q_id
stringlengths 5
6
| title
stringlengths 3
296
| selftext
stringlengths 0
34k
| document
stringclasses 1
value | subreddit
stringclasses 1
value | url
stringlengths 4
110
| answers
dict | title_urls
sequence | selftext_urls
sequence | answers_urls
sequence |
---|---|---|---|---|---|---|---|---|---|
5e8wyi | why do human babies take years to raise while other animals like puppies or antelopes take only a few months? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5e8wyi/eli5_why_do_human_babies_take_years_to_raise/ | {
"a_id": [
"daam5az"
],
"score": [
2
],
"text": [
"Partially because of life-expectancy - a human lives 75 years, whereas a dogs life-expectancy is more like 10 years.\n\nAlso, humans traded instinct for a more advanced brain. Animals instinctually know how to do a lot more than we do, but our learning curve beats everything else."
]
} | [] | [] | [
[]
] |
||
bpc1h1 | home buying terms | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/bpc1h1/eli5_home_buying_terms/ | {
"a_id": [
"enrbsux"
],
"score": [
3
],
"text": [
" > What are points and origination fees?\n\nThe origination fee is like an upfront payment to the lender for creating the loan. It is usually a percentage (0.5%, 1%) of the loan amount. _URL_1_\n\n > Is earnest money basically just a deposit? Does it get factored into the sale at all?\n\nThis is also called \"good faith\" money. It is like a deposit - it shows that you and the seller have taken the first step to put the house under contract, that you intend to buy the house (pending any serious findings from an inspection), etc. If you go through with the sale, then that money will go towards the final cost of the house, like part of an early deposit. If you as a buyer do not go through with the purchase because the inspection found a ton of mold or meth damage that wasn't previously disclosed (or other previously non-disclosed issues) then you should be entitled to the money back. If you do not go through with the purchase because you got cold feet/changed your mind, then you would not get the money back. If the seller changes his/her mind then you would get the money back.\n\n > What is a short sell and why do lenders ask if a house is a short sell?\n\nA short *sale* usually happens when the seller is having financial problems and the house is about to be foreclosed. They are trying to sell the house for less money than what their current loan amount for it is (for instance, they might owe $200,000 still but are trying to sell it for $160,000). Or it could be when the property of the value has fallen lower than what the owner owes and the loan holder might recover *some* money from the sale of the house in its current state. \n\nIt just requires more paperwork and more agreements on everyone's part to get a short sale through, since the bank that owns the title on the house has to agree to sell it at a loss basically. \n\nI would also caution you about short sales and just advise you to assume the worst possible scenario, which is that the person couldn't make financial payments, which means they probably couldn't pay to keep the house up so there might be some serious problems that you'll want to check for during an inspection (and some problems might even be self-evident when you do the initial walkthrough).\n\n > Is the interest rate different than the APR? If so, how are they different? If not, why are both terms used interchangeably?\n\nAPR = annual percentage rate, it is the more technical term for \"interest rate\". They're used interchangeably because they're equally common terms for the same thing. Sort of like how someone might say \"soda\" and someone might say \"pop\", or \"gas\" and \"fuel\". \n\n > What is mortgage insurance and what is covered by it?\n\nAlso called \"Private Mortgage Insurance\" or \"PMI\". It's generally activated when a buyer does not put down at least 20% deposit off the purchase cost. It's basically a way to protect the lender and help ensure the lender's investment in you is covered in case you stop paying the mortgage / fall behind on your payments. Some loans require it by default, others don't. You can read more about it here: _URL_0_\n\n > What happens in the time between going under contract and when you close?\n\nIf the loan isn't secured yet (ie, you were pre-approved so you could make the offer but the loan wasn't fully processed), they would fully process it. You would have licensed home inspectors come and check everything for issues (make sure the outlets work, make sure the appliances work, make sure the air conditioning and heat work, check for structural damage, make sure there aren't any gas leaks or unmitigated radon risks, stuff like that); once these inspections are done you get a report of the issues, and you can even go negotiate with the seller to get some of them fixed as part of a bargaining tool. You'll get homeowner's insurance set up. You can pay to get the title of the property inspected and secured so you don't have someone trying to make a claim against you ten years down the road that the property is part of their great-great-great-grandfather's inheritance that they just received. Stuff like that. \n\n**Since it's your first time buying a house, do research online about what benefits your state might offer you**. In some states there are first time home buyer benefits you can get access to that can help alleviate a little bit of the cost or grant you access to certain loans with better benefits.\n\nedit: If you live in Maryland I know a great guy > _ > I don't want to advertise here, PM me but this agent hooked me up with one of the hardest working lenders and insurance agents I'll probably ever meet."
]
} | [] | [] | [
[
"https://www.zillow.com/mortgage-learning/private-mortgage-insurance/",
"https://www.investopedia.com/terms/o/origination-fee.aspe"
]
] |
||
35efvf | why do newtonian physics break down at a quantum level? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/35efvf/eli5why_do_newtonian_physics_break_down_at_a/ | {
"a_id": [
"cr3myru",
"cr3na21",
"cr3nqme",
"cr3o9un"
],
"score": [
2,
156,
15,
9
],
"text": [
"Because, Newtonian Mechanics, Quantum Mechanics and other mechanics are simply a model of reality.\n\nIn each case, the model is the simplest explanation (Occam's razor) which could explain and predict all the phenomena observed. When Newton created the Newtonian Mechanics, the existance of Quantum level mechanics wasn't known, so the model never attempted to predict behaviour there.",
"It's not so much that they break down, rather it's that Newtonian physics is an approximation of how the world works that is not totally correct, but in many cases is accurate enough to be incredibly useful. In such circumstances (like the ordinary motion of a baseball), the inaccuracy is so low as to be practically imperceptible, though it is still there. When things become very small, very large, or very fast, however, the Newtonian model is very inaccurate.",
"A lot of people here, I feel, aren't really answering your question as to **why** it breaks down. The easiest way to explain this is with examples. One of the initial ways we discovered quantum mechanics is through exploration of the atom. Initially, we formulated the idea of an atom that was rigid, a building block for molecules, that was built off of newtonian forces. As we discovered more and more about the atom, this explanation became increasingly less consistent with the actual data. For example, we discovered that atoms weren't solid objects, but actually mostly empty space, held together by forces that weren't described in newtonian physics (the strong and weak forces). From there, we discovered principles that led much of the structure of the atom to be based on probability (the probability that an electron was in a certain location) rather than rigid orbits, which would have been more consistent (although still not that consistent) with Newtonian mechanics.\n\nSome other examples include the duality of particles (their ability to be both particles and waves) and quantum tunneling (this duality allows some low-mass particles to pass through solid objects!). The current standard model has all forces mediated by particles, which would have never been even dreamed of by Newton.\n\nRelativity does the same, but breaks down ideas mainly about motion and frame of reference (or in the case of GR, gravity).",
"Theories break down when the postulates behind them are no longer valid. For example, Newton's laws postulate objects at rest stay at rest unless acted upon. At a quantum level, we know this isn't true, because particles are really just smeared out probability distributions telling us we could find the particle in lots of places. This is telling us that firstly the idea of a solid particle is not really accurate at the quantum level, and the idea of something being stationary isn't really applicable too! Newtonian mechanics doesn't take this into account, so when the affects of it become noticeable, it ruins the results of the theory. If we look at the non-quantum limit of systems with quantum mechanics though, we can see Newton's laws emerge as a kind of average behaviour, which is why they work at big scales.\n\nThe same thing happens when you go from quantum mechanics (which is a low energy theory) to quantum field theory (high energy). Quantum mechanics postulate a conserved number of particles (to keep wavefunctions normalised or something, I can't really remember), but that clearly isn't very physical because we know particles can be created and destroyed in real life. Quantum field theory can accommodate both all of quantum mechanics and the extra stuff that comes from moving close to the speed of light, like particle production and relativistic effects. If we take a low energy limit of QFT, we get quantum mechanics back!\n\nThe standard model itself is what's called an \"Effective Field Theory\", because it's only valid up to a certain scale. On very high energies, we know it isn't right because it doesn't know about quantum gravity, so we know it isn't going to give us the right answers.\n\nTL;DR\nTheories (like Newton's) work because the things they don't know about don't really make a difference compared to the things they do (like quantum mechanics or relativity). When the things they don't know about start to cause a big effect, they still don't know about it so give wrong answers. \n\nIt's like if you try to drive a car without knowing about the steering wheel. It's fine if you're moving on a straight road, because you don't need to know about it. But when you meet a corner, you can't do a good job."
]
} | [] | [] | [
[],
[],
[],
[]
] |
||
qeuc7 | why the vitamins are named like they are. why do we have 12 vitamin b's but no vitamin j? is there a vitamin b9? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/qeuc7/eli5_why_the_vitamins_are_named_like_they_are_why/ | {
"a_id": [
"c3x1e5y",
"c3x1f3i"
],
"score": [
2,
8
],
"text": [
"[Copy-paste from here:](_URL_0_)\nWhen they[Vitamins] were discovered they were given temporary names, starting with Vitamin A, then B, C, D and so on. Then we discovered that Vitamin B was a mixture of several different chemicals so they were given subscript numbers 1 to 12. We knew what they did, but did not know their chemical composition. Even though we now know their chemical names, we still use their temporary names. (I don't know why we jumped from E to K.)",
"There used to be more vitamin letters, but we later learned that these weren't right, or were the same as others. So, we stopped calling them by things like vitamin J. \n\nAll of the vitamin B vitamins were once thought to be a single vitamin. When we learned more about them and their different sources, we broken them down into sub-vitamins. "
]
} | [] | [] | [
[
"http://www.purchon.com/biology/vitamins.htm"
],
[]
] |
||
9mw9q0 | why can’t you hum while holding your nose? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/9mw9q0/eli5_why_cant_you_hum_while_holding_your_nose/ | {
"a_id": [
"e7hugu6",
"e7huhwn"
],
"score": [
9,
3
],
"text": [
"You can if you open your mouth. The air that carries the sound from your vocal cords has to go somewhere. ",
"Because humming is essentially forcing sound to come out of your nose. You're basically pronouncing a nasal consonant; so if you're blocking your nose, you can't pronounce a nasal consonant, and thus, cannot hum. "
]
} | [] | [] | [
[],
[]
] |
||
555gaf | why do separate drops of cooking oil tend to drift towards each other when on water? | explanetti my spaghetti | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/555gaf/eli5why_do_separate_drops_of_cooking_oil_tend_to/ | {
"a_id": [
"d87p16p"
],
"score": [
3
],
"text": [
"Gravity. Water is polar so it forms a strong surface tension, the oil is less dense so it sits on top. Gravity makes the oil naturally tend to \"puddle\" on top of the water."
]
} | [] | [] | [
[]
] |
|
4c8q75 | could a nuclear submarine survive in space? if so, for how long? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4c8q75/eli5_could_a_nuclear_submarine_survive_in_space/ | {
"a_id": [
"d1g03s1"
],
"score": [
2
],
"text": [
"It is strong in compression, in tension it's less clear."
]
} | [] | [] | [
[]
] |
||
5euvxr | how do nature documentaries capture audio? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5euvxr/eli5_how_do_nature_documentaries_capture_audio/ | {
"a_id": [
"dafb3kc",
"dafdw4j"
],
"score": [
2,
2
],
"text": [
" > I can't help but be bugged by wondering how they manage to capture such pristine audio.\n\nTake along a really good microphone with a cover, or even a microphone within a parabolic dish to get audio from far away. Or of course you can dub it in later from audio captured elsewhere in similar fashion.",
"They capture sound from a distance using a directional microphone with a dish to focus on a specific direction. There are added sound design elements. "
]
} | [] | [] | [
[],
[]
] |
||
1qrkof | what will pot businesses look like in washington and colorado? | So I understand that the stuff is going to be legal (or is), but what will that customer experience be like? Right now, in Oregon, we have the dispensaries, but they're closed-off, very weird places I would feel weird entering. What will the stores in Washington State feel like? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1qrkof/eli5_what_will_pot_businesses_look_like_in/ | {
"a_id": [
"cdfrg3s"
],
"score": [
11
],
"text": [
"Coloradan here. The dispensaries, or medicinal marijuana stores, here are not weird or shady places. Many neighborhoods have multiple dispensaries. The recreational marijuana stores will be modeled after dispensaries. In fact, current medicinal dispensaries will have first dibs on licenses to open recreational stores. A customer will walk into the store and wait in a waiting room until they are next to be served. An employee will make sure the customer is over 21 years old by checking ID. An employee, perhaps the same one, who knows a lot about marijuana use will help the customer determine what product or products they want to buy. Customer A gets a half ounce of marijuana to use over a few weeks because they already know what they want. Customer B gets a recommendation for a specific strain of weed to help him or her fall asleep easier at night. He or she gets a quarter ounce of that and also buys a new vaporizer model to vaporize and inhale the marijuana. \nThese recreational stores will be different from a street dealer or buying from your neighbor because there will be dozens of strains of product available with slightly different effect and there will also be pipes, marijuana-infused baked goods, marijuana drinks, hash (a condensed, smokeable marijuana product), and a number of other marijuana and lifestyle products. When it's time to pay, there will be a 25% excise tax on the price of the recreational marijuana that is in addition to the sales tax of 7 to 8%. A half ounce of medical marijuana is around $90 for premium product here. The recreational marijuana policy makers want the experience to be similar to shopping in a liquor store for marijuana with personalized help."
]
} | [] | [] | [
[]
] |
|
g0ns9w | watts vs va | Why is power draw measured in WATTS ( which is volts multiplied by amperage ) but power production or power sources are measured in VA ( volt amps ). Are they not identical? What’s the reason for the difference. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/g0ns9w/eli5_watts_vs_va/ | {
"a_id": [
"fnan73e",
"fnb0pr5"
],
"score": [
9,
7
],
"text": [
"For a purely resistive load, like a light bulb or heater, volts times amps equals watts. But many loads are not purely resistive; they can also be capacitive or inductive. By far the most common of the two is inductive: most motors, for example, are inductive loads. These loads consume power but \"return\" some of it without using it. So there's a thing called a \"power triangle\" that shows the relationship between the \"real\" power (measured in watts; this is the actual amount of power consumed), the \"reactive\" power (measure in volt amps reactive; this is the power that gets \"returned\"), and the \"apparent\" power (measured in volt amps: for a purely resistive load, this will match the real power).",
"I will try my first ELI5 answer.\n\nTake your little red wagon, some string, and your little brother and go to the bottom of a small hill. Sit your brother on the wagon and tie one end of the string the string to the handle.\n\nNow, grab the string a short distance from the wagon and slowly walk up the hill, pulling the wagon behind you. Be careful not to jerk or pull too hard.\n\nThe strength the string needs to be, so it does not break while you are steadily dragging the wagon, is the Watts.\n\nThis is slightly like a resistive load like you'd find with a light bulb or a heating element (as others have mentioned)\n\nNow go back to the bottom of the hill. Position the wagon and your little brother in the same place but this time walk back up the hill with the other end of the string.\n\nPull the wagon up the hill hand over hand.\n\nEach pull brings your brother a bit closer and the wagon may even coast a little bit before your next pull.\n\nThis is like an inductive load like in an electric motor or the alternating current in an AC circuit (which 'tugs' 60 times a second).\n\nUnlike when you slowly pulled the wagon up with you, in this case you are tugging repeatedly on the string over and over to get the wagon up the hill. This means the string sometimes needs to be a little bit stronger in order to not break when you pull each time. This is like the Volt-Amps.\n\nThe amount of effort it takes to get you, your wagon, and your brother to the top of the hill is about the same in both cases.\n\nThis is why, in electrical systems, wiring and equipment that needs to handle AC current or feed power to motors, etc, are rated in VA because at certain points in time, they need to handle more. VA is always larger than W in these cases. Situations where there is a steady load VA = W as there is no ‘tugging’.\n\nEdit.. Apologies, I kinda broke rule 4 I think."
]
} | [] | [] | [
[],
[]
] |
|
33wgud | if a nuclear bomb were being tested, and it didn't go off... how is it approached and dismantled? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/33wgud/eli5_if_a_nuclear_bomb_were_being_tested_and_it/ | {
"a_id": [
"cqp0pxt",
"cqp1tiu"
],
"score": [
9,
9
],
"text": [
"Chances are they'd shoot another (small and conventional) bomb at it to blast it into tiny, no-longer explodable pieces, then pick those up and dispose of them.",
"A nuclear bomb is typically set off by a conventional bomb. If the conventional bomb portion failed to fire, they would defuse it just like any other bomb. If the nuclear portion failed to go off, the conventional bomb portion would have scattered the radioactive material all over, so they would have to go recover that material before it poisoned anyone nearby.\n\nDuring the development of nuclear weapons at [White Sands Missile Range](_URL_0_) in New Mexico, they actually built a gigantic container, called [Jumbo](_URL_1_), to catch the nuclear material should the bomb fail to detonate correctly. They were confident that the conventional part would fire, because at that point we had plenty of experience with \"normal\" bombs and didn't doubt it would fire. They were worried that the nuclear portion wouldn't detonate. In the end, though, they didn't use Jumbo, because by the time they were ready to fire they were confident that the nuclear portion would detonate.\n\n > Fears of a fizzle led to the construction of a steel containment vessel called Jumbo that could contain the plutonium, allowing it to be recovered, but Jumbo was not used."
]
} | [] | [] | [
[],
[
"http://en.wikipedia.org/wiki/Trinity_%28nuclear_test%29",
"http://www.gearthhacks.com/forums/attachment.php?attachmentid=6087&d=1186376319"
]
] |
||
cqtd1h | what causes bond interest rates to fluctuate? | I understand that the reason that Dow J dropped so sharply yesterday was because the interest on a longer term bond was higher than that of a short term bond (or at least that what my personal finance teacher explained it as; inverted interest was the term I think) but what major factors affect the interest rate for bonds? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/cqtd1h/eli5_what_causes_bond_interest_rates_to_fluctuate/ | {
"a_id": [
"ewzfqnr"
],
"score": [
6
],
"text": [
"The more you want a bond, the less the government has to pay you in interest to buy it. How much do I have to pay you per day to pick up dog poop? A lot. Now how much do I have to pay you per day to pet kittens? Very little, because everyone wants to pet kittens! If everyone wants a 10-year bond, they don't need to lure you into buying it by promising a huge interest rate - they already have your excitement to have one.\n\nTo take your question a step further, WHY does someone want a 10-year bond? Or a 2-year bond? It's a safe place to store your money and still get paid some interest in the process (as opposed to a bank account or under your mattress, which pays you essentially nothing). The problem is that more people want a bond that lasts for 10 years than one that lasts for 2 years. Crazy, right? Why would you rather have a bond that doesn't pay you back your original amount for 10 years than one that pays you back in two years? Because more and more, people are convinced that the economy will be terrible in two years, but will be back to normal in 10 years. By buying 10 year bonds, they're guaranteeing themselves that nice little interest rate for 10 years, rather than just two - in case things turn bad in two years and there are no more good interest rates available."
