, 0.0768302380434509f, 0.317557055919800f, -0.823316513699125f, 0.394699119350099f, 0.609556161256400f, -0.0413041171293194f, -0.244100882405517f, -0.939678976894569f, 0.403390183804743f, -0.933567523933859f, -0.331149894636631f, -0.0265881324103010f, 0.224249195386459f, 0.888271870759308f, -0.119845268644579f, -0.357275416804345f, -0.597001288429956f, -0.486847206619720f, -0.181232488650601f, 0.115441291842326f, -0.599055795186955f, 0.213179364205327f, -0.205238322081458f, -0.373942142629613f, -0.610680997090469f, -0.495737765362772f, -0.257634306994249f, 0.583708320566486f, -0.372047136603982f, 0.953878668619925f, -0.632595987923462f, 0.452049761997455f, 0.166602807787896f, 0.773555002555059f, -0.277154387560832f, -0.557129156714301f, -0.985242402457283f, -0.441173064787937f, 0.561221765682284f, -0.352004972295446f, 0.970292440826449f, 0.855523836321424f, -0.528113079339624f, 0.685454746939680f, 0.322200261898966f, 0.953249967336372f, 0.825673980624808f, 0.177229970128320f, -0.728281956776614f, -0.479030792350269f, -0.00697019557862144f, 0.851652517094715f, 0.853865750362844f, 0.514736989335681f, -0.943509205199198f, -0.0524009027225623f, -0.0798997671509367f, -0.355414349557791f, -0.366273957594958f, -0.565729285138989f, -0.931573923976439f, 0.345119269147864f, 0.638375370217726f, 0.711524360229150f, 0.331664704859388f, -0.986788646426241f, 0.521200596781614f, 0.656290865944842f, -0.436907564088290f, 0.305075696150381f, -0.848337345127939f, 0.354044695448027f, 0.690691708552038f, 0.900352213238582f, 0.475181192463882f, 0.219103309687964f, 0.885437995493547f, 0.421455288320496f, -0.879874221804522f, 0.893371290952196f, -0.545214090169942f, 0.800731783168682f, 0.249421864783476f, 0.0766192343033301f, -0.745747520609971f, -0.613575150364454f, -0.700199720327423, 0.0694373671332735f, 0.759953164582251f, -0.0973030480378387f, -0.298615297250225f, 0.0176506580013247f, -0.269562553201540f, -0.405489169051539f, -0.00491991297033256f, -0.0327449030548885f, -0.688168836745951f, 0.703014457338754f, -0.0909491575673764f, 0.738417882180070f, 0.202377973915515f, 0.338436193625848f, -0.408790267504483f, 0.611776208408261f, -0.711043784659083f, 0.841495665411188f, -0.0445715899008592f, -0.127281559164749f, -0.778797832908623f, 0.210344625249896f, 0.287086540530447f, -0.703702357088620f, -0.151146112491418f, -0.785180444786487f, 0.427963227387140f, 0.873814130606035f, -0.344356753075357f, -0.755726746591465f, 0.846013365191461f, 0.126678120904524f, 0.166687962199295f, -0.148273386834835f, -0.770559345875477f, -0.999129219024862f, -0.223692721084046f, -0.652712854614213f, 0.468054498362978f, -0.911782175948953f, 0.555084850374905f, 0.103972972463380f, -0.414021910330282f, 0.938793897617340f, 0.515461292224815f, -0.127677414947037f, 0.510661477088580f, 0.898409443447962f, 0.528096097102698f, -0.444620870908750f, -0.275909952832928f, -0.516074838791812f, 0.110104492330694f, -0.293114842926621f, -0.596621371059734f, 0.152807456749103f, -0.592864305196648f, 0.948295231208874f, -0.575278847840010f, -0.312463646261757f, 0.664597237604897f, -0.177619554099550f, -0.932259652303036f, -0.295074750863924f, 0.731539128777660f, 0.860409131570119f, -0.0947206503071862f, 0.106073387018718f, -0.235389180430490f, -0.494787189603633f, -0.536357147973158f, -0.680862001049455f, 0.618979489665256f, 0.613893487415732f, -0.308605775713246f, 0.694789556987429f, -0.440049894326668f, 0.908690328690240f, 0.233612239829512f, -0.190662564463532f, -0.344799878911344f, -0.185877286582818f, -0.553543917790750f, -0.859543533414720f, -0.996044831818542f, 0.0388505104043095f, 0.650508591477642f, -0.425233346101631f, -0.576839967180874f, 0.378730359294024f, 0.531713629917424f, 0.506096660522796f, 0.854779196325727f, 0.725302682547051f, -0.414685510902716f, 0.654208477287561f, 0.580368151427426f, -0.000356066597174687f, -0.897393734991154f, -0.845565244312410f, 0.615044057364182f, 0.0434592638759266f, 0.342119048500289f, -0.696414680186901f, -0.713269554140146f, -0.580866925323696f, -0.290886355957456f, -0.473082507703548f, 0.517942229000179f, -0.846159512055215f, -0.715410253368047f, -0.526272663742330f, 0.114004124940380f, -0.207397773975621f, -0.920379649009572f, -0.277970833475531f, -0.636533427057722f, -0.972531734576472f, -0.687000156900366f, 0.872752357637196f, 0.617872391924648f, -0.835274231587444f, -0.383282792481497f, 0.399233665040770f, -0.191230601890140f, 0.620222785371960f, 0.106379326744619f, 0.987222511696630f, 0.219022023664391f, 0.179689082166371f, -0.961619514581522f, 0.570178582343486f, -0.811091514477978f, 0.924484469376845f, 0.744507591138529f, 0.272936430096096f, 0.0646316580619510f, 0.314005111302676f, 0.558833629327024f, -0.329744916784918f, -0.544045568909541f, 0.895769679770795f, 0.798125821580789f, 0.877473384028199f, 0.616163339432501f, 0.441057381106904f, -0.642498173762053f, 0.989059595616979f, -0.374771110304453f, 0.480877593471524f, 0.904941689893360f, 0.428742160807762f, -0.430483645585549f, 0.0830560957640680f, 0.694220841170708f, -0.602964792788891f, -0.522672782287498f, 0.717494777479591f, -0.918002255923909f, -0.454075191574169f, -0.378662039464110f, 0.221482629450150f, 0.750918040362614f, -0.636211037178780f, -0.254529141198887f, -0.944623201010144f, -0.720775773991847f, -0.674641067104323f, -0.208243950413264f, -0.959488786545901f, -0.619966503980330f, 0.599486634018692f, -0.0955439064236721f, -0.458181000169795f, 0.736914498713083f, -0.176789993854223f, 0.676652697410790f, -0.967275583857650f, 0.319377813603719f, -0.427030468653864f, 0.0670640089595258f, 0.769945699222976f, 0.767923203047440f, 0.985790354694142f, -0.207111795449682f, 0.219134401666738f, 0.548513609112215f, 0.977227384558063f, -0.198131173309759f, 0.914163808432723f, 0.178214485462450f, -0.240590252223318f, 0.356128697574950f, 0.453093488702627f, -0.0401152114159198f, 0.818060948361957f, -0.880551400213416f, 0.631519794065582f, 0.658832307703964f, -0.179752451562622f, -0.237844011105596f, 0.739834592198990f, 0.711355594921083f, 0.774856912009109f, 0.321864249971600f, 0.470574585274056f, 0.261964793641569f, -0.634481134262705f, 0.461363065389595f, 0.0879014163867016f, 0.698353456328335f, 0.0611830044908546f, 0.918599000791453f, -0.147822590771951f, -0.208296009525534f, 0.775436805889909f, 0.0380914463017457f, -0.954468558268744f, -0.620451283908529f, -0.770251739379244f, 0.772246778681563f, 0.326462458587915f, 0.417738473564738f, 0.0942643452092895f, 0.486153909005530f, -0.720202618855819f, 0.0172425211828453f, -0.460430186764708f, -0.582933725313246f, -0.439721219285309f, -0.694337374508112f, 0.493516461453915f, -0.993527345413430f, -0.562763570629586f, -0.0644937992008268f, 0.741476357523546f, -0.668588797988340f, 0.594184164979780f, -0.605220767543645f, 0.110074204567278f, -0.599398769115359f, 0.723882026196765f, 0.678747828159456f, -0.608589528492249f, -0.881419419882399f, -0.139357674240927f, 0.873828011683502f, 0.314798068434754f, -0.457017849147976f, -0.526003289738433f, -0.411404919696823f, -0.792254466556923f, -0.299635866135236f, 0.0102316480137963f, 0.161921266554201f, 0.981427028530907f, -0.647351555346480f, -0.183312260273700f, -0.348651484808239f, -0.198142718294920f, 0.589869434168343f, -0.201926511662287f, 0.0337896878721506f, -0.0276515055864679f, 0.236943449722327f, -0.473103622922213f, 0.954358213176107f, -0.536519478008862f, -0.603363977756898f, 0.776267386457251f, 0.780662223932714f, 0.289187291033147f, -0.439954328280331f, 0.0429585232791456f, 0.457321950803212f, 0.236810565417317f, 0.167393310927116f, 0.634521586990289f, 0.154409349572581f, -0.750588956901316f, 0.862647670558265f, 0.800182258889404f, -0.342011510602950f, -0.102697321575297f, -0.797254530582515f, -0.718599505627591f, -0.729105921762328f, -0.152424255231618f, -0.702781451563249f, -0.0212710413372206f, 0.961258625954530f, -0.598484979483616f, 0.188043416567111f, -0.511990501189325f, -0.437449883017104f, -0.352443017251219f, 0.0991554004559394f, -0.663282401319921f, -0.835139403797870f, 0.587602722898819f, -0.939771062270554f, 0.613878515061637f, -0.523857415147229f, 0.444842501987166f, -0.297001528475358f, -0.914581150341453f, 0.554844832376064f, -0.816400014706997f, 0.823726509832068f, 0.704425080572720f, -0.819397910034912f, 0.999003444973468f, -0.968751535943602f, 0.0311500939174130f, 0.247867291448898f, 0.835560943875924f, 0.169794916341582f, -0.302041142019408f, 0.289549413666482f, 0.672141268085176f, 0.947060095876251f, 0.324754171403184f, 0.800014020753458f, -0.785428883146460f, -0.463092135879982f, 0.659192831110219f, 0.118301326248760f, -0.542297334341874f, -0.335957421787428f, 0.794808066256455f, 0.625133567458879f, 0.227917183877260f, 0.533557157748932f, -0.948877884679630f, 0.186417887458649f, 0.859592912781013f, -0.0183320237921572f, 0.967066787435574f, -0.141349529637213f, 0.958107445094614f, 0.264359167622140f, -0.631325355674829f, 0.684598042547604f, -0.527467468151933f, 0.294659298854560f, -0.439220168509424f, 0.391038218778621f, 0.0155669207052447f, -0.681384294454809f, 0.146739459198561f, -0.756404876084652f, 0.381192113543008f, 0.442850940158445f, 0.964002016096921f, -0.0507253848694798f, 0.563462880019551f, 0.190980650425415f, 0.482598778123453f, -0.273426091300166f, 0.980640722167518f, 0.198298590133615f, 0.678100193958147f, 0.530416610025615f, 0.196483886579908f, -0.00515783872303177f, 0.0273438459465027f, -0.257248394117661f, -0.576964504105195f, -0.331030677719652f, 0.389178134459083f, 0.0714066784585938f, 0.915179137858455f, 0.529738860096996f, -0.0851681338619263f, -0.692212896293625f, 0.0786352959300358f, -0.122712774017974f, -0.154641019547052f, -0.487537192251297f, 0.0435645872670241f, 0.856938631597551f, 0.351874085305670f, 0.708100804109985f, -0.701200509799317f, 0.0804479422214388f, -0.0794375302823220f, 0.543751723132725f, 0.346144383452864f, -0.680373368944156f, -0.572281173045994f, 0.237981706511708f, 0.0671482960376590f, 0.852393956008547f, -0.301262907769845f, 0.523762878044853f, 0.0885512158718469f, 0.885168455552951f, -0.333351382431635f, -0.914187358461713f, 0.657220242471575f, 0.202238670865175f, -0.660684692864216f, 0.641271628674064f, 0.795923699912913f, -0.332641448887164f, -0.297595219329770f, 0.427283618553541f, 0.601893958036382f, 0.355248259075043f, -0.420766820174961f, 0.355159952778514f, -0.806733697216087f, -0.694403711049608f, -0.719250654428532f, 0.580487742419744f, 0.959156165420351f, -0.941898541689400f, 0.960568821753178f, 0.119007749103819f, -0.973468502734443f, -0.627534816021182f, 0.331394418445345f, -0.415230278112412f, 0.225355270950915f, -0.216818510922154f, 0.716553646689289f, 0.149097723527982f, -0.212491921692561f, 0.681645638056938f, 0.675358683729395f, 0.0591550775861416f, -0.221626142364110f, -0.235878877821190f, 0.168188057112471f, -0.709738432254387f, 0.842890391064944f, -0.331175752377862f, 0.231375360302226f, -0.714989093452242f, -0.492645353426504f, 0.552424848261518f, -0.436987392663331f, -0.336155191719795f, 0.137666231065822f, 0.739347397348610f, 0.493222787180627f, 0.283646543313800f, -0.603522923409923f, -0.474181275984451f, 0.249315354427624f, 0.323736714335287f, 0.933612934150728f, -0.651555022796413f, -0.743229221575077f, -0.648309364385349f, 0.115117716036212f, -0.0689988553878600f, 0.0394979772968704f, 0.732729774997258f, 0.487584669162102f, 0.808754952095239f, 0.827617962775983f, 0.550826738558347f, 0.890858298785235f, 0.152998196795770f, 0.401198245071198f, 0.187173931669199f, 0.576387011979054f, -0.464903903379260f, 0.735172244343599f, -0.0393734341215035f, -0.501927105416023f, -0.852926247859480f, 0.384774001880198f, 0.723957370923565f, 0.869614310250896f, 0.698124990202440f, -0.0618370378422302f, -0.273879540781302f, -0.0745005910544518f, -0.754408143155094f, -0.859084370639359f, -0.709011936778905f, -0.883595552533659f, 0.326386065122049f, 0.756686513420982f, -0.639817612043620f, -0.536531544653662f, -0.596858657734988f, -0.187117983404806f, 0.760208405412209f, 0.191383034225783f, -0.771443976174702f, -0.371171018178012f, 0.723338724416329f, -0.325113980261468f, -0.652823731845602f, -0.902765567501679f, -0.109945188610355, 0.863727536109734f, 0.762531987550249f, 0.484671237555863f, -0.376731181566557f, -0.961176245257487f, 0.374503763045540f, -0.275274129954644f, 0.947951135663002f, 0.891610575724484f, 0.233179187366345f, 0.868694446846928f, -0.201812205484274f, -0.676342903796604f, 0.962133604967067f, 0.0941637112283598f, -0.0856261317646829f, 0.375061189807232f, -0.275342940020193f, 0.0614298144531287f, -0.183234253182376f, 0.146964792162229f, -0.307180215012337f, -0.139123531176191f, 0.130840221889238f, -0.0654726742084248f, 0.988722897887987f, -0.805684911622576f, 0.763299463922693f, 0.148136188784880f, -0.432183160161832f, -0.592185939638987f, -0.593835208842770f, -0.366135084813261f, 0.840566739882685f, 0.572052978307971f, -0.825682529425410f, -0.970222226210689f, -0.554421263584439f, 0.324648156825255f, 0.0472246837302466f, 0.168098848238140f, 0.00634984653176796f, 0.850237261066903f, 0.286624344510407f, 0.196043215794080f, 0.289161416244007f, 0.334801090322515f, 0.871286740072183f, -0.754609531300255f, 0.623871003889383f, 0.0843430009639772f, -0.736369938040848f, 0.400507674511444f, 0.816325383600297f, -0.500667496861800f, 0.453092855162135f, 0.281798170796444f, 0.631969623501011f, 0.472467114651372f, 0.525988741184527f, -0.124862967293674f, -0.882904489381606f, -0.501090007558747f, 0.631622297793485f, -0.0234210285578584f, -0.521093811962915f, -0.0402368492672573f, -0.762999364505356f, 0.948716268452360f, -0.572740830308272f, -0.261042904339051f, -0.506108365537530f, 0.585933508412429f, -0.362463094458446f, -0.885375028242576f, -0.835757117571791f, 0.337250829139564f, 0.298618238243588f, -0.744903291826588f, -0.979848674056393f, -0.488518944548476f, -0.000297116577397283f, -0.137863396173336f, -0.627207234158244f, -0.970417810284170f, -0.601487862773028f, -0.999527775716382f, 0.116672274325216f, -0.786330829714504f, 0.740118245374718f, 0.856485463622646f, -0.555144930193560f, -0.0168912375666686f, -0.774544329159697f, -0.782767315598991f, -0.600844843420598f, 0.885816107471180f, 0.577075799078571f, 0.663829997048111f, -0.359000184287277f, -0.390009578642891f, 0.202240602818017f, -0.0191477232064394f, -0.566459499064884f, 0.288883557382261f, 0.962583478738218f, 0.782123756762393f, -0.312311582870785f, -0.749354208187204f, 0.205679267602357f, 0.804004517387718f, -0.733078779233144f, -0.426195645938973f, 0.686872484317089f, -0.398704803137823f, -0.267786412313359f, -0.374306263341615f, 0.632992513422251f, -0.972217744254910f, -0.167080739523409f, 0.608176739669718f, -0.935550125875275f, -0.422451600932096f, 0.499643952974426f, -0.491034978653149f, -0.0256130378373849f, -0.158669355267388f, 0.360503946885584f, 0.227714934784132f, -0.138648043280479f, -0.0707461296301128f, 0.0638330442765616f, -0.168811643868974f, -0.575670642767690f, -0.162143785491822f, 0.528621079903453f, 0.581283330394272f, 0.444430744183000f, 0.859288341846780f, -0.170487584890459f, -0.440175706710406f, -0.184806402672108f, 0.676010805169568f, -0.0117535553470483f, -0.231606756742133f, -0.210042044569361f, -0.517950708003565f, -0.805772781723687f, 0.156938933772370f, 0.892075905739393f, 0.403874478002384f, 0.572031508558373f, -0.604145909072008f, -0.330076696654475f, 0.0314560087228033f, 0.683787496948704f, -0.788582181996934f, 0.835276281386949f, -0.0644658492206380f, 0.938270191882745f, -0.344927907293928f, -0.976720519493346f, 0.906264084343827f, -0.648152742145255f, -0.776984965421811f, -0.299470572593974f, -0.423690646950321f, 0.749911693814570f, -0.701929894551648f, -0.665191316321370f, -0.568359320650352f, -0.957309362369509f, 0.914088966355983f, 0.770952996203681f, 0.0924190787439159f, 0.844599990803978f, -0.613336716591875f, -0.683270165308367f, 0.358563204319583f, 0.934597169812267f, 0.236596595813630f, -0.895964332479994f, -0.673302324943916f, 0.454883302340070f, -0.473926010524343f, -0.576000657136217f, -0.644850950007290f, -0.980218836434995f, 0.321620362364719f, -0.799924718666919f, 0.0619872524925393f, -0.609255645268410f, 0.159243124858648f, -0.339764623434603f, 0.379865023026277f, -0.923132229333074f, -0.0300494021321296f, -0.183835365297645f, 0.122648511393234f, 0.887652015676064f, -0.616448517838488f, -0.920600866006207f, 0.352861591267815f, -0.930578364778234f, -0.378819076263050f, 0.775423778544869f, 0.836977798656885f, 0.0472244767469148f, 0.484934339557912f, -0.939155187409193f, 0.261555270800537f, 0.143595058480400f, -0.323517719771947f, 0.483466454684928f, -0.423163689969697f, 0.356966814701025f, -0.843907304366205f, 0.945903563730962f, -0.495952298317153f, 0.972277051575873f, 0.153052037173145f, -0.715894882755676f, -0.617028915483254f, -0.332307224095366f, -0.171207102890728f, 0.841771328272651f, -0.0308707743261867f, -0.626480028747696f, -0.729235538916864f, -0.743517330301179f, -0.733868915239511f, -0.449192858200231f, 0.362286468575150f, 0.327436676142902f, 0.609768663831898f, -0.147499187968100f, -0.470195300907973f, -0.232167856443943f, 0.225074905574485f, -0.0818541072414634f, 0.793403933843056f, 0.267628199755028f, -0.391701371806294f, -0.846991992740029f, -0.776221590294324f, 0.121351482320532f, -0.189789365942677f, -0.894392208695015f, -0.632864319945356f, 0.927817761109627f, -0.732454610273421f, 0.260011686544283f, -0.713973491605344f, 0.469764032416604f, -0.608895265807545f, -0.684992974060601f, -0.745556289276139f, -0.536308213076133f, 0.586581187207818f, 0.149804345860779f, 0.401576742698496f, -0.719670291046630f, 0.618659855530024f, -0.256639783379370f, -0.862966031725668f, 0.893866512913152f, 0.861800793529066f, -0.704895723095590f, 0.154163397540805f, -0.0775797186536984f, -0.252297335448882f, 0.869851864160888f, 0.428747373815147f, -0.818372805928921f, -0.739117647833389f, -0.697378012429133f, 0.182997863108567f, 0.689563104159966f, -0.0506114067037338f, -0.705077813920782f, 0.452892458862023f, -0.365069844049503f, -0.889224821648518f, 0.0194889225677406f, 0.847743515500726f, -0.0650338075825718f, -0.108889937983496f, -0.168485037502421f, 0.912533003086865f, 0.428132366084106f, 0.692652998111620f, 0.130599999674344f, 0.411245435867244f, -0.194909473459497f, 0.562152151569866f, 0.503795293326445f, 0.801805532943245f, 0.795718119772331f, -0.327975015537058f, 0.771389506217327f, 0.237139782375987f, -0.793798852884360f, 0.537824655594807f, -0.0767253125021830f, 0.444538451472890f, 0.623473048970629f, -0.500663871860675f, -0.890399840538612f, 0.389528755348857f, -0.915832255765501f, 0.000652855725217894f, -0.121310443088642f, 0.206662014558968f, -0.409513641801496f, -0.0496262665388731f, -0.313314447256644f, -0.994839397423865f, 0.344513198428247f, 0.250828855150578f, 0.845438302422055f, -0.728803841305459f, 0.249670562418639f, 0.543601559270672f, 0.0138774767713057f, -0.0667600054234216f, -0.803421294778238f, -0.222729734665659f, 0.461896933387103f, -0.378537171475208f, -0.464200027877777f, -0.363170335357481f, 0.616070694104851f, -0.316407896795124f, 0.131719997218670f, 0.0622146037260092f, -0.881713850066484f, 0.400811652868418f, 0.163777537634682f, -0.528768052383715f, 0.553072310703894f, 0.931393033749660f, 0.410062835546529f, -0.190904471223264f, 0.0533617852685424f, -0.911780226731855f, 0.823696403963215f, 0.756735978125573f, -0.849701310148249f, 0.106070214350541f, 0.747890454578944f, -0.559823302095172f, 0.976181619002882f, 0.506524051225122f, -0.0735228576098872f, 0.635610640336510f, 0.607728217052133f, -0.383443012662118f, -0.640835123345673f, 0.0897243696426577f, 0.722421963278953f, -0.368833835044170f, 0.684790387373836f, -0.0336846755494535f, 0.199819176553169f, 0.351822803019512f, -0.433387005248570f, 0.709401898386598f, -0.0149217994364210f, -0.549115733466769f, -0.774049259429836f, 0.440376751789406f, 0.740171176715015f, -0.322301969056869f, -0.148261856544327f, 0.724527166150266f, -0.744178178219827f, -0.743031462890542f, -0.00997727490160383f, 0.550074849063942f, 0.147825200269716f, 0.777182602759074f, -0.625412073440604f, -0.0614214671235789f, -0.400121310797195f, 0.864511820640236f, 0.327656445569618f, 0.765838911283705f, -0.906185069285438f, 0.543656228031101f, -0.527337383463707f, 0.544932532036177f, 0.453966596910417f, -0.422906847383216f, 0.803455668330395f, 0.496651297123425f, -0.254890927444284f, -0.940902660088963f, -0.0691448074129200f, 0.0165534278793877f, 0.510199004798987f, -0.0286331020627788f, -0.141471298460923f, 0.872000980716430f, -0.752995088893842f, 0.167696515625982f, -0.181673581299286f, 0.496236252387172f, 0.854022562040503f, 0.388320660177419f, 0.499320363074588f, 0.173522726183149f, 0.0334192536945390f, 0.631347719906229f, -0.832803059709609f, -0.523826088751894f, 0.322557683663180f, 0.0263621365506006f, 0.948982322858062f, -0.253991680115490f, -0.165970359640120f, 0.331700483099733f, 0.808731855823033f, 0.159862831431822f, -0.438178259673022f, -0.943749594272300f, -0.967819867274861f, 0.263403865531262f, 0.710981741513574f, -0.274597382335371f, 0.929606564147885f, 0.125943272920181f, 0.691306164809532f, -0.607946869004681f, 0.284352421048012f, -0.421663515398071f, -0.409479725854699f, -0.152265311389352f, 0.630868673855242f, 0.123144840061153f, -0.645105689918733f, 0.360153393247973f, 0.683885744053582f, 0.752598814717991f, -0.581494857182821f, -0.469116962448560f, -0.0691726199196117f, 0.174679188611332f, 0.351269328558955f, 0.394815335607621f, 0.710281940645013f, -0.618593505217632f, -0.721546422551907f, -0.974088703589852f, 0.939556772536401f, 0.599407011070674f, -0.342213391542906f, -0.387135346574836f, -0.572027944718123f, -0.622717582512866f, -0.676949872287677f, 0.993953153886700f, -0.784539234625462f, 0.788778188174951f, -0.0652679971583152f, -0.988740647590182f, 0.748989697777310f, 0.412949190397683f, 0.206661198525718f, 0.573116044772809f, 0.938498079842984f, 0.743167714677278f, 0.755679122637903f, -0.295095987460132f, 0.217166189740252f, 0.230160404687938f, -0.504654557405015f, 0.472402206737240f, -0.867751757044285f, 0.869050101160567f, -0.905285205825199f, -0.0698843699947245f, 0.762379282963140f, 0.634191197174691f, -0.498487028811837f, -0.284257632541078f, 0.224245853978976f, 0.412950901773606f, -0.831984679101472f, -0.375663639002356f, 0.153699995838016f, -0.953997055484851f, -0.545360745186449f, 0.637687001020610f, 0.465459355638311f, 0.0769011654935299f, 0.267123343048604f, 0.545842501706277f, 0.778890986545214f, -0.363432183057524f, 0.479786652022207, -0.600912698239979f, -0.738845504293020f, -0.775987143750184f, -0.705559714187038f, -0.310523750352236f, -0.576081829930414f, -0.0341897834633795f, -0.388414434291246f, -0.790681299048144f, -0.169440674711419f, 0.219815472280053f, -0.323451599202462f, 0.835623141427806f, -0.932446301638351f, -0.831480966559550f, -0.185050128422203f, 0.946045240208487f, 0.864740749402213f, 0.916918979039328f, -0.204049261822351f, -0.807183358636872f, -0.484543897885746f, 0.974235382435000f, -0.208019257024664f, 0.647411336652954f, 0.0961385231960816f, -0.800258527388060f, 0.352982142334643f, 0.917274278881503f, -0.733934252997685f, -0.229420044045673f, -0.358499183112933f, 0.469156578609832f, -0.859359096702447f, -0.937762141277625f, 0.389776419837803f, 0.458425599271073f, 0.542973137971009f, 0.675023236195573f, 0.944029213696263f, -0.774027667733194f, 0.262984845114612f, 0.842689106929982f, 0.349251854560315f, 0.815938991679117f, -0.226283690374971f, 0.144356327986477f, -0.610588223452142f, 0.539695204296007f, 0.655759463021729f, -0.725805170479948f, -0.194977831685847f, -0.306105075607822f, 0.725461617920836f, 0.678283785172857f, 0.250577882812283f, -0.571672652704059f, 0.112132856850530f, -0.236412229648694f, 0.768173015701816f, -0.799251028098975f, 0.100723381526471f, 0.113856811781171f, -0.0281630563735495f, -0.0727902548617043f, -0.515248547261805f, 0.795765010992038f, 0.505540143557856f, -0.496124371632015f, -0.363010091302494f, -0.302067159683438f, 0.941309812688142f, 0.0564765277142674f, 0.733027295879568f, 0.582734217224559f, -0.159007222603058f, 0.827637470837748f, -0.163060519537145f, 0.352357500273427f, 0.920405360379926f, -0.280691553157313f, -0.401974149240862f, -0.131353114797667f, 0.0719728276882135f, 0.795795661384902f, -0.348203323368113f, 0.946184663961743f, -0.188400643814906f, 0.979319203447783f, -0.132195434304746f, 0.585832597473452f, -0.894730397941282f, -0.998045985412111f, -0.717844040997160f, -0.706372640246558f, 0.237517748136224f, 0.767232946579208f, -0.246080656591091f, -0.767887803661775f, 0.139501344992184f, -0.545658806327887f, 0.480755550666584f, -0.355750609145607f, -0.493518864013929f, 0.832011102158605f, 0.122542855024589f, 0.179356501845966f, 0.630805165349165f, -0.888557403477561f, 0.861375782261841f, 0.963467658712489f, -0.00498707715217361f, 0.341894517453263f, 0.654808049991043f, -0.826909952854692f, 0.101446328788119f, 0.401514152845232f, -0.830556985096328f, 0.832187560444347f, -0.657254039822149f, 0.0304197382717133f, -0.718462386339415f, -0.592343549551534f, -0.356333235896531f, 0.674135547073730f, 0.606490641440102f, -0.707328770155748f, 0.0251846271186025f, 0.763024927861424f, -0.258224600040528f, 0.456384203436896f, 0.626482995304888f, 0.162353458245830f, 0.964280614412026f, 0.869262296229816f, -0.0659501568862260f, -0.712869755397848f, -0.946968242335746f, -0.852822740386429f, 0.791522782900379f, 0.824530390150335f, -0.369383609091590f, 0.118366422602132f, -0.713278848975255f, 0.549165545117801f, -0.00201102645336770f, 0.748955154405439f, -0.173689412898754f, 0.175162399203493f, 0.0819730422177463f, -0.804833155982895f, 0.972966530563786f, -0.0614871820303859f, -0.293463394754661f, 0.885919261783643f, 0.498531250561504f, -0.808874001349436f, 0.364344357769432f, -0.945616638616975f, -0.285864129675031f, -0.0438177789332626f, 0.303981486324719f, 0.362653007142366f, -0.543157427730716f, 0.174551703296805f, 0.140105048664068f, -0.704163993684247f, -0.647461975308389f, 0.831243960763754f, -0.364954329841192f, -0.730289885595360f, 0.0119708019435723f, 0.796338505809816f, -0.227851954967331f, -0.927330125804492f, 0.0602265250934577f, -0.485204061877453f, 0.198319346525046f, -0.529723177394882f, -0.321493822700232f, -0.839566193416413f, -0.187812484529161f, -0.396142329367383f, 0.367600156667632f, -0.922657847865138f, 0.893508892950972f, -0.504434314314017f, 0.663184814192863f, 0.887813887366393f, 0.267103483259066f, 0.984313142773772f, -0.667515321448428f, 0.0718416862496054f, -0.733363156570869f, 0.00186343206374962f, -0.316531364321301f, -0.467549697367438f, 0.569865535259013f, -0.556502178434536f, -0.650896672234238f, 0.564462797319346f, 0.585276582729153f, -0.433005641153548f, 0.847012427243871f, -0.462088105064984f, -0.379468633087939f, -0.0104892833799723f, 0.654191676584918f, -0.893278846859767f, -0.689350274835588f, -0.333220721049179f, -0.0461703436190983f, -0.463411501818667f, -0.995085073808794f, 0.526075522777196f, -0.0686703698159610f, -0.855908120278260f, -0.239774384006192f, -0.524142243888286f, 