text
stringlengths 188
632k
|
|---|
As the UPA-Left stand-off over the Indo-U.S. Nuclear Deal continues, a mid-term poll for the Lok Sabha seems imminent. But it is necessary to pause a moment and wonder whether our system is inherently unstable. The ruling coalition at the Centre is not the first of its kind. Atal Behari Vajpayee Government almost completed its full term, despite many rebellious allies within the coalition. But those allies were too small to have threatened the survival of the Government, if they walked out of the coalition. The present arrangement, on the contrary, suggests that if the Left walks out, the Government would clearly be in a minority.
But are minority Governments illegal? There is nothing in the Constitution which suggests that. The Council of Ministers, under Article 75(3) shall be collectively responsible to the House of the People. Some pundits have interpreted this responsibility to mean ‘enjoying the confidence of the House of the People’. In reality, this understanding has further narrowed to enjoying the confidence of the majority of the members of the House.
But such an understanding has no basis in reality. In 1991, India first had a minority Government led by P.V.Narasimha Rao sworn in without any hitch. The Opposition Bharatiya Janata Party then magnanimously said it would not move a no-confidence motion against the Government. The then President also did not insist on the Prime Minister seeking a confidence vote in the newly constituted Lok Sabha. The first serious no-confidence motion against the Rao Government was moved by the Opposition in 1993, two years after it was sworn-in.
The aberration with regard to asking the Prime Minister or a Chief Minister with not-so-clear majority in Lok Sabha and assembly to seek a confidence vote began, if I am right, in 1996, when Shankar Dayal Sharma asked Vajpayee to secure a confidence vote, after being sworn in. He quit after 13 days once it was clear the numbers were against him. Subsequently, Sharma’s successors followed this precedent, more or less. While Sharma simply sworn-in the leader of the single largest party as the Prime Minister, his successors were careful to first satisfy whether the Prime Minister-claimant would have enough numerical support in the Lok Sabha to secure a vote of confidence. Hence, letters of support from leaders of political parties forming the post-poll coalition claiming majority support were insisted upon by the Presidents. In the States, this precedent led to quite undesirable tendencies – parading of MLAs in Raj Bhavan and even Rashtrapati Bhavan.
In my view, the 1996 precedent set by Sharma was bad. Its flaw was in its assumption that a minority Government is per se illegal and unconstitutional. Had it been so, Narasimha Rao could not have been sworn-in as the Prime Minister. The issue is not whether a Prime Minister lacks the majority by a few seats (as in the case of Narasimha Rao) or suffers from a huge numerical disadvantage (as Manmohan would face, if Left withdraws support). Those who argue in favour of seeking a confidence vote, once the majority is disturbed, cite the 1979 precedent when Sanjeeva Reddy asked Charan Singh who toppled Morarji Desai to seek a confidence vote. Charan Singh, however, quit without facing the Lok Sabha, and continued as a caretaker Prime Minister till the conclusion of elections in 1980. But a bad precedent cannot become a binding rule.
Coming to the present situation, should Manmohan Singh quit if the Left officially withdraws support and informs the President of its decision? Manmohan Singh can do so on moral grounds, but legally and practically, his Government could survive in office even as a minority Government as Narasimha Rao did between from 1991 to 1993, when he managed a majority in Lok Sabha through political realignments.
What if the President asks Manmohan Singh to seek a vote of confidence, once the Left withdraws support? The Government could point out to the President that the precedent set earlier was incorrect, and the right course would be for the parties to move a no-confidence motion in the Lok Sabha. No-confidence motions are supported by conventions, and Lok Sabha rules, and once the Government loses a motion, it is inevitable that it resigns. No-confidence motion would require the Opposition to come under one platform and be united in dislodging the Government. If the Opposition parties do not see eye to eye, (like the Left and the BJP), then the chances are that one may not choose to support a motion, initiated by another, not even by abstension. This may lead to disagreements within the Opposition on the merits of the motion itself, or how it should be worded etc.
Therefore, there is no harm if the President satisfies herself, soon after the conclusion of elections, that a group of parties would be able to command a majority in the Lok Sabha, so that the leader of that group could be invited to form the Government. Here also, if a minority leader stakes a claim, and if there are no serious challenges to that claim by that leader’s opponents, then the President could invite that minority leader to form the Government, and not insist on seeking a confidence vote. The issue of confidence must be left to the House to decide, if necessary, through a no-confidence motion.
The practice of Prime Minister/Chief Minister seeking a confidence vote is an aberration, and must stop to lend stability to the system. This is because members of a coalition may agree to disagree on certain issues, even while letting the Government to continue in office, because of the absence of scope for forming an alternative Government, or because a fresh election could not be held so soon after the earlier one, or because there is a likelihood of a fresh election again resulting in a similar combination of parties as in the present ruling coalition.
CORRECTION: Thanks to Mr.Srinivasan for correcting a major factual error in my post. The link which he has provided in the comments section (the Lok Sabha debates in 1991), reveals that there was a confidence motion moved by Narasimha Rao and the BJP opposed it, although Narasimha Rao was under no compulsion to move it. |
The Dipterous family Mycetophilidae is composed of small to medium sized flies, ranging from two to nine millimeters in length. These fungus-gnats are numerous both in species and in number of individuals to be found in a local habitat. Characteristics of the legs that are particularly noticeable are as follows: elongated coxae, thickened femur and, spured and setose tibia. The adult resembles a mosquito in that it has a small head, antennae with twelve to seventeen joints and a highly arched thorax. Predominating colors are yellow and black; the abdominal segments often have alternate bands of black and yellow. The males have a complex hypopygia, which is important in the identification of the species.
Proceedings of the Iowa Academy of Science
©1939 Iowa Academy of Science, Inc.
Jaques, H. E. and Berger, B. G.
"A Preliminary List of the Mycetophilidae (Diptera) Known to Occur in Iowa,"
Proceedings of the Iowa Academy of Science, 46(1), 419-421.
Available at: https://scholarworks.uni.edu/pias/vol46/iss1/125 |
Sunday, November 30, 2008
The findings, which come from a series of published papers by a researcher at Sweden's Karolinska Institutet, show how a diet rich in fat, sugar and cholesterol could increase the risk of the most common type of dementia.
"On examining the brains of these mice, we found a chemical change not unlike that found in the Alzheimer brain," Susanne Akterin, a researcher at the Karolinska Institutet's Alzheimer's Disease Research Center, who led the study, said in a statement.
"We now suspect that a high intake of fat and cholesterol in combination with genetic factors ... can adversely affect several brain substances, which can be a contributory factor in the development of Alzheimer's."
Alzheimer's disease is incurable and is the most common form of dementia among older people. It affects the regions of the brain involving thought, memory and language.
While the most advanced drugs have focused on removing clumps of beta amyloid protein that forms plaques in the brain, researchers are also now looking at therapies to address the toxic tangles caused by an abnormal build-up of the protein tau.
In her research, Akterin focused on a gene variant called apoE4, found in 15 to 20 percent of people and which is a known risk factor for Alzheimer's. The gene is involved in the transport of cholesterol.
She studied mice genetically engineered to mimic the effect of the variant gene in humans, and which were fed a diet rich in fat, sugar and cholesterol for nine months -- meals representing the nutritional content of fast food.
These mice showed chemical changes in their brains, indicating an abnormal build-up of the protein tau as well as signs that cholesterol in food reduced levels of another protein called Arc involved in memory storage, Akterin said.
"All in all, the results give some indication of how Alzheimer's can be prevented, but more research in this field needs to be done before proper advice can be passed on to the general public," she said.
Kentucky’s Homeland Security office must publicize God’s benevolent protection of the state in its reports under the 2006 law that organized the department.
Under the law, Homeland Security’s religious duties come before anything else the department does, including distribution of millions of dollars in federal grants and analyzing possible threats.
The law lists the office’s initial duty as “stressing the dependence on Almighty God as being vital to the security of the Commonwealth.”
State Rep. Tom Riner of Louisville, who pushed for the religious requirement, told The Lexington Herald-Leader it was appropriate because government alone cannot protect the state.
State Sen. Kathy Stein of Lexington said the religious requirement takes away from the department’s mission.
The individuals developed agranulocytosis, a condition that makes the immune system incapable of fighting off infections.
It makes common infections become serious, even fatal, quite quickly.
"We are advising anyone who develops a fever or other signs of infection and has used cocaine to seek medical attention quickly," Dr. Gerry Predy, Alberta's Acting Chief Medical Officer of Health, said in a news release.
"Any skin abscess or lung infection that develops rapidly should also be treated immediately."
Officials have linked the cases to cocaine laced with levamisole, a chemical compound developed to treat intestinal worms in humans and animals.
The cases were reported in Edmonton, Red Deer, and in undisclosed locations in southern and northern Alberta.
Doctors in Alberta have been advised they should test and treat patients for this condition if they complain of a fever or other signs of infection after using cocaine.
Friday, November 28, 2008
Sunday, November 23, 2008
Scientists from Ohio State University report that marijuana, contrary to the conventional wisdom, may help ward off Alzheimer's and keep recall sharp. Their findings, released today at the Society for Neuroscience meeting in Washington D.C.: chemical components of marijuana reduce inflammation and stimulate the production of new brain cells, thereby enhancing memory.
The team suggested that a drug could be formulated that would resemble tetrahydroannibol, or THC, the psychoactive ingredient in pot sans making the user high. But the research may ultimately drive those who fear impending dementia to roll their own solution to the problem.
Study co-author Gary Wenk, a professor of psychology, had already devised a preliminary version of a THC-like synthetic drug that improves memory in lab animals. His team at the meeting said that it works by activating at least three receptors in the brain targeted by THC—proteins on the surface of nerve cells that then trigger cellular processes resulting in reduced inflammation and production of new brain cells that can boost recall. Understanding how the compounds work may pave the way for a pharmaceutical company to prepare its own med for human clinical trials.
The researchers ducked the obvious question of whether it might be simpler, faster and cheaper to simply light up a joint. “Could people smoke marijuana to prevent Alzheimer’s disease if the disease is in their family?" Wenk said in a statement. "We’re not saying that, but it might actually work.”
Wednesday, November 19, 2008
Ted Stevens, an Alaskan Senator , has been convicted of 7 Felony counts. He will lose no rights. As a matter of fact, the Government will pay him 150 thousand dollars a year for his pension.
The best part, the longer he is alive, the more the pension will grow.
So if you are rich and a politician, you can be convicted of multiple felonies and still collect from tax payers? If you are a regular person like me and get caught with 2 oz of pot, they lock you up and take your rights.....
This disgusts me beyond belief. How is this even possible in a free country where all of us are to be treated equal? How is this equal at all? It is clearly one rule for one kind and another rule for others! How is this "justice"? This teaches if you truly want to be a criminal and get away with it, to become a politician or civil servant that has money & power.
The ethnics reform that has been passed recently has many loop holes and does not bring any true reform. It is mind blowing to me how the rich & powerful are treated different than those without money & power.
Then we wonder why this nation is failing?
Sunday, November 16, 2008
Away from the spotlight, many local newspapers around the country have covered recent incidents of racially motivated reactions to last week's election, from flags hung upside-down to the dangling of nooses and cross burnings. As we noted last week, a couple in northern New Jersey who had an Obama sign on their front lawn woke up to find the charred remains of a cross. Local residents today announced a "unity march" to protest the still-unsolved incident.
In Midland, Mich., a man dressed in full Ku Klux Klan regalia walked around toting a handgun and waving an American flag. Initially denying it, the man eventually admitted to police that the display was a reaction to the Obama victory. “[The man] had a concealed weapon permit and was walking up and down the sidewalk in front of a vehicle dealership while some motorists shouted obscenities at him and others shouted accolades," police told The Saginaw News.
Parents in Rexburg, Idaho, contacted school officials this week after they learned that 2nd and 3rd graders on a school bus were chanting, "Assasssinate Obama!"
The Associated Press revealed on Wednesday, "Police on eastern Long Island are investigating reports that more than a dozen cars were spray painted with racist graffiti, reportedly including a message targeting President-elect Barack Obama. The graffiti included racist slurs and sexually graphic references. At least one resident in the quiet Mastic neighborhood told Newsday her son's car was scribbled with a message threatening to kill Obama."
From the Staten Island Advance this week: "The NYPD yesterday confirmed they are treating the Election night beating of a black Stapleton teen by a group of whites as a hate crime. Ali Kamara, 17, a black Muslim and immigrant from Liberia, said he was beaten with a baseball bat Tuesday night by four white men who shouted 'Obama,' before beginning the attack."
From The Republican in Springfield, Mass.: "Community leaders including area clergy gathered Wednesday to show support and offer help to congregation members whose new church on Tinkham Road was destroyed last week by arson....The predominantly black congregation's new church was under construction in the Sixteen Acres neighborhood when it was consumed in an early morning blaze on Nov. 5, a few hours after the election of Barack Obama as the nation's first black president. The timing prompted the church pastor, Bishop Bryant Robinson Jr., to question whether the fire was set and a hate crime."
Employees at Hampel's Key and Lockshop in Traverse City, Michigan, flew an American flag upside down last Wednesday protesting of the new president-elect, the Traverse City Record-Eagle reported. One worker used a racial slur during an interview with the Record-Eagle: "(The inverted flag is) an international signal for distress and we feel our country is in distress because the n----- got in," said Hampel’s employee Rod Nyland, who later apologized for the comment, according to the Record-Eagle.
One North Carolina man who flew his flag upside-down claimed that voters were racist, electing Obama because of his skin color, according to the Winston-Salem Journal. “The flag is stretched upside-down between two poles in a field, with a black X running from end to end. The X is a reference to the Confederate flag, said flag-owner Tony Heath. It reflects his belief that the Confederate flag has been unfairly targeted for protest by people trying to be politically correct,” the Journal reported.
In Pennsylvania, an interracial couple in Apolacon Township discovered the remains of a burned cross in their front yard. “The couple discovered the remnants of the cross about 8:15 a.m. Wednesday (Nov. 5) when a man knocked at their door. Johnson looked out the front window and noticed charring on the utility pole, then discovered two charred 1-by-3-inch planks, each about 4 feet in length, beneath it,” according to the Star-Gazette. The woman, who is Jewish, lives with her husband, who is black. "The Little Meadows area was the site of KKK rallies several decades ago, and a local woman who worked on Obama's campaign said Wednesday she heard tales of racist remarks directed at supporters," the story concludes.
Just today, two men were arrested there: 19-year-old Forrest Ashcraft and 22-yearold Stephen Barret of Friendsville. They're charged with ethnic intimidation and trespassing.
Authorities in Temecula, Calif., found spray-painted graffiti on a city sidewalk containing a swastika and anti-Obama slogan.
From today's Los Angeles Times: "Vandals spray-painted swastikas and racial slurs on a house and several cars in Torrance that displayed campaign signs or bumper stickers for President-elect Barack Obama, authorities said Tuesday. The incidents occurred Saturday night in the Hollywood Riviera section of the city, said Sgt. Bernard Anderson. Four separate incidents were reported the next day, he said. No arrests have been made.
"At one house, the phrase 'Go Back to Africa' was spray-painted across the wall, in addition to a racial epithet on the garage door, Anderson said. Several parked vehicles on the streets were spray-painted with racial slurs, he said."
Today, the NAACP called on North Carolina State University to expel four students who spray painted racist messages about Obama. Two of the messages said: "Let's shoot that (N-word) in the head" and "Hang Obama by a noose."
Students at Baylor University woke up on Election Day to a rope tied like a noose hanging from a tree outside of Morrison Hall, according to college newspaper The Lariat: “Later, verbal altercations occurred outside of Penland Residence Hall. A group of Obama supporters were walking around shouting 'Obama' and then passed a group of white men outside who made threatening and racist remarks, said Emmanuel Orupabo, Arlington senior,” according to the Lariat.
Another post-election noose incident happened in Maine. “More than 75 people rallied Sunday against an incident last week in which black figures were hanged by nooses from trees on Mount Desert Island the day after Barack Obama won the presidential election,” according to the Bangor Daily News. At a high school in Gray, a student was suspended after standing up in class, making a racist comment, and saying Obama should not be president, the News reported. Later that day, graffiti making a similar statement was found in a boys’ restroom.
In Allison Park, Pa., a student claimed that a teacher's aide went on a rant attacking the Obama victory on two occasions, one time in front of another teacher. According to the eleventh-grader's mother, the aide told the biracial student that Obama was going to be shot and killed, the U.S. flag would be changed to the KFC flag, and the national anthem would be changed to "Movin' On Up," the Pittsburgh Post-Gazette reported. The teacher's aide has been suspended while the school investigates.
At the University of Alabama, The Tuscaloosa News reported, "a political candidate's poster" on a faculty member's office door was defaced Monday evening. A university spokeswoman interviewed by the News withheld which candidate was on the poster and what was written on it, but WVUA-TV -- a Tuscaloosa station owned by the university -- reported today that the poster featured a picture of President-elect Barack Obama. The TV station also reported that message said "He'll be shot..." followed by the "N" word. The university provost and vice president of student affairs wrote to students, faculty, and staff, calling the incident "totally unacceptable," according to the News.
"If all mankind were to disappear, the world would regenerate back to the rich state of equilibrium that existed ten thousand years ago. If insects were to vanish, the environment would collapse into chaos."
Edward O. Wilson, The world's leading authority on Biodiversity, Emeritus Professor of Biology at Harvard and author of "The Creation: An Appeal to Save Life on Earth."
There is little doubt left in the minds of professional biologists that Earth is currently faced with a mounting loss of species that threatens to rival the five great mass extinctions of the geological past, the most devasting being the Third major Extinction (c. 245 mya), the Permian, where 54% of the planet's species families lost. As long ago as 1993, Harvard biologist E.O. Wilson estimated that Earth is currently losing something on the order of 30,000 species per year -- which breaks down to the even more daunting statistic of some three species per hour. Some biologists have begun to feel that this biodiversity crisis -- this "Sixth Extinction" -- is even more severe, and more imminent, than Wilson had supposed.
With the human population expected to reach 9-10 billion by the end of the century and the planet in the middle of its sixth mass extinction — this time due to human activity — the next few years are critical in conserving Earth’s precious biodiversity. The cause of the Sixth Extinction, Homo sapiens, means we can continue on the path to our own extinction, or, preferably, we modify our behavior toward the global ecosystem of which we are still very much a part.
At a casual glance, the physically caused extinction events of the past might seem to have little or nothing to tell us about the current Sixth Extinction, which is a human-caused event. For there is little doubt that humans are the direct cause of ecosystem stress and species destruction in the modern world through transformation of the landscape, overexploitation of species, pollution, and the introduction of alien species
The Sixth Extinction can be characterized as the first recorded global extinction event that has a biotic, rather than a physical, cause, due to massive asteroid impact, volcanic eruptions. Yet, looking deeper, human impact on the planet is a similar to the Cretaceous cometary collision. Sixty-five million years ago that extraterrestrial impact -- through its sheer explosive power, followed immediately by its injections of so much debris into the upper reaches of the atmosphere that global temperatures plummeted and, most critically, photosynthesis was severely inhibited -- wreaked havoc on the living systems of Earth, which is precisely what we are doing to the planet right now.
Phase two of the Sixth Extinction began around 10,000 years ago with the invention of agriculture-perhaps first in the Natufian culture of the Middle East. Agriculture appears to have been invented several different times in various different places, and has, in the intervening years, spread around the entire globe.
Agriculture, which began around 10,000 years ago in the Natufian culture of the Middle East, is a major engine driving the Sixth Extinction, represents the single most profound ecological change in the entire 3.5 billion-year history of life. With its invention humans did not have to interact with other species for survival, and so could manipulate other species for their own use nor did humans have to adhere to the ecosystem's carrying capacity, and so could overpopulate
Homo sapiens became the first species to stop living inside local ecosystems. All other species, including our ancestral hominid ancestors, all pre-agricultural humans, and remnant hunter-gatherer societies still extant exist as semi-isolated populations playing specific roles (i.e., have "niches") in local ecosystems. This is not so with post-agricultural revolution humans, who in effect have stepped outside local ecosystems. Indeed, to develop agriculture is essentially to declare war on ecosystems - converting land to produce one or two food crops, with all other native plant species all now classified as unwanted "weeds" -- and all but a few domesticated species of animals now considered as pests.
Yet, upon further reflection, human impact on the planet is a direct analogue of the Cretaceous cometary collision. Sixty-five million years ago that extraterrestrial impact -- through its sheer explosive power, followed immediately by its injections of so much debris into the upper reaches of the atmosphere that global temperatures plummeted and, most critically, photosynthesis was severely inhibited -- wreaked havoc on the living systems of Earth. That is precisely what human beings are doing to the planet right now: humans are causing vast physical changes on the planet.
"The comparison I make between these big extinction events, prehistoric meteorite-caused or natural event-caused extinctions and the present one," says E.O. Wilson, "is parallel to the difference between a heart attack and cancer. We understand that what we are doing is a slow but insidious, and only can be seen when you lay it out over the whole world over a period of decades. The hopeful thing about it is that this cancer can be treated. A lot of damage has been done, and it can be dangerous to us if we really just go on until half the species of organisms are extinct forever. Or we can halt the hemorrhaging.
"In terms of scale, it’s hard to put a figure on it," Wilson adds: "We’re in a pronounced early stage of an extinction event that would probably be, by the end of this century if human activities continue unabated, right up to the Cretaceous level. We’re part way there. Whether you can say its 10 percent there or 25 percent there, a lot of it depends on the organisms you’re talking about. One estimate has it that, particularly when you throw in the mass extinction of the Pacific Island birds, which are the most vulnerable on Earth, something like 20 percent of bird species has been extinguished by human activities."
Biocide is occurring at an alarming rate. Experts say that at least half of the world’s current species will be completely gone by the end of the century. Wild plant-life is also disappearing. Most biologists say that we are in the midst of an anthropogenic mass extinction. Numerous scientific studies confirm that this phenomenon is real and happening right now. Should anyone really care? Will it impact individuals on a personal level? Scientists say, “Yes!”
Critics argue that species disappear and new ones emerge all the time. That’s true, if you’re speaking in terms of millennia. Scientists acknowledge that species disappear at an estimated rate of one species per million per year, with new species replacing the lost ones at around the same rate. Recently humans have accelerated the extinction rate to where several entire species are annihilated every single day. The death toll artificially caused by humans is mind-boggling. Nature will take millions of years to repair what we destroy in just a few decades.
A recent analysis, published in the journal Nature, shows that it takes 10 million years before biological diversity even begins to approach what existed before a die-off. Over 10,000 scientists in the World Conservation Union have compiled data showing that currently 51 per cent of known reptiles, 52 per cent of known insects, and 73 per cent of known flowering plants are in danger along with many mammals, birds and amphibians. It is likely that some species will become extinct before they are even discovered, before any medicinal use or other important features can be assessed. The cliché movie plot where the cure for cancer is about to be annihilated is more real than anyone would like to imagine.
Research done by the American Museum of Natural History found that the vast majority of biologists believe that mass extinction poses a colossal threat to human existence, and is even more serious of an environmental problem than one of its contributors- global warming. The research also found that the average person woefully underestimates the dangers of mass extinction. Powerful industrial lobbies would like people to believe that we can survive while other species are quickly and quietly dying off. Irresponsible governments and businesses would have people believe that we don’t need a healthy planet to survive- even while human cancer rates are tripling every decade.
A lot of us heard about the recent extinction of the Yangtze river dolphin. It was publicized because dolphins are cute and smart, and we like dolphins. We were sort of sad that we humans were single-handedly responsible for destroying the entire millions-of-years-old species in just a few years through rampant pollution. Unfortunately the real death toll is so much higher than we hear on the news. Only a few endangered “celebrity favorites” get any notice at all.
Since animals and plants exist in symbiotic relationships to one another, extinction of one species is likely to cause ”co-extinctions”. Some species directly affect the health of hundreds of other species. There is always some kind of domino effect. This compounding process occurs with frightening speed. That makes rampant extinction similar too disease in the way that it spreads. Sooner or later- if gone unchecked- humans may catch it too.
Amphibians are a prime example at how tinkering with the environment can cause rapid animal death. For over 300 million years frogs, salamanders, newts and toads were hardy enough to precede and outlive the dinosaurs up until the present time. Now, within just two decades many amphibians are disappearing. Scientists are alarmed at how one seemingly robust species of amphibians will suddenly disappear within a few months.
The causes of biocide are a hodge-podge of human environmental “poisons” which often work synergistically, including a vast array of pollutants, pesticides, a thinning ozone layer which increases ultra-violet radiation, human induced climate change, habitat loss from agriculture and urban sprawl, invasions of exotic species introduced by humans, illegal and legal wildlife trade, light pollution, and man-made borders among other many other causes.
Is there a way out? The answer is yes and no. We’ll never regain the lost biodiversity-at least not within a fathomable time period, but there are ways to prevent a worldwide bio collapse, but they all require immediate action. Wilson, and other scientists point out that the world needs international cooperation in order to sustain ecosystems, since nature is unaware of artificially drawn borders. Humans love to fence off space they’ve claimed as their own. Sadly, a border fence often has terrible ecological consequences. One fence between India and Pakistan cuts off bears and leopards from their feeding habitats, which is causing them to starve to death. Starvation leads to attacks on villagers, and more slaughtering of the animals.
Some of the most endangered wildlife species live right in between the borderland area of the US and Mexico. These indigenous animals don’t know that they now live between two countries. They were here long before the people came and nations divided, but they will not survive if we cut them off from their habitat. The Sky Islands is one of many areas smack in the middle of this boundary where some of North America's most threatened wildlife is found. Jaguars, bison, and Wolves have to cross through international terrain in the course of their life's travels in order to survive. Unfortunately, illegal Mexican workers cross here too. People who know nothing of the wildlife’s biological needs want to create a large fence to keep out Mexicans, regardless of the fact that a fence would devastate these already fragile animal populations.
Wilson says the time has come to start calling the "environmentalist view" the "real-world view". We can’t ignore reality simply because it doesn’t conform nicely within convenient boundaries and moneymaking strategies. What good will all of our money and conveniences do for us, if we collectively destroy the necessities of life?
There is hope, but it requires radical changes. Many organizations are lobbying for that change. One group trying to salvage ecosystems is called The Wildlands Project, a conservation group spearheading the drive to reconnect the remaining wildernesses. The immediate goal is to reconnect wild North America in four broad "mega-linkages". Within each mega-linkage, mosaics of public and private lands, which would provide safe migrations for wildlife, would connect core areas. Broad, vegetated overpasses would link wilderness areas normally split by roads. They will need cooperation from local landowners and government agencies.
It is a radical vision to many people, and the Wildlands Project expects that it will take at least 100 years to complete. Even so, projects like this, on a worldwide basis, may be humanity’s best chance of saving what’s left of the planets eco-system, and the human race along with it.
Saturday, November 15, 2008
In an interview with French daily newspaper Le Figaro published on Thursday, Medvedev said Moscow had no choice but to react to U.S. plans to set up a network of missiles and radar systems near its own frontiers.
"But we are ready to abandon this decision to deploy the missiles in Kaliningrad if the new American administration, after analyzing the real usefulness of a system to respond to 'rogue states', decides to abandon its anti-missile system," he said.
"We are ready to negotiate a 'zero option'. We are ready to reflect on a system of global security with the United States, the countries of the European Union and the Russian Federation."
Washington says the missile defense system it plans to set up in Poland and the Czech Republic is needed to protect the United States against missile strikes from what it calls rogue states, notably Iran.
Russia believes the system poses a threat to its security and last week announced plans to deploy Iskander tactical missiles in the Kaliningrad region bordering Poland in response.
Medvedev said he had spoken with Obama by telephone and hoped to meet him in person soon.
"We hope to create frank and honest relations with the new administration and resolve problems that we were not able to resolve with the current administration," he said.
Asked about his response to the global financial crisis, which has hit the Russian banking sector hard, Medvedev said there had been a flight of capital out of Russia and moves to protect key banks and private savings were necessary.
He said the government might take stakes in certain banks, as had been done in the United States and Britain but he said "nationalization is not the solution" and added that any government stakes would be sold as soon as possible.
Friday, November 14, 2008
The Rev. Jay Scott Newman said in a letter distributed Sunday to parishioners at St. Mary's Catholic Church in Greenville that they are putting their souls at risk if they take Holy Communion before doing penance for their vote.
"Our nation has chosen for its chief executive the most radical pro-abortion politician ever to serve in the United States Senate or to run for president," Newman wrote, referring to Obama by his full name, including his middle name of Hussein.
"Voting for a pro-abortion politician when a plausible pro-life alternative exists constitutes material cooperation with intrinsic evil, and those Catholics who do so place themselves outside of the full communion of Christ's Church and under the judgment of divine law. Persons in this condition should not receive Holy Communion until and unless they are reconciled to God in the Sacrament of Penance, lest they eat and drink their own condemnation."
During the 2008 presidential campaign, many bishops spoke out on abortion more boldly than four years earlier, telling Catholic politicians and voters that the issue should be the most important consideration in setting policy and deciding which candidate to back. A few church leaders said parishioners risked their immortal soul by voting for candidates who support abortion rights.
But bishops differ on whether Catholic lawmakers — and voters — should refrain from receiving Communion if they diverge from church teaching on abortion. Each bishop sets policy in his own diocese. In their annual fall meeting, the nation's Catholic bishops vowed Tuesday to forcefully confront the Obama administration over its support for abortion rights.
According to national exit polls, 54 percent of Catholics chose Obama, who is Protestant. In South Carolina, which McCain carried, voters in Greenville County — traditionally seen as among the state's most conservative areas — went 61 percent for the Republican, and 37 percent for Obama.
"It was not an attempt to make a partisan point," Newman said in a telephone interview Thursday. "In fact, in this election, for the sake of argument, if the Republican candidate had been pro-abortion, and the Democratic candidate had been pro-life, everything that I wrote would have been exactly the same."
Conservative Catholics criticized Democratic presidential nominee John Kerry in 2004 for supporting abortion rights, with a few Catholic bishops saying Kerry should refrain from receiving Holy Communion because his views were contrary to church teachings.
Sister Mary Ann Walsh, spokeswoman for the U.S. Conference of Catholic Bishops, said she had not heard of other churches taking this position in reaction to Obama's win. A Boston-based group that supports Catholic Democrats questioned the move, saying it was too extreme.
"Father Newman is off base," said Steve Krueger, national director of Catholic Democrats. "He is acting beyond the authority of a parish priest to say what he did. ... Unfortunately, he is doing so in a manner that will be of great cost to those parishioners who did vote for Sens. Obama and Biden. There will be a spiritual cost to them for his words."
A man who has attended St. Mary's for 18 years said he welcomed Newman's message and anticipated it would inspire further discussion at the church.
"I don't understand anyone who would call themselves a Christian, let alone a Catholic, and could vote for someone who's a pro-abortion candidate," said Ted Kelly, 64, who volunteers his time as lector for the church. "You're talking about the murder of innocent beings."
Although many of the regulations have to do with energy and the environment, MSNBC's Rachel Maddow noted on Tuesday that there's also "one that'll kick opponents of the Patriot Act right in the teeth."
The proposed regulation "would allow state and local law enforcement agencies to collect intelligence on individuals and organizations even if the information is unrelated to any criminal matter," Maddow explained. She added, "Even if they weren't already watching you -- they soon could be."
Maddow was joined by the Nation's sports correspondent, Dave Zirin, who began by complaining about Bush, "Hemorrhoids are more popular than this man. Why is he making laws?"
Zirin described how he had been involved in an episode where "the Maryland State Police sent people to infiltrate meetings I was in -- a very seditious organization called the Campaign to End the Death Penalty, where we planned such horrifying acts like tabling at the local farmer's market or planning rallies."
"Why were they spying on us?" Zirin continued. "Because the governor at the time, Bob Ehrlich -- a right-wing Republican who makes Sarah Palin look like Emma Goldman -- I mean, he's somebody who saw us as political opponents. He was for the death penalty, we were against the death penalty, therefore in his mind we deserved to be spied upon."
"We were entered into a database the heading of which was 'Terrorists/Anti-Government,'" Zirin noted angrily. "The person who organized all of this, the head of the Maryland State Police ... called us 'fringe people' in the hearings. He said we deserved it because we were fringe people.'"
Zirin pointed out that the final report which exposed the state's anti-constitutional behavior recommended future safeguards but held no one accountable. "We either have a Constitution or we don't," he stated. "Either our rights were violated or they weren't."
"They're talking about expanding this nationwide," Maddow commented, "and what they will say in order to argue for it is, 'Oh, what's the harm done?'"
"Here's the harm," Zirin replied. "It has a chilling effect on the Constitution. It has a chilling effect on our ability to assemble. ... We need to be welcoming new people into community activism, welcoming new people into struggle. And what you have instead is people looking at each other in Maryland as if, 'Is that person an enemy? Is this person a plant?'"
"And it has a horrible effect," concluded Zirin, "right at a time where in the wake of the Obama victory we should be talking about solidarity, we should be talking about expanding our forces, we should be talking about fighting for the change that we all waited on line to vote for."
Thursday, November 13, 2008
The researchers believe that the drug could help people open up in therapy and express deep fears and painful memories.
If the study is successful the scientists hope that the drug MDMA will eventually be made available on prescription.
Dr Rick Doblin, president of the Florida-based Multidisciplinary Association for Psychedelic Studies, said the US Food and Drug Administration had already approved the trial.
He said that the feelings of self-acceptance and closeness to others reported by recreational ecstasy users suggested that the drug would work in a counselling environment.
“In a therapy setting it’s not that you take MDMA and feel ecstasy and happy and your problems go away,” Dr Doblin said.
“But it helps you go deeper into the problems and work through them.
“We anticipate that people who have had traumatic experiences but haven’t been able to really move past them, because they are too scary, will be able to really open up.
“They will be able to go through really deep emotions of fear, anger, pain, sadness, and let it go,” he said.
The test subjects would be patients who have already failed to overcome post-traumatic stress disorder with the therapy and drugs currently available.
The volunteers would include victims of violent crime, including rape.
Cancer sufferers in the end stages of terminal illness would be studied to see if the drug aids them in coming to terms with the prospect of death.
A parallel study, to be conducted in Israel, would include victims of terrorism and political violence which have dogged the region for many years, Dr Doblin said.
He went on: “There’s often a lot of shame and self-blame when people are attacked that’s really unnecessary and problematic.
“MDMA has this fundamental ability to help people with self-acceptance.”
The study could begin as early as January as long as the US Drug Enforcement Administration gives clearance for the researchers to handle the illegal drug.
Initially 20 victims will be studied. Each will be given a pill either a placebo or 125mg dose of MDMA before undergoing therapy sessions.
Neither the patients or therapists will know who has been given the drug and who has been given the placebo.
Even if the trial goes ahead without scientific or political disruption it could be at least five years before MDMA is available on prescription, Dr Doblin predicted.
Studies would have to be conducted on a much wider scale before Government agencies could be convinced of the benefits of making the drug legally available, he said.
Wednesday, November 12, 2008
The Texas Freedom Network, a watchdog group that monitors the board, released a public statement on Monday asking Dunbar to retract the statement.
"I don't have anything in there that would be retractable," said Dunbar, R-Richmond. "Those are my personal opinions and I don't think the language is questionable."
In a column posted on the Christian Worldview Network Web site, Dunbar wrote that a terrorist attack on America during the first six months of an Obama administration "will be a planned effort by those with whom Obama truly sympathizes to take down the America that is threat to tyranny."
She also suggests Obama would seek to expand his power by declaring martial law throughout the country.
"No matter who you support for president, we should all be able to agree that Ms. Dunbar's disgusting attack is a shocking example of the extremism that has infected the state board," TFN President Kathy Miller said.
"It's stunning that a board member who helps decide what Texas children learn in their public schools would say something so disgusting and reprehensible. She should be taking refresher courses in civics and good citizenship, not deciding what Texas kids learn."
The State Board of Education will begin revising public school social studies curriculum standards after adopting rules for science next year. Those standards will determine the content in new public school textbooks.
"Right now, we're still in America and we still have freedom of speech," Dunbar said. "And unless that's changed, I'm not aware of it."
On Tuesday, largely under the radar of the pundits and political chattering classes, voters dealt what may be a fatal blow to America's longest-running and least-discussed war -- the war on marijuana.
Michigan voters made their state the 13th to allow the medical use of marijuana by a whopping 63 percent to 37 percent, the largest margin ever for a medical marijuana initiative. And by 65 percent to 35 percent, Massachusetts voters decriminalized the possession of up to an ounce of marijuana, replacing arrests, legal fees, court appearances, the possibility of jail and a lifelong criminal record with a $100 fine, much like a traffic ticket, that can be paid through the mail.
What makes these results so amazing is that they followed the most intensive anti-marijuana campaign by federal officials since the days of "Reefer Madness." Marijuana arrests have been setting all-time records year after year, reaching the point where one American is arrested on marijuana charges every 36 seconds. More Americans are arrested each year for marijuana possession -- not sales or trafficking, just possession -- than for all violent crimes combined.
And the White House Office of National Drug Control Policy, with “drug czar” John Walters at the helm, has led a hysterical anti-marijuana propaganda campaign. During Walters' tenure, ONDCP has released at least 127 separate anti-marijuana TV, radio and print ads, at a cost of hundreds of millions of tax dollars, plus 34 press releases focused mainly on marijuana, while no fewer than 50 reports from ONDCP and other federal agencies focused on the alleged evils of marijuana or touted anti-marijuana campaigns.
Walters himself campaigned personally in Michigan against the medical marijuana initiative, calling it an "abomination" and claiming yet again that there is no evidence that marijuana has medical value -- an assertion flatly contradicted by at least four published clinical trials in just the last two years.
In Massachusetts, the state's political and law enforcement establishment lined up solidly against the marijuana decriminalization initiative, including both Republican and Democratic politicians and all 11 district attorneys -- several of whom actually admitted to having smoked marijuana. They warned of rampant drug abuse and crime should the measure pass, simply ignoring the fact that no such thing has happened in the 11 other states (including California, Ohio and New York) that have had similar laws for years.
Voters were having none of it, giving a thumping rejection to government officials’ lies and hysteria in both states. Americans have taken a hard look at our national war on marijuana and rejected it for the cruel, counterproductive disaster that it is.
The voters are right. Of over 872,000 arrests in one year, 89 percent are for possession only.
What has this gotten us? Not much. Marijuana arrests weren't the only thing that set a record last year. So did the number of Americans who have tried marijuana. Usage rates came down marginally in the last few years but are still higher than in the early 1990s. Marijuana is our nation's number one cash crop.
The one thing our costly and futile efforts to "eradicate" marijuana have accomplished is to create a boom for criminal gangs, to whom we've handed a monopoly on production and distribution. Unlike producers of legal drugs like beer, wine or tobacco, these criminals pay no taxes and obey no rules. Their illicit efforts despoil our national forests and bring violence and destabilization to Mexico.
For years, politicians who know our current marijuana laws make no sense have been afraid to change them for fear of political retribution. The voters' thundering rejection of our misguided war on marijuana shows that those fears are misplaced.
It's time for Congress and the new administration -- not to mention state governments around the country -- to listen to the public. It's time for a new approach.
"We don't know of anything out of the ordinary with them," said Stokes. "They are pleasant people and we have never had problems with them or their children."
The news left Stokes, and the Bogalusa community, speechless that his neighbor Raymond "Chuck" Foster, and seven others--including Foster's son, Shane Foster--were arrested in the murder of a woman during a Ku Klux Klan initiation.
"We have not seen anything in the town that would suggest anything going on that is racial in nature or anything," Stokes said.
The Bogalusa mayor and police chief said that the last allegations of Klan activity were from two years ago. The police, along with the FBI, investigated that incident, but did not find any evidence of Klan activity then, nor have they in decades.
"It is really disappointing to know you could have someone in your community that could do that, it looks like he (Raymond Foster) has only been here a couple of years," said James "Mack" McGehee, the Bogalusa mayor.
But the St. Tammany Parish Sheriff's Office said the Dixie Brotherhood of the KKK was based in Bogalusa. Sheriff Jack Strain said the Oklahoma woman who was murdered was recruited and brought to Sun, La., just outside of Bogalusa, for an initiation ceremony.
"From there part of the ritual was to go on a camping trip off of Lock 3 Road," said Sheriff Strain.
It was during that trip, authorities believe sometime on Sunday, the woman and the group's leader, Raymond "Chuck" Foster, argued--perhaps because the woman wanted to leave the ceremony--and Foster shot and killed her.
Strain said the group then tried to sanitize the area and conceal the crime, burning the woman's belongings at the campsite. Authorities said an employee at a nearby Circle K helped police make arrests when some Klan members stopped in and asked how they could get blood out of their clothes.
"It is a situation that defies logic, when you think you've seen it all something like this happens," said Sheriff Strain. "This was a case where, in the woods, during some sordid ritual event, things went terribly wrong."
Sheriff Strain said the Klan leader, Raymond Foster, has a long criminal history in St. Tammany Parish and in Washington Parish. He is charged with second-degree murder. The seven other suspects are charged with obstruction of justice.
Government Aid to GM, Ford, Chrysler Could Preserve Old Way of Building and Selling Cars
Last Friday, November 7, 2008, GM announced that unless its financial performance improves, there is a substantial risk of the company collapsing by the middle of next year.
Discussions abound about the current “credit freeze”, economic turndown, etc ….. a discussion of current economic trends is misplaced …. a broader historical perspective is needed. A perspective that looks ahead and not just back at GM’s and the rest of the Detroit 3’s historical importance to the Country.
I believe the term is “throwing good money after bad”.
The value of GM did not suddenly decline. In 2007 GM lost 38.7 Billion Dollars. It has been a five year slide for GM stock from $60 a share to today’s $3.00 and change per share.
Also see: http://money.cnn.com/2008/06/24/markets/thebuzz/index.htm?eref=aol
GM’s solution, “reduce costs by offering buyouts to more of its union employees. It’s astonishing how lavish these buyout packages can be, and yet still save the company money–early retirement plus $45,000 is apparently cheaper than keeping them on the line. It’s a sign of something deeply out of whack in the labor market when companies are consistently this desperate to shed workers–how can the UAW swing enough clout to keep the automakers tottering in and out of unprofitability?”
Critics say leaders over the years at Ford Motor Co., General Motors Corp. and what is now Chrysler LLC were slow to take on unions, failed to invest enough in new products, ceded the car market to the Japanese and were ill-prepared for the inevitable rise in gas prices that would make their trucks and SUVs obsolete.
“There’s been 30 years of denial,” said Noel Tichy, a University of Michigan business professor and author who ran General Electric Co.’s leadership program from 1985-87 and once worked as a consultant for Ford. “They did not make themselves competitive. They didn’t deal with the union issues, the cost structures long ago, everything that makes a successful company.”
Whatever the reasons, the Detroit Three are closer to collapse than ever, and likely won’t make it without billions in government loans.
On Friday, GM posted a $2.5 billion third-quarter loss and ominously said it could run out of money before the end of the year. The company spent $6.9 billion more than it took in for the quarter and reported that it had $16.2 billion in cash available at the end of September.
Ford reported a $129 million loss but said it burned up $7.7 billion in cash for the period. It had $18.9 billion on hand as of Sept. 30. Its chief financial officer says he’s confident Ford will make it through 2009, but that’s because the company took out a huge loan last year.
Industry analysts believe Chrysler, now a private company that does not have to open its books, is as bad off as GM as U.S. sales continue to plummet because of tight credit and lack of consumer confidence due to the economy.
The Detroit 3 failed to challange the Union, the companies say the UAW drove up their labor costs to $30 per hour more than Japanese companies paid their workers. When the Detroit 3 have pushed for change the Union has simply called for strikes, strikes which cost the companies 10’s of billions in lost profits. The last strikes came just this past summer, in the midst of the current economic turmoil.
America has two auto industries. The “Old Auto Industry” the one represented by GM, Ford and Chrysler is Midwestern, unionized, burdened with massive obligations to retirees, and shackled to marketing and product strategies that have roots reaching back to the early 1900s.
The other American auto industry, the “New Auto Industry” is largely Southern and non-union, owes relatively little to the few retirees it has, and enjoys a variety of advantages because its Japanese, European and Korean owners launched operations in this country relatively recently. Their factories are newer, their brand images and marketing strategies are more coherent – Toyota uses three brands in the U.S. to GM’s eight — and they have cars designed for the competitive global market that exists today.
Despite the economic turmoil, they are all profitable.
The New Industry has controlled costs, developed superior products and marketing. In fact the “New Industry”can’t produce some vehicles (Toyota Prius) fast enough to meet consumer demand.
The Old American auto industry is represented by the “Big Three” of Detroit. The “Detroit Three” employ approximately 200,000 people.
The New American Auto industry employs approximately 113,000 people, this is according to a recent study by the Center for Automotive Research.
This bailout debate is strictly about the Old American Auto Industry.
At present, the “Detroit 3″ are talking about a preliminary bailout number of an additional $50 Billion dollars. This would bring the total to $75 Billion Dollars for the “Old Auto Industry”.
The original $25 Billion has already been approved but is currently tied up in the Energy Committee of Congress.
A $75 Billion dollar bailout for the “Detroit 3″. $75 Billion Dollars!
$75 Billion for an industry that has 200,000 direct employees?
That comes out to $375,000 per direct employee. I kid you not, $375,000 per direct employee.
You try the math, $75,000,000,000 divided by 200,000. ($750,000 / 2 = $375,000).
You’ve got to be kidding me.
It just isn’t worth the gamble. Over the last 30 years the Detroit 3 has failed to demonstrate it can complete globally. How will throwing more money at their problem help. Throwing money at the Detroit 3 won’t solve their problems and they seem incapable of solving them on their own.
At Ford Motor Co. they called it “Blue,” a team set up around the year 2000 to design an array of small, fuel-efficient cars to compete with the Japanese. It didn’t get far because no one could figure out how to make money on low-priced compacts with Ford’s high labor costs. The same thing happened at GM & Chrysler. The Detroit 3 concentrated on trucks and SUV’s, markets that the New Auto Industry nearly conceeded, because focusing on that market (SUVs & Trucks) was just too short sighted for ongoing business success.
Now the Government is considering buying the Old American Auto Industry. That is essentially what a bailout would mean. The Government buying the Detroit 3.
“We are lowering our target on GM equity to zero dollars,” the Deutsche Bank report said. “Even if GM succeeds in averting a bankruptcy, we believe that the company’s future path is likely to be bankruptcy-like,” it said. “While we believe that GM’s secured creditors may get a par recovery, unsecured creditors may get very low recovery. Equity shareholders are unlikely to get anything.”
Duetsche Bank’s assessment, the bailout isn’t likely to work. Duetsche bank noted, “even if there is a government bailout of the auto giant, shareholders would not benefit.”
The US Government should not be in the business of buying private businesses, especially not businesses that will still be bankrupt after a $75 Billion cash investment at taxpayer expense.
Throwing good money after bad? Absolutely!
In a Capitalist economy, poorly run companies that can’t control costs, successfully plan future product or get desired products to market in a timely manner, fail. Simple enough, bad companies fail. They are not rewarded for inefficency. Successful companies are rewarded.
The current proposal to bailout 1/2 of the US Auto Industry does so at the expense of the other successful half and at tremendous costs to the American taxpayer.
Further bailouts are a bad idea. Its time to let the chips fall where they may.
Tuesday, November 11, 2008
"It may sound a bit crazy and off base, but the thing is, he's the one who proposed this national security force," Rep. Paul Broun said of Obama in an interview Monday with The Associated Press. "I'm just trying to bring attention to the fact that we may—may not, I hope not—but we may have a problem with that type of philosophy of radical socialism or Marxism."
Broun cited a July speech by Obama that has circulated on the Internet in which the then-Democratic presidential candidate called for a civilian force to take some of the national security burden off the military.
"That's exactly what Hitler did in Nazi Germany and it's exactly what the Soviet Union did," Broun said. "When he's proposing to have a national security force that's answering to him, that is as strong as the U.S. military, he's showing me signs of being Marxist."
Obama's comments about a national security force came during a speech in Colorado in which he called for expanding the nation's foreign service.
"We cannot continue to rely only on our military in order to achieve the national security objectives that we've set," Obama said in July. "We've got to have a civilian national security force that's just as powerful, just as strong, just as well-funded."
The Obama transition team declined to comment on Broun's remarks. But spokesman Tommy Vietor said Obama was referring in the speech to a proposal for a civilian reserve corps that could handle postwar reconstruction efforts such as rebuilding infrastructure—an idea endorsed by the Bush administration.
Broun said he believes Obama would move to ban gun ownership if he does build a national security force.
Obama has said he respects the Second Amendment right to bear arms and favors "common sense" gun laws. Gun rights advocates interpret that as meaning he'll at least enact curbs on ownership of assault weapons and concealed weapons. As an Illinois state lawmaker, Obama supported a ban on semiautomatic weapons and tighter restrictions on firearms generally.
"We can't be lulled into complacency," Broun said. "You have to remember that Adolf Hitler was elected in a democratic Germany. I'm not comparing him to Adolf Hitler. What I'm saying is there is the potential of going down that road."
Sunday, November 09, 2008
The Intelligence and Security Committee, the parliamentary watchdog of the intelligence and security agencies which has a cross-party membership from both Houses, wants to press ministers to introduce legislation that would prevent news outlets from reporting stories deemed by the Government to be against the interests of national security.
The committee also wants to censor reporting of police operations that are deemed to have implications for national security. The ISC is to recommend in its next report, out at the end of the year, that a commission be set up to look into its plans, according to senior Whitehall sources.
The ISC holds huge clout within Whitehall. It receives secret briefings from MI5, MI6 and GCHQ and is highly influential in forming government policy. Kim Howells, a respected former Foreign Office minister, was recently appointed its chairman. Under the existing voluntary code of conduct, known as the DA-Notice system, the Government can request that the media does not report a story. However, the committee's members are particularly worried about leaks, which, they believe, could derail investigations and the reporting of which needs to be banned by legislation.
Civil liberties groups say these restrictions would be "very dangerous" and "damaging for public accountability". They also point out that censoring journalists when the leaks come from officials is unjustified.
But the committee, in its last annual report, has already signalled its intention to press for changes. It states: "The current system for handling national security information through DA-Notices and the [intelligence and security] Agencies' relationship with the media more generally, is not working as effectively as it might and this is putting lives at risk." According to senior Whitehall sources the ISC is likely to advocate tighter controls on the DA-Notice system – formerly known as D-Notice – which operates in co-operation and consultation between the Government and the media.
The committee has focused on one particular case to highlight its concern: an Islamist plot to kidnap and murder a British serviceman in 2007, during which reporters were tipped off about the imminent arrest of suspects in Birmingham, a security operation known as "Gamble". The staff in the office of the then home secretary, John Reid, and the local police were among those accused of being responsible – charges they denied. An investigation by Scotland Yard failed to find the source of the leak.