]
} | [] | [] | [
[]
] |
|
2u26yk | why doesnt your soda get "shaken up" when it falls out of the vending machine? | When you buy a soda out of an older vending machine (not the ones with the moving tray thing that catches and deposits it), it falls down through the machine and hits through the door and lands in the slot with a bang. It seems like a rough journey. Why doesn't it explode when opened then? If you took that same bottle, shook it up, banged it around a little and opened it, the pressure would cause an explosion- so ELI5 why the vending doesn't do the same. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2u26yk/eli5_why_doesnt_your_soda_get_shaken_up_when_it/ | {
"a_id": [
"co4gcv4"
],
"score": [
7
],
"text": [
"Two reasons that both contribute:\n\n1) The vending machine acts as a fridge, and at a colder temperature the CO2 gas requires more force to seperate from the liquid\n\nBut more importantly:\n\n2) The \"drop\" you see in these machines isn't as dramatic as you may think. There are [columns](_URL_0_) of each different type of drink and the bottom drink (the one next in line when the consumer selects that drink) has a 5-10cm fall to the slanted surface that brings the drink to them. \n\nThe ~~kinetic energy~~ forces acting upon it during the 5-10cm fall and sliding down the slant is barely more than how much you impart when you put the drink down, so it doesn't get shaken up that much."
]
} | [] | [] | [
[
"https://eddieleephotography.files.wordpress.com/2013/02/insidecokemachine.jpg"
]
] |
|
dvm001 | what is the rationale behind kicking out a business from a strip mall/shopping center and leaving the space to sit for months/years? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/dvm001/eli5_what_is_the_rationale_behind_kicking_out_a/ | {
"a_id": [
"f7di2b2"
],
"score": [
3
],
"text": [
"If it’s empty, they get tax write offs. Maybe they want to empty out the whole place and sell it for multi-family housing development."
]
} | [] | [] | [
[]
] |
||
5mn1bl | how does a game like call of duty have practically no online delay at all while when playing a game like nba 2k17, multiplayer modes experience about a full second of delay between when the button is pressed and when the game responds? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5mn1bl/eli5_how_does_a_game_like_call_of_duty_have/ | {
"a_id": [
"dc4teq1",
"dc4u8wz"
],
"score": [
3,
2
],
"text": [
"Err. I haven't noticed this to happen in any online game so thought I'd start with that. \n\nVideo games online don't use much bandwidth so getting a faster connection doesn't really impact them that much. (Unless it comes with better latency)\n\nGames are mostly impacted by latency or ping, this is how long it takes for a piece of information to get from your computer to the host.\n\nSome games select a player with a good connection as a host and others use a central server. \n\nThe graphics are rendered locally with just the information about what movements the players are making sent back and forth. \n\nHaving played NHL, Madden, and NBA 2k I have never noticed long delays. Are you playing one of these games on a computer and the other on TV? Delays in console gaming especially can be very long if your TV isn't in \"game mode\"\n\nMost modern TVs put a 1/2 second delay on what they show so that they can upscale, and insert additional frames to make things look smoother- this obviously negatively impacts gaming. \n",
"There are mutliple ways of how you setup your networking when implementing networks for a game.\n\nOne of the most important, if not the most important aspect when doing this is if your game uses deterministic lockstep.\n\nWhen using a deterministic lockstep networking model, every action your client wants to do, has to be authorized by the authority of the game session, which in a client-server structure would be the server.\n\nIf you use peer-to-peer the authority of the gamesession would be one of the players who basically runs a server either within the client itself as paralel thread or as a dedicated program which is initiated by the gameclient which is called a child process (the gameclient would be the parent process while the server executable would be the child process).\n\nEitherway, when a gameclient wants to do something, it first has to get an ok from the authority. So you press a button which does the \"pass\" in a basketball game, and before it gets executed the authority will check if you are allowed to do this, and give you an ok if you are. Once the ok arrives, your client starts to execute the pass command you just game.\n\nAs you might already see, latency and server overload might cause the ok message to take a while. And until then, nothing is displayed for you. On the upside is, that what you see, is actually what is considered the correct state of the game... at all times. When you see a certain player holding the ball, you know, that this player hold the ball.\n\nNow there is another common way of doing network, which is predictive networking. As the name suggests your client predicts certain things. Movement for example. You move your character, and the client predicts that the authority does give it's ok, and starts displaying it right away. Or if you do an invalid command like trying to walk through a wall, it will predict that the authority will not give it's ok, and stop your model from going through the wall.\n\nNow the first thing is, with that your current gamestate will always be out of sync unless nothing moves or changes in any way. This often requires the authority to give a bit of leeway. Ever wondered why people can shot you while you were already behind a wall on your screen? Well the authority got a \"hey I shot this guy\" and due to the out of sync nature the authority decided that yes, indeed you got shot as the timeframe in which your client said \"I walked behind this wall\" and the other client said \"I shot this guy\" is within the margin of error. Without that margin of error you might never hit someone, as nobody would be where your client shows them, unless they stand still. And if you for a longer period of time not get updates, your client might run completely out of sync, in which case it needs to be resynced by the latest state from the authority, which is often shown as everyone either moving really fast or teleporting around.\n\nBut on the plus side is, that any action done on your side is immediatly reflected on your screen.\n\nAlso those two might be combined in certain ratios. An example would be Guild Wars 2 which allows predictive movement, but requires determinitis lockstep actions for skills.\n\nWhen you have a lag or a disconnect, you can still move as if nothing happened, and in case of a lag, the server might actually accept your movement if you could have reached that place within the timeframe in which no updates arrived. But at the same time using skills will not work, as you won't get an ok from the server."
]
} | [] | [] | [
[],
[]
] |
||
8cpf94 | how does saudi arabia make sure all of their expats like engineers, businessman, and english teachers follow their religious laws? | I heard that personal computers are all inspected for adult content and images. How are all expats monitored? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/8cpf94/eli5_how_does_saudi_arabia_make_sure_all_of_their/ | {
"a_id": [
"dxgpghp",
"dxgpjac",
"dxgrlo3",
"dxgsedf",
"dxh7z4p",
"dxi3yt8"
],
"score": [
91,
3,
8,
15,
5,
2
],
"text": [
"It only 'counts' inside the country. If you hang out with Arabs, you quickly learn they are all hypocrites and will happily travel to a less restrictive country where they get to drink and party.",
"Expats from Saudi Arabia, or those in Saudi Arabia? They have no control over those that have left their country, but for those moving to their country they do have the ability to check their homes, computers, phones, etc for what they deem to be illegal. ",
"if you are talking about alcohol and clubs, then there is no place to get booze excepts embassies. embassies usually hold parties and alcohol is served there, some is smuggled through. and there are compounds, which pretty much is a different countries inside saudi arabia.\nif you are talking about pornography then there is good old vpn, some saudis might even recommend you something. \nI have asked many foreigners who work in saudi, the worst part is that there is no night time activities like in the western world, and most go to dubai or kuwait or bahrain to have a good time. ",
"It's hard to wrap your head around if you assume the end goal is maintaining absolute purity of the country & laws are enforced fairly & equally. It's much simpler to understand if you view it as a tool of control.\n\nIf you're a foreigner with money & don't make enemies of the wrong people, you can get away with a lot of things as long as you do them in private. It's only after you piss off the wrong people or are stupid enough to do things publicly that they start coming after you to make an example out of you.\n\nSaudi Arabia isn't a modern Western Liberal Democracy. It's a theocratic absolute monarchy where the royal family literally owns the majority of the country and they aren't bound by pesky details like a \"Constitution\".",
"The main rules we had to follow was this: don’t flout the rules publicly. If you were drunk in your home, nobody cared as long as you didn’t sell alcohol to the locals. And don’t be drunk on the street. \n\nDon’t, don’t, don’t get caught drivinf under the influence. \n\nLong sleeve pants were strongly encouraged, but with all the heat out there, it was a great idea anyway! (Bare skin + vinyl car seat in July = PAIN)\n\nMost bigger companies paired the new folks up with a more experienced family who helped get you up to speed with the society’s expectations. Sometimes you got a welcome book from the company, too - giving you advice and guidance on not breaking the laws. \n\nThe mutawwah these days have much less power, you won’t get arrested for inappropriate dress; harassed, sure, but not as bad as before. \n\nAlso, depends on what city you’re in; the coastal cities are more liberal than the central highlands. \n\nYour luggage gets inspected at the airport (well, xrays now) but you’re not followed around. \n\nSource: 20+ years in KSA",
"For one, many foreign workers live in special 'compounds'. Basically an area where foreigners live. The best analogy I can think of is like a gated community in the US. So generally, many of the stricter laws don't apply. Like if you're a white American woman working in Saudi, you will probably live on a compound and not have to wear the niqab.\n\nDrugs and alcohol are illegal, but I mean, drugs are illegal in Canada too. People still get drugs and do them. Saudis get drunk too. They also have prostitutes and anything else you can think of. What makes you think Saudi is any different? Yeah, the punishments are harsh and you don't drink in public, but people have their own supply in their own homes. It's risky to get it into the country, like smuggling weed across the US border, but people do it. People also make their own. Saudi is not as religious as people think. Islam has a real concept of hiding your sins. The 'worst' thing you can do is talk about your sins. So people drink, fuck, drugs... and the culture and religious custom is to just not talk about it. Flout the rules publicly and yeah... you will get hit hard. \n\nInternet is something that foreigners are probably not exempt from. im not privvy to their surveillance programs, but i assume they watch all. But like all countries, people use VPNs or other stuff to bypass it. \n"
]
} | [] | [] | [
[],
[],
[],
[],
[],
[]
] |
|
3ev7rz | mountains are brown, yellow, and green and definitely not blue or purple, yet they look purplish-blue from far away. why is this? | Noticed it on my drive home in the desert...never occurred to me to actually ask why... | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/3ev7rz/eli5_mountains_are_brown_yellow_and_green_and/ | {
"a_id": [
"ctiq68q",
"ctiq8g3"
],
"score": [
12,
4
],
"text": [
"Because if they are far away, there's more stuff i.e. atmosphere between you and the mountains and thus it gets a slight bluish tint. It's the same reason why the sky is blue. Blue wavelengths are scattered less easily than red ones so they 'dominate'.\n\nYou'll notice that not only mountains appear bluish at a distance but really everything does.",
"If the mountains are really far away the volume of air between you and them is so high that it absorbs most of the visible light of the spectra but the blue light. With other words it is a result of the presence of air and its particular molecular composition. "
]
} | [] | [] | [
[],
[]
] |
|
518gob | now that mother teresa is saint teresa, how does her image change in the minds of christians? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/518gob/eli5now_that_mother_teresa_is_saint_teresa_how/ | {
"a_id": [
"d7a2fva",
"d7a2rw9",
"d7a3grj"
],
"score": [
3,
2,
2
],
"text": [
"Catholics and Christians already held Mother Teresa in a Saint like regard, so her getting actual Sainthood doesn't actually change very much.\n\nAs for her position, technically she isn't \"worshiped\", but she will be prayed to for people seeking guidance, and she now has a \"Feast Day\" (September 5th) where Catholics Bishops can decide to hold a feast in her honor.\n\nNo Church is actually obligated to host a feast for her, the Catholic Church currently has [810 saints](_URL_0_) and celebrating all of the Saint feast days would mean having a multiple feasts on every single day of the year, so the Bishops pick and choose which saints will celebrate which feast days are and are not celebrated.",
"For Protestants nothing changes. We do not celebrate or honor the Saints, and some Protestants view doing so as idolatry. Many think the work that she did was great, but it does not go beyond that. \n\nFor Catholics she is among the list of people that can be prayed to for guidance or help. But being canonized does not really change much, because people had to have already had high opinion of her for her to be canonized. ",
"If you admire Mother Teresa, you really might want to [inform yourself better.](_URL_0_)\n\nAmong other things, she let people suffer needlessly because she was obsessed with the Christian view of suffering as a virtuous act. Less charitably put, she tortured people because she found their pain beautiful."
]
} | [] | [] | [
[
"https://en.wikipedia.org/wiki/List_of_saints"
],
[],
[
"https://en.wikipedia.org/wiki/Criticism_of_Mother_Teresa"
]
] |
|
46qul7 | uk vote on leaving the eu - brexit | Today it was announced that there will be a referendum for the UK to leave the EU on June 23rd. All related questions in ELI5 will be forwarded to this sticky thread. Please read the comments on this thread and if your question isn't already covered please ask it as a question in this thread.
Thanks! | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/46qul7/eli5_uk_vote_on_leaving_the_eu_brexit/ | {
"a_id": [
"d076wy3",
"d0777j8",
"d077rqq",
"d07b7xf",
"d07ci8v",
"d07dn6y",
"d07g19t",
"d07k0ki",
"d07vqey",
"d089r00",
"d08kp3z",
"d09f3yx",
"d0bae6w",
"d0bawdq",
"d0g52b3"
],
"score": [
8,
56,
10,
12,
10,
6,
2,
7,
2,
2,
51,
7,
2,
2,
2
],
"text": [
"ELI5, why has this referendum come about? What lead up to it?",
"* What is a referendum?\n\nA referendum is when the electorate (general public who can vote), or the parliament (although usually MPs can't vote, but not in this specific referendum), vote on a specific issue, such as, for example, a law. \n\nUsually, it's basically that you choose \"yes\" or \"no\" on a particular law, for example, but sometimes there can be multiple choices as well.\n\n* What is the European Union?\n\nA political and economic union (or actually the economic part is only in the European Economic Area) between multiple countries, and most of them are usually located within Europe. Currently, there are 28 member countries. The idea of it is that basically those countries can work together, make laws which apply to all of them, have a unified trading market, have the same currency (the euro, of which 19 member countries currently use it), etc.\n\n* What is going to be asked in this UK referendum?\n\nThe exact question is \"*Should the United Kingdom remain a member of the European Union or leave the European Union?*\"\n\n* Is the parliament only the people who can vote on that question?\n\nNope, if you're a UK citizen who's over 18 years old, or you're a UK citizen who's living abroad but have done so for less than 15 years, or a commonwealth citizen residing in the UK, then you are able to vote.\n\n* Should the UK leave the European Union?\n\nSome people say that yes, it should, because they say that the European Union has too many rules for businesses, and they also say that even though the UK pays lots of money as membership fees, they don't get much stuff in return. They also want to reduce the number of people coming to the UK for work (as to basically get to control the borders and not have \"free movement\", which is a thing in the European Union wherein you don't need a visa to go to from one member country to another), etc.\n\nSome people say that no, it shouldn't (and that includes the UK prime minster, David Cameron, as well), because then it's easier to trade between other member countries, and that also that the immigrants who're coming for work actually help to boost the economy.\n\n* So, should the UK leave or not?\n\nIt depends, as there are plently of arguments on either side saying yes, it should, and no, it shouldn't.",
"If the UK leaves the EU, what will change for the UK citizens living in the EU and vice versa?",
"What exactly is this \"deal\" that Cameron has got? How does it change the relationship with the EU and what does it allow the UK Parliament to do which it couldn't do before?",
"What affect will this have on Ireland? Especially the border between the Republic and the North?",
"Why does the EU event WANT the UK to stay? I got the impression that the Brits have already bullied the EU into giving them special treatment multiple times. So... is keeping the UK in the EU really worth it?",
"Will non UK citizens who remain in the UK on some sort of visa likely to be entitled to free health care etc if they remain or will life become harder once on a visa / different terms and thus encourage people to leave the UK?\n\n(I'm thinking families who have lived here for years and work here that may suddenly find it difficult, and have to return to their home land, which may put a strain on businesses) ",
"Can someone explain to me the reasons the UK would want to stay in the EU and the reasons they would want to leave?",
"Can anyone give an idea of what applying to university will become post referendum?\n\nAssume that I was offered a position today, but started in the autumn, how would this affect my studies?",
"London Mayor Boris Johnson said he is campaigning to support the \"brexit.\" How important is this news and how influential is his opinion?",
"I guess what really blows my mind is Europe has the potential to be the most powerful state in the world economically, but the constant divisions and infighting leave it mostly impotent ",
"Why would England beg Scotland not to leave the UK, but the same people want to take UK out of EU?",
"And so Europe gets a little closer to another war between us.\n\nIt may be that the EU kept us together for so long (and ofc the nukes)",
"The way I understood it was if Scotland left the UK then we (England) would most likely go into another economic depression. Would any sort of similar thing happen if the UK left the EU? If so, what? And as a more general question what are the major economic effects on the general public as a whole (including things like if, how and when currency will change, if and how earning change etc.)?",
"Britain leaving the EU; is it the UK (England, Scotland, Wales, and Northern Ireland) or just England? What are the possible ramifications for 1) the UK, 2) Republic of Ireland, if it is the UK, 3) the rest of Europe, with regards to travel/visa arrangements, trade, etc?"
]
} | [] | [] | [
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[]
] |
|
2f1yak | what does this joke mean? i've been staring at it and i just don't understand it. | I was told at the doctor’s office that I should get a facelift. The doctor agreed with the waiting room when he came out.
[From this, the second bullet point](_URL_0_)
Maybe something to do with how bad the doctor's eyesight is? I don't see how that would be self-deprecating... | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2f1yak/eli5_what_does_this_joke_mean_ive_been_staring_at/ | {
"a_id": [
"ck54hwk"
],
"score": [
3
],
"text": [
"The doctor is supposed to be objective and not influenced by personal opinion/judgement when dealing with patients. The fact that the doctor, whose duty is to the patient's care and wellbeing, joined the waiting room group in belittling the protagonist is where the self-deprecating part comes into play. "
]
} | [] | [
"http://www.wikihow.com/Sample/Self-Deprecating-Humor"
] | [
[]
] |
|
3fqi5q | when a sound or person wakes you up while dreaming, is it just me or is the noise always perfectly timed with an event in the dream? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/3fqi5q/eli5_when_a_sound_or_person_wakes_you_up_while/ | {
"a_id": [
"ctqzg9l",
"ctr0bs5",
"ctr0nge"
],
"score": [
4,
3,
3
],
"text": [
"Memory of what happened in dreams is quite inaccurate. Your brain can actually construct the memory afterward, for example showing you that something happened simultaneously that didn't.",
"Your dream may have ended at that point many minutes before you were woken up, you just have no memories of the intervening time and to you the events were simultaneous.\n\nSame things happening when you find yourself always waking up at the \"good bit\" of a dream.",
"According to a psych course I took in university, dreams occur when information is transfered from short term memory to long term memory. During that transfer the brain sees that information, it doesn't make sense as it is just a bunch of random images and gets confused. To avoid confusion it makes up a story and presents it to you as a dream. \n\nI would imagine this would work for external stimuli as well - brain hears a noise, incorporates it into the dream."