0.119526621106050f, -0.838266471869898f, -0.459366707886497f, -0.974921205300089f, -0.680517660007036f, 0.507695286553230f, 0.0920009889477380f, -0.674459855090400f, 0.554585280302756f, 0.357871391273056f, 0.453052004120624f, -0.991707675828263f, 0.144725488641274f, 0.0886535789688503f, 0.708257184179799f, 0.579351194763774f, 0.902098539548710f, 0.0104715251706708f, 0.112677648152527f, 0.0513772996762050f, -0.647561525299580f, 0.321958856072156f, -0.433510239079594f, -0.481493822802105f, 0.651663699618654f, 0.922649363108760f, -0.751799312011289f, -0.0336105332513619f, 0.236872038257485f, -0.0434863841224971f, 0.150810692021768f, -0.217629544451037f, 0.345890414626050f, -0.471941673338326f, 0.675001035054686f, -0.986585320322202f, -0.784679789758475f, 0.270727429189404f, 0.595792127677512f, -0.485969146811564f, 0.222507692419212f, -0.850070310429306f, -0.575184466843042f, -0.220860571657717f, -0.749449040845746f, 0.743039624335149f, 0.463892797640518f, 0.224829531690830f, 0.935410439714992f, 0.00609595972560872f, 0.830877831388658f, 0.0270299847557276f, -0.648763861115704f, 0.471982277585509f, -0.145722971031426f, 0.650947186397952f, -0.266164907037466f, -0.962378355156458f, 0.354855353373398f, -0.184127215272909f, -0.825621979621661f, 0.595495186093792f, 0.448679578752395f, -0.839671989567806f, 0.302158874138200f, -0.735484620769119f, -0.891040803749876f, 0.880298595525880f, -0.281199581528421f, 0.0195033020490396f, -0.511515485794419f, 0.447303195702203f, 0.375317547074287f, 0.964442757731427f, 0.167643569291013f, 0.0118587246816413f, 0.958187068873858f, 0.315395458761821f, 0.188852872643367f, 0.417450657662866f, -0.540566147670448f, -0.422709015019828f, 0.101425586029329f, -0.235465301656357f, -0.806044548641562f, -0.617153815671298f, 0.350658348898447f, -0.738540593521098f, 0.291893065415692f, 0.335435501842245f, 0.832048727909480f, -0.609539777284250f, -0.436992256701542f, -0.685315947977391f, -0.502107715051164f, -0.893460699283628f, -0.262263680492396f, 0.454417031133778f, 0.223227655510993f, 0.605288383003966f, -0.698800586984034f, 0.864843125666124f, 0.363752223710394f, -0.354571459375900f, -0.575008718239530f, 0.423061550052490f, -0.272459660313524f, -0.116932919064239f, 0.547073367599225f, -0.890822451422250f, -0.884262586749836f, -0.889803003239001f, 0.217660629852574f, 0.154863581361214f, -0.333284425759330f, -0.826087281020982f, -0.958198419703014f, 0.850114828540176f, -0.391190814837661f, 0.956578087128909f, 0.0541599967910713f, 0.0988550815990206f, 0.851903747125444f, 0.361959550717838f, -0.901818125706440f, -0.0561477675277424f, 0.522090821863134f, 0.263383912024089f, -0.161061362097086f, -0.983707460720128f, -0.333128836619106f, -0.546535222349413f, 0.627261888412583f, 0.408731616102241f, 0.754700916401496f, 0.869772826180715f, 0.362242883540519f, 0.853587698951791f, -0.698910717068557f, -0.671945256263701f, 0.802655941071284f, 0.338701009518668f, -0.0297818698247327f, -0.881311052338108f, -0.296717226328950f, -0.965699941652671f, -0.737164428831818f, 0.00804554422537485f, 0.989716933531351f, -0.832438692682457f, 0.454553001515962f, -0.933801685729775f, -0.644562445615081f, 0.104508389084640f, -0.535426180524709f, -0.937041822784313f, 0.599911275476691f, -0.789109397888652f, 0.821293320968620f, 0.818032308067912f, -0.838306491947354f, -0.172883985566904f, -0.185775969502745f, -0.672256019841514f, -0.412525056012874f, 0.142272136963196f, 0.792136721788200f, -0.726314486042219f, -0.445981475954073f, -0.857821372905156f, -0.783006950965519f, 0.438776336055643f, 0.400193156140386f, 0.177525578340235f, -0.435380642286229f, 0.547815754835977f, 0.0496394855194708f, -0.442174406426496f, -0.0856142956982360f, -0.0247840885457120f, -0.779016166389253f, -0.511802368745331f, 0.319887353303028f, 0.721806644023428f, 0.770423389111803f, 0.809969588377187f, -0.196191981856391f, -0.105718971622809f, -0.301674515042257f, 0.613622254387482f, -0.969517273103490f, 0.0144576310630131f, -0.668829420461301f, 0.750377960820232f, 0.696858494013122f, -0.563485511352760f, 0.726226115587466f, -0.227540741583116f, 0.665488592033944f, -0.124611809537824f, 0.489550286613580f, -0.579185308695604f, 0.628687311174276f, -0.295770837727116f, 0.240358361854250f, -0.155642183802961f, -0.885945841456110f, 0.388592282428421f, -0.663862196774143f, 0.363779469451472f, -0.371285870971327f, 0.563159689631810f, 0.102725415308920f, -0.320909176496511f, 0.334328794247963f, -0.401664407219370f, 0.726728495517480f, -0.192310060924823f, -0.107973316004269f, 0.898177814643418f, 0.456682306673978f, 0.890742303266606f, -0.742770990765425f, 0.0337493848747046f, 0.786190819119190f, 0.911503487800545f, 0.288384155888888f, -0.249479393879906f, -0.431949793185094f, -0.0847659302921913f, -0.475416985100444f, -0.362720571751962f, 0.676910741300893f, 0.00488530543559529f, -0.227678010632002f, -0.0632947771540859f, -0.990261099329279f, -0.708485805011827f, -0.304846597458441f, -0.480289782580152f, -0.593254971635338f, -0.656335976085053f, 0.584373334310954f, -0.493268395245234f, -0.00212668034894836f, -0.480221591678953f, 0.622365041709782f, -0.258845071515928f, 0.943825418665593f, -0.716642329101759f, -0.765317239111819f, 0.324487844009035f, 0.108158868464706f, -0.790583201992229f, -0.649218622127061f, 0.751409704126257f, 0.301455204388007f, 0.620482350165047f, 0.411016780608874f, -0.878843779367281f, -0.779673415191805f, 0.616508572699874f, 0.0750844738292273f, 0.341011338533919f, -0.553376665552953f, 0.277561087965059f, 0.527499935800293f, -0.489644680144407f, 0.514353996113782f, 0.229842524701725f, 0.139172928186734f, 0.793753206591897f, 0.835555341130211f, 0.794120687009671f, -0.0994745468343306f, 0.109098970584400f, 0.383123470993648f, 0.272549010931094f, 0.683070582699418f, 0.522823199313615f, 0.235903759158310, -0.269490013000195f, -0.103775744391749f, -0.994083979953753f, 0.754983594207459f, 0.806308398378106f, -0.997543362839150f, -0.00396367603607373f, -0.873768378178592f, -0.755907732827809f, 0.703713206520365f, -0.0716773056166142f, 0.0792968663717508f, -0.113760825029016f, 0.828188140127672f, -0.103062543982628f, 0.0455017026983378f, 0.330658414568756f, -0.615810862221588f, 0.827890015477212f, -0.507551960954374f, -0.371044788092612f, 0.723489294741891f, 0.169072478802524f, 0.885612989356318f, -0.496475905980558f, 0.114400438991609f, 0.427961880327008f, -0.0456714004002505f, 0.0246660859589438f, 0.175616122301987f, -0.349777838484285f, -0.939474935533562f, -0.215061649130134f, 0.907049169335834f, -0.0553600192559760f, -0.982464152311714f, 0.405919915647442f, 0.755952405091542f, -0.695422520039876f, 0.373280568864688f, 0.483909023765611f, 0.784896384994620f, 0.978722132488262f, -0.113866140463085f, -0.630016943176703f, 0.512742627309861f, -0.829104067044703f, -0.240982431155520f, 0.0107361024967163f, -0.438682584788413f, 0.935730031472303f, -0.953447901200043f, -0.984218956474073f, -0.745077052885218f, -0.466232938128846f, 0.0326267564209573f, 0.303877586274065f, -0.199843777507458f, 0.674317529952029f, 0.448678903834397f, -0.681863209154081f, 0.273397524216090f, 0.193101955704959f, -0.342858479278718f, -0.485179713360910f, -0.586067050491890f, 0.393099777352274f, -0.982324485510343f, -0.852553426343700f, 0.773613825101220f, -0.590256032959421f, 0.837952413540589f, -0.643137731235821f, -0.311955662956384f, -0.888588599835619f, 0.304629859477166f, -0.810098957400030f, -0.534291626181040f, 0.878601703692302f, 0.362706441157764f, -0.254447668911795f, 0.604309282304246f, -0.977266419340276f, 0.250927873824064f, 0.549600558999971f, -0.796155833245480f, 0.226373301058549f, 0.0137578302483823f, 0.819708534464965f, 0.185662636424304f, -0.450456459548662f, 0.0953849597308440f, 0.736872088617975f, -0.582024306116842f, -0.0522261513001507f, 0.394348349710790f, -0.461023913227183f, 0.139996201153565f, -0.790168851966909f, 0.692544084408690f, -0.580603732841955f, -0.584540773580447f, -0.967062276813525f, -0.00886260208554912f, -0.0520831218167985f, -0.999614949922684f, -0.965820736077636f, 0.366390034326646f, 0.0323069925013668f, 0.164651515113853f, 0.300260003499445f, -0.340634856317630f, -0.238157231550037f, -0.291645957143165f, -0.773881882387456f, -0.144494053860223f, 0.660329619628580f, -0.626727996257997f, -0.994965090982706f, 0.161018019917379f, -0.327211572176153f, 0.0410991278573425f, 0.0123663905917732f, 0.747176159655312f, -0.485981637435718f, 0.00667961234248971f, 0.631625759154389f, -0.831294487064668f, 0.449606477050286f, 0.768845094514142f, 0.928354534843426f, 0.812647997969340f, 0.353418126917875f, -0.872184763557736f, -0.579130598386915f, -0.912928075675835f, -0.779484407508668f, 0.534916834944041f, 0.326353225230543f, 0.395431557674662f, -0.842103899863317f, 0.196590107332985f, -0.261317824893025f, 0.750190543523333f, -0.103409967857074f, -0.201452426430379f, -0.213633615009587f, 0.578822104214576f, -0.130809161238349f, -0.774608769872343f, -0.0222201705228122f, 0.126990738965544f, 0.785780586747108f, 0.0379484317527632f, 0.837140835706189f, -0.191007948387153f, 0.106781679021568f, 0.990298140861558f, 0.618337701073777f, 0.460255491901774f, 0.716379796730692f, -0.159421014009881f, -0.560212468621569f, -0.147263014783522f, -0.962301694075771f, -0.327702010262213f, -0.773959532468388f, 0.351239668535113f, -0.682281479449518f, 0.342188824054257f, -0.743039216419066f, 0.700710268270439f, 0.919651386092770f, 0.626343233048871f, -0.157189576636596f, 0.781882574006976f, 0.349953565654219f, 0.361235312853466f, 0.313242228422046f, 0.582185182102266f, 0.554504358491139f, 0.711217954194576f, 0.332473377627418f, 0.165078226255772f, -0.228349029389292f, 0.899730713958153f, 0.653894503448836f, -0.0452904440925501f, 0.0328806142413372f, 0.793701315832839f, -0.703826261467540f, -0.901648894320192f, -0.195631966969018f, -0.0470590812056508f, 0.487185699934959f, 0.175961644103331f, 0.818028721319245f, -0.224389104974946f, 0.901974203693823f, -0.153212477843726f, -0.472747796173897f, -0.587471692952684f, 0.452340198339707f, 0.996443894349412f, -0.849126217374502f, -0.403800337277983f, 0.923427876645159f, -0.0516037992113898f, -0.380335341989182f, -0.299914673109747f, 0.764492139190834f, 0.773463290027243f, 0.0175454601261817f, -0.400742340353541f, 0.912354892189422f, 0.999766609328281f, -0.521321752061712f, -0.365769506846305f, 0.477612405338644f, -0.0522578739905535f, -0.479259238587280f, 0.645161410912429f, -0.702546085166056f, 0.359736398041538f, 0.638130894056863f, 0.115633419893101f, -0.674410360620500f, -0.150824943737990f, -0.824854463897591f, -0.504410162129685f, 0.560317574021813f, -0.159611666752889f, 0.997647540626334f, 0.702777895178414f, -0.946494281691535f, -0.0109619562916898f, -0.383756482005404f, 0.872670066971334f, -0.453527506439184f, -0.635719199113957f, 0.932852122005178f, -0.800755479140234f, -0.225213334363716f, 0.251163542389519f, -0.598147625383133f, -0.155241293946661f, 0.967736510890644f, -0.0157250628103103f, 0.250570924071858f, 0.209749651169078f, -0.381016062687537f, -0.679300447230592f, 0.160197663113971f, -0.749803147200800f, 0.596917045783617f, -0.0878737681749431f, 0.642402180339789f, 0.261614973684270f, -0.111833224093973f, 0.300170844971678f, 0.317966800167647f, 0.0585375534708252f, -0.842709435910728f, 0.760207701069839f, -0.979366191145221f, 0.940703569377911f, 0.866488078693979f, 0.553497107695259f, 0.127260247084497f, 0.530106152060111f, 0.725171359852920f, 0.356742729430045f, -0.209841680046178f, -0.164239817187855f, -0.888858150931758f, 0.0367561852378047f, 0.803496113779956f, -0.594927045375575f, -0.00347281985657166f, 0.114118941713783f, -0.427864462568672f, 0.719021423892768f, 0.335845790828654f, 0.0207216235296064f, -0.523146933862102f, -0.145001077781793f, 0.490566784879983f, 0.461904660734682f, -0.897010089735077f, -0.895737903861849f, 0.343397505472310f, -0.684377591381862f, -0.0154016881290400f, -0.462987614871549f, 0.884045010701589f, 0.192617174725234f, 0.226497290324550f, -0.788151335932529f, -0.190538526746651f, -0.556614046330326f, -0.139480186854974f, 0.196785300148418f, 0.978844132512627f, -0.290726060479808f, -0.591813978495167f, -0.0769033757443105f, -0.467044929381376f, 0.171585053083057f, 0.408215527269010f, -0.818706013465989f, -0.328144984930982f, 0.790275356337217f, -0.977491163139178f, -0.979679268318504f, -0.524875121608236f, -0.263859024168277f, 0.0180787743488171f, -0.984390626106750f, 0.952274619010224f, -0.851400664579601f, 0.692959439369046f, -0.150312001943653f, 0.712066554169562f, -0.492336226254660f, -0.453559897031351f, -0.159679763180474f, 0.745834647687870f, -0.725963425297178f, -0.720341794596050f, 0.370674334928492f, -0.845974926208293f, -0.00448769398027360f, -0.595973105115042f, 0.967372249596385f, 0.512949503724102f, 0.889619262804735f, 0.990718232652913f, -0.662246751886904f, 0.333846293708563f, -0.423114421367372f, 0.549637439543149f, -0.987876053136374f, -0.782714958794276f, 0.294868983681807f, 0.931284560597614f, 0.445522387300861f, -0.388400162488578f, -0.182673246109423f, -0.773488958971573f, 0.438788569593725f, 0.578106509978236f, -0.373449127435319f, -0.301996528814967f, -0.227124771031239f, 0.700176189695036f, -0.910948938567526f, 0.733412403327578f, 0.486154072292544f, -0.974058632864456f, 0.216693355653246f, 0.147564301397678f, -0.715192277853558f, -0.366996833259925f, 0.568909126406069f, -0.0810069456450131f, -0.371253841044151f, 0.254736918036059f, -0.868966383080701f, 0.190312518076662f, 0.457253801337437f, 0.941043431633233f, -0.297470749600241f, 0.244270515950156f, -0.240122562119888f, -0.766384662307300f, 0.765045432900429f, -0.608250739173787f, -0.733052557932594f, -0.268433000443065f, 0.733598123424154f, -0.0550005774741753f, 0.273893221740822f, -0.659641650983149f, 0.967032725204337f, 0.390126626361090f, 0.518740746381756f, -0.859387560527806f, 0.554117289841284f, 0.648904904654236f, -0.755880975555381f, 0.834231592524942f, -0.137512395743275f, 0.0477027353535724f, -0.880364563062979f, 0.458763614093086f, 0.650036413308116f, 0.496385905878033f, -0.418537115548864f, -0.565561960782851f, -0.227941684691245f, -0.165031891659812f, 0.204464989908300f, -0.688093624763916f, -0.678874848552394f, 0.813764873880514f, -0.561723359541237f, -0.575805702297063f, -0.288097000970518f, 0.950119107184838f, 0.709879842972902f, 0.730067219897393f, 0.710813066057284f, -0.192333836978130f, -0.190446300563246f, 0.872679304648751f, 0.134143163657763f, -0.979443835407234f, -0.103872104041761f, -0.0568328979324004f, -0.863020133862081f, -0.0257801722427251f, -0.577962771617033f, -0.0500056799801032f, 0.191817418291914f, -0.799853775410853f, -0.110019424741421f, 0.840753817223395f, 0.355588322976119f, 0.274501278628024f, 0.757538306972136f, 0.771547320156202f, 0.0394143752709530f, 0.120744072764658f, 0.324337882930581f, -0.380086709776951f, -0.772025774284869f, 0.473986846199588f, 0.703247561676381f, 0.734667480205300f, -0.594290184210087f, 0.760158653782445f, 0.624553744314883f, -0.941053266957965f, -0.165913770936962f, -0.0497972870738055f, -0.0435608680908517f, -0.663165366083943f, -0.570972482385751f, 0.427845034528880f, 0.0897903148165149f, -0.481825010950428f, -0.0901127105939594f, 0.887770435656611f, 0.770985476674623f, 0.00966158758316293f, -0.331059327378268f, -0.286033645163736f, -0.0698945910210471f, 0.834392309773299f, 0.875537383319608f, -0.657919190548359f, 0.583890957562885f, -0.418481077359384f, -0.282242397022386f, 0.864577023994874f, -0.898367126143440f, 0.815804441243808f, 0.616061408588373f, 0.132365642864798f, -0.221099752471970f, -0.852722283680675f, -0.269499596712950f, 0.360828136129415f, -0.120022743070141f, -0.0354652134632905f, -0.718389836602256f, 0.973490047219112f, -0.201775047168341f, 0.348769511760972f, -0.338750368577880f, -0.269769414088757f, 0.498910931428472f, -0.787648791515347f, 0.508408064858444f, -0.904215976374529f, -0.778575029821227f, -0.662889546847757f, -0.787503064261069f, -0.915166838630178f, -0.415784802770356f, 0.731806835017609f, -0.903922155472207f, 0.0872811033112211f, -0.452516774501827f, 0.577942533813694f, -0.200909337658770f, 0.866167939661793f, 0.982552542055944f, -0.332277333696961f, 0.201673960342839, 0.881239812364993f, -0.0293753746942893f, 0.0967170348490725f, -0.765573023404242f, -0.179225339525953f, -0.931530757069740f, -0.702596334762137f, 0.439106079307245f, -0.469364154277323f, 0.211063395888038f, -0.245858633045693f, 0.936376071219385f, 0.0334087380010875f, 0.0765265939183459f, 0.417091701258078f, 0.962467059286170f, -0.180698008768999f, -0.129816441691123f, -0.833694435146788f, -0.800582099046532f, 0.736376297618233f, 0.0164704176688124f, 0.207462305741760f, 0.300555292898496f, 0.777154212278295f, -0.0804533056660695f, -0.279940128908185f, 0.203101811030871f, 0.447496959357837f, 0.508353359025257f, 0.644333822521829f, 0.897259297488483f, -0.675785952117501f, 0.149337263319588f, 0.350953290584184f, 0.600296681944338f, -0.606098182955297f, -0.418312129297725f, 0.792551232171214f, -0.944025948110651f, -0.923106441737020f, 0.508989820072736f, 0.101554011154237f, -0.799369609980037f, -0.229001813644938f, 0.196367996268564f, -0.634078446275840f, 0.267446716753553f, 0.943765754688567f, 0.329924442019441f, -0.898235312442524f, 0.563592978494850f, -0.976934293161001f, -0.609744819901837f, 0.498989633313589f, -0.105680058480959f, -0.400730747241191f, 0.264919109340783f, -0.313066735594123f, -0.465399967597728f, -0.425123918113080f, -0.609514085808810f, 0.916560800692384f, 0.0173757138934230f, 0.147814399202503f, 0.594152503614559f, -0.145681097751433f, -0.427232299718493f, 0.233460382614713f, 0.337361272635241f, 0.376106438004541f, 0.900277274651600f, 0.424547631957395f, -0.710790444715071f, 0.0846761090154495f, -0.0122707338404220f, 0.119989812955904f, -0.239774389963524f, -0.692300891031819f, -0.735109129583214f, 0.802276300301071f, 0.348982047806247f, 0.916302084278941f, -0.0838164783829127f, -0.989134997097880f, 0.832909602224562f, -0.701363449605445f, -0.150487976031971f, -0.728594035984111f, -0.144393031996783f, -0.458856761770637f, 0.733295441303064f, -0.405608670768629f, 0.522871610912813f, 0.468223399458939f, -0.575139530810903f, -0.241684287862418f, -0.499140599234906f, -0.395586476697394f, 0.692745485195348f, -0.125142235859546f, -0.342212246193052f, 0.133841188490164f, -0.539478395228865f, -0.887973984329817f, -0.474033882236453f, -0.837114132429830f, 0.773392302912611f, 0.117697651876253f, -0.461595011213406f, -0.528669601602068f, -0.957799577987062f, -0.468654423525192f, -0.0602288998398475f, 0.154553704272891f, -0.422854231304259f, -0.496136532114270f, -0.348154983723668f, 0.0576478341707483f, 0.542088962901856f, -0.0465812136931592f, -0.280128217727361f, -0.900695482510248f, 0.525110685457899f, -0.957266165874283f, 0.136490670826643f, -0.213221811269364f, 0.690040133288898f, 0.269408771473479f, -0.0488994830172422f, -0.837526616586426f, -0.289127052660601f, 0.149325279006459f, -0.694169700971401f, -0.0230547571616897f, -0.368313297034846f, 0.344434270521740f, 0.859135365902404f, 0.839336654691204f, -0.511783987355355f, -0.0349625753049687f, 0.935857929664427f, 0.820032045433520f, -0.0394079346656324f, -0.656352913407746f, -0.874383371678169f, -0.425836335156061f, 0.208600154889275f, -0.135596548598733f, 0.566430757256762f, 0.820840891306264f, 0.735746624790780f, -0.765482927015804f, -0.0195537720748045f, 0.606216172027628f, 0.436027839798869f, -0.609233580289002f, -0.963547951222316f, -0.575271468261977f, 0.692873344771925f, 0.143031668657597f, 0.890157114774225f, 0.762299295692265f, 0.653618249618643f, -0.957258626549595f, 0.521895225378123f, -0.607922211531407f, -0.956795748110572f, 0.477633684273092f, 0.794301967670603f, 0.139753218894595f, 0.371726372555490f, -0.804791987531745f, 0.837080126047059f, -0.440992020192054f, 0.584986017638085f, 0.950442046050057f, 0.613109120495913f, 0.633948971396891f, -0.581246845000116f, 0.730290176291093f, 0.599119212595240f, 0.120096101936515f, -0.144169383323758f, 0.930776406826440f, -0.0209712926465206f, 0.572995665695966f, 0.924623298379120f, -0.751832867985678f, 0.630196806059302f, 0.506634179395662f, 0.0388997263873157f, -0.311041196366299f, -0.729049093325017f, -0.918815504666740f, -0.103935429478766f, -0.000623544124330300f, 0.102880227280474f, -0.563637096166535f, -0.332148269587814f, 0.472114131256244f, 0.295717126494164f, 0.246944592105312f, -0.713191555660498f, 0.160410320426559f, 0.110992936470077f, 0.213877527744528f, 0.541660996543375f, -0.872405734998843f, 0.388515073094269f, -0.840811647524440f, -0.968008592072007f, 0.669947948420772f, -0.122943215855172f, 0.565929115911552f, -0.695408966310186f, 0.361296950635219f, 0.574282481983669f, 0.0877180513263536f, -0.694316083550519f, 0.327696487191071f, 0.289746985823208f, -0.241476327174879f, 0.605084742574250f, 0.0929272338220821f, -0.391399761658219f, -0.612928183827531f, 0.0471987261466311f, 0.157388702609590f, 0.575695018001234f, 0.450453491026024f, 0.876623108212541f, -0.456500163180038f, 0.436901006801809f, 0.796734433864345f, 0.771008396172517f, -0.784740610155705f, 0.405172719255834f, 0.958393667559228f, 0.787380105147761f, -0.262826016234054f, 0.773327117333271f, 0.482142068916266f, -0.461607549022954f, -0.153993688218026f, -0.129280134980317f, 0.901812622560630f, -0.111520793491644f, -0.0973214524989203f, -0.293695817178366f, -0.190045093887485f, -0.204792515844396f, 0.501086384719391f, 0.755953359112033f, -0.425886872154604f, -0.0883029298084141f, 0.763071371252921f, -0.556289447935984f, 0.577370462369201f, 0.0480599614417476f, -0.794423686623353f, 0.756645959967545f, 0.570538730848462f, 0.872575422156333f, -0.443572567528656f, -0.0487937634747691f, 0.283986553648095f, -0.170910821134099f, -0.329867000423004f, -0.982322841409943f, 0.555344201026651f, -0.351964643393940f, 0.776172688776518f, -0.148102477734717f, 0.889532618676503f, -0.310979434517253f, 0.711839903052208f, -0.646385596147085f, 0.145592596381502f, 0.233949589173221f, -0.825471565980294f, -0.370248763132654f, -0.777194557275684f, -0.224658064754195f, 0.263281286751478f, 0.849661910468068f, 0.271261490445121f, -0.915885420717958f, -0.947144520818678f, 0.227960459606299f, 0.784463828083640f, 0.995882406349565f, -0.987273766396493f, 0.0792453274840108f, -0.788403526960056f, -0.619975942121645f, 0.801181796307713f, 0.967884377026145f, -0.781223064263388f, -0.300716486479280f, 0.994748932974184f, -0.200152360574411f, -0.101898131541608f, 0.542914585925881f, 0.407729967031792f, -0.105215843903154f, 0.638066037611924f, -0.563777780161298f, 0.134189395993685f, -0.503320561486155f, -0.0379170306314711f, 0.723638115686875f, 0.747948383928228f, 0.928239905995551f, -0.736883772878758f, 0.892242913709735f, 0.468998243295705f, -0.224406388545097f, 0.758754382878863f, 0.994739001052496f, -0.749837906573089f, -0.938777322178786f, -0.619168635741936f, 0.827875717654585f, 0.294033159230782f, -0.372766318349126f, -0.292752124932124f, 0.396629951868878f, -0.986760927173237f, -0.0841834195975009f, 0.999760803826313f, 0.0142305924173638f, -0.820393900206961f, 0.409972278573230f, 0.227315924377402f, -0.641500351639361f, -0.470788010535406f, -0.486171076557593f, -0.758140688442947f, -0.971539708794928f, -0.949039718833189f, -0.146844988902767f, -0.0183627478820223f, 0.402918762093981f, 0.0620266698060286f, -0.182527786403967f, -0.374395326540229f, 0.566584207940253f, 0.879546558847970f, 0.853360173786566f, -0.515321950652696f, 0.511692631053674f, 0.342152084355850f, 0.374686420595610f, -0.794372980760555f, -0.648670375991101f, 0.761192158420166f, 0.223791993225057f, -0.342720055148453f, 0.965612513218950f, -0.796193009647904f, 0.215057114709867f, -0.0459498239576994f, 0.871047701509015f, 0.664672380241520f, -0.546301701630944f, -0.939910946986200f, -0.213195706858966f, 0.559543622118596f, -0.255844807516886f, 0.509576048776352f, -0.699005089750431f, -0.520317652140772f, -0.924306703712950f, -0.923814193467638f, 0.868401299001930f, -0.571229497763863f, 0.984740691690212f, -0.911782692220985f, -0.265295471266664f, 0.0479848731515942f, -0.195328058836883f, 0.758281465939343f, -0.418177229854869f, -0.263323557662932f, 0.0230762644115943f, 0.382605016442608f, -0.576209059863238f, -0.739785100410209f, 0.0956412509899256f, 0.0369702493097637f, 0.0738922616872486f, 0.589371657036664f, 0.548586250623500f, 0.996096574632666f, -0.574178408335425f, -0.827059309028347f, 0.600283403682961f, -0.0651062813338117f, 0.985857002071398f, 0.982700721670305f, 0.777628710286989f, -0.139415722014730f, 0.951156387462424f, 0.806391217144736f, 0.135433009714206f, 0.252388414319270f, 0.485541324740928f, 0.270688932431637f, 0.892850103229909f, 0.440168171407923f, 0.515384398158669f, 0.600884162546465f, 0.947986221531091f, 0.339440884303404f, 0.403857490690436f, -0.937015609644647f, 0.729529495316627f, -0.389601866986821f, -0.420712615666380f, -0.763003723744745f, -0.0619534667970105f, 0.486654476027536f, -0.943536854881494f, 0.471171699317719f, 0.996886209046820f, -0.945316270673373f, 0.230772742042993f, -0.621222111022648f, 0.838934157721328f, 0.124035987915113f, 0.737576768711407f, -0.217898078842006f, 0.0429859145211120f, 0.223685413947773f, 0.820073956039170f, -0.378381145423743f, -0.335672684173821f, 0.649791267584388f, -0.457253860252872f, -0.664776842833046f, 0.150429615666837f, 0.974812973893170f, 0.00119972362050369f, 0.140744912838368f, -0.252632269055503f, -0.124205752907507f, -0.383194456927254f, -0.356455432479067f, 0.0694989880525767f, 0.188230048541949f, -0.854592697407303f, -0.902559387772971f, 0.454054169179423f, 0.534684767654295f, 0.806837289706952f, 0.274203715752641f, -0.765433763984323f, 0.459365005291520f, -0.896797218412250f, 0.382900474341852f, 0.169400421233177f, -0.184111368111075f, 0.0323514487432812f, 0.621015577938758f, 0.139872518806323f, 0.480965263781330f, 0.0649386999855643f, 0.815365754221614f, 0.761990264098834f, -0.0927412249348933f, -0.580853742457387f, 0.211615321410605f, 0.165159968106305f, 0.305515629345863f, 0.725748395743965f, -0.667649812347274f, -0.621843189978885f, -0.939317191264789f, -0.197108718554958f, 0.902152006895939f, -0.889744652803018f, 0.667113256888905f, 0.929471703711725f, 0.660025836042506f, -0.0712223078913006f, 0.416152292126436f, -0.602223852277700f, -0.828462878627106f, -0.956915163338265f, 0.298196541541469f, -0.933863927954050f, -0.198745190221695f, 0.749101206471011f, -0.922366396086261f, 0.769953026855636f, 0.971459582749177f, -0.226637139032289f, -0.593509265485619f, -0.635649447577657, -0.443127775644156f, 0.350464269654307f, 0.379979516655134f, 0.896282784801247f, 0.00871209446887344f, 0.401818712823609f, 0.815422566258939f, 0.215868289995843f, 0.682217845700443f, 0.508819667108007f, -0.988484263336122f, 0.216656890144568f, -0.185777888700071f, 0.522106353117928f, 0.894211314619113f, -0.779300881699217f, 0.137801937535128f, -0.818740955579722f, 0.637214461095055f, 0.187867696634722f, 0.184985729971243f, 0.315323389557324f, -0.0312525033775366f, 