The then director general of MI5, Dame Eliza Manningham-Buller, was among those who complained to the ISC. "We were very angry, but it is not clear who we should be angry with, that most of the story of the arrests in Op Gamble were in the media very, very fast ... So the case was potentially jeopardised by the exposure of what the story was. My officers and the police were jeopardised by them being on operations when the story broke. The strategy of the police for interrogating those arrested was blown out of the water, and my staff felt pretty depressed ... that this has happened."
The ISC report said the DA-Notice system "provides advice and guidance to the media about defence and counter-terrorism information, whilst the system is voluntary, has no legal authority, and the final responsibility for deciding whether or not to publish rests solely with the editor or publisher concerned. The system has been effective in the past. However, the Cabinet Secretary told us ... this is no longer the case: 'I think we have problems now.'"
The human rights lawyer Louise Christian said: "This would be a very dangerous development. We need media scrutiny for public accountability. We can see this from the example, for instance, of the PhD student in Nottingham who was banged up for six days without charge because he downloaded something from the internet for his thesis. The only reason this came to light was because of the media attention to the case."
A spokesman for the human rights group Liberty said: "There is a difficult balance between protecting integrity and keeping the public properly informed. Any extension of the DA-Notice scheme requires a more open parliamentary debate."
In his annual speech at the Lord Mayor's Banquet, Brown -- who has spearheaded calls for the reform of international financial institutions -- will say Britain, the United States and Europe are key to forging a new world order.
"The alliance between Britain and the U.S. -- and more broadly between Europe and the U.S. -- can and must provide leadership, not in order to make the rules ourselves, but to lead the global effort to build a stronger and more just international order," an excerpt from the speech says.
Brown and other leaders meet in Washington next weekend to discuss longer term solutions for dealing with economic issues following a series of coordinated moves on interest rates and to recapitalize banks in the wake of the financial crisis.
"Uniquely in this global age, it is now in our power to come together so that 2008 is remembered not just for the failure of a financial crash that engulfed the world but for the resilience and optimism with which we faced the storm, endured it and prevailed," Brown will say in his speech on Monday evening.
"...And if we learn from our experience of turning unity of purpose into unity of action, we can together seize this moment of change in our world to create a truly global society."
According to a summary of the speech released by his office, Brown will set out five great challenges the world faces.
These are: terrorism and extremism and the need to reassert faith in democracy; the global economy; climate change; conflict and mechanisms for rebuilding states after conflict; and meeting goals on tackling poverty and disease.
Brown will also identify five stages for tackling the economy, starting with recapitalizing banks so they can resume lending to families and businesses, and better international co-ordination of fiscal and monetary policy.
He also wants immediate action to stop the spread of the financial crisis to middle-income countries, with a new facility for the International Monetary Fund, and agreement on a global trade deal, as well as reform of the global financial system.
"My message is that we must be: internationalist not protectionist; interventionist not neutral; progressive not reactive; and forward looking not frozen by events. We can seize the moment and in doing so build a truly global society."
The miniature reactors will be factory-sealed, contain no weapons-grade material, have no moving parts and will be nearly impossible to steal because they will be encased in concrete and buried underground.
The US government has licensed the technology to Hyperion, a New Mexico-based company which said last week that it has taken its first firm orders and plans to start mass production within five years. 'Our goal is to generate electricity for 10 cents a watt anywhere in the world,' said John Deal, chief executive of Hyperion. 'They will cost approximately $25m [£13m] each. For a community with 10,000 households, that is a very affordable $250 per home.'
Deal claims to have more than 100 firm orders, largely from the oil and electricity industries, but says the company is also targeting developing countries and isolated communities. 'It's leapfrog technology,' he said.
The company plans to set up three factories to produce 4,000 plants between 2013 and 2023. 'We already have a pipeline for 100 reactors, and we are taking our time to tool up to mass-produce this reactor.'
The first confirmed order came from TES, a Czech infrastructure company specialising in water plants and power plants. 'They ordered six units and optioned a further 12. We are very sure of their capability to purchase,' said Deal. The first one, he said, would be installed in Romania. 'We now have a six-year waiting list. We are in talks with developers in the Cayman Islands, Panama and the Bahamas.'
The reactors, only a few metres in diameter, will be delivered on the back of a lorry to be buried underground. They must be refuelled every 7 to 10 years. Because the reactor is based on a 50-year-old design that has proved safe for students to use, few countries are expected to object to plants on their territory. An application to build the plants will be submitted to the Nuclear Regulatory Commission next year.
'You could never have a Chernobyl-type event - there are no moving parts,' said Deal. 'You would need nation-state resources in order to enrich our uranium. Temperature-wise it's too hot to handle. It would be like stealing a barbecue with your bare hands.'
Other companies are known to be designing micro-reactors. Toshiba has been testing 200KW reactors measuring roughly six metres by two metres. Designed to fuel smaller numbers of homes for longer, they could power a single building for up to 40 years.
Saturday, November 08, 2008
The site — a down payment on Obama's pledge to create a more "transparent and connected government" — still has lots of white spaces and promises of future features.
But it gives viewers lots more details about the government's workings and more opportunities for input than the Bush administration's site, dominated by first dog Barney.
"It's a site in its infancy, but it's a nice start," said Alan Rosenblatt, an online advocacy specialist at the Center for American Progress Action Fund in Washington.
A video of Obama's victory speech is the home page's dominant feature. Inside are a promised new blog and lots of Obama issue positions.
"He plainly wants to reach out to people directly, and this technology allows him to bypass the press and reach them," said Darrell West, director of Governance Studies at the Brookings Institution, a center-left Washington think tank.
This is the newest claim coming from the ones who claim that all Americans will end up in FEMA concentration camps where we will be gassed and put to death.
With the election of Obama, the whole conspiracy theory about the Bush family turning America into a police state for their own NWO agenda, now has many holes in it. The democracy of America worked. Something the theorists were not counting on. So they have now made this wild claim, that a man shaped by the ideals of the 60's, is going to go against everything he believes in for the agenda of the white man of world domination.
What a bunch of fuckin' morons.....
I do admit, the Bush administration had me wondering if they had an agenda, but I knew it was only about profit. That is all it ever is about in this country...
I find it amazing these CTer's just can't realize that maybe they are nothing more than paranoid freaks who need a hobby or maybe medication.
I have said it before, Alex Jones is a snake oil salesman and if you follow him or others like him, they may end up getting you in trouble over nothing.
I just wanted to share this info I stumbled upon. I thought it was pretty funny how now that Bush is on the way out, that the CTer's story had to so vastly change that now it don't even make any sense.
Our Government ain't perfect and it fucks up a lot! Big business is allowed to guide our law makers into making laws that benefit them. Yes, we do have major issues we must address. But this country has one thing no other does....freedom.
It is why these people are allowed to spread such bs. They have freedom of speech. It is ironic that the same rights they claim we do not have, they abuse to spread their own agenda. Which for me, I cannot figure out. The only conclusion I can come up with is........profit of course! Alex Jones don't give his DVD's of "truth" away. He sells them babies. He is also paid by a broadcasting company to do his radio show.
Freedom.....it has great many benefits but also many distractions. As with all things, it is up to you to use discernment and find the correct balance.
Wednesday, November 05, 2008
Revelation (the final book of the New Testament) and Nostradamus' Prophecies are two all-purpose befuddling works. If you want to sow fear, uncertainty, and doubt (or simply yank people's chains), simply claim that some prominent person or recent event corresponds to descriptions that presage the end of the world, as elaborated by Revelation or Nostradamus. After all, comparatively few people have read either of those works; most people just have some vague idea that they describe, in detail, a coming apocalypse and the signs that will herald its imminent arrival. So pick your target, make up a list of reasons to explain how it supposedly matches up with end-of-the-world predictions, and watch the process of bewilderment begin. (We saw this happen in spades with bogus Nostradamus prophecies immediately after the 9/11 terrorist attacks.)
According to the Book of Revelations the anti-christ is: The anti-christ will be a man, in his 40s, of MUSLIM descent, who will deceive the nations with persuasive language, and have a MASSIVE Christ-like appeal.... the prophecy says that people will flock to him and he will promise false hope and world peace, and when he is in power, will destroy everything. Is it OBAMA??
The item quoted above, linking presidential candidate Barack Obama with the figure of the anti-Christ, is more of the same type of denigrative fiction. Contrary to popular belief, the New Testament book of Revelation (not "Revelations," as it is commonly rendered) does not provide a laundry list of signs for identifying the appearance of an anti-Christ. In fact, it neither uses the term "anti-Christ" nor describes such a figure — Chapter 13 of that book merely recounts the appearance of "beasts," who are depicted in animalistic terms (as rendered in the King James version of the Bible):
The term "anti-Christ" is mentioned several times in the first and second letters of John, but none of those passages specifically describes or identifies the anti-Christ figure (other than as a denier of the divinity of Jesus):
And I stood upon the sand of the sea, and saw a beast rise up out of the sea, having seven heads and ten horns, and upon his horns ten crowns, and upon his heads the name of blasphemy.
And the beast which I saw was like unto a leopard, and his feet were as the feet of a bear, and his mouth as the mouth of a lion: and the dragon gave him his power, and his seat, and great authority.
And I saw one of his heads as it were wounded to death; and his deadly wound was healed: and all the world wondered after the beast.
And they worshipped the dragon which gave power unto the beast: and they worshipped the beast, saying, Who is like unto the beast? Who is able to make war with him?
And there was given unto him a mouth speaking great things and blasphemies; and power was given unto him to continue forty and two months.
And he opened his mouth in blasphemy against God, to blaspheme his name, and his tabernacle, and them that dwell in heaven.
And it was given unto him to make war with the saints, and to overcome them: and power was given him over all kindreds, and tongues, and nations.
And all that dwell upon the earth shall worship him, whose names are not written in the book of life of the Lamb slain from the foundation of the world.
If any man have an ear, let him hear.
He that leadeth into captivity shall go into captivity: he that killeth with the sword must be killed with the sword. Here is the patience and the faith of the saints.
And I beheld another beast coming up out of the earth; and he had two horns like a lamb, and he spake as a dragon.
And he exerciseth all the power of the first beast before him, and causeth the earth and them which dwell therein to worship the first beast, whose deadly wound was healed.
And he doeth great wonders, so that he maketh fire come down from heaven on the earth in the sight of men,
And deceiveth them that dwell on the earth by the means of those miracles which he had power to do in the sight of the beast; saying to them that dwell on the earth, that they should make an image to the beast, which had the wound by a sword, and did live.
And he had power to give life unto the image of the beast, that the image of the beast should both speak, and cause that as many as would not worship the image of the beast should be killed.
And he causeth all, both small and great, rich and poor, free and bond, to receive a mark in their right hand, or in their foreheads:
And that no man might buy or sell, save he that had the mark, or the name of the beast, or the number of his name.
Here is wisdom. Let him that hath understanding count the number of the beast: for it is the number of a man; and his number is Six hundred threescore and six.
Little children, it is the last time: and as ye have heard that antichrist shall come, even now are there many antichrists; whereby we know that it is the last time.
Who is a liar but he that denieth that Jesus is the Christ? He is antichrist, that denieth the Father and the Son.
For many deceivers are entered into the world, who confess not that Jesus Christ is come in the flesh. This is a deceiver and an antichrist.
And every spirit that confesseth not that Jesus Christ is come in the flesh is not of God: and this is that spirit of antichrist, whereof ye have heard that it should come; and even now already is it in the world.
Nothing in the Bible — in Revelation or elsewhere — describes the anti-Christ as being "a man, in his 40s, of Muslim descent." In fact, since the book of Revelation was complete by the end of the second century, but the religion of Islam wasn't founded until about four hundred years later, the notion that Revelation would have mentioned a "Muslim" at all is rather far-fetched. (And even if it did, it couldn't be construed as a reference to Barack Obama, since Senator Obama isn't a Muslim.)
The Biblical citation most relevant to this issue might not be one from Revelation, but rather this passage from the Gospel of Matthew:
Watch out for false prophets. They come to you in sheep's clothing, but inwardly they are ferocious wolves.
And even this is such a broad statement. My mother is a christian and told me, if Obama is the anti Christ, there is nothing anyone can do about it. According to the teachings in the religion, he will come and no one, repeat key words, no one will know who it is because he will be so convincing other wise. Everyone will fall for it. There will be no one claiming they know who this person is.
To just show you how crazy this is, in my research I found an article about how the president of France, Sarkozy is the anti Christ. This proves that it is just rumors from paranoid people who think they know it all.
What I find amazing is how actual self proclaimed Christians do not know their bible. Even though they cling to it, they misquote it constantly. How is that even possible? It is because most religious people are sheep and follow. They do not research the information for themselves. They accept it from their pastor as truth.
I hope this opened someones eyes. Read your bible if you really believe that book was written by God. Study it and stop misquoting it!
The Federal Deposit Insurance Corp. was appointed receiver of Franklin Bank, which had $5.1 billion in assets and $3.7 billion in deposits as of Sept. 30, and of Security Pacific Bank, with $561.1 million in assets and $450.1 million in deposits as of Oct. 17.
The co-founder and chairman of parent Franklin Bank Corp. (FBTX) (FBTX), Lewis Ranieri, is credited with inventing mortgage-backed securities two decades ago, but apparently was unable to save his own company from getting ensnared in the home-loan bust.
The bank's failure is a bitter irony because it is the mortgage securitization business of which Ranieri is known as a pioneer - the repackaging of home loans as bonds that are sold to investors - that was at the heart of the mortgage and credit crises. Last spring, the audit committee of the company's board found in an investigation certain weaknesses in accounting, disclosure and other issues relating to residential real estate loans.
Franklin Bank Corp. just Sunday said it had received proposals for transactions to strengthen Franklin Bank's capital position and was keeping regulators informed of the talks' progress.
The FDIC said all of Franklin Bank's deposits will be assumed by Prosperity Bank of El Campo, Texas. Its 46 offices will reopen as branches of Prosperity Bank with their normal business hours, including those that open on Saturday. In addition to assuming Franklin Bank's deposits, Prosperity Bank also will acquire about $850 million of the failed bank's assets.
Parent company Franklin Bank Corp. just Sunday said it had received proposals for transactions to strengthen Franklin Bank's capital position and was keeping regulators informed of the talks' progress.
Meanwhile, all of Security Pacific's deposits will be assumed by Pacific Western Bank of Los Angeles. Its four offices will reopen Monday as branches of Pacific Western, a unit of PacWest Bancorp. (PACW) (PACW) In addition, Pacific Western will purchase around $51.8 million of Security Pacific's assets.
The FDIC will retain the remaining assets of the two banks for eventual sale.
The agency said depositors of Franklin Bank and Security Pacific Bank will continue to have full access to their deposits, which will continue to be insured by the FDIC.
The FDIC estimated that the resolution of Franklin Bank will cost the federal deposit insurance fund between $1.4 billion and $1.6 billion, while that of Security Pacific Bank will cost the fund $210 million.
Regular deposit accounts are now insured up to $250,000 as part of the new financial rescue law enacted in early October. The limit on individual retirement accounts held in banks remains at $250,000.
The 19 bank failures so far this year compare with three for all of 2007 and are more than in the previous five years combined. It's expected that many more banks won't survive the next year of economic tumult. The pressures of tumbling home prices, rising mortgage foreclosures and tighter credit have been battering many banks, large and small, across the nation.
The failures this year include that of Seattle-based thrift Washington Mutual Inc. in late September, the biggest bank collapse in history. It had $307 billion in assets. In July another big savings and loan, IndyMac Bank based in Pasadena, Calif., failed and was seized by regulators with about $32 billion in assets.
The FDIC estimates that through 2013 there will be about $40 billion in losses to the deposit insurance fund, including an $8.9 billion loss from the failure of IndyMac Bank. The FDIC is raising insurance premiums paid by banks and thrifts to replenish its fund, which now stands at around $45.2 billion, below the minimum target level set by Congress and the lowest level since 2003.
In addition, the FDIC may guarantee nearly $2 trillion in U.S. banks' debt and deposit accounts in an effort to break the crippling logjam in bank-to-bank lending.
Well over half of the roughly 8,500 federally-insured banks and savings and loans are expected to tap the FDIC's temporary guarantees. The agency will provide as much as $1.4 trillion in insurance for more than three years for loans between banks, guaranteeing the new debt in the event the issuing bank fails or its holding company files for bankruptcy.
Of the 8,500 FDIC-insured banks, 117 were considered to be in trouble in the second quarter - the highest level in about five years and up from 90 in the first quarter. The agency doesn't disclose the banks' names.
Tuesday, November 04, 2008
For eons, Christians have believed the world is hurling toward oblivion. But with the current economic downturn, the war in Iraq and the likely election of Barack Obama, many think it has picked up speed.
"Economic hardship is the mother's milk of prophetic progression," said Todd Strandberg of Bellevue, Neb. "It always brings about change, and it's what is helping Obama get elected."
Strandberg, founder and editor of raptureready.com, the largest Christian prophecy site on the Internet, spends his days linking current events with biblical passages. He created a Rapture Index, modeled after the Dow Jones Industrial Average, which consists of 45 categories of prophetic indicators from the occult to inflation and the crime rate. Each is assigned a value of one to five depending on the level of activity in that category. The numbers are adjusted weekly, and the higher the number, the faster the world is moving toward its end. Just before the time known as the Great Tributional, some believe there will be a "Rapture," where Christ takes the righteous to heaven without their tasting death.
"Any time there are disturbances whether they are natural phenomena like earthquakes or signs in the sky or social and political disasters this is manna from heaven for apocalyptic preachers," says Richard A. Landes, director of Center for Millennial Studies at Boston University. "That's how you get people worked up."
The Bible's Book of Revelations is the roadmap for Christian belief about the end-of-the-world and Second Coming of Jesus Christ. In several metaphor-laden chapters, the book describes horrific events that will befall the Earth: deception by a false Messiah, global war, hunger, famine, and disease, earthquakes, the persecution of true believers, and death by the millions.
Believers also will be warned of Christ's imminent return by physical signs, such as the sky turning black, so it's worth watching what's happening in the natural world.
In many eras, Christians have believed they were living in the last days.
One leader around 200 A.D. predicted Jesus was coming the next year so his followers halted all planting, Landes says. About 16 centuries later, a similar prediction meant the Millerites didn't harvest their crops.
Both groups starved, says Landes, editor of The Encyclopedia of Millennialism and Millennial Movements. "It was by and large self-destructive."
Today's presidential season is once again awash in global anxiety.
Some Web sites and conservative Christians have tried to argue that Obama could be the foretold Antichrist. In August, John McCain seemed to tap into evangelical anxiety with his ad, "The One," in which he mocked those who use messianic language to describe Obama.
The Rev. Tim LaHaye, co-author of the millennial Left Behind series, told the Wall Street Journal that he recognized allusions to his work in the ad but comparisons between Obama and the Antichrist were incorrect.
"The Antichrist isn't going to be an American, so it can't possibly be Obama. The Bible makes it clear he will be from an obscure place, like Romania," the 82-year-old author told the paper.
And the Rev. John Cowan, associate pastor at Salt Lake City's Calvary Chapel, likewise scoffed at the suggestion.
"I believe there is and will be an antichrist world leader who is probably alive today, but it's just silly to think Obama is that person," Cowan says. "I have a strong, literal understanding of end times, but that doesn't mean we name someone an antichrist every time we see someone whose stands we don't like."
In his 22 years working on Rapture Ready, Strandberg has seen an "avalanche" of anti-Christ suggestions, including Tony Blair and Bill Clinton. Obama doesn't fit the bill, he says, but he could be a type of "anti-Christ," which simply means too many people see him as a replacement for Jesus.
Still, Strandberg believes the end is at hand and Jesus' Second Coming will surprise everyone, coming as "a thief in the night," according to the Bible, but close observers will at least know "the season."
He points to tensions between Israel and Iran, Russia's invasion of Georgia, and the possibility of global depression as some of the top indicators.
"We are one big event from triggering a cascade that will not stop," he says. "There are so many indicators that are active. It's like an overhang of snow on a mountain top. Cracks are forming on the ridge and once the ridge breaks free, it will tumble down the mountain and nothing can stop it."
Monday, November 03, 2008
Bolivia's first indigenous president once served as the leader of the country's union of coca-growers. Relations between Bolivia and the US have been strained since Evo Morales won presidential elections in January 2006.
Coca is the raw material used in the production of cocaine and is widely grown in Bolivia. The country is a major producer of cocaine, but millions of Bolivians poorest people also chew coca leaves as part of their daily routine. Many believe the leaf offers health benefits.
"From today all the activities of the US DEA are suspended indefinitely," the Bolivian leader said in the coca-growing region of Chimore, in the central province of Chapare. "Personnel from the DEA supported activities of the unsuccessful coup d'etat in Bolivia," he added, referring to the unrest in September which left 19 people dead. "We have the obligation to defend the dignity and sovereignty of the Bolivian people."
US officials have denied any wrong doing.
In recent months, a string of tit-for-tat expulsions of diplomats and agencies increased tensions between both countries, the BBC's Andres Schipani reports from Bolivia. Bolivia's government expelled the US international development agency and the US ambassador to La Paz.
Washington retaliated by expelling its Bolivian counterpart, while last month President George W Bush himself put the Andean country on an anti-narcotics blacklist that cuts trade preferences. Making his announcement, Mr Morales also declared that his government had eradicated more than 5,000 hectares (12,300 acres) of illegally planted coca. |
Ah, glorious springtime. It brings flowers, warmer temperatures—and for many, incessant sneezes and sniffles. Everybody curses allergies as annoying at best, and some allergic reactions—such as anaphylaxis, which rapidly lowers blood pressure and closes the airways—can be fatal. But a handful of researchers now propose that allergies may actually have evolved to protect us. Runny noses, coughs and itchy rashes keep toxic chemicals out of our bodies, they argue, and persuade us to steer clear of dangerous environments.
Most immunologists consider allergies to be misdirected immune reactions to innocuous substances such as pollen or peanuts. Viral and bacterial infections invoke what are called "type 1" immune responses, whereas allergies involve "type 2" responses, which are thought to have evolved to protect against large parasites. Type 1 responses directly kill the pathogens and the human cells they infect; type 2 works by strengthening the body's protective barriers and promoting pest expulsion. The idea is that smaller pathogens can be offensively attacked and killed, but it's smarter to fight larger ones defensively.
Please continue reading at: |
Osmolarity is more than a difficult word to say quickly, three times in a row.
A chemist or a biologist would probably define osmolarity as a measurement of the total amount of chemicals dissolved in a liquid, cream, lotion or gel. Stated in a slightly different manner, osmolarity is the overall component concentration of a liquid.
Osmolarity occurs to help produce an equilibrium, when a substance in a solution (such as a fluid) crosses a membrane from an area of lower concentration to an area of higher concentration. As well, osmolarity is sometimes also refered to as osmolality. Solutions containing the same concentration of particles are said to be iso-osmotic or (isotonic).
The medical community must be aware of the osmolarity of a wide range of fluids, because for example, putting fluids into the blood that are not isotonic with blood may have profoundly negative impact. Whereas fluids that are isotonic or iso-osmotic with blood, may enter the body and remain there in harmony.
Blood osmolarity is normally between 275 to 295(1), urine can range from 50 to 1200, but after 12 to 14 hour fluid restriction this number should be over 850(2), while normal saline solution (often put into the body) has an osmolarity of 286.44(3).
In addition to this small list, the normal osmolarity of the following items, should also be noted:
- Female vaginal secretions (a woman’s natural lubrication): 260 to 290 (4)
- Human semen: 250-380 (4)
- Coconut Oil: 180-340 (5)
- Most commercial personal lubricants: 1,000 to over 10,000 (4)
As you may have noticed, the osmolarity of coconut oil is in the same range as the osmolarity of many core elements of the human body (the blood, vaginal secretions and sperm, for example). Therefore, these items are all iso-osmotic and may therefore be expected to exist in harmony. Stated slightly differently, they all contain the same concentration of dissolved particles permitting them to exist happily together in a cheerful state of equilibrium.
In comparison and nestled unhappily, in a dark place far away from the sunny bliss of coconut oil and body fluids, you will find the land of the personal lubricants. As noted by the short list above, the osmolarity of most commercial lubricants is much higher. But, what does this mean?
When two fluids combine that have a similar osmolarity, as mentioned, they create an equilibrium. Because of this equilibrium, the two fluids can peacefully co-exist. For example, coconut oil can be expected to play quite nicely with the human body, because the natural range for the osmolarity of coconut oil (180-340) is quite close to the osmolarity of vaginal secretions and sperm (260-380).
However, when two fluids combine that do not have the same osmolarity, they combine and then try to create a balance. Unfortunately, in an effort to form this new equilibrium, damage is caused by movement in or out of endothelial cells. And, the bigger the difference is between osmolarities, the greater the chance is for cellular damage and the faster that damage should be expected to occur. In fact, some research has already shown that personal lubricants can damage the cell lining of the vagina and the rectum. One such study, a January 2012 study published by the U.S. National Library of Medicine and the National Institute of Health, concluded that “lubricant products may increase vulnerability to STI’s (sexually transmitted diseases). Because of wide use of lubricants and their potential as carrier vehicles for microbes.” Additionally, when the protective lining of the rectum or the vagina becomes damaged, one of the body’s normal defense mechanisms is weakened.
In addition to this study, one other study also seems quite significant in its ability to document the impact of the osmolarity of personal lubricants. This study was published by the World Health Organization (WHO) in 2012. It was titled “Use and Procurement of Additional Lubricants for Male and Female Condoms”.
According to this study:
- Several papers (13–16) suggest that lubricants with high osmolality might cause vaginal and anal epithelial damage. Confirmation that lubricants with high osmolality can cause epithelium damage when applied rectally to humans has been demonstrated in a group of 10 volunteers.
- Epithelial damage could in turn increase the risk of infection, for example by HIV and other sexually transmitted infections (STIs), particularly when condom use is inconsistent.
- Most commercial personal lubricants have high osmolalities (2000–6000 mOsm/kg). This study reviewed over 40 personal lubricants.
- Ideally, the osmolality of a personal lubricant should not exceed 380 mOsm/Kg to minimize any risk of epithelial damage.
- Do not use oils (or coconut oil) with latex condoms, because they “have a highly damaging effect on latex.”
In summary, Osmolarity is important for the following, simple-to-understand reason:
- High Osmolarity = High Risk for STIs (sexually transmitted infections)
- Low Osmolarity = Low Risk for STIs
It should also be noted that the components that increase the osmolarity of coconut oil are dramatically different than the ingredients that increase the osmolarity of most commercial personal lubricants.
Conventional, non-organic lubricants contain ingredients like chlorhexidine, petrochemicals, parabens, silicon, glycerin, propylene and artificial fragrances, dyes or flavorings.
In 2002, during a Phase II/III clinical trial, even the highly touted nonoxynol-9 came face-to-face with the cold, hard truth that in addition to being a powerful spermacide, it also damages the cell lining of the vagina and rectum, thus increasing the risk of HIV infection in the people tested. And yet, nonoxynol-9 is still used on condoms today. (8)
Comparatively, coconut oil osmolarity is increased by the presence of natural constituents like amino acids, enzymes, minerals, and fatty acids which combine to create a pure, well-balanced source of healthy and hydrating nutrients.
(1) Medline Plus of the National Library of Medicine and the National Institute of Health – http://www.nlm.nih.gov/medlineplus/ency/article/003463.htm on June 21, 2014.
(2) Medline Plus of the National Library of Medicine and the National Institute of Health – http://www.nlm.nih.gov/medlineplus/ency/article/003609.htm
(3) Wikipedia – http://en.wikipedia.org/wiki/Saline_(medicine) on June 21, 2014.
(4) “Studies Raise Questions About Safety Of Personal Lubricants” Lauren K. Wolfe of Chemical & Engineering News: Volume 90, Issue 50, pp. 46-47. Published online at http://cen.acs.org/articles/90/i50/Studies-Raise-Questions-Safety-Personal.html, on December 10, 2012, and appeared there on June 20, 2014.
(5) Handbook of Applied Therapeutics, Eighth Edition page 95.9, listed under the section Pediatric Nutrition by M.A. Koda-Kimble, PharmD, L.Y. Young, PharmD, W.A. Kradjan, PharmD, B.J. Guglielmo, PharmD, B.K. Alldredge, PharmD, R.L. Corelli, PharmD. Copyright Lippincott Williams & Wilkins (LWW.com).
(6) “The slippery slope: Lubricant Use and Rectal Sexually Transmitted Infections: a newly identified risk”. Sex Transm Dis. 2012 Jan;39(1):59-64. doi: 10.1097/OLQ.0b013e318235502b. PMID: 22183849. http://www.ncbi.nlm.nih.gov/pubmed/22183849.
(7) “Use and procurement of additional lubricants for male and female condoms: WHO/UNFPA/FHI360 – Advisory Note by the World Health Organization in 2012. Published online at http://apps.who.int/iris/bitstream/10665/76580/1/WHO_RHR_12.33_eng.pdf.
(8) “Effectiveness of COL-1492, a nonoxynol-9 vaginal gel, on HIV-1 transmission in female sex workers: a randomised controlled trial” (Lancet, DOI: 10.1016/s0140-6736(02)11079-8). Published online at http://www.thelancet.com/journals/lancet/article/PIIS0140-6736(02)11079-8/abstract.
Article source: Tawne Bachus © 2014. All Rights Reserved. Originally published here on June 22, 2014.
Please note that while this site offers information, it should not be taken as medical advice.
Please consult a trusted medical professional before using the information on this site.
Results should be expected to vary from individual to individual. Also, please understand that you may still need to do other things to support your health in addition to using the information on this site as the information on this site is not intended for diagnosis or treatment. |
remote and disaster-ravaged areas, with the balloons operated by a solar-powered pump. They drift on winds at heights of 50,000 feet to 70,000 feet, tacking like a boat to follow air currents.to
Automation software collects wind forecast data, builds maps of where to travel and then processes each balloon’s observation so changes can be made to follow that map. It is this software that directs the balloon’s movements, not the 24/7 team of engineers monitoring them, head of Engineering Salvatore Candido said.
According to Candido, the first time he saw a balloon deciding to zig where a human would have chosen to zag, he had to “stare for a while at the strategy the algorithm was trying to execute” before realizing he had been outsmarted by the software.
“The first balloon allowed to fully execute this technique set a flight time record from Puerto Rico to Peru,” Candido said. “I had never simultaneously felt smarter and dumber at the same time.”
Balloons also choose when to loiter in an area to wait for winds to change, and fly in figure 8 patterns to maintain a constant LTE signal over an area for longer periods. |
We have previously discussed the importance of the right foods for people with Parkinson’s on this blog – Click here for a good example.
Recently, new data from researchers in Sweden points towards the benefits of a specific component of fish in particular.
It is a protein called β-parvalbumin, which has some very interesting properties.
In today’s post, we discuss what beta-parvalbumin is, review the new research findings, and consider how this new information could be applied to Parkinson’s.
A very old jaw bone. Source: Phys
In 2003, researchers found 34 bone fragments belonging to a single individual in a cave near Tianyuan, close to Beijing (China).
But it was not the beginning of a potential murder investigation.
This was the start of something far more interesting.
Naming the individual “Tianyuan man”, the researchers have subsequently found that “many present-day Asians and Native Americans” are genetically related to this individual. His bones represented one of the oldest set of modern human remains ever found in the eastern Eurasia region.
Tianyuan caves. Source: Sciencemag
But beyond the enormous family tree, when researchers further explored specific details about his jaw bone (or lower mandible as it is called) they found something else that was very interesting about Tianyuan man:
Title: Stable isotope dietary analysis of the Tianyuan 1 early modern human.
Authors: Hu Y, Shang H, Tong H, Nehlich O, Liu W, Zhao C, Yu J, Wang C, Trinkaus E, Richards MP.
Journal: Proc Natl Acad Sci U S A. 2009 Jul 7;106(27):10971-4.
PMID: 19581579 (This research article is OPEN ACCESS if you would like to read it)
In this study, the investigators analysed the carbon and nitrogen isotopes found within bone collagen samples taken from the jaw bone of Tianyuan man. In humans, the carbon and nitrogen isotope values indicate the sources of dietary protein over many years of life.
The researchers found that a substantial portion of Tianyuan man’s diet 40,000 years ago came from freshwater fish.
Interesting preamble, but what does this have to do with Parkinson’s?
Well, eating fish is believed to have many beneficial effects against numerous age-related conditions.
From cardiovascular disease (consuming small quantities of fish is associated with a 30% risk reduction for heart attacks – Click here to read more) to dementia/Alzheimer’s (one study found that eating fish once a week or more results in a 60% lower risk for developing Alzheimer’s – Click here to read more about this), the consumption of fish is believed to have many benefits.
And while Tianyuan man probably ate fish simply because he was hungry, more recently researchers have been trying to identify exactly which components of the fish meat provide the beneficial effects to our health.
Many people have become very excited about one particular component, called omega-3 fatty acids.
It has widely been presented as a potential therapeutic measure against dementia. Despite the enthusiasm, however, remarkably little direct evidence for this exists in humans (Click here to read more about this).
Clinical studies have found no evidence for benefit (or harm) from omega-3Polyunsaturated fatty acids supplements in people with mild to moderate Alzheimer’s (Click here to read more about this). This hasn’t stopped the research continuing though, and there is currently a phase 2/3 clinical trial of docosahexaenoic acid – a specific omega-3 fatty acid – in Alzheimer’s (Click here to read more about that).
What about Parkinson’s and Omega-3?
In the case of Parkinson’s, there has also been a lot of pre-clinical research on omega-3 acids (Click here and here to read more about this, and click here for a review that has a good section on omega-3 fatty acids research in Parkinson’s as well as other food components), but – again – there are limited clinical results supporting the preclinical data.
Title: Depression in Parkinson’s disease: a double-blind, randomized, placebo-controlled pilot study of omega-3 fatty-acid supplementation.
Authors: da Silva TM, Munhoz RP, Alvarez C, Naliwaiko K, Kiss A, Andreatini R, Ferraz AC.
Journal: J Affect Disord. 2008 Dec;111(2-3):351-9.
This study is the only randomised clinical trial on fish oil supplements in Parkinson’s (that I am aware of – happy to be corrected). In this pilot study, 31 individuals with Parkinson’s and depression were randomly assigned either fish oil capsules (“containing omega-3 fatty acids”) or mineral oil capsules for 12 weeks. At the end of that period, those who had been taking the fish oil capsules had statistically significant improvements in their levels of depression (compared to the mineral oil group), but they did not demonstrate any changes in their other Parkinson’s symptoms.
Fish oil capsules. Source: Indiamart
Recently a clinical trial (called ‘RLID-PD’ – Click here to find out more about that trial) has been conducted investigating the impact of docosahexaenoic acid on the development of L-dopa induced dyskinesias in Parkinson’s (Click here to find out more about dyskinesias). The preliminary results from that study suggest that for people just beginning L-dopa treatment, concomitant use of docosahexaenoic acid may help delay onset of L-dopa induced dyskinesias (Click here to see an early abstract of the results – NOTE: we are still waiting on the final results of the study).
Admittedly, both of these studies were a very small, and the depression study was too short (three months is not long enough to observe motor improvements), so it is difficult to draw too many conclusions.
And the lack of any strong clinical support for omega-3 fatty acids has not stopped researchers from focusing on other components of fish meat.
Which resulted in the research report we are going to review today:
Title: Abundant fish protein inhibits α-synuclein amyloid formation
Authors: Werner T, Kumar R, Horvath I, Scheers N, Wittung-Stafshede P
Journal: Sci Rep. 2018 Apr 3;8(1):5465.
PMID: 29615738 (This research article is OPEN ACCESS if you would like to read it)
In this study, a group of Swedish researchers wanted to look at the interactions between Atlantic cod β-parvalbumin and the Parkinson’s associated protein alpha synuclein.
What is β-parvalbumin?
Parvalbumins are proteins that represent one of the largest group of animal food allergens.
Allergens are proteins that triggers immune responses (or allergic reactions). For example, nuts are a common allergen, causing an immune response in people who are allergic to them.
Nuts. Source: Ronly
Parvalbumins are ubiquitous in animals – they are particularly abundant in the white muscle cells of many fish species. But Parvalbumins can be classified into two different types: alpha (α) and beta (β).
And the difference is important.
Most fish species are rich in β-parvalbumins – they contain about 0.2 g of β-parvalbumin per 100 g muscle tissue (that is quite a lot – source). And β-parvalbumins are the most allergenic (that is, they cause the biggest allergic reaction).
Seafood allergies are relatively common – 2.3% of the general population – but fish allergies specifically are much less common (only 0.4% of the population – Source). Allergic reactions to fish are mainly caused by parvalbumins, which are relatively heat stable (meaning that they are not destroyed by cooking the meat).
But why were the Swedish researchers looking at β-parvalbumin?
An interesting feature of parvalbumins is that they can bind together and form what is known as an amyloid state.
What is an amyloid state?
Amyloid states occur when a protein become folded in such a way that allows many copies of that particular protein to stick together. Quite often this clustering (or aggregation) occurs when the protein has been misfolded.
Small aggregates of these amyloid-proned proteins are called oligomers, and as they combine with other oligomers, they form what are referred to as fibrils.
In Parkinson’s, we see this property in the “bad guy” protein, alpha synuclein. It has this ability to form amyloid states, which results in the production of fibrils and (subsequently) the formation of Lewy bodies (the characteristic circular clumps of alpha synuclein that appear in cells in the Parkinsonian brain):
Parkinson’s associated alpha synuclein. Source: Nature
If you want to read more about amyloid state proteins (particularly in the context of disease), click here for a good review. And please don’t assume that amyloid clustering of proteins is only a disease-related phenomenon. There is a lot of evidence now of these amyloid-clusters of proteins having functional roles (Click here to read more about this).
And β-parvalbumin can form these amyloid states as well?
Yes it can.
There are actually a lot of proteins that can form amyloid states. In the case of β-parvalbumin, this amyloid state is believed to explain the allergic properties of the protein:
Title: Fish β-parvalbumin acquires allergenic properties by amyloid assembly.
Authors: Martínez J, Sánchez R, Castellanos M, Fernández-Escamilla AM, Vázquez-Cortés S, Fernández-Rivas M, Gasset M.
Journal: Swiss Med Wkly. 2015 May 29;145:w14128.
PMID: 26023765 (This article is OPEN ACCESS if you would like to read it)
In this study, the researchers found that forming an amyloid state protects β-parvalbumin from being broken down by stomach acid (after it has been consumed). The amyloid state also helped the protein to cross through the intestinal wall, and the amyloid formation resulted in the presentation of the epitope that makes β-parvalbumin an allergen.
Importantly, the researchers also report that the anti-amyloid compound epigallocatechin gallate (also known as EGCG) prevented β-parvalbumin forming an amyloid state, AND reduced the presentation of the epitope. We have previously discussed the potentially magical powers of EGCG in the context of Parkinson’s (Click here to read that post).
Ok, so what did the Swedish researchers in this new study do?
Knowing that human amyloid proteins can interact with each other, the researchers were wondering whether – once fish meat is consumed and absorbed into the host blood stream – fish β-parvalbumin may also interact with some of the human amyloid proteins.
To test this idea, the researchers collected Atlantic cod β-parvalbumin and tested it in a host of experiments with human alpha synuclein.
Atlantic cod. Source: Wikipedia
Through their experiments, the researchers discovered that β-parvalbumin robustly inhibits amyloid formation of alpha synuclein. It blocks the formation of alpha synuclein aggregates completely.
But it was the way that it did this that was particularly interesting.
The investigators found that the anti-amyloid effect involved alpha synuclein actually binding to the β-parvalbumin amyloid structures. In this fashion, β-parvalbumin “scavenges” alpha synuclein, binding it up so that it cannot form the aggregates.
What is the normal function of β-parvalbumin in the cell?
Parvalbumin is a calcium-binding albumin protein.
Yes, calcium is currently a big deal in the world of Parkinson’s research.
And in this current study, the researchers in Sweden found that β-parvalbumin adopted a very stable amyloid state in the absence of calcium. As soon as they added calcium to their experiments, β-parvalbumin would stop forming amyloid structures.
Importantly, the addition of calcium and the loss of β-parvalbumin amyloid structures resulted in the increase of alpha synuclein amyloid aggregates. As you can see in the image below, when β-parvalbumin and alpha synuclein were maintained in a low calcium solution they did not aggregate much over time. But as soon as the investigators added calcium to the solution (at 70 hours), there was an increase in alpha aggregation (the upward curve in crosses).
This result suggested that in order for β-parvalbumin to have its anti-amyloid effect on alpha synuclein, their interaction needs to be in a low calcium environment.
But given this anti-amyloid effect β-parvalbumin has on alpha synuclein, the researchers concluded that “fish intake may provide health benefits through PV amyloid interactions that prevent neurodegenerative processes”
The researchers even provided some dietary advice: “Fish is normally a lot more nutritious at the end of the summer, because of increased metabolic activity. Levels of parvalbumin are much higher in fish after they have had a lot of sun, so it could be worthwhile increasing consumption during autumn,” – Nathalie Scheers, Assistant Professor in the Department of Biology and Biological Engineering, and a researcher on the study (Source).
Interesting. Is there any evidence of a high-fish diet helping with Parkinson’s?
This is difficult to answer as fish is not eaten in isolation. There has, however, been some research looking at diet and the risk of developing Parkinson’s, and it puts fish into the groups of food that are associated with a lower risk of developing Parkinson’s:
Title: Prospective study of dietary pattern and risk of Parkinson disease.
Authors: Gao X, Chen H, Fung TT, Logroscino G, Schwarzschild MA, Hu FB, Ascherio A.
Journal: Am J Clin Nutr. 2007 Nov;86(5):1486-94.
PMID: 17991663 (This article is OPEN ACCESS if you would like to read it)
In this study, the researchers conducted a prospective study involving the medical details of 49 692 men and 81 676 women from two huge US databases: the Nurses’ Health Study (NHS) and the Health Professionals Follow-Up Study (HPFS).
NHS study was started in 1976 when 121,700 female registered nurses (aged 30 to 55 years) completed a mailed questionnaire. They provided an overview of their medical histories and health-related behaviours. The HPFS study was established in 1986, when 51,529 male health professionals (40 to 75 years) responded to a similar questionnaire. Both the NHS and the HPFS send out follow-up questionnaires every 2 years.
By analysing all of that data, the investigators found 508 cases of Parkinson’s. When they looked at the diets of these individuals, the researchers found that a high intake of fruit, vegetables, fish, and poultry and a low intake of saturated fat lowered the risk of developing Parkinson’s. Exactly how much impact the fish component had on this effect is still to be determined.
So does this mean I should eat more fish?
With regards to the β-parvalbumin study, the results need to be independently before we get too carried away. In addition, as Dr Beckie Port of Parkinson’s UK pointed out in her discussion of this research, ‘we don’t yet know if [β-parvalbumin] can cross the blood brain barrier to enter the brain’ (the blood brain barrier being the protective membrane that surrounds our brain).
Plus radically increasing the amount of fish in the diet of a person with Parkinson’s is not really a good idea, particularly if they are taking L-dopa.
Good food is important.
Particularly for an individual affected by Parkinson’s.
But too much foods that are high in protein should be avoided or eaten in moderation if you have Parkinson’s. And fish is high in protein.
The reason for this is because L-dopa is an amino acid, and protein competitively inhibits L-dopa absorption. This competition reduces the effectiveness of L-dopa therapy (Click here to read more about this).
Thus, one should be careful eating too much fish.
I have fish allergies, how can I get some of this β-parvalbumin stuff?
Again, the results need to be independently replicated.
But while we are waiting for those results, drink green tea. It is full of the anti-amyloid compound epigallocatechin gallate (EGCG – Click here to read more about this).
So what does it all mean?
Researchers in Sweden have published the results of a very interesting study that highlights the anti-amyloid effect of fish-derived β-parvalbumin on aggregating alpha synuclein. Their findings indicate that the β-parvalbumin achieves its effect by scavenging alpha synuclein, and this phenomenon is dependent on low calcium levels.
One important consideration when interpreting the results of this new research is that all of the experiments were conducted in solutions, not in cells. Thus, there is a question of how biologically relevant the anti-amyloid properties of β-parvalbumin are – particularly in the high calcium environment of a neuron.
It will thus be interesting to see if the results can be replicated in cells, and hopefully such experiments will include other amyloid-proned proteins like beta-amyloid (Alzheimer’s) and amylin (type-2 diabetes). The Swedish researchers have already indicated that they are certainly planning to follow up the research. And they have suggested that that follow up work will also include investigations of how β-parvalbumin is distribute within human tissues after consumption (Source).
We shall see what happens. And until those results become available, I’ll try not to be koi.
Not a bad pun. Cod do batter though.
The banner for today’s post was sourced from 24-hrbait |
Piacenza liver rendition by Mel Copeland, correcting some errors from renderings found on the internet
The Piacenza Liver appears to have been used by Etruscan augurs as a teaching instrument in forcasting using a sheep's liver. There are three areas of the liver that are noted within the text of the liver, which one should be able to discern by looking at it. On the left is an area called "The Net." The Etruscans wrote from right to left, and where there is some doubt as to the direction of reading the scribes faced the letter(s) in the direction they are to be read. In some scripts where an "F" might be able to go with the word before or after it, if it went together with the word preceeding it the scribe would face the "F" in that direction, countering the actual direction the other letters in the phrase would face. Also, they used a colon or a dot to separate words and phrases. These puncutation marks, in fact, became quite important as they were intended in reading the Etruscan texts. When in doubt I looked at the punctuation marks. This was particularly important in translating the Tavola Cortonensis.
Forgive my handwriting. If I have time I will redo the rendering.
The Net reads after the manner of a wheel, beginning with PL-1, LES VFELI, "Law of the sheep." The next region, PL-6, reads Te LVS Ce, "to you the light here, " followed by PL-5, "LER A and PL-4, "SELFA," meaning "the Lord / god to save." The last region of The Net is PL-3, CILEN and PL-2 ES SATR, meaning "they are quick ; he is the begetter / saver."
Another area of the Piacenza Liver is in its center, in an area called "TIVS ARC" : arch of the god. Rounding the lobe in the arch one reads AFIS LARI, "Eternal gods." Adjacent to it is a region, PL-7, PER _ _ and PL-11, RET PEVRI, meaning, " by_ _ net to propitiate."
The right hand area of the liver has to do with "hearing / reading beginning with PL-21, CARE, "he cares for, cures" then PL-20, BVB LVS, possibly a name, "Boblos." PL-19 is LARV, "ghost, spectre" and PL-17 is LER E, translated at TC 31 and K-1 as "gods, lords," but this may mean "the Lord e, ex (from)" following the example at PL-5, LER A, "god to.." Lar, Laris appear most frequently in the scripts, meaning god, pl. gods. The word refers to Roman tutelary / household deities.
The next panel is PL-18, RPIS but combined as a phrase with PL-17 reads god ERPIS, "god of vegetation." Working back up the liver we find PL-14, TINIR PER and PL-15, RV8ARAS, "to ring, tinkle, talk shrilly through hardwood /oak," i.e., the sacred oaks. Then PL-16 says TINI RF8, "he / it rang / shrilled disgrace."
The bands around the liver appear to voice the message in the three main regions, with the left being salvation and the right harboring disgrace and through the vegetation connection the promise of rebirth where one can go through the arch of god through the AFIS LARI "eternal gods" who adjoin RET PEORI, the Net to Propitiate (PL-11), where the Law of the Sheep, PL-1, begins.
The band above the RET PEVRI is PL-22, CILENI, which appears to be L. silanus-i, "fountains," but probably is CI LENI Le: that / which he makes straight there. The band, PL-28, 8V8LVNS, has been translated by scholars as "Flufluns," the Etruscan Bacchas or Dionysius, the vegetation god. Reading along the band in the direction the letters face, from right to left, there is PL-27, SELFA, L. salveo-are, to save, repeated directly below the panel carrying the same word. The next panels in the order, PL-26, LER NI, may be "no god," but the character "I" is not clear. NI is used in the Zagreb Mummy script, Z386, SAC NI CLERI, and may mean L. ne, indeed, truly. NE and NA are used in abundance in the Etruscan scripts. Panels PL-25 and PL-24 are hard to read.
Panel PL-23, CFLAN, may be "food" (L. culina-ae, f. kitchen, meton. food, fare)
The band on the right of the liver reinforces what we already know from the region adjacent to it: PL-34, TIN CILEN, "the ring of fountains," PL-33, TIN RE8, "the ring I echo / make to resound" (L. reboo-are, to echo, resound, make to resound), PL-32, TINI HE, and PL-31, VNI RAE and PL-30 YEIFA, appear to mean, "it has sounded of the goddess Uni the defendant /accused (L. reus-i, m. and rea-ae, f.) she drives back (L. reveho-vehere-vexi-vectum, to carry back, drive back). The panel, PL-29, LFS Le, seems to conclude this region of the arch of the god, referring perhaps back to atonement, PL-11. LFS Le appears to be L. luo-lure, "to atone" there, through the AFIS LARI, eternal gods, around the arch of god to PL-11, RET PEVRI, the net of propitiation. PL-7, PER _ _ is probably LER NA, god of nothing and appears to be a region like pergatory. It's a dead end. The long lobe, PL-35, is hard to read, but the letters on the tip appear to be REN. The word is used frequently, read as "I reign" (L. regno-are, to reign). It declines as RENA, RENeS, RENeR, RENI, RENV.
A line-by-line description follows: These words have been inserted into Etruscan Phrases Table 1.
PL-1 LES VFELI [Translation: The law (L. lex, legis, f.) of the sheep (L. ovillus-a; of sheep; ovile-is, a sheepfold, an enclosure)]
PL-2 SATR ES [Translation: the begetter (L. sator-oris) he is (L. es)]
PL-3 CILEN [Translation: they make quick (L. celero-are)]
PL-4 SELFA [Translation: he saves (L. salveo-are)
PL-5 LER A [Translation: god / lord (L. lar, lares) to (L. a)] Note: LER appears at Z5, K13, LERES, Z155, LERI, Z122, Z224, Z851. 1
PL-6 Te LVS Ce [Translation: you (L. te) the light (L. lux, lucis, f.) here (Fr. ici)] Note: LVS appears at TC71.
PL-7 PER _ _ [Translation: through (L. per) _ _ ]
PL-8 AFIS [Translation: eternity (L. aevus-i)] Note: This word appears at S-10, S-30, the Lemnos Script.
PL-9 LARI [Translation: gods / lords (L. Lar, Laris, m. plur. Lares)]
PL-10 ARC TIVS [Translation: the arc / arch (L. arcus-us, m. a bow, arch, arc, esp. the rainbow) of god / the divine (L deus, divus, m., numen divinum, god; dius-a-um, divine, god-like)] Note: TIVS appears at N738 and HJ-3; ARC appears at TC127, TC236 (CLENI ARC) , possibly TC260
PL-11 RET PEVRI [Translation: the net (L. rete-is) of propitiation (L. pio-are, to appease, propitiate, venerate, atone for)]
PL-12-13 Not used
PL-14 TINIR PER [Translation: to ring, tinkle, talk shrilly, pay money (L. tinnio-ire) by (L. per)] Note: TINiRS appears at Z522, TINiS appears at Z439, Z572, CA-1, a statue of the Chimera. The inscription on its leg tells you to pay up.