]
} | [] | [] | [
[],
[],
[]
] |
||
543osu | what did wells fargo do? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/543osu/eli5_what_did_wells_fargo_do/ | {
"a_id": [
"d7yncpa"
],
"score": [
2
],
"text": [
"Imagine you went to the bank to open a checking account and the banker tried everything possible to get you to sign up for a credit card and maybe even a second checking account to \"help you manage your finances\" but you just kept saying no. \n\nAfter you left the bank, the banker opened those accounts anyways and just never told you about them. But what about all the fees? WF employees then created transactions moving money between those fake accounts so the fees would be waived. In some cases where bankers got promoted, lost access to accounts, or were terminated, account holders then got late fees, overdraft charges, monthly fees or other penalties on accounts they never knew they had.\n\n• Opened deposit accounts and transferred funds without customer authorization, sometimes resulting in insufficient funds fees for customers.\n\n• Applied for credit card accounts without consumers' knowledge or consent. Customers were hit with annual fees, in addition to finance and interest charges and late fees for some consumers.\n\n• Issued and activated debit cards, creating PINs for customers, without their consent.\n\n•Created phony email addresses to enroll consumers in online-banking services."
]
} | [] | [] | [
[]
] |
||
7id8bi | why is it that you are able to start a manual car by popping the clutch in second gear? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/7id8bi/eli5_why_is_it_that_you_are_able_to_start_a/ | {
"a_id": [
"dqxxxrr"
],
"score": [
2
],
"text": [
"No-one is really addressing the *why* portion.\n\nIn short there are several ways to ignite fuel. One is by a spark, another other is by compressing the fuel/air mix. Boyle's law tells us that when you compress a gas the temperature increases. If you compress the fuel/air mix enough it will ignite, just as though the spark-plug had ignited it (this is how [fire pistons](_URL_0_) work for starting campfires).\n\nIt works because if the car is in gear there is a direct link from the crank that the pistons turn to the wheels. Normally the pistons fire, turn the crank, the engine, the driveshaft, and eventually the wheels. As long as the vehicle is in gear this process works in reverse too. This is why you downshift when going down a steep hill, you are bleeding speed off by making the wheels turn the engine.\n\nSecond gear (and reverse) have the best gear ratio to start an engine at the speed you can reach by pushing the vehicle.\n\n\n\n"
]
} | [] | [] | [
[
"https://en.wikipedia.org/wiki/Fire_piston"
]
] |
||
1ojjt9 | how can colleges legally create "customized" textbooks and not be found guilty of unlawful monopoly/duopoly? | A monopoly is a company that is the sole producer of a certain good or service. I know that monopolies themselves are not inherently illegal, but can become so when they exhibit certain qualities. For example: price gouging and "refusal to deal".
At my university, the school buys books from Pearson or McGraw hill, then "customizes" them by removing (not adding, no joke) content that doesn't apply to the specific course being taught. Then, the book is sold to the student at a markup over the normal cost of the textbook because it has been customized for your specific course. These textbooks don't add content, homework assignments, extra lecture/professor notes, but they screw with your ability to buy the original publisher textbook because the chapter numbers (and occasionally names) are different.
What makes it even worse, is that the universities refuse to let the students who purchase (or rent) the original publisher textbook or ebook, what the equivalent chapters are in the book.
So how is it that colleges that do this, charge twice as much as the original, and then get away with it without being fined for exclusionary practices and price gouging? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1ojjt9/eli5_how_can_colleges_legally_create_customized/ | {
"a_id": [
"ccsjklj"
],
"score": [
2
],
"text": [
"Your college isn't the only one offering BIO 101 or whatever the course is. It's not exclusionary because you could have chosen a different college, so they aren't doing anything anti-competitive. It's sort of like how a bank can charge you a fee that no other bank charges, but they get away with it because they can say \"hey you could've picked a different bank.\"\n\nI'm not saying it's right, but that's the loophole that they're dancing around in while they flip you the bird.\n\nedit: by the way, my school is doing the same thing for one of my courses, and what they're doing is they package the lab manual (which you need your own copy of) in with the textbook, so you can't just use a library copy or something. It's highway robbery, but it's legal."
]
} | [] | [] | [
[]
] |
|
1fgrwi | if we die after roughly 3 weeks without eating, why do eat 3 times a day? | I know you wouldn't spend 3 weeks very wealthy or you would lack energy, but still, it seems it's some sort of waste. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1fgrwi/eli5_if_we_die_after_roughly_3_weeks_without/ | {
"a_id": [
"caa3rv3",
"caa3s35",
"caa67s2",
"caa78wq",
"caa9hn3",
"caaaohf",
"caaej35"
],
"score": [
111,
25,
19,
5,
3,
2,
3
],
"text": [
"Eating three times a day is actually a modern invention (modern in terms of human history as a species). It wasn’t uncommon, or even unhealthy to eat once a day, or sometimes skip a day every few days. It still isn’t unhealthy to do that today, you are just so used to eating three times a day that it would be difficult.\n\nWe die after 3 weeks of not eating because we are healthy and well nourished. If you ate rarely and were malnourished you would die much quicker. We eat daily to make sure we are in top health.\n",
"Our body stores enough fuel to keep going for a while, but regular meals allow us to keep those reserves stable. Over the course of starvation your body dramatically cuts back energy use as well; if we were flirting with starvation we would be weak, stupid, slow to heal if at all, and generally unfit for anything.",
"Broke college kid here, I've eaten only once or twice a day pretty much all year. Haven't noticed any difference.\n\nBreakfast is a scam. ",
"Firstly, as others have said, three meals a day is a modern thing people in wealthy countries do. A lot of people are lucky to get one good meal in a day, that's why we've evolved to survive so long without food.\n\nNow, you would never want to go three weeks without food. Even two weeks would inflict a terrible toll. The first thing to go is your body fat, as you'd expect. When you start running out of fat, your body starts breaking down your muscles. You'd completely lose any energy and just feel like sleeping all the time. If you ever reach that point you're in serious danger because you can very easily pass the point of no return. That is to say, you can get into a situation where you totally lack the energy or ability to feed yourself. Days could go by in slumber as your body eats itself. By this point your ability to digest food would also be compromised - we use lots of energy breaking our food down - and eating solid food would be impossible. You'd most likely vomit it back up assuming you could swallow it in the first place; if you kept it down it would most likely constipate you.\n\nAfter you've the majority of your body fat and muscles, your body would then turn to all the other soft organs in your body. That means your liver, kidneys, pancreas, and your brain. Nerve cells are largely made up of fatty acids and are therefore full of energy. As your body breaks down your brain, it's possible to experience irreversible brain damage that causes significant defects in learning, memory, and perception. Anyone experiencing in this condition needs to be admitted to hospital, as not only are they likely to be a danger to themselves due to not knowing what's going on around them, they're also at risk of sudden heart failure. By this point levels of potassium are likely to be extremely low, and we need potassium to send signals down our nerves. This is a common killer in acute anorexia; the signal literally stops going to the heart and boom, they're dead.\n\nI've seen someone go down to just under four stone due to a combination of anorexia and bulimia, and that's pretty much what happened. You wouldn't believe what the body does to keep itself alive; it will even sacrifice the person inside. So, don't starve yourself. It's best to eat reasonable, healthy meals on a regular schedule. ",
"Three a day isn't really a rule, but a certain amount of nutrition is needed to 'keep ahead' of what's needed.\n\nThink of it this way... your body is a chemical furnace. Picture a steam boat. You need to keep throwing logs on the fire or it will go out. If you run out of logs, you can start taking apart the boat... stuff you can live without first, like some stairs, a few chairs, and so on. As time goes on you start getting down to more and more important stuff that doesn't burn as well, but you're desperate... the rudder, the floor... and as you cannibalize your boat it eventually just falls apart.\n\n... (gets less ELI5 from here. To an actual 5 year old, I'd probably stop with that)...\n\nNormally, you have a reserve of logs (fat) sitting along the side of the boat. Your body likes to avoid using this reserve because it's designed to be a backup source of energy. And when you do use it up, it wants to replace it as soon as possible (brings diet issues into focus a bit, eh?), because your body is built to survive emergency shortages.\n\nAdd to this complication that it's not *literally* a fire... you need specific \"Types of Wood\" if you will. So while you can work off the backup fuel, it's not as good for you (and it doesn't \"burn as hot\"... the energy doesn't work as efficiently as things like glucose/sugar).\n\nAnd, to throw on more unnecessary information and walk farther away from a true ELI5 response, add to the complication that certain body parts, like your brain, require certain fuels... such as your brain which really only uses glucose as fuel (part of what makes unmonitored blood sugar in diabetics so dangerous).\n\n",
"If my car can drive for fifty thousand miles without an oil change before it's totally ruined, why do I change the oil every three or four thousand?",
"Surviving is not the same as living. That said, I eat a banana for breakfast skip lunch, and then eat meat and veggies for dinner. Think of how inactive most of us are, sleep, stand get dressed, sit in car/train, stand to walk in to job, sit for four hours, stand to go to cafeteria, sit to eat, stand to go back to office, sit for four hours, stand to get to train car, sit to go home, stand to go inside make dinner, sit to eat dinner, sit to watch tv unwind, lay down to sleep, repeat. "
]
} | [] | [] | [
[],
[],
[],
[],
[],
[],
[]
] |
|
7yyyiq | the strength of currency | I don't think the "strength" is a exactly what I don't understand, but it's the closest word I could find. I've heard people say that the Euro is better than the USD because it's worth more per unit. This doesn't make sense to me. That's like saying a dollar is better than a cent because a cent is 100x more than a dollar, isn't it? You can easily convert between the two in both cases. Am I missing something? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/7yyyiq/eli5_the_strength_of_currency/ | {
"a_id": [
"duk5e3v",
"duk61n7",
"duk6341"
],
"score": [
4,
2,
3
],
"text": [
"You're right. It's a common misconception to say, for example, that since you get more Canadian dollars in exchange for US dollars, the US dollar is worth more. If prices were the same in both countries that would be the case, but prices are not even consistent from one city to the next within the same country, let alone across international borders. \n\nOnce US dollar is worth about 1.25 Canadian dollars. If a product that costs $1 in the US costs $1 in Canada, it's cheaper in Canada because the Canadian dollar is worth less, but if the same product that costs $1 in the US costs $1.50 in Canada, it's cheaper in the US because 1.25 is less than 1.50. \n\nThe more accurate metric is how the exchange rate changes. If exchange rate changes from 1 USD = 1.25 USD to 1 USD = 1.1 USD, that means the Canadian dollar is worth more than it used to be, indicating that the Canadian economy is growing faster than the US economy. ",
"It is mostly irrelevant to compare what 1 of one currency is compared to 1 of another. You're right about that.\n\nThe \"strength\" of a currency that I think you're referring to is more of the confidence in it that it will retain its current value - value not meaning how it exchanges to other currencies, but what you can actually purchase with it.\n\nLook at the Venezuelan bolivar as an extreme example of a weak currency. You could be able to afford a car this month and bicycle next month with the same amount of bolivar. ",
"The analogy between dollars/euros and dollars/cents is missing a key point: the cent is defined as 1/100 of a dollar; that number cannot vary (barring an act of Congress, at least).\n\nMeanwhile, a dollar will buy a varying amount of euros over time. Both currencies are fairly stable, so this isn't an enormous swing, but - if you used $1,000 to buy euros three months ago, you would have gotten €849.53. If you were to then exchange that €849.53 back to dollars today, you would receive $1,047.80.\n\nSo the euro, relative to the dollar, has gotten stronger in the last three months - one euro is worth more dollars now than it was then.\n\nThe inherent strength of a currency is a harder concept to nail down, but one way to think about it is in terms of how stable prices are for domestic goods where the currency is used. One of the reasons the US dollar is a strong currency is that prices are relatively stable. If you earn a dollar today, you expect it to be worth pretty much the same (in terms of what you can buy) tomorrow. This means that the dollar serves as a useful store of wealth.\n\nThis, in turn, can be (in part) attributed to the belief that the US government won't suddenly go on a money-creation spree. That is, they won't start creating dollars (by spending) too much faster than they destroy them (by taxing). \n\nIt can also (in part) be attributed to the belief that the US government won't collapse or be torn down - note that perhaps the most basic reason government-issued currency has value is because the government insists you pay your taxes in its currency. This means that you need a ready supply of dollars to pay your US taxes, which means there's a built in demand for dollars in the domestic economy."
]
} | [] | [] | [
[],
[],
[]
] |
|
404s7n | why wont an xbox dvd work on a playstation, or computer? | I've been wondering. Movies are able to do this, is it only to make money? It would, however, destroy the whole "console exclusive" thing. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/404s7n/eli5_why_wont_an_xbox_dvd_work_on_a_playstation/ | {
"a_id": [
"cyrh6xs",
"cyrhd8h"
],
"score": [
2,
2
],
"text": [
"its just different hardware. DVD machines are made to be able to be played on multiple different systems (theres sortof a standard), while thats just not the case for console gaming. They have no need to keep a standard so they dont. \n\n > It would, however, destroy the whole \"console exclusive\" thing.\n\nand there you have it. its not in inability, its a choice ",
"Are you talking about the video games on discs? If so, they are Blu-ray now, but that doesn't matter. \n \nYour question is the same as \"Why doesn't this Windows program run on Mac?\", it's because they have different programming. \n \nAll Blu-ray movies can play on all Blu-ray players (not taking into account region coding or anything like that) because all Blu-ray players are programmed to read the same data."
]
} | [] | [] | [
[],
[]
] |
|
2cuzx1 | why is the fetal position so comforting? | In other words, why do we curl up in the fetal position when we're in pain, are stressed, or are uncomfortable? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2cuzx1/eli5_why_is_the_fetal_position_so_comforting/ | {
"a_id": [
"cjjabgq"
],
"score": [
5
],
"text": [
"Simple answer: *We don't know.*\n\nPostulation: The fetal position may be a learned response, similar to how some people sit and sway back and forth when distressed.\n\nSince we associate the position with fetus's, or young babies, it may be a visual cue to others, expressing \"I am not a threat\" or a request for attention and/or comfort.\n\nIt may also serve the functions of protecting the face, head, anterior vital organs, and the genitals from attack.\n\nFurthermore, try bending the other way... Not as comfortable, *right*?"
]
} | [] | [] | [
[]
] |
|
a3l6ra | why are the front and back cameras on smartphones not the same to begin with? why do they need to differ in quality? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/a3l6ra/eli5_why_are_the_front_and_back_cameras_on/ | {
"a_id": [
"eb73ucz",
"eb73uty",
"eb73x9a",
"eb73z1j",
"eb7409j",
"eb7793x"
],
"score": [
49,
17,
10,
9,
2,
4
],
"text": [
"cost and size.\nif all other variables remain constant, a bigger lens allows for better photos, as well as a bigger image sensor (the light sensing chip behind the lens). since they’re intended for different things, they just use different cameras. smaller cameras are also better at taking pictures of things closer to themselves (like a selfie)",
"Size. And cost.\n\nOne has to discreetly fit beside the screen, not look like a hideous lens obscuring your screen size, and only needs to take photos up close of your face. The other one needs to function as an actual camera and take detail, be able to zoom, etc.\n\n",
"Back cameras are much larger and are able to do many more things. There’s no need to have two of them on a phone. The front facing camera is mostly for selfies so there’s no need for a zoom or wide lens",
"Most people are never going to use the selfie camera for anything other than - you guessed it - selfies, or possibly video chat, which by their very nature never need to be all that high quality. Putting a top quality camera in the front camera position would just increase the cost for a benefit, from most people's perspective, of very little. ",
"The bette the camera the more it costs to make. So the phone markers chooses cameras that are just good enough for what they are used for.\n\nThe back page camera is often used for big scenes with many details and need more data. The front camera is often used for selfies or similar, where details are not as needed or necessarily good thing (which is why we have filters that smooth the skin etc).\n\nHistorically the front camera was for video chat, which was limited by bandwidth and data, makings low resolution good enough. \n\nEdit: Switched back/front. D'uh!",
"Every penny saved on a component, when you're shipping several million units, adds up quick!!!\n\nIf the selfie camera just needs to be adequate enough to do a good enough job, it's hard to justify the few extra pennies on the component, especially since selfie cams are not that popular of a selling point. "
]
} | [] | [] | [
[],
[],
[],
[],
[],
[]
] |
||
9m8d63 | how does an epipen work to help severe allergies and why don’t we use it for moderate/mild allergies? | I’ve always wondered why people use an epipen when having a severe allergic reaction to things like peanuts or shellfish but we don’t use it for people who get bad allergies to things like pets or pollen? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/9m8d63/eli5_how_does_an_epipen_work_to_help_severe/ | {
"a_id": [
"e7cp3zz",
"e7cp40g",
"e7cpmj0"
],
"score": [
3,
3,
12
],
"text": [
"Because it’s a huge strain on the system of the person receiving it. It’d be like killing an ant mound with a bazooka — it would work, perhaps, but it’s not a thing you’d do often, and there are better, less-scorched-earth tools that are better suited to the situation. ",
"It causes bronchial dilation so your airway stays open when it’s trying to close in anaphylaxis. It increases blood pressure too. It’s the same thing as adrenaline. It’s only meant to be used in ER situations. It does nothing for histamine which is the cause of most every day allergies. ",
"An epipen contains epinephrine, commonly known as adrenaline, one of the main hormones released by the body when PANICKING OMG THERE'S A LION. \n\nIt's great for doing things like restarting your heart, lifting a car off your child, or removing blood flow from parts of your nose and throat that might be blocked by an allergic reaction, thus allowing you to breathe, but it also removes blood flow from your digestive system until your body can filter it out which... Well, apart from the explosive diahrroea brought on by extended use, your stomach will eventually dissolve it's own lining and dump a strong acid into your bloodstream, if that lining isn't grown back. \n\nLack of blood flow inhibits your body's ability to grow back your stomach. Which in mediocre cases result in ulcers. \n\nEpinephrine is healthy if released by your body occasionally. Injecting it on a regular basis isn't. "
]
} | [] | [] | [
[],
[],
[]
] |
|
2sqcf7 | if oil has a finite supply and is steadily running out, why does the price per barrel fluctuate? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2sqcf7/eli5_if_oil_has_a_finite_supply_and_is_steadily/ | {
"a_id": [
"cnrvyus",
"cnrw1n7",
"cnrw7w3"
],
"score": [
4,
2,
3
],
"text": [
"It comes down to basic economics of supply and demand.\n\nThe amount of oil in the ground is finite but the amount of oil that has been pumped to the surface and available for use changes on a regular basis. Currently the US, Iraq and Libya are pumping more oil than in the past. Combine that with the fact that Saudi Arabia has decided not to slow its own production and you have a large supply.\n\nOn the other side of the equation you have demand. China and Europe are currently using less oil than they were a few years ago.\n\nWhen you have high supply and low demand the price tends to drop.",
"Actually oil reserves grows as time goes on : ) Its because new oil is being found everyday.\nIn 1944 there \"were\" 51 billion of oil barrels..\nBetween 1945 and 2003 917 billions were used. In 2003 there were known 1,266 billion of oil reserves.\n\nIf you were to take all known oil reserves in 1980 and rate at which oil were used this year you would conclude that we gonna run out of oil in 25 years. Do you recall something like that happening? : )\n\n\nThere is cool lecture on that _URL_0_",
"There IS a finite supply, but its a VERY large finite supply, so it wont run out for a very very long time. The price is rising, but very very slowly over the long term. \nThe more common price fluctuations are due to other more immediate factors, as stated in other comments."