0.498559120407008f, 0.855778208118391f, 0.936851170962385f, -0.0524308158818188f, 0.257087262622978f, 0.816141818246927f, -0.147192803443011f, 0.194545158383538f, -0.655428449892669f, -0.650441844539509f, 0.536015423540886f, 0.0250060573607953f, -0.863380305825989f, 0.0605420782823460f, -0.963662464088496f, 0.689136717877590f, -0.929664162821947f, -0.327349437742288f, 0.713122240487331f, 0.765587094162777f, -0.314350325341316f, 0.409992519686522f, 0.753377832105546f, -0.756848529995586f, 0.760787899507869f, 0.512213162407276f, -0.674820237484644f, 0.560776719592082f, -0.874905891603855f, 0.925202682923872f, -0.907405002733482f, -0.575836335118172f, -0.248173888600965f, -0.187923239740639f, 0.230951002247789f, -0.540190666146588f, 0.390890663320481f, -0.705511708249712f, 0.0980457138183717f, 0.879979753648798f, -0.378326046226794f, -0.645363625221967f, 0.883365508962968f, 0.728720763588748f, -0.191571576393619f, -0.941989254130187f, 0.944312154950866f, -0.367184985473008f, -0.974124559264444f, -0.579946765132286f, 0.509825236656578f, 0.952047194261820f, -0.0955445631918663f, -0.00500764501201401f, -0.00111382665477655f, -0.0404281661495578f, -0.265706359102834f, 0.865881843285797f, -0.947915521623861f, -0.820337973623839f, 0.0843747524022067f, -0.948599514028391f, -0.464018526769358f, 0.600790429663803f, -0.0779017384430381f, 0.756949801920938f, -0.955436496929340f, -0.553346424499498f, -0.401256107066610f, 0.569624108543687f, 0.179455179577041f, -0.189386842296675f, -0.467166492259358f, 0.367644583467601f, -0.722338735126514f, 0.863903729827081f, 0.0631027352569811f, -0.982269235503679f, -0.837788470642698f, 0.421730643738386f, -0.671745211565315f, 0.858467932275763f, -0.745298219348761f, -0.659594977600028f, 0.403238381269873f, 0.951987904652099f, 0.228887404582426f, -0.331665752024408f, 0.794789885033899f, 0.669978127515269f, 0.977583870328654f, -0.346398989178462f, 0.692053246433782f, -0.159407706019695f, 0.710808563527500f, -0.555701359319642f, 0.625665798239905f, -0.711048329414687f, -0.672431532474912f, -0.474897384314332f, -0.196250611816064f, 0.902140605659856f, -0.459732035217428f, 0.651412290305649f, -0.686137550630920f, -0.803228611526547f, 0.371120664039117f, 0.289869860968561f, -0.720979161638185f, -0.0940498575417996f, 0.185025844935128f, 0.401524077274769f, 0.811721346556136f, 0.224659861626089f, 0.106438807548742f, -0.117458956991326f, -0.407361487623449f, 0.683891165426988f, -0.216582410631386f, 0.710644530504861f, 0.867797453793643f, 0.626683550176870f, 0.115061097783331f, 0.976742668387085f, 0.250700864990527f, 0.272723539841862f, 0.159923684669346f, 0.167713264013185f, -0.445764377935606f, -0.489538472614810f, 0.227880894824940f, 0.670702116476237f, 0.610361511284318f, 0.503801949624464f, -0.687816091694902f, -0.0413765153535617f, 0.155769004545734f, 0.921910233366689f, -0.467299226678025f, -0.991984541712805f, -0.527009262324220f, 0.248157897392517f, 0.661145853979517f, -0.975947426744844f, -0.242453990684693f, -0.277956284573619f, 0.162010437415540f, 0.889456199489152f, -0.171259539670729f, -0.0636124576727060f, 0.311318764402696f, -0.227771282875219f, -0.567702050585727f, -0.132881625149059f, 0.870846950418812f, 0.440078398779761f, -0.0908818839265000f, 0.410077545060762f, 0.917678125288724f, 0.975295290129489f, 0.736514272579886f, 0.653896379317074f, -0.166512942888681f, -0.218665383726096f, -0.0688642360506688f, -0.596589868100824f, -0.180873413844075f, 0.229002598511067f, -0.647630976455599f, 0.722615884501717f, 0.760194030884127f, 0.253262836539679f, 0.0734191803957118f, -0.941427952376035f, 0.224118866807764f, 0.634990976599086f, 0.538622500570355f, -0.591487367587299f, 0.829253069890529f, 0.426659996899884f, -0.562435396124737f, 0.924178169394878f, -0.693964899988321f, -0.520472617448914f, 0.845157115508053f, 0.162984246343684f, -0.212032053476592f, 0.0482566706558292f, 0.820584028875367f, 0.676120066619505f, 0.590174358812695f, -0.457289938956925f, -0.351282540371674f, 0.322162683499620f, -0.683726196205246f, -0.279636659553935f, -0.186133028676429f, 0.965481755833750f, -0.0550172560314044f, -0.437844829991532f, -0.448670532146325f, -0.438916826946834f, 0.830205353164842f, -0.0125988502002286f, 0.733716462327519f, 0.870000673588185f, -0.189915082276716f, -0.676269331249200f, -0.336432931956768f, -0.288892891213265f, -0.912569275291884f, 0.509853767908707f, -0.658452317958678f, -0.562848133961047f, -0.102082581799095f, 0.904062026055565f, 0.473339990381854f, 0.210234896873676f, -0.0884007008398613f, 0.720872020499257f, 0.538315255331760f, -0.884485227439286f, 0.160844002639634f, 0.625863524205804f, -0.947487159926400f, 0.362643826956149f, -0.189913270725334f, -0.110428721523612f, -0.666510263156819f, -0.214827103263521f, 0.912669747474334f, -0.973896103049543f, 0.665373714127588f, 0.148135031012834f, 0.126524689644449f, 0.00283763548841764f, 0.312700495893193f, 0.579520771033243f, 0.677583023476560f, -0.779567427807191f, 0.0694994546110597f, -0.298762697062437f, 0.655210050716681f, 0.435909078048151f, 0.322095567178671f, 0.764827170021089f, -0.713736794113842f, 0.992844460358584f, -0.735915506109616f, 0.280204875392391f, 0.584446532772711f, 0.796955505835788f, 0.742508124239176f, 0.0785523490091065f, -0.562359397016753f, 0.874448473576734f, -0.794251927759664f, -0.658767152705445f, 0.120015806343044f, 0.662372174700575f, -0.719334975225296f, -0.663474261357014f, -0.637663874969148f, 0.706137632813821f, 0.734790814693796f, -0.449118755654663f, -0.758125670003823f, 0.719059339327447f, -0.228679956701166f, -0.0782671261690160f, 0.637830522744746f, -0.178696376536345f, -0.848273935253246f, 0.840882430630200f, 0.977813953976437f, 0.565474986185913f, -0.807314895274907f, -0.100534840844589f, -0.436186956483089f, 0.854663592026441f, -0.547576146320248f, -0.621784076386717f, 0.688687549426321f, -0.688962085987764f, -0.998914668418794f, 0.751493418398842f, -0.203018738091861f, -0.881317097659280f, -0.422480898609404f, -0.321074554557095f, -0.759379357125740f, -0.806503084491033f, -0.496837315822352f, 0.217087355208111f, -0.776801484423500f, -0.445747498145286f, 0.710204776554782f, 0.274276964033182f, 0.650397224484409f, -0.709395921248168f, 0.862663541330686f, -0.946166202558813f, 0.826638502366159f, -0.450587332736099f, -0.808257632193740f, -0.414360554482101f, -0.471118187583276f, 0.981592919290155f, 0.192794908371370f, -0.314979855997427f, 0.722518962804398f, -0.795914669179603f, 0.121447532644509f, 0.0446893237592363f, 0.651720955387594f, 0.897128141094619f, 0.283834144643742f, 0.369570391543943f, -0.163784005163726f, -0.799144231493300f, 0.338136741961422f, 0.795991730702685f, 0.601735561139351f, -0.556654767533027f, 0.907044495725416f, -0.374604065784494f, 0.814308532452677f, -0.254295412850351f, 0.443103437041340f, -0.0218296619602199f, 0.826728672505738f, 0.773205771668962f, 0.171909022893217f, 0.497670481959597f, 0.954178712898056f, 0.0840098577761919f, -0.705861127301893f, 0.145663865959608f, -0.436204975766037f, 0.479359595998989f, -0.719493824988072f, -0.523146212355768f, -0.917822711649927f, -0.610003715217602f, -0.192266667446473f, -0.377507163265653f, -0.250419291332051f, 0.873627391381727f, 0.922899703740095f, -0.902411671519496f, 0.285830821349708f, -0.577368595723736f, -0.598296174995687f, -0.0152478418690674f, 0.503725955636280f, 0.946501779740920f, 0.261108140547963f, 0.206258978593364f, -0.887022338332430f, 0.989187042741485f, 0.461764104690670f, 0.305280284664753f, 0.243972878436235f, -0.573704516784209f, 0.111805651228880f, -0.373590027525854f, 0.574564836347642f, -0.712884790778729f, -0.0570130063179222f, 0.244209425500712f, -0.717492787619277f, -0.476920207759357f, -0.444169983027413f, -0.254851417015366f, -0.505678630542571f, -0.953549022234155f, -0.0316841901798541f, 0.198256779602804f, 0.151938229162240f, -0.0259028503944394f, -0.799645893003010f, -0.889308912372168f, 0.339221517072804f, 0.904784479404768f, -0.367330903112591f, 0.866281762131661f, 0.112765232993802f, -0.0852946527317187f, -0.283538359072154f, -0.734951426632046f, 0.502970854898684f, -0.541434927857400f, 0.881496286285600f, -0.227404039639917f, -0.636983936776183f, -0.0799774217214970f, -0.833780310813424f, -0.222787370954425f, 0.433143783060434f, 0.0953330524947187f, 0.965400264971588f, 0.308927931247299f, 0.344316393259575f, 0.122880788538352f, -0.898509922382301f, -0.187062523329053f, 0.705352247460646f, -0.817811000761718f, 0.303714513401701f, 0.714863075518907f, -0.00862372607283035f, -0.842715848975590f, 0.816504077307885f, 0.924594085591125f, 0.334618732730041f, -0.212414743241377f, -0.758289625449925f, 0.586405661412351f, 0.909247363444287f, -0.800422609846793f, 0.397430897916299f, -0.408827454151232f, -0.411913213123543f, -0.602703152770135f, -0.893591462026327f, 0.417648762458765f, -0.766362696266534f, -0.166060103951854f, 0.883234167729589f, -0.0741908774062401f, 0.113912882075078f, -0.268248292164738f, -0.825585719915457f, 0.885446166477969f, -0.996523379251940f, -0.000841720632677401f, 0.940286529247477f, -0.528330498750176f, 0.0938880690147421f, -0.966296878893937f, 0.891956527154360f, -0.483384605653306f, 0.257210342748458f, -0.820220338820906f, 0.363913841603935f, 0.0364865250689275f, 0.0619156958713947f, -0.645447937080250f, 0.548279343062761f, -0.289526240449473f, -0.506780094171335f, -0.901771170107367f, -0.437874075223813f, 0.748512212111141f, -0.529884246718074f, 0.924062132675193f, -0.365432219122282f, -0.263296006595835f, -0.927083881647913f, -0.192737974697553f, -0.450051159199964f, -0.543528645806642f, 0.834976909049276f, -0.426975046433596f, -0.361056079272416f, 0.883880063360531f, 0.680380429911630f, -0.553642515320953f, 0.548847108935282f, -0.357430246936948f, 0.210445016993628f, 0.949511601115471f, -0.611278947360487f, 0.344744934459962f, 0.0684247970496175f, -0.877154656281116f, -0.521992702610556, -0.0303764312006813f, -0.647220068176984f, 0.693175336224119f, -0.0955602614554496f, -0.765579758912278f, -0.821318118938906f, -0.220936603794347f, 0.159013709512021f, 0.0222743973539492f, 0.569438412513281f, 0.896083437551563f, 0.973699071868637f, -0.403438951991928f, -0.976931032127622f, -0.0720613180573018f, 0.0788813367661694f, -0.430781354548607f, 0.580378296309349f, -0.175446689199481f, -0.256743557012462f, -0.696667845393283f, 0.870473046831235f, 0.146660713923108f, 0.277741407197705f, 0.502075064404417f, 0.396530064046844f, -0.000209092342246420f, -0.977003947244262f, 0.451457326960000f, 0.420509664462095f, -0.0826395067671402f, 0.461120688156973f, 0.786867285802415f, 0.429254905841222f, 0.894426863739026f, -0.670297281923597f, -0.833650409296060f, -0.908588009702110f, 0.516311115539149f, 0.975234001829324f, -0.532953533466378f, 0.775291582519158f, -0.0136022600428900f, 0.654817093112596f, 0.363512141498233f, 0.624779024037534f, 0.0237004661473674f, -0.172570506046968f, 0.401807838319043f, 0.997391258152958f, -0.553969395939123f, -0.415425175833161f, -0.758032843655304f, -0.482766088920005f, 0.637574309072414f, -0.729000055114342f, 0.699851428676091f, -0.827508053421131f, 0.900655803848482f, -0.431149800814228f, 0.0369409101983413f, -0.378608101457895f, 0.237564147838841f, 0.533020461112441f, -0.280269627508005f, -0.864065787343603f, -0.0381481642453043f, -0.566886547530062f, 0.539727700361167f, 0.166859339425035f, 0.850080295054718f, 0.384690146030125f, -0.384995288415294f, 0.303656036600558f, -0.580297619022502f, 0.0649069482840878f, -0.162922327392773f, -0.235019427063355f, -0.265468718118809f, -0.121827312187455f, 0.0416628805824146f, 0.343481543012411f, -0.251429566892972f, -0.868100204320718f, -0.802636407512128f, -0.549547579028752f, -0.570017983863503f, -0.853634311513627f, -0.564570567173235f, 0.955944215494794f, -0.0930750790375956f, -0.160319122401953f, -0.640886790354213f, 0.798634607857513f, 0.503051518023559f, 0.765247226736789f, 0.909476811674882f, 0.677590253114963f, -0.110641683440517f, -0.336445241915220f, -0.684064840782028f, 0.962285048920031f, 0.883303701653897f, 0.981819291389659f, -0.597290928759656f, 0.215792997443025f, -0.847656608719347f, 0.679887992445640f, 0.299901700372808f, -0.677306526467426f, -0.348340058872692f, 0.651490451411335f, -0.133387041637395f, 0.718311240322040f, 0.0869279817052975f, 0.155413706090559f, -0.869119988858735f, -0.566773040844476f, -0.0513826414151206f, -0.368087669232071f, -0.978175512831125f, -0.229213501073727f, 0.344608572405871f, -0.663307667219997f, 0.437238632879575f, 0.00205230197288353f, -0.0897076092856746f, 0.834529513214144f, 0.131872357342232f, 0.113081940417244f, -0.418620232731326f, -0.317993033651213f, -0.740303025960662f, 0.423423655701288f, -0.300833032468860f, -0.458960388256530f, 0.692670405117589f, -0.559944357561921f, 0.0168623577148430f, 0.568661331088367f, -0.385055363002398f, -0.356055436463140f, -0.794446573681063f, 0.908870080953069f, -0.295500656666577f, 0.800625150733729f, 0.206307902542489f, 0.729591183391974f, -0.0655746333947396f, -0.261707022686154f, -0.802380330579914f, 0.0812359238243023f, -0.00528231140765212f, -0.725740453383981f, 0.919076065030463f, -0.896497189839174f, 0.861919731820265f, -0.804273875755869f, 0.230339021648310f, 0.296779613186519f, -0.349872572510143f, -0.270230381483447f, 0.0368924200249658f, 0.581340248642417f, 0.943620537648739f, 0.715012058065301f, 0.528414993233909f, 0.695917111744314f, -0.634354198968852f, -0.483786223099716f, 0.565405035681248f, -0.530076864213017f, 0.363019522302994f, -0.825556544716473f, 0.891096876998683f, -0.990692760548295f, -0.450641405862313f, -0.597008073985341f, -0.464377765418678f, -0.942926913464693f, -0.871399725569805f, 0.232335933943403f, 0.858786794807406f, -0.528589179815518f, -0.324757177062634f, 0.595880088750788f, -0.976574570427974f, -0.423824220654658f, -0.832990206908489f, 0.198704682807118f, -0.168244652325292f, 0.843066822744011f, 0.0912498543932607f, 0.485570815146582f, -0.104653316420662f, -0.623461298489716f, -0.807713596811018f, 0.737782734425857f, 0.456364368166532f, -0.430703367862900f, -0.188953991637209f, -0.827984282695373f, 0.0246267653665548f, 0.891225605267640f, 0.910600867999638f, 0.345236086687552f, -0.600682365520065f, 0.833182106437698f, 0.213749250288017f, -0.0866339102562885f, -0.618385082289017f, 0.859527120927500f, 0.749978780964161f, -0.334770513867011f, 0.242140166670949f, -0.196268320459958f, 0.611789869603675f, 0.655057159657307f, -0.603759576722096f, 0.614654509385217f, 0.144145218488192f, 0.959930150756613f, 0.485009777784726f, -0.564230295010912f, -0.404716165405314f, 0.0442672151313601f, 0.929486639423805f, 0.409386317338224f, 0.527053707674182f, 0.899087569745327f, -0.933259779365388f, 0.265159475034860f, -0.858300862890810f, -0.870994388031662f, 0.354868177430506f, 0.00956840260511749f, 0.429740959889133f, 0.649668163567379f, -0.744532888765288f, -0.967499901569196f, 0.556703631745254f, 0.535130550118618f, -0.639502350153040f, -0.604586469532735f, 0.0799683564329623f, -0.156074786599444f, -0.348308700325411f, 0.217829052228100f, 0.545642400171123f, -0.303317700019152f, -0.473220675222451f, -0.239688108834945f, 0.0998500862725149f, -0.962734081833842f, 0.870743993144299f, 0.464578557934316f, 0.184511089576136f, 0.559729843314504f, 0.0702052363354577f, 0.632714874625648f, 0.212930743289312f, -0.454606863365109f, -0.592679055778218f, 0.287649993384466f, -0.457293694071368f, -0.423493046785686f, -0.0674763327876298f, 0.242131064298176f, 0.488581911885965f, -0.464567743213882f, -0.387515661812354f, -0.914585596974616f, -0.255803162310627f, 0.941267268311980f, 0.690278917089395f, 0.302397314111962f, -0.178461434689705f, -0.949279941481428f, 0.160440202901122f, -0.970582196769486f, -0.0119478205074164f, -0.206440255898676f, 0.221640403444713f, -0.819801447827624f, 0.263614394802488f, 0.616376195532700f, -0.596859494305351f, -0.118659509995453f, 0.458168997595326f, -0.0400474705134108f, 0.934465050133603f, -0.852936731989621f, 0.0191637795580570f, 0.298534793677081f, -0.857491630206749f, -0.0141198383157879f, -0.365027350962024f, 0.450964838023674f, 0.351383095290905f, -0.387039947149600f, -0.983994933095116f, 0.610531582220017f, -0.0446025524732094f, 0.216718014780746f, -0.676819246943449f, 0.0385619292249610f, 0.192482456707739f, -0.288809653393521f, 0.241774557042318f, -0.444638770943313f, 0.535319194413803f, 0.374773141606987f, 0.186364279454450f, 0.0701814972821988f, -0.452753172654203f, -0.350918291268194f, -0.332963791049667f, 0.179301863965318f, 0.954101654404080f, -0.687960044344130f, 0.611454049205213f, -0.696789567124132f, -0.551566492897529f, 0.656434797122885f, -0.601779335396959f, -0.265656331560395f, -0.528821434638507f, 0.153601151147409f, 0.514739334540489f, -0.0517769842323894f, -0.659246830986894f, -0.453055366696259f, -0.0515886000780059f, 0.958478845408115f, 0.0221452906045994f, -0.159960643390796f, 0.816263632871352f, 0.245244170325114f, -0.0919839688704780f, 0.947170598807362f, 0.846772793441790f, 0.247105133025056f, -0.801972939368103f, -0.224977420586025f, 0.130099925027197f, 0.497816036746753f, 0.308139730113712f, -0.0536876417759813f, -0.492022090866895f, 0.188938438822753f, -0.400894058284033f, 0.314370104391157f, 0.618580768947071f, 0.830051263404639f, -0.228700130023340f, 0.811855169643177f, 0.0924092179787017f, 0.273652523319809f, -0.0624274843235475f, -0.503696982048589f, 0.510545161203341f, 0.341823133345436f, -0.437486933663093f, 0.0134072800031224f, 0.613837993234983f, 0.740945655313894f, 0.135311460882606f, 0.464832228842466f, -0.973962843371452f, -0.519388256678232f, 0.631469277357519f, -0.936937468616713f, 0.208677911871604f, -0.0946010975796272f, 0.560587233611855f, 0.230925763372331f, -0.637408482848184f, -0.679175194353885f, -0.408696637706987f, -0.0837464598184048f, -0.911070817707239f, 0.985815432104941f, -0.208807972878988f, 0.741966810464688f, 0.162772839973564f, 0.717702638881939f, 0.490767958961575f, -0.835565390813677f, -0.878516167634055f, -0.956727838876563f, -0.00772081382858891f, 0.355227897612178f, 0.202889185809854f, -0.431078767653467f, 0.106936101717808f, 0.354494042302258f, -0.619623833602791f, 0.193065593078352f, -0.105803087758606f, 0.151828327005194f, -0.141094922099930f, 0.847569902283069f, -0.656683924792181f, -0.880754505470701f, -0.421714047610595f, 0.681762288858050f, 0.633712681698887f, 0.947060360650644f, -0.959122611588459f, -0.0690574969687099f, -0.805062392278087f, 0.226501754467861f, -0.414732397455275f, 0.242398867364043f, -0.831838824773804f, 0.00787391802290793f, -0.860692119913991f, -0.391321299589110f, -0.0548681430681355f, -0.992920640472037f, 0.0975642331777702f, 0.894630836703243f, 0.767919825689366f, -0.260878774442215f, 0.407457430171103f, 0.140688657702825f, 0.737494845272763f, -0.650969054257040f, 0.230613259000797f, -0.0986876345046772f, 0.0996951163848971f, -0.679173062298700f, -0.760174222364469f, -0.613840714529317f, -0.692138390397415f, -0.0919103790884603f, 0.0259548517830916f, 0.463763807478796f, -0.859327137970617f, 0.298600182982665f, -0.591236092977368f, -0.994984881037264f, -0.0533840054951049f, 0.544979189292485f, 0.652482875230260f, 0.897548627394727f, -0.340241293753474f, 0.508237349558163f, -0.611986702936889f, -0.399952468536369f, -0.758494484998191f, -0.148960755782999f, 0.895231513826071f, -0.870487943961511f, -0.172763884748068f, -0.652702954266129f, 0.784450103085903f, -0.428504279168614f, -0.347266234450861f, -0.0897193897382391f, 0.760686883857503f, -0.0863659842493281f, -0.453544362916610f, 0.713112885874267f, -0.529914378597266f, -0.134507787695203f, -0.590955798880753f, -0.372583442870916f, 0.646730663631020f, -0.809515553972267f, 0.0226873348847205f, -0.209338539804651f, -0.737170063193136f, 0.365916689978321f, 0.658019395382111f, 0.733982378695990f, -0.579926149814113f, 0.973814182111372f, 0.933875763922095f, -0.985234946636757f, -0.103124599698243f, -0.798304574918884f, -0.119705341414667f, 0.205941898284561f, 0.111088288053652f, 0.418598493379981f, 0.309112287901667f, 0.0865232803642195f, -0.281174085998345f, -0.158426951248790f, 0.156672456990889f, 0.608691108739118f, -0.124654784531448f, -0.372060827503666f, 0.555750853569654f, -0.481715370485256f, 0.411012047999522f, 0.265636511301544f, 0.164466400718006f, 0.427292785417094, -0.407665783814271f, 0.0463239131527564f, 0.0109249300633605f, 0.0949704798708169f, 0.223291931618591f, 0.708651599857453f, 0.810927407452143f, -0.298811874805995f, 0.347215272448441f, 0.778225160999446f, -0.981258755328673f, -0.629231280170021f, -0.948786159268210f, -0.0530522786747270f, -0.665046033882002f, 0.776993795678436f, -0.604492154463805f, -0.906360689482177f, 0.543616910115371f, -0.501547360013149f, 0.571784796850774f, 0.868511495621889f, 0.783008382563488f, 0.571870376568081f, 0.0471150346240308f, 0.402433510592678f, 0.661353159662286f, 0.0253381317208246f, 0.720141243708461f, -0.478805385943742f, 0.989639021624774f, 0.538614599364854f, -0.282810721919526f, 0.888399971333007f, 0.118572990347886f, 0.564528382703688f, 0.988296121763412f, 0.509638594649021f, -0.797738059997026f, 0.0363326380089621f, 0.978315833815278f, -0.483368013204689f, 0.879051054425480f, 0.632539830439323f, 0.722677742708361f, 0.578919286433726f, -0.250721628167261f, 0.534435049744896f, -0.0404568429105234f, 0.00805525426120179f, 0.841210870775473f, -0.731771544679396f, 0.713758914490801f, 0.830250762535296f, 0.436563669872217f, 0.567024378980237f, 0.983941121609744f, -0.253548560865555f, 0.647105012325159f, 0.434994339049196f, 0.130837710207442f, -0.775136733344706f, 0.234917279141211f, -0.498429841761386f, -0.273571256415041f, 0.247467425899991f, -0.970396693506149f, 0.975835855884816f, -0.347896516486866f, -0.552856369180847f, -0.887336234316568f, -0.573271015958957f, 0.910862901097874f, -0.807236601077904f, -0.523971593712952f, -0.263589563369279f, 0.591056276091253f, -0.320168527954128f, 0.726795865615521f, -0.731502115921006f, -0.942225519371229f, 0.268573107637337f, 0.380348127119473f, -0.284539943611895f, 0.117478291379931f, -0.817442486350524f, 0.0734705767013011f, -0.626880755668906f, -0.873066996524459f, -0.528675805715351f, 0.490255491577847f, 0.398142666604162f, -0.911320079669940f, -0.870350237514323f, 0.854587452657144f, 0.736349579728106f, 0.948232845958681f, -0.00126774478569258f, 0.905641169934000f, -0.965500575551565f, 0.0831330388550517f, -0.892713267782484f, -0.277958019172831f, 0.312987842344813f, 0.484268977417485f, -0.365960524226328f, 0.177956605738091f, 0.913776767689874f, -0.897537691614058f, 0.473075982698961f, 0.913190042662185f, -0.00843862630950820f, 0.972679442298938f, -0.856058592202917f, 0.264007224067230f, -0.138444823656136f, -0.386195416368251f, -0.286657907928107f, -0.231200657384828f, 0.917365701941188f, -0.271317547281263f, -0.252691685075831f, 0.893742787021399f, 0.512463051119608f, 0.979155111008605f, -0.472272776864686f, 0.238767541974988f, -0.672234403865928f, -0.846783135777377f, 0.0877594573148737f, 0.493055606176910f, -0.289012308379085f, 0.416463895880697f, -0.0795051375851281f, -0.476692131327163f, -0.430471976159529f, -0.701875030095239f, 0.724684336417516f, 0.984802039066595f, 0.798285421773762f, 0.000509924988974175f, -0.0852199551444761f, -0.709724122158260f, -0.332735158942919f, -0.741119907407496f, 0.729608513555970f, 0.500578022862182f, 0.520862987462710f, 0.565678561009731f, -0.393741545311224f, -0.568866018100912f, 0.571654318026290f, -0.817900961532165f, -0.793268461448962f, 0.614914392385859f, 0.763415306986536f, 0.450074180772758f, -0.737435729799608f, 0.841185794339245f, 0.894276069286366f, -0.276262284222369f, -0.798623475612628f, -0.280994234105732f, 0.821175230597885f, -0.474251640366966f, -0.190039801864015f, 0.0663032720971493f, 0.884162053156770f, -0.162023139878049f, -0.963135153785511f, -0.582213329804047f, -0.328536493809765f, -0.938405687658462f, -0.0171569611327957f, -0.727260847907578f, 0.419920927745257f, -0.361592243835530f, 0.476989471873569f, -0.146161675185107f, 0.431817832405826f, -0.371528849369885f, -0.940567978751516f, 0.165203770962029f, 0.781321525273307f, 0.0585592625092357f, 0.573299596753579f, -0.378869924017182f, 0.523139576520889f, 0.385605607116478f, -0.235893429970747f, 0.285814921067909f, -0.121941292771133f, 0.621558611608942f, -0.0860979132283732f, -0.627097832687809f, -0.312083243705910f, -0.494490796681559f, -0.987187334387934f, -0.0804474888246625f, 0.496400656176795f, -0.851811189314651f, -0.791398271297849f, -0.868174317799275f, -0.226794668997878f, -0.335339474552766f, -0.276765924750817f, -0.395876032147377f, -0.740529136126816f, -0.167799472110453f, 0.593129248263724f, 0.336783120133436f, 0.248892158925787f, 0.950120283075237f, -0.795216613504226f, -0.574731116508357f, -0.822689608026685f, 0.973698546284335f, 0.125166556654624f, 0.588150318080073f, 0.128654744345192f, -0.219207714307262f, -0.271053050307713f, 0.124071241265810f, -0.618209718015327f, -0.766619799595349f, -0.478340220431165f, -0.446873929629545f, 0.978019432749647f, -0.627041040766022f, 0.169323691066764f, -0.714079827532216f, 0.386101296128268f, -0.360225804976135f, -0.236797717782837f, -0.311635747131794f, 0.0482888201705840f, -0.477302740867809f, -0.427349080854399f, 0.390352470816329f, 0.611790541936623f, -0.648292156214605f, -0.345871618789073f, 0.509300603302844f, -0.0142202703124219f, -0.570248077753979f, -0.0629178211029751f, -0.737806048037047f, 0.497750084049821f, -0.761650107803135f, -0.788756591098617f, -0.994497286039420f, -0.987344273533962f, 0.657151987467984f, -0.763708299084062f, -0.0729359162118841f, 0.0455275633022023f, -0.101919187896584f, 0.457804242981095f, 0.0117715388281796f, -0.274125197027132f, -0.949738804931191f, 0.762108173886486f, 0.405150754308562f, -0.733330375873553f, -0.712774896799572f, -0.791947616412901f, 0.444023894424500f, 0.00507562975249609f, -0.900698136223538f, -0.576055334977054f, -0.948895529956106f, -0.832665060374124f, -0.992753953473078f, -0.0674086978315183f, 0.569494111501383f, -0.962269067721443f, -0.489700810475570f, 0.972626508328545f, -0.777400448149780f, 0.115588644128954f, 0.0730469703310024f, 0.523584488072518f, 0.659055312807301f, 0.134198234373838f, -0.797833055125151f, -0.167842823235145f, -0.662347837139732f, -0.537544370279756f, -0.622353549740796f, -0.789789664448618f, 0.985300123665319f, 0.862449845163424f, 0.973193986256980f, 0.148883268671144f, 0.283619537155083f, 0.508503183151258f, -0.246167305966866f, -0.259543094514413f, -0.778029136807597f, 0.128978622849116f, -0.920978818238085f, -0.116324837544276f, -0.261472397833253f, 0.772449038068069f, -0.696754008784325f, 0.980778877985902f, -0.227636956328402f, -0.472493776528032f, -0.568519858000960f, -0.151689463117960f, -0.102997587484899f, 0.464752146042376f, -0.839114793935065f, -0.0325074343587592f, -0.180618880765978f, 0.0132253638432844f, -0.646173464496730f, 0.821983901071593f, 0.657453744559881f, 0.786315172070382f, -0.438718096604728f, 0.702691078885442f, 