PL-15 RV8ARAS [Translation: oak (L. rubur-oris, m., hardwood, oak) ; alternate could be Robigus, Rub, the deity invoked to preserve grain (L. Robigus, Rub-i) you plow (L. aro-are)]
PL-16 TINI RF8 [L. to the god Tin, Tini (L. Jupiter; Gr. Zeus) I am red, I blush (L. rubeo-ere)] Note: Tin, Tini appear frequently in Scripts Z and TC; Tinia is shown in the Divine Mirror.html.
PL-17 LER E [Translation: the god / lord (L. lar, lares) 1
PL-18 (E)RPIS [Translation: vegetation (L. herba-ae, f.) Note: the god / triumph of vegetation seems to be the theme of PL-14 through PL-18. Directly below the Net of Propitiation is the name 8V8LVNS, interpreted by scholars as Fufluns, the Etruscan Bacchas or Dionysius, the god of vegetation and rebirth.
PL-19 LARV [Translation: the ghost, spectre (L. arua [larua]-ae, f., a ghost, spectre, mask)] Note: This word appears at TC108, K43, AN31, LS-1.
PL-20 8V8 LVS [Translation: I vow / pray (L. voveo, vovere, vovi, votum, to vow, promise to god, to pray for, to wish) of the light (L. lux, lucis, f.)] Note: 8V8 is used at N607: TRE8: 8V8 KALE RV8: ; See RV8, PL-15 above. LVS is used in several scripts (See Table 1) and the Mirror from Tuscania shows an augur (haruspex) examining a liver with the goddess Dawn driving the sun-chariot overhead. The ceremony for Tarquin thus is shown on this mirror as taking place at dawn. The play of light on the liver would appear to be important..
PL-21 CARE [Translation: you care for, cure, minister to (L. curo-are)] Note: This word declines: CAR, Z582; CARV, K18 : LER CARV TEI. Script "K," the Perugia Cippus, is an important script that contains a list of kings and queens. A significant queen, RENF SARINA, has a bronze bust in the Louvre, Museum which has her name inscribed on her forehead, just as it appears in script K.
PL-22 CILENI Le [Translation: This is probably a name, Cileni] Note: The word possibly refers to: which / that (L. quae; It. ci, that, about it) he made straight / straightened (L. lineo-are) there (le, la)] Note: CI appears in scripts Z, TC, K, M, and AJ-9. LENI appears in Script TC; LENIES is at R426. This may be the word, L. silanus-i, "fountains" ; however, the word, PHVNT, PHVNTA, PHVNTE, PHVNTIA (L. fontanus-a-um) appears in scripts N, Q and R. See PL-34.
PL-23 CFLAN [Translation: kitchen, menton. food, fare (L. culina-ae, f.)] Note: KFLIN appears at L-7, Novilara Alphabet : ATHINE Mi CHFLIN PARIEMUS (Athena my food we purify).
PL-24 CE L S (unreadable)
PL-25 LVS S _ (unreadable)
PL-26 LERNI [Translation: no god / lord?] Note: This may refer to Lerna, a Greek town where the Alcyonian Lake, entrance to Hades was located. The word is interestingly located next to SELVA, "he saves."
PL-27 SELFA [Translation: he saves (L. salveo-are)] Note: See PL-4.
PL-28 8V8 LVNS [Translation: I vow / pray (L. voveo, vovere, vovi, votum, to vow, promise to god, to pray for, to wish) of the loins? (L. lumbus, m.; It. lonza, ounce, f. ; Fr. longe, f.)
PL-29 LFS Le [Translation: I loose, expiate, atone for (L. luo, lueere, lui, luitrus, to loose, to expiate, atone for, make good) there (le)] Note: LVRI, HA-2, is used in a script on a statue of an augur in the context: "Behold, he atoned for the true offspring."
PL-34 TIN CILEN [Translation: I ring (L. tinnio-ire) or to the god Tini of Cilen (name?)] Note: See PL-22 and PL-3.
PL-33 TIN RE8 [Translation: to the god Tini I dream, muse (Fr. rever ; L. somnio-are, to dream; It. sognare); this may be "I revere," L. venerari ; Fr. révérer)] Note: This word declines: RE8, RE8A, Pyrgi Gold Tablets, Au17, Au74, and RE8V, N16.
PL-32 TINI HE [Translation: the god Tini he has (L. habeo-ere, to have, hold, have about one, contain, possess)] Note: The Etruscan verb "to have" conjugates very much like French, Italian and more particularly Spanish: HV (ho) HA, HE. Third person singular, HE, appears frequently in Script Z and at K136. HV appears in Scripts Z, M and K.
PL-31 VNI RAE [Translation: the goddess Uni (Etruscan consort of Tini) she expunges (Fr. rayer, to stripe, streak, cancel, erase, expunge, strike out ; It. raschiare)] Note: RAE appears at Z412; RA appears at Z761, TC120, R36 and K113.
PL-30 YEIFA [Translation gods (L. deus, divus)]
Updated: 5.10.06; 5.11.06
Copyright © 1981-2006 Maravot. All rights reserved.
Copyright © 1981-2006 Mel Copeland. All rights reserved. Use of the information on this page is expressly forbidden for purposes of publication in any media without the prior written consent of the author. |
Money for Titles: The American Dollar Princesses
by Ellen Micheletti
Stately homes need large amounts of money poured into them to keep them from becoming stately ruins. For years, the nobility and gentry of England lived on the rents paid by the tenants of their estates. As long as England was primarily an agricultural country and there was no such thing as income tax, the owners of these estates had a good thing going (provided they had a good manager). When the country began the process of changing from an agricultural economy to a manufacturing one and income and inheritance taxes came into the picture, a lot of landowners had some real cash flow problems. Of course they could have gone to work, but there are some things a gentlemen does not do.
On the other side of the Atlantic, the Civil War had made some Americans very, very rich. These newly rich Americans wanted the respectability that money could not buy. Nouveau riche families like the Vanderbilts and Goulds were routinely snubbed by old-money Americans like the Astors, even though these newly rich families could buy and sell the most of the older families many times over. When cash-poor British and European aristocrats met wealthy, title-hungry Americans, marriage often followed.
I'm going to tell about a few of the trans-Atlantic marriages between American so-called "dollar princesses" and impoverished British and European nobility. These marriages were mostly a trade of money for title and very few of them were happy.
One of the first of these trans-Atlantic marriages was between Jennie Jerome and Lord Randolph Churchill, second son of the Duke of Marlborough. Unlike some of the later marriages between rich American girls and poor aristocrats, this one was based on love - or at least infatuation. Neither family approved of the match. Jennie's wealthy family thought that if she was going to marry into the aristocracy, at least marry an heir, not a younger son. As for Lord Randolph's family - Jennie was (horrors) an American! However, love carried the day and they were married. Seven months later, Jennie had a son, Winston Churchill, and later another son, Jack. She and her husband became prominent members of London Society and were associated with the Prince of Wales' Marlborough House Set.
Jennie was an extraordinarily beautiful and charming woman whose skills as a hostess and campaigner were invaluable to her husband in his political career. Lord Randolph spent his whole life in the House of Commons and eventually became Chancellor of the Exchequer. Great things were expected of him and many members of his party thought that he would eventually become Prime Minister. Unfortunately, Lord Randolph lacked tact and diplomacy. He interposed himself into a quarrel between his brother and the Prince of Wales, forgetting that royalty is never wrong, which resulted in his and Jennie's banishment from Society for some time. Lord Randolph quarreled with the senior members of his party, lost his position, and never fulfilled his early political promise. He died of syphilis at the age of forty six. As for Jennie, she remained beautiful and charming her whole life long. Jennie married twice after the death of Lord Randolph, both times to men younger than her son Winston. At her death, Winton Churchill said of her, "She shone like the evening star."
Later, an American heiress did snag a Duke of Marlborough. Consuelo Vanderbilt was the daughter of William Vanderbilt and his wife, Alva. The Vanderbilt family was one of the richest in the world, but to old-money Americans, they were nothing but upstarts. Alva Vanderbilt was a ferociously ambitious woman. She was determined that her beautiful daughter would marry into the nobility. Alva took over every aspect of Consuelo's education, training her in grace and deportment. Consuelo was a beautiful young woman - tall and elegant with a long, swan-like neck. The clothes of the period, with their long flowing lines and high collars, accented her beauty and she was quickly noticed by several wealthy, upper-crust young men. Mrs. Vanderbilt would not allow her daughter to keep company with any of these young men, no matter how rich they were or how good their lineage. She was holding out for a member of the British nobility, preferably a Duke. Consuelo did manage to meet one of these young men, Winthrop Rutherfurd, on the sly and fell in love with him. When she told her mother, Mrs. Vanderbilt threw a temper-fit of volcanic proportions and threatened to have a heart attack. Consuelo, who was thoroughly cowed, gave up Mr. Rutherfurd.
The Duke of Marlborough was called Sunny by his friends. This was not due to his disposition, which tended to the morose and taciturn. He lived in Blenheim Palace, a huge white elephant which was slowly falling apart (for more on Blenheim and the English version of this story, click here). It had so many windows, it took the window washers a year to finish, and then they just started over. It had fourteen acres of leaky roof, and gardens that were choked with weeds. The Duke needed money. Enter Alva and her beautiful daughter. Alva arranged for them to meet at every opportunity. The Duke proposed and Consuelo accepted (she didn't dare not). The marriage produced two sons but was unhappy for both parties. Consuelo did not like her husband's condescending attitude toward Americans, nor his air of superiority. She hated the toadying she received because of her position. Consuelo wrote that it was all she could do not to laugh when an unctuous official once asked her, "Would you care to say grace, Your Grace?" The Duke and his family thought that Consuelo was spoiled and unappreciative of the Marlborough name and heritage. it was a sad situation all around.
To escape from the unhappiness of her marriage, Consuelo became involved in political and women's issues. She spent most of her time in her London house and away from the Duke and Blenheim Palace. She and the Duke were separated for twelve years and later divorced. Consuelo spent millions of dollars to renovate Blenheim Palace, but she always hated the place. Consuelo married a Frenchman named Jacques Balsan and her second marriage was very happy. As for the Duke, he too re-married, to Gladys Deacon, but his second marriage was also very unhappy.
George Curzon was the son of a landowning parson/squire. He had an unhappy childhood, due to a sadistic nanny. When he went away to school to Eton and later Cambridge, his teachers discovered he had a brilliant mind. Curzon went into politics and quickly rose in the ranks. People did not like him - he was arrogant in the extreme - but they did respect him.
Curzon wanted the position of Viceroy of India, but the man in that position had to have money and he had none. Curzon became acquainted with a charming American girl named Mary Leiter, who was the daughter of Levi Leiter, one of the founders of the Marshall Fields department store. Mary was beautiful, kind, rich, and she worshipped the water Curzon walked on. Their marriage and Mary's wealth brought Curzon the position of Viceroy of India and the title of Baron, later upped to Marquis. As the Viceroy, Curzon was loved by the Indians, but hated by the British army and most of the other bureaucrats of the Empire. He had good ideas and was an excellent administrator, but he was arrogant and imperious with his subordinates. His marriage turned out to be a very happy one. Curzon married Mary for her money, but later came to love and depend on her. Mary, for her part, was totally subservient to her husband and deferred to him in all things. Mary was never in very good health and her early death left her husband devastated. After Mary's death, Curzon carried on a long love affair with the author, Elinor Glyn. Mrs. Glyn wrote romantic and passionate novels and was famous for her book Three Weeks which had a scene of torrid love-making on a tiger skin. It may not have been a coincidence that Curzon gave Mrs. Glyn a tiger skin as a present. Mrs. Glyn had hoped that Curzon would marry her, but he married another rich American, Grace Duggan. Grace and Curzon loved each other but she was not as compliant as Mary had been. When Curzon got too autocratic, Grace would go travelling. Still the marriage was happy.
Not all wealthy Americans married into the British nobility. At least one found her nobleman in France. Anna Gould was the daughter of Jay Gould, one of the wealthiest men in the world. His daughter Anna, was not very good looking. She was short, petulant, and plain, but her money made her very attractive especially to Boniface, Count of Castellane. The marriage between these two characters was the best example of a marriage entered into for money on his part and a title on hers. It was also a complete and total failure. If there had been tabloids at that time, Anna and Boni would never have been out of them. After their marriage, Boni began to spend money on a scale that was beyond extravagant. He bought homes and furnished them with the choicest of art and antiques. He bought a 1600 ton yacht that required a crew of over ninety. Boni was fond of giving lavish parties in beautifully decorated houses with the best food and fine wines. When Anna had her 21st birthday, Boni gave her a party for 3,000 guests, featuring fireworks, a ballet of 80 dancers, and an orchestra of 200 musicians.
All this spending angered the Goulds. Rich as they were, this was just too much for them. They set out to wage a public campaign against Boni, portraying him as a spendthrift (not hard to do). Boni loftily proclaimed that his spending was good for trade, but since he had the nobleman's disinclination to pay his bills, the tradesmen were not impressed. Finally Anna had had enough of Boni's spending and his flagrant infidelity, and left him. She obtained a divorce and married the Duc de Tallyrand who had his own money. Anna's second marriage was a happy one. As for Boni, he lived out his life in faded splendor.
Today, many of the expensive-to-maintain homes of the formerly-wealthy have been turned into museums and tourist attractions, including the Duke of Marlborough's Blenheim Palace. It is no longer considered a disgrace for a nobleman to work. Earl Nelson of Trafalgar is a police detective, and even Prince Edward has a job. Marriages for money do still occur, but they no longer command newspaper headlines. Of course, if any of Queen Elizabeth's sons marry a wealthy (or even not wealthy) American, the ink will flow!
||Ellen is the editor of the Historical Cheat Sheet and an AAR Editor/Reviewer - you can email her via the link here
||Find links to all of Ellen's Historical Cheat Sheet articles at the end of Servants |
Signs And Symptoms Of Ovulation
The signs and symptoms of ovulation vary from woman to woman. When you’re ovulating, you’re at your most fertile. So if you’re trying for a baby, it’s the best time of the month to have sex.
Ovulation and role of hormones –
Ovulation results from an interplay between the hypothalamus, pituitary, ovary and endometrium. The ovary has two roles: the first is the endocrine function of producing oestrogen and progesterone to prepare the endometrium to receive the fertilised ovum. The second, which is intrinsically related, is gametogenesis and ovulation.
Development of the ovarian follicle occurs in response to stimulation from the pituitary gland. The hypothalamus and pituitary are intimately associated. Together they regulate ovarian structure and function throughout the menstrual cycle. The hypothalamus produces Gonadotrophin Releasing Hormone (GnRH) in a pulsatile fashion and this in turn stimulates the production of the gonadotropins Follicle Stimulating Hormone (FSH) and Luteinising Hormone (LH). These hormones are responsible for the ovulation.
If you want to know, you have to check minute changes in your body, when you’re ovulating.
Ovulation is the key factor for getting pregnant. Take time now to learn about ovulation, its signs, and how to track it so that you can get pregnant quicker and easier.
Common Signs of Ovulation
Again, it is important to note that ovulation symptoms vary from woman to woman with some women experiencing no symptoms at all.
Primary Ovulation signs-
- Change in cervical mucus – Cervical mucus that resembles “egg whites” is a sign that you are about to ovulate or are ovulating. It’s become more thick during ovulation. During ovulation, under the influence of high estrogen level in the blood, mucus production volume increases. It is a mechanical barrier to the pathogen and less viable sperm. Cervical mucus provides sperm with proper nutrition, under the favorable conditions the sperm can stay viable up to 4-5 days.
- Change in basal body temperature –The basal body temperature is the lowest temperature of your body at rest. It will change throughout the month and is affected by ovulation, which makes it increase by 0.5°F to 1°F (0.25°C to 0.5°C).This temperature difference is very minute. So, it’s better to use Basal body thermometer.
- There is also a tendency for the body temperature to be lower in the days before ovulation and higher afterwards. This divides your menstrual cycle in two, with a peak in the middle when you ovulate.
The phase before ovulation is the follicular stage and the stage after is the luteal stage.
The higher temperature is caused by oestrogen. After ovulation, there is a rise in progesterone, which is released from the corpus luteum that develops from an ovarian follicle.
If a pregnancy occurs, the corpus luteum takes on a temporary role of maintaining pregnancy hormones until the placenta takes over. But if there’s no pregnancy, the corpus luteum breaks down and disintegrates at the same time as menstruation, when your BBT rises again.
Your cycle may be the same each month or might vary wildly. By charting your temperature, you can get to know what is happening during your cycles and also see whether your luteal phase is long enough to sustain a pregnancy.
Secondary Ovulation sign
- Light spotting
- Slight pain on one side of the pelvis
- Breast tenderness
- Abdominal bloating
- Increased sex drive
- Heightened sense of smell, taste or vision
These are the sign many women notice during their ovulation time. But it varies from women to women.
Ovulation prediction kits-
You can buy ovulation prediction kits over the counter (OTC). These kits test the hormone levels in your urine to find out when you’re at your most fertile. |
Lower Back Exercises & Stretches for a Strong, Pain-Free Back
8 minute read
The numbers of chronic lower back pain had skyrocketed over the last few decades, with an estimated 80% of Americans experiencing some form of back pain. After arthritis, back pain is the next major cause of disability in the United States. Not only does this mean time off work and missed family events but also large medical bills.
It may not seem like good news but the cause of most back pain issues result from mechanical issues rather than from serious illness. This means there are preventative measures you can take to keep your back healthy and to avoid all that unnecessary pain.
Once you confirm diagnosis with your doctor that your back pain is mechanical and not the result of injury or disease, then the right exercises and stretches will return strength to your back.
Lower back pain can be caused by a bulging disc or from repetitive movement that causes pinched nerves. Additionally, tight or weak muscles can cause persistent pain, especially larger muscle groups such as the hip flexors.
Some injuries will require a medical professional such as a chiropractor or spinal physician but others related to weakened muscles can be treated at home with exercising and stretches.
The most common back injuries are listed below:
Degenerative disc disease: The spinal discs that act as cushions between the vertebrae naturally degenerate over time. This pain is felt in the cervical spine or lower back and is often related to osteoarthritis or a herniated disc.
Pinched or compressed nerve: When the nerve becomes pinched between ligaments, tendons or bone, you can experience pain. Typically this occurs after repetitive movements or being in a particular position for a long period of time. Treatment can vary from physical therapy to surgery.
Muscle or ligament strain: This occurs often when muscles are stretched too far and can be caused by lifting a heavy object, extreme physical exertion or overextending your lower back. These actions weaken your back muscles, which creates instability in the spine, causing pain. You usually treat this with anti-inflammatory medications, rest, and light stretching.
Lack of exercise: Our bodies were designed to move and when we don't, our muscles and joints become weak, causing pain to develop over time. In this case, the right exercises and stretching can restore strength to your lower back.
Best Lower Back Exercises
Most exercises, when performed correctly, actually work the back and your core. It is important to perform all movements properly with the correct posture and a tight core. You want to do this not only to get the most effective results but also to prevent injury during your workout.
For the fullest and most effective lower back workouts you want to be sure you are targeting the following muscle groups:
♦ Erector spinae
♦ Latissimus dorsi
♦ Hip flexors
Effective Lower Back Exercises To Try
Arch hold: Start on your belly, keeping your legs straight and arms overhead. Lift your legs and chest at the same time to create a banana shape and hold for 30 seconds.
Swimmer kicks: From the arch hold position, make small kicks with your legs and arms. By completing 50 repetitions of this movement you add dynamics to the previous exercise.
Forearm plank: Start in a push-up position and drop down to your forearms. You want to drive your forearms into the floor as you pull your belly button towards your spine. Be sure to engage your legs and squeeze your butt to really work the muscles. Hold for a minute each time with an equal amount of time for rest in between.
Bird dog: From the plank position, keeping your legs and core tight, lift your right arm forward and lift your left foot from the ground. Return to plank position and then lift the alternate arm and leg. Alternate between the two for a minute and then rest.
Best Lower Back Stretches
You need to remember that as important as strength is, without mobility and flexibility your back is still susceptible to injury and pain. Tight muscles shift joint alignment, which can pinch nerves. This is where the right stretching comes in.
With any of the ideal stretches below, try to hold each pose for a minute at least and no more than two. Remember only hold a stretch to the point where you feel it working and never beyond otherwise you risk pulling the muscles.
Seated forward fold: Sit tall with your legs extended out in front of you. Curl your toes towards your shin. Reach your hands up and fold inward towards your legs You should feel the stretch in the back of your legs and lower back.
Cat and cow: Begin on your hands and knees. Arch your back and draw your chin into your chest; the idea is to look like a Halloween cat. Then, slowly draw your belly button in towards the floor, pulling your shoulder blades together and lifting your head. Now, you should look like a cow. Alternate between the two poses, breathing slowly for ten times each.
Seated forward fold: Sit up tall in a comfortable crossed leg position. Reach your arms overhead and bend inward, bringing your hands to the floor in front of you. Hold for a minute. Cross your legs the other way and repeat.
Reclined spiral twist: Lie flat on your back with your legs extended. Bring your right knee to your chest, shift your hips to the right,and let your right knee fall to the left. Allow your body to relax into the twist and extend your right arm to the right. Hold for a minute and then, switch sides.
Stronger Back; Better You
Incorporating the exercises and stretches discussed can help to strengthen your back and core muscles. The benefits of a strong, healthy back extend beyond just reducing potential injury and pain.
1. Improved posture: The muscles that form a column along the spine, known as the erector spinae, help the abdominal muscles, hip flexors, and oblique muscles to hold the body in an upright position. When you exercise to strengthen these muscles, your posture improves, as does your stability.
2. Better balance: Balance is a critical tool for humans. Sports such as gymnastics and CrossFit® demonstrate the advantages of having a strong core. The balance for this comes from having a strong back.
3. More lean muscle: Muscle weighs more than fat. To maintain health muscle requires fuel. So, strength training and muscle building require protein, making it important to combine exercise with nutrition to get the right balance..
4. Less back pain: By incorporating exercise into your life, you can strengthen weak muscles, which not only reduces pain, but improves your overall health.
The Bottom Line
The dynamic engineering of our bodies exists for movement. The interconnected system of bones, ligaments, muscles, and tendons is nothing short of amazing when it comes to efficient movements.
The stronger your back is, the less pain you are likely to suffer as you age, short of serious injuries. Not only is pain reduced, but the stability of your spine, your balance and posture are all improved. Essentially by taking care of your back, it can take care of you.
Read Next >>> The Inflammation Factor: The Heart of the Joint Health |
Analysis of "The Highwayman" written by Alfred Noyes
Extracts from this essay...
CRITICAL ESSAY âTHE HIGHWAYMANâ The title of the poem is called The Highwayman written by Alfred Noyes. This poem is set in the past during the time of King George. The main characters in this poem are The Highwayman and Bess The plot of this poem is about two lovers who encounter and meet death in unfortunate and unforeseen events. These events are triggered by a character called Tim the ostler depicted by the poet as an extremely jealous and stupid lover of Bess. The two lovers risk their lives for each other. This poem is a tragic tale of love, jealousy and bravery. The poet uses a number of techniques to create action, drama, passion and tension. In the first stanza the poet focuses on setting the scene with particular attention given to the mood and atmosphere creating both action and tension. Firstly, he uses âmetaphorsâ to do this such as, âtorrent of darknessâ, âghostly galleonâ and âribbon of moonlightâ to help create a vivid image of mystery,â coldness and death. The poet creates the connectedness between atmosphere and mood with the horrid deaths of The Highwayman and Bess. This is evident as further on in the poem, â⦠death at every windowâ, suggests that there was no hope for Bess.
The poet further helps us take on each of the characters in role making us see their perspective more clearly. This helps the reader to make up their own decisions about each of the characters. In the end, The Highwayman lived a violent life and died a violent death which he deserves. Also because of him the landlordâs daughter had an unfortunate violent death too. They had love for each other and because of Bessâs loyalty to The Highwayman, she sacrificed her own life. The repeating stanzas at end gives the reader the sense that although their lives have ended horridly their love lives on forever. Notes notes notes Another technique the poet uses is his choice of adjectives such as âgusty treesâ, âcloudy seasâ and âpurple moorâ adding effective detail to imagery. He also makes reference to âfrosty silenceâ and âechoing nightâ The poet continues to use metaphors throughout the poem. In stanza four, âhis eyes were hollows of madnessâ and âthe road was a gypsyâs ribbonâ¦â in the seventh stanza continues to maintain a sense of suspense and thrill. The repeated use of the word âmoonlightâ throughout plays a significance part to linking not only with the atmosphere, mood or setting the scene but also with death and sorrow. These seem to be intertwined.
The Highwayman comer riding, riding. âThis suggests that the Highwayman was riding up to the old inn door. Riding, Riding, Riding. This suggests that the Highwayman was riding on his horse for an extremely long time. The Highwayman was coming nearer and nearer to Bess. Her face shined as a sign of danger. She held the gun in her hand and pulled the trigger and warned him with her death. âMoonlight, moonlight.â This suggests that Bess was moving her fingers in the moonlight. Her musket destroyed the moonlights light. When the Highwayman found out that Bess was dead, he was riding on his horse and chasing after the troops he was consumed with grief and rage. He held up his sword to attack them, even though he knew that they were going to kill him. âHighwayman, Highwayman.â This suggests that the troops shot the Highwayman at the highway. Down like a dog suggests that the troops had no respect for him, by chasing after him, and shooting at the Highwayman. It suggests that the troopâs intention had been to shoot the Highwayman and not to let him live. Repetition helps me to effect, either to get a point across, emphasize something, or signal distress/tension, but it depends on what is being repeated.
Found what you're looking for?
- Start learning 29% faster today
- Over 150,000 essays available
- Just £6.99 a month
- Over 180,000 student essays
- Every subject and level covered
- Thousands of essays marked by teachers |
Cyberbullying is bullying that takes place using electronic technology. As communication technologies rapidly advance, cyberbullying has become a huge area of concern in most schools. The National Crime Prevention Council reports that cyberbullying is a problem that affects almost half of all teens. In this module, students will learn how cyberbullying is different from bullying and how to prevent it from happening.
- Discuss 3 ways cyberbullying is becoming a problem
- List 8 ways parents can help prevent cyberbullying
- Discuss 5 ways schools can prevent cyberbullying
- List 6 feelings people being cyberbullied feel |
As the world commemorates the centenary of WWI, Watani here honours some unsung war heroes: the warhorses. We commemorate the Englishwoman who cared for them and gave Egypt her first hospital for animals, The Brooke. This year, The Brooke marks 80 years in service of working animals in Egypt.
WWI was long over, but in 1930 the streets of Cairo still held one especially painful vestige of the war. It so moved one woman that she resolved to take action. What so horrified Dorothy Brooke when she arrived in Cairo with her major-general husband was to see broken down horses reduced to “scraps of skin and bone” labouring on the streets, and to learn that these “walking skeletons” were ex-cavalry horses of the British, Australian and American forces in Egypt during WWI. The horses had been shipped from Britain to serve in the war and, when the conflict ended in 1918, “were sold into a life of hard labour in Cairo”.
Appalled at the condition of the animals Mrs Brooke, herself a horse lover and an accomplished equestrian, promised she would do her best to save them from this life of hardship. She wrote a letter to the Morning Post, later the Daily Telegraph, appealing for funds to save the horses. Her letter was published on 16 April 1931 and drew a generous response from readers, who raised today’s equivalent of £20,000 “to help end the suffering of these once proud horses”.
Mrs Brooke set up a committee that bought 5,000 of the horses. Most were old, emaciated and in the final stages of collapse, and many were humanely and peacefully put down. She did not stop there, however. She saw that much needed to be done for the thousands of suffering equines in Cairo, and in 1934 she founded the Old War Horse Memorial Hospital to provide free veterinary care for the capital’s working horses, mules, and donkeys. The Brooke Hospital for Animals was born.
Last October the Brooke Hospital for Animals celebrated its 80th anniversary. The Brooke, as the UK-based organisation, is registered in Egypt as a non-governmental organisation (NGO) dedicated to improving the lives of working equines.
The anniversary celebrations began with a tribute at the Cairo Commonwealth Cemetery, where in 1955 Dorothy Brooke was laid to rest at her husband’s side. The ceremony was attended by most of the hospitals’ doctors and staff members and by this Watani reporter, who added his own bouquet of flowers to those on the grave.
The guests met hospital staff from Cairo and Brooke branches nationwide, among whom were a number of retired members. Also present were Dorothy Brooke’s grandchildren Richard and Sarah Searight, who have campaigned tirelessly for the organisation, and members of the Board of Directors of the Brooke Hospital for Animals in Egypt: board chairman Sherif Foda and treasurer Muhammad Foda. Other board members include Yasmine Shaarawi, daughter of Princess Ferial and granddaughter of Egypt’s last reigning monarch King Farouq, and Brigadier Muhammad al-Hossiny.
Award for senior vet
The guests were then treated to a tour of the hospital guided by the former senior veterinarian Dr Salah Wahib, who in 2010 received an award for the most inspirational vet from Camilla, Duchess of Cornwall. The duchess, a staunch supporter of animal welfare, is president of The Brooke’s international organisation.
All animals brought to the hospital are treated free of charge in several adjacent buildings that provide the necessary areas for treatment, including a maternity unit. If the animal needs extensive treatment or special care it is admitted to the hospital where it stays for as long as the treatment requires. Medical care, food and boarding are all provided.
The care given to each animal differs according to its condition. If a horse is very weak it is placed in a special sandy area to ensure it is comfortable. If the horse has an injury or wound it is placed in an area where the wound can be disinfected with warm water. If it suffers from seizures that render it violent, the horse is placed in a separate ward. In every case the horse, mule or donkey receives full veterinary care and follow-up by the hospital’s trained staff. There is even a farrier and a dental unit where the teeth can be floated if needed.
Dr Wahib recounted some of the most amusing incidents of his thirty-odd years of service at the hospital. “I can’t forget when once, after a donkey was treated at Brooke Hospital and discharged, it came back to us on its own. After a while its owner came running up asking about his donkey. This proves the animal longed for the place where it received not only treatment but also care and kindness. I also remember that when we looked after the animals in the Zabbaleen (garbage collectors’) neighbourhood in Cairo, the young children who drove the donkey carts in the early hours of the morning often fell asleep while driving. And believe it or not, the donkeys knew their way around very well and always walked in the right direction until the young drivers woke up.”
Another incident he recalled was when a horse’s tongue was almost completely cut off by a sharp piece of glass in its feed. “Surgery was required to reattach the donkey’s tongue, but the owner insisted that surgery was useless and he preferred that we glue it back with adhesive material. A huge argument resulted between the owner and myself in an attempt to convince him that his idea was not doable. Finally, he was convinced and we performed the surgery.”
Prevention over cure
Dr Wahib’s advice to animal owners is that, first and foremost, prevention is better than cure. “The animals must be given the proper vaccines to immunise them against disease and medication to combat intestinal parasites,” he says. “An animal’s wounds should be adequately treated, especially those in the neck area and the saddle sores that result from the use of ill-fitting or old saddles. Of course, cart wheels must be regularly oiled to ease pulling. Horseshoes must be rigorously checked and cared for, because they protect the animal’s hooves just as shoes shield the feet of humans. The old saying ‘no hoof, no horse’ hints at the vital importance of horseshoes.”
The hospital made the first discoveries of equine influenza in Egypt after some racehorses were imported from abroad. “When I visited the royal mews in England,” Dr Wahib said, “I had the chance to examine a few cases of equine influenza. After my return to Cairo it was very easy for me to recognise it, especially since the symptoms are very similar to human flu: runny nose, cough and high fever leading to pneumonia and finally death.”
It is of the utmost importance that working animals have their four legs in perfect condition. X-Rays are very important for diagnosing broken or fractured bones in the animal’s ribcage, pelvis or limbs. It is not possible to place plates and screws to fix a horse’s bones because they cause health complications that lead to death, so an equine with a broken bone is usually euthanised. In such cases the hospital gives its owner a sum of money to help him buy another animal.
Today The Brooke has branches in several Egyptian towns, especially where working animals are needed to perform specific tasks. In Alexandria, for instance, working animals are used in the port to transport merchandise; in Luxor they are used to pull tourist carriages.
“In the 1980s we had an ambulance to move sick animals to hospital. But now we use modern equipped vehicles that allow our vets to go to the sick animal and treat it on site. We also talk to owners to raise their awareness of equine welfare practices. The mobile clinic teams include not only a vet but also a farrier and saddler,” Dr Wahib said.
Recruiting new staff is difficult since there is no vocational training for veterinary assistants in Egypt, so the charity hires graduates from secondary schools of agriculture.
“We must also remember that animals, too, have rights. Among the most basic is that animal owners should allocate at least 10 per cent of their daily income for their animals and buy balanced animal feed that includes beans, hay, clover and barley. People must not use violence with their animals and should never beat them. In addition, one must not burden the animals with too heavy loads because this would certainly cause lethal bone fractures,” Dr Wahib said.
The Suez intervention
The hospital is still operating at the same site on which it was built 80 years ago. The first board of directors consisted mainly of British nationals living in Egypt, so it was in an especially vulnerable position during and in the wake of the 1956 Suez War when Britain battled Egypt and many Britons had to leave the country. Nasser Hosny, the hospital’s General Manager, said The Brooke Hospital survived thanks to the wisdom of those in charge who decided to ‘Egyptianise’ the hospital’s organisation and appoint a new board consisting solely of Egyptians while nevertheless keeping the donations from the UK as a main source of funding. In 1981 the BBC aired a documentary about the hospital and donations skyrocketed. The hospital now operates in cooperation with several local research centres, schools of veterinary medicine, government institutions and NGOs. “The hospital staff must take credit for this success; their will and their belief in their mission makes all the difference,” he said.
With massive donations received every year, the British-based international charity has opened other hospitals in the four corners of the world. The working animals of Jordan, India, Pakistan, Guatemala, Kenya, Ethiopia and Nepal also enjoy the services provided by The Brooke. A new office in the Netherlands was established a few years ago and shares in sending donations to the hospitals around the world.
Dr Emad Naoum, Deputy to the general manager and head of the veterinary services and Mercy for Animals organisation, explained that the hospital’s main purpose was to alleviate the sufferings of the working animals, which represent the sole source of income for many underprivileged households. “If an animal is healthy, it can work more and generate better income for its owner,” he said. “This is why the hospital pays special attention to raising the awareness of animal owners.
“We also try to raise the awareness of the entire society towards compassion for animals. Our vets visit children in schools and talk to them. The Brooke cooperates with local NGOs nationwide to provide veterinary services for working animals.”
The Brooke is the largest institution for equines in Egypt, and the number of beneficiaries from its services from 1934 to 2013 throughout Egypt has reached 39 million.
A 2008 report issued by the General Authority for Veterinary Services says there are more than 1.2 million working equines in Egypt. Most of them work under very harsh conditions which threaten their health, in addition to lack of care and proper treatment. Most are used to pull carriages or carry heavy loads, from garbage collection to the brick kilns in Helwan. These animals often suffer from overburdening, beat, dehydration, exhaustion, stress, lameness and hoof problems as well as contagious diseases such as equine influenza and skin infections.
Recent estimates place the number of equines living in the areas covered by The Brooke’s veterinary services at about 227,000. These animals need not only veterinary treatment but also good nourishment and care, all services provided free of charge by Brooke staff.
This is the letter Dorothy Brooke sent to the Morning Post
“There have been several references lately in the columns of The Morning Post as to the possibility of raising a memorial to horses killed in the War. May I make a suggestion?
Out here, in Egypt, there are still many hundreds of old Army Horses sold of necessity at the cessation of the War. They are all over twenty years of age by now, and to say that the majority of them have fallen on hard times is to express it very mildly.
Those sold at the end of the war have sunk to a very low rate of value indeed: they are past ‘good work’ and the majority of them drag out wretched days of toil in the ownership of masters too poor to feed them – too inured to hardship themselves to appreciate, in the faintest degree, the sufferings of animals in their hands.
These old horses were, many of them, born and bred in the green fields of England – how many years since they have seen a field, heard a stream of water, or a kind word in English?
Many are blind – all are skeletons.
A fund is being raised to buy up these old horses. As most of them are the sole means of a precarious livelihood to their owners, adequate compensation must, of necessity, be given in each case. An animal out here, who would be considered far too old and decrepit to be worked in England, will have before him several years of ceaseless toil – and there are no Sundays or days of rest in this country. Many have been condemned and destroyed by the Society for the Prevention of Cruelty to Animals (not a branch of the RSPCA), but want of funds necessitates that all not totally unfit for work should be restored to their owners after treatment.
If those who truly love horses – who realise what it can mean to be very old, very hungry and thirsty, and very tired, in a country where hard, ceaseless work has to be done in great heat – will send contributions to help in giving a merciful end to our poor old war heroes, we shall be extremely grateful; and we venture to think that, in many ways, this may be as fitting (though unspectacular) part of a War Memorial as any other that could be devised.”
Signed – Dorothy E. Brooke
3 December 2014 |
How Type 2 Diabetes Affects Eye Health: Warning Signs and More
6 minute read
Diabetes is a very serious problem in the United States. According to the American Diabetes Association, in 2015, 9.4% of the population had diabetes, but the percentage of Americans aged 65 or higher was at 25.2%.
Type 2 diabetes is the one that primarily affects adults. It’s not only a growing problem, but the longer you live, the better your chances are of developing this disease.
This report takes a deeper look at type 2 diabetes and how it affects your eye health.
What Causes Diabetes
Type 2 diabetes is typified by high insulin resistance, causing the body to improperly manage glucose (sugar) levels in the blood. It often causes a rollercoaster effect of insulin in the body and for some this exhausts the pancreas and less and less insulin is produced.
Your odds of getting type 2 diabetes increase as you age, but obesity, poor diet, and lack of physical activity can bring about this disease at any age, even childhood.
Most people know that having diabetes means watching your blood sugar or having to deal with health complications. Those complications can include kidney damage, heart disease, stroke, and nerve damage in the hands and/or feet. Another area of the body that’s particularly susceptible to the ravages of diabetes is your eyes.
How Diabetes Can Affect Your Eyes
There are several different ways that diabetes can cause eye complications. All of the following diseases can cause severe vision loss and even blindness.
Your vision is just one reason that regular blood tests should be performed and blood sugar levels need to be checked. It’s also vital that annual eye appointments be made to track vision for any complications.
Diabetic retinopathy is a condition that affects the eyes of someone who suffers from diabetes. When someone has a regularly elevated blood-sugar level in the blood vessels of their retina, damage is caused.
Diabetic retinopathy begins slowly and can take a while to even notice vision changes. Not all initial symptoms are the same, but you may experience the following:
♦ Fluctuation between clear and blurry vision
♦ Floaters across your vision
♦ Poor night vision
♦ Dark or “empty” areas in your vision
♦ Faded colors
If left untreated, diabetic retinopathy can lead to blindness and is estimated to be the most common cause of vision loss among people with diabetes.
If caught in the earliest stages, treatment other than keeping your blood sugar in check, might not even be necessary. If not noticed until later, there are several different forms of treatment that can halt the progress and may even be able to bring back some vision loss.
Diabetic Macular Edema (DME)
Diabetic macular edema is actually a complication that arises from diabetic retinopathy. It’s the swelling of the macula of the eye that is caused by a build-up of fluid. The macula is responsible for the vision directly in front of you, which is crucial for reading, recognizing faces, and driving.
As mentioned, DME appears in people who already have diabetic retinopathy, but they might not be aware of it yet. DME is so common for people that have diabetic retinopathy that about half of them develop it.
DME first presents with blurring in the center of your vision. It may be noticed by the patient or it can be detected during a comprehensive dilated eye exam, which should be performed every year for people with diabetes. Further tests may be required to give a complete diagnosis of the eye.
Because DME presents with diabetic retinopathy, the treatment will follow that of diabetic retinopathy. There are also a few different therapies that can be used specifically to treat DME.
People with diabetes can develop cataracts when excess blood sugar clouds the lenses. Cataracts are fairly common and typically related to aging. Because your chances of getting diabetes increase with age, as do cataracts, it’s believed that more than half of all Americans either have cataracts or have had cataract surgery by the age of 80.
Controlling blood sugar is again key to protecting the lens of the eye from cataracts. But cataracts are not strictly a diabetic disease; they can occur in people who have no problems with blood sugar or insulin. A lens with cataracts can be affected in two different ways: clouding or a yellow-brown discoloration.
Cataracts can be detected in your annual eye exam. Early treatment might include new glasses.
Cataract surgery is typically not performed until the vision loss interferes with daily living. Cataract surgery is one of the safest and most common operations in the United States, and for approximately 90% of all cases, the surgery not only cures the cataract but leaves the patient with better vision afterward.
Glaucoma is actually a collection of diseases that can affect the eye’s optic nerve. This can lead to irreversible loss of vision. While glaucoma can occur in people who do not have diabetes, a diabetic person’s chance of getting glaucoma is double that of someone else.
The symptoms, if there are any, can include patchy blind spots, tunnel vision, headaches and/or eye pain, blurred vision, and light halos.
Treatment for glaucoma includes eye drops, pills, laser surgery, traditional surgery or possibly the use of more than one of these treatments in conjunction. Unfortunately, untreated glaucoma eventually causes blindness, and in about 15% of treated cases, blindness still occurs.
The Bottom Line
Diabetes is a very common disease in the United States, with type 2 diabetes being the most prevalent form.
When there is too much sugar in the blood a number of different problems can occur throughout the body. The eyes and vision are particularly vulnerable to diabetes, and several different eye diseases can develop.
There are treatment options for all of these diabetic eye complications, but early detection is essential. If you have diabetes, make sure that your annual eye exam is part of your healthcare routine. |
12 April 2011
Researchers have identified the mechanism by which some antidepressants stimulate the formation of new brain cells, an insight that could lead to improved drugs.
Antidepressants combat depression by increasing levels of serotonin in the brain. But they can also help by stimulating the formation of new brain cells, a process called neurogenesis, which plays an important role in memory.
Depressed patients are thought to release greater amounts of glucocorticoid stress hormones, such as cortisol, which reduce neurogenesis, causing symptoms such as impaired memory and low mood. Previous research has shown that antidepressants block the effect of the glucocorticoid hormones and restore neurogenesis, but the mechanism by which this happens was unknown.
Now, scientists at King's College London in the UK have found that antidepressants affect neurogenesis by interacting with the glucocorticoid receptor, leading to expression of key genes needed for stem cells to differentiate and proliferate. The group exposed cultures of human stem cells from an area of the brain called the hippocampus to a range of antidepressants, including sertralene, which is marketed as Zoloft by Pfizer.
'We've seen that the glucorticoid hormones and the antidepressants activate the same protein, called the glucorticoid receptor,' explained Christoph Anacker, who led the study group. 'But they activate this receptor in very different ways'. Glucocorticoids decrease neurogenesis, whereas antidepressants increase it.
The researchers say that their work provides a model for depression in the laboratory and a platform for drug discovery to develop antidepressants that are more effective and lead to fewer side effects. 'It demonstrates that antidepressants have effects which go beyond simply increasing the transmission of serotonin in the brain,' says Daniel Smith, an expert in clinical psychology at Cardiff University, UK. 'Current antidepressants have quite a broad range of effects and interact with a large number of different receptors in the brain.' The work could lead to new drugs that target the glucocorticoid receptor more specifically, he adds.
By 2020, depression is expected to be the second most damaging disease globally as measured across a range of indicators. One in five women and one in 10 men are likely to experience the disease at some point. |
Eye color case study answers, the genetics of eye color
This sort of rare-color advantage has been reported in humans. Eye color fully matures in infancy and remains the same for life.
- Genetic determination of eye color
- Browse Our Products
- Understanding Genetics
- Eye Color and Genetics | CooperVision
- Frost: Why Do Europeans Have So Many Hair and Eye Colors?
- A Handy Guide to Ancestry and Relationship DNA Tests
- The Claim: Eye Color Can Change as We Age - The New York Times
- Eye Color and Genetics
- 7 Things That Can Change Your Eye Color
Sturm, R. Create and interpret Punnett squares for two unlinked genes.
Genetic determination of eye color
Genetica The more pigment, the darker the eye. Andrews University Scotland.
- Read on to learn the answers to these questions and more about eye color and genetics.
- More Than Meets the Eye - National Center for Case Study Teaching in Science
- Sex chromosomes & X-linked inheritance (article) | Khan Academy
- How do genes determine eye color?
- More Information.
That is exactly eye color case study answers you see happening in the kids from the third generation. Thus, some kind of non-random process seems to have targeted hair and eye color per se, that is, as visible characteristics.
Browse Our Products
For the same brunette, preference increased significantly from the first to the third series, i. Is hair color less diverse in such populations than in Europeans because sexual selection has been less intense or has acted over a shorter period of time? But the genetics of eye color is more complex than typically assumed.
Even in the case of two blue-eyed parents, it may be almost certain they would have a blue-eyed child, but because eye color is influenced by multiple genes, it is possible for a blue-eyed couple to have a brown-eyed child.
Each gene has the instructions for one small part of you.
The most extreme OSR imbalance occurs among hunting peoples of the "steppe-tundra," where almost all consumable biomass is in the form of highly mobile and spatially concentrated herbivores such as caribou, reindeer, or muskox. On the other, men are less polygynous because they bear almost the full cost of feeding their families in a habitat that offers women little opportunity for food gathering.
Please try again later. Familiarity leads to female mate preference for novel males in the guppy, Poecilia reticulata. Again, we can get around these things by looking at lots of family trees.
Eye Color and Genetics | CooperVision
The grandmother has blue eyes and you only see this trait showing up again in the grandchildren. Trends in Genetics Prospects were better for continuous and substantial human settlement on the European portion of this ecological zone.
The black circles and squares represent people with red hair. This isn't possible unless brown is dominant over blue.
Because of this, dominant alleles almost always win over recessive ones. For example, United Arab Emirates UAE has been operating an iris scan system since at all ports of entry to screen for expellees.
Our eyes are the most expressive parts of our body, and their color is one of our most distinguishing characteristics. Both are located on human chromosome Evolution and Human Behavior And how do blue-eyed couples give rise to brown-eyed offspring, as has been reported?
Frost: Why Do Europeans Have So Many Hair and Eye Colors?
The levels of melanin generally remain the same throughout life, but a few things can change them permanently. This means you have two copies of most of your genes. On the other hand, when the blue-eyed male in the third generation has kids with a blue-eyed woman all their children have blue eyes.
A potential mate will respond not simply to a bright color but also to a rare one that stands out from the crowd. Click on the image to see if you guessed right.
In general, brown is the most common eye color, followed by blue, grey and then green. But in a small percentage of adults, eye color can naturally become either noticeably darker or lighter with age. But first, a little background Less productive was the Asian steppe-tundra east of the Urals. For others still, this color diversity arose through random factors: Invalid email address.
In other words, it is possible for these parents to have all blue eyed kids. Is red hair dominant or recessive?
A Handy Guide to Ancestry and Relationship DNA Tests
Du, F. James, N.
Describe ways in which epigenetics can create phenotypes in children not present in the parents. As we'll talk about in a little bit, this particular case is not a for sure thing. However, you can only have blue eyes if you are bb.
The Claim: Eye Color Can Change as We Age - The New York Times
Steppe-tundra is now reduced to fragments along the northern fringes of Eurasia and North America. Genetic determination of eye color It was originally thought that eye color was a simple Mendelian trait, nonprofit ceo cover letter sample it was determined by a single gene, with brown being dominant and blue recessive.
But how? Both parents in the second generation have brown eyes but must carry the recessive blue allele. In other words, a dominant allele will always allow a specific trait to show up no matter if we have two dominant copies BB or just one Bb.
You get one copy of each gene from each parent.
Eye Color and Genetics
Brooks, R. What we call eye color is actually the color of the iris.
So based on that information let's have some fun filling out the family tree: Perhaps there was some gene flow between the two groups, psychopathology case study questions certainly not enough to account for the large number of Europeans with neither black hair nor brown eyes.
These rules only work if there is a big family history that always supports it. Heterochromia is a condition in which the color of one iris is different or partially different from the other eye. You must select a newsletter to subscribe to.
7 Things That Can Change Your Eye Color
What determines eye color is the pigment melanin. In this family the grandparents have 3 children 2 daughters and a son. Martin, and R. This diversity baby sitter cover letter a maximum in an area centered on the East Baltic and covering northern and eastern Europe. Eye colour: Human Molecular Genetics Bringing it all Home OK, so from this we can figure out that brown is dominant over blue. |
The Challenge of Teaching Soft Skills
The Soft Skills Challenge
I first became aware of the challenge of teaching soft skills while I was at the FBI Academy in 1995. I was working for a Johns Hopkins University think tank which supports DoD and NASA technology and we were identifying big challenges where new technologies could be used to help law enforcement and counterterrorism personnel. In our discussions, it was pointed out that a big challenge was to teach special agent trainees how to conduct a criminal investigation, a fundamental Bureau soft skill. A key component is to teach people to say things that are appropriate for the situation, but may not be natural to say; that is, to interact with people in a way that is new. At that time, the FBI’s training consisted of about 40 hours of classroom training, working with mentors, followed by more classes, and more mentors.
Training soft skills is challenging regardless of the discipline, whether it is sales or suicide intervention, leadership or addiction counseling. A technique used by addiction counselors is called Motivational Interviewing or MI. Research has proven this technique to be very effective, but like other soft skills, MI requires saying things that may not be natural or intuitive for counselors. Extensive research shows that MI is difficult to train. Specifically, counselors can read up on the techniques and take workshops, but the research shows that they perform the same six months after the training as they did prior to the training. Unfortunately, trained counselors perceive they are applying the MI techniques properly. People successfully learn MI by taking the workshops and then recording real counseling secessions and having independent experts review the recordings and provide feedback. Practice and extensive feedback appears to be the key to success.
In addition to mentor programs and careful review of recorded work to provide feedback, many organizations, including Achieve Global and Integrity Sales, address the challenge by providing follow up training after the basic training is complete. Still there is real concern that behavior changes do not last, and privately people have admitted that even with follow-on training, the change in behavior does not last. Training any skill requires learning the concepts, engaging in extensive practice, and receiving feedback. Is there a way to train soft skills that can combine the educational content of traditional methods, with the repeated practice and extensive feedback that make skills last, all using the internet? Simulation offers an approach.
Simulation for Teaching Soft Skills
The US government spends billions of dollars a year developing and training people using simulations. Industry also knows the value of training using simulations. A Boeing 747 pilot will spend hours practicing in a realistic flight simulator before ever flying a real plane. While trainees don’t experience the same G-forces, the experience must be realistic with the same visual sensations experienced in the 747. To successfully train soft skills the same principles must be applied, only rather than a plane, a person needs to be simulated and that person must seem real. There must be extensive feedback and the educational content at the user’s fingertips. As much as possible, the user should experience a wide range of situations.