]
} | [] | [] | [
[],
[
"https://www.youtube.com/watch?v=ZwfXGKrGzAM"
],
[]
] |
||
1t4ye1 | what causes cars to sometimes explode when they flip over in a crash? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1t4ye1/eli5what_causes_cars_to_sometimes_explode_when/ | {
"a_id": [
"ce4dc3j",
"ce4ea8t"
],
"score": [
3,
7
],
"text": [
"Cars generally don't actually tend to blow up.\n\nThe only reason a car would explode would be a spark or fire reaching the gas tank and even then its not quite like how you see it in movies. ",
"As a 25+ years firefighter / Paramedic I have NEVER seen a car that has exploded in an accident. And have rarely even seen cars catch fire. The few that I have seen catch fire are usually because the fuel line or gas tank has ruptured, and the fuel comes in contact with hot metal (Catalytic converter or engine block) Yes these fires can consume a car (and occupants) quickly but not like in the movies."
]
} | [] | [] | [
[],
[]
] |
||
eyq1ij | why we get sleepy in situations that sleeping can kill us | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/eyq1ij/eli5_why_we_get_sleepy_in_situations_that/ | {
"a_id": [
"fgijzvf",
"fgj4m2k",
"fgjdb1j"
],
"score": [
5,
2,
7
],
"text": [
"What situations do you mean?",
"Yeah I've always wonder why we get sleepy after hitting your head. I remember my parents always telling me to not fall asleep while they drove me to the hospital....",
"The bit of your brain that decides when to be sleepy can't access higher rational thought, it's based on the brain's physiological status. \n\nYour brain gets sleepy when the chemistry in your brain indicates that it needs to sleep, along with some hormonal inputs from the body like adrenaline which tell it that something critical is going on and you need to be awake. But the part of your brain thinking \"I better not fall asleep while driving because I could crash\" can't communicate that information to the part of the brain that decides when to be sleepy. As far as that part of your brain is concerned, if you are driving late at night you are sitting calmly in a quiet, dark place and you haven't slept in a while and now would be a good time. \n\nThis is not entirely terrible, it makes it harder for you to sleep-depriving yourself to a dangerous extent. And it's not like your conscious mind can't override sleepiness for a long time. But the modern world has a lot of situations where it would be a bad idea to be sleepy but there are no obvious cues the sleepiness part of your brain is adapted to interpret, and this causes problems (like, you aren't going to be sleepy if there's a large predator staring at you, because you are innately going to be adapted to respond to that. But there's no innate adaptation to staying awake while driving)."
]
} | [] | [] | [
[],
[],
[]
] |
||
drto7p | how can a single pixel on a tv screen change to so many different colors? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/drto7p/eli5_how_can_a_single_pixel_on_a_tv_screen_change/ | {
"a_id": [
"f6l1gyo",
"f6l3xcn"
],
"score": [
13,
4
],
"text": [
"You remember mixing paint colours when you were a kid? A single pixel is made up of a tiny blue light, a tiny red light, and a tiny green light. It can be any colour just by controlling how strong each of these colours shines inside it. More modern screens (e.g., Liquid Crystal Display) have fancier technology but let’s stick to ELI5.",
"Your eye have 3 types of cone cell that detect light color. One type is most sensitive to blue light, one to green light and one to red light . So any color you can see is a combination of signal from the three types of cones.\n\nA monitor have red green and blue sub pixel where each primary stimulate only on cone type. By changing the amount light each sub pixel emit can use get any response from the eye and see any possible color. So by exploiting how the human eye work you can produce any color with light on only 3 colors.\n\n It is a bit simplified explanation and a RGB monitor can't show all colors you can see with you naked eye. I suggest looking at [Technology Connections - The Weird World in RGB](_URL_0_) for entertaining explanation of color vision and RGB work and the limitations."
]
} | [] | [] | [
[],
[
"https://www.youtube.com/watch?v=uYbdx4I7STg"
]
] |
||
4mh538 | if insects and arachnids don't have feelings, than what would trigger them to act if in danger? | If the title doesn't make much sense, this is what I mean. For example, I saw a gif of a toilet being flushed and a spider going down with it. The spider is rapidly wriggling its legs as if it's trying to save itself. If they really can't sense fear, or feel threatened, then why would they bother try to stay alive? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4mh538/eli5_if_insects_and_arachnids_dont_have_feelings/ | {
"a_id": [
"d3vhksa",
"d3vigim"
],
"score": [
2,
2
],
"text": [
"Because reflexes and involuntary reactions often have little to do with emotion. Just like when a doctor hits you in the knee with the rubber mallet or when you stub your toe in the dark. Your reaction is to make a jerking motion but it doesn't necessarily trigger any significant emotions. Except maybe you'll get pissed off after stubbing your toe.\n\nAlso, studies suggest insects do in fact feel emotions such as fear and pain.\n\n_URL_0_",
"Insects and arachnids do have at least some feelings such as fear and pain. What they don't have is the self awareness and intelligence needed to contemplate what those feelings mean."
]
} | [] | [] | [
[
"http://www.independent.co.uk/news/science/flies-experience-emotions-like-fear-and-might-offer-insight-into-how-the-brain-makes-feelings-10253201.html"
],
[]
] |
|
139ef8 | the us and why israel is important to the us. | It seems like both republicans and democrats think Israel is important. Can somebody cover some of the details.
This is more of an 'in general' question. I'm not looking for information on the recent news. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/139ef8/eli5_the_us_and_why_israel_is_important_to_the_us/ | {
"a_id": [
"c71z4t2",
"c71zn5t"
],
"score": [
4,
3
],
"text": [
"After the Holocaust in the 1930s-40s, it became clear that the Jewish people needed a homeland that could protect their culture and their people in the event that another group decided to attempt to exterminate them. Many began returning to their ancestral homelands near Jerusalem, which was part of a British colony known as Palestine. Because many of them began an armed revolt against the British control of the land, the US and Great Britain, under the auspices of the United Nations, carved out a piece of Palestine and set it aside as the Jewish homeland. Since it is a piece of land that was disputed for over a millennium, and was at the time occupied by Muslims, Israel has needed the military muscle of the US to back it in order to ensure it's existence. While the US has never officially become militarily involved in the Israeli-Palestinian conflict, we have been supplying the Israelis with armaments and other support for decades, at the same time attempting to broker peace between the two factions, with little success. \n\nSo one could say that the reason Israel is important to the US is because we created it. It's existence was intended to protect the Jewish people and culture and allow them the freedom to practice their religion which many other countries had denied them. Some Americans view Israel as part of the Christian faith, believing that the prophesied return of Jesus Christ will begin when all 12 tribes return to the holy land. Others simply believe that such a place needs to exist to protect the Jews. Still others believe that we need Israel to ensure that there is at least one friendly government in the region, since most of the others don't like America very much. Overall, it's an extremely complex issue that will probably never be solved to everyone's satisfaction.",
"Israel is our one friend who lives in the ghetto neighbor hood. were always being nice to them because when we visit them they are the only thing that keeps the rest of the ghetto from shooting us and leaving us in the ditch without our jordans."
]
} | [] | [] | [
[],
[]
] |
|
2u548b | how is tesla able to improve the efficiency or performance of their cars with over-the-air updates? | They seem to be constantly improving the range of their cars and Elon Musk just tweeted that the Model S P85D will be able go 0-60 mph ~0.1 sec faster with a new update. How is this possible? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2u548b/eli5_how_is_tesla_able_to_improve_the_efficiency/ | {
"a_id": [
"co58br7"
],
"score": [
3
],
"text": [
"It's the future, man. Nowadays, computers control every aspect of cars from running the engine to turning on the interior lights when you open the door. Electric motors are controlled by changing the voltage and current running to them. More voltage means more torque (twisting force) and more current means faster speed (less current is less speed). Engineers use complex equations to decide *when* to change the current and voltage that go to the motors, both of which combine to form the 'power' of the engine or battery. For example, there may be a lot of voltage when accelerating from a stop, but much less of it at a constant speed--these things are controlled by the computer. What Tesla has done is tweaked various variables inside the computer program that relate to how and when electricity is distributed to the wheel motors. The computer program(s) that control these things are updated over the air, just like your phone. By constantly modifying the programs that run on the Model S, the engineers can figure out what combinations of voltages and currents work best in different scenarios. Sometimes they completely change the program itself."
]
} | [] | [] | [
[]
] |
|
5w2q23 | what is a social construct? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5w2q23/eli5_what_is_a_social_construct/ | {
"a_id": [
"de6uskr"
],
"score": [
17
],
"text": [
"Something that only exists solely because a bunch of humans agree it exists. Consider the value of cash, for example. A couple of sheets of cotton and some mostly zinc coins you have in your pocket aren't of much practical use to anyone. However, because we all agree they have value, they do."
]
} | [] | [] | [
[]
] |
||
8ixq8p | how can lonely cloud survive in a crystal clear sky? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/8ixq8p/eli5_how_can_lonely_cloud_survive_in_a_crystal/ | {
"a_id": [
"dyvei9e"
],
"score": [
4
],
"text": [
"In the absence of winds in the atmosphere, the \"lonely cloud\" would certainly dissipate. However, the rotation of the Earth and the different gradients of heating (of the soil and water) that the Sun causes, result in the atmosphere having currents of wind, and areas of higher and lower pressure and temperature. \n\nWater molecules stay in the air based on pressure and temperature. They condense to the fog droplets that you see as \"a cloud\" based on pressure and temperature. And rain condenses out of a cloud based on pressure and temperature.\n\nSo, basically, the \"lonely cloud\" is in a \"pocket\" of different pressure or temperature, bordered by winds (that you can't see) that keep it in that shape."
]
} | [] | [] | [
[]
] |
||
2n5k42 | when holding hands, why does it feel so much better to be the "under" hand than the "over" hand (since neither position is actually ~~physically~~ uncomfortable)? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2n5k42/eli5_when_holding_hands_why_does_it_feel_so_much/ | {
"a_id": [
"cmaucji"
],
"score": [
2
],
"text": [
"Supposedly has to do with left and right brained. Which may or may not be a thing. For me the left thumb has to be over the right when I clasp my hands and its same for holding hands. There's a thing with preference in crossing your arms and a couple others. I'm a bad example b/c I'm evenly split on which side is dominant which is actually accurate b/c I'm analytical + creative\n. decent writer, good at math, play piano."
]
} | [] | [] | [
[]
] |
||
1qbrc7 | how can uranium be used for "peaceful" purposes (as iran wants to do)? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1qbrc7/eli5_how_can_uranium_be_used_for_peaceful/ | {
"a_id": [
"cdb7j9x"
],
"score": [
7
],
"text": [
"Uranium can be used to generate nuclear energy, which can be used as an alternative for fossil fuels to provide buildings with electricity."
]
} | [] | [] | [
[]
] |
||
4yfkp7 | why do people become traumatized | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4yfkp7/eli5_why_do_people_become_traumatized/ | {
"a_id": [
"d6ndz39",
"d6nmz8s"
],
"score": [
16,
2
],
"text": [
"Your brain is a processing center that takes various stimuli and decides what to do with it. Say you're sorting toys into various bins and every time you pick a certain one up it gives you an electric shock and you drop it. It bothers you to leave it lying there when it should be sorted, but you can't get it into the right bin without getting shocked. Touching the toy causes trauma, and eventually even the thought of touching the toy will cause distress. That's what's going on in the head of someone with PTSD. ",
"The good guy always wins. The bad guy always loses. That's what we are taught by the United States Empire while they slaughter children in primal villages. \n\nI think people get traumatized because they figure \"this would never happen to me\" and take things like peace for granted. What would your reaction be if in 5 seconds somebody bursted in your house with a machete? That would never happen right? Just try to feel the energy from that possibility right now... it's weird even simulating it. \n\nWhen Aaron Schwartz killed himself I remember people saying it was because he \"never thought something like this would happen to someone like him\". When you look at the pure evil prosecutor involved in that case and the psychotic tendencies of our lettered organizations, I feel they exploited what they knew about Aaron to try to get him to crack which eventually resulted in his death, but either way part of him was in that \"how could this happen to me\" mindset. \n\nI have PTSD and honestly what really helped me was completely falling out of my comfort zone, going through a complete mental breakdown, then realizing that even though things go to shit they can come back together. I spent the last couple years almost homeless and barely eating, but eventually I humbled myself and changed a lot of bad habits. \n\nTLDR, people, including me, are sensitive pussies. There is nothing wrong with that. There are many things that I am bad ass at and it's not like I'm afraid of people, but when it comes to things like love I'm a sensitive pussy bitch. There are kids even today fighting wars at like 6 years old. They aren't as traumatized because they don't know what things like takeout or 401k's are.\n\n"
]
} | [] | [] | [
[],
[]
] |
||
2k7ijc | why don't any of the american ebola patients have privacy dealing with their sickness? aren't patients supposed to have medical privacy? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2k7ijc/eli5_why_dont_any_of_the_american_ebola_patients/ | {
"a_id": [
"climdfp",
"clinwgq",
"clit14l",
"cliuvsh",
"clj2lpy",
"cljg0un"
],
"score": [
88,
28,
2,
2,
3,
2
],
"text": [
"The medical staff protect their privacy, news teams have no such inhibitions",
"The patients gave permission for the information to be released.",
"I suspect its more to do with mass panicking and people losing their shit.\n\nIts ok folks they been quarantines blah blah blah\n\nBlah",
"Some diseases, in the interest of public health, have to be disclosed to appointed governmental institutions. They usually are rare, dangerous and/or very contagious diseases. In Quebec they are called Maladies à déclaration obligatoire (\"mandatory disclosure diseases\" is the closest translation on top of my head). It is a legal obligation for physicians to advise the Health Ministry everytime they diagnose one of these diseases (I'm guessing the CDC would have the responsibility to keep records in the US...). The records are usually available to the public.\n\nI believe patient's confidentiality is still strictly protected. If a name is made public, then a consent must have been obtained.",
"What makes you think they don't? How do you know about the ones you don't know about?\n\n",
"[There is/was one patient who remained anonymous.](_URL_0_) So it's up to the patient to decide whether or not to give information to the media. "
]
} | [] | [] | [
[],
[],
[],
[],
[],
[
"http://www.washingtonpost.com/news/to-your-health/wp/2014/10/20/anonymous-ebola-patient-released-from-emory-after-being-declared-virus-free/"
]
] |
||
9571t6 | how can hackers have more power in gta online than the makers of the game (rockstar) | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/9571t6/eli5_how_can_hackers_have_more_power_in_gta/ | {
"a_id": [
"e3qigo2"
],
"score": [
2
],
"text": [
"It's eather two things. One is that there is so much traffic that they can't find the hackers or they don't care enough to fix it."
]
} | [] | [] | [
[]
] |
||
4ns8vc | what exactly makes sunlight hot on a nice sunny day? is it the temperature of the sun itself radiating through space or some form of refraction of the light itself? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4ns8vc/eli5_what_exactly_makes_sunlight_hot_on_a_nice/ | {
"a_id": [
"d46hgqg"
],
"score": [
3
],
"text": [
"Sunlight hitting the atmosphere is always the same.\n\nIt's local weather conditions that change. Warm dry conditions, open sky, the sun is going to continue to warm up the already warm air. Warmth (or lack of) from previous days is stored in the ground and water and moves across the area in pressure systems."
]
} | [] | [] | [
[]
] |
||
8e08ee | why is integral of velocity equal to displacement? | So if you graph the velocity as a function and then find the area under the curve, why does that give you the displacement? I get how velocity is the derivative of displacement and doing the opposite which is integrating velocity would obviously get you back to displacement but I just don’t get why that means you have to take the area under the function to get that. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/8e08ee/eli5_why_is_integral_of_velocity_equal_to/ | {
"a_id": [
"dxrdl0p",
"dxrgsgy"
],
"score": [
2,
2
],
"text": [
"An area under a function is the definition of an integral.\n\nOr think of it this way: you have a height of a function on a graph. The slope of the function indicates if the height is getting bigger or smaller. Ex: if your function is a line with positive (upwards) slope that means the height is getting bigger as you move along the line. If downward (negative) the height is shrinking.\n\nSo graphically, that proves the formal definition of a derivative -- the rate at which something changes. Velocity is the rate at which displacement changes. So if you tried to indicate displacement as an area, the function bounding the top of it would be its rate of change, and therefore its velocity. Some examples:\n\nIf velocity = 1 m/s, then every second the displacement is 1 meter. If you only analyzed the displacement for 5 seconds -- from time 0 to time 5, the height of the velocity function would be 1 the whole time. But the width would be 5, and you know that 1 m/s * 5 sec = 5m. Graphically, the area under V from t0 to t5 is 1x5 which also = 5.\n\nIf velocity as a function is equal to 2t, that means that it's 0 at t0, 2 m/s at 1 sec, 4 m/s at 2 sec, etc. So the object is getting faster, which means during each second it moves more than in the previous second. Intuitively the displacement (height) should increase each second. In other words, it would look like a triangle, exactly the shape under the V graph.",
"Just to clarify, you're talking about integrating with respect to *time.*\n\nThe respective differential matters just as much as the nature of *integrand* does.\n\nIf you integrate with respect to *distance* you end up with the total travel time an object takes to get from location A to location B. \n\nThis is useful in a wide range of physics calculations where elapsed time needs to be known. "
]
} | [] | [] | [
[],
[]
] |
|
ettsci | how exactly is a person's phenotype determined? does every gene in our dna influence our phenotype? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/ettsci/eli5_how_exactly_is_a_persons_phenotype/ | {
"a_id": [
"ffij14n"
],
"score": [
2
],
"text": [
"So to start, there are dominant and recessive genes. You have two sets of every gene (one from each parent), so when one is dominant and the other recessive, the recessive gene isn't contributing anything (in reality this can be a bit more complicated). \n\nThen there's \"non-coding\" DNA, sometimes called \"junk DNA\". There's plenty of ways bits if DNA get into the genome. Viruses, mutations, etc. can all introduce random chunks of DNA with no biological activity. So this will also qualify. It's pretty unclear how much of human DNA is non-coding, but the upper limit of estimates is about 20%. \n\nThere are genes and traits associated with ethnicities, but it is important to be careful when talking about your DNA being a certain percentage Irish or something else. Genetic information codes for certain attributes, and certain regions have higher rates of those attributes. Scotland, for example, had a much much higher percentage of people with red hair than Mongolia. There are also trends in non-coding DNA, where certain random and mutations are more common in certain regions because someone got them and passed them along. This can also happen in functional DNA, as there are multiple ways for DNA to code for the same thing. But again, all of these things are correlations, so having a certain sequence of DNA means your ancestors are more likely to be from a certain region. There's certainly questions about the reliability of these markers. For one, theyre really only reliable if a population lived in an area for a very long time with little intermingling with other populations."