0.859957412428682f, -0.505281395658564f, -0.236722160990303f, -0.698465568366759f, -0.746418979540090f, -0.218205126412646f, -0.808715244840435f, -0.949813739800491f, 0.176975348790769f, 0.723960974918154f, -0.139253733704369f, -0.387224393658603f, -0.869945438924443f, -0.396979039594941f, 0.0256060022407458f, -0.566074790002811f, -0.161564565183606f, -0.736189868188370f, -0.205593811665825f, -0.628996407588712f, -0.0266462623004120f, -0.344127255771429f, -0.229003801178142f, -0.469786561635510f, 0.258249378153965f, 0.160442939158622f, 0.0528817242116550f, 0.261960766261548f, -0.571069557415276f, 0.411333771884545f, -0.145205354714326f, 0.249324532476397f, 0.163889600722793f, 0.649915677347011f, 0.147077371087195f, -0.227104208942068f, 0.867390199578604f, -0.0734153565896754f, 0.0491208061060167f, 0.0360590744216485f, 0.181620126101180f, 0.0567549454976457f, -0.856976992549465f, -0.242511192726339f, -0.624770508991394f, -0.793161214564285f, -0.251208532727981f, -0.833192309869275f, 0.368166434661069f, 0.939730260791580f, 0.305796202211942f, -0.598830491282818f, -0.0575368190467946f, 0.371329658849021f, -0.227872714677810f, 0.707539568196379f, 0.795186297468385f, 0.475847791658551f, 0.829361555893632f, 0.405386540930889f, 0.213282954068900f, 0.767339023510319f, 0.525055513018554f, 0.259437496637378f, -0.524342591286100f, -0.731515526086696f, -0.233118783725590f, 0.237972339628935f, -0.933985285078109f, 0.537013420173496f, 0.498819465200784f, -0.407713459607516f, 0.382821417923595f, -0.416894700661466f, 0.0787266904103943f, -0.0627973593192392f, -0.320105342653426f, -0.844066834407447f, 0.138221622417319f, -0.676665423871596f, -0.961043785105959f, 0.832268610130385f, -0.905530890441773f, -0.114191325652611f, -0.376697124207843f, 0.390323137798417f, 0.953143142925101f, 0.983427991280007f, -0.0895687386326503f, -0.681543125061097f, 0.677131540142176f, -0.867715848764628f, -0.812718786220309f, -0.212509939486840f, -0.990002327123638f, -0.0682855560011961f, 0.129310729289606f, -0.623746296335073f, -0.285580241032587f, 0.235626081900812f, -0.611973228709249f, 0.539189737955466f, 0.970058678533189f, 0.901944358898624f, 0.168094826408153f, -0.666711281252260f, 0.965612752173968f, 0.651034558458719f, 0.687501917067508f, 0.758614314567106f, -0.839396045781239f, -0.552775028233564f, -0.528941743867256f, 0.174761156721889f, 0.243585712774679f, 0.588913151268911f, -0.306898192880627f, 0.921540023069231f, -0.0223654942298541f, -0.102408576957649f, 0.612577852207921f, 0.835809058447089f, -0.437118459197839f, 0.455316033239981f, 0.311435507416257f, -0.648992336007256f, 0.346823844785409f, -0.632080213667648f, -0.599678627679202f, -0.653822991854328f, 0.484305292443427f, 0.782046295685087f, 0.960987598814982f, 0.627169162605570f, 0.948092598306120f, -0.185268381817018f, 0.602489977060513f, -0.885827813790617f, -0.00179203147433582f, -0.175476447614991f, 0.0461282236560925f, -0.898013889602944f, 0.256310837914276f, -0.733422110056865f, -0.740091677658095f, 0.966724540497493f, 0.328056986822768f, -0.267854591449557f, 0.670545831663244f, -0.356204313297688f, 0.0729865206358908f, -0.594530723723669f, 0.519965324048968f, 0.0632129606097647f, -0.878434885663544f, -0.497945943395010f, 0.0151854050905818f, -0.218036856012343f, 0.547721213710874f, -0.0915514918588898f, -0.279344098401951f, -0.228654882218650f, 0.100432155997130f, 0.802024600677294f, 0.175832345686877f, 0.0551231013299744f, 0.938247319394824f, 0.639298571360036f, -0.291461603371678f, -0.853503115314794f, -0.604829242631156f, 0.0291571486740745f, -0.932575328418390f, -0.621235088415116f, 0.403040314052094f, -0.809695618266849f, 0.966605888732736f, -0.199254401023053, -0.540808222970056f, -0.0141840769249790f, 0.114579158224093f, 0.466889318471371f, -0.145415211797766f, -0.846707387707480f, -0.881237200733915f, -0.410798723199712f, -0.637697860299854f, -0.196366036081372f, 0.193267531425712f, -0.258591200841940f, -0.173003722066551f, 0.478121376006132f, 0.953819951501542f, 0.969916001975448f, 0.131515861287576f, -0.499829658784781f, 0.320952777516193f, -0.226980682212371f, 0.766886115655233f, 0.647310434110803f, -0.772594685974992f, 0.772645949480187f, -0.936357605801364f, -0.671842916281206f, -0.595127074295355f, 0.335132581825520f, 0.648964430112689f, -0.793376819398441f, -0.963663232647360f, 0.914308824314478f, -0.397663128784982f, 0.803240040231588f, -0.291039120047626f, -0.339918835846510f, -0.208620988780609f, 0.278177231697424f, -0.833157746552451f, 0.260554706029473f, -0.580537744139231f, 0.918561093477862f, 0.641368468308093f, 0.827379039283645f, -0.412231303854834f, -0.518315486749742f, 0.423356687848085f, 0.0777277584993787f, 0.394127392657178f, 0.609705410002715f, 0.264669032561337f, -0.460555696512027f, -0.0858908123066196f, -0.281781559603429f, -0.179777723960362f, -0.00449990348855067f, 0.803703377739133f, -0.155074032314596f, -0.00206139428833696f, 0.0661730930565525f, -0.737509215752079f, 0.620182143819587f, 0.114750705414661f, 0.545663051433958f, 0.661601724477194f, -0.592280382351976f, 0.609240020031149f, -0.968781019917808f, -0.668068368389875f, 0.206915551463500f, 0.0951453192552747f, 0.268580107578401f, -0.0450052302342363f, -0.933589842483940f, 0.236570492858402f, 0.0688734168318912f, 0.930163232697303f, 0.435953476823146f, 0.533759385687075f, 0.368282038662015f, -0.602312961473778f, 0.709516631712345f, -0.168303926671961f, 0.130670870119294f, -0.657736111745007f, 0.115028598388756f, 0.173728026281032f, -0.681671363429886f, -0.538786035950873f, 0.481457671665448f, 0.0136795278434168f, -0.570065342244344f, 0.188187050857249f, -0.352869308173680f, -0.979175308628854f, 0.223702879460018f, 0.994220466087713f, -0.147795166105729f, 0.218427535879435f, -0.120050826084179f, -0.0124939247430063f, -0.645134875027126f, -0.503122688484778f, 0.534123007328982f, 0.619710972635444f, -0.234248243706177f, 0.987144458053815f, 0.261284702576427f, 0.851827092094236f, 0.750019654249059f, -0.926154630610335f, 0.449356103243440f, 0.783011320523296f, -0.459228158107270f, -0.228877816937867f, 0.271108937592868f, -0.676085611673506f, 0.783114428240160f, 0.636093784021493f, -0.754110314308629f, -0.546386104880684f, 0.0385811136139234f, -0.768951137117397f, -0.644624743947807f, 0.00890157035391148f, -0.0792572116273387f, -0.989980668770044f, 0.603057533157075f, 0.280835727469123f, -0.634716709420524f, -0.712669415138995f, -0.424129916157595f, -0.436923748487354f, 0.467366013559791f, 0.907740481011987f, 0.788617065944311f, -0.152237692069130f, -0.963044404518533f, 0.907393322909416f, 0.806867676446313f, 0.699270310021791f, 0.107867603776547f, 0.127360747415417f, -0.502645789696788f, -0.511744166872327f, -0.121672719343072f, -0.596527146770249f, 0.410180172377510f, -0.852889849908704f, 0.278972213674154f, 0.0260156356783650f, 0.997558501949683f, -0.499245840292893f, -0.451169267624132f, -0.881643497362337f, 0.986957209874262f, -0.129608292321380f, 0.935829016346258f, -0.649021465281634f, 0.550436689069794f, 0.278888743082679f, 0.0137769346664500f, -0.660666060213522f, -0.416709136728042f, -0.302903068397225f, 0.180657445835459f, -0.908195955986293f, 0.280056533234627f, -0.660025789034158f, -0.798207438952561f, 0.901575224780405f, -0.608702932295102f, 0.318860199910414f, 0.874005722023406f, -0.0816057579181704f, 0.981671341873017f, -0.339234700161323f, 0.559717959858931f, 0.390363525109105f, -0.309384476087470f, 0.956563156784297f, -0.623734354817613f, -0.196627375289105f, -0.702076014509088f, 0.293098766889643f, -0.617152224560368f, 0.859117491438645f, 0.661015739867647f, 0.0747554166353739f, -0.282417009682732f, -0.667461537762524f, -0.451029960388404f, -0.464518668674360f, 0.591389440503293f, 0.552648871601186f, -0.242406315814918f, 0.147876771864331f, -0.00605730052917419f, -0.850648363553678f, -0.659957159486993f, -0.165475362851332f, 0.204150315434812f, -0.665767311591476f, -0.716154682563576f, 0.417487456932076f, 0.448184990956287f, 0.733843802413198f, -0.170228277851921f, -0.346809954182150f, 0.956058632188011f, 0.0315623945930987f, 0.509027121691627f, -0.147826185909834f, 0.717423768198044f, -0.153258078639530f, -0.586190749016474f, 0.122228033051868f, -0.884999045468193f, -0.364729711773548f, 0.0869976154696972f, -0.793532199218799f, 0.533748273468951f, -0.852754376244435f, 0.294752047699830f, 0.136764278163013f, 0.838074791168389f, 0.795224598541123f, -0.778005568697498f, -0.260924769562304f, -0.303759147861313f, 0.273726011325558f, 0.530476779331216f, 0.0866801234357086f, 0.0677702376031544f, 0.724353404182035f, -0.974710312543683f, 0.791838170482991f, 0.247768259921660f, 0.979431048271259f, -0.386992541899814f, 0.0640038231299192f, -0.00457726816166693f, 0.371455553726539f, 0.647649995487707f, 0.268304945808406f, -0.320428608173924f, 0.0927511620029309f, 0.256010036486838f, 0.740396212690346f, -0.656873241472848f, 0.823534292439413f, -0.820380362458844f, -0.453300307443023f, 0.784238355222248f, 0.912791840124321f, 0.0999478035440859f, -0.212620916988855f, 0.0170290625008669f, -0.589062380565879f, -0.171833624145497f, -0.524918122866141f, 0.961528292650892f, 0.101262818636430f, 0.941455114569308f, -0.967226220138929f, 0.616781547648562f, -0.913823148383971f, 0.274508821885917f, 0.924653374107756f, -0.866302908989783f, 0.227541907715857f, 0.0907574361370582f, -0.127499097943315f, -0.942071371521895f, -0.119419163649152f, 0.674284088819523f, 0.881328505929745f, 0.246290207551702f, 0.0547607254148590f, -0.462882918359077f, 0.888969728230585f, 0.666583509571921f, 0.238417203582380f, -0.279842248122727f, 0.855260336845903f, 0.314306869401155f, -0.188654877893078f, -0.609304918228150f, 0.169453885325888f, 0.265617874907016f, -0.943423537926184f, 0.493118676869450f, -0.386147750024858f, 0.0103920154342951f, 0.753677832518483f, 0.363353012331066f, -0.286620106520429f, -0.623332994906295f, 0.183966714365642f, -0.124278942882867f, -0.687889346448110f, -0.509002319646341f, -0.705769785650865f, 0.600586126467172f, 0.814989294939922f, 0.198959025256652f, 0.477897007911356f, 0.757957814363899f, 0.617755921094230f, -0.353589871947529f, 0.419688673189503f, -0.860584865805600f, -0.0232779635193843f, -0.789951030889387f, -0.893196700185750f, 0.610996462535201f, 0.847373590985131f, -0.989553358501822f, -0.367651771428081f, 0.741563712056747f, -0.923595352848971f, -0.580174215739367f, 0.577092000574232f, -0.910872910110270f, -0.907499077314190f, 0.692372247654077f, 0.810694134592084f, -0.608596332548047f, 0.761254615051625f, 0.0546240611947364f, -0.393956427117691f, -0.116127831535139f, -0.0352014590913388f, 0.374742194768889f, -0.927344099730091f, 0.939301337232488f, -0.969831716293845f, -0.0489333404770240f, -0.586719398908953f, 0.0235541378462407f, 0.388882981728285f, -0.0728483242295113f, 0.418280445244943f, -0.574289337805456f, -0.779962057565259f, -0.835190719754123f, 0.918717316922657f, -0.765889988109173f, -0.935310664146932f, -0.0750906135370848f, -0.256246546197534f, 0.693865929543926f, 0.592800255527084f, 0.836743344551035f, -0.801953470827580f, 0.0595524153568945f, 0.158376549012192f, -0.429364776412726f, -0.450531184162532f, -0.169317185285268f, 0.420344570579195f, -0.902838087574441f, -0.654676904337469f, 0.941802178622893f, -0.411034608875500f, -0.455381371659872f, 0.582371240315256f, -0.276150504466756f, 0.164276403376185f, -0.960238817086774f, 0.590055303394028f, -0.995185688656226f, -0.285809748360467f, -0.792066171752882f, -0.456123303649101f, -0.864169187700384f, 0.798745251308383f, -0.517673464079948f, 0.523086536900369f, 0.398784615211052f, 0.908677185333852f, -0.434846969584770f, -0.277024535706464f, 0.575800013122065f, -0.0423952171673019f, -0.327530749916683f, -0.401220909875065f, -0.232577533032385f, 0.577630268254944f, -0.733290201484409f, -0.297499739456838f, 0.166541885572822f, -0.646828619904039f, 0.0312662656272755f, 0.754145050600965f, -0.908499825108811f, 0.315379190361296f, 0.366242661082351f, 0.867903806940678f, -0.613391940567782f, 0.00760147209048068f, 0.953424134034927f, -0.812551125910811f, 0.734998935207065f, 0.781720854678504f, -0.653974423413561f, 0.612587888218526f, -0.297359914095386f, -0.409559158758694f, -0.143962230212734f, -0.814888102841114f, 0.359131810502055f, 0.356924557741016f, -0.872415989401612f, 0.716849887848809f, -0.374916928585818f, -0.0702264435280595f, 0.329843438660215f, 0.0956097573088677f, -0.937528128860310f, -0.322293489817529f, 0.781444964993177f, -0.810141738751828f, -0.150295079242497f, 0.846909181293597f, -0.128124277517711f, -0.752611695817661f, 0.839996835828451f, -0.0705685941510277f, 0.000366462394740585f, 0.0788016995849923f, -0.246053200655556f, -0.156645099915028f, -0.460752333796863f, 0.622021359864204f, 0.722871957583123f, -0.257873353238499f, -0.309810184480446f, 0.765248644407833f, -0.553316047243663f, -0.612742789838491f, 0.354017349601509f, 0.923293368553697f, 0.630695912377860f, -0.148750121613537f, -0.821801680234240f, 0.368247966228196f, 0.405416044101496f, -0.803232509711354f, -0.429778551911399f, -0.723837414527446f, -0.963925147452133f, 0.190882872226757f, 0.477008077263598f, -0.661282403679070f, 0.271643442525556f, -0.915994079618801f, 0.196564556546175f, 0.378359035245796f, 0.584016730657668f, -0.0377864332655202f, -0.327376192853106f, 0.850744189707984f, 0.799571679043808f, -0.111126908452029f, 0.525587242291601f, -0.404486180733535f, -0.134496922397279f, 0.0890128096708100f, -0.815560643303157f, -0.920166023598312f, -0.360079578314899f, -0.556238898466371f, -0.220978103133838f, -0.571530268052405f, 0.573332217175226f, -0.133862258696460f, -0.982130330352248f, -0.352538465285082f, 0.318683937697894f, -0.790927430842686f, 0.691168535237102f, 0.806014327242002f, -0.981639450008060f, 0.407200095027265f, 0.918249921845949f, 0.776880149695420f, -0.437773083955269f, -0.385117533333437f, 0.0115152415796460f, 0.687224538003991f, 0.992524870612626f, 0.471003324792228f, -0.873541777412034f, -0.560923118634380f, -0.726151823613842f, -0.538941951730010f, 0.772057551475325f, 0.858490725829641f, -0.168849338472479f }; # 102 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" fxp_t wrap(fxp_t kX, fxp_t kLowerBound, fxp_t kUpperBound) { int32_t range_size = kUpperBound - kLowerBound + 1; if (kX < kLowerBound){ kX += range_size * ((kLowerBound - kX) / range_size + 1); } return kLowerBound + (kX - kLowerBound) % range_size; } fxp_t fxp_get_int_part(fxp_t in) { return ((in < 0) ? -((-in) & _fxp_imask) : in & _fxp_imask); } fxp_t fxp_get_frac_part(fxp_t in) { return ((in < 0) ? -((-in) & _fxp_fmask) : in & _fxp_fmask); } float fxp_to_float(fxp_t fxp); fxp_t fxp_quantize(fxp_t aquant) { if (overflow_mode == 2) { if(aquant < _fxp_min) { return _fxp_min; } else if(aquant > _fxp_max) { return _fxp_max; } } else if (overflow_mode == 3) { if(aquant < _fxp_min || aquant > _fxp_max) { return wrap(aquant, _fxp_min, _fxp_max); } } return (fxp_t) aquant; } void fxp_verify_overflow(fxp_t value){ fxp_quantize(value); printf("An Overflow Occurred in system's output"); __DSVERIFIER_assert(value <= _fxp_max && value >= _fxp_min); } void fxp_verify_overflow_node(fxp_t value, char* msg){ if (3 == 2) { printf("%s",msg); __DSVERIFIER_assert(value <= _fxp_max && value >= _fxp_min); } } void fxp_verify_overflow_array(fxp_t array[], int n){ int i=0; for(i=0; i<n;i++){ fxp_verify_overflow(array[i]); } } fxp_t fxp_int_to_fxp(int in) { fxp_t lin; lin = (fxp_t) in*_fxp_one; return lin; } int fxp_to_int(fxp_t fxp) { if(fxp >= 0){ fxp += _fxp_half; } else { fxp -= _fxp_half; } fxp >>= impl.frac_bits; return (int) fxp; } fxp_t fxp_float_to_fxp(float f) { fxp_t tmp; double ftemp; ftemp = f * scale_factor[impl.frac_bits]; if(f >= 0) { tmp = (fxp_t)(ftemp + 0.5); } else { tmp = (fxp_t)(ftemp - 0.5); } return tmp; } fxp_t fxp_double_to_fxp(double value) { fxp_t tmp; double ftemp = value * scale_factor[impl.frac_bits]; if (rounding_mode == 0){ if(value >= 0) { tmp = (fxp_t)(ftemp + 0.5); } else { tmp = (fxp_t)(ftemp - 0.5); } } else if(rounding_mode == 1){ tmp = (fxp_t) ftemp; double residue = ftemp - tmp; if ((value < 0) && (residue != 0)){ ftemp = ftemp - 1; tmp = (fxp_t) ftemp; } } else if (rounding_mode == 0){ tmp = (fxp_t) ftemp; } return tmp; } void fxp_float_to_fxp_array(float f[], fxp_t r[], int N) { int i; for(i = 0; i < N; ++i) { r[i] = fxp_float_to_fxp(f[i]); } } void fxp_double_to_fxp_array(double f[], fxp_t r[], int N) { int i; for(i = 0; i < N; ++i) { r[i] = fxp_double_to_fxp(f[i]); } } # 275 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" float fxp_to_float(fxp_t fxp) { float f; int f_int = (int) fxp; f = f_int * scale_factor_inv[impl.frac_bits]; return f; } double fxp_to_double(fxp_t fxp) { double f; int f_int = (int) fxp; f = f_int * scale_factor_inv[impl.frac_bits]; return f; } void fxp_to_float_array(float f[], fxp_t r[], int N) { int i; for(i = 0; i < N; ++i) { f[i] = fxp_to_float(r[i]); } } void fxp_to_double_array(double f[], fxp_t r[], int N) { int i; for(i = 0; i < N; ++i) { f[i] = fxp_to_double(r[i]); } } fxp_t fxp_abs(fxp_t a) { fxp_t tmp; tmp = ((a < 0) ? -(fxp_t)(a) : a); tmp = fxp_quantize(tmp); return tmp; } fxp_t fxp_add(fxp_t aadd, fxp_t badd) { fxp_t tmpadd; tmpadd = ((fxp_t)(aadd) + (fxp_t)(badd)); tmpadd = fxp_quantize(tmpadd); return tmpadd; } fxp_t fxp_sub(fxp_t asub, fxp_t bsub) { fxp_t tmpsub; tmpsub = (fxp_t)((fxp_t)(asub) - (fxp_t)(bsub)); tmpsub = fxp_quantize(tmpsub); return tmpsub; } fxp_t fxp_mult(fxp_t amult, fxp_t bmult) { fxp_t tmpmult, tmpmultprec; tmpmult = (fxp_t)((fxp_t)(amult)*(fxp_t)(bmult)); if (tmpmult >= 0) { tmpmultprec = (tmpmult + ((tmpmult & 1 << (impl.frac_bits - 1)) << 1)) >> impl.frac_bits; } else { tmpmultprec = -(((-tmpmult) + (((-tmpmult) & 1 << (impl.frac_bits - 1)) << 1)) >> impl.frac_bits); } tmpmultprec = fxp_quantize(tmpmultprec); return tmpmultprec; } # 372 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" fxp_t fxp_div(fxp_t a, fxp_t b){ __DSVERIFIER_assume( b!=0 ); fxp_t tmpdiv = ((a << impl.frac_bits) / b); tmpdiv = fxp_quantize(tmpdiv); return tmpdiv; } fxp_t fxp_neg(fxp_t aneg) { fxp_t tmpneg; tmpneg = -(fxp_t)(aneg); tmpneg = fxp_quantize(tmpneg); return tmpneg; } # 398 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/fixed-point.h" fxp_t fxp_sign(fxp_t a) { return ((a == 0) ? 0 : ((a < 0) ? _fxp_minus_one : _fxp_one) ); } fxp_t fxp_shrl(fxp_t in, int shift) { return (fxp_t) (((unsigned int) in) >> shift); } fxp_t fxp_square(fxp_t a) { return fxp_mult(a, a); } void fxp_print_int(fxp_t a) { printf("\n%i", (int32_t)a); } void fxp_print_float(fxp_t a) { printf("\n%f", fxp_to_float(a)); } void fxp_print_float_array(fxp_t a[], int N) { int i; for(i = 0; i < N; ++i) { printf("\n%f", fxp_to_float(a[i])); } } void print_fxp_array_elements(char * name, fxp_t * v, int n){ printf("%s = {", name); int i; for(i=0; i < n; i++){ printf(" %jd ", v[i]); } printf("}\n"); } # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" 1 # 24 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" void initialize_array(double v[], int n){ int i; for(i=0; i<n; i++){ v[i] = 0; } } void revert_array(double v[], double out[], int n){ initialize_array(out,n); int i; for(i=0; i<n; i++){ out[i] = v[n-i-1]; } } double internal_pow(double a, double b){ int i; double acc = 1; for (i=0; i < b; i++){ acc = acc*a; } return acc; } double internal_abs(double a){ return a < 0 ? -a : a; } int fatorial(int n){ return n == 0 ? 1 : n * fatorial(n-1); } int check_stability(double a[], int n){ int lines = 2 * n - 1; int columns = n; double m[lines][n]; int i,j; double current_stability[n]; for (i=0; i < n; i++){ current_stability[i] = a[i]; } double sum = 0; for (i=0; i < n; i++){ sum += a[i]; } if (sum <= 0){ printf("[DEBUG] the first constraint of Jury criteria failed: (F(1) > 0)"); return 0; } sum = 0; for (i=0; i < n; i++){ sum += a[i] * internal_pow(-1, n-1-i); } sum = sum * internal_pow(-1, n-1); if (sum <= 0){ printf("[DEBUG] the second constraint of Jury criteria failed: (F(-1)*(-1)^n > 0)"); return 0; } if (internal_abs(a[n-1]) > a[0]){ printf("[DEBUG] the third constraint of Jury criteria failed: (abs(a0) < a_{n}*z^{n})"); return 0; } for (i=0; i < lines; i++){ for (j=0; j < columns; j++){ m[i][j] = 0; } } for (i=0; i < lines; i++){ for (j=0; j < columns; j++){ if (i == 0){ m[i][j] = a[j]; continue; } if (i % 2 != 0 ){ int x; for(x=0; x<columns;x++){ m[i][x] = m[i-1][columns-x-1]; } columns = columns - 1; j = columns; }else{ m[i][j] = m[i-2][j] - (m[i-2][columns] / m[i-2][0]) * m[i-1][j]; } } } int first_is_positive = m[0][0] >= 0 ? 1 : 0; for (i=0; i < lines; i++){ if (i % 2 == 0){ int line_is_positive = m[i][0] >= 0 ? 1 : 0; if (first_is_positive != line_is_positive){ return 0; } continue; } } return 1; } void poly_sum(double a[], int Na, double b[], int Nb, double ans[], int Nans){ int i; Nans = Na>Nb? Na:Nb; for (i=0; i<Nans; i++){ if (Na>Nb){ ans[i]=a[i]; if (i > Na-Nb-1){ ans[i]=ans[i]+b[i-Na+Nb]; } }else { ans[i]=b[i]; if (i> Nb - Na -1){ ans[i]=ans[i]+a[i-Nb+Na]; } } } } void poly_mult(double a[], int Na, double b[], int Nb, double ans[], int Nans){ int i; int j; int k; Nans = Na+Nb-1; for (i=0; i<Na; i++){ for (j=0; j<Nb; j++){ k= Na + Nb - i - j - 2; ans[k]=0; } } for (i=0; i<Na; i++){ for (j=0; j<Nb; j++){ k= Na + Nb - i - j - 2; ans[k]=ans[k]+a[Na - i - 1]*b[Nb - j - 1]; } } } void double_check_oscillations(double * y, int y_size){ __DSVERIFIER_assume(y[0] != y[y_size - 1]); int window_timer = 0; int window_count = 0; int i, j; for (i = 2; i < y_size; i++){ int window_size = i; for(j=0; j<y_size; j++){ if (window_timer > window_size){ window_timer = 0; window_count = 0; } int window_index = j + window_size; if (window_index < y_size){ if (y[j] == y[window_index]){ window_count++; # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" 3 4 ((void) sizeof (( # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" !(window_count == window_size) # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" !(window_count == window_size) # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" 3 4 ) ; else __assert_fail ( # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" "!(window_count == window_size)" # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h", 209, __extension__ __PRETTY_FUNCTION__); })) # 209 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/util.h" ; } }else{ break; } window_timer++; } } } void double_check_limit_cycle(double * y, int y_size){ double reference = y[y_size - 1]; int idx = 0; int window_size = 1; for(idx = (y_size-2); idx >= 0; idx--){ if (y[idx] != reference){ window_size++; }else{ break; } } __DSVERIFIER_assume(window_size != y_size && window_size != 1); printf("window_size %d\n", window_size); int desired_elements = 2 * window_size; int found_elements = 0; for(idx = (y_size-1); idx >= 0; idx--){ if (idx > (y_size-window_size-1)){ printf("%.0f == %.0f\n", y[idx], y[idx-window_size]); int cmp_idx = idx - window_size; if ((cmp_idx > 0) && (y[idx] == y[idx-window_size])){ found_elements = found_elements + 2; }else{ break; } } } printf("desired_elements %d\n", desired_elements); printf("found_elements %d\n", found_elements); __DSVERIFIER_assert(desired_elements != found_elements); } void double_check_persistent_limit_cycle(double * y, int y_size){ int idy = 0; int count_same = 0; int window_size = 0; double reference = y[0]; for(idy = 0; idy < y_size; idy++){ if (y[idy] != reference){ window_size++; } else if (window_size != 0){ break; } else { count_same++; } } window_size += count_same; __DSVERIFIER_assume(window_size > 1 && window_size <= y_size/2); double lco_elements[window_size]; for(idy = 0; idy < y_size; idy++){ if (idy < window_size){ lco_elements[idy] = y[idy]; } } idy = 0; int lco_idy = 0; _Bool is_persistent = 0; while (idy < y_size){ if(y[idy++] == lco_elements[lco_idy++]){ is_persistent = 1; }else{ is_persistent = 0; break; } if (lco_idy == window_size){ lco_idy = 0; } } __DSVERIFIER_assert(is_persistent == 0); } void print_array_elements(char * name, double * v, int n){ printf("%s = {", name); int i; for(i=0; i < n; i++){ printf(" %.32f ", v[i]); } printf("}\n"); } void double_add_matrix( unsigned int lines, unsigned int columns, double m1[4][4], double m2[4][4], double result[4][4]){ unsigned int i, j; for (i = 0; i < lines; i++){ for (j = 0; j < columns; j++){ result[i][j] = m1[i][j] + m2[i][j]; } } } void double_sub_matrix( unsigned int lines, unsigned int columns, double m1[4][4], double m2[4][4], double result[4][4]){ unsigned int i, j; for (i = 0; i < lines; i++){ for (j = 0; j < columns; j++){ result[i][j] = m1[i][j] - m2[i][j]; } } } void double_matrix_multiplication( unsigned int i1, unsigned int j1, unsigned int i2, unsigned int j2, double m1[4][4], double m2[4][4], double m3[4][4]){ unsigned int i, j, k; if (j1 == i2) { for (i=0; i<i1; i++) { for (j=0; j<j2; j++) { m3[i][j] = 0; } } for (i=0;i<i1; i++) { for (j=0; j<j2; j++) { for (k=0; k<j1; k++) { double mult = (m1[i][k] * m2[k][j]); m3[i][j] = m3[i][j] + (m1[i][k] * m2[k][j]); } } } } else { printf("\nError! Operation invalid, please enter with valid matrices.\n"); } } void fxp_matrix_multiplication( unsigned int i1, unsigned int j1, unsigned int i2, unsigned int j2, fxp_t m1[4][4], fxp_t m2[4][4], fxp_t m3[4][4]){ unsigned int i, j, k; if (j1 == i2) { for (i=0; i<i1; i++) { for (j=0; j<j2; j++) { m3[i][j] = 0; } } for (i=0;i<i1; i++) { for (j=0; j<j2; j++) { for (k=0; k<j1; k++) { m3[i][j] = fxp_add( m3[i][j], fxp_mult(m1[i][k] , m2[k][j])); } } } } else { printf("\nError! Operation invalid, please enter with valid matrices.