My First Training System
The first simulation I developed meeting these requirements was for the FBI in 1998. [Reference 1] The simulated person was sometimes innocent and sometimes guilty of a crime, yet each play of the simulation was guaranteed to be different. The simulation included a model for emotions to replicate longer-term changes in rapport. Video was used to capture the subtleties in human behavior. The system was design to require trainees to think about what they should say as they went through the conversation as opposed to effectively being a multiple choice test, each time selecting the best one of five choices. When using the system, the agent trainees were in the boot camp stage of their training and were only asked to use a laboratory computer to play the system for a few minute. In spite of being sleep deprived, the trainees volunteered 6.5 hours on the system. This speaks to how engaging the simulation was in 1998. The more students played, the more their scores improved, but the question remained: were their skills really improving?
Simulation Training Efficacy
The question of efficacy remained until sufficient funding could be found for a formal research study on SIMmersion’s Alcohol Intervention Training System. Screening and Brief Interventions training was an integral part of the simulation training, while Referral training was not. In 2007, the School of Medicine and Public Health at the University of Wisconsin, Madison performed a study involving 100 healthcare providers as subjects, including MDs, PAs, RNs and forth year medical students. To start off, the subjects were tested for their skills in delivering alcohol screenings, brief interventions, and referrals using three different standardized patients to play the roles of someone who may be abusing alcohol. The subjects were scored on their initial abilities. Fifty subjects were then randomly assigned to the research group and given the opportunity to train and the 50 others were assigned to the control group. The subjects in the research group were provided with the simulation training system and shown how to install it. After six months, all 100 subjects returned and were again tested using three different standardized patient encounters. The research group showed significantly more improvement in their skills than the control group for screening, brief interventions, but not for referral. I was pleased to see that the simulation approach provided long-term changes in behavior.
Training soft skills will always be challenging since it requires people to change the way they communicate, and habits that have been developed over a lifetime. Other on-going research shows that simulations can be very effective if the technology provides educational materials matching the experience gained using the simulation, allows for repeated practice, and provides extensive feedback.
1) Own Einspahr; The Interview Challenge, FBI Bulletin, April 2000
2) Fleming, M., Olsen, D., Boteler, L., Stathes, H., Grossberg, P., Pfiefer, J., Schiro, S., Banning, J., & Skochelak, S. (2009). Virtual reality skills training for health care professionals in alcohol screening and brief intervention. Journal of the American Board of Family Medicine, 22(4), 387–398. doi: 10.3122/jabfm.2009.04.080208 |
View your list of saved words. (You can log in using Facebook.)
Rearing of fish, shellfish, and some aquatic plants to supplement the natural supply. Fish are reared in controlled conditions worldwide. Though most aquaculture supplies the commercial food market, many governmental agencies engage in it to stock lakes and rivers for sport fishing. It also supplies goldfish and other decorative fish for home aquariums and bait fish for sport and commercial fishing. Carp, trout, catfish, tilapia, scallops, mussels, lobsters, and oysters are well-known species raised through aquaculture.
Variants of AQUACULTURE
aquaculture or fish farming or mariculture
This entry comes from Encyclopædia Britannica Concise. For the full entry on aquaculture, visit Britannica.com. |
In total we can estimate the robot would be approximately 5-6 feet long, 4 feet wide, and 250 pounds. The robot’s design would be based upon a single person pontoon boat. The pontoons would allow space for a set of conveyer belts on either end of the robot. The robot would use a series of two conveyor belts made of stainless steel woven wire: the first conveyer belt to remove the aquatic vegetation from the water’s surface, and the second to move the vegetative material from the robot to the shore to be dumped in a manner which facilitates either proper decomposition or easy dumping in a portable container.
Paddle Wheels and Batteries
The robot would use two paddle wheels, one on either side of the robot. These wheels will have the ability to run in both reverse and forward directions to give the robot the ability to rotate around its own axis. A large 12 volt battery will be placed in the bottom of the craft, which would also serve as ballast for our top-heavy design. We will need to build an AC powered docking station to charge the robot when not in use.
Our robot will use a Raspberry Pi or Beaglebone as the controller, with software written in Java. To locate each robot, we will use the Piksi, an RTK (real-time kinematic) GPS made by Swift Navigation that is accurate within two inches. One GPS unit mounted on a base station will calculate ionospheric interference and transmit the data to the GPS on each robot. The communication between robots and the base station will use XBee pro radios, which have limited bandwidth but a range of 1.5 miles, which should allow all units working in a single body of water to use a central base station.
We will develop the software in phases, allowing our hardware to be tested early while more advanced navigation code can be tested on a functional robot.
Our first software phase will be basic joystick control. The drive code will be similar to the FIRST robots made by our robotics program, except it will detect motion using a compass and compensate for drift.
The next phase will consist of basic navigation around shorelines and the location of disposal sites. The layout of islands and other obstacles in a body of water will be recorded by manually driving the robot around each hazard and storing their locations into a grid. Each grid square will be one square foot and be occupied by either land or water. Two ultrasonic sensors, one facing downwards under the robot and one facing forward will alert it of additional hazards such as dogs or boats. At this phase, the robot will drive straight until it approaches a hazard, turn, and continue. While this will not perform intelligent or systematic sweeps, it will allow us to develop and test GPS and radio input. We will also record the positions of possible disposal locations, and utilize a capacitive proximity sensor to detect when disposal is necessary. It will approach these locations and orient itself using a compass. Once we are capable of building accurate map files and finding accurate GPS coordinates, we can begin development of a more advanced autonomous mode. This will involve grouping the grid squares into sections, and keeping track of the time since each section was last visited. The robot would then navigate to the desired section using a node graph and a simple path finding algorithm. Once there, the robot would perform a systematic sweep of the section before repeating the cycle. This would be effective assuming that all areas of the lake require an equal amount of attention. This, however, is not the case. Wind and water flow, as well as sunlight levels, affect the amount of vegetation buildup in each area of a body of water. Therefore, we will also develop a desktop application that will communicate with the robots, allowing users to select areas of lake for the robots to prioritize.
The final phase of development will involve collaboration between multiple robots operating in one area. The robots will communicate directly with each other, sharing a map of the area. Upon completing a task, a robot will find the area with the most urgent priority and proceed to clean that area, updating the shared map so that other units do not go to work on that area. |
Those of us who are getting on in years can remember a time when most people had no health insurance, when we simply paid the doctors or the pharmacies and went on our way, without giving it a second thought. I have especially painful memories of having a hospital bill of $50 for the treatment of a baseball injury back in 1949.
You have no idea how big $50 was for me at that time. It was the most money that I had ever paid for anything. But the bill got paid off, a few dollars at a time, over a period of months.
When and why did health insurance, paid by third parties, become widespread in the American economy? Like so many things that the government does, third-party health insurance grew out of problems created by previous government policies.
During World War II, the government imposed wage and price controls. This meant that employers who wanted to hire more workers were forbidden to offer higher wages to attract them. So employers started offering various benefits instead. One of these benefits was employer-paid health insurance.
Since these benefits were not taxed as income, and could be treated as a business expense by the employer, everybody seemed to be better off. But, long after the war was over and wage and price controls were gone, the idea that third parties ought to pay for health insurance continued on. Eventually the government itself got into the business of providing health insurance and now some politicians depict it as a scandal that not everyone has health insurance paid for by third-parties.
This might make some sense if third-party insurance was cheaper or better than insurance that each individual pays for directly. All the evidence is that it is just the opposite. When third parties pay, use of the insurance -- and of the medical resources that it pays for -- has skyrocketed beyond anything contemplated at the outset.
China, Britain and other countries have been surprised to discover that the costs of government-provided health care greatly exceeded the costs initially projected. But they should not have been surprised. It is one of the oldest and simplest principles of economics that people demand more when they pay a lower price, especially when that price is zero.
There is no fixed amount of medical "need." There are some minor ailments that you may either ignore or treat with some over-the-counter medication, perhaps with the advice of a pharmacist. There are some other ailments that might cause you to phone your doctor for advice but which neither you nor he considers serious enough for an office visit. And of course there are other things that require immediate and perhaps extensive medical attention.
When you are paying your own money, you sort these things out accordingly. But when someone else is paying, then the trivial and the urgent are both likely to find their way to the doctor's office. This means that both are likely to get less time and that patients with serious problems are the biggest losers.
Countries with government-provided health care have been known for shorter office visits, whether in the Soviet Union, Canada, Japan or elsewhere.
As bureaucratic hassles multiply under third-party payments, being a doctor becomes a less attractive occupation for some, leading to such things as earlier retirement or fewer young people going into medicine. More than half the doctors in Britain, for example, were not trained in British medical schools, but have been imported from other countries, including Third World countries where the training may not be up to the standards of British medical schools.
These are just some of the real-world problems of third-party payments and government controls that are passed over in utter silence by those who are pushing for "universal health care." Lurking just beneath the surface is the old lure of something for nothing.
What about the poor when it comes to health care? If this were the real issue, then money could be provided to take care of the poor. But here, as elsewhere, the poor are being used as excuses to fasten a whole system of controls on all of us. The left uses the poor as political human shields. |
tet·ra·eth·yl·am·mo·ni·um noun \ˌte-trə-ˌeth-əl-ə-ˈmō-nē-əm\
: the quaternary ammonium ion (C2H5)4N+ containing four ethyl groups; also : a salt of this ion (as the deliquescent crystalline chloride used as a ganglionic blocking agent)—abbreviation TEA
Seen & Heard
What made you want to look up tetraethylammonium? Please tell us where you read or heard it (including the quote, if possible). |
Developers Rushing Regulations Threaten Croatia’s Cave Creatures
According to cave biologists, many species of animals, millions of years old, could be wiped out by development in Croatia in advance of it joining the European Union.
Recent research has discovered that underground cave systems of the Balkans, especially Croatia, contain some of the most diverse cave fauna in the world. It seems that while other countries have rich fauna areas in rainforests or marine ecosystems, Croatia has its caves.
Home to ancient creatures such as spiders, millipedes, clams, sponges, scorpions and cave salamanders. These species adapted to living in caves over the past 10 million years after ice ages and deserts wiped out most other life above the ground.
With Croatia expected to join the European Union in just two years, and a backlog of road, rail and power projects in the queue after decades of communism and wars. Development is moving rapidly.
One of the biggest and most biologically abundant caves in the Balkans, known as “Vilina Spila” or Fairy Cave is a part of a new hydro-electric plan, which involves sealing the cave with concrete and using it to store water.
It is believed by many environmentalists believe that because European Union rules would never allow developments like the one for Fairy Cave to go ahead, developers are in a hurry to get their projects started now, before Croatia becomes a member state.
Europe has many rules on habitat conservation and it is likely that large parts of Croatia would be protected once it becomes part of the EU.
Although the Croatia’s Nature Protection Directorate in their Ministry of Culture will do their best to protect the environment, they accept that some valuable caves will inevitably be lost in order to build important national infrastructure.
Because up to 41% of the country lies on a bed of limestone, whenever a tunnel is built there is an 80% chance of hitting a cave. |
Toxoplasmosis is called a parasitic disease caused by protozoa are representatives - coccidia.Another interesting fact is that women are diagnosed with this disease is almost twice as likely than that of the male part of humanity.By itself, this disease is not so dangerous to the human body and it is often confused with the common cold.But toxoplasmosis during pregnancy - is a different matter, since there is always a risk of infection of the child.
Toxoplasmosis in pregnancy: how do you get infected?The main source of infection are different kinds of animals, but particularly dangerous are the representatives of the cat family, including pets.Statistics show that almost every other cat is a carrier of cysts of Toxoplasma.These microorganisms thrive in the intestine of cats and excreted into the environment with feces.
Infection occurs when a pregnant woman's care and contact with the pet.In addition, placement of cysts in the body possibly together with unwashed vegetables, fruits, as well as raw
Toxoplasmosis in pregnancy: symptoms.The first sign of toxoplasmosis is considered to be a significant increase in the lymph nodes, as well as their pain when touched.In addition, pregnant women may slightly increase the temperature.The disease is accompanied by joint pain, body aches, skin rash, headache, dizziness, and sometimes loss of consciousness.When studies revealed an enlarged spleen and liver.
Toxoplasmosis in pregnancy: how dangerous it is?Toxoplasmosis during pregnancy is dangerous not for the mother's body, and especially for the unborn child.The risk of complications depends on the duration of pregnancy.
If the mother is infected before pregnancy, the chance of complications is reduced to a minimum, as in this time have already develop antibodies that destroy the infection.Those women who had once been ill with toxoplasmosis, produced proof lifelong immunity to that disease.
In that case, if the infection has penetrated into the mother's body during the first half of pregnancy, the likelihood of Toxoplasma penetrate the placenta is about 10 - 14%.If all the same fetal infection occurred, many doctors believe the disease is an indication for abortion.The fact that the toxoplasma primarily affects fetal brain neurons, and this leads to various deviations in development, including mental retardation.Development of disease at early stages of pregnancy leads to fading fetus or abortion.
If the infection of the female body was in the later stages of pregnancy, the risk of penetration of Toxoplasma in the child's body is greatly increased, as over time weakens the placenta and passes this kind of infection.But at the same time, developmental disorders are less frequent, because the fetus already has its own, albeit a weak immune system.
Toxoplasmosis in pregnancy: diagnosis and treatment.Typically, tests for the presence of infection or immunity to it is carried out immediately after the detection of pregnancy and occasionally during its planning.If the infection has occurred while carrying a child, a sick woman is assigned a number of studies, including blood and amniotic fluid.If abortion is not possible, or the woman waived, then used for the treatment of a certain group of antibiotics.
methods of prevention of toxoplasmosis.If a woman's body no antibodies to the disease, then it must be carefully monitor their health.During this period, it is not necessary to keep the house pets.All products before use should be carefully washed with boiled water.Meat should not succumb to a thorough and proper heat treatment. |
My advice on cognitive training for youth climbers parallels almost everything I’ve outlined above on training technical skills. Start with the most basic mental challenges—developing confidence and poise in climbing hand-over-hand up juggy vertical routes—and gradually introduce more challenging terrain that requires visualization of sequences and the vertical chess match of reading several moves ahead while on a climb. For some kid climbers the process is a natural and apparently simple one to learn, as they quickly solve climbing wall puzzles on the fly. Other kids will require more coaching input to help them solve the puzzle and “see” the moves to be performed. (A laser pointer is a must-have coaching tool for helping a young climber see and mentally rehearse a tricky sequence.)
For younger climbers—say, under age nine—it’s important to treat a climbing session as more a playground experience than a training session. A good coach will present climbing games that keep the focus on having fun, with learning of climbing skills and strategies a by-product.
Climbers between the ages of nine and thirteen can be presented with more complex instruction on critical cognitive skills such as mental rehearsal, visualization, arousal and fear control, risk management, and such. With good instruction, it’s within this age range that many youth climbers, usually those with several years of experience, come to put together the complex technical-and-mental puzzle that is hard climbing and suddenly break into the lofty grades of bouldering V8 and/or lead climbing 5.12 (or harder).
Given a growing mastery of the fundamental technical and mental skills, some youth climbers between eight and twelve are ready to be introduced to the challenges and joys of outdoor climbing. As with the introduction to lead climbing indoors, however, taking youths outside is a big step that should not be rushed. The earliest transitioners to outdoor climbing will be those youths whose parents are experienced climbers themselves—this way the parent can be responsible for making the tough calls on what climbs are safe or unsafe for a youth to attempt. For those kids without a climbing parent, it’s best to wait until at least twelve or thirteen to venture outdoors—and even then, to do so only in the presence of a mature, qualified climbing coach and/or instructor.
No matter if the outdoor climbing adventure is bouldering, toproping, or lead climbing, the game is pretty much the same as it is indoors, although the technical and mental demands are far greater on the infinite playing field of Mother Nature’s rock walls. Given a good coach or experienced parent, however, climbing outdoors offers extraordinarily rich environment for learning and experiencing the wonders of nature. The bottom line: Outdoor climbing can be nearly as safe as indoor, but there is certainly far greater potential for climber error, belayer error, objective dangers, and more to come into play. Proceed with caution.
Just as outdoor climbing will stretch a youth climber’s cognition in new and exciting ways, so will competition climbing—which for many youths whose parents don’t climb offers an excellent way to add a more difficult cognitive aspect to the game. Many climbing gyms hold local youth competitions, which offer a great introduction to the unique challenges and pressures of competition climbing. More formalized regional competitions for both bouldering and roped climbing are professionally organized and sanctioned by the governing body USA Climbing. Youths between the ages of eight and eighteen compete in five different age divisions for medals and to qualify for a national championship event. Learn more at USAClimbing.org.
Youth Training Articles by Hörst (please share with fellow coaches and youth climbing parents)
- Overview of Training for Youth Climbers
- Skill Development of Youth Climbers
- Age-Appropriate Strength Training for Youth Climbers
- Youth Climbing Injuries and Prevention
Copyright © 2000–2015 Eric J. Hörst | All Rights Reserved. |
Genetically Modified Food – GM Foods List and Information
Information provided by Mavis Butcher – Published: 2009-09-22
Information on Genetically Modified (GM) foods including a list of GM foods with DNA changes and the pros and cons of GM food today.
Genetic modification of food is not new.
For centuries, food crops and animals have been altered through selective breeding. While genes can be transferred during selective breeding, the scope for exchanging genetic material is much wider using genetic engineering. In theory, genetic engineering allows genetic material to be transferred between any organism, including between plants and animals. For example, the gene from a fish that lives in very cold seas has been inserted into a strawberry, allowing the fruit to be frost-tolerant.
By far the most common genetically modified (GM) organisms are crop plants. But the technology has now been applied to almost all forms of life, from pets that glow under UV light to bacteria which form HIV blocking “living condoms” and from pigs bearing spinach genes to goats that produce spider silk.
When did genetically modified foods originate?
Between 1997 and 1999, gene-modified (GM) ingredients suddenly appeared in 2/3rds of all US processed foods. This food alteration was fueled by a single Supreme Court ruling. It allowed, for the first time, the patenting of life forms for commercialization. Since then thousands of applications for experimental GM organisms have been filed with the US Patent Office alone, and many more abroad.
The first commercially grown genetically modified whole food crop was the tomato (called Flavr Savr), which was made more resistant to rotting by Californian company Calgene. The tomatoes were released into the market in 1994 without any special labeling.
In February 1996, J. Sainsbury and Safeway Stores in the United Kingdom introduced Europe’s first genetically-modified food product. A variant of the Flavr Savr was used by Zeneca to produce tomato paste which was sold in Europe during the summer of 1996. Following GM crops included insect resistant cotton and herbicide-tolerant soybeans both of which were commercially available in 1996.
In 2003, countries that grew 99 % of the global transgenic crops were the United States (63 %), Argentina (21 %), Canada (6 %), Brazil (4 %), China (4 %), and South Africa (1 %) and today the Grocery Manufacturers of America estimate that 75 % of all processed foods in the U.S. contain a GM ingredient.
Between 1995 and 2005, the total surface area of land cultivated with GMOs had increased by a factor of 50, from 17,000 km² (4.2 million acres) to 900,000 km² (222 million acres), of which 55 percent were in Brazil.
In the US, by 2006 89 % of the planted area of soybeans, 83 % of cotton, and 61 % maize were genetically modified varieties.
Today many Gmod crops are grown in North America. India has also come aboard the bandwagon in 2002 with a rapid and continuing expansion of GM cotton varieties.
“Genetic engineering is inherently dangerous, because it greatly expands the scope for horizontal gene transfer and recombination, precisely the processes that create new viruses and bacteria that cause disease epidemics, and trigger cancer in cells.” – Dr. Mae-Wan Ho
Genetically Modified Food Debates
Genetically modified foods, or GM foods, are often mentioned in the news lately. European environmental organizations and public interest groups have been actively protesting against GM foods since they were first created, and recent controversial studies about the effects of genetically modified corn pollen on monarch butterfly caterpillars have brought the issues of genetic engineering plants and animals to the attention of the public.
The benefits of genetically modified food crops include being able to breed disease resistant crops and herbicide tolerant strains. Genetically modified crops can also be made to include vitamins that may be lacking in some staple varieties.
According to the UK Greenpeace website – The introduction of genetically modified (GM) food and crops has been a disaster. The science of taking genes from one species and inserting them into another was supposed to be a giant leap forward, but instead they pose a serious threat to biodiversity and our own health. In addition, the real reason for their development has not been to end world hunger but to increase the stranglehold multinational biotech companies already have on food production. And – The simple truth is, we don’t need GM technology in order to possess future food security. Using sustainable and organic farming methods will allow us to repair the damage done by industrial farming, reducing the excessive use of fertiliser, herbicides and other man-made chemicals, and making GM crops redundant.
Many scientists argue that there is more than enough food in the world and that the hunger crisis is caused by problems in food distribution and politics, not production, so people should not be offered food that may carry some degree of risk.
Activists are opposed to genetic engineering as with current recombinant technology there is no way to ensure that genetically modified organisms will remain under control, plus the use of this technology outside secure laboratory environments represents multiple unacceptable risks to both farmed and wild ecosystems.
In 1996, Brazil nut genes were spliced into soybeans by a company called Pioneer Hi-Bred. Some individuals, however, are so allergic to this nut, they go into anaphylactic shock (similar to a severe bee sting reaction) which can cause death.
Many opponents of current genetic engineering realize that the increasing use of GM in crops has caused a power shift in agriculture towards Biotechnology companies, which are gaining more control over the production chain of crops and food, and over the farmers that use their products, as well.
In 1989, dozens of Americans died and several thousands were afflicted and impaired by a genetically altered version of the food supplement – L-tryptophan. A settlement of $2 billion dollars was paid by Showa Denko, Japan’s third largest chemical company. (Mayeno and Gleich, 1994).
On August 18, 2006, American exports of rice to Europe were interrupted when much of the U.S. crop was confirmed to be contaminated with unapproved engineered genes, possibly due to accidental cross-pollination with conventional crops.
In 1998, 95-98 percent of about 10 km² planted with canola by Canadian farmer Percy Schmeiser were found to contain Monsanto’s patented Roundup Ready gene although Schmeiser had never purchased seed from the Monsanto company. Monsanto then sued Schmeiser for piracy. In the past few years more and more crops have started to cross-pollinate which leaves a problem that is yet to be solved.
In 2005 Environmentalists say Australia faced “the most serious genetic contamination event” in its history, after the West Australian government confirmed low levels of genetically modified canola had been found in non-GM canola. Also in 2005 a decade-long project to develop genetically modified peas with built-in pest-resistance has been abandoned after tests showed they caused allergic lung damage in mice.
“They’re now turning those seeds into intellectual property, so they have a virtual lock on the seeds upon which we all depend for our food and survival.” – Jeremy Rifkin
Genetically Modified Food Labels
In America, there’s no need for labeling and this has resulted in a largely uninformed populace that is ingesting “gene-altered” food.
In other parts of the world such as the European Union, Japan, Malaysia and Australia consumers demand labelling so they can exercise choice between foods that have genetically modified, conventional or organic origins. Since its implementation in April 2004, EU Regulation 1829/2003 (labeling of genetically modified food and feed) has caused both food and feed manufacturers in Europe as well as their overseas suppliers a great deal of concern.
All genetically modified foods intended for sale in Australia and New Zealand must undergo a safety evaluation by Food Standards Australia New Zealand (FSANZ), an independent government agency. FSANZ will not approve a GM food unless it is safe to eat. It is mandatory for GM foods to be identified on food labels in Australia and New Zealand. These requirements became law in December 2001 and were put in place by food ministers to assist consumers to purchase or avoid GM foods, depending on their own views and beliefs.
The Canadian Federation of Agriculture says the industry faces huge losses if mandatory labelling is implemented. The fear is that consumers will see the labels as a warning and avoid these foods, and that food processors will reformulate their products to avoid GM foods rather than place labels. It also says labels will increase the price of foods produced and processed in Canada.
“The fact is, it is virtually impossible to even conceive of a testing procedure to assess the health effects of genetically engineered foods when introduced into the food chain, nor is there any valid nutritional or public interest reason for their introduction.” Richard Lacey: Professor of Food Safety, Leeds University.
List of genetically modified foods:
It’s virtually impossible to provide a complete list of genetically modified food (GM food) in the United States because there aren’t any laws for genetically modified crops!
Some estimates say as many as 30,000 different products on grocery store shelves are “modified.” That’s largely because many processed foods contain soy. Half of North America’s soy crop is genetically engineered!
Rapeseed – Resistance to certain pesticides and improved rapeseed cultivars to be free of erucic acid and glucosinolates. Gluconsinolates, which were found in rapeseed meal leftover from pressing, are toxic and had prevented the use of the meal in animal feed. In Canada, where “double-zero” rapeseed was developed, the crop was renamed “canola” (Canadian oil) to differentiate it from non-edible rapeseed.
Honey – Honey can be produced from GM crops. Some Canadian honey comes from bees collecting nectar from GM canola plants. This has shut down exports of Canadian honey to Europe.
Cotton – Resistant to certain pesticides – considered a food because the oil can be consumed. The introduction of genetically engineered cotton plants has had an unexpectedly effect on Chinese agriculture. The so-called Bt cotton plants that produce a chemical that kills the cotton bollworm have not only reduced the incidence of the pest in cotton fields, but also in neighboring fields of corn, soybeans, and other crops.
Rice – Genetically modified to contain high amounts of Vitamin A. Rice containing human genes is to be grown in the US. Rather than end up on dinner plates, the rice will make human proteins useful for treating infant diarrhoea in the developing world.
Soybean – Genetically modified to be resistant to herbicides – Soy foods including, soy beverages, tofu, soy oil, soy flour, lecithin. Other products may include breads, pastries, snack foods, baked products, fried products, edible oil products and special purpose foods.
Sugar cane – Made resistant to certain pesticides. A large percentage of sweeteners used in processed food actually comes from corn, not sugar cane or beets. Genetically modified sugar cane is regarded so badly by consumers at the present time that it could not be marketed successfully.
Tomatoes – Made for a longer shelf life and to prevent a substance that causes tomatoes to rot and degrade.
Corn – Resistant to certain pesticides – Corn oil, flour, sugar or syrup. May include snack foods, baked goods, fried foods, edible oil products, confectionery, special purpose foods, and soft drinks.
Sweet corn – genetically modified to produces its own insecticide. Officials from the US Food and Drug Administration (FDA) have said that thousands of tonnes of genetically engineered sweetcorn have made their way into the human food supply chain, even though the produce has been approved only for use in animal feed. Recently Monsanto, a biotechnology food producer, said that about half of the USA’s sweetcorn acreage has been planted with genetically modified seed this year.
Canola – Canola oil. May include edible oil products, fried foods, and baked products, snack foods.
Potatoes – (Atlantic, Russett Burbank, Russet Norkatah, and Shepody) – May include snack foods, processed potato products and other processed foods containing potatoes.
Flax – More and more food products contain flax oil and seed because of their excellent nutritional properties. No genetically modified flax is currently grown. An herbicide-resistant GM flax was introduced in 2001, but was soon taken off the market because European importers refused to buy it.
Papaya – The first virus resistant papayas were commercially grown in Hawaii in 1999. Transgenic papayas now cover about one thousand hectares, or three quarters of the total Hawaiian papaya crop. Monsanto, donated technology to Tamil Nadu Agricultural University, Coimbatore, for developing a papaya resistant to the ringspot virus in India.
Squash – (yellow crookneck) – Some zucchini and yellow crookneck squash are also GM but they are not popular with farmers.
Red-hearted chicory – (radicchio) – Chicory (Cichorium intybus var. foliosum) is popular in some regions as a salad green, especially in France and Belgium. Scientists developed a genetically modified line of chicory containing a gene that makes it male sterile, simply facilitating the production of hybrid cultivars. Today there is no genetically modified chicory on the market.
Cotton seed oil – Cottonseed oil and linters. Products may include blended vegetable oils, fried foods, baked foods, snack foods, edible oil products, and smallgoods casings.
Tobacco -The company Vector has a GMO tobacco being sold under the brand of Quest® cigarettes in the U.S. It is engineered to produce low or no nicotine.
Meat – Meat and dairy products usually come from animals that have eaten GM feed.
Peas – Genetically modified (GM) peas created immune responses in mice, suggesting that they may also create serious allergic reactions in people. The peas had been inserted with a gene from kidney beans, which creates a protein that acts as a pesticide.
Vegetable Oil – Most generic vegetable oils and margarines used in restaurants and in processed foods in North America are made from soy, corn, canola, or cottonseed. Unless these oils specifically say “Non-GMO” or “Organic,” it is probably genetically modified.
Sugarbeets – May include any processed foods containing sugar.
Dairy Products – About 22 percent of cows in the U.S. are injected with recombinant (genetically modified) bovine growth hormone (rbGH).
Vitamins – Vitamin C (ascorbic acid) is often made from corn, vitamin E is usually made from soy. Vitamins A, B2, B6, and B12 may be derived from GMOs as well as vitamin D and vitamin K may have “carriers” derived from GM corn sources, such as starch, glucose, and maltodextrin.
How can the public make informed decisions about genetically modified (GM) foods when there is so little information about its safety?
According to the FDA and the United States Department of Agriculture (USDA), there are over 40 plant varieties that have completed all of the federal requirements for commercialization.
Future planned applications of GMOs are diverse and may include drugs in foods, for example, bananas that produce human vaccines against infectious diseases such as Hepatitis B, metabolically engineered fish that mature more quickly, fruit and nut trees that yield years earlier, and plants that produce new plastics with unique properties.
“History has many records of crimes against humanity, which were also justified by dominant commercial interests and governments of the day. Despite protests from citizens, social justice for the common good was eroded in favour of private profits. Today, patenting of life forms and the genetic engineering which it stimulates, is being justified on the grounds that it will benefit society, especially the poor, by providing better and more food and medicine. But in fact, by monopolising the ‘raw’ biological materials, the development of other options is deliberately blocked. Farmers therefore, become totally dependent on the corporations for seeds.” – Professor Wangari Mathai.
UPDATE: California Proposition 37 – Mandatory Labeling of Genetically Engineered Food:
Proposition 37, a Mandatory Labeling of Genetically Engineered Food Initiative, is on the November 6, 2012 ballot in California as an initiated state statute. Proposition 37 requires labeling of food sold to consumers made from plants or animals with genetic material changed in specified ways and prohibits marketing such food, or other processed food, as “natural.” The Right to Know Genetically Modified Food Act, a piece of state legislation if passed in November would require GMO-containing products to disclose that on labels, and make California the first state to mandate genetically modified food. A recent poll showed that nearly 2/3rds of likely California voters favored Proposition 37.
Citation: Disabled World News (2009-09-22) – Genetically modified foods information including list of GM foods with dna changes and pros and cons of GM food: http://www.disabled-world.com/fitness/gm-foods.php#ixzz27LclS3QQ
What are Genetically Modified Organisms or GMO Foods?
Scientists have been and are currently introducing genetic material into organisms to alter, create and affect changes in living plants and animals. These radical changes scientists are developing create specific, desirable traits that might never evolve naturally and in my opinion are extremely dangerous.
Collectively called recombinant DNA technology, this practice changes the core genetic make-up of organisms. This genetic manipulation gives scientists the ability to create any trait that they wish, or suppress natural traits they don’t want. There are several reasons this unnatural genetic manipulation may affect you.
- It’s usually not clear which consumables have been genetically manipulated.
- You don’t know the long term health effects of these genetically modified foods. Initial research has shown that short-term reactions can be severe.
- Agro-chemical companies and the government are planning to charge farmers fees to grow their GMO crops, thereby negatively affecting the economy and environment.
Cultivated Genetically Modified Foods
From bacteria (E. coli) and fungus, fruits and vegetables to animals, genetic manipulation is becoming more and more common in our society. In the US market now, 60-70% of the processed foods are genetically modified. In 2006, United States GMO crops reached just shy of 135 million acres, with the total global area exceeding 250 million acres!¹
This is a short list of the genetically modified food crops that are grown in the US today:
- Soy bean
- Sugar cane
- Sweet peppers
- Cocoa beans
- Yellow squash
And each week more are being created at an alarming rate!
Processed Consumer Goods Made With GMO Ingredients
The bio-chemical industry is fiercely going after two crops, corn and soy, because of their high demand for use throughout our processed goods and biofuel industries.
For companies to increase and control the yield of these crops, it would mean controlling a large part of the processed goods and biofuels markets. It would also mean considerable profit as they can patent these crops and technically OWN THEM!
For now, you won’t see GMO on the labels of foods in the US. Currently, producers are not required to tell you, because, believe it or not, the Federal government has declared it’s their choice to determine what is good for you and what foods are safe for your consumption — and we know how far that is gotten us.
Following is a short list of processed foods made with genetically modified organisms:
- Canola Oil
- Cottonseed Oil
- Soy Sauce
- Frozen Pizza
- Frozen Dinners
- Dry Cereal
- Baby Formula
- Canned Soups
- Ice Cream
- Aspartame Sweetener
The list of GMO products on the market today is long and growing. So, I recommend doing your research because the USDA made the following determination: These products don’t need to be labeled with GMO content information unless the product presents the threat of causing allergic reactions in humans. Amazing, huh?
Several sites on the internet today are working hard to track and compile such information regarding these man-made foods. The items above are compiled from several lists including the 2003 food guide from The True Food Network².
The long-term dangers of Genetically Modified Foods are uncertain, but we have already seen severe short-term reactions
In 1989, a Japanese company paid out a $2 billion dollar settlement to several thousand American citizens who became ill from a genetically modified version of L-Tryptophan³. Several dozen Americans died from ingesting L-Tryptophan before it was taken off the market. Today, some health practitioners are returning to non-GMO L-Tryptophan for use in treating sleep disorders.
In 1996, animal tests, conducted after the danger was inflicted on humans, proved that there was a severe danger from genes spliced from Brazil nuts and soybeans. The danger: allergic reactions so severe that the individuals could suffer anaphylactic shock, possibly leading to death4.
In 2006, Japan suspended long grain rice imports from the US after tests revealed that the rice contained trace amounts of GMO that were not approved for human consumption. In the US, we still accept variations of the banned genetic modification to the rice5.
It all started by the government giving blanket approval to the “Frankenstein” tomato. You see, by 1994, the government made a stunning decision, one that reeks of something foul. They decided that since the Flavr Savr® performed “so well in its tests” that its results would stand for any further GMO produce. Because of that, no further testing would be required before presenting it to consumers for consumption.6
Shocking Fact About Genetically Modified Foods
The FDA suppressed a report that described lesions being created in the stomachs of mice that had eaten the Flavr Savr®. As a matter of fact, “Seven out of forty rats tested died within two weeks for unstated reasons.” 8
Are there fees that farmers will have to pay to grow GMO crops?
Genetically Modified Foods are now being marketed as the crops of the future. You can have everything you want in produce, meat and milk, and they can make it happen. Don’t doubt the economic gain that these agro-chemical companies are seeking.
The following two plans are under development by Monsanto of the US, and AstraZeneca of Britain. They fall under the trait-specific technology, called Genetic Use Restriction Technology (T-GURT).
“Technology Protection,” is how they sell it. “Terminator” technology makes plants that would produce sterile seeds after one season. This means, farmers have to buy more seeds for the next harvest.
“Traitor” technology is a trait-specific technology that develops traits which would remain dormant in crops. Farmers can choose to activate this trait by spraying their crops with a proprietary chemical compound. This means, they’ll have to buy the proprietary compound to treat their crops in order to activate it. There are even biochemical companies requiring farmers to sign agreements to not save any of their seeds for re-planting. This means that instead of using the seeds for the next planting season, they have to get rid of them and buy more seeds.
Why would business and the government do something like this?
The USDA, Monsanto and AstraZeneca, have contrived a way to make money on two fronts: First they make money on gene modification. Second, they make money because farmers have to pay them annually to continue to grow crops. It’s apparently dollars and cents all the way, no sense of human protection involved. The USDA is actually in business with Monsanto in owning some of the genetic engineering technology patents.
Did You Know?
Margaret Wertheim, in a 2002 article in LA Weekly, expressed fears that “Quietly and stealthily, our fields are being turned into industrial factories. This is potentially the most dangerous technology since nuclear power, yet we have no way of finding out what is being done.”7
How Are GMO Foods Toxic?
Genetically modified foods affect the human physiology. A study of people in the Philippines reported that their bodies developed antibodies to Bt toxin. What this means is that, the human body processed these engineered traits into their guts and reacted to them. These same consumers of the GMO corn in the Philippines also developed a resistance to the antibiotic ampicillin.
This antibiotic resistance is something that science hadn’t foreseen-which is indicative of questionable experimentation and not enough testing. And it makes me wonder if there is a bigger picture at hand. Maybe to create more illness and sell you more pharmaceuticals?
How to Eliminate Toxins from Genetically Modified Foods
- Whenever possible, eat all natural foods. Shop at your local farmers market for fresh foods which supports your local economy.
- Use only organically grown fruit and vegetables. Organic crops are grown using no genetic modification or toxic pesticides and herbicides.
- Your zucchini and yellow squash may be genetically modified too. Use only locally grown or organic produce.
- Be careful to eat only organic varieties of popcorn and corn. They are very often genetically modified.
- Start your own organic garden. Growing your own fruit and vegetables is one of the best things you can do for your family. Be sure your location is not in close proximity to plants, industry or bioengineered farms.
- When you’re shopping for meat and dairy products, be sure to look for the hormone and antibiotic-free, organic, range fed information on the label.
- Avoid canola oil and cottonseed oil. Use instead, organic sources of grape seed oil, virgin coconut oil, hempseed oil and olive oil which are available at organic and whole foods markets.
- Check your condiments for organic labels. You can find organic fermented sources for soy like natto (fermented soybeans), tempeh, miso, tamari, and tofu.
- Aspartame is genetically modified and is very toxic, it’s best to avoid all products that contain this substance.
- Take action. Write your council members and grocery executives. Let them know that you want fresh foods in your stores. Ask them to stock organic and no GMO foods.
- Visit www.TrueFoodNow.org/shoppers-guide for the extensive list of foods and brand names that contain GMOs.
- Genetically Modified Foods: Why You Should Avoid Them
- Is the UK conducting secret crop trials using Genetically Modified Foods?
CHECK THIS OUT:
Death over life
Monsanto’s products cause death. They compromise and violate life. Monsanto’s GM corn grown a toxic chemical right inside each and every corn kernel. This corn is what is subsequently eaten by humans.
Rats fed this corn grew horrifying cancer tumors as shown here:
In a recent scientific study, a shocking 70 percent of female rats died prematurely when fed GMOs. Fifty percent of males died early. Almost all of them died from cancer tumors.
Read more about the link between GMOs and cancer tumors at: http://www.naturalnews.com/037249_GMO_study_cancer_tumors_organ_damag…
Learn more: http://www.naturalnews.com/037289_Monsanto_corporations_ethics.html#ixzz27LhRicnX |
Investing in American Means Investing in its Small and Microbusinesses
By: Richard Eidlin
In his State of the Union speech, President Obama focused on investing to create the, infrastructure, work environment and skills for good jobs and a thriving middle class.
But, do you know how most jobs get created in America? The answer is small and microbusinesses.
As the Kaufman Foundation has noted, the majority of jobs created in the US are done so by companies with 50 or less employees. There are more than 25.5 million microbusinesses – 90 per cent of all businesses – in the US, employing more than 31 million people and generating $2.4 trillion in annual receipts. With many of the largest companies sitting on trillions of dollars in cash, rather than investing it and the jobless rate close to 8%, it’s now time to fully acknowledge the vital role that small and microbusinesses play in stimulating economic activity.
The problem is that small businesses receive much lip service but little action from policymakers.
More and more firms are starting smaller and staying smaller. As the Bureau of Labor statistics reported in March 2012, the average size of new start-ups went from 7.6 employees in the 1990's to 4.7 employees in 2011. And the share of the self-employed in the labor market is growing exponentially. If one in three microbusinesses hired just one additional employee, the US economy would achieve full employment. In addition, small and microbusinesses are more innovative and more likely to focus on positive social and environmental goals.
In many ways, these businesses represent our best hope for achieving the economy of the future. And yet these entrepreneurs face enormous challenges accessing the capital they need to start and grow their businesses. Those in underserved communities are especially challenged, due to lack of assets, credit scores, and net worth.
As the President noted in his State of the Union address only “a thriving middle class” can ensure long-term growth, and Americans must be given the tools to succeed. We applaud the President’s focus on attracting jobs to the US, calling for smarter investments in manufacturing and increasing the minimum wage, for example. But, the federal government must also play a role in providing start up entrepreneurs with the tools to create their own economic opportunities and build wealth for themselves and their community. Here are a few suggestions of what these tools need to include:
· Revamp the tax code and increase revenue, by eliminating corporate tax havens that allow capital to be offshored. An estimated $100 billion or more in tax revenue is lost to corporate tax havens every year. Our economic progress is undermined when companies are rewarded for financial manipulation rather than innovation and productive investment.
· End wasteful subsidies that benefit the nation’s largest companies. In an era that requires trimming the federal budget, the $5 billion in direct payments for agribusiness are not justifiable, especially when funding and technical assistance for small farmers and ranchers is eliminated. Nor should we provide nearly $4 billion in annual incentives for the oil and gas industry.
· Provide Small Business Access to Capital. There is no shortage of determined, committed, and capable entrepreneurs who want to succeed. However, there are a dearth of opportunities for microbusiness owners to access to fairly-priced capital and resources. Congress must re-instate the ability of the SBA 504 lending program to do refinancing. New Market Tax Credits should be modified to allow for lending to small businesses. And, SBA’s technical assistance, Microloan and the highly successful Program for Investment in Microentrepreneurs need to be fully funded.
· Pass the National Cooperative Development Act. Cooperatives are a critical tool in catalyzing economic development and wealth creation in low to moderate income areas, both rural and urban, throughout the United States. Representative Fattah’s bill would provide much needed loans and seed capital to groups working to form cooperatives.
The American economy is the most dynamic in the world, and a market-based business system must remain the heart of our economy. It spurs innovation and efficiency and allocates resources better than any alternative. However, it must have a set of 21st century tools that directs this innovation onto a path that is sustainable – for our small businesses, our people and our planet.
American Forum 2/19/13 |
MACBETH opens after the victory of Macbeth and Banquo, two Scottish generals, over rebels against the crown. Three witches appear and greet Banquo as the ancestor of kings and Macbeth as Thane of Cawdor and “king hereafter.”
Emboldened by these prophecies and urged on by his wife, Macbeth murders Duncan, his king and kinsman, while Duncan is a guest in his home. After Macbeth is proclaimed king, he decides to forestall the prophecy of the witches by murdering Banquo’s family. Haunted by Banquo’s ghost, Macbeth awakens the suspicions of Macduff, who flees the country.
Warned by the witches to beware of Macduff, Macbeth proceeds to murder Macduff’s family. He feels secure since the witches promise him that he will not be vanquished by anyone of woman born, nor will he be defeated until “Great Birnam wood to high Dunsinane hill” has come.
Lady Macbeth becomes insane and commits suicide. The enemy troops cut down Birnam trees to use as camouflage. Revealing that he was delivered in a Caesarian operation and so not of woman born, Macduff confronts the usurper Macbeth in combat. Macduff wins the battle and brandishes Macbeth’s head on a sword. Duncan’s son Malcolm is proclaimed king.
Shakespeare’s dramatic mastery is fully mature in MACBETH. Even though Macbeth trespasses against the standards of human decency, he successfully claims our interest and understanding, his despair evokes our sympathy.
Bradley, A. C. Shakespearean Tragedy. London: Macmillan, 1905. A classic study. Chapters on Macbeth deal with fundamental issues of evil, flawed nobility of character, and tragic choice; Bradley’s eloquent prose helps the reader appreciate the grandeur of the subject.
Harbage, Alfred. William Shakespeare: A Reader’s Guide. New York: Farrar, Straus & Giroux, 1963. An excellent introduction to Shakespeare’s plays, accessible to the general reader while providing masterful analyses of selected plays. Discussion of Macbeth gives a scene-by-scene synopsis, illuminated by wide-ranging, sensitive, analytical commentary.
Holland, Norman. The Shakespearean Imagination. New York: Macmillan, 1964. Informative, readable discussions of Shakespeare’s major plays based on a series of educational television lectures. Introductory chapters provide a good background to the beliefs and values of Shakespeare’s times. The chapter on Macbeth discusses elements of the play such as theme, characterization, atmosphere, and imagery.
Long, Michael. Macbeth. Boston: Twayne, 1989. An excellent introduction to the play as well as original critical commentary. Includes chapters on stage history, literary counterparts and antecedents, and dramatic symbols, as well as scene-by-scene analysis. Long characterizes Macbeth’s tragedy as both Christian and classical, a story of radical isolation from humanity.
Shakespeare, William. Macbeth. Edited by Alan Sinfield. Houndsmills, England: Macmillan, 1992. Contains a dozen articles on Macbeth that together provide a good idea of the intellectual issues, political concerns, and style of postmodernist criticism not only of this play but also of literature in general. Includes a useful introduction and summative chapter endnotes, plus an annotated bibliography.
Wills, Garry. Witches and Jesuits: Shakespeare’s “Macbeth.” New York: Oxford University Press, 1994. This study of Macbeth reconstructs the political and historical context of Shakespeare’s dark and troubling play, suggesting the links that its first audiences would have perceived between the Gunpowder Plot and this imaginative text.
Annotated Bibliography on MacbethGet Your
Starting at Just $13.90 a page
Curtis Turner Mr. Doyle Eng 4th January 19 2010 Annotated bibliography Wells, Catherine. www. sff. net. Special Libraries Association. Science Fiction and Fantasy Writers Association. (2007). 19 January 2010. Macbeths father was Findlaech, the Mormaer of Moray, and his grandfather was Ruadhri. In 1020, Findlaech was challenged for rule of Moray by his two nephews, Malcolm and Gillecomgain, and killed. Malcolm then became ruler in Findlaech’s place. Macbeth would have been 15 at the time, and quite possibly in fosterage somewhere outside of Inverness, the capital of Moray.
It was the common practice of nobles to have their sons fostered from age 7 to age 17, the “age of choice. ” Macbeth returned to his home upon turning 17, there to gain practical experience both in the art of war and the management of his family’s assets: cattle, sheep, and grain. Whatever the circumstances, Duncan went up against Macbeth and lost. Duncan was buried with previous kings on the sacred Isle of Iona. Macbeth was now the biggest dog on the hill, and he rode to the capital city of Scone to claim the high kingship for himself. Ellis, Peter Berresford ehistory. su. edu- MacBeth- Barnes & Noble Books- New York, (1993) 19 January 2010. He was born in 1005 at Alba, Scotland and died on August 15th 1057 at Lumphanan-in-Mar, Scotland. He is considered by historians as the last of the galic kings of Scotland, but has become less of a historical figure and more of a fictional character, ultimately by William Shakespeare. He was born the same year as his grandfather Malcolm the 2nd became king. At the age of seven MacBeth was sent away to be educated The term of study usually lasted about ten years.
In 1020, at age fifteen, his cousins Malcolm and Gillecomgain killed MacBeth’s father. The reason escaped history, but it could have been that Findlaech MacRuaridh had established a warm relationship with the House of Atholl. As for MacBeth, not much is known about him at this time, it is possible he was far away in his studies Bingham, Caroline www. 4scots. us. Clan Donnachaidh Society of Florida. March,30 2007. January 19 2010. On the death of Malcolm II, the House of Alpin failed in the male line.
Malcolm had two daughters, and the only surviving descendant of his cousin and immediate predecessor Kenneth III was a grand-daughter. King Malcolm’s grandsons and King Kenneth’s grand-daughter were the leading characters in the drama with which the history of the new dynasty opened. Malcolm’s elder daughter Bethoc married Crinan “the Thane”, lay abbot of Dunkeld. At this period, when Celtic monasticism was in decline, lay abbots appear to have been as accepted a part of the ecclesiastical structure as they became centuries later on the eve of the Reformation.
Crinan was a great nobleman, as his title implies, and he possessed the added prestige of belonging to the kindred of St. Columba. It was from his abbacy of Dunkeld that the new royal House took its name, for Crinan and Bethoc were the parents of King Duncan I. Malcolm’s younger daughter, whose name may have been Donada, married Finlaech, Mormaer of Moray (Mormaer was a Celtic title which appears to have been the equivalent of Thane or Earl), and they were the parents of Macbeth, who was therefore Duncan’s first cousin.
His name was in fact ‘Maelbeatha’, though it would be somewhat pedantic to revert to it. Macbeth married Kenneth III’s grand-daughter Gruoch, the original of Shakespeare’s Lady Macbeth. Gruoch had been previously married to Gillicomgan, Mormaer of Moray, a cousin of Macbeth’s father Finlaech. By her first marriage she had a son named Lulach. The events in which Duncan, Macbeth and Gruoch took part were different in emphasis and timing from the familiar events of Shakespeare’s tragedy. Duncan was quite young, probably about thirty-three, when he succeeded his grandfather.
At the time of his death in 1040 his two sons, Malcolm and Donald Ban (or Donalbain), were small children. Macbeth, who was slightly younger than his cousin the King, had, according to the rule of tanistry, an equally good claim to the throne by right of birth, though Duncan had apparently succeeded as their grandfather’s chosen heir. In 1040 Macbeth asserted his claim by force of arms, slew Duncan in battle and made himself king. There is no knowing whether Gruoch’s influence played any part in these events.
She and Macbeth had no children, but it is likely that as the years passed, she may have become anxious to see her son Lulach accepted as his stepfather’s heir. Duncan’s Queen had been a kinswoman of Siward, the Danish Earl who governed northern England under Edward the Confessor. Upon Duncan’s death his elder son Malcolm was sent for safety to Siward’s Court at York, and subsequently went to the Court of the English king; the younger son Donald Ban was sent to the Western Isles, and then possibly to Ireland.
The ‘separated fortune’ of the brothers, to which Shakespeare referred, was to lead to separate interests and ultimately to their bitter enmity. Meanwhile, Macbeth consolidated his triumph by defeating and slaying Duncan’s father, Crinan, in a battle at Dunkeld in 1045. Bloodshed, if not murder, had made him king, but he ruled successfully for seventeen years. He was an outstanding benefactor of the Church, and his rule was strong enough to permit his making a pilgrimage to Rome in 1050, where it was recorded that he “scattered money among the poor like seed”.
Macbeth appeared to be liberal and secure, but he had an enemy whom the years could only make more dangerous. In 1054 Malcolm, with the assistance of his kinsman Siward, invaded Scotland, defeated Macbeth at Scone and wrested Lothian and Cumbria from him. (The name Cumbria was now given to the whole area which had previously been the kingdom of Strathclyde. ) Three years later Malcolm invaded again and completed his victory when he defeated and slew Macbeth at Lumphanan in Aberdeenshire, in 1057. Malcolm still had Lulach to deal with.