]
} | [] | [] | [
[]
] |
|
4tso90 | how do laser range finders work? wouldn't the laser bounce away when it hits the target? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4tso90/eli5_how_do_laser_range_finders_work_wouldnt_the/ | {
"a_id": [
"d5jwe7b"
],
"score": [
11
],
"text": [
"if there is a visible dot on the surface, than atleast *some* of that light is being reflected back at you.\n\ndoesnt even need to be visible to you, as the device is going to be far more sensitive."
]
} | [] | [] | [
[]
] |
|
6p4576 | how did people who found other people who speak a previously unknown language translate it to the point of perfection? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/6p4576/eli5_how_did_people_who_found_other_people_who/ | {
"a_id": [
"dkmfg1e"
],
"score": [
3
],
"text": [
"The same way children who previously don't know any language learn it to perfection: someone learns the unknown language. As soon as you've got a few people that can translate, the accuracy of it snowballs. "
]
} | [] | [] | [
[]
] |
||
2l9m2s | what are the us voting for today? | I'm from England, I don't understand politics the greatest, not in the UK nor the US. However I understand you elect a new president every 4 years and a president cannot be president for longer than 8 years (2 terms).
What exactly do you vote for in what is being called a 'mid term'? I believe the UK has something similar and I don't understand what is being voted for there either. I know we recently had a big vote. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2l9m2s/eli5_what_are_the_us_voting_for_today/ | {
"a_id": [
"clsoi9k",
"clsosyu",
"clsq2fx"
],
"score": [
7,
2,
2
],
"text": [
"Congress gets voted in more often. The House of Representatives(like your House of Commons) gets completely re-voted every two years, so they're all up for election, and the Senate(vaguely similar to an elected House of Lords) is on staggered 6-year terms, so 1/3 of them are up for election. Also, there's a lot of state and municipal elections and referendums that get bundled into it, including 36 of the 50 state governors. ",
"Congressional races (\"local\" representatives that control the spending of the federal government) occur every two years, to help keep the government accountable to the people and (in certain cases) limit the power of the President and/or the party in the majority. _URL_1_\n\nThis is also an election year for some of the U.S. Senate (there are two senators in every state) who are on a 6 year term. _URL_0_\n\nThere are also some state races for Governor, Auditor, Secretary of State, etc; each state varies as each have their own constitution and laws that determine elections.\n\nThere are also a number of local elections for city councils, mayors, school boards, sheriff's.",
"We have an election every year in November. We don't just elect our president - we also elect many state and local officials. We can also vote on laws and tax levies. \n\nMy ballot today was two pages long. It included the state governor, representatives to the US congress and my state congress, a lot of judges, a school board member, a state treasurer, a county auditor, a revision to my city's charter and tax levies for my city's public schools, hospitals, and the renovation of a historic monument. "
]
} | [] | [] | [
[],
[
"http://en.wikipedia.org/wiki/United_States_Senate",
"http://en.wikipedia.org/wiki/United_States_House_of_Representatives"
],
[]
] |
|
3jn9fw | expiration dates for painkillers (details inside) | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3jn9fw/eli5_expiration_dates_for_painkillers_details/ | {
"a_id": [
"cuqo1sg",
"cuqr149",
"cuqvjai",
"cur08hw"
],
"score": [
5,
5,
4,
3
],
"text": [
"You are looking at date Filled vs date expired. Not date manufactured vs date expired. These drugs are created in large quantities but that doesnt mean they all get distributed at the same time. So the ones you got in 2013 and the ones you got in 2015 could have all been made in 2013. Drugs do expire. ",
"Also, expiration dates on medications are a date until which they are guaranteed to be 100% as effective as when manufactured. One of the pills, taken a year later, will still be safe but may only be say 90% as potent as when manufactured.",
"Doctors have done studies (most recently by the DHS) to gauge the efficacy of medications past their due dates. Most antibiotics were indistinguishable from new even at 10, 20 or even 40 years past their due date. \n\nThe due date is just so you buy more pills (in most cases). Some notable exceptions include epi pens, insulin. ",
"[This page](_URL_0_), section 5, has a good breakdown on medications that you should NOT use past expiration. Most other medications in pill or tablet form retain good potency for many years."
]
} | [] | [] | [
[],
[],
[],
[
"http://www.emedexpert.com/tips/expired-meds.shtml"
]
] |
|
15wbgz | why do we say "on the plane", "on the train", but "in the car"? | Why do we say on in some situations and in in others for the same meaning?
On the sub,
On the blimp,
In the cart.
Edit: On a related note why do you go on vacation but into work? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/15wbgz/eli5_why_do_we_say_on_the_plane_on_the_train_but/ | {
"a_id": [
"c7qdyzt",
"c7qe10e",
"c7qe1ys",
"c7qe8cn",
"c7qedlx",
"c7qelru",
"c7qeqkz",
"c7qetxb",
"c7qeuoa",
"c7qevex",
"c7qewam",
"c7qey5w",
"c7qezr9",
"c7qfskw",
"c7qfziz",
"c7qg9gu",
"c7qjhxm",
"c7qlg2p",
"c7qnvfm",
"c7qo0sb",
"c7qppa2",
"c7qr8vc",
"c7qs0if"
],
"score": [
364,
29,
9,
17,
1000,
31,
11,
3,
2,
50,
23,
170,
3,
3,
2,
4,
5,
2,
2,
2,
4,
2,
2
],
"text": [
"Presumably in this case because a car is ours, so we're *in* our possession.\n\nThe others are open to the public, so we're *on* the service.\n\nAt least, that's how I assumed it works.\n****\nEdit: Giraffebacon has an awesome theory that it doesn't depend on possession, but **control**. If you control something, you're in it. If not, you're on it.\n\nEdit 2: Of course there are exceptions. Bikes / skateboards you are physically \"on\", and can't be \"in\", so the rule doesn't apply.\n\nEdit 3: thedrew is [very clever] (_URL_0_).",
"Not sure if related, but in German, you don't ride on _or_ in any of them (to my knowledge); you ride _with_ them. We're all just weird with our languages. :p\n\nFor example: Ich fahre mit dem Bus. \"I ride _with_ the bus.\"",
"I think it depends on where you're from. People in NYC usually say they're \"waiting on line\" when referring to waiting in line. People where I'm from would say \"waiting in line\". I think the same thing applies to vehicles as I know a person who would say she's \"getting off the car\" when exiting the vehicle. It sounds weird to me because I would say I'm \"getting out of the car\". \n\nTL;DR I think it's just a regional thing.",
"Also, one must board a train, or a plane or a sub. You do not board a car.",
"I thought it was because you can walk around ON a train and plane, but you can't really walk around IN your car. On is for platforms.",
"We ride *in* a car because we ride *in* a carriage, even when that carriage is *on* a train.",
"Related question: Why do we say we're \"driving\" a car, but \"riding\" a bike? Seems like you put much more effort into making the bike move.",
"Do people who own and fly personal planes say they're in' the plane, as opposed to 'on', referring to the personal possession explanation. ",
"The way I have always understood it is in terms of who decides the destination. \n\nA car or Taxi only travels to where we decide for it to go, whereas a train, bus or plane etc have pre-existing destinations that we choose to go on. \n\nFor example, a bus or train will be making that trip regardless of if I am using it or not, where as a car will only travel to a location if I am in it.\n\n\n",
"English is terrible when it comes to consistency of grammar and mechanics rules.",
"As Georgeorgeorge Carlin said: \"'Get on the plane, get on the plane' Fuck you, I'm getting in the plane!\"",
"Linguist teaching English to foreign students here.\n\nCan you be inside it? Yes: you can be \"in\" it (\"I'm in the plane\" is also acceptable, but a little off). No: you can only be \"on\" it (i.e. skateboard).\n\nCan you stand up while inside? Yes: you can be \"on\" it. No: you can only be \"in\" it.",
"My guess is that it relates to the relative size of what you're talking about.\n\nOn the plane. On the train. (They are large.) \nIn the car. In the taxi. (They are small.)",
"Not sure, but it only recently occurred to me why I was raised to say \"get down from the car\" instead of \"get out of the car.\" People have been bugging me about it my whole life. My family is Mexican-American and \"bajar\" means to get out and also to get down in Spanish, so the English translation is \"get down.\" ",
"In sorta relation to this topic. Why do we have a baby but take a shit? Wouldn't we be having a shit?",
"You board a ship.\n\nYou board a train.\n\nYou board a plane.\n\nYou board a bus.\n\nYou are \"on\" them.\n\nYou don't board a car or taxi. You just get in them.",
"Things that you can 'drive': in. \nThings that you can 'ride': on.",
"Because English is the second most ridiculous language on the planet.",
"As a long Islander, I always wondered why you can be \"in New York\" or \"in Brooklyn\" but we are always \" on Long Island.\" Why is that?",
"this is sort of meta, but I thought eli5 was about people asking for simplistic but detailed answers to questions they only know a little about to help them piece together their knowledge... not just generic one-off questions that could be answered with one sentence and would fit better on /r/askreddit or something. I mean, you gotta ask yourself, is this something I want to have explained in laymen's terms, or just a factual answer that I need?",
"I think that a lot of the people responding in this thread are leading you in the wrong direction. I find it unlikely that the preposition which people choose to head these phrases is semantically determined.\n\nMy guess would be that these phrases are forms of [lexical phrases](_URL_1_) or [multi-word expressions](_URL_0_) I think that it's most likely that they are institutionalized phrases which are mentioned at the bottom of the MWE link, which are not as strict as others which would account for why you can rationalize being *on a plane* but also *in a plane*.\n\nI think that it's more sensible to approach items like this descriptively, because I'm not convinced that we actually pick and choose which words we use like this based on any rules.",
"I think it all comes down to whether you need to duck or crouch to board the vehicle, or if you can simply walk on.",
"As a french-canadian, it's so obvious this is just cultural standards, \n\nno real answer can be given, \n\nfor example, \n\nhere **in Quebec we say \"in the city\"** while **in France they say \"on the city\"**, when visiting or living or whatever \"in\" the city (this is a translation, in Quebec we say \"dans la ville\" while in France they say \"sur la ville\")."
]
} | [] | [] | [
[
"http://www.reddit.com/r/explainlikeimfive/comments/15wbgz/eli5_why_do_we_say_on_the_plane_on_the_train_but/c7qfrze"
],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[
"http://aclweb.org/aclwiki/index.php?title=Multiword_Expressions",
"http://bogglesworldesl.com/askthomas.htm"
],
[],
[]
] |
|
5kmkqg | why is the tachometer (rpm counter) so large in a car's dashboard (as large as the speed dial)? how is the information useful to the average driver? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5kmkqg/eli5eli5_why_is_the_tachometer_rpm_counter_so/ | {
"a_id": [
"dbp152l",
"dbp1ins",
"dbp1o03",
"dbp3dic"
],
"score": [
6,
3,
4,
2
],
"text": [
"Great if you drive a manual. Tells you if your revs are too high and you need to shift up, or too low and you need to shift down. No idea why you'd want one on an automatic. ",
"It's mostly useless, even for a standard transmission. If all you drive is a standard, you'll end up shifting based on sound, feel, and perception than by looking at the tach. Normal street legal cars have rev-limiters, so it's difficult to overshoot on accident, even on a down shift.\n\nFor racing, it's a visual queue prior to the shift light to prepare yourself for the shift, lest you miss your shift, over-rev, and blow the engine. Most race cars use light bars and shift lights so you don't have to look directly at the indicator, and don't have a rev-limiter. If you're racing a sports car that doesn't have a light, you'll get in the bad habit of looking at the tach near the top end of the rpm range instead of the road.\n\nIt can convey some diagnostic information depending on the situation and if you know what to look for, but more for standards than automatics.",
"In an automatic I use it to know how much passing power I have while driving on flat roads.\n\nIf I'm midway in my gear (medium RPM) and going the same speed as the car in front of me then I know I can punch it and zoom around. But if I'm high or low in the gear it becomes more doubtful that I have the torque to make a quick pass and I'm better off increasing speed (if I'm low) or letting the gear change (if I'm high) before punching the gas.\n\nIf my car has Overdrive (most do) then it's not so much of an issue.\n\nIn a stick shift you have full control of your torque if you watch where the gears top out. Riding near the top of the RPM's provides you with optimal power; you've got a small amount of excellent torque and the option to slow the vehicle without applying the brake (by just easing off on the gas and letting the engine do the braking.) If you're racing this is critical.\n\nAnybody used to driving in the mountains is as glued to the tach as they are to the speedometer. Application of torque becomes a lot more critical in mountains (especially in snow or mud.)\n\n",
"Even for daily drivers it can be useful info.. if you find your car is most efficient around 3k revs as in power curve ramps up steeply just before there then you know optimum time to shift... over time will get used to a particular car but every car sounds different"
]
} | [] | [] | [
[],
[],
[],
[]
] |
||
bx3c4t | how does the brain create brand new words? | Is it started in Werneke’s area (or Broca’s area, can’t remember which does what at the moment)? How does the brain decide “oh I need a new word to describe this, here’s something I pulled out of thin air?” Like I called a pain I would get in my stomach as a kid “tummy crustles.” Obviously “crustles” isn’t an English word, so how and why did my brain decide that was the word it was gonna use to describe my pain? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/bx3c4t/eli5_how_does_the_brain_create_brand_new_words/ | {
"a_id": [
"eq2z046"
],
"score": [
2
],
"text": [
"Creativity. You could have merged together \"rustles\" with \"cramp\" or just added a c to the beginning because it was amusing to 8 year old you. Or you just randomly thought of it and it stuck.\n\nFor an example not involving language, imagine a purple creature the size of a chihuahua with a handlebar mustache and monocle. Chances are, you can picture this thing that does not actually exist in real life. Why did I choose these specific features? Because I was actively trying to be random and then when I added the handlebar mustache my brain associated the monocle with it so I added that too."
]
} | [] | [] | [
[]
] |
|
1ri567 | modern militia purposes? | What do modern militias do? I'm referring to state militias, but not the National Guard. Are they just for natural disaster relief? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1ri567/eli5modern_militia_purposes/ | {
"a_id": [
"cdngxh6",
"cdnjnxn",
"cdnktue",
"cdnn128"
],
"score": [
16,
5,
7,
2
],
"text": [
"The are a remnant of an earlier time. The truth is they aren't all that important, but many states feel strongly about maintaining their right to have one (Which is the true point of the 2nd Amendment).\n\nIn theory, in the event of an invasion or the like they would join the fight. The thing is, that is also what the National Guard and the regular military is for.",
"They're also around to overthrow the government should the need arise. The right to revolution is a core principle of the American founding.",
"At least in the U.S., the official state militia is indeed the state's National Guard. Most other militias are associated with smaller townships and are tailored to purposes that serve that specific township (possibly disaster relief, as you mentioned). However, there are established militias that have mission statements that carry more gravitas. For example, it's not unheard of for a town to have a militia whose objective it is to protect the town from unwarranted intrusions (perhaps from the state or, more likely, federal government). ",
"Also the US military \"legally\" is not allowed to conduct operations on American soil. The National Guard is the modern state militia. A state's National Guard answers to the governor of that respective state. Originally the state militia served as a reserve force in event of invasion and also as a counterpoint to the Federal Government's need for a regular military. It ensures (or rather ensured) that should the Feds ever try to overstep their constitutional bounds with force; the states could resist. \n\nTL;DR To back up the military in time of invasion and to balance power between the states and Feds."
]
} | [] | [] | [
[],
[],
[],
[]
] |
|
9i96y7 | why and how do electronic devices draw only as much current from a power source as required in that very moment? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/9i96y7/eli5_why_and_how_do_electronic_devices_draw_only/ | {
"a_id": [
"e6htuna",
"e6hvkwr",
"e6hxsgx"
],
"score": [
6,
5,
2
],
"text": [
"Everything draws only as much as it needs.\n\nElectricity flows a little like water, for ELI5. You open the radio a little when you need just a little, or all the way when you want a lot.\n\nYour television, to pick one, draws just a little power while it waits for you to turn it on. Then when it's on, it draws more to turn on the lights, change the sounds and so on.\n\nMore specifically, like water, the ability to take as much as it wants (up to what's available) is always there. When parts of the electronics are used, and they need more, they take more. Different circuits close, allowing there electrons to flow, and more electricity gets used.",
"In some appliances, there is actually a physical rheostat. As you turn the dial, you are physically increasing the contact surface between 2 areas and creating more contact for the electricity to flow through. A familiar use is like the dimmer switch on your wall. (google image search for circular rheostat and you will find good pictures)\n\nThere are also \"digital potentiometers\" which do the same thing but are all electrical. This, for instance, can increase the volume on a tv without a physical control knob.\n\nIn terms of how the TV simply turns on - when the TV get a signal to turn on (either with a physical button or an electronic signal) it electronically \"opens a gate\" to electrical flow. The electrical current would LOVE to rush through your TV, so as soon as that gate is open, the electricity flows through and the TV turns on.\n\nAn electronic device might a combination of on/off gates, and/or variable digital potentiometers as needed.",
"Three important equations: V A R, W A V, and W I^2 R. These three allow you to determine all those power flow numbers if you just know two. In each of these, imagine a circle with the top half to itself, and the bottom half further split in two, so like a T in a circle. The first letter goes up top and the other two in the bottom. Multiply the bottom two to get the top one, or divide the top one by one of the bottom ones to get the other bottom one.\n\nIn this case, we'll be using V A R, because we know the voltage from the power source (let's say it's a toaster at 120V). So why does this toaster pull 5 amps? Because of the other half of that bottom bit, the R, or resistance. Volts divided by resistance equals your amperage, so you hook up a meter and get a reading of 24 ohms. 120 / 24 = 5! Voltage is like the pressure trying to push electricity in, and the resistance U\nIs... Well it's the resistance of the \"pipe\" to having that pushed in, which balances out to how much *actually* goes through. You have a pipe pushing So much water pressure and a valve partially shut holding some of that potential flow back, you'll get less gallons per minute."