\n"); } } void fxp_exp_matrix(unsigned int lines, unsigned int columns, fxp_t m1[4][4], unsigned int expNumber, fxp_t result[4][4]){ unsigned int i, j, l, k; fxp_t m2[4][4]; if(expNumber == 0){ for (i = 0; i < lines; i++){ for (j = 0; j < columns; j++){ if(i == j){ result[i][j] = fxp_double_to_fxp(1.0); } else { result[i][j] = 0.0; } } } return; } for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) result[i][j] = m1[i][j]; if(expNumber == 1){ return; } for(l = 1; l < expNumber; l++){ for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) m2[i][j] = result[i][j]; for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) result[i][j] = 0; for (i=0;i<lines; i++) { for (j=0; j<columns; j++) { for (k=0; k<columns; k++) { result[i][j] = fxp_add( result[i][j], fxp_mult(m2[i][k] , m1[k][j])); } } } } } void double_exp_matrix(unsigned int lines, unsigned int columns, double m1[4][4], unsigned int expNumber, double result[4][4]){ unsigned int i, j, k, l; double m2[4][4]; if(expNumber == 0){ for (i = 0; i < lines; i++){ for (j = 0; j < columns; j++){ if(i == j){ result[i][j] = 1.0; } else { result[i][j] = 0.0; } } } return; } for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) result[i][j] = m1[i][j]; if(expNumber == 1){ return; } for(l = 1; l < expNumber; l++){ for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) m2[i][j] = result[i][j]; for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) result[i][j] = 0; for (i=0;i<lines; i++) { for (j=0; j<columns; j++) { for (k=0; k<columns; k++) { result[i][j] = result[i][j] + (m2[i][k] * m1[k][j]); } } } } } void fxp_add_matrix( unsigned int lines, unsigned int columns, fxp_t m1[4][4], fxp_t m2[4][4], fxp_t result[4][4]){ unsigned int i, j; for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) { result[i][j] = fxp_add(m1[i][j] , m2[i][j]); } } void fxp_sub_matrix( unsigned int lines, unsigned int columns, fxp_t m1[4][4], fxp_t m2[4][4], fxp_t result[4][4]){ unsigned int i, j; for (i = 0; i < lines; i++) for (j = 0; j < columns; j++) result[i][j] = fxp_sub(m1[i][j] , m2[i][j]); } void print_matrix(double matrix[4][4], unsigned int lines, unsigned int columns){ printf("\nMatrix\n=====================\n\n"); unsigned int i, j; for (i=0; i<lines; i++) { for (j=0; j<columns; j++) { printf("#matrix[%d][%d]: %2.2f ", i,j,matrix[i][j]); } printf("\n"); } printf("\n"); } double determinant(double a[4][4],int n) { int i,j,j1,j2; double det = 0; double m[4][4]; if (n < 1) { } else if (n == 1) { det = a[0][0]; } else if (n == 2) { det = a[0][0] * a[1][1] - a[1][0] * a[0][1]; } else { det = 0; for (j1=0;j1<n;j1++) { for (i=0;i<n-1;i++) for (i=1;i<n;i++) { j2 = 0; for (j=0;j<n;j++) { if (j == j1) continue; m[i-1][j2] = a[i][j]; j2++; } } det += internal_pow(-1.0,1.0+j1+1.0) * a[0][j1] * determinant(m,n-1); } } return(det); } double fxp_determinant(fxp_t a_fxp[4][4],int n) { int i,j,j1,j2; double a[4][4]; for(i=0; i<n;i++){ for(j=0; j<n;j++){ a[i][j]= fxp_to_double(a_fxp[i][j]); } } double det = 0; double m[4][4]; if (n < 1) { } else if (n == 1) { det = a[0][0]; } else if (n == 2) { det = a[0][0] * a[1][1] - a[1][0] * a[0][1]; } else { det = 0; for (j1=0;j1<n;j1++) { for (i=0;i<n-1;i++) for (i=1;i<n;i++) { j2 = 0; for (j=0;j<n;j++) { if (j == j1) continue; m[i-1][j2] = a[i][j]; j2++; } } det += internal_pow(-1.0,1.0+j1+1.0) * a[0][j1] * determinant(m,n-1); } } return(det); } void transpose(double a[4][4], double b[4][4],int n, int m) { int i,j; for (i=0;i<n;i++) { for (j=0;j<m;j++) { b[j][i] = a[i][j]; } } } void fxp_transpose(fxp_t a[4][4], fxp_t b[4][4],int n, int m) { int i,j; for (i=0;i<n;i++) { for (j=0;j<m;j++) { b[j][i] = a[i][j]; } } } # 24 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 1 # 19 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" extern int generic_timer; extern hardware hw; double generic_timing_shift_l_double(double zIn, double z[], int N) { generic_timer += ((2 * hw.assembly.push) + (3 * hw.assembly.in) + (3 * hw.assembly.out) + (1 * hw.assembly.sbiw) + (1 * hw.assembly.cli) + (8 * hw.assembly.std)); int i; double zOut; zOut = z[0]; generic_timer += ((5 * hw.assembly.ldd) + (2 * hw.assembly.mov) + (4 * hw.assembly.std) + (1 * hw.assembly.ld)); generic_timer += ((2 * hw.assembly.std) + (1 * hw.assembly.rjmp)); for (i = 0; i < N - 1; i++) { generic_timer += ((17 * hw.assembly.ldd) + (4 * hw.assembly.lsl) + (4 * hw.assembly.rol) + (2 * hw.assembly.add) + (2 * hw.assembly.adc) + (6 * hw.assembly.mov) + (2 * hw.assembly.adiw) + (5 * hw.assembly.std) + (1 * hw.assembly.ld) + (1 * hw.assembly.st) + (1 * hw.assembly.subi) + (1 * hw.assembly.sbc)+ (1 * hw.assembly.cp) + (1 * hw.assembly.cpc) + (1 * hw.assembly.brlt)); z[i] = z[i + 1]; } z[N - 1] = zIn; generic_timer += ((12 * hw.assembly.ldd) + (6 * hw.assembly.mov) + (3 * hw.assembly.std) + (2 * hw.assembly.lsl) + (2 * hw.assembly.rol) + (1 * hw.assembly.adc) + (1 * hw.assembly.add) + (1 * hw.assembly.subi) + (1 * hw.assembly.sbci) + (1 * hw.assembly.st) + (1 * hw.assembly.adiw) + (1 * hw.assembly.in)+ (1 * hw.assembly.cli)); generic_timer += ((3 * hw.assembly.out) + (2 * hw.assembly.pop) + (1 * hw.assembly.ret)); return (zOut); } double generic_timing_shift_r_double(double zIn, double z[], int N) { generic_timer += ((2 * hw.assembly.push) + (3 * hw.assembly.in) + (3 * hw.assembly.out) + (1 * hw.assembly.sbiw) + (1 * hw.assembly.cli) + (8 * hw.assembly.std)); int i; double zOut; zOut = z[N - 1]; generic_timer += ((7 * hw.assembly.ldd) + (2 * hw.assembly.rol) + (2 * hw.assembly.lsl) + (2 * hw.assembly.mov) + (4 * hw.assembly.std) + (1 * hw.assembly.add) + (1 * hw.assembly.adc) + (1 * hw.assembly.ld) + (1 * hw.assembly.subi) + (1 * hw.assembly.sbci)); generic_timer += ((2 * hw.assembly.ldd) + (2 * hw.assembly.std) + (1 * hw.assembly.sbiw) + (1 * hw.assembly.rjmp)); for (i = N - 1; i > 0; i--) { z[i] = z[i - 1]; generic_timer += ((15 * hw.assembly.ldd) + (4 * hw.assembly.lsl) + (4 * hw.assembly.rol) + (2 * hw.assembly.add) + (2 * hw.assembly.adc) + (4 * hw.assembly.mov) + (5 * hw.assembly.std) + (1 * hw.assembly.subi) + (1 * hw.assembly.sbci) + (1 * hw.assembly.ld) + (1 * hw.assembly.st) + (1 * hw.assembly.sbiw) + (1 * hw.assembly.cp) + (1 * hw.assembly.cpc) + (1 * hw.assembly.brlt)); } z[0] = zIn; generic_timer += ((10 * hw.assembly.ldd) + (5 * hw.assembly.mov) + (3 * hw.assembly.std) + (3 * hw.assembly.out) + (2 * hw.assembly.pop) + (1 * hw.assembly.ret) + (1 * hw.assembly.ret) + (1 * hw.assembly.cli) + (1 * hw.assembly.in) + (1 * hw.assembly.st) + (1 * hw.assembly.adiw)); return zOut; } fxp_t shiftL(fxp_t zIn, fxp_t z[], int N) { int i; fxp_t zOut; zOut = z[0]; for (i = 0; i < N - 1; i++) { z[i] = z[i + 1]; } z[N - 1] = zIn; return (zOut); } fxp_t shiftR(fxp_t zIn, fxp_t z[], int N) { int i; fxp_t zOut; zOut = z[N - 1]; for (i = N - 1; i > 0; i--) { z[i] = z[i - 1]; } z[0] = zIn; return zOut; } float shiftLfloat(float zIn, float z[], int N) { int i; float zOut; zOut = z[0]; for (i = 0; i < N - 1; i++) { z[i] = z[i + 1]; } z[N - 1] = zIn; return (zOut); } float shiftRfloat(float zIn, float z[], int N) { int i; float zOut; zOut = z[N - 1]; for (i = N - 1; i > 0; i--) { z[i] = z[i - 1]; } z[0] = zIn; return zOut; } double shiftRDdouble(double zIn, double z[], int N) { int i; double zOut; zOut = z[0]; for (i = 0; i < N - 1; i++) { z[i] = z[i + 1]; } z[N - 1] = zIn; return (zOut); } double shiftRdouble(double zIn, double z[], int N) { int i; double zOut; zOut = z[N - 1]; for (i = N - 1; i > 0; i--) { z[i] = z[i - 1]; } z[0] = zIn; return zOut; } double shiftLDouble(double zIn, double z[], int N) { int i; double zOut; zOut = z[0]; for (i = 0; i < N - 1; i++) { z[i] = z[i + 1]; } z[N - 1] = zIn; return (zOut); } void shiftLboth(float zfIn, float zf[], fxp_t zIn, fxp_t z[], int N) { int i; fxp_t zOut; float zfOut; zOut = z[0]; zfOut = zf[0]; for (i = 0; i < N - 1; i++) { z[i] = z[i + 1]; zf[i] = zf[i + 1]; } z[N - 1] = zIn; zf[N - 1] = zfIn; } void shiftRboth(float zfIn, float zf[], fxp_t zIn, fxp_t z[], int N) { int i; fxp_t zOut; float zfOut; zOut = z[N - 1]; zfOut = zf[N - 1]; for (i = N - 1; i > 0; i--) { z[i] = z[i - 1]; zf[i] = zf[i - 1]; } z[0] = zIn; zf[0] = zfIn; } int order(int Na, int Nb) { return Na > Nb ? Na - 1 : Nb - 1; } void fxp_check_limit_cycle(fxp_t y[], int y_size){ fxp_t reference = y[y_size - 1]; int idx = 0; int window_size = 1; for(idx = (y_size-2); idx >= 0; idx--){ if (y[idx] != reference){ window_size++; }else{ break; } } __DSVERIFIER_assume(window_size != y_size && window_size != 1); printf("window_size %d\n", window_size); int desired_elements = 2 * window_size; int found_elements = 0; for(idx = (y_size-1); idx >= 0; idx--){ if (idx > (y_size-window_size-1)){ printf("%.0f == %.0f\n", y[idx], y[idx-window_size]); int cmp_idx = idx - window_size; if ((cmp_idx > 0) && (y[idx] == y[idx-window_size])){ found_elements = found_elements + 2; }else{ break; } } } __DSVERIFIER_assume(found_elements > 0); printf("desired_elements %d\n", desired_elements); printf("found_elements %d\n", found_elements); __DSVERIFIER_assume(found_elements == desired_elements); __DSVERIFIER_assert(0); } void fxp_check_persistent_limit_cycle(fxp_t * y, int y_size){ int idy = 0; int count_same = 0; int window_size = 0; fxp_t reference = y[0]; for(idy = 0; idy < y_size; idy++){ if (y[idy] != reference){ window_size++; } else if (window_size != 0){ break; } else { count_same++; } } window_size += count_same; __DSVERIFIER_assume(window_size > 1 && window_size <= y_size/2); fxp_t lco_elements[window_size]; for(idy = 0; idy < y_size; idy++){ if (idy < window_size){ lco_elements[idy] = y[idy]; } } idy = 0; int lco_idy = 0; _Bool is_persistent = 0; while (idy < y_size){ if(y[idy++] == lco_elements[lco_idy++]){ is_persistent = 1; }else{ is_persistent = 0; break; } if (lco_idy == window_size){ lco_idy = 0; } } __DSVERIFIER_assert(is_persistent == 0); } void fxp_check_oscillations(fxp_t y[] , int y_size){ __DSVERIFIER_assume((y[0] != y[y_size - 1]) && (y[y_size - 1] != y[y_size - 2])); int window_timer = 0; int window_count = 0; int i, j; for (i = 2; i < y_size; i++){ int window_size = i; for(j=0; j<y_size; j++){ if (window_timer > window_size){ window_timer = 0; window_count = 0; } int window_index = j + window_size; if (window_index < y_size){ if (y[j] == y[window_index]){ window_count++; __DSVERIFIER_assert(!(window_count == window_size)); } }else{ break; } window_timer++; } } } int fxp_ln(int x) { int t, y; y = 0xa65af; if (x < 0x00008000) x <<= 16, y -= 0xb1721; if (x < 0x00800000) x <<= 8, y -= 0x58b91; if (x < 0x08000000) x <<= 4, y -= 0x2c5c8; if (x < 0x20000000) x <<= 2, y -= 0x162e4; if (x < 0x40000000) x <<= 1, y -= 0x0b172; t = x + (x >> 1); if ((t & 0x80000000) == 0) x = t, y -= 0x067cd; t = x + (x >> 2); if ((t & 0x80000000) == 0) x = t, y -= 0x03920; t = x + (x >> 3); if ((t & 0x80000000) == 0) x = t, y -= 0x01e27; t = x + (x >> 4); if ((t & 0x80000000) == 0) x = t, y -= 0x00f85; t = x + (x >> 5); if ((t & 0x80000000) == 0) x = t, y -= 0x007e1; t = x + (x >> 6); if ((t & 0x80000000) == 0) x = t, y -= 0x003f8; t = x + (x >> 7); if ((t & 0x80000000) == 0) x = t, y -= 0x001fe; x = 0x80000000 - x; y -= x >> 15; return y; } double fxp_log10_low(double x) { int xint = (int) (x * 65536.0 + 0.5); int lnum = fxp_ln(xint); int lden = fxp_ln(655360); return ((double) lnum / (double) lden); } double fxp_log10(double x) { if (x > 32767.0) { if (x > 1073676289.0) { x = x / 1073676289.0; return fxp_log10_low(x) + 9.030873362; } x = x / 32767.0; return fxp_log10_low(x) + 4.515436681; } return fxp_log10_low(x); } float snrVariance(float s[], float n[], int blksz) { int i; double sm = 0, nm = 0, sv = 0, nv = 0, snr; for (i = 0; i < blksz; i++) { sm += s[i]; nm += n[i]; } sm /= blksz; nm /= blksz; for (i = 0; i < blksz; i++) { sv += (s[i] - sm) * (s[i] - sm); nv += (n[i] - nm) * (n[i] - nm); } if (nv != 0.0f) { # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ((void) sizeof (( # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" sv >= nv # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" sv >= nv # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ; else __assert_fail ( # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" "sv >= nv" # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h", 373, __extension__ __PRETTY_FUNCTION__); })) # 373 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" ; snr = sv / nv; return snr; } else { return 9999.9f; } } float snrPower(float s[], float n[], int blksz) { int i; double sv = 0, nv = 0, snr; for (i = 0; i < blksz; i++) { sv += s[i] * s[i]; nv += n[i] * n[i]; } if (nv != 0.0f) { # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ((void) sizeof (( # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" sv >= nv # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" sv >= nv # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ; else __assert_fail ( # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" "sv >= nv" # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h", 394, __extension__ __PRETTY_FUNCTION__); })) # 394 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" ; snr = sv / nv; return snr; } else { return 9999.9f; } } float snrPoint(float s[], float n[], int blksz) { int i; double ratio = 0, power = 0; for (i = 0; i < blksz; i++) { if(n[i] == 0) continue; ratio = s[i] / n[i]; if(ratio > 150.0f || ratio < -150.0f) continue; power = ratio * ratio; # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ((void) sizeof (( # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" power >= 1.0f # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" power >= 1.0f # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ; else __assert_fail ( # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" "power >= 1.0f" # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h", 412, __extension__ __PRETTY_FUNCTION__); })) # 412 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" ; } return 9999.9f; } unsigned long next = 1; int rand(void) { next = next*1103515245 + 12345; return (unsigned int)(next/65536) % 32768; } void srand(unsigned int seed) { next = seed; } float iirIIOutTime(float w[], float x, float a[], float b[], int Na, int Nb) { int timer1 = 0; float *a_ptr, *b_ptr, *w_ptr; float sum = 0; a_ptr = &a[1]; b_ptr = &b[0]; w_ptr = &w[1]; int k, j; timer1 += 71; for (j = 1; j < Na; j++) { w[0] -= *a_ptr++ * *w_ptr++; timer1 += 54; } w[0] += x; w_ptr = &w[0]; for (k = 0; k < Nb; k++) { sum += *b_ptr++ * *w_ptr++; timer1 += 46; } timer1 += 38; # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ((void) sizeof (( # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" (double)timer1*1 / 16000000 <= (double)1 / 100 # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" (double)timer1*1 / 16000000 <= (double)1 / 100 # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ; else __assert_fail ( # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" "(double)timer1*CYCLE <= (double)DEADLINE" # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h", 450, __extension__ __PRETTY_FUNCTION__); })) # 450 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" ; return sum; } float iirIItOutTime(float w[], float x, float a[], float b[], int Na, int Nb) { int timer1 = 0; float *a_ptr, *b_ptr; float yout = 0; a_ptr = &a[1]; b_ptr = &b[0]; int Nw = Na > Nb ? Na : Nb; yout = (*b_ptr++ * x) + w[0]; int j; timer1 += 105; for (j = 0; j < Nw - 1; j++) { w[j] = w[j + 1]; if (j < Na - 1) { w[j] -= *a_ptr++ * yout; timer1 += 41; } if (j < Nb - 1) { w[j] += *b_ptr++ * x; timer1 += 38; } timer1 += 54; } timer1 += 7; # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ((void) sizeof (( # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" (double)timer1*1 / 16000000 <= (double)1 / 100 # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" (double)timer1*1 / 16000000 <= (double)1 / 100 # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ; else __assert_fail ( # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" "(double)timer1*CYCLE <= (double)DEADLINE" # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h", 477, __extension__ __PRETTY_FUNCTION__); })) # 477 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" ; return yout; } double iirIItOutTime_double(double w[], double x, double a[], double b[], int Na, int Nb) { int timer1 = 0; double *a_ptr, *b_ptr; double yout = 0; a_ptr = &a[1]; b_ptr = &b[0]; int Nw = Na > Nb ? Na : Nb; yout = (*b_ptr++ * x) + w[0]; int j; timer1 += 105; for (j = 0; j < Nw - 1; j++) { w[j] = w[j + 1]; if (j < Na - 1) { w[j] -= *a_ptr++ * yout; timer1 += 41; } if (j < Nb - 1) { w[j] += *b_ptr++ * x; timer1 += 38; } timer1 += 54; } timer1 += 7; # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ((void) sizeof (( # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" (double)timer1*1 / 16000000 <= (double)1 / 100 # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" (double)timer1*1 / 16000000 <= (double)1 / 100 # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 ) ; else __assert_fail ( # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" "(double)timer1*CYCLE <= (double)DEADLINE" # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h", 504, __extension__ __PRETTY_FUNCTION__); })) # 504 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/functions.h" ; return yout; } void iirOutBoth(float yf[], float xf[], float af[], float bf[], float *sumf_ref, fxp_t y[], fxp_t x[], fxp_t a[], fxp_t b[], fxp_t *sum_ref, int Na, int Nb) { fxp_t *a_ptr, *y_ptr, *b_ptr, *x_ptr; float *af_ptr, *yf_ptr, *bf_ptr, *xf_ptr; fxp_t sum = 0; float sumf = 0; a_ptr = &a[1]; y_ptr = &y[Na - 1]; b_ptr = &b[0]; x_ptr = &x[Nb - 1]; af_ptr = &af[1]; yf_ptr = &yf[Na - 1]; bf_ptr = &bf[0]; xf_ptr = &xf[Nb - 1]; int i, j; for (i = 0; i < Nb; i++) { sum = fxp_add(sum, fxp_mult(*b_ptr++, *x_ptr--)); sumf += *bf_ptr++ * *xf_ptr--; } for (j = 1; j < Na; j++) { sum = fxp_sub(sum, fxp_mult(*a_ptr++, *y_ptr--)); sumf -= *af_ptr++ * *yf_ptr--; } *sum_ref = sum; *sumf_ref = sumf; } fxp_t iirOutFixedL(fxp_t y[], fxp_t x[], fxp_t xin, fxp_t a[], fxp_t b[], int Na, int Nb) { fxp_t *a_ptr, *y_ptr, *b_ptr, *x_ptr; fxp_t sum = 0; a_ptr = &a[Na - 1]; y_ptr = &y[1]; b_ptr = &b[Nb - 1]; x_ptr = &x[0]; int i, j; for (i = 0; i < Nb - 1; i++) { x[i] = x[i+1]; sum = fxp_add(sum, fxp_mult(*b_ptr--, *x_ptr++)); } x[Nb - 1] = xin; sum = fxp_add(sum, fxp_mult(*b_ptr--, *x_ptr++)); for (j = 1; j < Na - 1; j++) { sum = fxp_sub(sum, fxp_mult(*a_ptr--, *y_ptr++)); y[j] = y[j+1]; } if(Na>1) sum = fxp_sub(sum, fxp_mult(*a_ptr--, *y_ptr++)); y[Na - 1] = sum; return sum; } float iirOutFloatL(float y[], float x[], float xin, float a[], float b[], int Na, int Nb) { float *a_ptr, *y_ptr, *b_ptr, *x_ptr; float sum = 0; a_ptr = &a[Na - 1]; y_ptr = &y[1]; b_ptr = &b[Nb - 1]; x_ptr = &x[0]; int i, j; for (i = 0; i < Nb - 1; i++) { x[i] = x[i+1]; sum += *b_ptr-- * *x_ptr++; } x[Nb - 1] = xin; sum += *b_ptr-- * *x_ptr++; for (j = 1; j < Na - 1; j++) { sum -= *a_ptr-- * *y_ptr++; y[j] = y[j+1]; } if(Na>1) sum -= *a_ptr-- * *y_ptr++; y[Na - 1] = sum; return sum; } float iirOutBothL(float yf[], float xf[], float af[], float bf[], float xfin, fxp_t y[], fxp_t x[], fxp_t a[], fxp_t b[], fxp_t xin, int Na, int Nb) { fxp_t *a_ptr, *y_ptr, *b_ptr, *x_ptr; fxp_t sum = 0; a_ptr = &a[Na - 1]; y_ptr = &y[1]; b_ptr = &b[Nb - 1]; x_ptr = &x[0]; float *af_ptr, *yf_ptr, *bf_ptr, *xf_ptr; float sumf = 0; af_ptr = &af[Na - 1]; yf_ptr = &yf[1]; bf_ptr = &bf[Nb - 1]; xf_ptr = &xf[0]; int i, j; for (i = 0; i < Nb - 1; i++) { x[i] = x[i+1]; sum = fxp_add(sum, fxp_mult(*b_ptr--, *x_ptr++)); xf[i] = xf[i+1]; sumf += *bf_ptr-- * *xf_ptr++; } x[Nb - 1] = xin; sum = fxp_add(sum, fxp_mult(*b_ptr--, *x_ptr++)); xf[Nb - 1] = xfin; sumf += *bf_ptr-- * *xf_ptr++; for (j = 1; j < Na - 1; j++) { sum = fxp_sub(sum, fxp_mult(*a_ptr--, *y_ptr++)); y[j] = y[j+1]; sumf -= *af_ptr-- * *yf_ptr++; yf[j] = yf[j+1]; } if(Na>1) sum = fxp_sub(sum, fxp_mult(*a_ptr--, *y_ptr++)); y[Na - 1] = sum; if(Na>1) sumf -= *af_ptr-- * *yf_ptr++; yf[Na - 1] = sumf; return fxp_to_float(sum) - sumf; } float iirOutBothL2(float yf[], float xf[], float af[], float bf[], float xfin, fxp_t y[], fxp_t x[], fxp_t a[], fxp_t b[], fxp_t xin, int Na, int Nb) { fxp_t *a_ptr, *y_ptr, *b_ptr, *x_ptr; fxp_t sum = 0; a_ptr = &a[Na - 1]; y_ptr = &y[1]; b_ptr = &b[Nb - 1]; x_ptr = &x[0]; float *af_ptr, *yf_ptr, *bf_ptr, *xf_ptr; float sumf = 0; af_ptr = &af[Na - 1]; yf_ptr = &yf[1]; bf_ptr = &bf[Nb - 1]; xf_ptr = &xf[0]; int i=0, j=1; for (i = 0; i < Nb - 1; i++) { x[i] = x[i+1]; sum = fxp_add(sum, fxp_mult(b[Nb - 1 - i], x[i])); xf[i] = xf[i+1]; sumf += bf[Nb - 1 - i] * xf[i]; } x[Nb - 1] = xin; sum = fxp_add(sum, fxp_mult(b[Nb - 1 - i], x[i])); xf[Nb - 1] = xfin; sumf += bf[Nb - 1 - i] * xf[i]; for (j = 1; j < Na - 1; j++) { sum = fxp_sub(sum, fxp_mult(a[Na - j], y[j])); y[j] = y[j+1]; sumf -= af[Na - j] * yf[j]; yf[j] = yf[j+1]; } if(Na>1) sum = fxp_sub(sum, fxp_mult(a[Na - j], y[j])); y[Na - 1] = sum; if(Na>1) sumf -= af[Na - j] * yf[j]; yf[Na - 1] = sumf; return fxp_to_float(sum) - sumf; } # 25 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 1 # 19 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" extern digital_system ds; extern hardware hw; extern int generic_timer; fxp_t fxp_direct_form_1(fxp_t y[], fxp_t x[], fxp_t a[], fxp_t b[], int Na, int Nb) { fxp_t *a_ptr, *y_ptr, *b_ptr, *x_ptr; fxp_t sum = 0; a_ptr = &a[1]; y_ptr = &y[Na - 1]; b_ptr = &b[0]; x_ptr = &x[Nb - 1]; int i, j; for (i = 0; i < Nb; i++) { sum = fxp_add(sum, fxp_mult(*b_ptr++, *x_ptr--)); } for (j = 1; j < Na; j++) { sum = fxp_sub(sum, fxp_mult(*a_ptr++, *y_ptr--)); } fxp_verify_overflow_node(sum, "An Overflow Occurred in the node a0"); sum = fxp_div(sum,a[0]); return fxp_quantize(sum); } fxp_t fxp_direct_form_2(fxp_t w[], fxp_t x, fxp_t a[], fxp_t b[], int Na, int Nb) { fxp_t *a_ptr, *b_ptr, *w_ptr; fxp_t sum = 0; a_ptr = &a[1]; b_ptr = &b[0]; w_ptr = &w[1]; int k, j; for (j = 1; j < Na; j++) { w[0] = fxp_sub(w[0], fxp_mult(*a_ptr++, *w_ptr++)); } w[0] = fxp_add(w[0], x); w[0] = fxp_div(w[0], a[0]); fxp_verify_overflow_node(w[0], "An Overflow Occurred in the node b0"); w_ptr = &w[0]; for (k = 0; k < Nb; k++) { sum = fxp_add(sum, fxp_mult(*b_ptr++, *w_ptr++)); } return fxp_quantize(sum); } fxp_t fxp_transposed_direct_form_2(fxp_t w[], fxp_t x, fxp_t a[], fxp_t b[], int Na, int Nb) { fxp_t *a_ptr, *b_ptr; fxp_t yout = 0; a_ptr = &a[1]; b_ptr = &b[0]; int Nw = Na > Nb ? Na : Nb; yout = fxp_add(fxp_mult(*b_ptr++, x), w[0]); yout = fxp_div(yout, a[0]); int j; for (j = 0; j < Nw - 1; j++) { w[j] = w[j + 1]; if (j < Na - 1) { w[j] = fxp_sub(w[j], fxp_mult(*a_ptr++, yout)); } if (j < Nb - 1) { w[j] = fxp_add(w[j], fxp_mult(*b_ptr++, x)); } } fxp_verify_overflow_node(w[j], "An Overflow Occurred in the node a0"); return fxp_quantize(yout); } double double_direct_form_1(double y[], double x[], double a[], double b[], int Na, int Nb) { double *a_ptr, *y_ptr, *b_ptr, *x_ptr; double sum = 0; a_ptr = &a[1]; y_ptr = &y[Na - 1]; b_ptr = &b[0]; x_ptr = &x[Nb - 1]; int i, j; for (i = 0; i < Nb; i++) { sum += *b_ptr++ * *x_ptr--; } for (j = 1; j < Na; j++) { sum -= *a_ptr++ * *y_ptr--; } sum = (sum / a[0]); return sum; } double double_direct_form_2(double w[], double x, double a[], double b[], int Na, int Nb) { double *a_ptr, *b_ptr, *w_ptr; double sum = 0; a_ptr = &a[1]; b_ptr = &b[0]; w_ptr = &w[1]; int k, j; for (j = 1; j < Na; j++) { w[0] -= *a_ptr++ * *w_ptr++; } w[0] += x; w[0] = w[0] / a[0]; w_ptr = &w[0]; for (k = 0; k < Nb; k++) { sum += *b_ptr++ * *w_ptr++; } return sum; } double double_transposed_direct_form_2(double w[], double x, double a[], double b[], int Na, int Nb) { double *a_ptr, *b_ptr; double yout = 0; a_ptr = &a[1]; b_ptr = &b[0]; int Nw = Na > Nb ? Na : Nb; yout = (*b_ptr++ * x) + w[0]; yout = yout / a[0]; int j; for (j = 0; j < Nw - 1; j++) { w[j] = w[j + 1]; if (j < Na - 1) { w[j] -= *a_ptr++ * yout; } if (j < Nb - 1) { w[j] += *b_ptr++ * x; } } return yout; } float float_direct_form_1(float y[], float x[], float a[], float b[], int Na, int Nb) { float *a_ptr, *y_ptr, *b_ptr, *x_ptr; float sum = 0; a_ptr = &a[1]; y_ptr = &y[Na - 1]; b_ptr = &b[0]; x_ptr = &x[Nb - 1]; int i, j; for (i = 0; i < Nb; i++) { sum += *b_ptr++ * *x_ptr--; } for (j = 1; j < Na; j++) { sum -= *a_ptr++ * *y_ptr--; } sum = (sum / a[0]); return sum; } float float_direct_form_2(float w[], float x, float a[], float b[], int Na, int Nb) { float *a_ptr, *b_ptr, *w_ptr; float sum = 0; a_ptr = &a[1]; b_ptr = &b[0]; w_ptr = &w[1]; int k, j; for (j = 1; j < Na; j++) { w[0] -= *a_ptr++ * *w_ptr++; } w[0] += x; w[0] = w[0] / a[0]; w_ptr = &w[0]; for (k = 0; k < Nb; k++) { sum += *b_ptr++ * *w_ptr++; } return sum; } float float_transposed_direct_form_2(float w[], float x, float a[], float b[], int Na, int Nb) { float *a_ptr, *b_ptr; float yout = 0; a_ptr = &a[1]; b_ptr = &b[0]; int Nw = Na > Nb ? Na : Nb; yout = (*b_ptr++ * x) + w[0]; yout = yout / a[0]; int j; for (j = 0; j < Nw - 1; j++) { w[j] = w[j + 1]; if (j < Na - 1) { w[j] -= *a_ptr++ * yout; } if (j < Nb - 1) { w[j] += *b_ptr++ * x; } } return yout; } double double_direct_form_1_MSP430(double y[], double x[], double a[], double b[], int Na, int Nb){ int timer1 = 0; double *a_ptr, *y_ptr, *b_ptr, *x_ptr; double sum = 0; a_ptr = &a[1]; y_ptr = &y[Na-1]; b_ptr = &b[0]; x_ptr = &x[Nb-1]; int i, j; timer1 += 91; for (i = 0; i < Nb; i++){ sum += *b_ptr++ * *x_ptr--; timer1 += 47; } for (j = 1; j < Na; j++){ sum -= *a_ptr++ * *y_ptr--; timer1 += 57; } timer1 += 3; # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ((void) sizeof (( # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" (double) timer1 * hw.cycle <= ds.sample_time # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" (double) timer1 * hw.cycle <= ds.sample_time # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ) ; else __assert_fail ( # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" "(double) timer1 * hw.cycle <= ds.sample_time" # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h", 235, __extension__ __PRETTY_FUNCTION__); })) # 235 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" ; return sum; } double double_direct_form_2_MSP430(double w[], double x, double a[], double b[], int Na, int Nb) { int timer1 = 0; double *a_ptr, *b_ptr, *w_ptr; double sum = 0; a_ptr = &a[1]; b_ptr = &b[0]; w_ptr = &w[1]; int k, j; timer1 += 71; for (j = 1; j < Na; j++) { w[0] -= *a_ptr++ * *w_ptr++; timer1 += 54; } w[0] += x; w[0] = w[0] / a[0]; w_ptr = &w[0]; for (k = 0; k < Nb; k++) { sum += *b_ptr++ * *w_ptr++; timer1 += 46; } timer1 += 38; # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ((void) sizeof (( # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" (double) timer1 * hw.cycle <= ds.sample_time # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" (double) timer1 * hw.cycle <= ds.sample_time # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ) ; else __assert_fail ( # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" "(double) timer1 * hw.cycle <= ds.sample_time" # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h", 262, __extension__ __PRETTY_FUNCTION__); })) # 262 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" ; return sum; } double double_transposed_direct_form_2_MSP430(double w[], double x, double a[], double b[], int Na, int Nb) { int timer1 = 0; double *a_ptr, *b_ptr; double yout = 0; a_ptr = &a[1]; b_ptr = &b[0]; int Nw = Na > Nb ? Na : Nb; yout = (*b_ptr++ * x) + w[0]; int j; timer1 += 105; for (j = 0; j < Nw - 1; j++) { w[j] = w[j + 1]; if (j < Na - 1) { w[j] -= *a_ptr++ * yout; timer1 += 41; } if (j < Nb - 1) { w[j] += *b_ptr++ * x; timer1 += 38; } timer1 += 54; } timer1 += 7; # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ((void) sizeof (( # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" (double) timer1 * hw.cycle <= ds.sample_time # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" (double) timer1 * hw.cycle <= ds.sample_time # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 ) ; else __assert_fail ( # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" "(double) timer1 * hw.cycle <= ds.sample_time" # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h", 291, __extension__ __PRETTY_FUNCTION__); })) # 291 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/realizations.h" ; return yout; } double generic_timing_double_direct_form_1(double