Do you like
this material?Get help to write a similar one
Lulach was called “the Simple”, so possible it is permissible to see the influence of Gruoch behind his coronation at Scone immediately upon the death of his stepfather. But early the following year Malcolm slew him, it was said, “by strategy”. At the end of Shakespeare’s play Malcolm, on his way to his coronation at Scone, refers to Macbeth and his wife with pious horror as ‘this dead butcher and his fiend-like Queen’, but perhaps when Malcolm became King of Scots, his had were no less bloodstained than Macbeth’s
Author: Kimber Trivett
Annotated Bibliography on Macbeth
We have so large base of authors that we can prepare a unique summary of any book. Don't believe? Check it!
How fast would you like to get it? |
Celebrate the golden age of early photography
The invention of photography in 1839 was a pivotal achievement that changed the course of cultural history. The early years of the medium were rich in experimentation. As each process and technique was invented, artists enthusiastically explored new possibilities for visual recording and expression. This exhibition celebrates the golden age of early photography in France and Britain, the two countries in which the medium was simultaneously invented.
Arranged according to theme and exploring a range of photographic approaches, “Silver, Salt, and Sunlight” features some rare early photographs from the Museum's collection. Among the photographic pioneers included are William Henry Fox Talbot, Hill and Adamson, Roger Fenton, Edouard Baldus, Gustave Le Gray, Nadar, Julia Margaret Cameron, and Francis Frith.
With support from the Patricia B. Jacoby Exhibition Fund. |
Learning calculus from scratch
I have enrolled in a degree that requires maths involving calculus but i did not do mathematics B in high school, so i am looking for the best resources to reach a level that satisfies a high school maths b understanding.
What would be the best way to achieve this (book? online?...) Can anyone refer me to some online tutorials or books?
Would a wikibook be a worthy learning resource for these outcomes?
Calculus - Wikibooks, collection of open-content textbooks
The course has the following description and learning outcomes:
The course revises and extends basic integral and differential calculus of one variable, introduces partial derivatives and basic vector algebra in two and three dimensions. It provides a foundation for later studies in mathematics and science.
Prior Assumed: A grade of SA over 4 semesters in Mathematics B (Qld high school subject), or equivalent study over 4 semesters of a high school subject that includes the study of differential and integral calculus.
1 Manipulate 2D and 3D vectors and use vector addition and subtraction as well as the dot and
cross product of vectors. Use these ideas in problems involving geometric, force and velocity
2 Know and use the standard addition formulas for sin, cos and tan. To be able to prove some
of the simpler trig addition formulas To understand and use the inverse trigonometric functions.
3 Define and evaluate reasonably straightforward limits and be able to use and interpret the limit definition of the derivative.
4 Calculate derivatives using the sum, product, quotient and chain rule and to know the derivatives of the functions xn, ex, sin(x), cos(x), tan(x), loge(x), sin-1(x) and tan-1(x).
5 Identify the local maxima, minima and points of inflection of straightforward functions and use this information to sketch the graphs of these functions.
6 State and use the small change formula appropriately.
7 Convert word problems into mathematics and analyze these using calculus.
8 Be able to state and calculate Taylor approximations to standard functions.
9 Be able to state and use líHopitalís rule to evaluate 0/0 limits.
10 Understand the definition of integrals using Riemann sums and be able to provide a variety of situations in which the integral is used besides areas under curves.
11 Be able to state the Fundamental Theorem of Calculus and use anti-derivatives appropriately to evaluate definite and indefinite integrals.
12 Be able to use straightforward substitutions to evaluate integrals.
13 Use definite integrals to calculate areas, mean values and some related applications such as centroids, masses or straightforward volumes.
14 Understand the geometric meaning and the analytic definition of partial derivatives. be able to calculate the first and second derivatives of straightforward functions and be able to apply the small change formula for functions of several variables. |
Facts about the Bedouins
Basic information about this misunderstood community of southern Israel.
This fact sheet was compiled by Dr. Elie Rekhess, Visiting Crown Chair in Middle East Studies, The Crown Family Center for Jewish Studies at Northwestern University, and Director of the Konrad Adenauer Program for Jewish-Arab Cooperation at Tel Aviv University and a team of Jewish and Arab researchers.
Demographics, Socio-Economics and Politics
-In 2008, 170,000 Bedouin lived in the Negev, accounting for approximately on quarter of the population in the region. In addition, 60,000 Bedouin live in the Galilee and close to 10,000 in central Israel.
-The term "Bedouin" defines various groups of traditionally pastoral nomadic desert-dwelling Arabs (exclusively Muslims). Since the 1950s, the Bedouin in Israel underwent a process of sedentarization with an emphasis on agricultural production.
-The Negev Bedouin have one of the highest natural growth rates in the world, 4.3% in 2008. This means that the population doubles once every 18 years. The Israel Land Administration projects that the Negev Bedouin population will reach 300,000 by 2020.
|Demographic Features (2006)||Negev Bedouins||Muslims||Jews|
|Natural growth rate||4.2%||2.6%||1.4%|
|Infant mortality (per 1000)||10.6||7.1||2.9|
-The Bedouin who live in the Negev are by far Israel's most disadvantaged community in terms of per capita income, unemployment, education and public infrastructure.
-According to the Ministry of Interior's socio-economic ranking of 400 localities in Israel, the four lowest-ranking municipalities and local councils are Bedouin townships (Kseife, Tel-Sheva, Rahat, Ara'ara in the Negev and Segev-Shalom).
Did you like this article? MyJewishLearning is a not-for-profit organization. |
Major uses of chlorine in the United States in 1988 included chemicals manufacturing (76 percent), water and sewage treatment (5 percent), pulp and paper bleaching (14 percent), titanium dioxide manufacturing from rutile (3 percent), and miscellaneous, including silicon processing (2 percent). The use of elemental chlorine for bleaching in the pulp and paper industry has become a very contentious subject in recent years, due to the discovery of dioxin traces in bleached paper products. As a consequence, whether justified or not, this bleaching process has been largely phased out in Europe and may soon be phased out in North America. The likely alternative process is oxygen bleaching using chlorine oxide from sodium chlorate29 or hydrogen peroxide.
Chemical end uses of chlorine in 1988 were as bleaches such as calcium and sodium hypochlorite (7.8 percent); other inorganics like phosgene (2 percent) and phosphorus trichloride (1 percent); ethylene dichloride, or EDC (40.5 percent); chlorinated methanes (9 percent); chlorinated ethanes (5 percent); epichlorohydrin (1 percent); ethyl chloride (3.5 percent); chlorinated benzenes (1.5 percent); chloroprene (1 percent); and miscellaneous (3 percent, including hydrochloric acid [HCl] used outside the industry). These total to about three-quarters of U.S. chlorine output.
One of the major chlorine intermediates is HCl. Nine percent of HCl is made by direct chlorination of hydrogen, but most HCl, about 91 percent, is recovered as a by-product of one of the chlorination processes, especially the chlorohydrin process for propylene oxide production. The latter process consumed 8.3 percent of U.S. chlorine output in 1988, but this chlorine was entirely recycled internally as HCl. The other major source of HCl is the process that converts EDC to vinyl chloride monomer (VCM). HCl is also consumed by a parallel process that produces EDC by hydrochlorination of ethylene. These two processes are deliberately combined. Other end uses of HCl include ethyl chloride (for tetraethyl lead production, now nearly phased out) and hypochlorite bleaches.
By far the biggest single intermediate is EDC, the intermediate leading to polyvinyl chloride (PVC). However, PVC accounts for only 24 percent of produced chlorine; part of the chlorine contained in EDC is reclaimed again as HCl. EDC also has other end products, such as trichloroethylene and perchloroethylene. Some is also exported. Another important intermediate is epichlorohydrin, an intermediate to epoxies; phosgene (COCl2) is an intermediate to isocyanate pesticides and urethanes. Chlorinated benzenes are also intermediates to a variety of products.
Virtually all uses of chlorine are dissipative, with the major exception of PVC, which is used for structural purposes (e.g., water and sewer pipes, siding, window frames, calendered products, and bottles). PVC, from vinyl chloride monomer, accounts for 24 percent of U.S. elemental chlorine output.
Direct chlorination processes are relatively inefficient. Hence, recycling of waste streams is commonplace and a fairly large proportion of the input chlorine eventually becomes a production waste for manufacturing other downstream |
If there is a universal symbol of Christianity today it is undoubtedly the cross. But in the first three hundred years of the church it was the fish.
The fish symbol was particularly significant during outbreaks of persecution. Because it had been used by pagans it aroused little suspicion. Christians would mark the symbol on meeting places to indicate their presence and on tombs to mark the faith of the person who had died. It is also reported that when a Christian was on the road and came across a stranger, the Christian would draw an arc in the sand. This was one half of the fish symbol. If the stranger drew the other half both travellers knew they were believers.
The symbol appears to have been adopted due to the fact that in Greek the letters making up the word “fish” formed an acrostic for “Jesus Christ, Son of God, Saviour”. This was a tremendously dangerous thing to claim, for the Roman Emperor was worshipped using exactly the same language, presenting himself and his Empire as the path to peace. By proclaiming Jesus as Son of God and Saviour the early Christians rejected the Emperor’s claim. The king they followed represented a radically different vision and set of values. They sought a kingdom based on worship of the God revealed by Jesus, not a multiplicity of Roman gods; service rather than violence; love rather than force; embrace of the marginalised rather than the privileging of Roman citizens; care for the poor rather than their neglect. They knew that their Lord had been crucified on a Roman cross, but rather than signalling the triumph of Rome over Christ, the resurrection signalled the triumph of Christ and his way.
When a Christian of old drew that arc in the sand, she was making a statement: I follow Jesus and seek first his kingdom, not Caesar and his.
I want to do the same. I want to keep hold of that revolutionary fervour, that commitment to a kingdom marked by love, grace, inclusion and justice; the unashamed worship of the God of Jesus; the practice of a new way of living that is prepared to go up against the values of the age; the devotion to the poor, exploited and oppressed in the name of King Jesus.
I want to draw an arc in the sand. What about you?
This Easter, why not give something more meaningful than chocolate and give the gift of fish! You’ll help put out a line and enable groups to be trained in fish raising in Bangladesh, Cambodia and Nepal. This means a new supply of fish for income generation and a lifeline for the family’s diet. There’s nothing fishy about that! |
Genomics studies the interactions of the environment and our DNA. With 20,000–25,000 genes that contain over 3 billion base pairs of DNA, our genome provides the blueprint for everything that happens in our bodies.
Genomic testing starts with collecting a small DNA sample with a simple cheek swab. At our certified laboratory, we detect and evaluate small genetic variations called SNPs, or single nucleotide polymorphisms. We carefully select the SNPs that are backed by scientific studies, and have actionable steps you can use to improve your health. We offer 10 unique nutritional genomic tests and a comprehensive pharmacogenomic test. Each test analyzes and translates large amounts of genomic data into personalized and actionable information, addressing different broad or specialized areas of concern.
Genomic tests can only be ordered by approved clinicians. If you are looking to order a genomic test, please contact us for providers in your area.
The data inherent in genomic testing provides an unparalleled depth of information about any targeted health condition, enabling more precise insight into contributing factors, and tailored prevention and treatment strategies that are based on your unique biochemistry and genetic predispositions.
Genoma International offers many e-learning opportunities, providing information about the benefits of genomic testing, how genomic data is translated into actionable interventions, and how this information can positively impact your health outcome. Get started by signing-up for our newsletter, or take one of the entry-level, online courses listed below.
The following materials, brochures, and e-books provide information about genomic testing, analysis and reporting, as the foundation for personalized medicine. |
logic gate (plural logic gates)
- a physical device, typically electronic, which computes a Boolean logical output (0 or 1) from Boolean input or inputs according to the rules of some logical operator.
- There are six non-trivial, symmetric, two-input, Boolean logic gates: AND, OR, XOR, NAND, NOR and XNOR.
a physical Boolean device
- Symbols for logic gates. Twenty First Century Books, Breckenridge, CO.
- The IEC symbols are defined in IEC 60617-12 (1997-12), Graphical symbols for diagrams - Part 12: Binary logic elements |
Paths of the Spirit: Dydd gwyl Dewi Sant hapus
I grew up in southeastern Pennsylvania amid towns with Welsh names like Bala Cynwyd, Gwynedd, Tredyffrin and Bryn Mawr, most no longer said correctly because the pronunciation, and the language, was lost after hundreds of years. Many Welsh came in colonial times to form a self-governing Welsh region in William Penn’s Woods. Later the Welsh came to the mines in the anthracite region of northeast Pennsylvania, where they established towns with names like Bangor, Pen Argyl, and Nant-i-coke.
March 1 is St. David’s Day. It is a day to bake Welsh Cakes, cook leeks with something else, perhaps potatoes and chicken, and enjoy what daffodils you can find — all of them symbols of Wales, along with Y Ddraig Goch, the Red Dragon of the Welsh flag — which symbolizes King Arthur, the great leader who entered into the mists of Avalon and mythology.
St. David, revered patron of Wales, should share the honor with St. Gwynfrewi, a woman of great esteem whose well remains to this day as a major pilgrimage site in Britain. Through a series of circumstances, her relics were transferred across the wide boundary area from Wales to England, where she came to rest at the Monastery of SS. Peter and Paul in Shrewsbury — the site for the series of novels and BBC movies about Cadfael the monk, which some of you may know and enjoy. Since she no longer rested in Welsh soil, David became the chief patron of the country. This is somewhat odd since numerous countries have patron saints with no native connection to a land, like St. George and England or St. Andrew and Scotland. St. Gwenfrewi is the patron of women who refuse unwanted advances, however, so she could be an important symbol and refuge for some of my readers. More plainly put, she represents resistance to domestic violence, abuse, and rape. I revere her immensely. November 3 is her day.
St. David was a scholarly monk and preacher who founded monasteries; he was, thus, principally a teacher, since monasteries were the chief source of education during the so-called Dark Ages (not so dark; the candle of learning burned brightly through the period). David visited Rome and Jerusalem before settling in Pembrokeshire. His monastic rule was austere: totally vegetarian, with only water as a beverage. He ruled that the fields be plowed only with human power and no use of animals. His monks’ only possessions were the clothes on their backs.
To St. David, we trace the tradition of the leek as the symbol of Wales. He is said to have advised Welsh soldiers during one of the many skirmishes with the Saxons to wear a leek in their hats in order to distinguish themselves from the enemy, since military garb at that time was rather loosely arranged with little insignia for identification. In later centuries, folks began to wear leeks on St. David’s Day and the custom has remained.
St. David died on a Tuesday, March 1 in 589, so this is an especially significant year to commemorate him. Despite his record of austerity to a point many would consider extreme, he was a man full of deep joy in his faith. In his final sermon, his parting words to his flock were, “Be joyful brothers and sisters! Keep the faith and do the little things you have seen and heard with me. I will walk the path our ancestors have trod before us.” May we all be able to leave this life with such a bright message to our family and friends.
Dydd gwyl Dewi Sant hapus. Happy St. David’s Day.
Fr. Gabriel Rochelle is pastor of St. Anthony of the Desert Orthodox Mission, Las Cruces. Visit the church web site at http://stanthonylc.org. |
Here's one approach to your problem. Extend the line through (3, 5) and (2, 1) until it crosses the x -axis. We can find the slope of this line to be 4.
To determine the angle made with the x-axis, we take the arctan of 4 which is approximately 76 degrees (75.9637).
The angle formed at (3, 5) is the larger of the two angles in the parallelogram and is supplementary to the angle we just found. |
There are many types of allergens; therefore, it is nearly impossible to eliminate all allergens from your environment. However, there are certain things you can do to help reduce allergens and minimize your exposure to allergy triggers. While avoiding the allergens may eliminate your symptoms, it will not eliminate or reduce your sensitivity to that allergen, and symptoms will reoccur whenever you are re-exposed.
The primary indoor allergens are waste products from microscopic organisms called dust mites. Dust mites are especially prevalent in bedding, curtains, and carpeting.
To control dust mites:
It is not animal fur that causes allergies, but a protein that exists in the saliva, urine, and skin flakes (dander) of animals. If you have a pet allergy, you may need to take certain steps to minimize contact with your pet's saliva, urine, and skin flakes.
Be aware that you may have to remove your pet from your home if you or a family member is severely allergic.
Studies have shown that people who live in environments that contain cockroaches and mice have a higher incidence of asthma and allergies. If pests are a chronic problem in your home, consider hiring an exterminator.
Other tips to diminish pest infestation include:
The spores of molds and fungi that thrive in warm, moist, and humid areas can create allergic reactions. To reduce indoor molds and fungi:
Air irritants and pollutants can trigger an allergic reaction. You can do the following to help reduce your exposure to airborne irritants:
Nearly all allergens thrive in moist, damp, or dirty environments. One of the most effective ways to reduce the risk of allergic rhinitis is to maintain a clean, dry environment. The following will help:
If you have allergies to pollens, molds, or other outdoor allergens:
When to Contact Your Doctor
If your symptoms are not controlled or become severe despite lifestyle changes and over-the-counter allergy medications, contact your doctor for further care.
Advice from your allergist: Rhinitis. American College of Allergy, Asthma, & Immunology website. Available at: http://www.acaai.org/public/advice/rhin.htm. Accessed September 15, 2008.
Carson-DeWitt R. Allergic rhinitis. EBSCO Health Library website. Available at: http://www.ebscohost.com/healthLibrary/. Updated November 2007. Accessed September 15, 2008.
Last reviewed September 2014 by Marcin Chwistek, MD
Please be aware that this information is provided to supplement the care provided by your physician. It is neither intended nor implied to be a substitute for professional medical advice. CALL YOUR HEALTHCARE PROVIDER IMMEDIATELY IF YOU THINK YOU MAY HAVE A MEDICAL EMERGENCY. Always seek the advice of your physician or other qualified health provider prior to starting any new treatment or with any questions you may have regarding a medical condition.
Copyright © 2012 EBSCO Publishing All rights reserved.
What can we help you find?close × |
May 25, 2012
Union minister of state for forests Jayanthi Natarajan on Wednesday announced a recovery programme for saving critically endangered species and their habitats.
Under the initiative, 16 species have been identified for support. This includes snow leopard, bustards (including floricans), dolphin, hangul, Nilgiri tahr, marine turtles, dugongs and coral reefs, edible nest swiftlet, Asian wild buffalo, Nicobar megapode, Manipur brow-antlered deer, vultures, Malabar civet, Indian rhinoceros, asiatic lion, swamp deer and jerdon’s courser.
Reacting to queries related to conservation of species that are on the verge of extinction, the minister informed Rajya Sabha that financial and technical assistance is extended to the state governments under various Centrally-sponsored schemes.
Under CSS projects ‘Integrated Development of Wildlife Habitats’, ‘Project Tiger’ and ‘Project Elephant’ are mooted to ensure better protection and conservation to wildlife.
Besides, CBI has been empowered under the Wildlife (Protection) Act, 1972 to apprehend and prosecute wildlife offenders.
A Wildlife Crime Control Bureau has also been set up for control of poaching and illegal trade in wildlife and its products, she said.
Meanwhile, wildlife activists welcomed the Union minister’s announcement. “Tamil Nadu was once a home for large number of vultures and Nilgiri Tahr.
The state should utilise the opportunity to conserve the Nilgiri Tahr, which is our state animal,” said Mr K.V.R.K. Thirunaranan, founder, The Nature Trust.
Ms Jayanthi Natarajan also added that the state governments have been requested to strengthen the patrolling in and around the protected areas and national parks.
Source: Deccan Chronicle |
Congratulations to Yash Veer for publishing this piece in the Tehelka.
The future of biodiversity in the higher Himalayas lies outside protected areas
The northern part of India is rimmed by a 2,500 km stretch of mountains, the Himalayas, the land of snow. Covering over a million sq km, it includes low Siwalik foothills at 400 m, through the Middle Himalayas, to massive peaks above 8,000 m, going further in its rainshadow into the Trans Himalayas.
Usually, rainfall declines from east to west and from south to the northern Trans Himalayan cold-deserts, causing an immense vertical and horizontal diversity of habitats. The non-forested areas above 3,200 m in the west and 4,200 m in the east cover over 1.5 lakh sq km. About 45 percent of this high altitude area is a vast expanse of permafrost, glaciers and sheer rock faces, largely uninhabitable.
The Himalayas host unique biodiversity including at least 350 species of mammals, 1,200 species of birds, 635 species of amphibians and reptiles and numerous plants. Over 335 species of wild relatives of cultivated crops are found here. The higher Himalayas also have the highest diversity of wild relatives of domestic animals — sheep (urial, argali), goats (markhor, ibex), cattle (yak) and equids (kiang). There are numerous biologically important wetlands that form breeding grounds for waterfowl.
Only a part of this region’s biodiversity is covered by more than 30 wildlife Protected Areas (PA) that dot the higher Himalayas. Unlike the rest of the country, where most biodiversity are locked in habitat ‘islands’ formed by PAs, here it is spread continuously in the entire region. For example, it is estimated that over 60 percent of the snow leopard population, a flagship of this ecosystem, may be outside PAs. The same is true for other species such as Ladakh urial, Tibetan argali and takin, of which less than 1,500 may survive in India.
While wildlife values are pervasive in the landscape, so is the use by the resident agro-pastoral communities who use the mountains for pasture, some cultivation, collection of biomass and medicinal plants. With increasing human population, the growing people and wildlife interface is probably posing greater problems. Wild herbivores in places have been out-competed by increasing domestic stock, while in other regions poaching and conflict are decimating wildlife. With the recent thrust of developmental pressures, primarily to match up with the tremendous infrastructural boom on the Chinese side, there is a great risk of prime areas getting overrun by such
One offshoot of the recent thrust of development is the huge influx of poor migrant labourers. Many of them are alleged to be involved with poaching and illegal wildlife trade. Garbage from many labour campsites, military camps and tourist facilities has resulted in an explosion of feral dog population that threatens local wildlife, including
Realising that traditional conservation approaches may not be effective in these areas, the MoEF, in collaboration with the Himalayan states, NGOs and communities, developed an alternative strategy in 2009. Project Snow Leopard is a landscape and knowledge based conservation programme that doesn’t limit itself to the PAs and utilises recent lessons from participatory work to achieve holistic ecosystem conservation. Finally, we are moving in the right direction but, given the challenges, it
Bhatnagar is a biologist working in the Higher Himalayas and director, Snow Leopard Trust-India. |
Category Archives: Local
The Recycling Program staff of the City of Fresno is pleased to offer the opportunity to schedule a presentation or participate in a community outreach event, located within the city of Fresno, for your students or members of your service organization. To make arrangements, please click here or call the Recycling Hotline at 621-1111. Click the image to the left to visit our “Grow up Green” website where you can see a short video of a recycling presentation.
Recycling presentations are available to pre-k, elementary, middle schools, high schools and colleges, within the City of Fresno. Interactive and entertaining presentations cover information on recycling, resource conservation, and protection of the environment. Students will learn about the importance of recycling programs available to them in Fresno. Our staff is happy to work with you to relate the information and materials covered in your curriculum.
Each presentation takes between 45 minutes to an hour or can be tailored to meet your needs. Handouts, videos and visual aides reinforce the information. There is no fee and all handouts are free.
The program is funded by the City of Fresno and various state grants and focuses on the following areas of recycling:
Household Hazardous Waste (HHW)
Community Service Organizations
Recycling Program staff are available to make presentations to community service organizations within the city of Fresno. Topics include recycling, resources conservation, and protection of the environment. To schedule a presentation, please click here or call the Recycling Hotline at 621-1111.
Community and School Events
As part of our goal to educate the residents of the City of Fresno about recycling and protecting our natural resources, Recycling Program staff are available to participate in events, within the city of Fresno, that promote environmental awareness. They are also available to attend community-wide school events such as science fairs, career days and Earth Day events located within the city of Fresno. For more information, or to schedule a presentation or event, please click here or call the Recycling Hotline at 621-1111.
Additional Resources and Supplemental Materials
Educational Packets – includes information on Solid Waste and Recycling services and opportunities throughout the City of Fresno.
“Closing the Loop” Curriculum (grades K – 6) – provides current and accurate waste management information. Enables students to get involved with hands-on action-oriented projects. (Available online at www.CalRecycle.gov).
“A Child’s Place in the Environment” Curriculum (grades 1 – 6) – provides teachers with an environmental education program that encourages students to become environmentally aware and active. (Available online at www.ACPE.Lake.K12.ca.us)
“Teens for Planet Earth” Website (grades 9 – 12) – provides teens and adults who work with with teens, resources to carry out environmental service-learning projects in their community. (Available online at: www.teens4planetearth.com)
For more recycling information and links to games, click here to go to our “Kid’s Pages“
To contact the City of Fresno Recycling Program, please click here or call 621-1111.
What is Grasscycling?
Grasscycling is the natural recycling of grass by leaving the clippings on the lawn when mowing. Grass clippings decompose quickly and release valuable nutrients back into your lawn. It’s simple, and it works! Grass clippings make up a big part of California’s waste during the growing season. To keep these out of the waste stream, try grasscycling!
Grasscycling provides free fertilizer and helps make lawns greener and healthier. Grasscycling reduces turf grass fertilizer and water requirements, which can reduce the toxic runoff that enters storm drains and pollutes creeks and rivers. Grasscycling reduces mowing time too since it eliminates the need to bag and dispose of clippings.
Grasscycling also reduces the amount of yard waste disposed in landfills. Lawns can generate 300 pounds of grass clippings per 1000 square feet annually. For more information on grasscycling from the California Integrated Waste Management Board, visit www.ciwmb.ca.gov.
Backyard composting is nature’s way of recycling. Composting is fun, easy and educational. Decomposed organic material such as leaves, grass clippings, twigs, fruit and vegetables make a great soil conditioner. Compost made from leaves and yard trimmings is great for your landscaping. To learn more about composting, visit www.ciwmb.ca.gov. or the “Master Gardener’s of Fresno County” website.
- 9 Steps to Start an Organic Garden (greenerideal.com)
- Step Up Your Recycling Efforts: Composting, It’s Easier Than You Think! (cleansd.wordpress.com)
- How to compost ; (hys28gysyraftm.wordpress.com)
Whether you own a cabin, cottage, lakehome or lodge, or you just dream of owning one, Cabin Life magazine captures the essence of the vacation-home lifestyle – escape and reconnection.
A breath of fresh air, award-winning Cabin Life gives you great ideas, information and inspiration for enjoying your vacation home. And when you just can’t get to your special getaway, Cabin Life provides that mental escape to tide you over until your next trip.
Launched in 2001, Cabin Life enjoys rapid growth and strong reader loyalty. Cabin Life is unique because it is both a home and lifestyle publication, and also because it appeals to everyone — young and old, male and female, owners and dreamers.
Trash Knight is currently advertising in Cabin Life.
Place an adequate number of trash containers in parking lots as well as inside and outside of all building entrances.
Establish a regular schedule for emptying trash containers. Avoid having trash emptied on an ‘as needed’ basis.
This will prevent trash overflows.
Replace broken, dirty or damaged containers.
Use only covered trash containers to eliminate trash from spilling or blowing out.
Establish the expectation that employees will pick up trash anywhere in or around your place of business. Let them know that it is not acceptable to walk past litter.
Removed trapped litter from fence lines on a regularly scheduled basis.
Establish smoking areas with appropriate ash receptacles for employees and customers.
Place only tied bags of trash in outdoor dumpsters. This greatly decreases loose trash from blowing out of the dumpster during collection.
Call the city’s Solid Waste Department when your dumpster is near to overflowing, or if your current level of service is not sufficient. Change or increase scheduled pickups, if necessary.
Enclose dumpsters with fences or walls to minimize the amount of trash that will blow to other areas of your business or onto city streets and rights-of-way. Remove trash from the enclosure area regularly.
Commit to reducing loose trash from company vehicles by:
Requiring tarps on any vehicles transporting materials.
Requiring tightly sealed containers to transport materials that are not covered by tarps.
Instructing drivers to pick up any materials that have fallen off of their load.
Instructing drivers to discard cigarette butts in vehicle ashtrays.
Adding trash bags to company vehicles.
From Keep America Beautiful. For more information about eliminating litter, proper litter disposal or to learn more about our Trash Knight garbage system, please visit www.trashknight.com.
Q. What can the TRASH KNIGHT do for me?
A. The main use of the TRASH KNIGHT has always been to keep animals out of residential garbage, but it does other things as well.
1. The rolling and towable models are an excellent mobility aid for older folks or a simple convenience for anybody who doesn’t want to make multiple trips to the curb lugging heavy trash cans. Your garbage can be taken out on ‘trash night’ (the night before your trash service comes), to avoid having to take it out before dawn on ‘trash day’ for fear of animal intrusion.
2. The TRASH KNIGHT can get your garbage cans out of the garage. Tired of that odor when you go to get in your car?
3. The TRASH KNIGHT opens your cans for you. No more prying unsanitary lids off. Taking the garbage out is now ‘touchless’. Germaphobes rejoice!
4. Reduce your trash can expense. The Rubbermaid BRUTEtm trash can is an extremely tough commercial grade product. They are expensive, but last a very long time, and the Trash Man can’t throw the lids when they are attached to the unit. In fact, my trash man likes the fact that he never has to pick up my trash so much that he has agreed to gently place my cans back in my TRASH KNIGHT rather than tossing them on the ground.
5. The TRASH KNIGHT can be used for storage of animal feed of almost any type. From rabbits to horses, one of our models can simplify feeding time and ensure varmint proof storage.
For more information about the Trash Knight garbage system, please visit www.trashknight.com. |
Essential tremor is a somewhat common condition that results in a rhythmic trembling in the hands, arms, head, legs, trunk or voice. The tremors cannot be cured but can be treated with different natural, lifestyle and medical treatments. Symptoms of essential tremor are generally very obvious because of the magnitude and rhythm of the trembling. To be diagnosed with the condition, usually a blood test will be used to check your thyroid function. Overactive thyroid can cause an exaggerated tremor of the hands. Your doctor will also have to look over your current prescribed medications as types of medication can cause tremors which will go away when the medicine is taken away.
Essential tremor is progressive and will usually start in both hands, and then spreads upwards and outward. Generally it is onset in people over the age of 40, but genetic types of essential tremor will usually start in children of a very young age. The younger the onset of essential tremor begins, the faster it usually progresses.
Essential tremor is a kinetic tremor unlike most other conditions involving tremors. This means that the tremor is caused by movement, stress, anxiety, and can be influenced by caffeine and other types of stimulants. Other tremors are usually resting tremors, which happen when the muscle is relaxed.
The cause of essential tremor is unknown, although we have a general idea of where it may begin. Essential tremor is a nervous system disorder. It’s not dangerous, but as mentioned before it can become detrimental to daily life as it progresses. About half of essential tremor cases seem to be linked by genetic mutation. Although the gene entirely responsible hasn’t been identified, it is referred to as a familial tremor for its ability to be passed through the generations. A parent with the genetic mutation has 50 percent chance of passing the condition to their child. The age of onset for children can be as young as 3 or 4 years old.
Another cause of essential tremor seems to be age, and it is more common in people over 40 years of age. Because age can also bring on a whole other set of conditions and health concerns, these may also influence the onset of essential tremor. Some conditions seem to occur hand in hand with essential tremor, and cause it to start.
One theory of essential tremor is that the cerebellum, a part of the brain, is responsible. The cerebellum is the main part of movement centers in the brain, and it may be that the cerebellum is not properly communicating or connecting with the nervous system. This would mean that signals get mixed, and movement cannot be executed properly. This would explain why tremors tend to worsen with caffeine, as caffeine is a type of stimulant to the nervous system.
Essential tremor cannot be prevented, and though the causes are unknown, treatment can be provided to help comfort and provide normal function to the individual affected. Please consult your medical provider if you have any questions about treating your essential tremor effectively. |
The term Islamic World refers to all the countries that have Islam as their main religion, Arab speaking countries and areas with Muslim cultural practices.
In the global context the oil producing countries of the Middle East have an important role since the oil crisis of 1973. Saudi Arabia, the United Arab Emirates, Bahrain, Qatar and Kuwait are the most influential countries due to their oil reserves. Other Arab countries of North Africa (Egypt, Libya and Algeria) have experienced a period of political instability affecting international relations.
THE ARAB -ISRAELI CONFLICT
This is the longest conflict in the region. It started in 1947 when the UN divided Palestine into the Arab – Palestinian state and the Jewish state. Arab countries did not recognized Israel when it was proclaimed in 1948.
Several wars between the Arab countries and Israel have taken place. The most important ones are the Six-Day War in 1967 and the Yom Kippur War in 1973. The main consequence of these wars led to Israeli occupation of Gaza territories and West Bank where Jewish settlements have been established.
Israel also occupied territories in the surrounding Arab countries and proclaimed Jerusalem as the capital city of Israel. Palestinians fight is based on terrorist attacks, intifada and civilian attacks to Israeli army.
Israel abandoned Gaza in 2006 but the conflict still continues with some agreements which have not been fulfilled.
CONFLICTS IN THE MIDDLE EAST
- The Iran- Iraq war (1980-1988) started when Saddam Hussein – President of Iraq – occupied the iranian oil producing region of Shatt-el – Arab with the help of Western countries. At the end, Iraq signed the peace treaty without obtaining its claims.
- The Gulf Wars. The First Gulf War began when Saddam Hussein invaded Kuwait to control its oil. The United States liberated Kuwait and forbade trade with Iraq as well as forced the destruction of its weapons of mass destruction. After terrorist attack of September 2001, the United States accused Iraq of supporting al-Qaeda. This was the cause of the Second Gulf War in 2002 when Sadam Hussein was deposed and Iraq was occupied by the international coalition. A provisional government was established and to exploit oil. However, the Iraqui population rebelled against the Western influence. USA withdrew from Iraq in 2011 but the internal conflict continues.
- Invasion of Afghanistan started after 9/11 attacks since Taliban governments supported Al Qaeda. USA overthrew the Taliban government, established a democratic system and NATO displayed a peace force until 2011.
THE ARAB SPRING
This name is given to the revolts that took place in North African Islamic governments. The revolts started in Tunisia in 2010 protesting for the miserable living conditions, lack of democracy, unemployment and poverty.
Morocco, Algeria, Saudi Arabia and Oman introduced some reforms to skip the popular revolt.
Egypt and Tunisia overthrew their presidents while Syria and Libya started civil wars continuing today.
Yemen has entered a period of instability and it is a fallen state. |
WASHINGTON — The federal government announced Tuesday that baby bottles and sippy cups can no longer contain the chemical bisphenol-A, or BPA.
The U.S. chemical industry's chief association, the American Chemistry Council, had asked the Food and Drug Administration to phase out rules allowing BPA in those products in October, after determining that all manufacturers of bottles and sippy cups had already abandoned the chemical due to safety concerns.
It is illegal for companies to use substances not covered by FDA rules.
"Consumers can be confident that these products do not contain BPA," FDA spokesman Allen Curtis said in a statement, adding that the agency's action was based on the bottle industry's phase-out of the chemical. "The agency continues to support the safety of BPA for use in products that hold food."
The chemical industry's request may help curb years of negative publicity from consumer groups and head off tougher laws that would ban BPA from other types of packaging because of health worries.
Legislation introduced by some members of Congress would ban BPA nationwide in all canned food, water bottles and food containers. Chemical makers maintain that the plastic-hardening chemical is safe for all food and drink uses.
BPA is found in hundreds of plastic items from water bottles to CDs to dental sealants. Some researchers say ingesting the chemical can interfere with development of the reproductive and nervous systems in babies and young children. They point to dozens of studies showing such an effect from BPA in rodents and other animals.
But the FDA has repeatedly stated that those findings cannot be applied to humans. The federal government is currently spending $30 million on its own studies assessing the chemical's health effects on humans.
About 90 percent of Americans have traces of BPA in their urine, mainly because the chemical leaches out of food and beverage packaging. The vast majority of canned goods in the U.S. are sealed with resin that contains BPA to prevent contamination and spoiling. Canned food manufacturers have used the chemicals since the 1950s. The practice is approved by the FDA. |
In the earliest medieval poems, Robin Hood is devoted to the Virgin Mary. While this may seem odd, many thieves in medieval Europe had an attachment to her.
Crime historians often pay little regard to medieval outlaw literature, but my paper aims to use the history of crime in the early modern period to add a new context to their study. The ballad A Lytell Geste of Robyn Hode was first printed in the early sixteenth century. Around the same time also we see other outlaw ballads printed such as Adam Bell, Clim of the Clough, and William of Cloudesly (c.1530). My paper explores one reason why the figure of the outlaw hero became popular in print during the sixteenth century. Could it be that the idealisation of the outlaw occurred during the sixteenth century because another, more sinister criminal figure was also emerging in print: the ‘rogue’? Whilst outlaws such as Robin Hood were ‘curteyse’ and ‘dyde pore men moch god’, the figure of the rogue was more menacing. The word ‘rogue’ was first coined in 1561. Unlike the relatively good greenwood outlaw who lived apart from mainstream society, however, rogues were part of it, describing somebody who would rob, cheat, and swindle people indiscriminately, all the while effecting the disguise of a law-abiding citizen. Thus there was a need for people to believe in a good outlaw, because real-life offenders were ultimately more menacing. Hence the proposed paper explores the dichotomy between outlaws and rogues in print, in the process highlighting how changes in the nature of crime in the early modern period might have affected medieval outlaw myths.
A paper read at Chethams Library, Manchester – 20 May 2016.
A forthcoming public talk to be delivered at Pontefract Castle on 8 May 2016.
The Downfall of Robert, Earle of Huntington (1598) & The Death of Robert, Earle of Huntingdon (1601) by Anthony Munday and Henry Chettle.
Robin Hood first became an Earl in the 16th century; two relatively unknown plays had a dramatic effect upon later interpretations of the legend. |
If you thought that only the excessive noise levels at your workplace caused your loss of hearing, you might be mistaken. The Occupational Safety and Health Administration says ototoxicants can cause balance problems and hearing loss. Ototoxicants are certain types of chemicals to which many workers in Iowa are exposed.
If you work with solvents, pharmaceuticals or pesticides that contain ototoxicants, your hearing might be at risk. OSHA also warns that ototoxicity combined with excessive noise levels exacerbate the potential adverse effect on your hearing.
Ototoxicants damage the pathways to the brain
The nerves or nuclei that form the auditory system that carries messages about sounds to the brain, and even the brain itself, suffer damage through exposure to ototoxicants, affecting your hearing in the following ways:
- Hearing loss: You will only hear the louder sounds.
- Speech discrimination dysfunction: Voices and background noises will lose clarity and become inseparable.
- Frequency resolution: Sounds with similar frequencies will seem the same.
- Compressed loudness: You will hear distorted sounds.
- Spatial resolution: You will find it difficult to localize sound and determine its origin.
- Temporal resolution: Sounds will flow together because you will be unable to detect time lapses between them.
Of all these hearing impairments, the speech discrimination dysfunction might be the most threatening one if you work in a noisy area because you will not hear warning signals, the voices of co-workers, instructions from supervisors and environmental sounds.
Who is at risk?
If your job involves working with machinery in industries such as chemical and paint manufacturing, textile and apparel, furniture manufacturing, plastics, and others that use chemicals that contain ototoxicants, you will be at risk. The ototoxicants are present in toluene, mercury compounds, carbon monoxide, antineoplastic agents and certain loop diuretics. Protection and prevention can be challenging because it can enter your body through skin absorption, ingestion and inhalation.
Information about ototoxicity or presence of ototoxicants might not be on the labels of chemicals. For that reason, your employer must inform you of the risks and provide you with training and safety information to mitigate the hazards. He or she must also provide the necessary personal protective equipment such as a respirator and hand protection.
Securing workers’ compensation benefits for hearing loss could be challenging because it typically develops gradually and you might only become aware of the severity of the damage after years of exposure. An experienced Iowa workers’ compensation attorney can provide invaluable support and guidance throughout the legal and administrative steps of the benefits claims process to obtain the compensation for which you are eligible. |
- How do you prove vandalism?
- Where does vandalism occur the most?
- What is your opinion School Vandalism?
- What is the solution of vandalism?
- What are the three forms of vandalism?
- What are the disadvantages of vandalism?
- Do Police Investigate Car Vandalism?
- What are examples of vandalism?
- Can u go to jail for vandalism?
- How do you get vandalism charges dropped?
- How do you stop car vandalism?
- How do you prove innocence in vandalism?
- How do you press charges for vandalism?
- Can you sue someone for vandalism?
- What happens when you get charged with vandalism?
- What are three strategies a school can use to reduce vandalism?
- What is the cause of vandalism?
- Can you call the cops for vandalism?
How do you prove vandalism?
Vandalism is the act of intentionally harming someone else’s property….To prove that the defendant is guilty of this crime, the prosecutor must prove that the defendant maliciously:Defaced with graffiti1 or with other inscribed material, or.Damaged2, or.Destroyed real or personal property..
Where does vandalism occur the most?
However, there are certain areas where vandalism is more likely to happen.Parking Lots. Cars are often a target of vandalism, and this is especially true if the owner leaves the vehicle in public parking lots with low levels of surveillance. … Schools. … Private Property.
What is your opinion School Vandalism?
Answer. Answer: The presence of vandalism at school costs money and makes school facilities less attractive and even unusable. You deserve an environment that is free from graffiti and property damage.
What is the solution of vandalism?
You Can Help Prevent Vandalism Clean up vandalism as soon as it happens — replace signs, repair playground equipment, paint over graffiti. If you see anyone committing vandalism, report it to the police, school authorities, or someone who can take action. Remember, vandalism is a crime.
What are the three forms of vandalism?
Three Types of Vandalism in Vacant PropertiesTheft. Theft is one type of vandalism, usually because the thieves are taking things they have to “dig” for, like copper wiring. … Graffiti and Broken Windows. Cosmetic damage such as broken windows and graffiti are extremely common. … Broken Pipes.
What are the disadvantages of vandalism?
The effects of vandalism Vandalism can affect people’s quality of life because it damages or destroys things that they need or care about. It also: Makes people feel that their lives are less safe than they really are. Can be dangerous – people have died when acts of vandalism got out of control.
Do Police Investigate Car Vandalism?
You phone the police non-emergency line and report that someone vandalized your car. … You need to file in person at the police department only if you know who did it. That’s because the police are not very likely to get involved in a vandalism investigation without solid evidence of who was responsible.
What are examples of vandalism?
Definition of VandalismSpray painting another’s property with the purpose of defacing;”Egging” someone’s car or house;Keying (or scratching) paint off of someone’s car;Breaking someone’s windows;Defacing public property with graffiti and other forms of “art”;Slashing someone’s tires;Defacing park benches;More items…•
Can u go to jail for vandalism?
In general, vandalism is not a serious crime unless the property destroyed is worth a lot of money. Many acts of vandalism are misdemeanors, meaning the maximum penalties include fines and up to a year in the local jail. … Defendants charged with a felony can face more than a year in state prison and significant fines.
How do you get vandalism charges dropped?
Outcomes in Vandalism Cases For defendants that have not had prior vandalism charges or convictions, criminal charges can be dropped in exchange for a defendant entering a civil compromise, if a DA is amenable. That’s when a defendant agrees to pay fines and for the clean-up or restoration of the damaged property.
How do you stop car vandalism?
Here you’ll learn how to avoid car vandalism in 6 easy steps.Clean your vehicle. Always try to clean your vehicle clean and free of clutter. … Park your vehicle strategically. … Lock your car after parking. … Check for security cameras. … Add security features to your car. … Pay for valet parking.
How do you prove innocence in vandalism?
If your witnesses are people you know, then follow these simple steps:Let them know you have been charged with a crime.Let them know the date and time of the crime being alleged.Ask your witness to write out and date a brief statement containing important facts they remember that would show your innocence.More items…•
How do you press charges for vandalism?
If your car is vandalized you’ll need to file a police report, and submit a copy of the complaint to your insurance company. However, if you know who vandalized your car, you can press charges. Whether it’s characterized as a misdemeanor or felony depends on how much damage was done to the vehicle.
Can you sue someone for vandalism?
Depending on the situation, you may be able to recover in civil court. You may be able to sue the vandal under civil tort law for trespass, conversion, larceny, etc. If your property was damaged to the point that you can no longer use it, you may be able to recover the cost of the property.
What happens when you get charged with vandalism?
Under California Penal Code 594 (a), a person is guilty of vandalism when he or she defaces, damages or destroys “any real or personal property not his or her own.” If the amount of the damage is $400 or more, the vandalism is punishable by up to one year in county jail and a fine of up to $10,000.
What are three strategies a school can use to reduce vandalism?
1) Connect with the Local Police Department. Most police departments will gladly work with you to protect your school from vandalism. … 2) Set Up Video Surveillance Monitoring. … 3) Install an Access Control System. … 4) Have Students Paint a Mural. … 5) Install an Alarm System. … 6) Connect with the Community.
What is the cause of vandalism?
Vandalism is the crime of intentionally damaging property belonging to government or other people. … Psychologists suggest that vandalism is mostly carried out by people from lower socio- economic groups, for example, unemployers or teenagers, which reflect the social problem of poor economy, peer pressure and bullying.
Can you call the cops for vandalism?
Call the police . Davis said it is important for police to have vandalism documented. Patrols throughout the city can be geared to a specific area if there are numerous vandalism reports. “If you can call, we can maybe stop it or catch the people doing it,” he said. |
MedicationPosted by anonghost on Wednesday, 8 December 2010
Medicine sensitivity is common to people with multiple chemical sensitivity due to impaired liver detoxification, heightened nerve inflammation and sensitisations to the nervous system and over activation of inflammatory Mast Cells. For this reason a multi dimensional approach combining chemical (and other trigger) exposure reduction and non pharmacological stress and symptom management strategies recommended to people with other Central Sensitivity Syndromes (CSS) such as fibromyalgia and chronic fatigue syndrome (CFS) is usually preferred - See Treatment.
For some people however, medications can be helpful and may even decrease sensitivities. Most useful seem to be anti-histamines, Tricylic Antidepressants, Gabapentin (Neurontin) and Pregabalin (Lyrica). These generally need to be started on lower doses than usual and increased slowly under medical supervision to test for tolerance. Following the same recommendations made by the Center for Disease Control and Prevention (CDC) in the MCS related condition Chronic Fatigue Syndrome
The Centre of Disease Control Says...
"Many CFS patients are sensitive to medications, particularly sedating medications. Therapeutic benefits can often be achieved at lower than normal dosages, so try prescribing a fraction of the usual recommended dose to start and gradually increase as necessary and as tolerated. All medications can cause side effects, which may lead to new symptoms or exacerbate existing symptoms, so it is important to routinely monitor all prescription drugs, OTC therapies and supplements the patient is taking." www.cdc.gov/cfs/cfstreatmentHCP.htm#pharmacologica
For people with more severe pharmacological food intolerance medicine sensitivity is generally increased particularly to aspirin, many anti-inflammatories (e.g. NSAID, Cox 2 inhibitors), anti-depressants and others containing salicylates and phenols. People with Mast Cell Activation Disorder (MCAD) also experience a number of medicine sensitivities and need to use medicines cautiously. Many of the medicine sensitivities experienced by people with MCAD are similar to those who have severe phenol-salicylate intolerance.
- Cough lollies, syrups and medications, mouthwash or inhalations that contain menthol, mint, camphor, eucalyptus or tea tree oil. These may make you feel better but can be powerful irritants for individuals with allergy, food and chemical sensitivities.
- Pain relieving medications to avoid are aspirin, natural herbal pain relieving compounds, non-steroid anti-inflammatory agents (Advil, Nurofen, Voltaren).
- Avoid liquid paracetamol preparations as they are coloured and/or flavoured and should not be given if tolerance to them has not been tested.
- Antioxidants, multivitamins and other nutritional products with preservatives, flavourings, colourings, bioflavonoids, herbs, rutin, kelp or hesperidin.
Refer guide: Medications for use with a Low Phenolic Diet at www.asehaqld.org.au. For a list of medications etc that may be tolerated see Low salicylate Medications: Medications listed as suitable for those with salicylate and amine (Phenolic) sensitivities by the Royal Prince Alfred Hospital Allergy Clinic. |
An eyelid papilloma is any lesion on the eyelid that is papillomatous, that is, of smooth, rounded, or pedunculated elevation.
The lesion that most commonly fits this description is a benign squamous papilloma. However, it is possible that other benign eyelid lesions may take on the same appearance, as well as malignant skin lesions, especially squamous carcinoma. Malignant eyelid skin conditions are covered in other articles; this article outlines benign skin lesions.
Squamous papilloma is a benign tumor of epithelial origin.
Squamous papilloma is the most common benign lesion of the eyelid.
No known differences in race presentation or frequency exist.
No difference in occurrence exists between the sexes.
Frequency increases steadily with age, but they may occur at any age and are seen most frequently in patients older than 30 years.
In addition to general questions about past medical history and family history, document the following:
Check the skin for additional lesions, and palpate the preauricular and submaxillary lymph nodes for metastasis if suspecting a malignant lesion.
No known cause for squamous papilloma exists. However, for most malignant lesions, UV (sun) exposure is the main etiologic factor.
Usually, squamous papillomas are sessile or pedunculated and have a color similar to the surrounding skin. They often are multiple and tend to involve the lid margin. A small keratin crust often can be palpated on the surface (keratotic papilloma). Microscopically, these lesions are composed of fingerlike projections of vascularized connective tissue covered by hyperplastic epithelium (papillae). The epidermis usually is acanthotic, with elongation of the rete ridges, and shows areas of hyperkeratosis and focal parakeratosis.
Lee et al studied eyelid margin papillomas for which complete excision was cosmetically unacceptable. The study reported a case in which interferon was an effective treatment for a conjunctival papilloma.
Surgical excision usually is a simple procedure for these benign skin lesions. |
Butterfly weed (Asclepias tuberosa), a hardy kind of Asclepias, grows in U.S. Department of Agriculture planting zones 3 through 9. From summer to early fall, the plant bears showy, orange blooms that attract butterflies. It grows about 1 to 3 feet tall with about a 1-foot spread. Butterfly weed is easy to grow from seeds started indoors or sown directly into the garden.
Butterfly weed flowers form seed pods from late summer through early fall. The plants produce 3- to 6-inch-long pods that contain hundreds of seeds. The seeds have tufts of silky, long hairs that aid in wind dispersal. You should allow seeds to completely mature before collecting them. Seed pods break open when ripe, releasing hundreds of seeds into the wind. To avoid self-seeding, remove seed pods before they split.
Planting Butterfly Weed Seeds
You can plant butterfly weed seeds outdoors about six to eight weeks before the last frost for your area. Sow seeds about 1/8 to 1/4 inch deep. Seeds planted directly outdoors take between 30 to 90 days to germinate in soil temperature between 50 and 75 degrees Fahrenheit, and plants grown from seed can take two to three years before bearing flowers. You can also start seeds indoors six to eight weeks before the last frost. Fresh seeds need a period of cold, damp stratification. You can place the seeds in a bag with moist peat moss and keep them in the refrigerator for 10 to 12 weeks to provide the necessary stratification.
For seeds started indoors, you can transplant them outdoors after the last frost date for your area. Butterfly weed needs a location with full sun to light shade and spacing of 12 to 24 inches between plants. While plants prefer sandy soil, they do tolerate dry soil, as long as it is not clay or chalky. While the plants take a few years to bloom, once established, plants become thicker each year.