]
} | [] | [] | [
[],
[],
[]
] |
||
1y0e72 | how significant was finding the rosetta stone? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1y0e72/eli5_how_significant_was_finding_the_rosetta_stone/ | {
"a_id": [
"cfg7x3k",
"cfg7zoz"
],
"score": [
5,
2
],
"text": [
"From an archaeological and histological perspective, massively significant. Before the discovery of the Rosetta Stone we were unable to decipher hieroglyphics from ancient Egypt. The Rosetta Stone had 3 blocks of characters on it, the top was Egyptian Hieroglyphics, the middle was Demotic script and the bottom was Ancient Greek. They all said the same thing.\nBecause we already knew and understood Ancient Greek it allowed us to translate the Hieroglyphics. With this knowledge we were then able to learn what Hieroglyphics meant and unlocked all the texts written in tombs and monuments and all that jazz.\n",
"Extremely: the Rosetta stone's text contains three copies of the same text -- one in a well known language (Greek), a not-quite-so-well-known language (Demotic), and a language they knew very little about (Heiroglyphics).\n\nNow, there had been other examples (couldn't find links right away) of snippets of the same text in heiroglyphics and another known language, but not enough to really figure out heiroglyphics -- mostly names which were pronounced much the same, so they could figure out what some sounds were, but not necessarily what the words meant.\n\nThe Rosetta stone meant, since linguists had a good grasp of Greek, and sorta understood Demotic, they could compare the same sentences in all three and decode not just how to pronounce heiroglyphics, but what the words actually *meant*.\n\nThis was huge in the language community -- but what it also meant for everyone else is that up until we could translate heiroglyphics the only source of Egyptian history was from later writers who were documenting things in a language we understand. Now that the Rosetta stone helped crack the code, it opened up a bunch of history, written in its original language, for historians to add our understanding of one of the biggest and longest-lived societies in history."
]
} | [] | [] | [
[],
[]
] |
||
1l0sbi | how were cameras allowed inside of concentration camps? | You see all of this footage of people being tortured in concentration camps in school and on the internet. How were these people allowed to record what was going on? I thought most people didn't realize that the holocaust was going on during that time. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1l0sbi/eli5_how_were_cameras_allowed_inside_of/ | {
"a_id": [
"cbulry2",
"cbulwmc",
"cbulx7x",
"cbummu6",
"cbup54l",
"cbur17m",
"cburbek",
"cburrqx",
"cbuta2j"
],
"score": [
58,
23,
26,
2,
16,
4,
8,
2,
7
],
"text": [
"Well the Nazi's documented and kept thourough records of the concentration camps. plus the vast amounts of scientific literature garnered from the medical experiments performed on prisoners has proven very usefull in modern medicine",
"A lot of what went on was being deliberately documented by the Nazis. As far as they were concerned, they were making historical records for future generations. A lot of them actually believed in what they were doing; they bought into the idea of a master race overcoming the weak, the decadent, the defective, and the evil components of humanity. ",
"When the allied forces, most notably [General Eisenhower](_URL_0_), liberated the camps; they brought in journalists to document first hand evidence knowing there would be deniers of the holocaust. ",
"Important to point out that there is no film nor any photos of people being gassed. There are things that seem to indicate it was happening and there is a shit-ton of anecdotal evidence, but that, AFAIK, is it.\n\nEven Schindlers List did not show a gassing taking place, preferring instead to focus on the cruel treatment and callous indifference of certain Nazi's toward Jews.",
"I know that they made recordings about the ghettos of Warzaw etc. where people were held in very small buildings with only very little food. Many starved and were buried in mass graves. The nazis made a lot of such recordings for the Wochenschau, a weekly cinema show. It was basically propaganda material, but many recordings were later seen as too cruel for the audience. These are very interresting/disturbing, as many have the original audio commentary by the nazis. I am german, we saw some of this footage in school. It's far more shocking than a horror movie because you know it is real.\n\nI think some of the pictures are taken by the guards, they had a lot of freedom. Then there's some recordings for \"scientific purposes\" and of course the documentation by the allied forces.",
"The nazis thought they would rule the world. And they thought they were right.",
"The nazis intended to create a museum about the destruction of a race. They brought the cameras an wanted to document all aspects of what they did so that future generations could see how the \"perfect race\" was created. A site for the museum was even pick out and construction began at one point as well.",
"Have you really seen film of people being tortured in the camps in school? That seems very unlikely. Or you have a different definition of \"tortured\" to mine. ",
"Buchenwald had a very good exhibit a few years ago, it was photography from three sides of the war. Prisoners, Nazis, and Allied Liberation.\n\nPrisoners smuggled things like they do now (and like they've done throughout history). Film and cameras were one of many things smuggled by prisoners. Of course, they weren't allowed, so they had to be very secretive about taking photos. Usually when guards weren't around (like on Sundays, which was a \"day off\"). Usually, film got smuggled by prisoners who had special privilege due to their former professions (journalists, artists, and photographers were made to document whatever the Nazis told them to). They also made their own pinhole cameras.\n\nThere is a very bizarre photo of emaciated prisoners sunbathing on a rare Sunday in the spring when they were literally unsupervised for a few hours. They look dead, but they're all in repose. The photographer went outside with his camera under his shirt, lifted it to expose the film, and went back in his bunk and hid it somewhere inside until he could develop it.\n\nThe Nazis documented everything for posterity and instruction. They were either recording the success of a massive experiment or they were documenting how to do it. Many Nazi photographs are staged and were used for propaganda purposes. However, prison officers lived on site with their families. They had beautiful houses and were separated from the prisoners by chain fences. They kept up German family traditions and had scrapbooks. It's also quite eerie to read \"Papi macht eine witzchen\" (Papa makes a little joke) under a photo of a Nazi officer tickling his toddler.\n\nThe Americans documented crimes, perhaps moreso than prisoners because prisoner photos, while exposing some of the atrocities, also had in them a sense of intimacy. There is no intimacy in American photos. It is from a removed perspective that shows: mass graves, starvation, the far ends of human cruelty.\n\nBonus: Buchenwald also had a zoo with fucking black bears (among other animals) for the enjoyment of the officers' families, and many personal photos from the officers were taken in front of the bears. They all look so.fucking.happy. The bear enclosure, I shit you not, is *right next* to the camp's perimeter. You can see the barracks and fence in family photos IIRC. The kennels built for the guard dogs were way nicer than the prisoners' bunks, too.\n"
]
} | [] | [] | [
[],
[],
[
"http://en.wikipedia.org/wiki/Ohrdruf_concentration_camp#Liberation"
],
[],
[],
[],
[],
[],
[]
] |
|
br0njb | how does the price of the dollar affect the economy of foreign countries? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/br0njb/eli5_how_does_the_price_of_the_dollar_affect_the/ | {
"a_id": [
"eo98isz"
],
"score": [
2
],
"text": [
"If the price of the dollar (exchange rate) is low, it means that countries with a different currency can buy the same US products for less money. Example: company A sells 100 products for 100 USD to a foreign company B. Now the exchange rate falls and 100 products now cost 95 dollars. This might look not great for company A, but now company C would also like the cheaper products. Therefore a lower exchange rate makes US products more compatible with foreign products. US firms will probably have more orders and exports.\nThis is one reason why Germany is fairly interested in keeping the Euro low, since it \"boosts\" exports. (Not the best for the Euro area as a whole, since most countries import a lot)"
]
} | [] | [] | [
[]
] |
||
4hw4mf | what stops the bones in your foot from ripping through your flesh and skin with all the pressure from walking and running? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4hw4mf/eli5_what_stops_the_bones_in_your_foot_from/ | {
"a_id": [
"d2stikk",
"d2sv5ip"
],
"score": [
7,
3
],
"text": [
"The bones aren't that sharp and your skin isn't that weak. That's really the long and short of it.",
"Where your bones bear on the outside world they have pads - your heel, for example, has quite a thick pad of for want of a better word, gristle.\n\nElsewhere bones generally bear on other bones - your knees for example rely on cartilage between the two parts of the hinge to allow smooth operation, and is wrapped up in a capsule surrounded by ligaments. There's not really anywhere where it could push its way through without first breaking."
]
} | [] | [] | [
[],
[]
] |
||
2b1grt | on reddit, why are links to youtube, sometimes written as "_url_0_" (dot after u, before b), next to the title | Sometimes it's _URL_0_ | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2b1grt/eli5_on_reddit_why_are_links_to_youtube_sometimes/ | {
"a_id": [
"cj0u216",
"cj0u2e1",
"cj0u4o9",
"cj0ztvo"
],
"score": [
16,
12,
14,
10
],
"text": [
"Because that's what youtube gives you when you click the \"link\" option from the \"share\" box. It's designed to save a few extra letters for stuff like twitter where that matters.",
"_URL_0_\n\nIt's just a way to make your link appear shorter. If you share a video through YouTube's interface, it will link to the shortened URL and not the full one. On most sites it doesn't really matter, but on sites like Twitter that limit the length of posts, shorter links are more useful.",
"For a moment in my life, I genuinely thought these links would get me on a weird website hosted in Belgium.\n\nI was not a smart man.",
"As others have said, it's to have a shorter link for sharing purposes. The reason it works in this case is that it's a [domain hack](_URL_0_). \n\n**.be** is the top-level domain for Belgium, just like *.ca* is for Canada, *.jp* is for Japan, etc. So, in addition to \"normal\" domains like google**.be** and yahoo**.be**, you can be clever and register youtu**.be**.\n\nOther companies have done similar things using domains for other countries, such as instagr**.am** (*.am* is for Armenia) and nyti**.ms** (*.ms* is Montserrat). \n\nReddit does this too. If you look in the sidebar of this page, there's a shortlink for this page: _URL_1_ (*.it* is for Italy)."
]
} | [
"youtu.be"
] | [
"www.youtube.com"
] | [
[],
[
"http://en.wikipedia.org/wiki/URL_shortening"
],
[],
[
"http://en.wikipedia.org/wiki/Domain_hack",
"http://redd.it/2b1grt"
]
] |
|
7323do | physical nature of genes. | A friend of mine asked me about the physical nature of genes but I could not satisfy her. Have the genes any appearance like beads or anything like that? And how is one gene separated from another on a chromosomes locus? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/7323do/eli5_physical_nature_of_genes/ | {
"a_id": [
"dnmzjky",
"dnn1d07"
],
"score": [
2,
4
],
"text": [
"DNA is a string of nucleotides. some of it codes for proteins, some of it controls the expression of genes, some of it is junk. All of it looks the same, it's the same four amino acids in billions of different patterns.\n\nSections that translate into proteins have special bits at each end tat are known as \"stop codons\", this is a code that tells the cellular machinery transcribing the section to top. You still can't see them, since it's just three more amino acids just like all of the DNA before and after it. \n\nThere is no special appearance of a gene, it's just a section in a long, long, long string of AGATAGAGATAGAAAGGTTAAGGG that means something specific. It doesn't have decorations or beads or clumps.\n",
"Genes are separated from each other by non-coding regions on chromosomes. In fact, the majority of the DNA in humans is never expressed as a protein product, and we're not entirely sure what a lot of it is for. \n\nI talked about the structure of DNA in the reply to the above poster,\n adding on to that, every three DNA nucleotides forms a codon - there are special \"Start\" and \"Stop\" codons - the START signal is basically a complex that is designed to attach to the DNA replication machinery in your cells. It will keep reading down the line and producing a mirror image copy of everything it reads until it reaches a \"Stop\" codon."
]
} | [] | [] | [
[],
[]
] |
|
9sgnxo | if 52*7 is 364 where do we get our extra day to make a 365 day calendar year? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/9sgnxo/eli5_if_527_is_364_where_do_we_get_our_extra_day/ | {
"a_id": [
"e8oli6j",
"e8oljc9",
"e8olk5e",
"e8olmp4",
"e8om225",
"e8pqwph"
],
"score": [
2,
5,
2,
3,
2,
2
],
"text": [
"52 is just a rough enough guide to how many days there are in a year but if you add the days of each month, you'll get 365.",
"There are 52 FULL weeks in a year, and 365 FULL days. Those extra fractions make the extra day each year and the extra day every four years.",
"The calendar year isn't a whole number of weeks, which is also why a particular date will be one day of the week one year, but another the next year.",
"The year isn't exactly 52 weeks long, it's 52.14 weeks long. This is also why the first of the month moves forward one day of the week each year, and why you'll get an extra paycheck some years if paid weekly or biweekly.\n\n52 weeks is not the definition of a year, it's just a convenient approximation",
"Well there simply isn't 52 weeks in a year, there are 52 weeks and one day or 52.143 weeks. Saying 52 weeks in a year is just a close enough approximation. It's the same when someone says there are 4 weeks in a month even though there isn't exactly 4 weeks. Technically there isn't even 365 days in a year. There is about 365.25 which is why leap years exist to keep everything lined up and even that isn't exactly right. ",
"This isnt exactly a five year old question\n\nI have had to program the leap year algorithm in software control units, before those formulas for the algorithms were commonly found in software libraries. \n\nThe formula goes...\nIf the year is wholly divisible by 4 then it is a leap year,\nUnless it is wholly divisible by 100 then it is not a leap year,\nUnless it is wholly divisible by 400, in which it is a leap year.\n\nThis can be expressed by the formula....\nLeap = year % 400 == 0 and not (year % 100 == 0) and year % 4 == 0,\nWhere % is the modulus operator. \n\nSo this means that 2000 was a leap year, coz 2000. % 400 == 0\nAnd 1900 was not a leap year coz 1900 % 100 != 0\nAnd 2020 will be a leap year coz 2020 % 4.== 0\n\nMakes sense now?\n\nBut even that is not the whole story as that too is an approximation, not to mention that the rotation of the earth and the rotation of the earth around the sun is slowing sown, so future corrections will be needed. "
]
} | [] | [] | [
[],
[],
[],
[],
[],
[]
] |
||
p3ou9 | how to legitimately change your last name? | So I've been contemplating this for awhile and I just need to know what one has to go through to change a last name. I am a freshman in college and wanted to change to my mother's maiden name. Anything can help! | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/p3ou9/eli5_how_to_legitimately_change_your_last_name/ | {
"a_id": [
"c3mano5"
],
"score": [
3
],
"text": [
"I just recently did this! I can't tell you about maybe something weird in your county, but you go to your county of residence. It was super easy. I filled out forms and showed up on the date and time that they have open for name changes. The judge asked why I wanted to change it, I just said I preferred my mother's maiden name, and it was done. It was about $120 I think, and that included three signed and sealed court orders. You'll need those to change your name on your credit cards/bank accounts/drivers license/etc. \n\nThey don't really care that you're doing it or anything, you just swear under oath you're not trying to run from anything (like debts) and you're good. I did it in Snohomish County in WA, if you happen to be from there. :)"
]
} | [] | [] | [
[]
] |
|
3qn8vd | why do some radio stations (usually more popular or "mainstream ones) raise the pitch or speed up the songs they play? | I *thought* I have noticed this before a few times but I felt like maybe I was just imagining things. But then I confirmed it that some do. I was covering a song at one point and then it came on the radio. Because I was covering, I was basically studying the song to a "T". So I knew it inside and out. Then I noticed that it was sped up on the more "mainstream" radio stations (i.e. the big stations that play all the Top Hits). But then when the song played on a local "indie" station, it was it's normal pitch.
Has anyone else noticed this? Does anybody know why it happens or why some stations do that? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3qn8vd/eli5_why_do_some_radio_stations_usually_more/ | {
"a_id": [
"cwgo1s0",
"cwgod7o",
"cwgon73",
"cwhb0rz"
],
"score": [
19,
2,
13,
2
],
"text": [
"Just so the song is shorter. Sometimes they will cut sections out of songs too. What comes to mind is when Metallica released death magnetic back in '08.\n\n[The shortest song is 5 minutes, and the next shortest is 6:25](_URL_0_)\n\nI forget which songs they were always playing exactly. \"The day that never comes\" was one of them but there was another also. They would chop whole sections out of that song (it is 8 minutes long....), specifically they would chop out a \"bridge\" which Metallica tends to have in their songs and tends to be repetitive.",
"If you speed it up it raises the pitch slightly in doing that. They can't get the band to just record another version but faster. They do it for time slots usually. They don't want to play seven minute songs because that can be bad for viewers who don't like that one song. Also, if all songs are about three to four minutes then they can fit commercials in nicely without having to worry about a lot of different songs with different durations. It's pretty much just to keep everything organized",
"Radio stations these days are often owned by multi-radio station owning conglomerates. They have a few goals. \n\n1. a consistent song length lets them make sure all of their stations switch to commercials at about the same time (no switching stations to avoid commercials) \n\n2. a large mix of the current play list every hour. So just because you dislike song X, it will be over before you get annoyed enough to switch the station. \n\n3. Fast pitch songs have a faster tempo, seem more up beat and hip. ",
"I am the guy who is messing with your music. I work for A small Radio Station in germany and have worked for other CHR and HotAC stations. Although in my experience mostly the AC stations use this technic.\n\nBefor there were digital workstations you had to use tape. Music on tape is hard to cut. Speeding it up in the otherhand makes the song shorter and also pitches the song up wich makes it sound \"happyer\"\n\nThe main reasons why music is edited in the first place are\n1. you can play more Songs in an houre if they are shorter\n2. editing out instrumental parts that are deemed problematic (best example is the guitar solo in nothing else matters"
]
} | [] | [] | [
[
"https://en.wikipedia.org/wiki/Death_Magnetic#Track_listing"
],
[],
[],
[]
] |
|
20dxn5 | "for every action there is an equal and opposite reaction". is there anything in the universe where this isn't true? | I'm no scientist but I did read somewhere that that statement is not true for everything, in what cases is it not true? Does anything spontaneously happen without an action causing it? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/20dxn5/eli5_for_every_action_there_is_an_equal_and/ | {
"a_id": [
"cg2as4d"
],
"score": [
3
],
"text": [
"Well, sure. There are all kinds of situations of one thing \"acting\" on another without getting \"acted\" on back, because \"acting\" is not a scientific word. That definition of Newton's Third Law is very vague and actually has no real meaning. A better definition is:\n\n\"For every force there is an equal and opposite force\". I'm sitting on a chair now, and the weight of my butt is pressing against the chair with ~195 lbs of force, because I'm fat and not good at dieting. The chair is also pressing against me with 195 lbs of force, and I know that this is the case because my butt is deformed, and I can feel pressure in the nerves on my skin. \n\nIf we restrict the definition to what it properly should be, then yes, this law is universal and applies to all possible scenarios. "
]
} | [] | [] | [
[]
] |
|
2qqx2h | how /r/adviceanimals isn't a default sub even though it has more subscribers than /r/explainlikeimfive? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2qqx2h/eli5_how_radviceanimals_isnt_a_default_sub_even/ | {
"a_id": [
"cn8nilx"
],
"score": [
2
],
"text": [
"It used to be, and redditors got tired of the same misused full-of-shit memes clogging the page. I'm guessing reddit admins did as well."