y[], double x[], double a[], double b[], int Na, int Nb){ generic_timer += ((6 * hw.assembly.push) + (3 * hw.assembly.in) + (1 * hw.assembly.sbiw) + (1 * hw.assembly.cli) + (3 * hw.assembly.out) + (12 * hw.assembly.std)); double *a_ptr, *y_ptr, *b_ptr, *x_ptr; double sum = 0; a_ptr = &a[1]; y_ptr = &y[Na-1]; b_ptr = &b[0]; x_ptr = &x[Nb-1]; generic_timer += ((12 * hw.assembly.std) + (12 * hw.assembly.ldd) + (2 * hw.assembly.subi) + (2 * hw.assembly.sbci) + (4 * hw.assembly.lsl) + (4 * hw.assembly.rol) + (2 * hw.assembly.add) + (2 * hw.assembly.adc) + (1 * hw.assembly.adiw)); int i, j; generic_timer += ((2 * hw.assembly.std) + (1 * hw.assembly.rjmp)); for (i = 0; i < Nb; i++){ generic_timer += ((20 * hw.assembly.ldd) + (24 * hw.assembly.mov) + (2 * hw.assembly.subi) + (1 * hw.assembly.sbci) + (1 * hw.assembly.sbc) + (10 * hw.assembly.std) + (2 * hw.assembly.ld) + (2 * hw.assembly.rcall) + (1 * hw.assembly.adiw) + (1 * hw.assembly.cp) + (1 * hw.assembly.cpc) + (1 * hw.assembly.adiw) + (1 * hw.assembly.brge) + (1 * hw.assembly.rjmp)); sum += *b_ptr++ * *x_ptr--; } generic_timer += ((2 * hw.assembly.ldi) + (2 * hw.assembly.std) + (1 * hw.assembly.rjmp)); for (j = 1; j < Na; j++){ generic_timer += ((22 * hw.assembly.ldd) + (24 * hw.assembly.mov) + (2 * hw.assembly.subi) + (8 * hw.assembly.std) + (1 * hw.assembly.sbci) + (2 * hw.assembly.ld) + (2 * hw.assembly.rcall) + (1 * hw.assembly.sbc) + (1 * hw.assembly.adiw) + (1 * hw.assembly.cp) + (1 * hw.assembly.cpc) + (1 * hw.assembly.adiw) + (1 * hw.assembly.brge) + (1 * hw.assembly.rjmp)); sum -= *a_ptr++ * *y_ptr--; } generic_timer += ((4 * hw.assembly.ldd) + (4 * hw.assembly.mov) + (1 * hw.assembly.adiw) + (1 * hw.assembly.in) + (1 * hw.assembly.cli) + (3 * hw.assembly.out) + (6 * hw.assembly.pop) + (1 * hw.assembly.ret)); return sum; } double generic_timing_double_direct_form_2(double w[], double x, double a[], double b[], int Na, int Nb) { generic_timer += ((8 * hw.assembly.push) + (14 * hw.assembly.std) + (3 * hw.assembly.out) + (3 * hw.assembly.in) + (1 * hw.assembly.sbiw) + (1 * hw.assembly.cli)); double *a_ptr, *b_ptr, *w_ptr; double sum = 0; a_ptr = &a[1]; b_ptr = &b[0]; w_ptr = &w[1]; int k, j; generic_timer += ((10 * hw.assembly.std) + (6 * hw.assembly.ldd) + (2 * hw.assembly.adiw)); generic_timer += ((2 * hw.assembly.ldi) + (2 * hw.assembly.std) + (1 * hw.assembly.rjmp)); for (j = 1; j < Na; j++) { w[0] -= *a_ptr++ * *w_ptr++; generic_timer += ((23 * hw.assembly.ldd) + (32 * hw.assembly.mov) + (9 * hw.assembly.std) + (2 * hw.assembly.subi) + (3 * hw.assembly.ld) + (2 * hw.assembly.rcall) + (2 * hw.assembly.sbci) + (1 * hw.assembly.st) + (1 * hw.assembly.adiw) + (1 * hw.assembly.cp) + (1 * hw.assembly.cpc) + (1 * hw.assembly.brge)); } w[0] += x; w_ptr = &w[0]; generic_timer += ((13 * hw.assembly.ldd) + (12 * hw.assembly.mov) + (5 * hw.assembly.std) + (1 * hw.assembly.st) + (1 * hw.assembly.ld) + (1 * hw.assembly.rcall)); generic_timer += ((2 * hw.assembly.std) + (1 * hw.assembly.rjmp)); for (k = 0; k < Nb; k++) { sum += *b_ptr++ * *w_ptr++; generic_timer += ((20 * hw.assembly.ldd) + (24 * hw.assembly.mov) + (10 * hw.assembly.std) + (2 * hw.assembly.rcall) + (2 * hw.assembly.ld) + (2 * hw.assembly.subi) + (2 * hw.assembly.sbci) + (1 * hw.assembly.adiw) + (1 * hw.assembly.cp) + (1 * hw.assembly.cpc) + (1 * hw.assembly.brge) + (1 * hw.assembly.rjmp)); } generic_timer += ((4 * hw.assembly.ldd) + (4 * hw.assembly.mov) + (1 * hw.assembly.adiw) + (1 * hw.assembly.in) + (1 * hw.assembly.cli) + (3 * hw.assembly.out) + (8 * hw.assembly.pop) + (1 * hw.assembly.ret)); return sum; } double generic_timing_double_transposed_direct_form_2(double w[], double x, double a[], double b[], int Na, int Nb) { generic_timer += ((8 * hw.assembly.push) + (14 * hw.assembly.std) + (3 * hw.assembly.out) + (3 * hw.assembly.in) + (1 * hw.assembly.sbiw) + (1 * hw.assembly.cli)); double *a_ptr, *b_ptr; double yout = 0; a_ptr = &a[1]; b_ptr = &b[0]; int Nw = Na > Nb ? Na : Nb; yout = (*b_ptr++ * x) + w[0]; int j; generic_timer += ((15 * hw.assembly.std) + (22 * hw.assembly.ldd) + (24 * hw.assembly.mov) + (2 * hw.assembly.rcall) + (2 * hw.assembly.ld) + (1 * hw.assembly.cp) + (1 * hw.assembly.cpc) + (1 * hw.assembly.subi) + (1 * hw.assembly.sbci) + (1 * hw.assembly.brge) + (1 * hw.assembly.adiw)); generic_timer += ((2 * hw.assembly.std) + (1 * hw.assembly.rjmp)); for (j = 0; j < Nw - 1; j++) { w[j] = w[j + 1]; if (j < Na - 1) { w[j] -= *a_ptr++ * yout; } if (j < Nb - 1) { w[j] += *b_ptr++ * x; } generic_timer += ((70 * hw.assembly.mov) + (65 * hw.assembly.ldd) + (12 * hw.assembly.lsl) + (12 * hw.assembly.rol) + (15 * hw.assembly.std) + (6 * hw.assembly.add) + (6 * hw.assembly.adc) + (2 * hw.assembly.adiw) + (3 * hw.assembly.cpc) + (3 * hw.assembly.cp) + (5 * hw.assembly.ld) + (4 * hw.assembly.rcall) + (5 * hw.assembly.subi) + (3 * hw.assembly.rjmp) + (2 * hw.assembly.brlt) + (3 * hw.assembly.st) + (2 * hw.assembly.sbci) + (3 * hw.assembly.sbc) + (1 * hw.assembly.brge)); } generic_timer += ((4 * hw.assembly.ldd) + (4 * hw.assembly.mov) + (8 * hw.assembly.pop) + (3 * hw.assembly.out) + (1 * hw.assembly.in) + (1 * hw.assembly.cli) + (1 * hw.assembly.adiw) + (1 * hw.assembly.ret)); return yout; } void double_direct_form_1_impl2(double x[], int x_size, double b[], int b_size, double a[], int a_size, double y[]){ int i = 0; int j = 0; double v[x_size]; for(i = 0; i < x_size; i++){ v[i] = 0; for(j = 0; j < b_size; j++){ if (j > i) break; v[i] = v[i] + x[i-j] * b[j]; } } y[0] = v[0]; for(i = 1; i < x_size; i++){ y[i] = 0; y[i] = y[i] + v[i]; for(j = 1; j < a_size; j++){ if (j > i) break; y[i] = y[i] + y[i-j] * ((-1) * a[j]); } } } void fxp_direct_form_1_impl2(fxp_t x[], int x_size, fxp_t b[], int b_size, fxp_t a[], int a_size, fxp_t y[]){ int i = 0; int j = 0; fxp_t v[x_size]; for(i = 0; i < x_size; i++){ v[i] = 0; for(j = 0; j < b_size; j++){ if (j > i) break; v[i] = fxp_add(v[i], fxp_mult(x[i-j], b[j])); } } y[0] = v[0]; for(i = 1; i < x_size; i++){ y[i] = 0; y[i] = fxp_add(y[i], v[i]); for(j = 1; j < a_size; j++){ if (j > i) break; y[i] = fxp_add(y[i], fxp_mult(y[i-j] , -a[j])); } } } # 26 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/delta-operator.h" 1 # 19 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/delta-operator.h" # 1 "/usr/include/assert.h" 1 3 4 # 20 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/delta-operator.h" 2 # 1 "/usr/include/assert.h" 1 3 4 # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/delta-operator.h" 2 int nchoosek(int n, int k){ if (k == 0) return 1; return (n * nchoosek(n - 1, k - 1)) / k; } void generate_delta_coefficients(double vetor[], double out[], int n, double delta){ int i,j; int N = n - 1; double sum_delta_operator; for(i=0; i<=N; i++) { sum_delta_operator = 0; for(j=0; j<=i; j++) { sum_delta_operator = sum_delta_operator + vetor[j]*nchoosek(N-j,i-j); } out[i] = internal_pow(delta,N-i)*sum_delta_operator; } } void get_delta_transfer_function(double b[], double b_out[], int b_size, double a[], double a_out[], int a_size, double delta){ generate_delta_coefficients(b, b_out, b_size, delta); generate_delta_coefficients(a, a_out, a_size, delta); } void get_delta_transfer_function_with_base(double b[], double b_out[], int b_size, double a[], double a_out[], int a_size, double delta){ int i,j; int N = a_size - 1; int M = b_size - 1; double sum_delta_operator; for(i=0; i<=N; i++) { sum_delta_operator = 0; for(j=0; j<=i; j++) { sum_delta_operator = sum_delta_operator + a[j]*nchoosek(N-j,i-j); } a_out[i] = internal_pow(delta,N-i)*sum_delta_operator; } for(i=0; i<=M; i++) { sum_delta_operator = 0; for(j=0; j<=i; j++) { sum_delta_operator = sum_delta_operator + b[j]*nchoosek(M-j,i-j); } b_out[i] = internal_pow(delta,M-i)*sum_delta_operator; } } # 27 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/closed-loop.h" 1 # 28 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/closed-loop.h" void ft_closedloop_series(double c_num[], int Nc_num, double c_den[], int Nc_den, double model_num[], int Nmodel_num, double model_den[], int Nmodel_den, double ans_num[], int Nans_num, double ans_den[], int Nans_den){ Nans_num = Nc_num + Nmodel_num - 1; Nans_den = Nc_den + Nmodel_den - 1 ; double den_mult [Nans_den]; poly_mult(c_num, Nc_num, model_num, Nmodel_num, ans_num, Nans_num); poly_mult(c_den, Nc_den, model_den, Nmodel_den, den_mult, Nans_den ); poly_sum(ans_num, Nans_num , den_mult, Nans_den , ans_den, Nans_den); } void ft_closedloop_sensitivity(double c_num[], int Nc_num, double c_den[], int Nc_den, double model_num[], int Nmodel_num, double model_den[], int Nmodel_den, double ans_num[], int Nans_num, double ans_den[], int Nans_den){ int Nans_num_p = Nc_num + Nmodel_num-1; Nans_den = Nc_den + Nmodel_den-1; Nans_num = Nc_den + Nmodel_den-1; double num_mult [Nans_num_p]; poly_mult(c_den, Nc_den, model_den, Nmodel_den, ans_num, Nans_num); poly_mult(c_num, Nc_num, model_num, Nmodel_num, num_mult, Nans_num_p); poly_sum(ans_num, Nans_num, num_mult, Nans_num_p, ans_den, Nans_den); } void ft_closedloop_feedback(double c_num[], int Nc_num, double c_den[], int Nc_den, double model_num[], int Nmodel_num, double model_den[], int Nmodel_den, double ans_num[], int Nans_num, double ans_den[], int Nans_den){ Nans_num = Nc_den + Nmodel_num - 1; Nans_den = Nc_den + Nmodel_den - 1; int Nnum_mult = Nc_num + Nmodel_num - 1; double den_mult [Nans_den]; double num_mult [Nnum_mult]; poly_mult(c_num, Nc_num, model_num, Nmodel_num, num_mult, Nnum_mult); poly_mult(c_den, Nc_den, model_den, Nmodel_den, den_mult, Nans_den); poly_sum(num_mult, Nnum_mult, den_mult, Nans_den, ans_den, Nans_den); poly_mult(c_den, Nc_den, model_num, Nmodel_num, ans_num, Nans_num); } int check_stability_closedloop(double a[], int n, double plant_num[], int p_num_size, double plant_den[], int p_den_size){ int columns = n; double m[2 * n - 1][n]; int i,j; int first_is_positive = 0; double * p_num = plant_num; double * p_den = plant_den; double sum = 0; for (i=0; i < n; i++){ sum += a[i]; } __DSVERIFIER_assert(sum > 0); sum = 0; for (i=0; i < n; i++){ sum += a[i] * internal_pow(-1, n-1-i); } sum = sum * internal_pow(-1, n-1); __DSVERIFIER_assert(sum > 0); __DSVERIFIER_assert(internal_abs(a[n-1]) < a[0]); for (i=0; i < 2 * n - 1; i++){ for (j=0; j < columns; j++){ m[i][j] = 0; if (i == 0){ m[i][j] = a[j]; continue; } if (i % 2 != 0 ){ int x; for(x=0; x<columns;x++){ m[i][x] = m[i-1][columns-x-1]; } columns = columns - 1; j = columns; }else{ __DSVERIFIER_assert(m[i-2][0] > 0); m[i][j] = m[i-2][j] - (m[i-2][columns] / m[i-2][0]) * m[i-1][j]; __DSVERIFIER_assert((m[0][0] >= 0) && (m[i][0] >= 0)); } } } return 1; } # 28 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" 1 # 17 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" extern digital_system ds; extern digital_system plant; extern digital_system control; extern implementation impl; extern filter_parameters filter; extern hardware hw; void initialization(){ if (impl.frac_bits >= 32){ printf("impl.frac_bits must be less than word width!\n"); } if (impl.int_bits >= 32 - impl.frac_bits){ printf("impl.int_bits must be less than word width subtracted by precision!\n"); # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" 3 4 ((void) sizeof (( # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" 0 # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" 0 # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" 3 4 ) ; else __assert_fail ( # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" "0" # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h", 33, __extension__ __PRETTY_FUNCTION__); })) # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" ; } if(impl.frac_bits >= 31){ _fxp_one = 0x7fffffff; }else{ _fxp_one = (0x00000001 << impl.frac_bits); } _fxp_half = (0x00000001 << (impl.frac_bits - 1)); _fxp_minus_one = -(0x00000001 << impl.frac_bits); _fxp_min = -(0x00000001 << (impl.frac_bits + impl.int_bits - 1)); _fxp_max = (0x00000001 << (impl.frac_bits + impl.int_bits - 1)) - 1; _fxp_fmask = ((((int32_t) 1) << impl.frac_bits) - 1); _fxp_imask = ((0x80000000) >> (32 - impl.frac_bits - 1)); _dbl_min = _fxp_min; _dbl_min /= (1 << impl.frac_bits); _dbl_max = _fxp_max; _dbl_max /= (1 << impl.frac_bits); if ((impl.scale == 0) || (impl.scale == 1)){ impl.scale = 1; return; } if (impl.min != 0){ impl.min = impl.min / impl.scale; } if (impl.max != 0){ impl.max = impl.max / impl.scale; } # 80 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/initialization.h" } # 29 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/state-space.h" 1 # 19 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/state-space.h" extern digital_system_state_space _controller; extern int nStates; extern int nInputs; extern int nOutputs; double double_state_space_representation(void){ double result1[4][4]; double result2[4][4]; int i, j; for(i=0; i<4;i++){ for(j=0; j<4;j++){ result1[i][j]=0; result2[i][j]=0; } } double_matrix_multiplication(nOutputs,nStates,nStates,1,_controller.C,_controller.states,result1); double_matrix_multiplication(nOutputs,nInputs,nInputs,1,_controller.D,_controller.inputs,result2); double_add_matrix(nOutputs, 1, result1, result2, _controller.outputs); double_matrix_multiplication(nStates,nStates,nStates,1,_controller.A,_controller.states,result1); double_matrix_multiplication(nStates,nInputs,nInputs,1,_controller.B,_controller.inputs,result2); double_add_matrix(nStates, 1, result1, result2, _controller.states); return _controller.outputs[0][0]; } double fxp_state_space_representation(void){ fxp_t result1[4][4]; fxp_t result2[4][4]; int i, j; for(i=0; i<4;i++){ for(j=0; j<4;j++){ result1[i][j]=0; result2[i][j]=0; } } fxp_t A_fpx[4][4]; fxp_t B_fpx[4][4]; fxp_t C_fpx[4][4]; fxp_t D_fpx[4][4]; fxp_t states_fpx[4][4]; fxp_t inputs_fpx[4][4]; fxp_t outputs_fpx[4][4]; for(i=0; i<4;i++){ for(j=0; j<4;j++){ A_fpx[i][j]=0; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ B_fpx[i][j]=0; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ C_fpx[i][j]=0; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ D_fpx[i][j]=0; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ states_fpx[i][j]=0; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ inputs_fpx[i][j]=0; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ outputs_fpx[i][j]=0; } } for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ A_fpx[i][j]= fxp_double_to_fxp(_controller.A[i][j]); } } for(i=0; i<nStates;i++){ for(j=0; j<nInputs;j++){ B_fpx[i][j]= fxp_double_to_fxp(_controller.B[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<nStates;j++){ C_fpx[i][j]= fxp_double_to_fxp(_controller.C[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<nInputs;j++){ D_fpx[i][j]= fxp_double_to_fxp(_controller.D[i][j]); } } for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ states_fpx[i][j]= fxp_double_to_fxp(_controller.states[i][j]); } } for(i=0; i<nInputs;i++){ for(j=0; j<1;j++){ inputs_fpx[i][j]= fxp_double_to_fxp(_controller.inputs[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<1;j++){ outputs_fpx[i][j]= fxp_double_to_fxp(_controller.outputs[i][j]); } } fxp_matrix_multiplication(nOutputs,nStates,nStates,1,C_fpx,states_fpx,result1); fxp_matrix_multiplication(nOutputs,nInputs,nInputs,1,D_fpx,inputs_fpx,result2); fxp_add_matrix(nOutputs, 1, result1, result2, outputs_fpx); fxp_matrix_multiplication(nStates,nStates,nStates,1,A_fpx,states_fpx,result1); fxp_matrix_multiplication(nStates,nInputs,nInputs,1,B_fpx,inputs_fpx,result2); fxp_add_matrix(nStates, 1, result1, result2, states_fpx); for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ _controller.states[i][j]= fxp_to_double(states_fpx[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<1;j++){ _controller.outputs[i][j]= fxp_to_double(outputs_fpx[i][j]); } } return _controller.outputs[0][0]; } # 30 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/filter_functions.h" 1 # 20 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/core/filter_functions.h" double sinTyl(double x, int precision){ double sine; double xsquared = x*x; double aux; if (precision < 0) { printf("Warning: Function sinTyl from bmc/core/filter_functions.h: " "Precision must be a positive integer. Assuming 0 precision\n"); precision = 0; } if (precision >= 0) { aux = 0; sine = aux; if (precision >= 1) { aux = x; sine += aux; if (precision >= 2) { aux = aux*xsquared; sine -= aux/6; if (precision >= 3) { aux = aux*xsquared; sine +=aux/120; if(precision >=4) { aux = aux*xsquared; sine -=aux/5040; if(precision >= 5) { aux = aux*xsquared; sine +=aux/362880; if(precision >= 6) { aux = aux*xsquared; sine -=aux/39916800; if (precision >= 7) printf("Warning: Function sinTyl " "from bmc/core/filter_functions.h: Precision " "representation exceeded. Assuming maximum precision of 6\n"); } } } } } } } return sine; } double cosTyl(double x, int precision){ double cosine; double xsquared = x*x; double aux; if (precision < 0) { printf("Warning: Function cosTyl from bmc/core/filter_functions.h: " "Precision must be a positive integer. Assuming 0 precision\n"); precision = 0; } if (precision >= 0) { aux = 0; cosine = aux; if (precision >= 1) { aux = 1; cosine = 1; if (precision >= 2) { aux = xsquared; cosine -= aux/2; if (precision >= 3) { aux = aux*xsquared; cosine += aux/24; if(precision >=4) { aux = aux*xsquared; cosine -=aux/720; if(precision >= 5) { aux = aux*xsquared; cosine +=aux/40320; if(precision >= 6) { aux = aux*xsquared; cosine -=aux/3628800; if (precision >= 7) printf("Warning: Function sinTyl " "from bmc/core/filter_functions.h: Precision " "representation exceeded. Assuming maximum precision of 6\n"); } } } } } } } return cosine; } double atanTyl(double x, int precision){ double atangent; double xsquared = x*x; double aux; if (precision < 0) { printf("Warning: Function sinTyl from bmc/core/filter_functions.h: " "Precision must be a positive integer. Assuming 0 precision\n"); precision = 0; } if (precision >= 0) { aux = 0; atangent = aux; if (precision >= 1) { aux = x; atangent = aux; if (precision >= 2) { aux = xsquared; atangent -= aux/3; if (precision >= 3) { aux = aux*xsquared; atangent += aux/5; if(precision >=4) { aux = aux*xsquared; atangent -=aux/7; if (precision >= 7) printf("Warning: Function sinTyl from bmc/core/filter_functions.h: " "Precision representation exceeded. Assuming maximum precision of 4\n"); } } } } } return atangent; } float sqrt1(const float x) { const float xhalf = 0.5f*x; union { float x; int i; } u; u.x = x; u.i = 0x5f3759df - (u.i >> 1); return x*u.x*(1.5f - xhalf*u.x*u.x); } float sqrt2(const float x) { union { int i; float x; } u; u.x = x; u.i = (1<<29) + (u.i >> 1) - (1<<22); return u.x; } float fabsolut(float x) { if (x < 0) x = -x; return x; } static float sqrt3(float val) { float x = val/10; float dx; double diff; double min_tol = 0.00001; int i, flag; flag = 0; if (val == 0 ) x = 0; else { for (i=1;i<20;i++) { if (!flag) { dx = (val - (x*x)) / (2.0 * x); x = x + dx; diff = val - (x*x); if (fabsolut(diff) <= min_tol) flag = 1; } else x =x; } } return (x); } # 31 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_overflow.h" 1 # 19 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_overflow.h" int nondet_int(); float nondet_float(); extern digital_system ds; extern implementation impl; int verify_overflow(void) { fxp_t a_fxp[ds.a_size]; fxp_t b_fxp[ds.b_size]; fxp_double_to_fxp_array(ds.a, a_fxp, ds.a_size); fxp_double_to_fxp_array(ds.b, b_fxp, ds.b_size); # 73 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_overflow.h" fxp_t min_fxp = fxp_double_to_fxp(impl.min); fxp_t max_fxp = fxp_double_to_fxp(impl.max); fxp_t y[X_SIZE_VALUE]; fxp_t x[X_SIZE_VALUE]; int i; for (i = 0; i < X_SIZE_VALUE; ++i) { y[i] = 0; x[i] = nondet_int(); __DSVERIFIER_assume(x[i] >= min_fxp && x[i] <= max_fxp); } int Nw = 0; Nw = ds.a_size > ds.b_size ? ds.a_size : ds.b_size; fxp_t yaux[ds.a_size]; fxp_t xaux[ds.b_size]; fxp_t waux[Nw]; for (i = 0; i < ds.a_size; ++i) { yaux[i] = 0; } for (i = 0; i < ds.b_size; ++i) { xaux[i] = 0; } for (i = 0; i < Nw; ++i) { waux[i] = 0; } fxp_t xk, temp; fxp_t *aptr, *bptr, *xptr, *yptr, *wptr; int j; for (i = 0; i < X_SIZE_VALUE; ++i) { # 129 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_overflow.h" y[i] = fxp_transposed_direct_form_2(waux, x[i], a_fxp, b_fxp, ds.a_size, ds.b_size); # 174 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_overflow.h" } overflow_mode = 1; fxp_verify_overflow_array(y, X_SIZE_VALUE); return 0; } # 33 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 1 # 15 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" extern digital_system ds; extern implementation impl; extern digital_system_state_space _controller; extern int nStates; extern int nInputs; extern int nOutputs; int verify_limit_cycle_state_space(void){ double stateMatrix[4][4]; double outputMatrix[4][4]; double arrayLimitCycle[4]; double result1[4][4]; double result2[4][4]; int i, j, k; for(i=0; i<4;i++){ for(j=0; j<4;j++){ result1[i][j]=0; result2[i][j]=0; stateMatrix[i][j]=0; outputMatrix[i][j]=0; } } double_matrix_multiplication(nOutputs,nStates,nStates,1,_controller.C,_controller.states,result1); double_matrix_multiplication(nOutputs,nInputs,nInputs,1,_controller.D,_controller.inputs,result2); double_add_matrix(nOutputs, 1, result1, result2, _controller.outputs); k = 0; for (i = 1; i < 0; i++) { double_matrix_multiplication(nStates,nStates,nStates,1,_controller.A,_controller.states,result1); double_matrix_multiplication(nStates,nInputs,nInputs,1,_controller.B,_controller.inputs,result2); double_add_matrix(nStates, 1, result1, result2, _controller.states); double_matrix_multiplication(nOutputs,nStates,nStates,1,_controller.C,_controller.states,result1); double_matrix_multiplication(nOutputs,nInputs,nInputs,1,_controller.D,_controller.inputs,result2); double_add_matrix(nOutputs, 1, result1, result2, _controller.outputs); int l; for(l = 0; l < nStates; l++){ stateMatrix[l][k] = _controller.states[l][0]; } for(l = 0; l < nOutputs; l++){ stateMatrix[l][k] = _controller.outputs[l][0]; } k++; } printf("#matrix STATES -------------------------------"); print_matrix(stateMatrix,nStates,0); printf("#matrix OUTPUTS -------------------------------"); print_matrix(outputMatrix,nOutputs,0); # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 ((void) sizeof (( # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 0 # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 0 # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 ) ; else __assert_fail ( # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" "0" # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h", 93, __extension__ __PRETTY_FUNCTION__); })) # 93 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" ; for(i=0; i<nStates;i++){ for(j=0; j<0;j++){ arrayLimitCycle[j] = stateMatrix[i][j]; } double_check_persistent_limit_cycle(arrayLimitCycle,0); } for(i=0; i<nOutputs;i++){ for(j=0; j<0;j++){ arrayLimitCycle[j] = outputMatrix[i][j]; } double_check_persistent_limit_cycle(arrayLimitCycle,0); } # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 ((void) sizeof (( # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 0 # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 0 # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 ) ; else __assert_fail ( # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" "0" # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h", 110, __extension__ __PRETTY_FUNCTION__); })) # 110 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" ; } int verify_limit_cycle(void){ overflow_mode = 3; int i; int Set_xsize_at_least_two_times_Na = 2 * ds.a_size; printf("X_SIZE must be at least 2 * ds.a_size"); __DSVERIFIER_assert(X_SIZE_VALUE >= Set_xsize_at_least_two_times_Na); fxp_t a_fxp[ds.a_size]; fxp_t b_fxp[ds.b_size]; fxp_double_to_fxp_array(ds.a, a_fxp, ds.a_size); fxp_double_to_fxp_array(ds.b, b_fxp, ds.b_size); # 168 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" fxp_t y[X_SIZE_VALUE]; fxp_t x[X_SIZE_VALUE]; fxp_t min_fxp = fxp_double_to_fxp(impl.min); fxp_t max_fxp = fxp_double_to_fxp(impl.max); fxp_t xaux[ds.b_size]; int nondet_constant_input = nondet_int(); __DSVERIFIER_assume(nondet_constant_input >= min_fxp && nondet_constant_input <= max_fxp); for (i = 0; i < X_SIZE_VALUE; ++i) { x[i] = nondet_constant_input; y[i] = 0; } for (i = 0; i < ds.b_size; ++i) { xaux[i] = nondet_constant_input; } int Nw = 0; Nw = ds.a_size > ds.b_size ? ds.a_size : ds.b_size; fxp_t yaux[ds.a_size]; fxp_t y0[ds.a_size]; fxp_t waux[Nw]; fxp_t w0[Nw]; # 206 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" for (i = 0; i < Nw; ++i) { waux[i] = nondet_int(); __DSVERIFIER_assume(waux[i] >= min_fxp && waux[i] <= max_fxp); w0[i] = waux[i]; } fxp_t xk, temp; fxp_t *aptr, *bptr, *xptr, *yptr, *wptr; int j; for(i=0; i<X_SIZE_VALUE; ++i){ # 234 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" y[i] = fxp_transposed_direct_form_2(waux, x[i], a_fxp, b_fxp, ds.a_size, ds.b_size); # 278 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle.h" } fxp_check_persistent_limit_cycle(y, X_SIZE_VALUE); return 0; } # 34 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error.h" 1 # 17 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error.h" extern digital_system ds; extern implementation impl; int verify_error(void){ overflow_mode = 2; double a_cascade[100]; int a_cascade_size; double b_cascade[100]; int b_cascade_size; fxp_t a_fxp[ds.a_size]; fxp_t b_fxp[ds.b_size]; fxp_double_to_fxp_array(ds.a, a_fxp, ds.a_size); fxp_double_to_fxp_array(ds.b, b_fxp, ds.b_size); # 69 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error.h" fxp_t min_fxp = fxp_double_to_fxp(impl.min); fxp_t max_fxp = fxp_double_to_fxp(impl.max); fxp_t y[X_SIZE_VALUE]; fxp_t x[X_SIZE_VALUE]; double yf[X_SIZE_VALUE]; double xf[X_SIZE_VALUE]; int Nw = 0; Nw = ds.a_size > ds.b_size ? ds.a_size : ds.b_size; fxp_t yaux[ds.a_size]; fxp_t xaux[ds.b_size]; fxp_t waux[Nw]; double yfaux[ds.a_size]; double xfaux[ds.b_size]; double wfaux[Nw]; int i; for (i = 0; i < ds.a_size; ++i) { yaux[i] = 0; yfaux[i] = 0; } for (i = 0; i < ds.b_size; ++i) { xaux[i] = 0; xfaux[i] = 0; } for (i = 0; i < Nw; ++i) { waux[i] = 0; wfaux[i] = 0; } for (i = 0; i < X_SIZE_VALUE; ++i) { y[i] = 0; x[i] = nondet_int(); __DSVERIFIER_assume(x[i] >= min_fxp && x[i] <= max_fxp); yf[i] = 0.0f; xf[i] = fxp_to_double(x[i]); } for (i = 0; i < X_SIZE_VALUE; ++i) { # 156 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error.h" y[i] = fxp_transposed_direct_form_2(waux, x[i], a_fxp, b_fxp, ds.a_size, ds.b_size); yf[i] = double_transposed_direct_form_2(wfaux, xf[i], ds.a, ds.b, ds.a_size, ds.b_size); # 169 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error.h" double absolute_error = yf[i] - fxp_to_double(y[i]); __DSVERIFIER_assert(absolute_error < (impl.max_error) && absolute_error > (-impl.max_error)); } return 0; } # 35 