You can take root cuttings or divide plants in spring. Division has to be done carefully because damage to the taproots can cause plant death. It is best not to move or disturb unless absolutely necessary. If you take cuttings, cut the taproots into 2-inch sections and plant them vertically in the ground, keeping the area moist as plants become established. Plants propagated from division or cuttings generally bloom the next year.
- Missouri Botanical Garden: Asclepias tuberosa
- The New Sunset Western Garden Book; Kathleen Norris Brenzel, Editor
- Lady Bird Johnson Wildflower Center: Asclepias Tuberosa
- The Gardener's A-Z Guide to Growing Flowers from Seed to Bloom; Eileen Powell
- Photos.com/Photos.com/Getty Images |
Unfortunately, malaria is not usually transmitted by only one species of mosquito within a given region or country, and even within mosquito species, populations may develop behavioral adaptations to avoid current vector control practices. Long-lasting nets and indoor residual spraying address the vast proportion of malaria transmission that occurs from the main malaria vectors, which bite people indoors at night during sleeping hours and then rest on indoor surfaces after taking a blood meal.
However, it is becoming increasingly recognized that malaria elimination will not be reached if we rely only on these existing ‘traditional’ intervention methods. We need new tools which can effectively reduce human-vector contact with the mosquitoes that bite people outdoors or outside of the times when people sleep under a bed net; or to target mosquitoes that bite people indoors and then rest outdoors after a bloodmeal. All of these require different approaches from what we have today.
For that reason, a suite of new tools for vector control is under evaluation. In a Guidance note of 2014, WHO recommends testing the effectiveness of the following strategies:
- Using physical screening barriers or repellants to exclude or limit indoor entry;
- Following entry, preventing successful indoor feeding and/ or resting using exit or other barriers, repellents or insecticides with no deterrent properties;
- Preventing successful outdoor feeding by using insecticide-treated clothing or repellants to directly protect people;
- Reducing adult vector densities or transmission potential by outdoor attractants to trap/kill mosquitoes by tropical or systemic insecticides for livestock by applying insecticides to natural sugar sources or introducing insecticidal sugar baits.
A joint effort of national institutions, private partners, researchers and WHO will be necessary to develop, validate and implement new approaches for targeting such residual transmission.
The Role of the Private Sector in the Future of Malaria Control
In addition, to new tools and new approaches with those tools, sustaining future funding for the fight in a pre-elimination setting will play a crucial role. As disease burden comes down, commitment and interest wanes, which can result in a resurgence of the disease. “Indeed, an arsenal of potent technologies was at the ready. Insecticide-treated bed nets had been shown to protect against malaria-carrying mosquitoes, which are active primarily at night. Indoor residual spraying with insecticides remained a safe and effective alternative. And a new generation of powerful drugs had been developed for the treatment of malaria.
Despite this arsenal, the fight against malaria had stalled,” commented Margaret Chan, former head of WHO in 2010. In this regard, the private sector can play an important role.
A good example for a successful public-private partnership model for malaria elimination is Sri Lanka, where cooperation between the government and the private sector partner considerably contributed to the elimination of the disease. In this situation, private support was temporarily provided to war-damaged areas of the nation in order to ensure the continuation of these efforts supported Sri Lanka to become one of the most recent countries to achieve malaria elimination, as it was certified as malaria-free by WHO in 2016.
There are various opportunities to engage private companies in small or large-scale projects. Targeted interventions such as immunization programs, distribution of long-lasting insecticidal nets (LLNs) and improved access to diagnostics and treatments can protect communities and part of populations that live in hard-to-reach areas. In-company campaigns can help raise awareness of malaria symptoms and of the importance of prevention efforts. The expertise and resources of the private sector offer unique opportunities to confront the challenge of drug and insecticide resistance.
An Optimistic Future or a Long Way to Go?
The efforts of the International community over the past 15 years have reduced malaria risk levels for many millions of people. This is suggestive that elimination targets are within our reach, with the right level of resources and commitment and with the right tools in our hands. The challenges are many, but the commitment is strong. The pipeline for new modes of action to mange resistance in malaria vectors looks promising. There is no shortage of innovative ideas for a large toolbox to address other elements of malaria transmission. An as economic development in some endemic countries advances, this creates less reliance on international funding, opportunities for different domestic funding mechanisms and different models of private sector management.
Bayer awaits the results of this years’ World Malaria Report with bated breath and remains hopeful that this year we will see positive progress towards malaria elimination goals.
Meanwhile, Sarah De Souza, Marketing Analyst with Environmental Science at Bayer in Ivory Coast, West Africa, has been dedicated to this topic for the last two years. “There was limited awareness of the relevance of crop protection usage of the ‘new’ class of repurposed chemistry in West Africa, which we are developing for Malaria Vector Control, said De Souza.
“For instance, if this insecticide class was widely used in intensive agricultural production environments, did that overlap with areas where malaria mosquitoes breed?” |
Have you ever wondered how it might have felt to walk around an ancient site like Stonehenge thousands of years ago? Using virtual and augmented reality technologies, now you can experience a sense of how it may have been. At Virtual Heritage we work with heritage organizations, archaeologists and historians, soundscape specialists, virtual reality designers and augmented reality developers to create simulations of heritage sites and archaeological locations as they might have appeared in the past.
As a taster, the video below takes you on a walk through Avebury in Wiltshire, a Late Neolithic stone circle and henge monument, as it may have looked 4,300 years ago at the summer solstice.
We are particularly interested in how virtual reality, augmented reality and 3D images can help to interpret and extend the understanding of historical sites for specialists and visitors alike. If you’d like to talk to us about our work, or have ideas for a project you would like to do, please feel free to contact us at [email protected] . |
The terms of marketing metrics and analytics are often used interchangeably, but they do refer to slightly different concepts.
What is a marketing metric?
A metric can be defined as a single measuring system that quantifies a trend, dynamic, or characteristic.
A marketing metric is an individual measure of a result, input/output or other factor related to marketing performance or financial results.
Examples of marketing metrics
Some examples of marketing metrics include:
- response rate
- brand awareness
- sales conversion
- market share
- return on marketing investment
- profit margin
- market penetration
- share of customer
As you can see, marketing metrics are all individual measures and essentially act as inputs to the overall analysis.
What is analytics?
Analytics is the process of combining appropriate metrics to gain a better understanding of the market, to identify insights, to evaluate marketing performance, and so on.
Therefore, analytics is the process of interrelating various metrics and using them together, not the actual metrics themselves.
Probably the most commonly known analytics system is Google Analytics. For example, to determine the overall level of engagement of a website, a marketer would review the following marketing metrics in a combined set.
- Number of page views per session
- Bounce rate
- Percentage of returning visitors
- Total time on sites
- Particular pages visited
Analytics = greater insight
By looking at multiple metrics at the one time, and perhaps interrelating them and even constructing additional metrics from them – acmarketer is able to generate far greater insight into the marketplace and their brand’s/firm’s marketing performance. |
|This article needs additional citations for verification. (March 2009)|
|Birth name||Athanasios Nikolaos Massavetas
Αθανάσιος Νικόλαος Μασσαβέτας
Ano Mousounitsa or Artotina, Phocis
|Died|| (aged 32–33)
|Years of service||1821|
|Rank||General (Hellenic Army) (posthumously)|
|Wars||Greek War of Independence|
Athanasios Diakos was born Athanasios Nikolaos Massavetas in Phocis, in the village of Ano Mousounitsa, or according to other sources in nearby Artotina. The grandson of a local outlaw, or klepht, he was drawn to religion from an early age and was sent away by his parents to the Monastery of St. John The Baptist (Greek: Αγίου Ιωάννου Προδρόμου), near Artotina, for his education. He became a monk at the age of seventeen and, due to his devotion to his faith and good temperament, was ordained a Greek Orthodox deacon not long afterwards.
Popular tradition has it that while at the monastery, an Ottoman Pasha visited with his troops and was impressed by Athanasios's good looks. The young Athanasios took offence to the Turk's remarks (and subsequent proposal) and the ensuing altercation resulted in the death of the Turkish official. Athanasios was forced to flee into the nearby mountains and become a klepht. Soon afterwards he adopted the pseudonym "Diakos", or Deacon.
Klephtis and Armatolos
Diakos served under a number of local klepht leaders in the region of Roumeli, distinguishing himself in various encounters with the Ottomans. He also served for a time as a mercenary in the army of Ali Pasha at Ioannina, Epirus, where he befriended Odysseas Androutsos, another klepht. When Androutsos became the captain of a unit of armatoloi at Livadeia, Diakos served for a time as his protopallikaro (literally "first warrior", or lieutenant). In the years leading up to the Greek War of Independence, Diakos had formed his own band of klephtes and, like many other klepht and armatoloi captains, had become a member of the Filiki Eteria.
Soon after the outbreak of hostilities, Diakos and a local brigand captain and friend, Vasilis Bousgos, led a contingent of fighters to capture the town of Livadeia. On 1 April 1821, after three days of vicious house-by-house fighting, and the burning of Mir Aga's residence, including the harem, the Greeks liberated the town. Hursid Pasha sent two of his most competent commanders from Thessaly, Omer Vryonis and Köse Mehmed, at the head of 8,000 men with orders to put down the revolt in Roumeli and then proceed to the Peloponnese and lift the siege at Tripolitsa.
Diakos and his band, reinforced by the fighters of Dimitrios Panourgias and Yiannis Dyovouniotis, decided to halt the Ottoman advance into Roumeli by taking defensive positions near Thermopylae. The Greek force of 1500 men was split into three sections. Dyovouniotis was to defend the bridge at Gorgopotamos, Panourgias the heights of Halkomata, and Diakos the bridge at Alamana.
Setting out from their camp at Lianokladi, near Lamia, the Ottoman Turks soon divided their force. The main force attacked Diakos. The other attacked Dyovouniotis, whose force was quickly routed, and then Panourgias, whose men retreated when he was wounded. The majority of the Greek force having fled, the Ottomans concentrated their attack on Diakos's position at the Alamana bridge. Seeing that it was a matter of time before they were overrun by the enemy, Bousgos, who had been fighting alongside Diakos, pleaded with him to retreat to safety. Diakos chose to stay and fight with 48 men; they put up a desperate hand-to-hand struggle for a number of hours before being overwhelmed.
The severely wounded Diakos was taken before Vryonis[need quotation to verify], who offered to make him an officer in the Ottoman army if he converted from Christianity to Islam. Diakos refused the offer, replying "I was born a Greek, I shall die a Greek" ("Εγώ Γραικός γεννήθηκα, Γραικός θε να πεθάνω" transliterated as: Ego Graikos yennithika, Graikos the na pethano). The next day he was impaled. According to popular tradition, as he was being led away to be executed, he said:
Poetic: Oh, what a moment Hades chose for me to perish. Spring grass everywhere and branches with blossoms to cherish. Literally: Look at the time Charon chose to take me, now that the branches are flowering, and the earth sends forth grass (Greek: Για δες καιρό που διάλεξε ο Χάρος να με πάρει, τώρα π' ανθίζουν τα κλαριά και βγάνει η γης χορτάρι - Ya thes kero pou dialexe o Haros na me parei, tora p' anthizoun ta klaria kai vganei i yis hortari).
This was a metaphor for the independence and freedom of Greece.
The brutal manner of Diakos's death initially struck fear into the populace of Roumeli, but his final stand near Thermopylae, echoing the heroic defence of the Spartan King Leonidas, made him a martyr for the Greek cause. A monument now stands at the bridge near Alamana, the site of his final battle. His alleged birthplace, the village of Ano Mousounitsa, was later renamed Athanasios Diakos in his honour. The Greek Army honoured him with the rank of General. Also streets and statues in several parts of Greece as well as in nearly every one of the larger towns and cities bears his name.
- Aiolos (2004), "Turkish Culture: The Art of Impalement", Hellenic Lines: The National conservative newspaper, retrieved 9 March 2011
||This article includes a list of references, but its sources remain unclear because it has insufficient inline citations. (March 2009)|
- Diamantopoulos, N. and Kyriazopoulou, A. Elliniki Istoria Ton Neoteron Hronon. OEDB, (1980).
- Brewer, David. The Greek War of Independence. The Overlook Press (2001). ISBN 1-58567-172-X.
- Paroulakis, Peter H. The Greeks: Their Struggle For Independence. Hellenic International Press (1984). ISBN 0-9590894-1-1.
- Stratiki, Poti. To Athanato 1821. Stratikis Bros, (1990). ISBN 960-7261-50-X.
- Athanasios Diakos Museum at Athanasios Diakos, Phocis, Greece (in Greek) |
Female Gender Bias in Schools Essay
Sadker and Sadker 1994 reported a startling fact that few people realize. Today”s girls continue a three-hundred year-old struggle for full participation in America”s educational system. During colonial times school doors were closed for young women seeking knowledge, and the home was considered the learning place for young women. The home, serving as the girls” classroom, was where young girls learned the practical domestic skills for their inevitable role as wife and mother.
However, in 1767 a school in Providence, Rhode Island, began advertising it would teach reading and writing to girls. At the bottom of the advertisement, in small print, was noted the inconvenient hours of instruction. The girls were being taught either before or after the boys” regular instructional time. At this time the teachers of the boys needed additional income and opted to teach girls before and after school for an awesome fee. Thus, the idea of educating girls was formulated Sadker & Sadker, 1994.
During the early nineteenth century, many cities began establishing separate high schools for girls. Most communities built one high school, but designated separate entrances for the sexes. The classes were on separate floors in single-sex areas where girls were taught by women and boys by men. Single-sex schools were now born! Following a considerable amount of frustration from attempting to receive an education at male-dominated colleges, men and women created a bold alternative–colleges for women. Finally, in 1972, a historic victory was achieved.
Congress enacted Title IX as part of the Education Amendments. The preamble Valentin, 1997 to Title IX states: “No person in the United States shall, on the basis of sex, be excluded from participation in, be denied the benefits of, or be subject to discrimination under any educational programs or activity receiving federal assistance” p. 1. Miraculously, a federal law made sex discriminations in schools illegal. Under Title IX, sex bias was outlawed in school athletics, career counseling, medical services, financial aid, admission practices, and the treatment of students.
From elementary school through the university, Title IX violators were threatened with the loss of federal funds Sadker & Sadker, 1994. Title IX legislation changed the mode of operation in our schools. Better athletic programs for girls were instituted. Teachers began to carefully analyze books and resource materials for bias. As the 1970s came to an end, high hopes for Title IX ending gender bias mounted. However, many schools simply did not take this law seriously. In many schools vocational programs remained segregated with cosmetology and secretarial courses only for women and electrical and automotive courses only for men.
In other schools, pregnancy was grounds for the expulsion of the teenage mothers, but not teenage fathers. Complaints were lodged, and paperwork was piled high Sadker & Sadker, 1994. During the budget cuts and staff realignment of the 1980s under the Reagan-Bush administration, the heart of the equality movement was stopped. Between 1972 and 1991 not one school in the United States lost a single penny of federal funds due to gender bias. However, Valente and Valente 2001 cited two Supreme Court decisions where boards of education were held liable for the violation of Title IX provisions.
The Supreme Court acknowledged in Franklin v. Gwinnet County Public Schools et al. 1992 and Davis v. Monroe County Board of Education 1999 that institutions could be held liable for individuals in those institutions who participated in discriminatory behavior toward females. During the 25th anniversary year, Valentin 1997 reported the following Title IX accomplishments: * From 1972 to 1995 college women athletes increased from 15 percent to 37 percent. * In 1996, girls constituted 39 percent of high school athletes, compared to 7. 5 percent in 1971. Between 1971 and 1994 college enrollment of female high school graduates increased from 43 percent to 63 percent.
* Between 1971 and 1994 bachelor degrees earned by females rose from 18 percent to 27 percent. * In 1994, women received 38 percent of the medical degrees, compared with 9 percent in 1972; 43 percent of the law degrees, compared with 7 percent in 1972; and 44 percent of all doctoral degrees, compared to 25 percent in 1977. The gender bias movement has taken root in America, and with or without a beating heart, it continues.
Gender Inequalities Encouraged Gender equity in education is the elimination of sex role stereotyping and sex bias from the educational process, thus providing the opportunity and environment to validate and empower individuals as they make appropriate career and life choices Hilke & Conway, 1994. Therefore, gender bias in education can be defined as treating boys and girls differently in schools. This includes how teachers respond to students, what students are encouraged to study, and how textbooks and other resources represent gender roles.
A study commissioned by the American Association of University Women AAUW in 1992 entitled “Shortchanging Girls; Shortchanging America” synthesized much earlier research and concluded that the average school is biased against girls in a number of ways. The study found that girls did not receive as much attention from teachers as boys, and boys were called upon to answer more abstract and complex questions than girls. Instead, all too often, female high school students focused on their bodies and neglected their minds. Early differences in the treatment of girls and boys can result in enduring learning patterns.
Skolnick 1982 reported that children spend more time with their teachers than any other adult with the exception of their parents. Consequently, teachers” expectations and actions have a profound effect on student achievement as well as self-esteem. What teachers say and do not say, their body language, what they do and who they call upon, form a hidden curriculum that is more powerful than any textbook lesson. Sadker and Sadker 1994 stated the self esteem of elementary girls remained high even though they received less time, less help, and fewer challenges from the teachers.
However, the constant reinforcement for passivity results in a decline in their independence and self-esteem. Sadker and Sadker concluded, as victims of benign neglect, girls are penalized for doing what they should and lose ground as they go through school. After 25 years of research, documentation reveals numerous examples where girls are denied opportunities to excel in the classroom. The sexism is subtle, and the bias very often is unconscious. Girls are rewarded for their conformity to classroom rules by simply being ignored, thus they pay a huge price for their compliance.
Sex segregation, both during play and in the classroom, polarizes the sexes and contributes to female invisibility. Well-meaning teachers often think they protect girls by this separation when, in fact, they encourage stereotypical patterns of passivity in girls and aggression in boys Wellesley College Center for Research on Women, 1992; Sadker & Sadker, 1984, 1994. Despite the loss of confidence and voice, the most profound effects of gender bias are evident in today”s high schools.
During adolescence many girls become over-socialized to contemporary stereotypical definitions of “femininity. ” The messages they receive from the popular culture and media cause many girls to become preoccupied with physical appearance and perfection. Many of the models which appear in leading fashion magazines today are commonly 23 percent below normal body weight. Eating disorders, once considered prevalent among young women on college campuses, are now common among high school girls. It has been estimated that as many as 66 percent of high school girls are engaged in dieting.
The stress of dieting and appearance undoubtedly uses energy that is necessary for learning in school Wellesley College Center for Research on Women, 1992; Pipher, 1994; Sadker & Sadker, 1994. Keyes 1976 interviewed adults that attended high school during the 1970s, and found that being popular was a top priority for girls. This was also true in the 1960s, when James Coleman conducted his classic study, The Adolescent Society. Sadker and Sadker 1994 found that in our present society, many girls think that being intelligent conflicts with popularity.
High school dreams consist of the following: to go to the prom with the right date; to be a cheerleader; to be chosen as most popular; and to be elected class officer. During most of the twentieth century an invisible line dissected the courses offered in our nation”s high schools. In the division of curricular, home economics was a female field, preparing girls for their roles as wives and mothers, while shop was reserved for boys. Women considered incapable of learning math and science when they were girls were written off by both teachers and parents and bear the scars of sexist schooling Sadker & Sadker, 1994.
Finally, girls are now learning the lessons that math matters. Girls are at last staying in math courses longer. Often school counselors harm young girls when they only want to help. Feeling sorry for girls enrolled in math and science courses, which they find difficult, school counselors often dismiss girls. This dismissal is less likely to be offered to male students. Young girls, though, tend to neglect to realize the high cost of their math/ science course dismissal.
When girls self-select out of math, science, and computer technology, they are making decisions that will affect the rest of their lives Sadker & Sadker, 1994. While girls appeared to gain ground in the sciences between 1960 and 1980, there is evidence that this trend is reversing. It is well documented that something occurs between junior high and high school that causes girls to lose interest, perceive science, mathematics, and computer technology as masculine endeavors and opt out of more difficult courses Wellesley College Center for Research on Women, 1992; Chapman, 1997; Sadker & Sadker, 1994.
Denied their history, discouraged from taking crucial courses that lead to key careers, concluding that the appearance of their bodies may be worth more than the quality of their minds, realizing they are not the gender of choice, and doubting their intelligence and ability, high school girls make the journey from adolescence to womanhood. It is abundantly clear that they pay a steep price for their passage Sadker & Sadker, 1994. Practical Solutions Achieving equity will require more than gender-balanced textbooks and gender-fair teaching practices.
The traditional curricula should be transformed to include the contributions, experiences, and scholarship of women. Boxer 1989 and Reis 1990 pointed out the considerable time needed for significant change to occur in educational practices, and the need for systematic support for effective implementation. However, the authors believe that teachers and educational leaders do have the ability to create transformative classrooms. Epp 1995 found the lack of women in leadership positions did not create a positive image for girls.
For example, a female teacher with a male principal sends a powerful message to girls about their leadership capabilities and their position in society. In 1995, only 19 percent of all principals at a secondary level were female. Despite many qualified female applicants in the job pool, females are often overlooked for leadership positions. Teacher education programs contribute to the problem. Rarely do students in teacher education programs receive gender equity training and instruction in gender-balanced teaching strategies.
Teachers need to learn how to identify gender equity in instructional materials as well as learn about specific scholarship and contributions made by women in their content areas. Teachers who receive this training may become important change agents once they arrive in the classroom Eckert & Tracy, 1995; Sanders, 1996. To achieve equity educators should begin the process early in the lives of girls. Guidance counselors and vocational educators need to provide career information to girls when they are in elementary school.
Self-perception of ability in mathematics, science, and technology has been found to be a high predictor of course selection and of choosing these areas as major fields of study. The relationship between self-esteem and success in these fields appears to be circular. Girls need female role models as mentors and opportunities to interact with women in the community who work in technical and nontraditional fields Kane, 1991. It must no longer be acceptable to parents or guidance counselors for students to opt out of difficult science or mathematics classes.
Students in China and other countries which require these courses do not perform differently by gender. Teachers must encourage girls as much as boys to pursue rigorous courses. Parents can increase science achievement by providing their daughters with science-related experiments at home, toys that are mechanical in nature, and science-related excursions Kahle & Meece, 1994. Educators can help parents become aware of the impact of the culture and teach them to empower their daughters with their support and active involvement Baldwin & Kielbaso, 1990.
Parents begin treating their female and male children differently as soon as they enter the world. This is reflected in several ways: a the way parents hold and plan with their children as infants, b the toys, books, television programs, and activities their children are exposed to as toddlers, and c the type of encouragement children receive when trying new activities Wellesley College Center for Research on Women, 1992; Sadker & Sadker, 1994.
Chapman 1997 and Hammrich 1997 recommend to parents that they should provide girls with puzzles, building blocks, and teach them to use common household tools as prerequisite skills needed for science Chapman, 1997; Hammrich, 1997. Conclusion It is imperative to spotlight the cost of gender equity to society and to change the instructive strategies used in all schools. Educators must take the responsibility to expand and enhance commitments to gender equity. Presently, the need for qualified scientists and engineers can not be met.
Therefore, the norm in the schools must include enticing female students to pursue the sciences. To understand the position of girls and women in education requires an understanding of changing structures and complex processes and a commitment to breaking down the barriers which continue to result in female disadvantage. If America is to hold the best possible future for our people and civilization, she cannot afford to waste a primary resource–our nation”s girls and women. |
What is CEAP?
CEAP vein classification system was developed in order to standardize the reporting and treatment of chronic vein disorders. CEAP allows physicians to now have a uniform diagnosis of vein disorders. Use of such a classification system improves the accuracy of the diagnosis and improves communication between specialists. The elements of the CEAP classification are:
- Clinical – what the patient’s vein looks like; severity of the problem
- Etiology – cause of the problem and whether it is inherited or not
- Anatomy – which veins are involved
- Pathophysiology – is there normal or abnormal blood flow? Is there any blockage?
According to the American College of Phlebology, “The CEAP vein classification system describes what the doctor sees on the physical exam, the cause of the problem, the location in the leg, and the mechanism responsible for the manifestation of the vein problem. If you, as a patient, were able to recognize what CEAP classification you are in, it might be helpful for you to decide if and when you should seek help.”
What are the 7 Categories of the Clinical Section?
While vein disorders are common in the legs and thighs, the symptoms and appearance of these disorders can be quite unique. These 7 categories help to standardize the vein disorder, which assists specialists in determining the cause and severity of each disorder.
- C0 – No evidence of vein disease.
- C1 – Superficial spider veins only.
- C2 – Simple varicose veins only.
- C3 – Ankle edema, which is the abnormal buildup of fluid in the leg (swelling).
- C4 – A brown discoloration of the skin develops in the area just above the ankle.
- C5 – A healed venous ulcer.
- C6 – An open venous ulcer.
What is the difference between spider veins and varicose veins?
Spider veins are very fine veins that are visible just under the skin on the leg. They are blue or purplish in color and usually form a tree-like pattern. If you press on the spider veins they will lose their color as the blood they contain is squeezed out. Varicose veins are dilated, twisted leg veins that are visible under the skin, particularly when standing. They may have a bluish color.
While the veins are different, spider veins are actually just smaller varicose veins. The presence of spider veins can be determined with a basic examination of the skin. Varicose veins require a more extensive examination that could include ultrasounds/dopplers and blood tests.
To learn more, visit Dr. Klein’s page on varicose and spider veins treatment options.
CEAP Classification – Why is it Important to Patients?
If you have any of the findings mentioned above, depending on the severity, you may wish to be evaluated by a doctor. The CEAP classification helps us to communicate the severity of the problem to insurance companies and to other doctors, as needed. If you feel symptoms in your legs and notice higher CEAP score type changes, you may want to make an appointment to be screened for the presence of significant vein disease. |
Battle of Wayna Daga
|Battle of Wayna Daga|
|Part of the Ethiopian–Adal War and Ottoman–Portuguese conflicts (1538–57)|
|Portuguese Empire||Ottoman Empire|
|Commanders and leaders|
|Emperor Galawdewos||Imam Ahmad ibn Ibrihim al-Ghazi †|
|8,000 Ethiopian infantry
500 Ethiopian cavalry
70 Portuguese musketeers
60 Portuguese cavalry
200 Ottoman musketeers
|Casualties and losses|
|Unknown||Extensive, but not precisely known;
160 Ottoman musketeers killed
The Battle of Wayna Daga (Amharic for "grape-cultivating altitude") occurred on 21 February 1543 east of Lake Tana in Ethiopia. Led by the Emperor Galawdewos, the combined army of Ethiopian and Portuguese troops defeated the Adal-Ottoman army led by Imam Ahmad ibn Ibrahim al-Ghazi. Tradition states that Ahmad was killed by a Portuguese musketeer, who had charged alone into the Muslim lines. Once the Imam's soldiers learned of his death, they fled the battlefield.
At the Battle of Wofla (28 August 1542), Imam Ahmad had crushed the Portuguese expeditionary force, killing most of its men, capturing practically all of the firearms they had, and capturing and killing its leader, Cristóvão da Gama. By any reasonable assessment, the Imam enjoyed a decisive victory over his greatest foe; armies in the Horn of Africa melted away with the death of their leaders. He then reduced the number of the mercenary Ottoman arquebusiers to 200, and relying on his own forces retired to Emfraz near Lake Tana for the coming rainy season. Miguel de Castanhoso states that these arquebusiers left his service because they were upset that he beheaded da Gama, whom they wanted to present to the Ottoman emperor. However, Beckingham notes that a Hadhrami chronicle states that some of them threatened the Imam's life unless he gave them 10,000 ounces of gold, to which he "gave a very favorable reply". When the rest of the group learned of their success, they came to the Imam and made a similar demand; deciding that he had no further need of their services, he sent them home giving them 2,000 ounces of gold.
However, Gama had inspired a fierce loyalty in his surviving followers, all but 50 of whom had reassembled after their defeat around Queen Sabla Wengel, and taken refuge at "The Mountain of the Jews", which Whiteway identifies as Amba Sel. De Castanhoso, writing decades after the fact, states that after the Emperor Gelawdewos had joined the survivors, and seeing the number of men who flocked to the Emperor's standard, at Christmas "we went to the Preste, and begged him to help us avenge the death of Dom Christovão." Gelawdewos agreed to march against the Imam. The Portuguese firearms which had been stored at Debre Damo were produced. A message was sent to a company of Portuguese soldiers who had proceeded to Debarwa to find passage home, but they failed to respond in time for the coming battle.
The allied forces spent the following months marching the provinces before heading to Imam Ahmad's camp next to Lake Tana. On 13 February 1543, they defeated a group of cavalry and infantry led by the Imam's lieutenant Sayid Mehmed in Wogera (roughly corresponding to the modern woreda of the same name), killing Sayid Mehmed. From the prisoners it was learned that the Imam was camped only 5 days' march away at Deresgue, and flush with victory the army marched to confront their enemy.
As with many of the battles in Castanhoso's narrative, published 20 years after the events they describe, the exact location where the two forces encountered one another is not known. General histories of Ethiopia are vague: Paul B. Henze, in his Layers of Time, implies the battlefield was near Lake Tana, and in a footnote states that much of the combat activity at this time "would seem to have been in Gaynt", the former province located southeast of Lake Tana. Richard Pankhurst in The Ethiopian: A History places the engagement in "Western Bagemder", which covered the area corresponding to the contemporary Debub Gondar Zone. Lastly, the name itself is of little help: "Wayna Daga" is the traditional Amharic word for the climatic regions between the higher, mountainous "Daga" elevations (2,600 meters above sea level and above) and the lowland "Qolla" elevations (between 1,400 and 2,000 meters above sea level). Most of the lands around Lake Tana fall into this middle climatic region.
Whiteway, in his introduction to Castanhoso's account, discusses the evidence he was able to compile for its location. Castanhoso himself does not name the place; it was Pedro Páez who first provided the name of "Wayna Daga". Paez's younger contemporary, Jerónimo Lobo, locates the battle at a place called Granhi Berr Jaaf Granhi, or "Granhi's Gate, Granhi's Tree"; Lobo was told the locale acquired this name when Imam Ahmad, finding himself mortally wounded in the battle, "in great pain and rage, took the unsheathed scimitar with which he was fighting and struck a blow on the trunk of a tree near him". Lobo adds that he was shown the place, tree and mark. James Bruce, travelling south of Dengel Ber over three centuries later, mentions passing "the small village of Waindega, famous for the decisive battle fought between King Claudius and the Moor Gragne", adding in a footnote that the village was "otherwise called Graneber."However, as Whiteway points out, "The difficulty that presents itself to my mind is, to understand by what possible strategy one army starting from Darasgue, and the other from Woggera, neither desiring to avoid an engagement, and both starting-places being north of Lake Tzana, the decisive battle could have taken place at its south-west corner." Bruce may have been of the same mind, for earlier in his lengthy account of Ethiopian history, when he recounts the Battle of Wayna Daga Bruce appears to indicate the two armies fought at the north-east corner of the lake. Whiteway notes that two explorers, Combes and Tamisier, who crossed the mountainous country north-east of Lake Tana in 1835 call that region "Ouenadega" or Wayna Daga, and he concludes his discussion by locating the battle there.
Once the Ethiopian-Portuguese army found the army of Imam Ahmad, they set up camp nearby; Emperor Gelawedewos advised against engaging the enemy right away, hoping that the 50 missing Portuguese soldiers would arrive soon as "in that country fifty Portuguese are a greater reinforcement than one thousand natives." Over the following days, each camp preceded to harass the other with cavalry raids. The allied side had the better of the exchange, keeping their opponents from venturing from their camp for supplies, until the Somalis managed to kill the leading Ethiopian soldier, Azmach Keflo, which demoralized the Ethiopian troops. Faced with the potential desertion of his force, Galawedewos decided he could wait no longer and prepared for an assault the next day.
The two forces started the main battle early the next day, with the Somali-Ottoman force divided into two groups. At first, the Muslim side succeeded in driving the allied side back, until a charge by the Portuguese and Ethiopian cavalry broke up the charge. At this point Imam Ahmad ibn Ibrihim al-Ghazi, with his son at his side, took to the field and led a renewed assault. It was in this charge that the Imam was killed by a bullet to his chest which threw him from his horse, although the sources differ in how he died.
According to Castanhoso, the Imam was recognized by the Portuguese arquebusiers, who directed their combined firepower at him, and one of the arquebuses in the group fired the fatal shot. Although he was an eyewitness to the battle, Castanhoso constantly emphasizes in his account the corporate identity of the Portuguese expedition after Gama's death: "We bore before us the banner of Holy Compassion (Sancta Misericordia); the Preste had sought to appoint one of us Captain, but we desired none save the banner of himself to lead us, for it was not to be anticipated that we should follow another, having lost what we had lost."
There is another tradition, at least as old as João Bermudes, and repeated by every other near-contemporary source (e.g., Gaspar Correia, Jerónimo Lobo), that gives the credit of Imam Ahmad's death to one João de Castilho; João charged into the Somali troops so he could fire upon Ahmad Gragn at point-blank range, an audacious act resulting in his death. Both Castanhoso and the story of João de Castilho return to agreement about Imam Ahmad's fate after this point: at the end of the battle, when Emperor Galawedewos offered his sister's hand in marriage to the man who killed the Imam, an Ethiopian soldier presented the Imam's head as proof of the deed; but a subsequent investigation revealed that the Portuguese had wounded him before the soldier had cut off the Imam's head, "thus he did not give his sister to that man, nor did he reward the Portuguese, as it was not known who wounded him".
As they heard of the death of the Imam, his followers fled the battlefield. Armies of that time and place tended to pledge their loyalty to a leader, not to a cause; most of his followers pragmatically looked to their own well-being. An exception was the captain of the Ottoman arquebusiers, who seeing
- that the Moors were giving way, he determined to die; with bared arms, and a long broadsword in his hand, he swept a great space in front of him; he fought like a valiant cavalier, for five Abyssinian horsemen were on him, who could neither make him yield nor slay him. One of them attacked him with a javelin; he wrenched it from his hand, he houghed another's horse, and none dared approach him. There came up a Portuguese horseman, by name Gonçalo Fernandes, who charged him spear in rest and wounded him sorely; the Turk grasped it [the spear] so firmly, that before he could disengage himself the Moor gave him a great cut above the knee that severed all the sinews and crippled him; finding himself wounded, he drew his sword and killed him.
Imam Ahmad's wife Bati del Wambara managed to escape with a group of the surviving Ottoman arquebusiers, 300 horsemen of her personal guard, and as much of the Imam's treasure as they could carry. The moment they left their camp, the victorious Ethiopian army poured in, slaughtering everyone they encountered except for women and children. Amongst the women were numerous Christian captives and, as Castanhoso tells the story, "some found sisters, others daughters, others their wives, and it was for them no small delight to see them delivered from captivity."
According to Bruce, there remained one enemy leader with a sizable force still at large, under one Joram. This Joram had driven Gelawadewos "from his hiding-place on Mount Tsalem, and forced him to cross the Tacazze on foot, with equal danger of being drowned or taken." Joram had been unable to join the Imam before the battle, and Emperor Gelawadewos learned he was hastening towards him, unaware that the battle had already been lost. Gelawadewos sent out a party who successfully ambushed him, "which closed the account of Claudius with his father's enemies."
The father of the Bahr negus, who had despaired of the rightful Emperor being restored to power and had come to be a valuable supporter of the Imam, sought pardon from Gelawadewos, offering Imam Ahmad's son in exchange; despite the Emperor's anger at the man's betrayal, out of respect for the Bahr negus, who had provided critical help in getting the Portuguese expedition into Ethiopia, Gelawadewos consented to the offer. The Imam's son later proved a useful prize, for he was later exchanged for the Emperor's own brother, Menas, who later succeeded Gelawadewos. A number of other Christians who had joined Imam Ahmed Gragn accompanied the Bahr negus' father into camp, but not having the influence or bargaining chip he did, the Emperor ordered the execution of some of them. Other individuals who sought his safe-conduct, the Emperor Gelawadewos granted it, "for there were so many that had he ordered all to be killed, he would have remained alone."
By Easter (25 March), it became clear to Gelawdewos that he would not be able to make a circuit of his newly-won empire to impress his authority on all parts of it before the start of the rainy season, so he set up camp "three leagues away" in an unnamed location on the shores of Lake Tana. Once the rains had ended, Emperor Gelawdewos began the long task of consolidating his rule.
- R.S. Whiteway, editor and translator, The Portuguese Expedition to Abyssinia in 1441–1543, 1902. (Nendeln, Liechtenstein: Kraus Reprint, 1967), p. 69; C.F. Beckingham, "A Note on the topography of Ahmad Gragn's campaigns in 1542", Journal of Semitic Studies, 4 (1959), p. 373 note
- Whiteway, pp. 56f.
- Sic. Early visitors to Ethiopia commonly erroneously identified the Emperor with the legendary Prester John
- Whiteway, p. 74
- Whiteway, pp. 75f
- Henze, Layers of Time (New York: Palgrave, 2000), p. 88 and note 15
- Pankhurst, The Ethiopian: A History (Oxford: Blackwell, 1998), p. 93
- Richard Pankhurst, Economic History of Ethiopia (Addis Ababa: Haile Selassie I University, 1968), p. 184
- Jerónimo Lobo, The Itinerário of Jerónimo Lobo, translated by Donald M. Lockhart (London: Hakluyt Society, 1984), p. 209
- Bruce, Travels to Discover the Source of the Nile (1805 edition), vol. 5 p. 210 and note
- Whiteway, p. lxx
- Bruce, Travels, vol. 3 pp. 213f
- Whiteway, p. lxxf
- Whiteway, p. 77
- Whiteway, pp. 78f. Castanhoso describes Keflo as "captain-general of the camp", which Whiteway believes was equivalent to the post of Fitawrari.
- Whiteway, p. 80
- Whiteway, p. 76
- See, for example, Jerónimo Lobo, The Itinerário, p. 209
- Whiteway, p. 82
- Whiteway, p. 81
- Bruce, Travels, vol. 3 pp. 215f
- Whiteway, pp. 84–6
- Whiteway, p. 86
- Whiteway, pp. 92ff |
The First Word: Grace and Healing
The First Word, by Patricia Harty.
Our hearts weep for Boston.
This most Irish of American cities has seen its share of tragedy, but when the bombings at the marathon turned a sporting celebration into a scene of destruction, it was a fresh horror that is hard to process.
This city, where at least a quarter of the population are of Irish heritage, is one of the cornerstones of our history in America.
When the news of the blasts hit, all that history came flooding back. Knowing the measure of the city’s hardscrabble past gave reassurance that Bostonians would rise above this tragedy, because that’s what they have always done.
It was to Boston that thousands of Irish at the edge of desperation would find their way during the Famine years. They crowded into the waterfront close to the docks where the men might find a day’s work and the women might find jobs as domestics. The unsanitary conditions were breeding grounds for disease. *Sixty percent of children did not reach their sixth birthday, and on average, the adult Irish immigrant lived just six years after arrival. (Patrick Kennedy, great-grandfather of JFK, was one of those adults who did not survive. He died of cholera, which had earlier taken his first-born son, John III, at just 18 months.) And still they clung on, and enough survived and eventually thrived. “Out of those narrow lanes, blind courts, dirty streets, damp cellars, and suffocating garrets will come forth some of the the noblest sons of our country, whom she will delight to own and honor,” wrote Orestes Brownson in the Quarterly Review in 1843.
Boston gave us two of her finest sons, and they too were taken from us. First John in 1963 and then Bobby in 1968. They would weep for their beloved Boston today. But we can hear JFK’s strong voice saying, “We have come too far, we have sacrificed too much, to disdain the future now.”
And indeed, the people of Boston inspired the nation as we witnessed ordinary citizens turn into heroes, and the emergency services and police operating at their highest levels. In the days following the bombings the community rallied to help families affected by the tragedy. A “Dance Out for Jane” was held for the Richard family of Dorchester. Eight-year-old Martin Richard was killed in the blast. Jane, his seven-year-old sister, lost her leg, and their mother, Denise, suffered a head injury. Jane was an Irish step dancer at the Clifton Academy of Irish Dance in Milton.
When tragedy strikes, it is often to the artists that we turn to raise our spirits and funds. Two New Yorkers, David Fagin and Jaime Hazan, wrote a song called “Boston Strong” that got a lot of play on YouTube. Hazan was a 9/11 first responder during the attacks on the World Trade Center.
In the wake of 9/11,“Amazing Grace” was the tune we heard most often at memorial services for the fallen. Judy Collins plucked this 18th-century hymn from near obscurity in the late sixties, and it has never really left our cultural consciousness since. Judy, who also composed her own anthem for 9/11 first responders called “Kingdom Come,” still believes in the power of music to heal. And I do too. |
Temporal range: 37.2–16.3Ma Late Eocene - Early Miocene
Entelodonts — sometimes facetiously termed hell pigs or terminator pigs — are an extinct family of pig-like omnivores endemic to forests and plains of North America, Europe, and Asia from the late Eocene to early Miocene epochs (37.2—16.3 million years ago), existing for about 21 million years.
The Entelodontidae were named by Richard Lydekker and assigned to Nonruminantia by Gregory (1910). They were then assigned to Artiodactyla by Lucas et al. (1998) and to Entelodontoidea by Carroll (1988) and Boisserie et al. (2005). While entelodonts have long been classified as members of the Suina, Spaulding et al. have found them to be closer to whales and hippos than to pigs.
Entelodonts are an extinct group of rather pig-like omnivorous mammals with bulky bodies, but short, slender legs, and long muzzles. The largest were the North American Daeodon shoshonensis, and the Eurasian Paraentelodon intermedium, standing up to 2.1 m (6.9 ft) tall at the shoulder, with brains the size of an orange.
Entelodonts had full sets of teeth, including large canines, heavy incisors, and relatively simple, yet powerful, molars. These features suggest an omnivorous diet, similar to that of modern pigs. Like many other artiodactyls, they had cloven hooves, with two toes touching the ground, and the remaining two being vestigial.
The most distinguishing characteristic of the animals, however, would have been the heavy, bony lumps on either side of their heads which are similar to a warthog's. Some of these may have been attachment points for powerful jaw muscles, but some were larger in males, suggesting they may have fought over mates.
Entelodonts lived in the forests and plains where they were the apex predators of North America's early Miocene and Oligocene, consuming carrion and live animals and rounding off their diets with plants and tubers. They would have hunted large animals, like the cow-sized artiodactyl Eporeodon major and the sheep-sized cameloid Poebrotherium wilsoni, dispatching them with a bite from their jaws. Some fossil remains of these other animals have been found with the bite marks of entelodonts on them. Like modern-day pigs, they were omnivores, eating both meat and plants, but their adaptations show a bias towards live prey and carrion. They were most likely opportunists, mainly eating live animals, but not rejecting carrion and roots and tubers in times of drought. Some entelodonts even exhibited caching behavior, as an Archaeotherium's cache has been discovered, made up of the remains of several early camels.
In popular culture
Entelodonts appear in the third episode of the popular BBC documentary Walking with Beasts, where in the program, the narrator always refers to the creatures as "entelodonts" rather than a more specific genus, such as Entelodon or Archaeotherium. The same creatures appear in another BBC production, the 2001 remake of The Lost World. Entelodonts were also the main focus of episode 4 of National Geographic Channel's show Prehistoric Predators in an episode titled "Killer Pig". The episode featured Archaeotherium (identified as "entelodont") as being the top predator of the American Badlands, and how it evolved into the even larger Daeodon ("Dinohyus").
- Adrienne Mayor Fossil Legends of the First Americans. Princeton University Press, 2005. p. 213
- PaleoBiology Database: Entelodonts, basic info
- W. K. Gregory. 1910. The orders of mammals. Bulletin of the American Museum of Natural History 27:1-524
- S. G. Lucas, R. J. Emry, and S. E. Foss. 1998. Taxonomy and distribution of Daeodon, an Oligocene-Miocene entelodont (Mammalia: Artiodactyla) from North America. Proceedings of the Biological Society of Washington 111(2):425-435
- "Relationships of Cetacea (Artiodactyla) among mammals: increased taxon sampling alters interpretations of key fossils and character evolution". PLoS ONE 4 (9): e7062. 2009. doi:10.1371/journal.pone.0007062. PMC 2740860. PMID 19774069.
- Walking With Beasts, episode 3
- M. Mendoza, C. M. Janis, and P. Palmqvist. 2006. Estimating the body mass of extinct ungulates: a study on the use of multiple regression. Journal of Zoology 270.
- Savage, RJG, & Long, MR (1986). Mammal Evolution: an illustrated guide. New York: Facts on File. pp. 209–210. ISBN 0-8160-1194-X.
- Palmer, D., ed. (1999). The Marshall Illustrated Encyclopedia of Dinosaurs and Prehistoric Animals. London: Marshall Editions. p. 267. ISBN 1-84028-152-9.
- "Entelodont General Evidence". BBC Worldwide. 2002. Retrieved 2007-11-21.[dead link]
- http://www.abc.net.au/beasts/factfiles/factfiles/entelodont.htm Video, images & sound
- http://digital.lib.uiowa.edu/u?/geoscience,34 Entelodont Skeleton |
In this seminar we will focus on how totalitarian rulers have been depicted in film. We will explore the range of portrayals of the ruler, from the dictator as buffoon to the dictator as monster. Our guiding questions will be: What purposes does it serve to regard the dead dictator as one-dimensional? How long after the end of dictatorship do sympathetic or nuanced portrayals begin to appear? Is it more controversial to treat him seriously or satirically? Beginning with Chaplin’s 1940 classic The Great Dictator, Hitler and Mussolini will feature prominently in our films; we will also visit an unnamed Latin American country, and dictator Idi Amin in Uganda.
Each student is responsible for watching the weekly film prior to our class meetings, and submitting a short written exercise to the whole group by midnight on the eve of class. In addition, each student will be responsible for one short classroom presentation, introducing the film before the class discusses it. Students are expected to attend class regularly and participate actively in discussion, and enjoy the films! |
If you’re a follower of my work, you’ll know that one of my favorite Maria Montessori quotes, which I regularly like to share with clients of my coaching practice, is that she famously described the hands as “the tools of intelligence.”
It should come as no surprise then, that activities as simple as opening and closing bottles would be encouraged among our children. Any size bottles with varying screw caps and lids will work, perhaps even an empty spice jar will do the trick.
This simple task requires your child’s eye-hand coordination, a refinement of fine motor skills and a strengthening of dexterity. It asks all ten fingers to work together to achieve the end result. Best of all, it develops your child’s pincer grip, which is an essential and preliminary component of knowing how to hold a writing utensil, such as a pen or pencil. Imagine the head start it can give them once they start putting pen to paper!
The key here is to make these open-and-closeable objects available to your child and allow them to explore at their own pace. Ideally, you can provide them with bottles that don’t have any labels, as this adds an unnecessary distraction to the task. If there are multiple bottles with varying tops, however, they’ll have the added challenge of using visual discrimination to correctly match the items, which is also beneficial to their development.
I like this activity for a child as young as 20 months, but this is a good one all the way up to a 2.5-year-old and is a wonderful way to stimulate their independence. As a friendly reminder, never show a child how to open a medicine bottle!
For more tips on how to introduce Montessori activities, read The Nine Key Points to Sharing a New Activity with Your Child.
P.S. Would you like more support and guidance setting-up your Montessori home? If, yes then go ahead and schedule a ‘Discovery Session’ with me. It’s free and you’ll know if we are a good fit. 😉 |
The aging of societies is a global phenomenon. In the United States alone, the life expectancy for both men and women will continue to increase over the next few decades and with that a population explosion of older adults. The dramatic increase in the number and diversity of older adults elevates the visibility of gerontological matters. As a result, social work practice is becoming more multigenerational, thereby demanding social workers, regardless of their professional endeavors, to be equipped with the most innovative theories and practices to serve older adults and their families.
This comprehensive text spans the new knowledge and skills required in direct practice areas, group work, and macro practice. It also outlines the Geriatric Social Work Competencies, as developed by social work educators, necessary to serve the older adult population and suggests how these competencies can be integrated into foundation curriculum.
Social work educators, students, practitioners, administrators, and policymakers will find updated, useful information in this text regarding
- assessment tools
- cultural influences
- evidence-based practices
- intervention techniques
- theoretical examples.
“Individuals are living longer and healthier lives in part because of the extraordinary growth of biomedical knowledge and public health initiatives. The confluence of the rapid and large increase of the older population and the exponential increase in the dissemination of knowledge create an imperative for social workers to employ the most recent knowledge in their practice with people living increasingly long lives.”
Department of Social Welfare
University of California, Los Angeles |
A Part of Conversation Questions for the ESL Classroom.
- Do you think English is a difficult language to learn?
- Have you ever spoken English on the phone?
- How often do you practice your English?
- What is your favorite way to practice your English? (UK spelling = favorite)
- What is the most difficult thing about English?
- Why are you learning English?
- What do you think you will be able to do in English in the future?
- Do you think that English will completely dominate all the other languages in the future? If yes, how will it affect the world?
- How much time do you spend looking out of the window during class?
- If you are really absorbed in lessons, do the classroom arrangement matter?
- How do you use the Internet to learn English?
- What search engine do you use most often when you study? Why?
- Do you think English is a difficult language to
- What is your favorite way to practice your English?
- What do you think you will be able to do in English
- in the future?
- How can English language help you advance in your career?
- Which country is the best place to study English?
- Are you willing to get a tutor just to further learn English?
- What is the best way to teach vocabulary at the upper intermediate level EFL?
- What kind of dormitory room would you like to stay in?
- In your own teaching environment what forms of pronunciation of English are learners likely to encounter?
- How can I listen to conversations and improve my pronunciation?
- What do you like about your classroom?
- Who cooks Thanksgiving dinner in your home?
- How do you cook the turkey?
- When do you eat?
- Why do you think people celebrate Thanksgiving Day?
If you can think of another good question for this list, please add it.
Copyright © 1997-2010 by The Internet TESL Journal |
You may have heard the term API before. For example, you may hear it if you try to integrate an existing service into your website. An invoicing website may use the API of a payment service provider to facilitate user payments in the website. Or, a mobile app may use a text-to-speech API to include this feature for the users of the app. But what is an API exactly, and how can you save money by using an API?
Defining an API
API stands for Application Programming Interface. It is a way for a developer, or a company, to expose their data or service for others to use. Others, means other developers, companies or simply other applications. And by exposing, I mean giving access to the functionality without revealing the source code or all the data in the database. Using an API has a lot of advantages when exposing a functionality to others. Not the least of which is controlling who has access to what. Users often access an API by providing an access code (or token). Based on this access code, the user can be identified, and their access is determined.
How an API saves you money
So, now that we know what an API is, the question is how does it save you money? Well, let’s say for example, you are a developer and you want to create a chat app. And, you want to keep the app family-friendly so everyone could use it. In this case, you have to make sure that all the messages exchanged through the app do not contain any curse words. Because the app is very popular, and millions of users are on it, it is not possible to manually moderate all the messages. The logical solution would be to automatically inspect every message, and flag it, if it’s inappropriate.