]
} | [] | [] | [
[]
] |
||
42lgk0 | how much money is there in the world in total and how's it measured? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/42lgk0/eli5_how_much_money_is_there_in_the_world_in/ | {
"a_id": [
"czb872o"
],
"score": [
2
],
"text": [
"For a while counting is the simplest way to measure money. I say that because eventually it gets tricky.\n\nThere is of course the cash money. Money in our pockets and in the cash drawers of registers. That is the smallest amount. It is counted as it is produced and banks count it as it comes in.\n\nThen there is money on deposit. That also is countable. Once banks count their deposits they are allowed to loan a fraction of this money out. So they like deposits. The money they loaned out was in a sense the money which is deposited. But in another sense it was new money.\n\nSome banks have drawing rights. They are allowed to borrow money on paper, or to be electronically debited. They can loan this money too. This money was created by granting the drawing rights.\n\nNow take the money loaned out as mortgages. They can be bundled and offered for sale. it is future money but can be sold today in a bundle. We just created more money.\n\nIf you are worried those loans will not be paid then the bundle of loans can be discounted. The bundle will be sold for less than their face value because some loans will go into default. \n\nGuarantees can be bought and sold that these bundles will be good. More money is created that way. They are just guarantees. But money will be paid if the defaults exceed the expected amount.\n\nThere is where it gets fuzzy. sometimes these credit default swaps, that is what they are called. are not reported to be counted. The assets of big corporations are used to back the defaults. The regulations are loose. There is not enough accountability and the amount is hard to count. But this kind of money is easily the largest pile of nonexistent money."
]
} | [] | [] | [
[]
] |
||
1vno20 | why you can get a heart attack if you're shocked or scared. | I'm not sure if it has something to do with blood pressure, but if it is, how is it so quick? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1vno20/eli5_why_you_can_get_a_heart_attack_if_youre/ | {
"a_id": [
"ceu2acf"
],
"score": [
3
],
"text": [
"An increase in heart rate and/or blood pressure can dislodge fatty deposits in the arteries that feed the heart. If they break off they can block the supply of blood to parts of the heart. That's a heart attack. The heart muscle then begins to die. "
]
} | [] | [] | [
[]
] |
|
dxmbcq | 5: why is it so hard to replace plastics with another material with similar properties? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/dxmbcq/elif5_why_is_it_so_hard_to_replace_plastics_with/ | {
"a_id": [
"f7soiee",
"f7sonp6",
"f7tpnwm",
"f7tw9dj"
],
"score": [
138,
3,
12,
6
],
"text": [
"Cost: plastic is extremely cheap to produce (also to recycle), currently nothing as cheap exists so companies will keep using what makes them the most money. \n\nProperties: there actually aren't many materials with similar properties: \n- recycled/compostable plastics aren't as maleable and mess up the recycling of normal plastics. \n- paper, well just see the outrage of paper straws \n- metal costs too much and is heavy \n- the cutting edge \"plastic killers\" don't currently work on large scale due to lack of technology/knowledge in how to scale (eg. Nanostructures)\n\nIn actuality plastics are probably the most important, useful and revolutionary material technology in history. It would also be the most environmentally friendly material if we would be able to close the loop and recycle most of it. Problems only arise when it ends up in nature, which I personally believe to just be due to severe incompetence on parts of government, companies and to some extent people.\n\nAFAIK \"fact\" to take forward: Producing paper straws rather than plastic ones is often a net loss in terms of GHG emissions, habitat loss and chemical intensity. \n\nUse this to always think about the whole life-cycle of products and on the many different ways the environment can be hurt.",
"There are two parts to this question: first plastics are largely defined by their properties and composition. If something had all the same propertied then it likely is another plastic.\n\nSecondly for different individual properties (malleable, non biodegradable, non reactive to most things, etc.) there are plenty of alternatives.\n\nNone are as cheap.\n\nThere are also minor issues like paper products breakdown faster, metal things are heavier, etc. that add up to issues over time but the big simple one is that plastic is very very cheap. Its a considerable investment in both short and long term to switch to something else (certainly one worth making but people don’t like to spend money).",
"Plastics are incredible. There isn't one single material capable of having the wide range of material properties plastics can have. They can be cheap, durable, lend themselves well to manufacturing methods such as blow moulding, rotation moulding, injection moulding etc. In the case of thermoplastic elastomers they can be reused (in some capacity anyway). There are food grade plastics, plastics capable of withstanding pretty impressive temperatures (the inner side of many cooking pans are coated with a thin layer of PTFE, better known as Teflon, for non-sticking purposes). They have favourable mechanical properties in that some can act as living hinges in many products (think the lid of a tictac box), meaning no bearings and with that no additional manufacturing processes are required. Sure there are materials with similar properties to _some_ plastic types but you'll be hard pressed to find one which can mimic most let alone all plastic types.",
"\"Plastics\" is not a single thing, it is a group of things defined by properties. Specifically the ability to be easily molded into various shapes while being durable.\n\nIf you find something that has the properties of plastic, it's plastic. \n\nFwiw, we already do have plastics that will biodegrade. Made from corn. Not economically practical and cannot replace everything we use plastic for."
]
} | [] | [] | [
[],
[],
[],
[]
] |
||
2rgt4a | why farmers give their cows nose rings | I've seen a few pics of cows (male cows, I think) with the nose ring. Is there a purpose there? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2rgt4a/eli5_why_farmers_give_their_cows_nose_rings/ | {
"a_id": [
"cnfq5ez"
],
"score": [
7
],
"text": [
"It's to attach a leash to. It's very painful for a cow to pull against a lead when it's attached by the nose, so this allows humans to walk them around. If it were around their neck, there's no wah you'd get them to move unless they wanted to."
]
} | [] | [] | [
[]
] |
|
4ajrel | how does mental illness start? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4ajrel/eli5_how_does_mental_illness_start/ | {
"a_id": [
"d10x8e1",
"d10xq2o"
],
"score": [
6,
2
],
"text": [
"It's a large category, including different illnesses with several different causes. These can include:\n\n- Chemical imbalances\n- Traumatic experiences\n- Inadequate care during the first 3 years of life\n- Brain injury\n- Genetic abnormalities\n- Long-term stress",
"For some illnesses and in some patients, we can say for sure (but it's not always the same cause even for the same illness in different patients, or for different illnesses in one patient!). Some mental illnesses often seem to be something to do with how the chemicals in your brain are made, which in turn is often related to your genetics: but this doesn't tell the whole story, because even if both of your parents have a particular mental illness it doesn't have to mean that you'll get it... and even if neither of them do it doesn't mean that you won't! But we've done lots of studies that have shown that many mental illnesses seem to run in families, and some of those have clear things that you can test for that are different about people who have them.\n\nThere are other big things, though, that affect whether or not you'll be affected by mental illness. Some mental illnesses can be caused during your development in the womb (it's one of the many reasons that pregnant women are generally advised not to drink alcohol!). Some kinds of mental illness can be caused by injury - for example, a blow to the head. There are even some bacteria and viruses that seem to be able to cause long-term mental illness in some people: and some kinds of drugs seem to be associated with some kinds of mental illness, too!\n\nAside from these \"physical\" ways that mental illness can be caused, there are also lots of psychological ways... although they're even harder to understand and pin-down, and we're only just beginning to make sense of them. Abuse and trauma can lead to mood disorders, anxiety, paranoid, and post-traumatic stress disorder (PTSD), for example. Difficult circumstances in your life, especially when you're a child, seem to be especially effective at triggering depression and might be linked to bipolar disorder.\n\nWe're a long way from understanding exactly what causes mental illness, and it clearly varies from case to case."
]
} | [] | [] | [
[],
[]
] |
||
4ti7z2 | why does it mess up my counting when someone starts saying random numbers | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4ti7z2/eli5_why_does_it_mess_up_my_counting_when_someone/ | {
"a_id": [
"d5hlks9"
],
"score": [
3
],
"text": [
"It's not just counting which is effected by other people talking. A similar experience can be had when someone else talks to you about a similar topic at the same time as you try to speak (it's often used as a demonstration of what it's like to live auditory hallucinations). Sadly I can't find a video demonstrating the effect but I can speak first hand of it's effectiveness. \n\nI understand this works on similar vine as demonstrated in the following video regarding speech jamming and how the brain takes all it's inputs sound, touch etc and that stronger signals can overpower weaker ones. \n\n_URL_1_\nThis seems to be an international link to the segment in question\n\n_URL_0_\nThis is an alternative source for the same episode with the relevant time stamp for anyone that the first link doesn't work on."
]
} | [] | [] | [
[
"https://youtu.be/GaWhr7-X7sU?t=8m45s",
"https://www.youtube.com/watch?v=wnt8qWZAflI"
]
] |
||
153rk4 | is there an actual quote from bible that condems homosexuality? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/153rk4/is_there_an_actual_quote_from_bible_that_condems/ | {
"a_id": [
"c7j0fw4",
"c7j135d",
"c7j7kb1",
"c7kcnm9"
],
"score": [
4,
4,
2,
2
],
"text": [
"It depends on what you believe 1 Corinthians 6:9 says\n\nThe Apostle Paul warns people against being \"arsenokoitai\" in the original Greek language text. Arsenokoitai were male shrine prostitutes that claimed to sell religious ritual sexual experiences.\n\nSome people believe the sin of the arsenokoitai was homosexuality, and that Paul is warning people not to be homosexual. Other people believe the sin of the arsenokoitai was being profane in selling their bodies at the temple, and that Paul is warning people away from that kind of degradation of a holy place in general.",
"this verse along with the other verse mentioned by cecikierk, is from Leviticus, which is from before Jesus' time, known as the Old Testament. this is from chapter 20, verse 13.\n > 13 “‘If a man has sexual relations with a man as one does with a woman, both of them have done what is detestable. They are to be put to death; their blood will be on their own heads.\nLeviticus is a book from the old testament, which is still relevant, but it was before Jesus' time (I'm not sure how much you know so I'll try and make it as understandable as possible).\n\nthis verse is from after Jesus' time, or the New Testament (see explanation below)\n**1 Corinthians 6:9-10**\n > 9 Or do you not know that wrongdoers will not inherit the kingdom of God? Do not be deceived: Neither the sexually immoral nor idolaters nor adulterers nor men who have sex with men[a] 10 nor thieves nor the greedy nor drunkards nor slanderers nor swindlers will inherit the kingdom of God.\n\nJesus came down to earth many years (im not 100% sure, i believe it was at least 1500 years) after Leviticus was written, he lived for around 30 years and then was crucified (killed on a cross) - 3 days later, he rose from the dead. (his birth was used for a basis of the date system, so year 0 was around about when he was born) After these events is when Christianity was formed. A large amount of these first Christians were Jews (Israel). They had many rules and regulations for how one was supposed to live - but they were focusing on following rules and doing good works to get into heaven, rather than redemption from God - and while Jesus was alive, He 'called them out' on it, said that they were 'doing it wrong' and they needed to change. Before - and after - Jesus explained to his followers (the disciples) that the only way to get to heaven is through grace - in laymans terms, not by doing anything, but God accepting you, despite you not deserving being saved (see verse below)\n > For it is by grace you have been saved, through faith--and this not from yourselves, it is the gift of God - Ephesians 2:8\n\nso i've deviated here, and my explanation is average, but if you do want to know more, you're welcome to ask me (or i can find someone more knowledgeable and better at explaining)\n\n**TL:DR** there are multiple places in the bible that condemn homosexuality (see the two above as well as Leviticus 18:22). \nAs for Christian's views of homosexuality, there are a few:\n\n~Some say it is ok.\n\n~some are unsure but will accept homosexuals.\n\n~some are unsure but will not accept homosexuals.\n\n~some are opposed, but will not ignore/harass homosexuals.\n\n~and some (the most conservative) are opposed, and are very critical of gay people.\n\nand with all the publicity they have been getting lately, i would say that Westboro is a cult more than a baptist church (just throwing it out there)\n\n\n",
"The interesting part is, as far as I know, there is absolutely no reference in the bible, even once, about women having relations/relationships with other women. It only targets males. Even more reason its stupid and should have no bearing on today's society.",
"Another quote I haven't seen mentioned is from the book of Romans (which is a letter written by a guy named Paul to the Christians living in Rome). This was after Jesus.\n\nNear the beginning of the letter, he states that since the creation of the world, God's existence, power, and nature have been evident in his creation. But people chose to ignore the evidence and ignore God. In light of that, he goes on to say:\n\nSo God abandoned them to do whatever shameful things their hearts desired. As a result, they did vile and degrading things with each other’s bodies. They traded the truth about God for a lie. So they worshiped and served the things God created instead of the Creator himself, who is worthy of eternal praise! Amen. That is why God abandoned them to their shameful desires. **Even the women turned against the natural way to have sex and instead indulged in sex with each other. And the men, instead of having normal sexual relations with women, burned with lust for each other. Men did shameful things with other men, and as a result of this sin, they suffered within themselves the penalty they deserved.**\n\nSince they thought it foolish to acknowledge God, he abandoned them to their foolish thinking and let them do things that should never be done. Their lives became full of every kind of wickedness, sin, greed, hate, envy, murder, quarreling, deception, malicious behavior, and gossip. They are backstabbers, haters of God, insolent, proud, and boastful. They invent new ways of sinning, and they disobey their parents. They refuse to understand, break their promises, are heartless, and have no mercy. They know God’s justice requires that those who do these things deserve to die, yet they do them anyway. Worse yet, they encourage others to do them, too.\n\n**You may think you can condemn such people, but you are just as bad, and you have no excuse! When you say they are wicked and should be punished, you are condemning yourself, for you who judge others do these very same things.** And we know that God, in his justice, will punish anyone who does such things. Since you judge others for doing these things, why do you think you can avoid God’s judgment when you do the same things? Don’t you see how wonderfully kind, tolerant, and patient God is with you? Does this mean nothing to you? Can’t you see that his kindness is intended to turn you from your sin?\n\n---\n\ntl;dr, The Bible does say homosexuality is a sin. But in the same breath, it also says hate, gossip, and pride are wrong, and it specifically instructs Christians not to condemn other people for their sin."
]
} | [] | [] | [
[],
[],
[],
[]
] |
||
afzqqn | how do you get four first degree murder charges from one death? | Sad story if the allegations are true, but the charges confuse me.
_URL_0_
TLDR: A 19 year old man allegedly killed his gf’s 4 year old daughter for spilling juice on his Xbox. He has been charged with four counts of first degree murder. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/afzqqn/eli5_how_do_you_get_four_first_degree_murder/ | {
"a_id": [
"ee3uref"
],
"score": [
2
],
"text": [
"This is a case of 'throwing everything at the wall and seeing what sticks'.\n\nOr to put this another way - if you really piss the government or wrong person off they can really fuck up your life.\n\nNormally if you punch your girlfriend that's one count of domestic violence. But if the prosecutor really hates you that can be 5-10 different charges. Just to list a few - threatening (when you make that loud sound as you prepare to hit), first degree assault (when the fist connects), causing bodily injury (the bruise), failure to stop and render medical aid (not calling the ambulance for your girlfriend), endangerment of a child (if there's a kid asleep anywhere in the house), failure to report a crime against a child (for not calling the cops on yourself after you endangered a sleeping child 3 rooms away). I'm sure an actual prosecutor could think up a few dozen more. Some of these are dependant on state.\n\nIn IL you can be charged for murder for any felony that results in a death - so one murder for the murder, one murder for beating her, one murder for having a gun in the house, one murder for the drugs. She could probably have found a dozen more felonies to charge him with murder for if she really wanted to.\n\nNormally acts committed at the same time the sentences are served at the same time - but if the judge doesn't like you he may order them sequentially served with any or no justification.\n\nMurder means, literally, whatever the government says it means. In AZ it can mean \"walked into the wrong house with my friend and the homeowner shot him to death while I laid facedown on the ground with my hands on my head\".\n\nYou're making the mistake of assuming words mean what they normally mean. To the government they can mean literally anything they decide. That's how sexual assault can be a wholesome, enjoyable experience for all involved."
]
} | [] | [
"https://www.ctvnews.ca/mobile/world/man-accused-in-death-of-girl-4-who-spilled-juice-on-xbox-1.4251640"
] | [
[]
] |
|
a6w7zv | why do foreign names get spelled and pronounced differently in english? | I️ always see English translations of Chinese words or names and they utilize letters that can in no way phonetically produce the sound of the word. A close example would be “Zhou.” So what’s the purpose of spelling a word that does not translate correctly letter for letter but also does not phonetically have the correct meaning? Why not spell Xiang as Chiang?
This occurs in other language translations to English to it’s just prominent in Chinese. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/a6w7zv/eli5_why_do_foreign_names_get_spelled_and/ | {
"a_id": [
"ebyhukf",
"ebylyyu",
"ebysmvz",
"ebyta2k"
],
"score": [
8,
4,
2,
2
],
"text": [
"Because they have different origin languages. English is Germanic in origin, converts semi-ok to Romanic languages but not really. Nordic languages have different letter sets, and the Chinese has different inflections on syllables, makes its tough",
" > I️ always see English translations of Chinese words or names and they utilize letters that can in no way phonetically produce the sound of the word.\n\nThose aren't translations, but *transliterations*. It really only shows up most significantly in Chinese.\n\nThe short version is that there are a lot of sounds in Chinese that just don't have analogues in English or with the Latin alphabet. Worse, Chinese doesn't have a phonetic alphabet. We've gone through successive styles for representing Chinese in Latin characters. The current version (Hanyu Pinyin) is just the latest, and was developed by the Chinese government, and adopted in the US as part of Nixon's push to open up China to the rest of the world.\n\nFor example, if you were referring to that most infamous of Warlords (and of the Kingdom of Wei) from the Three Kingdoms period of Chinese history, if you were using the old Wade-Giles system you'd spell it as Ts'ao Ts'ao, which is relatively close to the actual pronunciation. Under the current system, it's Cao Cao.",
" > Why not spell Xiang as Chiang?\n\nBecause \"x\" and \"ch\" are used to represent two different Chinese sounds, neither of which appears in English (just as the English \"ch\" sound doesn't appear in Chinese). \"Xiang\" and \"Chiang\" would be pronounced completely differently. The sound represented by \"ch\" is closer to an English \"ch\" than anything else in Mandarin Chinese, so it gets represented as \"ch\". Similarly, Mandarin doesn't have the English \"sh\" sound, so the closest thing they have gets represented as \"sh\". The sound represented by \"x\" does also sound kind of like an English \"sh\", but that's already taken by a different sound so they had to pick something else. \"x\" in particular was chosen because the sound is similar to a Portuguese \"x\" sound.",
" > I️ always see English translations of Chinese words or names and they utilize letters that can in no way phonetically produce the sound of the word\n\nActually, they very much do. *To native-speakers of European languages.*\n\nThe English-language is a composite of a group of languages, specifically the *Indo-European languages*- the core of which is Latin, French and North Germanic.\n\nEuropean-language speakers use the Pinyin system instead of Chinese characters to indicate phonetic sounds of Chinese words.\n\nPinyin is the standard system invented by Zhou Youguang to *romanize* the Chinese characters into phonetic sounds *with the tonal marks* (as you would see in Polish or French) so that they are comprehensible to Indo-European languages, not just for native-English speakers, but for all European languages.\n\nChinese is a *tonal* language with four diacritic-tones *(zhōu; zhòu; zhǒu; zhóu)- the infliction-sound of a Chinese word that goes up and down in four different tones.\n\nBecause other cultures outside the Sino-Tibetian group *(Chinese, Burmese, etc)* do not use a logogram-writing system, it is very difficult for European-speakers to interpret phonetic sounds from Chinese characters *(aka Hanzi)*. \n\nSpelling \"Xiang\" as *Chiang* would not be correct within the Pinyin system. \"Xi\" *(sh-urh)* has a completely different meaning to \"Chi\" *(ch-ee)* when spoken.\n\n'Chiang' in pinyin means it should sound like *\"gee-yang\"*. \n\nIt's a completely different sound to Xiāng *(\"shee-yang\")* In fact, the *\"gee-yang\"* sound should be written in Pinyin as *Jiang.*\n\nIn learning Chinese, it is always useful to visualise both the Chinese character along with the Pinyin-tone word. This is what makes learning Chinese so very difficult and laborious.\n\n\n"
]
} | [] | [] | [
[],
[],
[],
[]
] |
|
2e9yc3 | why does starting task manager when my computer is frozen seem to unfreeze it? | I've been remedying my frozen computer this way for as long as I can remember, and with many different computers. Does it have something to do with the priority the computer places on starting up the task manager?