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" 1 # 13 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" extern digital_system ds; extern implementation impl; int verify_zero_input_limit_cycle(void){ overflow_mode = 3; int i,j; int Set_xsize_at_least_two_times_Na = 2 * ds.a_size; printf("X_SIZE must be at least 2 * ds.a_size"); # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" 3 4 ((void) sizeof (( # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" X_SIZE_VALUE >= Set_xsize_at_least_two_times_Na # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" X_SIZE_VALUE >= Set_xsize_at_least_two_times_Na # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" 3 4 ) ; else __assert_fail ( # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" "X_SIZE_VALUE >= Set_xsize_at_least_two_times_Na" # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h", 23, __extension__ __PRETTY_FUNCTION__); })) # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" ; fxp_t a_fxp[ds.a_size]; fxp_t b_fxp[ds.b_size]; fxp_double_to_fxp_array(ds.a, a_fxp, ds.a_size); fxp_double_to_fxp_array(ds.b, b_fxp, ds.b_size); # 71 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" fxp_t min_fxp = fxp_double_to_fxp(impl.min); fxp_t max_fxp = fxp_double_to_fxp(impl.max); fxp_t y[X_SIZE_VALUE]; fxp_t x[X_SIZE_VALUE]; for (i = 0; i < X_SIZE_VALUE; ++i) { y[i] = 0; x[i] = 0; } int Nw = 0; Nw = ds.a_size > ds.b_size ? ds.a_size : ds.b_size; fxp_t yaux[ds.a_size]; fxp_t xaux[ds.b_size]; fxp_t waux[Nw]; fxp_t y0[ds.a_size]; fxp_t w0[Nw]; # 104 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" for (i = 0; i < Nw; ++i) { waux[i] = nondet_int(); __DSVERIFIER_assume(waux[i] >= min_fxp && waux[i] <= max_fxp); w0[i] = waux[i]; } for (i = 0; i < ds.b_size; ++i) { xaux[i] = 0; } fxp_t xk, temp; fxp_t *aptr, *bptr, *xptr, *yptr, *wptr; for(i=0; i<X_SIZE_VALUE; ++i){ # 141 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" y[i] = fxp_transposed_direct_form_2(waux, x[i], a_fxp, b_fxp, ds.a_size, ds.b_size); # 188 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_zero_input_limit_cycle.h" } fxp_check_persistent_limit_cycle(y, X_SIZE_VALUE); return 0; } # 36 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" 1 # 16 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" int nondet_int(); float nondet_float(); extern digital_system ds; extern implementation impl; extern hardware hw; int generic_timer = 0; int verify_generic_timing(void) { double y[X_SIZE_VALUE]; double x[X_SIZE_VALUE]; int i; for (i = 0; i < X_SIZE_VALUE; ++i) { y[i] = 0; x[i] = nondet_float(); __DSVERIFIER_assume(x[i] >= impl.min && x[i] <= impl.max); } int Nw = 0; Nw = ds.a_size > ds.b_size ? ds.a_size : ds.b_size; double yaux[ds.a_size]; double xaux[ds.b_size]; double waux[Nw]; for (i = 0; i < ds.a_size; ++i) { yaux[i] = 0; } for (i = 0; i < ds.b_size; ++i) { xaux[i] = 0; } for (i = 0; i < Nw; ++i) { waux[i] = 0; } double xk, temp; double *aptr, *bptr, *xptr, *yptr, *wptr; int j; generic_timer += ((2 * hw.assembly.std) + (1 * hw.assembly.rjmp)); double initial_timer = generic_timer; for (i = 0; i < X_SIZE_VALUE; ++i) { generic_timer += ((2 * hw.assembly.ldd) + (1 * hw.assembly.adiw) + (2 * hw.assembly.std)); generic_timer += ((2 * hw.assembly.ldd) + (1 * hw.assembly.cpi) + (1 * hw.assembly.cpc) + (1 * hw.assembly.brlt)); # 85 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" y[i] = generic_timing_double_transposed_direct_form_2(waux, x[i], ds.a, ds.b, ds.a_size, ds.b_size); double spent_time = (((double) generic_timer) * hw.cycle); # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" 3 4 ((void) sizeof (( # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" spent_time <= ds.sample_time # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" spent_time <= ds.sample_time # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" 3 4 ) ; else __assert_fail ( # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" "spent_time <= ds.sample_time" # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h", 89, __extension__ __PRETTY_FUNCTION__); })) # 89 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_generic_timing.h" ; generic_timer = initial_timer; } return 0; } # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_timing_msp430.h" 1 # 16 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_timing_msp430.h" int nondet_int(); float nondet_float(); extern digital_system ds; extern implementation impl; int verify_timing_msp_430(void) { double y[X_SIZE_VALUE]; double x[X_SIZE_VALUE]; int i; for (i = 0; i < X_SIZE_VALUE; ++i) { y[i] = 0; x[i] = nondet_float(); __DSVERIFIER_assume(x[i] >= impl.min && x[i] <= impl.max); } int Nw = 0; Nw = ds.a_size > ds.b_size ? ds.a_size : ds.b_size; double yaux[ds.a_size]; double xaux[ds.b_size]; double waux[Nw]; for (i = 0; i < ds.a_size; ++i) { yaux[i] = 0; } for (i = 0; i < ds.b_size; ++i) { xaux[i] = 0; } for (i = 0; i < Nw; ++i) { waux[i] = 0; } double xk, temp; double *aptr, *bptr, *xptr, *yptr, *wptr; int j; for (i = 0; i < X_SIZE_VALUE; ++i) { # 75 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_timing_msp430.h" y[i] = double_transposed_direct_form_2_MSP430(waux, x[i], ds.a, ds.b, ds.a_size, ds.b_size); # 121 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_timing_msp430.h" } return 0; } # 38 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" 1 # 21 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" extern digital_system ds; extern implementation impl; int verify_stability(void){ overflow_mode = 0; fxp_t a_fxp[ds.a_size]; fxp_double_to_fxp_array(ds.a, a_fxp, ds.a_size); double _a[ds.a_size]; fxp_to_double_array(_a, a_fxp, ds.a_size); # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" 3 4 ((void) sizeof (( # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" check_stability(_a, ds.a_size) # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" check_stability(_a, ds.a_size) # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" 3 4 ) ; else __assert_fail ( # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" "check_stability(_a, ds.a_size)" # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h", 37, __extension__ __PRETTY_FUNCTION__); })) # 37 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" ; # 83 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability.h" return 0; } # 39 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_minimum_phase.h" 1 # 21 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_minimum_phase.h" extern digital_system ds; extern implementation impl; int verify_minimum_phase(void){ overflow_mode = 0; fxp_t b_fxp[ds.b_size]; fxp_double_to_fxp_array(ds.b, b_fxp, ds.b_size); double _b[ds.b_size]; fxp_to_double_array(_b, b_fxp, ds.b_size); __DSVERIFIER_assert(check_stability(_b, ds.b_size)); # 85 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_minimum_phase.h" return 0; } # 40 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability_closedloop.h" 1 # 17 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability_closedloop.h" extern digital_system plant; extern digital_system plant_cbmc; extern digital_system controller; int verify_stability_closedloop_using_dslib(void){ double * c_num = controller.b; int c_num_size = controller.b_size; double * c_den = controller.a; int c_den_size = controller.a_size; fxp_t c_num_fxp[controller.b_size]; fxp_double_to_fxp_array(c_num, c_num_fxp, controller.b_size); fxp_t c_den_fxp[controller.a_size]; fxp_double_to_fxp_array(c_den, c_den_fxp, controller.a_size); double c_num_qtz[controller.b_size]; fxp_to_double_array(c_num_qtz, c_num_fxp, controller.b_size); double c_den_qtz[controller.a_size]; fxp_to_double_array(c_den_qtz, c_den_fxp, controller.a_size); double * p_num = plant.b; int p_num_size = plant.b_size; double * p_den = plant.a; int p_den_size = plant.a_size; double ans_num[100]; int ans_num_size = controller.b_size + plant.b_size - 1; double ans_den[100]; int ans_den_size = controller.a_size + plant.a_size - 1; # 68 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_stability_closedloop.h" printf("Verifying stability for closedloop function\n"); __DSVERIFIER_assert(check_stability_closedloop(ans_den, ans_den_size, p_num, p_num_size, p_den, p_den_size)); return 0; } # 41 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle_closedloop.h" 1 # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle_closedloop.h" extern digital_system plant; extern digital_system plant_cbmc; extern digital_system controller; double nondet_double(); int verify_limit_cycle_closed_loop(void){ overflow_mode = 3; double * c_num = controller.b; int c_num_size = controller.b_size; double * c_den = controller.a; int c_den_size = controller.a_size; fxp_t c_num_fxp[controller.b_size]; fxp_double_to_fxp_array(c_num, c_num_fxp, controller.b_size); fxp_t c_den_fxp[controller.a_size]; fxp_double_to_fxp_array(c_den, c_den_fxp, controller.a_size); double c_num_qtz[controller.b_size]; fxp_to_double_array(c_num_qtz, c_num_fxp, controller.b_size); double c_den_qtz[controller.a_size]; fxp_to_double_array(c_den_qtz, c_den_fxp, controller.a_size); double * p_num = plant.b; int p_num_size = plant.b_size; double * p_den = plant.a; int p_den_size = plant.a_size; double ans_num[100]; int ans_num_size = controller.b_size + plant.b_size - 1; double ans_den[100]; int ans_den_size = controller.a_size + plant.a_size - 1; int i; double y[X_SIZE_VALUE]; double x[X_SIZE_VALUE]; double xaux[ans_num_size]; double nondet_constant_input = nondet_double(); __DSVERIFIER_assume(nondet_constant_input >= impl.min && nondet_constant_input <= impl.max); for (i = 0; i < X_SIZE_VALUE; ++i) { x[i] = nondet_constant_input; y[i] = 0; } for (i = 0; i < ans_num_size; ++i) { xaux[i] = nondet_constant_input; } double yaux[ans_den_size]; double y0[ans_den_size]; int Nw = ans_den_size > ans_num_size ? ans_den_size : ans_num_size; double waux[Nw]; double w0[Nw]; # 105 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle_closedloop.h" for (i = 0; i < Nw; ++i) { waux[i] = nondet_int(); __DSVERIFIER_assume(waux[i] >= impl.min && waux[i] <= impl.max); w0[i] = waux[i]; } double xk, temp; double *aptr, *bptr, *xptr, *yptr, *wptr; int j; for(i=0; i<X_SIZE_VALUE; ++i){ # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_limit_cycle_closedloop.h" y[i] = double_transposed_direct_form_2(waux, x[i], ans_den, ans_num, ans_den_size, ans_num_size); } double_check_persistent_limit_cycle(y, X_SIZE_VALUE); return 0; } # 42 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_closedloop.h" 1 # 23 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_closedloop.h" extern digital_system plant; extern digital_system plant_cbmc; extern digital_system controller; int verify_error_closedloop(void){ overflow_mode = 3; double * c_num = controller.b; int c_num_size = controller.b_size; double * c_den = controller.a; int c_den_size = controller.a_size; fxp_t c_num_fxp[controller.b_size]; fxp_double_to_fxp_array(c_num, c_num_fxp, controller.b_size); fxp_t c_den_fxp[controller.a_size]; fxp_double_to_fxp_array(c_den, c_den_fxp, controller.a_size); double c_num_qtz[controller.b_size]; fxp_to_double_array(c_num_qtz, c_num_fxp, controller.b_size); double c_den_qtz[controller.a_size]; fxp_to_double_array(c_den_qtz, c_den_fxp, controller.a_size); double * p_num = plant.b; int p_num_size = plant.b_size; double * p_den = plant.a; int p_den_size = plant.a_size; double ans_num_double[100]; double ans_num_qtz[100]; int ans_num_size = controller.b_size + plant.b_size - 1; double ans_den_qtz[100]; double ans_den_double[100]; int ans_den_size = controller.a_size + plant.a_size - 1; # 77 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_closedloop.h" int i; double y_qtz[X_SIZE_VALUE]; double y_double[X_SIZE_VALUE]; double x_qtz[X_SIZE_VALUE]; double x_double[X_SIZE_VALUE]; double xaux_qtz[ans_num_size]; double xaux_double[ans_num_size]; double xaux[ans_num_size]; double nondet_constant_input = nondet_double(); __DSVERIFIER_assume(nondet_constant_input >= impl.min && nondet_constant_input <= impl.max); for (i = 0; i < X_SIZE_VALUE; ++i) { x_qtz[i] = nondet_constant_input; x_double[i] = nondet_constant_input; y_qtz[i] = 0; y_double[i] = 0; } for (i = 0; i < ans_num_size; ++i) { xaux_qtz[i] = nondet_constant_input; xaux_double[i] = nondet_constant_input; } double yaux_qtz[ans_den_size]; double yaux_double[ans_den_size]; double y0_qtz[ans_den_size]; double y0_double[ans_den_size]; int Nw = ans_den_size > ans_num_size ? ans_den_size : ans_num_size; double waux_qtz[Nw]; double waux_double[Nw]; double w0_qtz[Nw]; double w0_double[Nw]; for (i = 0; i < Nw; ++i) { waux_qtz[i] = 0; waux_double[i] = 0; } for(i=0; i<X_SIZE_VALUE; ++i){ # 150 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_closedloop.h" y_qtz[i] = double_transposed_direct_form_2(waux_qtz, x_qtz[i], ans_den_qtz, ans_num_qtz, ans_den_size, ans_num_size); y_double[i] = double_transposed_direct_form_2(waux_double, x_double[i], ans_den_double, ans_num_double, ans_den_size, ans_num_size); double absolute_error = y_double[i] - fxp_to_double(y_qtz[i]); __DSVERIFIER_assert(absolute_error < (impl.max_error) && absolute_error > (-impl.max_error)); } return 0; } # 43 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 1 # 20 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" extern digital_system_state_space _controller; extern double error_limit; extern int closed_loop; double new_state[4][4]; double new_stateFWL[4][4]; digital_system_state_space _controller_fxp; digital_system_state_space _controller_double; double ss_system_quantization_error(fxp_t inputs){ digital_system_state_space __backupController; int i; int j; _controller.inputs[0][0] = inputs; for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ __backupController.A[i][j]= (_controller.A[i][j]); } } for(i=0; i<nStates;i++){ for(j=0; j<nInputs;j++){ __backupController.B[i][j]= (_controller.B[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<nStates;j++){ __backupController.C[i][j]= (_controller.C[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<nInputs;j++){ __backupController.D[i][j]= (_controller.D[i][j]); } } for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ __backupController.states[i][j]= (_controller.states[i][j]); } } for(i=0; i<nInputs;i++){ for(j=0; j<1;j++){ __backupController.inputs[i][j]= (_controller.inputs[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<1;j++){ __backupController.outputs[i][j]= (_controller.outputs[i][j]); } } double __quant_error = 0.0; for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ _controller.states[i][j]= (new_state[i][j]); } } double output_double = double_state_space_representation(); for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ new_state[i][j]= (_controller.states[i][j]); } } __backupController.inputs[0][0] = inputs; for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ _controller.A[i][j] = __backupController.A[i][j]; } } for(i=0; i<nStates;i++){ for(j=0; j<nInputs;j++){ _controller.B[i][j] = __backupController.B[i][j]; } } for(i=0; i<nOutputs;i++){ for(j=0; j<nStates;j++){ _controller.C[i][j] = __backupController.C[i][j]; } } for(i=0; i<nOutputs;i++){ for(j=0; j<nInputs;j++){ _controller.D[i][j] = __backupController.D[i][j]; } } for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ _controller.states[i][j] = __backupController.states[i][j]; } } for(i=0; i<nInputs;i++){ for(j=0; j<1;j++){ _controller.inputs[i][j] = __backupController.inputs[i][j]; } } for(i=0; i<nOutputs;i++){ for(j=0; j<1;j++){ _controller.outputs[i][j] = __backupController.outputs[i][j]; } } for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ _controller.states[i][j]= (new_stateFWL[i][j]); } } double output_fxp = fxp_state_space_representation(); for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ new_stateFWL[i][j]= (_controller.states[i][j]); } } __quant_error = output_double - output_fxp; return __quant_error; } double fxp_ss_closed_loop_quantization_error(double reference){ double reference_aux[4][4]; double result1[4][4]; double temp_result1[4][4]; double result2[4][4]; double temp_states[4][4]; fxp_t K_fxp[4][4]; fxp_t states_fxp[4][4]; fxp_t result_fxp[4][4]; unsigned int i; unsigned int j; unsigned int k; short unsigned int flag = 0; for(i=0; i<nOutputs;i++){ for(j=0; j<nInputs;j++){ if(_controller_fxp.D[i][j] != 0){ flag = 1; } } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ reference_aux[i][j]=0; K_fxp[i][j] = 0; } } for(i=0; i<nInputs;i++){ reference_aux[i][0]= reference; } for(i=0; i<4;i++){ states_fxp[i][0]=0; } for(i=0; i<nStates;i++){ K_fxp[0][i]= fxp_double_to_fxp(_controller_fxp.K[0][i]); } for(i=0; i<4;i++){ for(j=0; j<4;j++){ result1[i][j]=0; result2[i][j]=0; } } for(k=0; k<nStates;k++) { states_fxp[k][0]= fxp_double_to_fxp(_controller_fxp.states[k][0]); } fxp_matrix_multiplication(nOutputs,nStates,nStates,1,K_fxp,states_fxp,result_fxp); fxp_t reference_fxp[4][4]; fxp_t result_fxp2[4][4]; for(k=0;k<nInputs;k++) { reference_fxp[k][0] =fxp_double_to_fxp(fxp_quantize(reference_aux[k][0])); } fxp_sub_matrix(nInputs,1, reference_fxp, result_fxp, result_fxp2); for(k=0; k<nInputs;k++) { _controller_fxp.inputs[k][0] = fxp_to_double(fxp_quantize(result_fxp2[k][0])); } double_matrix_multiplication(nOutputs,nStates,nStates,1,_controller_fxp.C,_controller_fxp.states,result1); if(flag == 1) { double_matrix_multiplication(nOutputs,nInputs,nInputs,1,_controller_fxp.D,_controller_fxp.inputs,result2); } double_add_matrix(nOutputs,1,result1,result2,_controller_fxp.outputs); double_matrix_multiplication(nStates,nStates,nStates,1,_controller_fxp.A,_controller_fxp.states,result1); double_matrix_multiplication(nStates,nInputs,nInputs,1,_controller_fxp.B,_controller_fxp.inputs,result2); double_add_matrix(nStates,1,result1,result2,_controller_fxp.states); return _controller_fxp.outputs[0][0]; } double ss_closed_loop_quantization_error(double reference){ double reference_aux[4][4]; double result1[4][4]; double result2[4][4]; unsigned int i; unsigned int j; short unsigned int flag = 0; for(i=0; i<nOutputs;i++){ for(j=0; j<nInputs;j++){ if(_controller_double.D[i][j] != 0){ flag = 1; } } } for(i=0; i<nInputs;i++){ for(j=0; j<1;j++){ reference_aux[i][j]= reference; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ result1[i][j]=0; result2[i][j]=0; } } double_matrix_multiplication(nOutputs,nStates,nStates,1,_controller_double.K,_controller_double.states,result1); double_sub_matrix(nInputs,1,reference_aux,result1, _controller_double.inputs); double_matrix_multiplication(nOutputs,nStates,nStates,1,_controller_double.C,_controller_double.states,result1); if(flag == 1) double_matrix_multiplication(nOutputs,nInputs,nInputs,1,_controller_double.D,_controller_double.inputs,result2); double_add_matrix(nOutputs,1,result1,result2,_controller_double.outputs); double_matrix_multiplication(nStates,nStates,nStates,1,_controller_double.A,_controller_double.states,result1); double_matrix_multiplication(nStates,nInputs,nInputs,1,_controller_double.B,_controller_double.inputs,result2); double_add_matrix(nStates,1,result1,result2,_controller_double.states); return _controller_double.outputs[0][0]; } int verify_error_state_space(void){ int i,j; for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ new_state[i][j]= (_controller.states[i][j]); } } for(i=0; i<nStates;i++){ for(j=0; j<1;j++){ new_stateFWL[i][j]= (_controller.states[i][j]); } } _controller_fxp = _controller; _controller_double = _controller; overflow_mode = 0; fxp_t x[0]; fxp_t min_fxp = fxp_double_to_fxp(impl.min); fxp_t max_fxp = fxp_double_to_fxp(impl.max); double nondet_constant_input = nondet_double(); __DSVERIFIER_assume(nondet_constant_input >= min_fxp && nondet_constant_input <= max_fxp); for (i = 0; i < 0; ++i) { x[i] = nondet_constant_input; } double __quant_error; if(closed_loop){ for (i = 0; i < 0; ++i) { __quant_error = ss_closed_loop_quantization_error(x[i]) - fxp_ss_closed_loop_quantization_error(x[i]); # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 ((void) sizeof (( # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" __quant_error < error_limit && __quant_error > ((-1)*error_limit) # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" __quant_error < error_limit && __quant_error > ((-1)*error_limit) # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 ) ; else __assert_fail ( # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" "__quant_error < error_limit && __quant_error > ((-1)*error_limit)" # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h", 354, __extension__ __PRETTY_FUNCTION__); })) # 354 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" ; } } else { for (i=0; i < 0; i++) { __quant_error = ss_system_quantization_error(x[i]); # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 ((void) sizeof (( # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" __quant_error < error_limit && __quant_error > ((-1)*error_limit) # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" __quant_error < error_limit && __quant_error > ((-1)*error_limit) # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 ) ; else __assert_fail ( # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" "__quant_error < error_limit && __quant_error > ((-1)*error_limit)" # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h", 361, __extension__ __PRETTY_FUNCTION__); })) # 361 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_error_state_space.h" ; } } return 0; } # 44 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" 1 # 17 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" extern digital_system_state_space _controller; extern double error_limit; extern int closed_loop; double fxp_ss_closed_loop_safety(){ double reference[4][4]; double result1[4][4]; double result2[4][4]; fxp_t K_fpx[4][4]; fxp_t outputs_fpx[4][4]; fxp_t result_fxp[4][4]; unsigned int i; unsigned int j; unsigned int k; short unsigned int flag = 0; for(i=0; i<nOutputs;i++){ for(j=0; j<nInputs;j++){ if(_controller.D[i][j] != 0){ flag = 1; } } } for(i=0; i<nInputs;i++){ for(j=0; j<1;j++){ reference[i][j]= (_controller.inputs[i][j]); } } for(i=0; i<nInputs;i++){ for(j=0; j<nOutputs;j++){ K_fpx[i][j]=0; } } for(i=0; i<nOutputs;i++){ for(j=0; j<1;j++){ outputs_fpx[i][j]=0; } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ result_fxp[i][j]=0; } } for(i=0; i<nInputs;i++){ for(j=0; j<nOutputs;j++){ K_fpx[i][j]= fxp_double_to_fxp(_controller.K[i][j]); } } for(i=0; i<4;i++){ for(j=0; j<4;j++){ result1[i][j]=0; result2[i][j]=0; } } for (i = 1; i < 0; i++) { double_matrix_multiplication(nOutputs,nStates,nStates,1,_controller.C,_controller.states,result1); if(flag == 1){ double_matrix_multiplication(nOutputs,nInputs,nInputs,1,_controller.D,_controller.inputs,result2); } double_add_matrix(nOutputs, 1, result1, result2, _controller.outputs); for(k=0; k<nOutputs;k++){ for(j=0; j<1;j++){ outputs_fpx[k][j]= fxp_double_to_fxp(_controller.outputs[k][j]); } } fxp_matrix_multiplication(nInputs,nOutputs,nOutputs,1,K_fpx,outputs_fpx,result_fxp); for(k=0; k<nInputs;k++){ for(j=0; j<1;j++){ result1[k][j]= fxp_to_double(result_fxp[k][j]); } } printf("### fxp: U (before) = %.9f", _controller.inputs[0][0]); printf("### fxp: reference = %.9f", reference[0][0]); printf("### fxp: result1 = %.9f", result1[0][0]); printf("### fxp: reference - result1 = %.9f", (reference[0][0] - result1[0][0])); double_sub_matrix(nInputs, 1, reference, result1, _controller.inputs); printf("### fxp: Y = %.9f", _controller.outputs[0][0]); printf("### fxp: U (after) = %.9f \n### \n### ", _controller.inputs[0][0]); double_matrix_multiplication(nStates,nStates,nStates,1,_controller.A,_controller.states,result1); double_matrix_multiplication(nStates,nInputs,nInputs,1,_controller.B,_controller.inputs,result2); double_add_matrix(nStates, 1, result1, result2, _controller.states); } return _controller.outputs[0][0]; } int verify_safety_state_space(void){ fxp_t output_fxp = fxp_ss_closed_loop_safety(); double output_double = fxp_to_double(output_fxp); # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" 3 4 ((void) sizeof (( # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" output_double <= error_limit # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" output_double <= error_limit # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" 3 4 ) ; else __assert_fail ( # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" "output_double <= error_limit" # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h", 140, __extension__ __PRETTY_FUNCTION__); })) # 140 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_safety_state_space.h" ; return 0; } # 45 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 1 # 14 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" extern digital_system_state_space _controller; int verify_controllability(void){ int i; int j; fxp_t A_fpx[4][4]; fxp_t B_fpx[4][4]; fxp_t controllabilityMatrix[4][4]; fxp_t backup[4][4]; fxp_t backupSecond[4][4]; double controllabilityMatrix_double[4][4]; for(i=0; i<nStates;i++){ for(j=0; j<(nStates*nInputs);j++){ A_fpx[i][j] = 0.0; B_fpx[i][j] = 0.0; controllabilityMatrix[i][j] = 0.0; backup[i][j] = 0.0; backupSecond[i][j] = 0.0; controllabilityMatrix_double[i][j] = 0.0; } } for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ A_fpx[i][j]= fxp_double_to_fxp(_controller.A[i][j]); } } for(i=0; i<nStates;i++){ for(j=0; j<nInputs;j++){ B_fpx[i][j]= fxp_double_to_fxp(_controller.B[i][j]); } } if(nInputs > 1){ int l = 0; for(j=0; j<(nStates*nInputs);){ fxp_exp_matrix(nStates,nStates,A_fpx,l,backup); l++; fxp_matrix_multiplication(nStates,nStates,nStates,nInputs,backup,B_fpx,backupSecond); for(int k = 0; k < nInputs; k++){ for(i = 0; i<nStates;i++){ controllabilityMatrix[i][j]= backupSecond[i][k]; } j++; } } for(i=0; i<nStates;i++){ for(j=0; j<(nStates*nInputs);j++){ backup[i][j]= 0.0; } } fxp_transpose(controllabilityMatrix,backup,nStates,(nStates*nInputs)); fxp_t mimo_controllabilityMatrix_fxp[4][4]; fxp_matrix_multiplication(nStates,(nStates*nInputs),(nStates*nInputs),nStates,controllabilityMatrix,backup,mimo_controllabilityMatrix_fxp); for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ controllabilityMatrix_double[i][j]= fxp_to_double(mimo_controllabilityMatrix_fxp[i][j]); } } # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ((void) sizeof (( # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(controllabilityMatrix_double,nStates) != 0 # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(controllabilityMatrix_double,nStates) != 0 # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ; else __assert_fail ( # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" "determinant(controllabilityMatrix_double,nStates) != 0" # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h", 91, __extension__ __PRETTY_FUNCTION__); })) # 91 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" ; } else { for(j=0; j<nStates;j++){ fxp_exp_matrix(nStates,nStates,A_fpx,j,backup); fxp_matrix_multiplication(nStates,nStates,nStates,nInputs,backup,B_fpx,backupSecond); for(i = 0; i<nStates;i++){ controllabilityMatrix[i][j]= backupSecond[i][0]; } } for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ controllabilityMatrix_double[i][j]= fxp_to_double(controllabilityMatrix[i][j]); } } # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ((void) sizeof (( # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(controllabilityMatrix_double,nStates) != 0 # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(controllabilityMatrix_double,nStates) != 0 # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ; else __assert_fail ( # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" "determinant(controllabilityMatrix_double,nStates) != 0" # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h", 113, __extension__ __PRETTY_FUNCTION__); })) # 113 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" ; } return 0; } int verify_controllability_double(void){ int i; int j; double controllabilityMatrix[4][4]; double backup[4][4]; double backupSecond[4][4]; double controllabilityMatrix_double[4][4]; if(nInputs > 1){ int l = 0; for(j=0; j<(nStates*nInputs);){ double_exp_matrix(nStates,nStates,_controller.A,l,backup); l++; double_matrix_multiplication(nStates,nStates,nStates,nInputs,backup,_controller.B,backupSecond); for(int k = 0; k < nInputs; k++){ for(i = 0; i<nStates;i++){ controllabilityMatrix[i][j]= backupSecond[i][k]; } j++; } } for(i=0; i<nStates;i++){ for(j=0; j<(nStates*nInputs);j++){ backup[i][j]= 0.0; } } transpose(controllabilityMatrix,backup,nStates,(nStates*nInputs)); double mimo_controllabilityMatrix_double[4][4]; double_matrix_multiplication(nStates,(nStates*nInputs),(nStates*nInputs),nStates,controllabilityMatrix,backup,mimo_controllabilityMatrix_double); # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ((void) sizeof (( # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(mimo_controllabilityMatrix_double,nStates) != 0 # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(mimo_controllabilityMatrix_double,nStates) != 0 # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ; else __assert_fail ( # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" "determinant(mimo_controllabilityMatrix_double,nStates) != 0" # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h", 154, __extension__ __PRETTY_FUNCTION__); })) # 154 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" ; } else { for(j=0; j<nStates;j++){ double_exp_matrix(nStates,nStates,_controller.A,j,backup); double_matrix_multiplication(nStates,nStates,nStates,nInputs,backup,_controller.B,backupSecond); for(i = 0; i<nStates;i++){ controllabilityMatrix[i][j]= backupSecond[i][0]; } } # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ((void) sizeof (( # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(controllabilityMatrix,nStates) != 0 # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" determinant(controllabilityMatrix,nStates) != 0 # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 ) ; else __assert_fail ( # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" "determinant(controllabilityMatrix,nStates) != 0" # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h", 163, __extension__ __PRETTY_FUNCTION__); })) # 163 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_controllability.h" ; } return 0; } # 46 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 1 # 17 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" extern digital_system_state_space _controller; int verify_observability(void){ int i; int j; fxp_t A_fpx[4][4]; fxp_t C_fpx[4][4]; fxp_t observabilityMatrix[4][4]; fxp_t backup[4][4]; fxp_t backupSecond[4][4]; double observabilityMatrix_double[4][4]; for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ observabilityMatrix[i][j]= 0; A_fpx[i][j]=0; C_fpx[i][j]= 0; backup[i][j]= 0; backupSecond[i][j]= 0; } } for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ A_fpx[i][j]= fxp_double_to_fxp(_controller.A[i][j]); } } for(i=0; i<nOutputs;i++){ for(j=0; j<nStates;j++){ C_fpx[i][j]= fxp_double_to_fxp(_controller.C[i][j]); } } if(nOutputs > 1){ int l; j = 0; for(l=0; l<nStates;){ fxp_exp_matrix(nStates,nStates,A_fpx,l,backup); l++; fxp_matrix_multiplication(nOutputs,nStates,nStates,nStates,C_fpx,backup,backupSecond); for(int k = 0; k < nOutputs; k++){ for(i = 0; i<nStates;i++){ observabilityMatrix[j][i]= backupSecond[k][i]; } j++; } } # 80 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" for(i=0; i<nStates;i++){ for(j=0; j<(nStates*nOutputs);j++){ backup[i][j]= 0.0; } } fxp_transpose(observabilityMatrix,backup,(nStates*nOutputs),nStates); # 99 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" fxp_t mimo_observabilityMatrix_fxp[4][4]; fxp_matrix_multiplication(nStates,(nStates*nOutputs),(nStates*nOutputs),nStates,backup,observabilityMatrix,mimo_observabilityMatrix_fxp); # 112 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ observabilityMatrix_double[i][j]= fxp_to_double(mimo_observabilityMatrix_fxp[i][j]); } } # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 ((void) sizeof (( # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" determinant(observabilityMatrix_double,nStates) != 0 # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" determinant(observabilityMatrix_double,nStates) != 0 # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 ) ; else __assert_fail ( # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" "determinant(observabilityMatrix_double,nStates) != 0" # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h", 119, __extension__ __PRETTY_FUNCTION__); })) # 119 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" ; }else{ for(i=0; i<nStates;i++){ fxp_exp_matrix(nStates,nStates,A_fpx,i,backup); fxp_matrix_multiplication(nOutputs,nStates,nStates,nStates,C_fpx,backup,backupSecond); for(j = 0; j<nStates;j++){ observabilityMatrix[i][j]= backupSecond[0][j]; } } for(i=0; i<nStates;i++){ for(j=0; j<nStates;j++){ observabilityMatrix_double[i][j]= fxp_to_double(observabilityMatrix[i][j]); } } # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 ((void) sizeof (( # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" determinant(observabilityMatrix_double,nStates) != 0 # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 ) ? 1 : 0), __extension__ ({ if ( # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" determinant(observabilityMatrix_double,nStates) != 0 # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 ) ; else __assert_fail ( # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" "determinant(observabilityMatrix_double,nStates) != 0" # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" 3 4 , "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h", 134, __extension__ __PRETTY_FUNCTION__); })) # 134 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_observability.h" ; } return 0; } # 47 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 # 1 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_magnitude.h" 1 # 16 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_magnitude.h" extern filter_parameters filter; extern implementation impl; extern digital_system ds; # 28 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/engine/verify_magnitude.h" void resp_mag(double* num, int lnum, double* den, int lden, double* res, int N) { double w; int m, i; double out_numRe[N + 1]; double out_numIm[N + 1]; double out_denRe[N + 1]; double out_denIm[N + 1]; double old_out_Re; double zero_test; for (w = 0, i = 0; w <= 3.14159265358979323846; w += 3.14159265358979323846 / N, ++i) { out_numRe[i] = num[0]; out_numIm[i] = 0; for (m = 1; m < lnum; ++m) { old_out_Re = out_numRe[i]; out_numRe[i] = cosTyl(w, 6) * out_numRe[i] - sinTyl(w, 6) * out_numIm[i] + num[m]; out_numIm[i] = sinTyl(w, 6) * old_out_Re + cosTyl(w, 6) * out_numIm[i]; } out_denRe[i] = den[0]; out_denIm[i] = 0; for (m = 1; m < lden; ++m) { old_out_Re = out_denRe[i]; out_denRe[i] = cosTyl(w, 6) * out_denRe[i] - sinTyl(w, 6) * out_denIm[i] + den[m]; out_denIm[i] = sinTyl(w, 6) * old_out_Re + cosTyl(w, 6) * out_denIm[i]; } res[i] = sqrt3(out_numRe[i] * out_numRe[i] + out_numIm[i] * out_numIm[i]); zero_test = sqrt3(out_denRe[i] * out_denRe[i] + out_denIm[i] * out_denIm[i]); __DSVERIFIER_assume(zero_test != 0); res[i] = res[i] / zero_test; } } int verify_magnitude(void) { int freq_response_samples = 100; double w; double w_incr = 1.0 / freq_response_samples; double res[freq_response_samples+1]; int i,j; fxp_t a_fxp[ds.a_size]; fxp_double_to_fxp_array(ds.a, a_fxp, ds.a_size); double _a[ds.a_size]; fxp_to_double_array(_a, a_fxp, ds.a_size); fxp_t b_fxp[ds.b_size]; fxp_double_to_fxp_array(ds.b, b_fxp, ds.b_size); double _b[ds.b_size]; fxp_to_double_array(_b, b_fxp, ds.b_size); resp_mag(ds.b, ds.b_size, ds.a, ds.a_size, res, freq_response_samples); if (filter.type == 1) { for (i = 0, w = 0; (w <= 1.0); ++i, w += w_incr) { if (w <= filter.wp) { __DSVERIFIER_assert_msg(res[i] >= filter.Ap, "|----------------Passband Failure-------------|"); } else if (w == filter.wc) { __DSVERIFIER_assert_msg(res[i] <= filter.Ac, "|-------------Cutoff Frequency Failure--------|"); } else if ((w >= filter.wr) && (w <= 1)) { __DSVERIFIER_assert_msg(res[i] <= filter.Ar, "|----------------Stopband Failure-------------|"); } } } else if (filter.type == 2) { for (i = 0, w = 0; (w <= 1.0); ++i, w += w_incr) { if (w <= filter.wr) { __DSVERIFIER_assert_msg(res[i] <= filter.Ar, "|----------------Stopband Failure-------------|"); } else if (w == filter.wc) { __DSVERIFIER_assert_msg(res[i] <= filter.Ac, "|-------------Cutoff Frequency Failure--------|"); } else if ((w > filter.wp) && (w <= 1)) { __DSVERIFIER_assert_msg(res[i] >= filter.Ap, "|----------------Passband Failure-------------|"); } } } else { __DSVERIFIER_assert(0); } return 0; } # 48 "/home/yashchopda/Desktop/dsverifier-v2.0.3-esbmc-v4.0-cbmc-5.6/bmc/dsverifier.h" 2 extern digital_system ds; extern digital_system plant; digital_system plant_cbmc; extern digital_system controller; extern implementation impl; extern hardware hw; extern digital_system_state_space _controller; extern filter_parameters filter; unsigned int nondet_uint(); extern void initials(); void validation(); void call_verification_task(void * verification_task); void call_closedloop_verification_task(void * closedloop_verification_task); float nondet_float(); double nondet_double(); int main(){ initialization(); validation(); if (1 == 0) rounding_mode = 0; else if (1 == 1) rounding_mode = 1; else if (1 == 2) rounding_mode = 2; if (3 == 3) { call_verification_task(&verify_overflow); } else if (3 == 2) { call_verification_task(&verify_limit_cycle); } else if (3 == 6) { call_verification_task(&verify_error); } else if (3 == 1) { call_verification_task(&verify_zero_input_limit_cycle); } else if (3 == 4) { call_verification_task(&verify_timing_msp_430); } else if (3 == 5) { call_verification_task(&verify_generic_timing); } else if (3 == 7) { call_verification_task(&verify_stability); } else if (3 == 8) { call_verification_task(&verify_minimum_phase); } else if (3 == 9) { call_closedloop_verification_task(&verify_stability_closedloop_using_dslib); } else if (3 == 10) { call_closedloop_verification_task(&verify_limit_cycle_closed_loop); } else if (3 == 11) { call_closedloop_verification_task(&verify_error_closedloop); } else if (3 == 12) { verify_error_state_space(); } else if (3 == 16) { verify_safety_state_space(); } else if (3 == 13) { verify_controllability(); } else if (3 == 14) { verify_observability(); } else if (3 == 15) { verify_limit_cycle_state_space(); } else if (3 == 18) { call_verification_task(&verify_magnitude); } return 0; } void validation() { if (3 == 12 || 3 == 16 || 3 == 15 || 3 == 13 || 3 == 14) { if (0 == 0) { printf("\n\n********************************************************************************************\n"); printf("* set a K_SIZE to use this property in DSVerifier (use: -DK_SIZE=VALUE) *\n"); printf("********************************************************************************************\n"); __DSVERIFIER_assert(0); exit(1); } initials(); return; } if (((3 != 9) && (3 != 10) && (3 != 11)) && (ds.a_size == 0 || ds.b_size == 0)) { printf("\n\n****************************************************************************\n"); printf("* set (ds and impl) parameters to check with DSVerifier *\n"); printf("****************************************************************************\n"); __DSVERIFIER_assert(0); } if ((3 == 9) || (3 == 10) || (3 == 11)) { if (controller.a_size == 0 || plant.b_size == 0 || impl.int_bits == 0 ) { printf("\n\n*****************************************************************************************************\n"); printf("* set (controller, plant, and impl) parameters to check CLOSED LOOP with DSVerifier *\n"); printf("*****************************************************************************************************\n"); __DSVERIFIER_assert(0); } else { printf("\n\n*****************************************************************************************************\n"); printf("* set (controller and impl) parameters so that they do not overflow *\n"); printf("*****************************************************************************************************\n"); unsigned j; for (j = 0; j < controller.a_size; ++j) { const double value=controller.a[j]; __DSVERIFIER_assert(value <= _dbl_max); __DSVERIFIER_assert(value >= _dbl_min); } for (j = 0; j < controller.b_size; ++j) { const double value=controller.b[j]; __DSVERIFIER_assert(value <= _dbl_max); __DSVERIFIER_assert(value >= _dbl_min); } } if (controller.b_size > 0) { unsigned j, zeros=0; for (j = 0; j < controller.b_size; ++j) { if (controller.b[j]==0) ++zeros; } if (zeros == controller.b_size) { printf("\n\n*****************************************************************************************************\n"); printf("* The controller numerator must not be zero *\n"); printf("*****************************************************************************************************\n"); __DSVERIFIER_assert(0); } } if (controller.a_size > 0) { unsigned j, zeros=0; for (j = 0; j < controller.a_size; ++j) { if (controller.a[j]==0) ++zeros; } if (zeros == controller.a_size) { printf("\n\n*****************************************************************************************************\n"); printf("* The controller denominator must not be zero *\n"); printf("*****************************************************************************************************\n"); __DSVERIFIER_assert(0); } } if (0 == 0) { printf("\n\n***************************************************************************************************************\n"); printf("* set a connection mode to check CLOSED LOOP with DSVerifier (use: --connection-mode TYPE) *\n"); printf("***************************************************************************************************************\n"); __DSVERIFIER_assert(0); } } if (3 == 0) { printf("\n\n***************************************************************************************\n"); printf("* set the property to check with DSVerifier (use: --property NAME) *\n"); printf("***************************************************************************************\n"); __DSVERIFIER_assert(0); } if ((3 == 3) || (3 == 2) || (3 == 1) || (3 == 10) || (3 == 11) || (3 == 4 || 3 == 5) || 3 == 6) { if ((5 == 0) && !(0 == 1)) { printf("\n\n********************************************************************************************\n"); printf("* set a X_SIZE to use this property in DSVerifier (use: --x-size VALUE) *\n"); printf("********************************************************************************************\n"); __DSVERIFIER_assert(0); } else if (0 == 1) { X_SIZE_VALUE = nondet_uint(); __DSVERIFIER_assume( X_SIZE_VALUE > (2 * ds.a_size)); } else if (5 < 0) { printf("\n\n********************************************************************************************\n"); printf("* set a X_SIZE > 0 *\n"); printf("********************************************************************************************\n"); __DSVERIFIER_assert(0); } else { X_SIZE_VALUE = 5; } } if ((3 == 0) && (3 != 9) && (3 != 18)) { printf("\n\n*********************************************************************************************\n"); printf("* set the realization to check with DSVerifier (use: --realization NAME) *\n"); printf("*********************************************************************************************\n"); __DSVERIFIER_assert(0); } if (3 == 6 || 3 == 11) { if (impl.max_error == 0) { printf("\n\n***********************************************************************\n"); printf("* provide the maximum expected error (use: impl.max_error) *\n"); printf("***********************************************************************\n"); __DSVERIFIER_assert(0); } } if (3 == 4 || 3 == 5) { if (3 == 5 || 3 == 4) { if (hw.clock == 0l) { printf("\n\n***************************\n"); printf("* Clock could not be zero *\n"); printf("***************************\n"); __DSVERIFIER_assert(0); } hw.cycle = ((double) 1.0 / hw.clock); if (hw.cycle < 0) { printf("\n\n*********************************************\n"); printf("* The cycle time could not be representable *\n"); printf("*********************************************\n"); __DSVERIFIER_assert(0); } if (ds.sample_time == 0) { printf("\n\n*****************************************************************************\n"); printf("* provide the sample time of the digital system (ds.sample_time) *\n"); printf("*****************************************************************************\n"); __DSVERIFIER_assert(0); } } } if (3 == 18) { if (!((filter.Ap > 0) && (filter.Ac >0) && (filter.Ar >0))) { printf("\n\n*****************************************************************************\n"); printf("* set values bigger than 0 for Ap, Ac and Ar* \n"); printf("*****************************************************************************\n"); __DSVERIFIER_assert(0); } } if ((3 == 7) || (3 == 8) || (3 == 9) || (3 == 10) || (3 == 11) || (3 == 12)) { printf("\n\n******************************************\n"); printf("* Temporarily the cascade modes are disabled *\n"); printf("**********************************************\n"); __DSVERIFIER_assert(0); } } void call_verification_task(void * verification_task) { int i = 0; _Bool base_case_executed = 0; if (0 == 2) { for(i=0; i<ds.b_size; i++) { if (ds.b_uncertainty[i] > 0) { double factor = ds.b_uncertainty[i]; factor = factor < 0 ? factor * (-1) : factor; double min = ds.b[i] - factor; double max = ds.b[i] + factor; if ((factor == 0) && (base_case_executed == 1)) { continue; } else if ((factor == 0) && (base_case_executed == 0)) { base_case_executed = 1; } ds.b[i] = nondet_double(); __DSVERIFIER_assume((ds.b[i] >= min) && (ds.b[i] <= max)); } } for(i=0; i<ds.a_size; i++) { if (ds.a_uncertainty[i] > 0) { double factor = ds.a_uncertainty[i]; factor = factor < 0 ? factor * (-1) : factor; double min = ds.a[i] - factor; double max = ds.a[i] + factor; if ((factor == 0) && (base_case_executed == 1)) { continue; } else if ((factor == 0) && (base_case_executed == 0)) { base_case_executed = 1; } ds.a[i] = nondet_double(); __DSVERIFIER_assume((ds.a[i] >= min) && (ds.a[i] <= max)); } } } else { int i=0; for(i=0; i<ds.b_size; i++) { if (ds.b_uncertainty[i] > 0) { double factor = ((ds.b[i] * ds.b_uncertainty[i]) / 100); factor = factor < 0 ? factor * (-1) : factor; double min = ds.b[i] - factor; double max = ds.b[i] + factor; if ((factor == 0) && (base_case_executed == 1)) { continue; } else if ((factor == 0) && (base_case_executed == 0)) { base_case_executed = 1; } ds.b[i] = nondet_double(); __DSVERIFIER_assume((ds.b[i] >= min) && (ds.b[i] <= max)); } } for(i=0; i<ds.a_size; i++) { if (ds.a_uncertainty[i] > 0) { double factor = ((ds.a[i] * ds.a_uncertainty[i]) / 100); factor = factor < 0 ? factor * (-1) : factor; double min = ds.a[i] - factor; double max = ds.a[i] + factor; if ((factor == 0) && (base_case_executed == 1)) { continue; } else if ((factor == 0) && (base_case_executed == 0)) { base_case_executed = 1; } ds.a[i] = nondet_double(); __DSVERIFIER_assume((ds.a[i] >= min) && (ds.a[i] <= max)); } } } ((void(*)())verification_task)(); } void call_closedloop_verification_task(void * closedloop_verification_task) { _Bool base_case_executed = 0; int i=0; for(i=0; i<plant.b_size; i++) { if (plant.b_uncertainty[i] > 0) { double factor = ((plant.b[i] * plant.b_uncertainty[i]) / 100); factor = factor < 0 ? factor * (-1) : factor; double min = plant.b[i] - factor; double max = plant.b[i] + factor; if ((factor == 0) && (base_case_executed == 1)) { continue; } else if ((factor == 0) && (base_case_executed == 0)) { base_case_executed = 1; } plant.b[i] = nondet_double(); __DSVERIFIER_assume((plant.b[i] >= min) && (plant.b[i] <= max)); }else{ } } for(i=0; i<plant.a_size; i++) { if (plant.a_uncertainty[i] > 0) { double factor = ((plant.a[i] * plant.a_uncertainty[i]) / 100); factor = factor < 0 ? factor * (-1) : factor; double min = plant.a[i] - factor; double max = plant.a[i] + factor; if ((factor == 0) && (base_case_executed == 1)) { continue; } else if ((factor == 0) && (base_case_executed == 0)) { base_case_executed = 1; } plant.a[i] = nondet_double(); __DSVERIFIER_assume((plant.a[i] >= min) && (plant.a[i] <= max)); } else { } } ((void(*)())closedloop_verification_task)(); } # 2 "benchmarks/ds-06-impl1.c" 2 digital_system ds = { .b = { 0.93, -0.87 }, .b_size = 2, .a = { 1.0, 1.0 }, .a_size = 2, .sample_time = 0.02 }; implementation impl = { .int_bits = 4, .frac_bits = 12, .max = 1.0, .min = -1.0 };
the_stack_data/974474.c
#include <stdio.h> #define N 20 int Q[N],Pr[N]; int r = -1,f = -1; void enqueue(int data,int p) { int i; if((f==0)&&(r==N-1)) printf("Queue is full\n"); else { if(f==-1) { f = r = 0; Q[r] = data; Pr[r] = p; } else if(r == N-1) { for(i=f;i<=r;i++) { Q[i-f] = Q[i]; Pr[i-f] = Pr[i]; r = r-f; f = 0; for(i = r;i>f;i--) { if(p>Pr[i]) { Q[i+1] = Q[i]; Pr[i+1] = Pr[i]; } else break; Q[i+1] = data; Pr[i+1] = p; r++; } } } else { for(i = r;i>=f;i--) { if(p>Pr[i]) { Q[i+1] = Q[i]; Pr[i+1] = Pr[i]; } else break; } Q[i+1] = data; Pr[i+1] = p; r++; } } } void print() { int i; for(i=f;i<=r;i++) { printf("\nElement = %d\tPriority = %d",Q[i],Pr[i]); } } int dequeue() { if(f == -1) { printf("Queue is Empty\n"); } else { printf("deleted Element = %d\t Its Priority = %d",Q[f],Pr[f]); if(f==r) f = r = -1; else f++; } } int main() { int opt,n,i,data,p; printf("Enter Your Choice:-\n"); do{ printf("\n\n1 for Insert the Data in Queue\n2 for show the Data in Queue \n3 for Delete the data from the Queue\n0 for Exit\n"); scanf("%d",&opt); switch(opt){ case 1: printf("\nEnter the number of data\n"); scanf("%d",&n); printf("\nEnter your data and Priority of data\n"); i=0; while(i<n){ scanf("%d %d",&data,&p); enqueue(data,p); i++; } break; case 2: print(); break; case 3: dequeue(); break; case 0: break; default: printf("\nIncorrect Choice"); } }while(opt!=0); return 0; }
the_stack_data/82979.c
/* ************************************************************************** */ /* */ /* :::::::: */ /* ft_strclr.c :+: :+: */ /* +:+ */ /* By: jandre-d <[email protected]> +#+ */ /* +#+ */ /* Created: 2019/01/10 11:16:09 by jandre-d #+# #+# */ /* Updated: 2019/02/04 12:15:49 by jandre-d ######## odam.nl */ /* */ /* ************************************************************************** */ void ft_strclr(char *as) { while (*as) { *(as) = '\0'; as++; } }
the_stack_data/232955364.c
/* * @explain: Copyright (c) 2020 WEI.ZHOU. All rights reserved. * The following code is only used for learning and communication, not for * illegal and commercial use. If the code is used, no consent is required, but * the author has nothing to do with any problems and consequences. * * In case of code problems, feedback can be made through the following email * address. <[email protected]> * * @Description:字符串连接 * @Author: WEI.ZHOU * @Date: 2020-11-14 08:56:42 * @Version: V1.0 * @Others: 自定义方法 */ #include <stdio.h> #include <string.h> #define N 80 /** * @brief 合并字符串 * @Date 2020-11-14 14:56:35 * @param char T[] 被添加的字符串 * @param char V[] 复制的字符串 */ void appenString(char T[], char V[]); int main() { char str1[N] = "This Is a ", str2[N] = "c Program"; printf("String1 is: %s\n", str1); printf("String2 is: %s\n", str2); appenString(str1,str2); printf("Result is: %s\n", str1); return 1; } void appenString(char T[], char V[]){ int Tlen = strlen(T), Vlen = strlen(V); for(int i = 0; i < Vlen; i++,Tlen++){ T[Tlen] = V[i]; } }
the_stack_data/403819.c
#include <stdio.h> int main(void) { int age; // int 16 bit -32,768 to 32,767 - 2 bytes 1 sign bit, 15 data bits int weight; int height; int age1, weight1, height1; // multiple variables of the same type // assigning values at declaration int age2 = 41; int weight2 = 165; int height2 = 73; // initialize multiple variables during declaration int age3 = 44, weight3, height3 = 72; // understanding variables of type char char letter = 65; // char 8 bit -128 to 127 char letter1 = 'A'; // understanding variables of type float float radius = 34.56; // float 32 bit 3.4E-38 to 3.4E+38 - 4 bytes 1 sign bit, 8 bit exponent, 23 bit mantissa float radius1 = 3.456E1; // understanding variables of type double double doubleVal = 3.15; // double 64 bit 1.7E-308 to 1.7E+308 - 8 bytes, 1 sign bit, 11 bit exponent, 52 bit mantissa // understanding type modifiers unsigned int inventory_count; // 0 to 65,535 register int counter; // prefers to keep value in register long int very_large_number; // long 32 bit -2,147,483,648 to 2,147,483,647 - 4 bytes, 1 sign bit, 31 data bits unsigned long int national_debt; // long 32 bit 0 to 4,292,967,265 unsigned char menu_border; // extended ASCII character long int one_million = 1000000L; // long has trailing L short int force_16_bit_int; // short 16 bit -32,768 to 32,767 - 2 bytes 1 sign bit, 15 data bits // int can be omitted unsigned status_flags; short small_value; long very_big_number; signed char byte_value; // signed - force first bit to be sign bit // multiple assignment operators age = 0; height = 0; weight = 0; age = height = weight = 0; // C assigns values right to left }
the_stack_data/90762194.c
#include <stdio.h> #include <stdlib.h> #include <string.h> /* returns first location s wheres any character of t occurs */ int any(char *s, char *t) { int i, j; for(i = 0; s[i] != '\0'; i++){ for(j = 0; t[j] != '\0'; j++){ if(s[i] == t[j++]) { return i; } } } return -1; } void main() { int match; char *s = malloc(strlen("daniel")+1); char *t = malloc(strlen("lgdhtposxl")+1); strcpy(s, "daniel"); strcpy(t, "lgdhtposxl"); match = any(s, t); printf("s=%s \tt=%s\n", s, t); printf("match=%d \n", match); free(s); free(t); }