Even if technically you could develop this feature on your own, it would take you considerable effort to create something useable and fool-proof. And, even if you do decide to spend the time and effort to build this yourself, there’s the added work of having to maintain it. Unfortunately, curse words tend to evolve and change with time, so the database needs to be maintained and monitored all the time.
If you need it, someone has done it before
Instead of doing all this work yourself, you could use an existing API that provides this feature for you. As the saying goes, if you need it, someone has done it before. If you could use an existing API that provides a feature you’re looking for, this can potentially save you a lot of time and money as a developer. A great resource to search for available APIs, is a website called ProgrammableWeb. It has a huge searchable database of available APIs along with information about them.
Saving money as a client
Using an API can save you money not only as a developer, but as a client as well. For example, if you want to create a social networking website, and you hire a developer to create the website for you. To create a website like this, the developer will have to work on these key areas:
- Database: where all the website data will be stored.
- Backend code: this is usually the code that performs the business logic, and accesses the database.
- Front-end code: this is the user interface that the user sees and interacts with. For example, the buttons and forms on the website.
Out of these three areas of the website, the backend code can be implemented as an API. And this is where you will potentially save money. Let’s say, after some time, the website becomes very popular and you decide you want to create a mobile application to go with the website. Well, if the backend was created as an API, then the only thing that the developers have to do is to create the mobile app’s front-end code. This is because the database is the same whether the data is being accessed by a website or a mobile app. And the backend is already an API, which can be used by a website or a mobile app.
Using APIs saves time and effort for developers, and ultimately, this means saving money for clients as well. So, for your next project, ask the developer if they’re going to use an API or not. And, if not, let them know the benefits of using an API. Here at W3 Applications, we always use APIs when creating web or mobile applications. This not only saves us time and effort, but saves money for our clients as well. If you have any questions about this, leave a comment here, or use the contact form. Thanks. |
Greetings Earthlings! 🙂
In this week’s post I’m going to briefly explore the history of autism.
So gather round for storytime! 😀
As autism rates increase, many people have come to believe that the condition is relatively new. Whilst the clinical term may be in it’s infancy, autism can in fact trace it’s genetic lineage back through millennia!
Genetic research has shown that some of the key genes involved in the development of autism came from our shared heritage with the apes, predating the evolution from monkey to man (somewhere in the region of 7 million years ago).
Other related autism genes are slightly more “recent” than this, having come into existence over 100,000-years ago.
Whilst a third of autistic genes may come about through spontaneous genetic mutation, from this evidence we can see that autistic genes were inserted into the genetic code of our ancestors for a reason.
Interestingly in ancient times, people that displayed autistic traits were in fact highly revered. Such autistic traits as exceptional memory skills, creative thinking, observational skills, heightened senses and extensive knowledge in important areas such as plants and animals (i.e specialist interests), would all have been greatly valued in an ancient community. The incorporation of these skills within the group would have been essential to their survival.
Experts also believe that autistic skills such as memory and attention to detail may have contributed to the creation of ancient cave paintings such as this one:
How often we focus on the negatives of autism that we fail to stop and consider the reasons these genes exist. If they were a hindrance to the human race, why have they not been eradicated through millennia of evolution?
I think Temple Grandin sums it up pretty well here:
And she would be right! 😉 Experts believe that autistic genes have been conserved to advance our intelligence. Variants of autistic genes have been linked to improved cognitive performance and the formation of new brain cells.
Such talented historical figures as Michelangelo, Mozart, Beethoven and of course, Albert Einstein, are all believed to have shown signs of autism- but history remembers them for their esteemed achievements, not their genetic quirks.
Something that we would all do well to think of when we commit autistic people to the annals of history in future.
So there we have it Earthlings, I hope you find this information as interesting as I found it 🙂 I could go on further buuuuttt I think I’ll spare you the clinical history of autism for another day 😉
Have a good weekend everyone! 🙂 |
The School Sport Award self assessment tool and development plan are designed to help schools to continuously improve the quality and quantity of physical education (PE) and sport opportunities and increase young people’s engagement in PE and school sport.
PE and school sport should be accessible to all and we would encourage schools to think about how they ensure their sessions are inclusive and how they engage with young people, including those with protected characteristics, to participate.
Here is a list of protected characteristics to consider and a list of related organisations that can provide support and guidance.
- Gender reassignment
- Marriage and civil partnership
- Pregnancy and maternity
- Religion or belief
- Sexual orientation
Here is a list of the key organisations for advice and guidance on the protected characteristics: |
Gnathostomiasis infections are rare worldwide. They're reported mostly in Southeast Asia, but are now also seen in Central and South America. This type of infection is considered by the Centers for Disease Control and Prevention (CDC) to be an emerging imported disease. This means that it's spreading around the world just as we do as travelers.
Gnathostomiasis is caused by gnathostoma spinigerum, a helminth-type parasite, which you are at risk for ingesting when you eat undercooked or raw infected foods, including freshwater fish, crustaceans (shrimp, crab, crayfish), frog meat, pork and chicken.
Humans aren't actually very good hosts for this parasite, which can live for as long as a decade in your body after you've been infected. We're unintended, accidental hosts for this organism -- they aren't able to reproduce inside a human body as they do inside other hosts. Good for you, but bad for the parasite. Instead, they live out their 10 to 12 year life cycle migrating throughout your body, causing swelling under your skin. |
- What is the difference between two dimensional art and three dimensional art?
- What is meant by 3 dimensional?
- How do you explain 2d and 3d shapes?
- Are humans three dimensional?
- How do you teach 3 dimensional shapes?
- What are the three dimensions of 3 dimensional artwork?
- Is a photograph 2d or 3d?
- What is a two dimensional artwork?
- What is the meaning of two dimensional?
- Are anime 2d or 3d?
- Are Photos 2 dimensional?
- What is another name for three dimensional shape?
- What is 3 dimensional art called?
- Is a sculpture 2 dimensional?
- What is 3d effect?
- Is a sculpture 3 dimensional?
- What are some examples of three dimensional art activities?
- What is a three dimensional sculpture?
What is the difference between two dimensional art and three dimensional art?
2-dimensional art includes only the length and width of a flat object such as a drawing, print, or painting.
3-dimensional art includes the length, width, and depth of an object such as a structure, building, or sculpture..
What is meant by 3 dimensional?
In geometry, a three-dimensional shape can be defined as a solid figure or an object or shape that has three dimensions – length, width and height. Unlike two-dimensional shapes, three-dimensional shapes have thickness or depth.
How do you explain 2d and 3d shapes?
A 2D shape is a shape with two dimensions, such as width and height; a 3D shape is a shape with three dimensions, such as width, height and depth.
Are humans three dimensional?
In everyday life, we inhabit a space of three dimensions – a vast ‘cupboard’ with height, width and depth, well known for centuries. Less obviously, we can consider time as an additional, fourth dimension, as Einstein famously revealed.
How do you teach 3 dimensional shapes?
HANDS-ON IDEAS FOR TEACHING 3D OBJECTSPlace different 3D objects into a bag or sensory tub and have your children describe them by feel. … Experiment to see how the different objects move. … Go on a 3D shape hunt in the environment.More items…
What are the three dimensions of 3 dimensional artwork?
Three-dimensional art pieces, presented in the dimensions of height, width, and depth, occupy physical space and can be perceived from all sides and angles.
Is a photograph 2d or 3d?
Although we live in, move through and see a world of three dimensions, most of the representations of that world are two dimensional. We view drawings or photographs on flat paper or computer screens. … Simple images can also be rendered in one dimension.
What is a two dimensional artwork?
When a work of art is classified as being 2-dimensional, it means that the composition possesses the dimensions of length and width but does not possess depth. All 2-dimensional pieces of art, such as drawings, paintings, and prints, are made up of shapes.
What is the meaning of two dimensional?
1 : of, relating to, or having two dimensions. 2 : lacking the illusion of depth : not three-dimensional. 3 : lacking depth of characterization two-dimensional characters.
Are anime 2d or 3d?
Traditionally anime has always been in 2D and many fans have become used to this and treat this as part of what anime is in General but as a medium and art form anime is subject to change and has been seen to be embracing 3D animation more often.
Are Photos 2 dimensional?
Photography, A Two-Dimensional Art. Photography is a two-dimensional art. It is also a more hands-off process than most other two-dimensional work – indeed, many of us work more within the confines of the computer than we do with physical prints.
What is another name for three dimensional shape?
Solid Shapes in Maths The three-dimensional objects having depth, width and height are called solid shapes.
What is 3 dimensional art called?
Sculpture is any artwork made by the manipulation of materials resulting in a three-dimensional object.
Is a sculpture 2 dimensional?
Sculpture, an artistic form in which hard or plastic materials are worked into three-dimensional art objects.
What is 3d effect?
In computers, 3-D (three dimensions or three-dimensional) describes an image that provides the perception of depth. … Popular products for creating 3-D effects include Extreme 3D, LightWave 3D, Ray Dream Studio, 3D Studio MAX, Softimage 3D, and Visual Reality.
Is a sculpture 3 dimensional?
Sculptures are a three dimensional artform, given shape and brought to life by various materials and many different techniques. The design of a sculpture can vary from it being embedded on a surface or a free standing object, or even a kind of unseen/unnoticed discovery.
What are some examples of three dimensional art activities?
Three dimensional art activities include things such as sculpture and clay work. Three dimensional artwork is art that can be looked at from many different sides or angles. Many crafts can be included in three dimensional art activities.
What is a three dimensional sculpture?
TYPES OF SCULPTURE & OTHER THREE-DIMENSIONAL MEDIA. Sculpture is any artwork made by the manipulation of materials resulting in a three-dimensional object. The sculpted figure of the Venus of Berekhat Ram, discovered in the Middle East in 1981, dates to 230,000 years BCE. It is the oldest example of artwork known. |
Many diseases are due to inflammation. In fact, the syllable 'itis' at the end of so many medical words indicates inflammation. Arthritis, for example, means an inflammation of the joints; appendicitis indicates an inflammation of the appendix; and gastritis, an inflammation of the stomach.
Inflammation produces pain, swelling, heat and loss of function. Chronic inflammation inflicts devastating effects on health. A list of common but seemingly unrelated health problems - asthma, allergies, heart disease, kidney failure, strokes and Alzheimer's disease - all have their genesis in inflammation. In addition, many of the 'diseases of old age' are simply the result of long-standing inflammation.
A vast number of drugs are taken to simply suppress or control these symptoms. They are called anti-inflammatory drugs. These drugs may initially be effective in easing the pain or reducing the swelling, but they do not deal with the underlying problem; they simply control the symptom for awhile. What is worse, they have major side effects, especially when taken for prolonged periods; your stomach may develop bleeding ulcers or kidneys may be damaged.
The good news is, your body is designed with its own ability to control, reverse and even prevent inflammation. Here are some ways to do this:
Some foods promote inflammation, while others prevent and relieve it.
AVOID THESE FOODS
Fatty red meat, fried foods, organ meats like liver and kidney, dairy products and egg yolks. (These contain pro-inflammatory substances)
Rice, pasta, refined flour products, e.g. dumplings, crackers and white bread (these elevate blood sugar and create hormonal imbalance);
Sugar, excess sweet fruits and fruit juices (elevate blood sugar);
Food flavourings, preservatives, artificial food colourings.
EMPHASIZE THESE FOODS
mackerel, salmon and other cold-water fish;
fresh vegetables and less sweet fruit;
virgin olive oil and olives, flaxseed, flaxseed oil and avocados;
oatmeal, nuts, seeds and whole grain.
DETOXIFY THE BODY
It is important to look for and clear up any sites of chronic infection in the body. Particular attention should be paid to the mouth (teeth and gums), the sinuses, the nails (fungal infections) and the skin. You may need the assistance of your medical practitioner for this.
Natural detoxification programmes using herbs, colonic irrigation, saunas, massage and liquid fasts are very effective. These may be necessary at regular intervals.
There are some specific anti-inflammatory supplements that will assist the body in correcting the imbalance that has produced the inflammation. These include:
a programme of vitamin and mineral supplements like the Cellular Nutrition Plan which I promote.
fish oil capsules (use a high quality variety from several different fish);
the antioxidants (vitamins A, C, E and selenium);
herbs: nettle leaf extract, aloe, boswellia and curcumin;
DHEA and vitamin E.
Chronic stress poorly managed produces certain chemical imbalances in the body that promote inflammatory responses. Learning to identify the stressors in one's life and developing effective stress management techniques are extremely important aspects of any programme for controlling inflammation. Develop an emotional and spiritual support system. Healthy relationships, prayer, meditation and other spiritual practices can greatly facilitate the healing process. |
The town of Ouazzane, where I grew up, is known in Morocco for its Koranic traditions and its crafts, of which weaving and tannery are the most representative. But in our childhood, after Morocco’s independence, we were, as kids, more interested in jobs that gave us something to have fun with. The spinning top was one of our favorite toys. The artisans who made them did not know about unemployment. These fabricators carried out their manufacturing operations, almost identically, using only their memory and rudimentary working tools.
History shows that the stages of artisanal manufacturing are phases through which countries pass in their transit towards more progress. But few countries have been able to promote artisanal trades through industrialization as the Germans have done. The reason is that the Germanic apprenticeship system, unique in its kind, has for centuries provided for the alternation, for the candidates in training, of a school education coupled with an apprenticeship with a “Master of apprenticeship“. In other words, if there is no place with the apprentice master, there can be no training of an apprentice who will then become a technician or even a specialist. It is the widespread application of this practice that has long promoted “Made in Germany” industrial products. This system is also found in countries of Germanic obedience such as Switzerland.
Thus, Germany had the chance to have the foundations to build on it a model of civilian development that could have set a benchmark for countries around the world. Unfortunately, the onset of the First World War and, above all, the Treaty of Versailles which followed, in our opinion, completely upset this prospect for the Germans.
Indeed, the treaty in question included financial requirements, reparations for war damage to France in the first place, but also to Great Britain, which will subsequently prove to be beyond the possibilities of reimbursement of defeated Germany. This remark is probably one of the factors that led the US Senate at the time to refuse to ratify this Treaty. The impossibility of repayment and the resentment of the Germans, as a result, constituted the seeds of the emergence of Nazism which led to the Second Great War.
During this war, Denmark, a small neighbor to the north, was among the first countries to be invaded in 1940 by the Germans. In this connection, it is reported that after a firefight incident between German soldiers and the Danish Royal Guard, a Colonel came out of the palace to inquire into the situation. Stirring a little heap on the ground with his cane, he asked one of his soldiers, “What is this?”. The soldier replied, “The brain of a German soldier, Colonel.” The Colonel concludes: “This is why they are so aggressive; they have such a small brain”.
This joke, macabre as it is, refers to a dichotomy that some observers have noticed among the Germans. On the one hand, they can efficiently manufacture complex machines. But, they sometimes seem to lack consistency when it comes to measuring the impact of their actions, or their words, on others. For example, they strive to make a clear separation between “Nazis” and “Germans”. Since there is no biological basis for such an assertion, one can only surmises that, for example, the money that the Germans pay to victims of Nazism would ultimately make people forget the horrors of the Holocaust. But, that would ignore an important detail. The Nazis are indeed fanatics of a particularly virulent strain; but they did not descend from another planet on earth. They are Germans too. I remember during a student discussion in the 1970s the startling exit of a German scholar who said: “If Hitler had won, I would be the governor of Lausanne now“.
The point is, Germany lost the war, and without the muscular financial and administrative intervention of the Americans, the Germans would have had no chance of becoming what they are today. After taking up residence there, the American delegates, like pragmatic people, encouraged the Federal Republic of Germany (FRG) to get involved in what the Germans did best, namely the machine tool industry. This equipment was exported all over the world with the US market as its first destination. US initiatives, along with their money and that of their Middle Eastern partners, have boosted the German economy, which quickly transformed to establish itself as Europe’s leading economic power. As a corollary, German industrial power has, in short, swept aside any hint of competition from other EU member countries. The regained Germanic economic power, supplemented by their sales force, has thus widened the deficit of the EU partners vis-à-vis the Germans. Most of the countries in the EU market then became debtors of Germany, which gave the Germans a unique lever to guide the EU’s financial, economic, industrial and agricultural policy as they saw fit. At the same time, this German metamorphosis must probably have acted like a drug on the minds of the Germans who began, after the fall of the Berlin Wall, to gradually distance themselves from their US mentor.
Seeing this, and once the Americans documented this behavior over a reasonable period of time, they, in turn, began to undo “the crowns they had previously plaited to RFA” Some observers, including ourselves, believe that the bankruptcy of Lehman Brothers, an investment bank long considered the gateway for German businessmen to the US market, and the Volkswagen scandal, also known as “dieselgate” , events initiated in the USA, are part of a set of acts decided by the Americans to punish the Germans for their behavior which has become hostile to the interests of Uncle Sam.
Further actions followed which hardened the entry of “Made in Germany” products into the US market. The Germans were supposedly touched in their pride and then turned to the Chinese market as an alternative. But, after a few years, German businessmen realized that this Asian market was locked from within and much more difficult to control than the US market.
However, the German economy is addicted to exports. For this reason, Germany seems to have no other solution than to reclaim the markets of our African continent. Considering the European rules in force, they must carry out their procedures through the EU, whose cogs they have perfectly mastered, as we have just said.
In this regard, to come to their end, EU strategists have in the past used to show their teeth to bend their counterparts in a negotiation. This is how they approached the negotiations with Morocco in the nineties by Mr. Franz Fischler, then European Commissioner for Agriculture and Rural Development. They have of course succeeded in forcing us into what they pompously called an Association Agreement and which we believe needs to be reclassified as an agreement for our enslavement!
But, this type of worn-out trick (showing fangs) no longer works with our African countries. First, as it has served enough, it became obsolete. Secondly, because the markets of our Continent are coveted by everyone and, henceforth, the preference will necessarily go to the best price which has often not been the case for EU companies. Finally, perhaps we Africans understand a little better every day that the German Prestige, which EU officials put forward to conduct their Business with others, no longer deceives anyone. It is at best a largely overrated reputation or, more simply, a facade slogan behind which hides the European desire, constant for centuries, to maintain their control over our raw materials in particular and our wealth in general.
However, only the effective entry into force of the Acfta (African Continental Free Trade Area) will show these people that we are better placed to manage our African affairs on our own. |
A new analysis of existing studies provides more support for the idea that cocoa in chocolate may actually be good for you.
But be cautious if you’re tempted to raid the candy aisle: While it seems to be beneficial, the impact of chocolate on day-to-day health isn’t clear.
And the researchers aren’t ready to offer recommendations about exactly how much chocolate — and what type — provides benefits that outweigh its unhealthy effects.
Whatever the case, “when balancing the benefits and risks,” said study lead author Xiaochen Lin, users “shouldn’t ignore the calories and sugar that may come with chocolate.” Lin is a graduate student at Brown University in Providence, R.I.
At issue: What do we know overall about the health effects of flavanols — a component of the cocoa in chocolate — on cardiovascular and metabolic systems? To gain more perspective, Lin and her colleagues reviewed 19 controlled trials that involved a total of 1,131 participants eating cocoa flavanols or a placebo.
The participants assigned to consume the flavanols either ate or drank as little as 166 milligrams a day or as much as 2,110 milligrams. They consumed the foods for as little as two weeks or as long as a year.
The amount of flavanols is not standard among chocolate products. A 2011 study in the Journal of Agricultural and Food Chemistry found that flavanol levels varied widely among popular dark chocolate candy products, although there were more than in milk or white chocolate.
With funding from the U.S. National Institutes of Health and the Mars candy company as well as the American Heart Association and drug maker Pfizer, the researchers found that those who ate the cocoa flavanol foods had lower levels of triglycerides, potentially boosting cardiovascular health. Also, tests suggested their bodies were doing a better job of controlling inflammation and blood sugar.
And “good” cholesterol levels also rose slightly in those who ate the cocoa flavanol foods, the analysis showed.
According to Lin, these differences were “small-to-modest” but still significant from a statistical perspective. The studies also suggest that the effects are the same regardless of whether people are overweight or have certain other health problems.
At this point, Lin said, there’s no way to know whether the apparent beneficial effect of chocolate will actually affect people’s health in a significant way. The authors of the analysis are calling for more research to gain insight into how the “short-term” apparent benefits revealed by the studies may affect people over the long term.
For now, Lin and her colleagues don’t know what to tell people about the best levels of chocolate consumption. However, the researchers do note that most of the studies looked at dark chocolate (also known as “bittersweet” or “semisweet” chocolate) specifically.
According to the University of Michigan, dark chocolate has high levels (more than 60 percent) of cocoa and little or no added sugar.
“The findings from the current study apparently shouldn’t be generalized to different sorts of chocolate candies or white chocolates” since they could have different levels of sugar and fat, said study co-author Dr. Simin Liu. He is director of the Center for Global Cardiometabolic Health at Brown University.
Why might chocolate be good for you?
John Finley, an adjunct professor of nutrition and food sciences at Louisiana State University, said cocoa flavanols may be beneficial because they fight off inflammation, which is linked to diabetes and heart disease.
Cocoa “is likely to be beneficial along with other approaches to improving health,” he said. But, he added, “cocoa is frequently combined with high-sugar products, which would be likely to cancel any benefits.”
Finley, who was not involved with the study, recommends taking cocoa flavanols through cocoa supplements — they are available in sugar-free forms — or as an addition to otherwise beneficial foods.
“I actually add it to oatmeal every day,” he said, sprinkling on 25 grams of cocoa — roughly 2 rounded tablespoons.
“I also suggest the extra-dark cocoa. It tastes better and may have more benefits,” Finley said.
The report was published recently in The Journal of Nutrition.
For more about adding dark chocolate to your diet, visit the University of Michigan. |
Currently, pet farming has become popular. To make sure they live long and healthy, we need to conduct regular home inspections.
1. Measure temperature
To check regularly at home, you can buy a special thermometer that measures a pet’s temperature by placing the probe in the ear. The normal temperature range of cats is 100°F – 102.5°F (37.7°C – 39.1°C). The average temperature in dogs is usually 101°F (38°C), but it is better if it is higher or lower than this by 1 to 2 degrees.
2. Measure and control your pet’s heart rate
For this process, you will need to prepare a stopwatch or a timer function on the smartphone.
– To measure the cat’s heart rate, just place your hand on the chest behind the cat’s elbow. Count beats for 15 seconds and multiplies the result by 4 times. The normal heart rate of cats is 140-220 beats per minute.
– To measure the heart rate of a dog, place the palm on the chest under the armpit. Count the beat similar to the above. The normal heart rate of a dog is 70-120 beats per minute (depending on the size of the animal).
– Check your pet’s eye problems: Eye problems are one of the most common reasons for dogs and cats to visit a vet. Eye infections have many different forms, one of the causes of blindness, leaving serious consequences. That’s why it’s important to check and clean your eyes. In case you notice that their eyes have any inflammation, do not hesitate to see a veterinarian.
3. Check ears to find ticks and scratches
A pet’s ear test can help you detect parasites and infections early. Check carefully both outside and inside. It should be noted that when a pet has one of the following symptoms: earache, smell, inflamed skin, a bump, strange object in the ear.
4. Weight control and attention to pet behavior
In addition to checking the body parts, you need to monitor the amount of food and behavior of the pet. Just like humans, obese pets are at risk for diseases that prevent them from living long. Pay attention when they are suddenly lazy, sad or have any unusual actions.
5. Check your pet’s fur and skin
Check your pet’s skin for scratches or parasites, especially when they play outside. Early detection of unusual symptoms is easy to find positive treatment for your pet. |
Dengue fever is a viral disease contracted through infected mosquitos. Primarily prominent through the tropics and subtropics of the world, there are only preventative measures residents and tourists can take to avoid being bitten. There is no known cure for the disease, so treatment measures are geared toward relieving symptoms. A correct diagnosis is required because signs of the disease mimic other unrelated conditions.
10. Outbreak 2016
An outbreak was declared in the Solomon Islands in October 2016 after cases of dengue fever continually rose for three months. Initially limited to Honiara and Guadalcanal, the declaration grew to include other nearby provinces eleven days later. In total, a reported 1,212 cases were examined, with the majority of patients being under the age of fifteen and between the ages of twenty-five and forty-nine. The male to female ratio was similar. The number of aerial sprays was ramped up by the government. |
Sports equipment, also referred to as sports goods, has different forms depending on the sport, but it is very important to complete the sport. Range of equipment from balls, nets and protective gear like a helmet. Sports equipment can be used as a defense mechanism or a tool used to help athletes to play sports. Over time, the sports equipment has evolved, because the sport began to demand more protective gear to prevent injury. Sports equipment can be found in any Department store.
In device Manager is the responsible person of equipment used the business or organization. Their responsibilities include purchase, maintenance, repair, inventory, transportation, storage, treatment and elimination. They are responsible for ensuring the proper equipment for the job, either on site or outside it. In sports, in device Manager is a person who is engaged in sports equipment teams. In professional and collegiate sports, its usually a full day and includes transportation, Laundry, repairs and regular maintenance.
In aerotrim is a 3-axis gimbal is large enough to hold a person is used for training the cardiovascular and learning senses of balance, plus pilots and astronauts. Aerotrims have been used in gyms during the 1980s years, but is currently out of production outside of professional applications. A handful of machines are still in use, mainly used for entertainment at fairs and events and as the science exhibits of science fiction in movies and on television. Several companies around the world picked up the idea and produced their own version with minor changes. One of the originals, made in Korea, can be found in Slovenia at Aerotrim Ekopool Celje.
Aquatic timing system is designed to automate the process of timing, Judging and scoring in competitive swimming and other water sports, including diving, Water Polo and synchronized swimming. These systems are also used in the preparation of athletes, and many products have been developed to assist in the learning process.
Assistive technology in sport is an area of technology design that is growing. Assistive technology-these are new devices created to ensure that sports fans, who have a disability to play. Assistive technology can be used in disabled sports, where an existing sport is modified so that players with a disability to participate or assistive technology can be used to invent completely new sports with athletes with disabilities exclusively in mind. The increase in the number of disabled people participating in sport, leading to the development of new assistive technologies. Assistive devices can be simple, "low-tech", or they can use the most modern technology, with some even using computers. Assistive technology for sports may also be simple or advanced. Accordingly, assistive technology can be found in sports ranging from local community recreation to elite Paralympic games. More complex assistive technology devices have been developed over time, and as a result, sports for people with disabilities "have changed from being a clinical therapeutic tool all competition-oriented activity".
Users also searched:
no need to download or install
Pino - logical board game which is based on tactics and strategy. In general this is a remix of chess, checkers and corners. The game develops imagination, concentration, teaches how to solve tasks, plan their own actions and of course to think logically. It does not matter how much pieces you have, the main thing is how they are placement!online intellectual game → |
Why Are We Still Banning Books in 2017
Did you know we’re still banning books?
When I was in high school, one of my favorite weeks as a reader was Banned Books Week. This annual event celebrates our freedom to read and highlights the value of open access to information, which often serves as a student’s introduction to the idea of banning books entirely. During this week, libraries encourage their readers to find books from the Top Ten Most Challenged Books list that is published annually by the American Library Association (ALA) Office for Intellectual Freedom. Some of my favorite book series, including The Hunger Games and Harry Potter, have been challenged for their content.
While Banned Books Week encourages our first amendment right, there is some discrepancy between what they advocate against and what actually happens.
Often, what they fail to mention during this week is that books listed are not truly banned from the libraries. There is a difference between the words ‘challenged’ and ‘banned.’ A challenged book has been called for removal or restriction based on the objections of a person or group. When a book is banned, the materials are removed from the libraries or curriculum. However, these removals rarely go unchallenged and the books do eventually find their way back into libraries.
Honestly, the attempt to censor information that makes us uncomfortable is not new. Before the printing press’ creation, handwritten books only existed in a few copies and the destruction of those books through burning often guaranteed that no one would read them. It was the easiest way to prevent the spread of ideas. Now, it’s much harder to prevent information from reaching the masses.
The Legal Standard for Banning Books
The First Amendment
Freedom of speech is a two-part argument for the topic of banning books.
First, the amendment states that no law can be made by Congress that abridges the freedom of speech. While that prevents government interference, private schools and libraries operate on a broader scale of possibility. Private companies have similar discretion to choose what they will and won’t accept for publishing.
Second, does reading constitute our freedom of speech? The answer, established by several Supreme Court cases, is yes. Our right to receive ideas through books and movies is a necessity. Without access to this information, our rights of speech and press and political freedom have been infringed.
The Library’s Right
While we are guaranteed access to information, libraries are not required to own particular works that do not uphold their standards. Libraries also have the freedom to decline requests to obtain a particular work, rather than banning or censoring what they’ve already collected. In terms of banning books, a public library cannot ban books based on their content if the challenge intends to suppress the ideas presented in the works.
Also, libraries are places dedicated to the pursuit of knowledge and enjoyment of written works. Libraries are public buildings that invite people from all walks of life to peruse their collections. The use of a library is voluntary, as is the content that we access while using that public service. We use the library and its resources for individual purposes. Because of this, public libraries are entitled to greater protection when it comes to freedom of speech.
Island Trees School District v. Pico
As mentioned before, the idea of censorship and banning books has been before the Supreme Court. A prominent case that established our current precedent for banned books is that of the Island Trees School District v. Steven Pico. In 1975, several members of the school board obtained a list of ‘objectionable books’ from a conservative parent organization. Despite their established policy, the board arranged to have the books removed from the libraries immediately.
When news of the removal found its way into the media, the board rejected recommendations to return the books to the library shelves. They claimed that the morals of the students were put at risk by making those books available because of the content discussed. In response to that decision, a seventeen-year-old high school student led a group of students who sued the school board.
Steven Pico and his classmates claimed that removing books based on the content was a denial of their First Amendment rights. After several attempts in smaller courts, the case eventually made its way to the Supreme Court. In a 5-4 decision, the Supreme Court ruled that our right to express ideas must be supported by an implied right to receive information and ideas from outside sources. They went on to say in their decision that, despite having authority over the content of speech in schools, that power is not absolute.
The Moral Decisions Surrounding Banned Books
A Parent’s Right To Decide
The ALA has reported over 6,000 book challenges between the years 1990 and 2000, with concerned parents often the source. That’s not to say that their concerns are not legitimate. Books are challenged for a variety of reasons, some which include: profanity, graphic violence, sexual content, witchcraft and the occult, politically incorrect language, and ‘new age’ philosophies. It is a parent’s right to decide what their children should be exposed to until the child is of age to make that decision themselves.
However, it isn’t fair to hold all students to the standards that one parent has set. Every family has a different set of values and ideas that must be respected. What they choose to be acceptable for their child might not reflect the ideals of another. Now, while writing this article, I knew that I was missing an element for this section. I’m not a parent and haven’t had to make these decisions. My mother, Andrea, was more than happy to lend her opinion on the subject of banning books.
As a parent, I feel that I’m more than capable of deciding what is right and wrong for my kids to read, as well as what they are exposed to. ~ Andrea Ballard
The Personal Choice of Readers
Another thing that must be considered is the personal choice of the readers. There is a limit to parental control after a certain age. Students are free to access information that their parents do not approve of. However, the decision in Island Trees School District v. Steven Pico clearly explains that a right to express ideas is dependent on receiving information and ideas from other sources. If a student has decided that they want to access material considered inappropriate, they will.
We need to consider the implications of being told that certain books are off-limits. In my experience, I am more likely to read a book that’s been challenged than one that hasn’t. I enjoy the conversations that it invokes when someone sees me with a ‘taboo’ book. Additionally, books with complex and nuanced themes are far more interesting to read. |
A longtime figure in Cleveland's underworld, Joseph Filkowski led the Polish bootlegging gang, the Flats Mob. In October 1930, he and two other gang members held a police officer captive during the gangs hold up of the Dixie Shoe Company, relieving him of both his gun and uniform.
Although successfully escaping, the incident resulted in gaining the attention of local law enforcement and, although escaping from a police trap on December 6, Filkowski associate Joseph Stazek was killed by Cleveland detectives the following day. Two days later, on December 9, a Patrolman Patrick McNeely accidentally shot Joseph Fortini, a district circulation manager of the newspaper The Plain Dealer, who McNeely had mistaken for Filkowski. The Fortini shooting would begin a lengthy, yet ultimately unresolved, inquiry into the use of police firearms.
The majority of the gang were eventually captured by authorities and sentenced to life imprisonment with the exception of Filkowski, who was sentenced to death. Filkowski's death mask is on display in the Cleveland Police History Museum.
- Morton, James. Gangland International: The Mafia and Other Mobs. Warner Books, 1998. ISBN 0-7515-2237-6. "Reprinted 2000, 2001. Non-Fiction. The moral right of the author has been asserted". Pages: 235-236, Chapter 10: Cleveland. |
This recent article, shared via @PeteGretzGCPS is an interesting read, about how to prepare students for innovation outside of school. I’d recommend taking the five suggestions on taping them up near where we plan lessons or even in our classrooms, as reminders of how we ought to be designing instruction for students.
- Play – learning can be fun and we need to give opportunities for play in our classrooms.
- Curiosity – inquiry will drive deeper learning and we need to develop and use student curiosity to fuel learning.
- Passion – when we think of personalization, we first need to know what our students are interested in and then find opportunities to match learning with these passions.
- Fearlessness – we can’t be afraid to make mistakes. We learn from them.
- Purpose – the work students take on need purpose; students should be working for making change rather than a grade.
These aren’t easy to do each and every day. But I was struck with how these qualities for promoting innovation also so closely align with deeper learning! |
While on a recent photography excursion at a local park I encountered what I thought was some sort of stick bug. It was so well camouflaged I probably would not have noticed it except that it had captured a Gulf Fritillary butterfly. After a few fruitless database searches, I discovered that this was not a stick bug at all.
This insect is a Brunner’s Mantis (Brunneria borealis), a rare mantid native to the southeastern United States. It has underdeveloped wings and does not fly. What is most interesting is that the species only consists of females and it reproduces asexually, laying eggs without male fertilization. Not much is known about their diet, but they apparently will consume the unwary butterfly. This specimen was about seven inches long hanging out in some low flowers and grass about a foot off of the ground.
You also might notice in the photo above a small fly on the mantis. This is likely a Milichiid, sometimes called freeloader or jackal fly. They are kleptoparasites often waiting on predatory invertebrates for a free meal. |
Title: The Recent Progress in RSV Vaccine Technology
Journal: Recent Patents on Anti-Infective Drug Discovery
Author: Doxa Kotzia
Vol.7, No.3, 2012
The most effective way to control RSV infection would be the development of an expedient and safe vaccine. Subunit vaccines, live attenuated RSV vaccines, plasmid DNA vaccines have been tested either in human or in mouse models without reaching the ultimate goal of efficacy and safety, at least in humans. Viruses such as adenovirus, sendai virus, measles virus were also used as vectors for the generation of RSV vaccines with promising results in animal models. Recent patents describe new techniques for the generation of candidate vaccines. These patents include virus like particles as vaccine platforms, recombinant RSVs or modified RSV F protein as component of the vaccine. Despite the number of the candidate vaccines, the new RSV vaccines should overcome many obstacles before being established as effective vaccines for the control of RSV infections especially for the young infants who are more susceptible to the virus.
For more information on the article: http://eurekaselect.com/103971/article |
|Systematic (IUPAC) name|
|Bioavailability||Not orally absorbed|
|ATC code||J01 QJ51|
|Molecular mass||380.42 g/mol|
|(what is this?)|
Meticillin (INN, BAN) or methicillin (USAN) is a narrow-spectrum β-lactam antibiotic of the penicillin class. It should not be confused with the antibiotic metacycline. In 2005, the name of the drug was changed from methicillin to meticillin in accordance with the International Pharmacopoeia guidelines.
Meticillin was developed by Beecham in 1959. It was previously used to treat infections caused by susceptible Gram-positive bacteria, in particular, penicillinase-producing organisms such as Staphylococcus aureus that would otherwise be resistant to most penicillins.
Its role in therapy has been largely replaced by flucloxacillin and dicloxacillin, but the term meticillin-resistant Staphylococcus aureus (MRSA) continues to be used to describe S. aureus strains resistant to all penicillins.
Meticillin is no longer manufactured because the more stable and similar penicillins such as oxacillin (used for clinical antimicrobial susceptibility testing), flucloxacillin, and dicloxacillin are used medically.
Mode of action
Like other beta-lactam antibiotics, meticillin acts by inhibiting the synthesis of bacterial cell walls. It inhibits cross-linkage between the linear peptidoglycan polymer chains that make up a major component of the cell wall of Gram-positive bacteria. It does this by binding to and competitively inhibiting the transpeptidase enzyme (also known as penicillin-binding proteins (PBPs)). These PBPs crosslink glycopeptides (D-alanyl-alanine), forming the peptidoglycan cell wall. Meticillin and other β-lactam antibiotics are structural analogs of D-alanyl-alanine, and the transpeptidase enzymes that bind to them are sometimes called penicillin-binding proteins (PBPs).
Meticillin is actually a penicillinase-resistant B-lactam antibiotic. Penicillinase is a bacterial enzyme produced by bacteria resistant to other B-lactam antibiotics which hydrolyses the antibiotic, rendering it nonfunctional. Meticillin is not bound and hydrolysed by penicillinase, meaning it can kill the bacteria, even if this enzyme is present.
Spectrum of bacterial resistance and susceptibility
At one time, meticillin was used to treat infections caused by certain Gram-positive bacteria including Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, and Streptococcus pneumoniae. Today, meticillin is not as effective against these organisms due to resistance.
Resistance to meticillin is conferred by activation of a new bacterial PBP gene (mec2). This encodes for the PBP2a. PBP2a works in a similar manner to other PBPs, but it is bound by β-lactams with very low affinity, meaning they cannot hydrolyse it and kill the bacteria. Expression of PBPA2 confers resistance to all β-lactams.
These susceptibility data are given on a few medically significant bacteria:
- Staphylococcus aureus - 0.125 - >100 μg/ml
- Meticillin resistant Staphylococcus aureus (MRSA) - 15.6 - >1000 μg/ml
- Streptococcus pneumoniae 0.39 μg/ml
Meticillin is insensitive to beta-lactamase (also known as penicillinase) enzymes secreted by many penicillin-resistant bacteria. The presence of the ortho-dimethoxyphenyl group directly attached to the side-chain carbonyl group of the penicillin nucleus facilitates the β-lactamase resistance, since those enzymes are relatively intolerant of side-chain steric hindrance. Thus, it is able to bind to PBPs and inhibit peptidoglycan crosslinking, but it is not bound by or inactivated by β-lactamases.
Meticillin is no longer used to treat patients. Compared to other β-lactamase-resistant penicillins, it is less active, can be administered only parenterally, and has a higher frequency of interstitial nephritis, an otherwise-rare side effect of penicillins. However, selection of Meticillin depended on the outcome of susceptibility test of the microorganism, since it is no longer produced, it is also not routinely tested any more. It also served a purpose in the laboratory to determine the antibiotic sensitivity of Staphylococcus aureus to other β-lactamase-resistant penicillins; this role has now been passed on to other penicillines, namely Cloxacillin as well as genetic testing for the presence of mecA gene by PCR.
|Wikinews has related news: Supergerm deaths soar, surpass AIDS in the United States|
- UK parliament MRSA
- Graham Dutfield (30 July 2009). Intellectual property rights and the life science industries: past, present and future. World Scientific. pp. 140–. ISBN 978-981-283-227-6. Retrieved 18 November 2010.
- MRSA—past, present, future
- Gladwin M., Trattler B. Clinical Microbiology made ridiculously simple. 3rd edition. Miami: MedMaster, Inc.; 2004. |
Bacterial vaginosis (BV) is the most common form of vaginitis worldwide and has been linked to multiple reproductive tract complications including preterm birth and increased risk of acquiring STD/HIV.1–3 The pathogenesis of BV is poorly understood and there is lack of consensus on a possible etiologic agent, if any. The majority of epidemiologic data, however, suggests that BV is an STD.4–7 Early on, in the recognition of this syndrome it was accepted that Gardnerella vaginalis was the causative organism; however, this fell out of favor when it was reported that G. vaginalis could be cultured from women who did not meet the Amsel criteria for BV.8 In retrospect, although these women did not meet the clinical criteria for the diagnosis of BV, they also may have not had normal vaginal flora. Although BV flora is characterized by a multitude of organisms, the presence of G. vaginalis in the vaginal flora of women with BV is universal. Studies of G. vaginalis in men have been limited and few studies of concordance among sexual partners have been published and none using polymerase chain reaction (PCR). We determined the presence or absence of this organism from genitourinary specimens of male sexual partners of women with and without normal vaginal flora using G. vaginalis-specific PCR.
Women attending the Jefferson County Department of Health STD Clinic for screening or a new problem were invited to participate in the study. Women were classified as having BV if they met the clinical criteria of Amsel et al.9 or as negative for BV if they did not fulfill this criteria. Women were administered standardized questionnaires regarding sexual behavior and a vaginal smear was obtained for Gram stain using the method of Nugent et al.10 Women were asked to refer sexual partners with whom they had had sexual intercourse within the past 2 weeks to the study for enrollment in the study. Men were also administered a questionnaire and examined for signs of STD. First fraction urine (15–20 mL) was collected, centrifuged, and the pellet resuspended in 5 mL of urine. The pellet mixture was refrigerated on-site then stored at −20 °C before processing. Swabs were obtained from the coronal sulcus and the urethra, placed into a dry sterile screw-capped tube, refrigerated on-site then stored at −20 °C before processing.
Total DNA was extracted from urine sediment, urethral, and coronal sulcus swab specimens by inorganic extraction (Wizard Genomic Purification Kit, Promega, Madison, WI).11 Amplification of a conserved sequence within the G. vaginalis 16 S rRNA gene was carried out using previously reported primers: GV-V6-U2 5′ GACCATGCACCACCTGTGAA 3′ and GV-V2-R1 5′ TCGTGGAGGGTTCGATTCTG 3′.12 Reactions were carried out in 20 μL containing template DNA, 1 × CoralLoad Buffer (Qiagen, Valencia, CA), 200 μmol/L of each dNTP, 0.5 μmol/L of each primer, and 0.025 U/μL of HotStarTaq Plus (Qiagen, Valencia, CA). Amplification conditions on an iCycler (BioRad Laboratories, Hercules, CA) were as follows: 95 °C × 5′/(94 °C × 30′; 60 °C × 30′; 72 °C × 30′) × 30/72 °C × 5′/4°C pause. Two negative controls were run on each amplification batch: water as template for reagent check and Mobiluncus mulieris. The positive control was laboratory cultured G. vaginalis. Amplicons were electrophoresed on 2% agarose/1 × tris acetic acid EDTA (TAE) gels prestained with ethidium bromide, followed by photodigital documentation. G. vaginalis positivity (a band of 1041 base pairs) was defined as a positive PCR from at least 1 sampling of the specimen set.
For comparisons of categorical data, Fisher exact test, and the χ2 test were used. The Wilcoxon rank sum test was used to compare groups about continuous variables because a number of variables were not normally distributed.
A total of 68 men were enrolled into the study, 29 (43%) as partners of women with BV and 39 (57%) as partners of women without BV. For the present analysis we limited inclusion to only those 47 (69.1%) men who had available specimens from all 3 sampling sites (urine, urethral swab, coronal sulcus swab). Women with BV by Amsel criteria had a median baseline Nugent score of 8 versus 2 for the women without BV (P <0.001). The only significant difference other than the baseline Nugent scores of the female partners was race. There was a significantly higher proportion of black subjects who were partners of women with BV than those who were partners to women without BV (Table 1). There were no significant differences between the 47 men who had samples available and the larger cohort (data not shown).
G. vaginalis was detected in 12 patients [25%, 95% confidence interval (CI) from 14% to 40%]. Urethral specimens were positive in 8/12 (66.6%) of the infected subjects. One patient had a positive result only from the coronal sulcus and 3 patients were positive only in the urine (Table 2). Twenty-six percent of partners of women with BV tested positive for Gardnerella versus 25% of partners of women without BV. There was no significant difference in the rates of G. vaginalis between men who were sexual partners of women with and without BV by Amsel criteria, women with and without normal Nugent scores of 0 to 3, or women with and without bacterial morphotypes on vaginal Gram stain that were consistent with G. vaginalis.
None of the 11 participants who stated that they had used a condom at the last sexual encounter tested positive for G. vaginalis in contrast to 12/36 (33%) of those who did not use a condom at the last sexual encounter (P = 0.04). None of the 5 participants who stated that they always used a condom in the previous 3 months were positive for G. vaginalis. In comparison, 12/42 (29%) of those who did not always use a condom in the past 3 months were positive for G. vaginalis (P = 0.31) (Table 3).
The significance of G. vaginalis in the pathogenesis of BV remains controversial; however, nearly all women with BV have high concentrations of this organism.13 Like Neisseria gonorrhoeae, it is a fastidious bacterium that is recovered primarily from genitourinary sites in both sexes and is unstable when removed from its natural environment.14 The human vagina provides an especially rich culture medium, the presence of glycogen being an in vivo growth requirement.15 In males, G. vaginalis has been repeatedly recovered from the urethra and from seminal fluid.16–20
Sexual contact studies point to the sexual transmissibility of G. vaginalis. In 1955, Gardner and Dukes reported that they had isolated Gardnerella from the urethras of 86% of husbands of women with BV.16 Similarly, in 1978, Pheiffer et al. demonstrated the concordance of Gardnerella among 79% of couples in which the woman had BV versus 0% of couples in which the woman did not have BV.21 Biotyping of G. vaginalis has yielded compelling results supporting the sexual transmission of this bacterium. Piot et al. found that biotypes isolated from women with BV and from the urethras of their sexual partners were identical 90% of the time.22 In a longitudinal study of G. vaginalis biotypes, Briselden and Hillier found that lipase-producing strains were associated with BV and that although not statistically significant there was an association between acquisition of a new biotype and new sex partners.23 Ninety percent of women who developed BV acquired a new biotype suggesting a new infection rather than relapse.23 Holst cultured the urethra, coronal sulcus, and seminal fluid of male partners of women with and without BV. They found that 17% of male partners of women with BV were infected versus 2% of partners of women without BV. Further, among men who had specimens taken within 20 hours of unprotected sex with women with BV and then 2 weeks later after interval condom usage, G. vaginalis was only isolated from specimens taken after recent unprotected intercourse.24
In our study, using PCR, we found an overall prevalence of G. vaginalis of 25% but found no difference in the prevalence rates between male sexual partners of women with and without BV. This unexpected finding may be the result of the fact that both groups of men were recruited from the same high risk cohort of patients attending an STD clinic. In fact, the overall prevalence of BV among women attending the clinic is between 50% and 60% (unpublished data). It is therefore possible that the male partners of women without BV were either exposed to abnormal vaginal flora in their referring partners at an earlier time or that they were exposed via a second partner. Although a few men had G. vaginalis detected externally from the coronal sulcus, most cases were detected using either urethral swab specimens or urine. Condom use with the last sexual encounter was significantly associated with a reduced rate of G. vaginalis detection and there was a similar trend for those men who reported always using condoms in the previous 3 months. Condom use has been shown in several recent studies to be protective for acquisition of BV in women.25,26 Additional studies examining concordance of BV-related pathogens in couples, especially couples at lower risk of STD, may be beneficial in contributing to our knowledge of the pathogenesis of BV.
1.Eschenbach DA. Bacterial vaginosis and anaerobes in obstetric-gynecologic infection. Clin Infec Dis 1993; 16:S282–S287.
2.Martin H, Richardson BA, Nyange PM, et al. Vaginal lactobacilli, microbial flora, and risk of human immundodeficiency virus type 1 and sexually transmitted disease acquisition. J Infect Dis 1999; 180:1863–1868.
3.Wiesenfeld H, Hillier S, Krohn MA, et al. Bacterial vaginosis is a strong predictor of Neisseria gonorrhoeae
and Chlamydia trachomatis
infection. Clin Infect Dis 2003; 36:663–668.
4.Moi H. Prevalence of bacterial vaginosis and its association with genital infections, inflammation and contraceptive methods in women attending sexually transmitted disease and primary health clinics. Int J STD AIDS 1990; 1:86–94.
5.Barbone F, Austin H, Louv WC, et al. A follow-up study of methods of contraception, sexual activity and rates of trichomoniasis, candidiasis and bacterial vaginosis. Am J Obstet Gynecol 1990; 163:510–514.
6.Hawes SE, Hillier SL, Benedetti J, et al. Hydrogen peroxide-producing lactobacilli and acquisition of vaginal infections. J Infect Dis 1996; 174:1058–1063.
7.Schwebke J, Desmond RA. Risk factors for bacterial vaginosis in women at high risk for STDs. Sex Transm Dis 2005; 32:654–658.
8.Totten P, Amsel R, Hale J, et al. Selective differential human blood bilayer media for isolation of Gardnerella (Haemophilus) vaginalis.
J Clin Microbiol 1982; 15:141–147.
9.Amsel R, Totten PA, Spiegel CA, et al. Non-specific vaginitis: diagnostic and microbial and epidemiological associations. Am J Med 1983; 74:14–22.
10.Nugent RP, Krohn MA, Hillier SL. Reliability of diagnosing bacterial vaginosis is improved by a standardized method of Gram stain interpretation. J Clin Microbiol 1991; 29:297–301.
11.Schwebke J, Lawing L. Improved detection of Trichomonas vaginalis
in males using DNA amplification. J Clin Microbiol 2002; 3681–3683.
12.Nath K, Sarosy J, Stylianou S. Suitability of a unique 16S rRNA gene PCR product as an indicator of Gardnerella vaginalis.
Biotechniques 2000; 28:222–224.
13.Hillier SL. Diagnostic microbiology of bacterial vaginosis. Am J Obstet Gynecol 1993; 169:455–459.
14.Funke G, Bernard KA. Coryneform Gram-positive rods. In: Murray P, ed. Manual of Clinical Microbiology. Washington, DC: ASM Press, 1999; 319–345.
15.Lam M, Birch DF. Survival of Gardnerella vaginalis
in human urine. Am J Clin Pathol 1991; 95:234–239.
16.Gardner HL, Dukes CD. Haemophilus vaginalis vaginitis. A newly defined specific infection previously classified “nonspecific vaginitis.” Am J Obstet Gynecol 1955; 69:962–976.
17.Keane FE, Thomas BJ, Whitaker L, et al. An association between non-gonococcal urethritis and bacterial vaginosis and the implications for patients and their sexual partners. Genitourin Med 1997; 73:373–377.
18.Masfari AN, Kinghorn GR, Duerden BI. Anaerobes in genitourinary infections in men. Br J Vener Dis 1983; 59:255–259.
19.Kinghorn GR, Jones BM, Chowdhury FH, et al. Balanoposthitis associated with Gardnerella vaginalis
infection in men. Br J Vener Dis 1982; 58:127–129.
20.Hillier SL, Rabe LK, Muller CH, et al. Relationship of bacteriologic characteristics to semen indices in men attending an infertility clinic. Obstet Gynecol 1990; 75:800–804.
21.Pheiffer TA, Forsyth PS, Durfee MA, et al. Non-specific vaginitis: role of Haemophilus vaginalis
and treatment with metronidazole. N Engl J Med 1978; 298:1429–1434.
22.Piot P, VanDyck E, Peeters M, et al. Biotypes of Gardnerella vaginalis.
J Clin Microbiol 1984; 20:677–679.
23.Briselden AM, Hillier SL. Longitudinal study of the biotypes of Gardnerella vaginalis.
J Clin Microbiol 1990; 28:2761–2764.
24.Holst E. Reservoir of four organisms associated with bacterial vaginosis suggests lack of sexual transmission. J Clin Microbiol 1990; 28:2035–2039.
25.Sanchez S, Garcia PJ, Thomas KK, et al. Intravaginal metronidazole gel versus metronidazole plus nystatin ovules for bacterial vaginosis: a randomized controlled trial. Am J Obstet Gynecol 2004; 191:1898–1906.
26.Schwebke J, Desmond RA. A randomized trial of metronidazole in asymptomatic BV to prevent acquisition of STDs. Am J Obstet Gynecol 2007; 196:517–522. |
What Is a Good Indoor Humidity In Winter?
For winter months, the ideal indoor humidity level would be between 30-40%. The reason we lower the recommended RH level to 10 percent is to avoid any condensation on the windows. As air is drier during winter, a humidifier can make a big difference in moisturizing the air.
What Is a Good Indoor Humidity In Summer?
For summer months, the ideal indoor humidity level would be between 30-60%. As air carries more moisture from the hot climate, a dehumidifier would make perfect sense to reduce dampness in a home. By increasing the RH level by 10 percent, it prevents the dehumidifier from overburden and a big surge on the electricity bill.
Ideal Indoor Humidity Level By Outdoor Temperature
The lower the outdoor temperature, the lower the indoor humidity level should be. This is according to the Minnesota Department of Public Service and many manufacturers’ manuals. Keep in mind that outside temperature is only one of the determining factors. You may also need to account for the number of windows, heating, and air conditioning in a home. The recommended indoor relative humidity level below will give a gauge of what needs to be set in a dehumidifier.
- If outdoor temperature is over 50˚F, indoor humidity level should not be more than 50%
- If outdoor temperature is over 20˚F, indoor humidity level should not be more than 40%
- If outdoor temperature is between 10˚F to 20˚F, indoor humidity level should not be more than 35%
- If outdoor temperature is between 0˚F to 10˚F, indoor humidity level should not be more than 30%
- If outdoor temperature is between -10˚F to 0˚F, indoor humidity level should not be more than 25%
- If outdoor temperature is between -20˚F to -10˚F, indoor humidity level should not be more than 20%
- If outdoor temperature is between -20˚F or lower, indoor humidity level should not be more than 15%
Ideal Indoor Humidity Chart
|Outside Temperature (°F)||Outside Temperature (°C)||Indoor Relative Humidity|
|+50˚F or higher||+10°C or higher||50%|
|+20˚F or higher||-7°C or higher||40%|
|+10˚F to +20˚F||-12°C to -7°C||35%|
|0˚F to +10˚F||-17°C to -12°C||30%|
|-10˚F to 0˚F||-23°C to -17°C||25%|
|-20˚F to -10˚F||-29°C to -23°C||20%|
|-20˚F or lower||-29°C or lower||15%|
Signs Of Excessive Indoor Humidity
Too much humidity will make you feel sick and uncomfortable all day long. This is because in a damp environment, the body cannot regulate its internal temperature through evaporation. Excessive moisture will also create a breeding ground for mold/ mildew, destroy your home structure and have an adverse effect on your health. In short, indoor humidity level above 60% is too high in a house so do look out for below signs and symptoms.
- Musty odor in your home, particularly in the basement, garage or crawlspace
- Visible mold growth in your home on wall, ceiling, tiles, and bathroom
- More pesticide and insects like dust mites, cockroaches popping up
- Water stains on wall and ceiling
- Visible condensation on windows
- Cupped wood floors
- Furniture started to crack, rot, swell and warp
- Peeling wallpaper or blistering “bubbles” paint
- Whole house feel warmer and stuffy despite at a normal room temperature
- Struggle to fall and stay asleep from excessive body heat
- Hot, sticky or muggy feeling at home
- Experiencing mold allergic reactions (Runny nose, red eyes, headache, itchy throat, postnasal cough)
- Fatigue from Heat exhaustion, dehydration
- Muscle cramp
- Breathing difficulties especially people with asthma and allergies
Signs Of Low Indoor Humidity
We are talking about dry air with a humidity level below 30 percent. Too little humidity will also affect your breathing comfort and damage your home possessions. You will feel the chill even at higher temperature due to our body moisture evaporates quicker. Low humidity will lead to all kinds of irritation mainly on your nose, skin, and throat. Even though the impact is not as obvious as excessive humidity, there are some clear signs that you are treading on thin ice.
- Dry, flaky, and itchy skin
- Eczema, allergy, and asthma flare-ups
- Chapped and cracked lips
- Sore, scratchy throat (from dry out mucous membranes)
- Coughing, wheezing, and chest tightness
- Breathing difficulty
- Sleepless night from constant night cough and throat irritation
- Increase in static electricity
- Cracking, warping and shrinking dried wood e.g. door frames, cabinet, chairs, tables
- Creaking wooden floor
Maintaining Ideal Indoor Humidity In House
Managing indoor humidity should be the utmost priority for every homeowner. Here are some quick tips to maintain the indoor humidity level within 30-50%. For places with high humidity problems, avoid steam shower, boiling water, or drying clothes inside. Opt for a cold shower and dry your clothes outside instead. Open windows and doors if you’re not running on any air conditioner or ventilation. Otherwise, use air conditioner, exhaust ventilation fan to prevent air from being stagnant. Fix any leaky pipes, crack roof or clogged gutter. Caulk and seal windows and doors to prevent hot air from creeping out and cold air from infiltrating. Little things like charcoal briquettes, desiccants or moving your house plants away do help but at a minimum level.
For places with low humidity problems, just do the opposite of what we have alluded earlier. Feel free to boil water with stove, enjoy a hot shower and dry clothes indoor. Get more houseplants that will clean the air and provide moisture. This may sound weird, placing bowls of water at every corner does help bring room dampness up. Remember to inspect home ventilation, ductwork, and insulation for any leakage while you’re at it.
But none of the above methods is as effective as getting a humidifier or dehumidifier. It is without a shadow of a doubt the best tool to maintain ideal humidity in a house. A humidifier increases the dampness level in your home by dispersing moisture. Dehumidifier does the opposite by decreases the dampness level with moisture absorption. While both machines will work in conjunction with an air purifier, air conditioner, and heating system, there are some running costs on it. In the long run, it is definitely worth every penny you paid as it can save you from enduring countless home repair damage caused by rotting building material. More critically, you can never put a price on one’s health. |
Wednesday, July 11, 2012
How to Make Good Decisions
How many of you think that your driving skills are better than average? In a typical poll, 90% of respondents say that they are better than average drivers.
Let me tell you about a person I know. Linda is thirty-one years old, single, outspoken, and very bright. She majored in philosophy. As a student, she was deeply concerned with issues of discrimination and social justice, and also participated in antinuclear demonstrations.
Which do you think is more probable? 1) Linda works in a bookstore and takes yoga classes. 2) Linda is a bank teller. Most of you probably chose 1 over 2.
Now, another comparison. Which do you think is more probable? 1) Linda is a bank teller. 2) Linda is a bank teller and feminist. Most of you, I know, chose 2 over 1. However, ,think twice.
Linda being a bank teller and feminist is clearly a subset of Linda being a bank teller. The probability of Linda being a bank teller and feminist cannot be higher than the probability of Linda being a bank teller. However, you made an apparent logical mistake. Why do you think so? It is because you formed a stereotype in your mind when I described Linda.
The Linda test is from Danielle Kahneman’s book Thinking, Fast and Slow (2011). In this book, he suggests that we have two thinking systems: system 1, which is fast and intuitive, and system 2, slow but meticulous. Because we are lazy (according to Kahneman’s description), or because we seek efficiency in as many occasions as we can, we try to avoid the effortful system 2 as much as possible. In most cases, the system 1 will handle problems as they arise, and system 2 will occasionally check the validity of the system 1’s answers. Therefore, most of the time, we can respond fast with minimal efforts. This is also what Malcolm Gladwell describes in his book, Blink(2005).
When you hear the description of Linda, your system 1 responds accordingly, and searches through your cached database for plausible answers. The quick answer comes from the patternized knowledge database you have stored in your brain. In your patternized knowledge, Linda sounds more like a bank teller who is a feminist as well, rather than just a bank teller. So you choose the more plausible description even before engaging the system 2 to verify if the conjecture makes sense at all.
As a conclusion, here is my suggestion for your decision making, based on my reading of those two books, Thinking, Fast and Slow, and Blink. When you face a decision-making situation, your system 1 will automatically engage and provide a quick answer. Pause for a second at this moment, and effortfully engage the system 2, if you think the decision is worth the efforts. If your system 2 concurs with your system 1, you have the best answer you can have. If not, ask another question. Am I super-confident about my system 2 answer? If yes, go with it. If no, you’ve better stick with your system 1’s original answer. Probably, your intuition (based on your lifetime experiences) produced a good answer, even though you cannot quite articulate the reasoning verbally. |
What is an SDK?
SDK stands for Software Development Kit (also called devkit), which explains what it is – a kit. According to Braze, a software development kit is formed of 3rd party written codes that can be added to the digital applications to support new capabilities. It is like a pre-built tool or application segment. Although SDKs are commonly used for mobile applications, it is possible to use them on websites or other digital platforms.
One common analogy to explain SDKs better is comparing them to the kits for model planes. You have the necessary items within the kit such as model plane pieces, glues, and other tools needed to put them together, instructions, etc. SDKs work in a similar way, they come as kits of a set of documents, codes, libraries, and other tools needed to construct applications on a specific platform.
What Does an SDK Contain?
The content of an SDK varies depending on whether the kit is designed for an operating system, a particular programming language or a hardware component, etc.
SDKs should contain interfaces to connect software and also the tools needed in the development process. These components are:
- APIs (Application Programming Interface)
- Run-times and development environments
- Network Protocols
- Examples and test projects
Some SDK manufacturers call their software with alternative names, such as JDK, Java Development Kit. JDK is a software development kit developed to build software on Java. To execute Java byte codes, you need Java Runtime Environment (JRE) which is a component of JDKs. Basically, JDKs contain everything JRE contains and also compilers and debuggers like other SDKs. Oracle and OpenJDK provide JDK.
Let’s examine two of the most confusing components.
What is a Library?
A library, sometimes misused as an SDK itself, refers to a collection of pre-built codes which you can call from your own codes. Basically libraries save developers writing all those codes and functions themselves.
What is an API?
Application Programming Interface (API) is an interface that allows the software to interact with other software. API is the face of the library, it explains to the programmer what they can do with the library. APIs reduce the number of codes the developers write and create consistency across apps.
Confusion Between APIs and SDKs
It is quite common that APIs and SDKs are mixed up. One of the main causes of this confusion is because SDKs usually contain APIs. However, an API doesn’t always come within an SDK.
So, when an SDK is used to build an application that would communicate with other applications, this SDK includes an API. Imagine you own a ride-sharing app. Instead of writing code to verify the phone number of the user, you would use an API to verify that via SMS. You would use a map API to locate the cars and users. You would use another API for the payment process, etc.
SDKs, on the other hand, include the package of tools that are required to build or improve your app.
We said an API doesn’t always come within an SDK. In this case, how do you choose between an API and an SDK? The Next Web gives this example: API is like a recipe to cook a cake. SDK is a box of cake mix. Although there are different uses for each, usually, however, generally SDKs are easier to integrate and more secure to use.
What should you take into consideration before integrating an SDK?
Apart from the value that comes from the core functionality that an SDK provides, it is also important how an SDK brings that value.
- Integration: The integration process of an SDK to an app should be painless to the app developers.
- Documentation: An SDK should include clear documentation of codes and sample examples to help developers.
- Uniformity: An SDK’s features and methods should be uniform to work on different platforms. Having such consistency would help developers use the SDK on cross platforms.
- Use of Resources: It is obvious that the SDK shouldn’t affect the performance of your app negatively. Maximum functionality and minimum resource usage should be ideal for an SDK. The main resource usage problems due to an SDK could be a drained battery because of intensive background process or unnecessary network polls; large network usage and huge size.
- Transparency: An SDK should be transparent to your users with what it is doing and also with permissions.
- Updates: SDKs should be compatible with the latest OS versions and architectures by bearing in mind the older versions. When new features are added, they should be explained to the users.
- Security: SDKs can be unsafe since they run different codes than your apps’. It is possible for malicious SDKs to violate user rights, and harm your app’s performance and cause your app to get banned from application stores.
Why are SDKs Important? Don’t Reinvent the Wheel.
Imagine building an app as building a house. If you make a list of what you need to build a house, you would come up with the materials such as concrete and bricks or people to build the house such as roofers. Many people wouldn’t go, chop a tree to have some wood, or gather the components to make brick but they would buy the bricks or wood instead. This is a similar scenario for your app too. You can, of course, develop your app without any 3rd party SDKs, but users wouldn’t be able to use your app on different platforms and it would be hard to carry out all the necessary actions.
Having a well-built SDK makes your life easier as a developer, and increases the performance of your app by bringing new opportunities to reach and engage with your users.
Storyly is an SDK helping you maximize your in-app engagement and grow your business by simply integrating stories to your app. Check out how your app can use Storyly SDK. |
Salomon August Andrée
||This article includes a list of references, but its sources remain unclear because it has insufficient inline citations. (July 2011)|
|Salomon August Andrée|
Salomon August Andrée
|Born||18 October 1854
|Education||Royal Institute of Technology|
|Occupation||civil servant (Patent Office)|
|Known for||Arctic Balloon Expedition of 1897|
Salomon August Andrée (18 October 1854, Gränna, Småland – October 1897, Kvitøya, Arctic Norway), during his lifetime most often known as S. A. Andrée, was a Swedish engineer, physicist, aeronaut and polar explorer who died while leading an attempt to reach the Geographic North Pole by hydrogen balloon. The balloon expedition was unsuccessful in reaching the Pole and resulted in the deaths of all three of its participants.
Early life and influences
Andrée was born in the small town of Gränna, Sweden; he was very close to his mother, especially after the death of his father in 1870. He attended the Royal Institute of Technology in Stockholm and graduated with a degree in mechanical engineering in 1874. In 1876 he went to the Centennial Exposition in Philadelphia, where he was employed as a janitor at the Swedish Pavilion. During his trip to the United States he read a book on trade winds and met the American balloonist John Wise; these encounters initiated his lifelong fascination with balloon travel. He returned to Sweden and opened a machine shop where he worked until 1880; it was less than successful and he soon looked for other employment. From 1880 to 1882 he was an assistant at the Royal Institute of Technology, and in 1882–1883 he participated in a Swedish scientific expedition to Spitsbergen led by Nils Ekholm, where Andrée was responsible for the observations regarding air electricity. From 1885 to his death, he was employed by the Swedish patent office. From 1891 to 1894 he was also a liberal member of the Stockholm city council. As a scientist, Andrée published scientific journals about air electricity, conduction of heat, and inventions. His view of life was that of the natural sciences, and he entirely lacked interest in art or literature. He was a believer in industrial and technical development, and claimed also that emancipation of women would come as a consequence of technical progress.
Expedition to the North Pole
Supported by the Royal Swedish Academy of Sciences and funded by people like King Oscar II and Alfred Nobel, his polar exploration project was the subject of enormous interest and was seen as a brave and patriotic scheme. The North Pole expedition made a first attempt to launch the balloon Örnen (The Eagle) in the summer of 1896 from Danskøya, an island in the west of the Svalbard Archipelago, but the winds did not permit the expedition to start. When Andrée next tried, on 11 July 1897, together with his companions engineer Knut Frænkel and photographer Nils Strindberg (a second cousin of playwright August Strindberg), the balloon did set off and sailed for 65 hours. This was not directed flight, however; already at the lift-off the gondola had lost two of the three sliding ropes that were supposed to drag on the ice and thus function as a kind of rudder (this was observed by the ground crew). And within ten hours of lift-off, they were caught by powerful winds from a storm raging in the area. The heavy winds continued and, together with the rain creating ice on the balloon, impeded the flight. It is likely that Andrée realized before the flight ended that they would never come near the pole.
For these reasons they were forced down on to the ice, though the landing was conducted in a semi-controlled way rather than actually crashing. They had covered 295 miles (475 km) and floundered on the pack ice. The expedition was well equipped for travelling on the ice (three sledges and a boat) and had supplies for three months; also there were three deposits in northern Svalbard and one in Franz Josef Land. They set off eastbound for the latter but after a week they had moved west due to the currents which moved the ice. They then changed direction towards northern Svalbard; movement was slowed down by ice drift and by the craggy surface of the pack ice. The three had to pull the sledges themselves, and despite good reserves of food, added to by their shooting polar bears, the efforts against the moving, uneven ice wore them out.
They reached land in early October after over two months on the ice, setting foot on Kvitøya (White Island), just east of Svalbard. They perished there, probably within two weeks after landfall. Most modern writers agree that Nils Strindberg died within a week of arrival: he was buried among the rocks (though no marker was placed on his grave) while the other two men were later found in the tent.
Diary notes and observations end just a few days after they landed on Kvitøya; up to that point these had been kept up even in hard conditions; this seems to indicate that something critical happened after a few days. It is likely that Strindberg met his end at this point. It has not been possible to establish the reason for his death. Suicide (which would have been possible with opium) is very unlikely in his case even though by this time all three no doubt realized they would die. Whatever Strindberg might have felt about the outcome of the expedition, it is near certain that he would have judged the option of suicide as treachery to his fellow explorers.
The diary notes of the expedition indicate that all three men were sometimes plagued by digestive trouble, illness and exhaustion during the trek over the sea ice. The ultimate cause of death probably had something to do with the ingestion of polar bear flesh carrying Trichinella parasites, which were found in the remains of a polar bear on the spot examined by the Danish physician Ernst Tryde and published in a book in 1952 called "The Dead on White Island". There is no doubt that the men became infected at some point during the ice trek, though the exact time span is unclear (and this matters because humans normally develop immunity to trichinosis if they survive the first wave of infection). When they arrived at White Island they were suffering from recurrent diarrhea. A plausible indication of this is that some of the provisions they brought ashore (obviously after a few days of scouting to the west) were unloaded and left near the water and not carried to a safer place near the camp.
In contrast, Arctic explorer Vilhjalmur Stefansson theorized in his book 'Unsolved Mysteries of the Arctic' that Nils Strindberg probably had died while chasing a polar bear, perhaps from drowning, and Andrée and Frænkel had asphyxiated on carbon monoxide from a malfunctioning stove while cooking in their tent. To account for the unburned amount of fuel in the stove Stefansson referred to his own experience with malfunctioning stoves that required regular pumping up to keep burning. In his opinion they had not lost hope of getting back, but they had made many mistakes and would have died of something else if they hadn't died when they did.
Until Andrée's last camp was found in 1930, what could have happened to the expedition was the subject of myth and rumours. In 1898, eleven months after Andrée's first sighting of White Island (which he called New Iceland) a Swedish polar expedition led by A G Nathorst was passing by just 1 km offshore from the camp, but the weather stopped them from getting ashore. Already around this time, it was noticed that a heavy storm had been raging and that the expedition had lost the steering lines at departure, and experienced polar explorers surmised already before 1930 that the expedition couldn't have got very far and had likely been forced down on the ice. Finally the remains of the three men were found in 1930 by the Norwegian Bratvaag Expedition which picked up remains including two bodies. A month later the ship M/K Isbjørn, hired by a newspaper, made additional finds, among them the third body. Notebooks, diaries, photographic negatives, the boat and many utensils and other objects were recovered. The homecoming of the bodies of Andrée and his colleagues Strindberg and Frænkel was a grand event. King Gustaf V delivered an oration, and the explorers received a funeral with great honors. The three explorers were cremated and their ashes interred together at the cemetery Norra begravningsplatsen in Stockholm.
Starting in the 1960s, Andrée's status as a national hero has become questioned and a cooler, more skeptic view began to prevail, in a way not unlike the changing assessment of Robert Falcon Scott's South polar journey. The emphasis has turned to the fact that the expedition was bound to fail, and that Andrée obviously refused to take in information that questioned the expedition's feasibility (and also had meagre actual flight experience with large balloons, and none in Arctic conditions). Andrée has been seen as a manipulator of the national emotions of his age, bringing a meaningless death on himself and his two companions. Several modern writers, following Sundman's Andrée portrait in the semidocumentary novel The Flight of the Eagle ("Ingenjör Andrées luftfärd", 1967), have speculated that Andrée, by the time of the departure for Svalbard in 1897, had become the prisoner of his own successful funding campaign and the excited national feelings, and was now incapable of backing out or admitting weaknesses in the plans in front of the press.
Andrée's writings were adapted into the song cycle The Andrée Expedition by the American composer Dominick Argento, written for the Swedish baritone Håkan Hagegård. Swedish composer Klas Torstensson's opera "Expeditionen" (1994–99) is also based on Andrée's story.
In 2010, the American rock group Brian's Escape created a seven-track concept album inspired by Andrée's adventures entitled The Journey: An Account of S. A. Andrée's Arctic Expedition of 1897.
A 2010 novel Strindber's Star by Swedish writer Jan Wallentin revolves around the story of the expedition. The explorers reportedly found two relics which opened a portal to the Norse underworld and set off a chain of events connecting both world wars and the modern day with ancient Norse myths.
In 2013, UK/ Norway theatre company New International Encounter (NIE) created a show charting the story of the ice balloon in co-production with The North Wall Oxford and The Key Theatre. North North North premiered at The Key Theatre, Peterborough on May 9 2013 and toured across the UK and internationally.
- Wilkinson, Alec. "The Ice Balloon", The New Yorker. April 19, 2010. p39.
- "Lesson Learned: Don't Fly To North Pole In A Balloon". NPR. Retrieved 2012-01-21.
- Per-Johan Östberg, Tolkning, förståelse, vetande (Interpretation; understanding, knowledge), Stockholm 1979, p.116 - the book makes a long and rigorous analysis of the written and physical traces of the Andrée expedition and how these may be harnessed in rational interpretation of the course of the journey.
- This assessment is discussed in several contexts in Vår position är ej synnerligen god... by Andrée specialist Sven Lundström, curator of the Andreexpedition Polarcenter in Gränna, Sweden (see for example p. 131) and it's also a key underpinning of P-O. Sundman's two books, Ingenjör Andrées luftfärd and Ingen fruktan, intet hopp
- See Kjellström, p. 45, and Lundström, pp. 69–73.
- "Odi e Inni".
- "The expedition".
- "The Journey: An Account of S. A. Andrée's Arctic Expedition of 1897". The Journey. Brian's Escape. Retrieved 25 July 2011.
- (Swedish) Ahlman, Axel (1928) Isviddernas hjältar (Heroes of the realm of ice), ed. Gleerup, Lund, Sweden - popular book on polar expeditions; the author had long experience of treks in the Arctic ocean and makes a detailed analysis of what might have happened to Andrée.
- (Swedish) Andrée, S.A., Fraenkel, K and Strindberg, N. (1930), Med Örnen mot polen (With the Eagle towards the pole) ed. Bonniers, Stockholm - original chronicle and publication of the diaries and notes of the expedition, and some of its photographs.
- (Swedish) Kjellström, Rolf (1999). "Andrée-expeditionen och dess undergång: tolkning nu och då", in The Centennial of S.A. Andrée's North Pole Expedition: Proceedings of a Conference on S.A. Andrée and the Agenda for Social Science research of the Polar Regions, ed. Urban Wråkberg. Stockholm: Center for History of Science, Royal Swedish Academy of Sciences.
- (Swedish) Lundström, Sven (1997). "Vår position är ej synnerligen god..." Andréexpeditionen i svart och vitt. Borås: Carlssons förlag. Lundström is the curator of the Andreexpedition Polarcenter in Gränna, Sweden. This museum has been mainly dedicated to Andrées polar expedition.
- (Swedish) Sörlin, Sverker. Entries Andrée, Salomon August and Andrée-expeditionen in the web version of the encyclopedia Nationalencyklopedin, accessed April 27, 2006 (Swedish)
- (Swedish) Nordisk familjebok, 2nd edition, the entry Andrée, Salomon August (Swedish; written several years before the final fate of the expedition was discovered)
- Sollinger, Guenther (2005), S.A. Andree: The Beginning of Polar Aviation 1895-1897. Moscow. Russian Academy of Sciences.
- Sollinger, Guenther (2005), S.A. Andree and Aeronautics: An Annotated Bibliography. Moscow. Russian Academy of Sciences.
|Wikisource has the text of the 1911 Encyclopædia Britannica article Andrée, Salomon August.|
- Article in Polish by Andrzej M. Kobos with many pictures of the balloon expedition
- Grenna Museum - The Andreexpedition Polarcenter (Swedish)
- IMDB - Swedish Movie about Andrée's balloon expedition, with Max von Sydow as Andrée
- Arctic Mystery Of Andree's Fate Now Solved Popular Mechanics, November 1930 |
|Created||Around the First Century A.D.|
Christianity is one of the three major religions that sprang forth from the Middle East, along with Judaism and Islam. Its founder was Jesus Christ, the Son of God who was believed to be the Messiah of the Jews and the Savior of all mankind. It started from Jerusalem after the time of His death, resurrection, and ascension into heaven and eventually spread forth unto all the earth throughout the centuries. From that time it has divided into many different sects, including Orthodox, Protestantism, and the Roman Catholic Church. During the time of the Tribulation, true followers of Christ were considered enemies of the state and were called "Judah-ites". Jesus' Biblical message that He alone is the way to God also makes Christianity seem intolerant in the eyes of those of either no religion or of other religions, as seen in the reactions of characters in the Left Behind books.
Doctrines of Christianity
Its core essential teachings are that:
- The Bible is the infallible and inerrant Word of God (2nd Timothy 3:16-17)
- God is monothestic, but exists in a Trinity that consists of the Father, the Son, and the Holy Spirit
- Jesus is fully God made manifest in the flesh (John 8:58; 1st Timothy 3:16)
- Jesus was born of a virgin
- Jesus lived a completely sinless life (Hebrews 4:15)
- Jesus sacrificed Himself on the cross for atonement of our sins, being our substitute (1st Corinthians 15:3)
- Jesus rose from the dead on the third day (1st Corinthians 15:4)
- Jesus will come again
- Salvation is by grace through faith (a gift of God), not of our works (Ephesians 2:8-9)
- Salvation is through Jesus Christ alone being the Way, the Truth, and the Life (John 14:6; Acts 4:12)
The common worship practices of Christianity include attending services with a local body of believers that make up the Church, studying the Bible, and prayer. Water baptism and holy communion services are also included, though how often they are practiced and who is allowed to participate in them depends on the congregation. In Left Behind: World at War, holy communion was practiced by the Tribulation Force core members as Bruce Barnes and Chloe Williams faced death by way of a disease that was transmitted through shipments of tainted Bibles. |
Objects can be assigned to different layers. If you ignore this option, all newly inserted objects will be assigned to the same standard “Base” layer. The Layer option makes it possible to display or to remove parts of the drawing, so you can, for example, design a presentation that gradually increases in complexity. You can start building a model with only a few elements and gradually increase the number of elements that are displayed, thus creating a structure that continually gains complexity.
The Layer function can be activated by clicking the layer icon in the Start tab. This will open a window in which the existing layers are listed. At first, this includes only the “Base” layer. You can define a new layer by selecting New.
Any object on the drawing pad can be assigned to a certain layer. Just choose the option Layer after selecting the object with the right mouse button and assign the object to the desired levelin the menu.
To display a level, simply put a checkmark in front of the desired layer in the dialogue window. |
The Prevalence of Hepatitis B and C Awareness Among Dental Students in Jeddah
Hepatitis is a liver inflammation, a potentially life-threatening due to serious complications. Dentistry is a susceptible environment for cross infections, as dental practitioners have direct contact to patients` saliva and blood. In fact, dentist are three to four times at higher risk of exposure to HBV and HCV than general population.
The aim of this study is to assess the level of knowledge and attitude of hepatitis B, and C among dental students in Jeddah.
in this cross-sectional study, 453 clinical dental students in Jeddah colleges, were participated to assess their knowledge and attitude toward HBV and HCV. An anonymous self-administrated hard copy questionnaire included four sections with total of 28 questions, adopted from pervious study with modifications were distributed.
Results: the mean of total knowledge of corrected answers of participants were 5.35 out of 9 questions with standard deviations ± 1.54. The mean of attitude questions range between 2.04 with standard deviation ± 1.18 to 3.9 with standard deviation ± 1.5. By comparing of total knowledge score with GPA, students who has GPA 4.1 and above, were significantly higher than other students. The study showed that 67 of 4th year students, 104 of 5th year students, 98 of 6th year students and 48 of intern students haven't been fully vaccinated against HBV.
It is recommended that more educational courses should be included for dental students to improve their knowledge about HBV and HCV in Saudi Arabia. In addition, colleges should obligate students to get vaccinated before admitting clinics.
100 words abstract version
Hepatitis is a life-threatening due to its serious complications. This study aims to assess the knowledge and attitude of HBV and HCV among dental students in Jeddah. A total of 453 students were participated to assess their knowledge and attitude, using anonymous self-administrated hard copy questionnaire included 28 questions, adopted from pervious study with modifications. The mean of total knowledge of corrected answers were 5.35 out of 9 (SD= 1.54). The mean of answers of attitude questions range between 2.04 (SD= 1.18) to 3.9 (SD= 1.5). It is recommended that more educational courses to improve their knowledge. |
1. Stimulate and promote student interest and enjoyment in mathematics.
2. Put in the hands of mathematics students, a publication with which they can personally identify.
3. Demonstrate that mathematics is both a unique and interesting field of study within itself and a vital tool in real-world applications.
4. Supply the teacher with readily accessible material for diversified classroom use and individual student study.
5. Solicit, write, and edit materials which satisfy the above four charges.
6. Define the general format and topics covered in the notes and initiate any studies needed to make the notes more useful.
7. Work with the staff liaison to develop procedures for processing materials and maintaining records.
8. Advise the Board of Directors on matters related to the student publication.
9. Prepare an annual report, including budget for the Board of Directors. |
Treaty of Basel
From Wikipedia, the free encyclopedia
There were several Treaties of Basel:
- Treaty of Basel (1499)
- Peace of Basel (1795)
- The Basel Convention on the Control of Transboundary Movements of Hazardous Wastes and Their Disposal (1989)
|This disambiguation page lists articles associated with the title Treaty of Basel.
If an internal link led you here, you may wish to change the link to point directly to the intended article. |
ESCHER might have gawped. But this labyrinthine nest of stairs is no impossible construction. Between AD 600 and 1850, more than 3000 step wells were dug, by hand, in the Indian provinces of Gujarat and Rajasthan. Many of them had intricate staircase designs, peppered with shrines and balconies on which to linger in the afternoon heat.
They reach deep underground and provided insurance against the region's fluctuating water supply. The stairs guided local people – women, mostly – down to the water that seeps in from nearby aquifers. During the rainy season, the wells fill up, but in the dry season, you would have to lug containers up and down the entire well. This particular well, Panna Meena ka Kund near Amber Fort in Rajasthan, has eight storeys. According to local tradition, you must use different sets of stairs to climb down and climb out.
The photograph was taken by Edward Burtynsky for his latest exhibition, Water, which opens at Flowers Gallery in London on 16 October. "I wanted to find ways to make compelling photographs about the human systems employed to redirect and control water," he writes in the accompanying book. His research took him around the globe, from the fish farms and giant dams of China to Iceland's glaciers and the salt flats of Mexico.
Burtynsky found it a challenge to gain enough height to capture the enormous scale of water resources and the structures we build to tap them, and had to resort to drones, aerial lifts and helicopters. He took this picture using a 15-metre pneumatic mast, with his remotely controlled camera mounted on the top.
As well as documenting our ingenuity and recklessness in controlling water, he reveals the depth of our connection to this vital resource. As Wade Davis of the National Geographic Society puts it in his introduction to Burtynsky's book: "We are born of water... Compress our bones, ligaments and muscle sinew, extract the platelets and cells from our blood, and the rest of us, nearly two-thirds of our weight, would flow as easily as a river to the sea."
This article appeared in print under the headline "Well of holes"
If you would like to reuse any content from New Scientist, either in print or online, please contact the syndication department first for permission. New Scientist does not own rights to photos, but there are a variety of licensing options available for use of articles and graphics we own the copyright to. |
Satisfaction is something we all want to have. Being human, different kinds of feelings prevail in our bodies. And our mind grows as we rationalize our thoughts.
The basic feelings which each of us has our love, hate, anger, and happiness. We all are very well aware of the positive and negative feelings.
Desiring, and aiming to be successful is a goal of everyone. And we take every step to fulfill our desires.
But the question here is what are you actually doing to achieve this? Is your mind prevailed by greediness? How Greed can be Dangerous to our Life?
How would you differentiate between greed and desires?
Nonetheless, we all need an answer. A definite answer is still needed: is greed has a positive side?
If yes, then what, and if no then what should we do to make things right.
Let’s first discuss what actually is greed.
What is greed?
Greed is an excessive amount of desire to enrich yourself. Often more than one’s proper share. It is definitely uncomplimentary in implication. It arouses many hands against you and the consequences are even worse.
In simpler terms, Something did illegally earn more wealth.
It’s troublesome when everything goes against our will.
A famous saying
” There is a sufficiency in the world for man’s need but not for man’s greed.”
by Mahatma Gandhi
In psychological studies, for greedy people, enough is never going to be enough. Their mind never attains peace and greediness is an outcome of a lot of anger, stress, and thinking.
Wealth is the most powerful weapon according to more than half the population of the earth.
No doubt it’s the most important thing we need to survive but we forget it’s acting like parasites to our mind.
Lets the live instances where greed has controlled the minds
- Taking credit for the hard work of others
The easiest way to find a greedy person is by his behavior traits.
You can see the real examples in your neighborhood, or around your working place. Taking the appreciation of something they don’t even deserve. The real hard workers are ignored and the ones imitating them get benefited. A sign that clearly shows that a person has a high addiction level of greed.
- Avoiding to provide financial aid
If a person is unable to provide financial aid to their loved ones not because they don’t have but because they don’t want to provide.
They want to achieve more in expenses of losing their backbones.
- Trying to be more deserving
A deserving candidate or a person doesn’t have to act that they are more deserving. But another person’s greed comes in between and rips their efforts apart.
Their addiction to achieve more makes them blind and present themselves as the most deserving person in the room.
“We are in danger of destroying ourselves by our greed and stupidity. We cannot remain looking inwards at ourselves on a small and increasingly polluted and overcrowded planet.”
Why is greed dangerous?
Dangerous is just a word but the damage greed does to our life is unexpected.
Greed an addiction with unexpected outcomes. how hard you try once you got addicted to something like drugs.
It requires immense efforts to come out of this.
Without a legal cure, you will risk your life. The more is not more anymore for greedy people. Always want more as there is no word for them to get satisfied.
A simple life of contentment and sharing will clothe us with perpetual happiness, good health, and long life.
What makes a greedy person?
Addiction is one of many reasons why a person becomes greedier. Their habit of asking for more and never getting satisfied with less.
Like we get too addicted to social media, and once we get addicted then you will also welcome the problems with it. Stress is a major problem faced today by most people. And this is How Greed can be Dangerous to our Life. An addiction syndrome that changes life.
Sometimes a person grows through seeing their household problems. It’s even more impactful as they spend most of their time at home.
Deal them in less time or otherwise bear the consequences.
Don’t allow your past to affect your future with feelings like greed, jealousy, and anger.
The door to more health problems is greed. So, control it before it controls you.
How greed affects our life?
How greed affects our life? is greed controlling our minds? How greed is preventing us from moving forward in our lives? The answer is simple to guess, greed has been controlling our mind long before we actually know. And also the problems associated with it.
Let’s see the problems associated with greed.
- Health- A proven fact in fact a reality with no wealth without health. Greed is controlling our mind, so means our mind is trapped by unfaithful beliefs of greed. More stress, less work. All and all making our brain functioning poorly.
- Mind – greed straightly affects the mind, an invitation to more health problems.
- Less sleep– it’s a proven and even famous fact that greed is affecting our minds. And leading to many sleepless nights. More headaches less Focus.
- Losing loved ones– in a race to obtain more and more we lose the support of people who are with us through our goods and bad times.
- Less focused- Thousands of people are in a race with you but not with spirit to achieve more and more money but to build their brand value and stand out from the crowd. And with a clear cut focus on goals rather than a greedy mind.
Greed affects our day to activities making our life miserable. More stress, less work on goals, and eventually less to little focus.
It is never too late to start. So, consult a specialist to get rid of the problem.
You should have got a great idea by now, how dangerous is greed for humans.
Greed can be a positive one too if taken in a positive way I
If you work tooth and nail to get the job done. Cracking business deals and achieving greater heights of success with a positive mindset is always helpful.
Now you guys know How Greed can be Dangerous to our Life.
Want more now! Just kidding. |
What are those curiosities spotted from Mars? Pixels or UFOs?
TO ZOOM, CLICK ON THE IMAGE.
When Curiosity first touched down on Mars, Internet pranksters were quick to mock up photographs of alien life on the alien landscape.
But it seems NASA has itself captured something very strange on camera, including a strange white light dancing across the horizon of the red planet, and four blobs hovering in the sky
While the images are certainly a curiosity, NASA and photography experts insist that these are nothing more than blemishes on the images, picked up by the camera lens sitting on the rover at a distance of 350 million miles away.
So far, Nasa has not commented on any of the strange sightings, but alien hunters have suggested these are alien ships monitoring our baby steps into the universe.
SEE COMPLETE TEXT |
Distribution and Habitat
Found in the southwest corner of Western Australia, near Walpole and in Nornalup National Park. The area of occupancy of the species is approximately 200 km2.
- Barker, J., Grigg, G. C., and Tyler, M. J. (1995). A Field Guide to Australian Frogs. Surrey Beatty and Sons, New South Wales.
- Tyler, M.J., Smith, L.A., and Johnstone, R.E. (1994). Frogs of Western Australia. Western Australian Museum, Perth. |
PLEASE NOTE: All bidding for the auction currently underway
at our new website at
Auction End Date
11/13/2007 10:19:30 AM (mm/dd/yyyy)
Decree affecting Jews
[Ms. - Community - Vellum]
This listing is an independent item not part of any collection
p., 325:225 mm., faded ink on vellum, signed and dated.
The first record of a Jewish settlement in Mantua dates from 1145, when Abraham Ibn Ezra lived there for a while. A small Jewish community existed during the heyday of the city-republic. Sometime after the Gonzaga had become lords of Mantua, Jewish bankers were invited to start operations in the capital and province. Subsequently the Jewish population increased, reaching 3,000 by 1600. The merchant and artisan population soon outnumbered the bankers. Some 50 Jewish settlements of varying size flourished in the province, the major ones being Bozzolo, Sabbioneta, Luzzara, Guastalla, Viadana, Revere, Sermide, and Ostiano. The Jews were protected by a series of privileges granted them by popes, emperors, and the Gonzaga rulers. A Christian loan bank (monte di pietà) was established in Mantua in 1486 to compete with Jewish banking, but initially at least had little success. Anti-Jewish riots took place at Mantua in the 15th century, fostered by the Church and aided and abetted by the business competitors of the Jews. There was also an isolated case of blood libel in 1478. At the end of the 15th century the regulation imposing the Jewish badge was introduced in Mantua. Rioting in 1495, after Duke Francesco Gonzaga's indecisive encounter with the French forces at Fornovo, resulted in the confiscation of the house of the leading Jewish banker in the city, Daniel Norsa, and the erection of the Church of the Madonna della Vittoria on the site. David Reuveni visited Mantua in 1530, but failed to obtain the support of either the ruler or the Jews. Two years later Solomon Molcho was burned at the stake there. The Counter-Reformation began to affect the Jews of Mantua adversely in the last quarter of the 16th century. Restrictive measures and anti-Jewish propaganda culminated in riots and murder.
(Click thumbnail to view full size image)
Kind of Judaica |
Bolebec Farm moated enclosure, associated platforms and enclosures
Heritage Category: Scheduled Monument
List Entry Number: 1010970
Date first listed: 08-Mar-1991
The above map is for quick reference purposes only and may not be to scale. For a copy of the full scale map, please see the attached PDF - 1010970 .pdf
The PDF will be generated from our live systems and may take a few minutes to download depending on how busy our servers are. We apologise for this delay.
This copy shows the entry on 17-Feb-2019 at 17:35:53.
The building or site itself may lie within the boundary of more than one authority.
District: Central Bedfordshire (Unitary Authority)
National Grid Reference: TL 05357 38832
Reasons for Designation
Around 6,000 moated sites are known in England. They consist of wide ditches,
often or seasonally water-filled, partly or completely enclosing one or more
islands of dry ground on which stood domestic or religious buildings. In some
cases the islands were used for horticulture. The majority of moated sites
served as prestigious aristocratic and seigneurial residences with the
provision of a moat intended as a status symbol rather than a practical
military defence. The peak period during which moated sites were built was
between about 1250 and 1350 and by far the greatest concentration lies in
central and eastern parts of England. However, moated sites were built
throughout the medieval period, are widely scattered throughout England and
exhibit a high level of diversity in their forms and sizes. They form a
significant class of medieval monument and are important for the understanding
of the distribution of wealth and status in the countryside. Many examples
provide conditions favourable to the survival of organic remains.
This site is a fine example of a small Bedfordshire rectangular moated enclosure. The importance of the site is further enhanced by the occurrence of adjacent enclosures and cultivation earthworks which provide a contemporary setting far the monument.
The site of the scheduled monument is shown outlined in black and highlighted in red on the attached "Scheduled Monument" map extract and includes a 2m boundary around the archaeological features, on all but the southern boundary of the site, which is considered essential for the monument's support and preservation.
The monument includes the remains of a moat and its associated platforms
and enclosures. The moated enclosure is rectangular in shape measuring
about 40m east-west by 50m north-south including the surrounding 10m
wide moat. The island is raised about 1.5m above the surrounding area.
The surface is flat with no visible evidence for internal buildings or
other features. The ditch is currently dry but is believed to have once
contained water which drained into a wide leat at the south-east corner.
Associated with the moated site are a series of platforms and enclosures
including a 50m square platform adjacent to the south side of the moat.
Additional ditches, scarps and enclosures are located around the moated
enclosure but mainly downslope to its south. These outer earthworks are
considered to be subsidiary manorial enclosures contemporary with the
Medieval occupation of the site.
MAP EXTRACT The site of the monument is shown on the attached map extract.
The contents of this record have been generated from a legacy data system.
Legacy System number: 11537
Legacy System: RSM
Coleman, S, Watching brief on drainage trenching at Bolebec Farm Maulden, 1980, SMR ref 13
SMR record, Simco, A, Maulden, Bolebec Farm, (1979)
UK/2097-3222-3, RAF (1947) UK/2097-3222-3, (1947)
This monument is scheduled under the Ancient Monuments and Archaeological Areas Act 1979 as amended as it appears to the Secretary of State to be of national importance. This entry is a copy, the original is held by the Department for Digital, Culture, Media and Sport.
End of official listing |
The traveling exhibit "Changing America: 1863, Emancipation Proclamation and 1963, March on Washington" will be on display at the Metropolitan State University Library & Learning Center from September 21 - November 4, 2016.
This is an excerpt from the documentary film Slavery By Another Name, which tells the stories of men, charged with crimes like vagrancy, and often guilty of nothing, who were bought and sold, abused, and subject to sometimes deadly working conditions as unpaid convict labor, creating a system of forced, unpaid labor, mostly affecting Southern black men, that lasted until World War II. Click here to watch the entire film streaming online (including captions).
Amy Goodman at Democracy Now! speaks with Michelle Alexander, author of The New Jim Crow: Mass Incarceration in the Age of Colorblindness about historical connections between slavery, Jim Crow, and mass incarceration of African Americans.
The Abolitionists vividly brings to life the struggles of the men and women who led the battle to end slavery. Through innovative use of reenactments, this three-episode series puts a face on the anti-slavery movement—or rather, five faces: impassioned New England newspaper editor William Lloyd Garrison; former slave, author, and activist Frederick Douglass; Angelina Grimké, daughter of a rich South Carolina slaveholder; Harriet Beecher Stowe, author of the enormously influential Uncle Tom's Cabin; and John Brown, ultimately executed for his armed seizure of the federal arsenal at Harpers Ferry. Click here to watch the entire series streaming online.
Umbra: Search African American History (umbrasearch.org) is a freely available search tool that brings together the most extensive digital collection dedicated to African American history and culture from US archives, museums, & cultural heritage institutions. It currently includes over 400,000 digital items are made available from over 500 institutions.
All Library Guides by Metropolitan State University Library are licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. |
Bowl barrow 450m north of Damgate
Heritage Category: Scheduled Monument
List Entry Number: 1011861
Date first listed: 09-Aug-1967
Date of most recent amendment: 12-Nov-1992
The above map is for quick reference purposes only and may not be to scale. For a copy of the full scale map, please see the attached PDF - 1011861 .pdf
The PDF will be generated from our live systems and may take a few minutes to download depending on how busy our servers are. We apologise for this delay.
This copy shows the entry on 17-Feb-2019 at 18:41:44.
The building or site itself may lie within the boundary of more than one authority.
District: Staffordshire Moorlands (District Authority)
National Park: PEAK DISTRICT
National Grid Reference: SK 12835 53852
Reasons for Designation
Bowl barrows, the most numerous form of round barrow, are funerary monuments
dating from the Late Neolithic period to the Late Bronze Age, with most
examples belonging to the period 2400-1500 BC. They were constructed as
earthen or rubble mounds, sometimes ditched, which covered single or multiple
burials. They occur either in isolation or grouped as cemeteries and often
acted as a focus for burials in later periods. Often superficially similar,
although differing widely in size, they exhibit regional variations in form
and a diversity of burial practices. There are over 10,000 surviving bowl
barrows recorded nationally (many more have already been destroyed), occurring
across most of lowland Britain. Often occupying prominent locations, they are
a major historic element in the modern landscape and their considerable
variation of form and longevity as a monument type provide important
information on the diversity of beliefs and social organisations amongst early
prehistoric communities. They are particularly representative of their period
and a substantial proportion of surviving examples are considered worthy of
Despite limited antiquarian investigation at the barrow's centre and some slight spreading of the mound due to past ploughing the monument survives well. It will contain intact archaeological deposits including inhumations and grave goods.
The monument includes a bowl barrow located 450m north of Damgate on a broad
plateau shelf sloping down to the north. It survives as a circular earthen
mound 27m diameter and up to 0.8m high, with a low central mound measuring 11m
by 7m and up to 0.2m high that indicates the position of limited antiquarian
investigation. This investigation consisted of a trench 4.6m square and 1.05m
deep that located a scatter of charcoal.
A drystone wall running north-south across the eastern half of the barrow is
excluded from the scheduling. The ground beneath the wall, however, is
MAP EXTRACT The site of the monument is shown on the attached map extract. It includes a 2 metre boundary around the archaeological features, considered to be essential for the monument's support and preservation.
The contents of this record have been generated from a legacy data system.
Legacy System number: 13533
Legacy System: RSM
Books and journals
Barnatt, J, The Peak District Barrow Survey (1989), (1989)
Bateman, , Ten Years Digging (1861), (1861), 173
Carrington, Barrow Diggers (Unpub MS with letters and notes), 1848,
Darvill, T, MPP Single Monument Class Descriptions - Bowl Barrows (1988), (1988)
This monument is scheduled under the Ancient Monuments and Archaeological Areas Act 1979 as amended as it appears to the Secretary of State to be of national importance. This entry is a copy, the original is held by the Department for Digital, Culture, Media and Sport.
End of official listing |
Winter is a prime time prune your trees and shrubs because most woody plants are dormant, making it an ideal time to give them a trim. Well-pruned plants produce more flowers and fruit. Pruning helps trees and shrubs ward off pests and diseases, so you’ll have to care for them less. Here’s how to prune almost any flowering shrub or fruit tree.
Pruning in winter during the dormant season helps many trees and shrubs because it leaves the plants with extra root and energy reserves that will support new growth on the remaining branches. Here is a partial list of shrubs and trees you can prune from winter. You’ll also find here a short list of trees not to prune during winter.
Some trees “bleed” or ooze sap when pruned in late winter or early spring. While oozing sap is not dangerous to the tree, it can make a sticky, dirty mess, especially on parked cars. Prune these trees in summer or fall:
Remove dead or dying branches. Prune out diseased limbs right away. Be sure to cut well below the diseased areas, and don’t prune when the plants are wet (water can spread disease). If you prefer to be extra cautious, rinse your tools with a solution of 10 percent bleach in water. Cut back branches that have grown over where you walk or mow so they don’t break off. Where you see two branches crossing, prune off the smaller one. Thin branches judiciously to allow sunlight and air into the center of trees and shrubs.
DO cut at an angle that mirrors the branch collar—the furrow of bark where branch and trunk meet. Cut the branch next to the branch collar. If you did it right, a circle of healthy callus will swell around the spot.
DO cut large branches in three parts. First, cut off about one-third of the branch to reduce the weight. Holding up a heavy branch while you prune it off the trunk will break your back and your saw, and tear the trunk’s bark. Next, undercut the remaining stub so the trunk bark won’t rip when the stub falls free. Last, make the final cut from the top, beside (but not cutting into) the branch collar.
DON’T leave stubs behind inviting insects and disease to move in and attack healthy tissue.
DON’T scalp your trees. A tree with a flat-top looks ridiculous, and it will grow weak new sprouts in place of healthy branches. Cut to the tree’s natural shape and let it grow up. |
When World War II broke out, British ballet was only a few decades old, and few had imagined that it would establish roots in a nation long thought to be unresponsive to the genre.
Nevertheless, the War proved to be a boon for ballet dancers, choreographers, and audiences, for Britain’s dancers were forced to look inward to their own identity and sources of creativity. Instead of withering during the enforced isolation of war, ballet in Britain flourished, exhibiting a surprising heterogeneity and vibrant populism that moved ballet outside its typical elitist surroundings to be seen by uninitiated, often enthusiastic audiences.
Ballet proved to help boost morale, to render solace to the soul-weary, and to afford entertainment and diversion to those who simply craved a few hours of distraction. Government authorities came to see that ballet could serve as a tool of propaganda; it functioned within the larger public discourse of sacrifice, and it answered a public mood of pragmatism and idealism.
This according to Albion’s dance: British ballet during the Second World War by Karen Eliot (New York: Oxford University Press, 2016). |
Subsets and Splits