Thanks! | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2e9yc3/eli5_why_does_starting_task_manager_when_my/ | {
"a_id": [
"cjxfpkd",
"cjxgc72",
"cjxii0x",
"cjxlnl0"
],
"score": [
14,
3,
6,
4
],
"text": [
"Task manager has top priority, so if any other program is hogging up the computer in an endless cycle you can force it to shut down.",
"Well, I can't say the same for my computer...\n_URL_0_",
"Context: Task Manager is a program like any other program and as such is subject to the same resource limitations as any other program. However, because of the nature of the program (I.E. reading other processes and being able to send a terminate signal to said processes) Task Manager runs in what's called an \"elevated user space.\" An elevated user space is a special way of running a program (it much like running a program as administrator, but it is different in a few ways) that allows special privileges. \n\nExplanation: there are two things that go into Task Manager being able to run when the computer appears \"frozen.\" One: different user spaces have different process priority queues in the NT architecture. Task Manager is most likely one of the few programs in its queue, so it gets more processing time in its individual queue than the program that's one of many programs in the normal user space. Two: applications that aren't part of the system invoke parts of the kernel via an API layer, but Task Manager is part of the system. What this means is that Task Manager has direct access to system resources that eliminates the need for extra processing time and delays from making these API calls.\n\nAddendum: running Task Manager will not \"unfreeze\" a computer. It only seems to because it is allotted more processing time (see above.) If a computer is truly locked up Task Manager will **not** start (ctrl+alt+del will probably not do anything either.) ",
"I like to think that my computer knows shit is about to go down, so it stops playing games with me and gets back to work"
]
} | [] | [] | [
[],
[
"http://i.imgur.com/kBd2Pya.png"
],
[],
[]
] |
|
5n6daw | what's the deal with yellowstone? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5n6daw/eli5whats_the_deal_with_yellowstone/ | {
"a_id": [
"dc8zcan",
"dc8zxno",
"dc905op"
],
"score": [
2,
2,
5
],
"text": [
"Yellowstone National Park sits over what is known as the Yellowstone Caldera. This is the mouth of what's called a supervolcano. There are many predictions online on what would happen if the supervolcano erupted. [Here is one](_URL_0_).\n\nThe worst part, other than the immediate effects is such an eruption would severely hurt growing seasons for most of the farmland in the U.S.",
"Yellowstone is a supervolcano. If it erupted it would cover most of North America in ash, something that is very lethal as volcanic ash is shards of glass. Anything it touches including water and food is contaminated and breathing it in deadly. It would also put enough ash into the air to put the world into a volcanic winter, potentially even starting a new Ice Age if the eruption is big enough. ",
"Yellowstone sits over a massive hotspot and is a supervolcano.\n\nWhile it would be very bad if it erupted, the danger is rather hilariously overblown by Hollywood. Granted, Wyoming and parts of Idaho and Montana would be gone, and the states immediately east and southeast of Wyoming (so, Colorado, the Dakotas, Nebraska, Iowa, Minnesota, and Kansas) would have a lot of ashfall and a slight but still significant global temperature shift for a few years (honestly, less than 5 years), that would be it. Anything West of the Rockies, or East of the Appalachians, would be basically unscathed other than a very light dusting of ash.\n\nIt would be less of a \"everyone on Earth is going to die\" and more of a \"North America is going to kind of suck for the next decade\" kind of thing."
]
} | [] | [] | [
[
"https://io9.gizmodo.com/what-will-really-happen-when-yellowstone-volcano-has-a-508274690"
],
[],
[]
] |
|
1ua3k7 | why do people get diarrhea when they are dehydrated? | Why do you get diarrhea when you are dehydrated instead of constipation? Doesn't it lead to further dehydration? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1ua3k7/eli5_why_do_people_get_diarrhea_when_they_are/ | {
"a_id": [
"cefz5qv",
"ceg0ctp"
],
"score": [
2,
3
],
"text": [
"It does, and it's responsible for quite a lot of deaths annually in less developed areas.\n\nThe mechanics of diarrhea are not your body having too much liquid, but rather the balance of things dissolved on one side of your colon versus the other being off. This can happen even when you're dehydrated - in fact, if you're losing lots of electrolytes but bringing in some water, it may even get worse.",
"For the most part it's the other way around. People get dehydrated because they have diarrhea due to sickness, etc. When you have diarrhea you aren't absorbing the water from your digestive tract, which causes the dehydration."
]
} | [] | [] | [
[],
[]
] |
|
eqs5re | why are other standards for data transfer used at all (hdmi, usb, sata, etc), when ethernet cables have higher bandwidth, are cheap, and can be 100s of meters long? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/eqs5re/eli5_why_are_other_standards_for_data_transfer/ | {
"a_id": [
"fewk0kl",
"fewkm9u",
"fewknis",
"fewkozd",
"fewle91",
"fewma2m",
"fewma92",
"fewmfah",
"fewomkr",
"fewq7di",
"fewt7fa",
"fewxsid",
"fexeiuc",
"fexf5mv",
"fexg1ul",
"fexhm70",
"fexkt44",
"fexmjwa",
"fexqpx5",
"fexw6n0",
"feybu38",
"feycc5p",
"feykez6",
"feyyaqk",
"fezbzrm",
"fezlsa8",
"fezuemc",
"ff04n3b",
"ff08dnr",
"ff0pt11"
],
"score": [
2115,
8062,
76,
695,
2,
7,
237,
143,
2,
2,
7,
45,
5,
2,
2,
2,
15,
2,
2,
6,
2,
6,
2,
2,
2,
2,
2,
2,
2,
2
],
"text": [
"You had the misconception of ethernet cables having higher bandwidth. That's where your root of your confusion.",
"USB cabling and receptacle buses are cheaper than ethernet cables.\n\nUSB has greater port density, and will fit cleanly into thinner form factor platforms.\n\nUSB 3.0 has ~5 gbps transfer rate, whereas cat5e gets stable 1gbps. Getting 10Gbps typically requires cat6e ethernet cables or fiber, which are not exactly flexible and definitely not as cheap.\n\nCopper ethernet is also rated for 100 meters; you would not get very good throughput at 100s of meters on copper. Granted, this isn't typically a requirement for USB based eqpt either.\n\nEli5 edit:\n1. USB cable and especially the equipment you plug into (buses/controllers) cheaper than ethernet\n2. Fit more USB ports in tiny space (known as port density)\n3. USB faster than ethernet for price, especially on modern solutions like USB-C\n4. Ethernet is better at longer distances, which is why networking equipment uses it, but your keyboard does not need to",
"Ethernet generally cannot transmit power, or requires quite a bit of componentry on both ends to do so. It therefore doesn't work well for things like keyboards, mice, flash drives that require a power source.\n\nIt doesn't have the sheer bandwidth needed for HDMI or displayport, or the very low latency and, until recently, high bandwidth needed to run SATA.\n\n10Gb/s ethernet endpoints are still very expensive and power consuming.",
"Gigabit ethernet max. transfer speed: ca. 1 Gb/sec\n\nHDMI 2.1 max. transfer speed: ca. 42 Gb/sec",
"Because you need 100m ethernet cables. That's basically it. And they are cheap because you need a few hundred meters to wire up something, and the bigger the production the cheaper the cost of a single unit. Pair that with a cheap connecter, and you have Ethernet Cables.",
"There are many advantages and disadvantages to each type of transportation. Since every industry is unique and has different costs and profit margins, companies choose the method that fits them best. \nFor example, HDMI works best for transferring videos, USB works best for transferring files to small portable devices such as flash drives. SATA works best for external hard drives.",
"So what is being conflated here is Ethernet cables and Ethernet, HDMI cables and HDMI, etc. We need to talk about the physical layer and the protocols separately. \n\nEthernet is a protocol that can be run on top of a number of physical layers. Most people think of Ethernet cable as twisted shielded pair. \n\nThis is a type of transmission line that has an impedance of about 100 ohms. Depending on a number of factors like the dielectric loss, and how uniform the impedance of the line is different sorts of transmission lines have different bandwidths. The usable bandwidth of a CAT6A cable is about 500 MHz. The rest of the bandwidth comes from additional channels or QAM modulation techniques. \n\nNow what are SATA cables? Well they are differential pair signals as well. So is HDMI, copper differential signal pairs.\n\nNow imagine you want to send a signal down a transmission line and you want it to switch on and off at 20 GHz. Well you can actually do that on any sort of cable, the question really is just how much of the signal will actually make it to the other end and what it will look like. If its just loss and not lots of horrific reflections then you just need to just put repeaters in the cable or make it short enough. If the transmission line has a lot of dispersion then the shape of the signal will get lost and it will become hard to \"see\". These factors are often shown with something called an eye diagram, the more open the eye is the better the signal integrity of the communication channel. \n\nThe fact that Ethernet can be 100 m long means that the dispersion and the loss of the cable have to be low at the frequencies that protocol is used at. As others have pointed out HDMI has a lot more bandwidth so the cables can't be as long or the transmission line quality has to be better. Cheap cables mean lower transmission line quality. \n\nThe very best cables that are not optical (in terms of bandwidth) tend to be rigid pipes that are quite a lot like coax but have the center conductor basically floating in air with little spacers, these get up above 100 GHz.",
"This comes down to the intended use of the Device more than anything else. HDMI to Ethernet adapters do exist, and Ethernet can obviously handle the bandwidth required for a 1080p video stream, but a lot of the \"extra pins\" HDMI has cover audio, error detection, frame timing etc. Classically the interface to provide a usable signal on the video output end is provided by the input device, and monitors, TV's, etc tend to follow this pattern.\n\nIn the case of USB, the devices themselves have to be smart enough to tell the computer how they're connecting and what sort of functionality they'll perform.\n\nBandwidth isn't the end all consideration when determining what the most efficient way to transmit information is. While transmitting the required signals via ethernet may be possible it wasn't designed to support the wide array of applications better suited to specific connector types.",
"Ethernet is the slowest of Transfer standards you mentioned. That's why a USB to Ethernet dongle works at full speed, but HDMI over Ethernet works only with compression.",
"Follow up eli5. \nWhy is one connector/ cable give better or worse speed? My understanding is that a conductor is a conductor, obviously less resistance based on wire guage, and type of metal, and stranded vs solidcore would be parameters that would effect how much current it can use etc. Also i imagine the specific impedance or capacitance of the wire at that guage and length could affect its ability to transmit frequencies cleanly. And Obviously you would need the correct number of conductors for a particular data protocal. But how would the shape of the connector type at the end have anything to do with transfer speeds? Can't one easily convert any wire to any connector type with similar number of conductors? Shielding and wire guage options aside what is the physics that allow one wire or connector standard to transfer at twice the speed of the next? Also why does the twisted pair or cat5 wires have any affect on transfer speeds vs non twisted 8 conductor wire?",
"In addition to things others have mentioned, the RJ45 connectors you are probably thinking of aren’t very durable (the clips tend to break off if you unplug and plug back in often). Unlike USBc they also aren’t reversible.",
"I know this comment will never be seen, but Ill try anyway. Data bandwidth is not the only measurement for a cable, and many cables are used because they fill a role no other cable will fill properly. HDMI for instance was shoved down our collective throats by the media 'powers that be'. It has 19 wires inside it, and performs a massive series of handshakes both to negotiate things like display resolution (through EDID) and copyright protection (HDCP). An ethernet cable cant pass this signal without a translation device (which exists and is known as an HDMI extender). Meanwhile, HDMI wires are notoriously finicky over medium to long distances. \n\n\nRG6 with a BNC connector is often used because the actual termination (bit on the end) can be secured. BNC was actually created by the British Navy iirc for that express purpose. The equipment it is used on does not require ethernet throughput. \n\n\nFiber is frankly very high on the list of wires that are great. Extreme data transmission speeds are possible, and you can run it for extremely long distances without issue. There are also secure connectors that pretty much assure the thing will not pop out by accident. The downsides are its fragility, and lack of easily available equipment for it to be used with.\n\n & #x200B;\n\nTLDR; \nWires are used for all kinds of reasons, not just data throughput.",
"for HDMI, it is lossless and has 48Gbps bandwidth (with [hdmi 2.1](_URL_0_)). So it's not quite like you've thought",
"Ethernet at those rates requires high powered high speed data management as well as a hardware interface and network layer computing where as others use more like a hardware chip to do the handling and stream pretty simple digital data streams that talk more on a hardware interface.",
"HDMI is up to 48GB/s. The fastest attainable ethernet you can get in your home is 10GB/s, and that's a signficant cost. Normally, people have 1gbps. 40 and 100 gb ethernet are used in and between datacenters.\n\nEach of these cables has a specific purpose that ethernet cannot nessecarily match. Sometimes it's high bandwidth, sometimes low latency.",
"Ethernet cables can not be 100s of meters long. They can be up to 100m, a singular hundred.",
"The easiest answer is that USB has built in standards for device detection, drivers, and is designed to handle a much broader range of devices.\n\nHDMI has built in negotiated standards for DRM, and the port is meant to be easier to install in tighter places.\n\nWith the addition of Thunderbolt to the USB 4.0 specification, fiber optics are now used for handling stuff previously relegated to PCI cards inside computers.\n\nFinally, power. HDMI includes Ethernet for transport. USB can handle up to 100W of power with the proper Type-C cable\n\nBottom line, Ethernet is designed to do one thing - networking. We can sometimes shoehorn it to do these other tasks, but imagine an Ethernet port on a thin tablet today.",
"DisplayPort 1.4 is something like 32.4 Gbps. HDMI 2.0 is 14.4 Gbps (a new version is slowly coming out with bandwidth even higher than DisplayPort 1.4). These also require relatively short cables. Ethernet in real use and inexpensively acquired by consumers don't really come close to those speeds.\n\nTo put that in perspective of what you can do with that, DisplayPort 1.4 can easily do 4k/60fps/4:4:4 chroma/10 or 12bit color. I'm not sure exactly what it maxes out at, but at some point you have to start compromising on something. For example the current mainstream HDMI spec, which as stated already has higher bandwidth than what most consumers have access to as far at network gear, is already hitting it's limit with 4k forcing you to choose between 4k/60fps/4:2:2 chroma/10 or 12bit color, 4k/60fps/4:4:4 chroma/8bit color, or 4k/30fps/4:4:4 chroma/10 or 12 bit color. Basically you have to compromise on resolution, chroma subsampling, refresh rate, or color depth. The more you make one go up, the less you can have of the others.\n\nPlease disregard any typos or technical errors. The gist of this reply is to point out that even at really high bandwidths, higher than what most of us have access to with networking gear, compromises have to be made. My current display is a 3440x1440@144hz, 10bit color, 4:4:4 chroma subsampling using DisplayPort. I am not sure the current mainstream HDMI can handle that.",
"**Summary/TL;DR**: Different standards exist, because it is impossible to meet all design requirements in one standard that is also inexpensive enough for consumer use. In some cases, it's even impossible to meet them all, period. Like with cabling. Some applications need stable cabling, others need flexible cabling. And some design criteria have only been recently met by Ethernet, whereas other standards have been meeting them for over a decade now.\n\nOkay lets unwrap this a bit:\n\n**USB** was originally designed to be a standard to connect inexpensive peripherals in a way that is unified and easier to handle than previous options. Compared to Ethernet (or really just about anything else) USB has always been both dirt cheap and dead simple to implement. It is also designed to be easy to handle for people with physical disabilities. USB connectors being simple and sliding in and out of their receptacles easily isn't a mistake, it's a deliberate design choice. Same with the cables being thinner and easier to bend. USB also comes with a set of standard drivers that do away with the need to write your own driver software for all but the most unusual devices.\n\n* (+) Much cheaper on the hardware side\n* (+) Simpler to implement, hardware wise\n* (+) Small. Many USB devices are smaller than even an RJ45 socket\n* (+) Connectors specified for a high number of connect/disconnect cycles, almost unbreakable, simple, easy to handle, even for people with physical disabilities\n* (+) Cheaper on the software side as well. (usually no extra drivers needed, can do lots of things)\n* (+) Still cheaper for similar bandwidth for high bandwidth\n* (-) Plugs unplug themselves all the time\n* (-) Historically, relatively low bandwith\n\n**SATA** was specified as point to point high bandwidth low latency short distance bus. Until 10G Ethernet, SATA has been much faster than Ethernet, and because of the point to point design (i.e. there are never more than one receiver and one sender on a connection), things like arbitration (figuring out who gets to send next) are unnecessary, very *very* greatly improving latency, which is what you need for access to local storage devices. The short distance design also makes cables and transceivers (the send/receiver chips at the end) much cheaper to implement.\n\n* (+) Much cheaper on the hardware side\n* (+) Lower latency (Important for storage)\n* (+) Less complexity, one sender, one receiver per cable\n* (+) Until very recently, faster than Ethernet\n* (+) Cheaper per bandwidth unit\n* (-) Single purpose\n\n**HDMI** is actually not that different from SATA, conceptually, but it has a few extra features added. Specifically it is designed for very low latency, it features very high bandwidth (even current 10G Ethernet is slower than an HDMI connection, starting from HDMI 1.3, which was specified in *2006*). Essentially it is designed to meet all needs of a digital A/V connection, which actually aren't that easy to meet with a general purpose network standard. On the other hand, as point to point short range standard it lacks a few of the design requirements of Ethernet, which makes it cheaper to implement. (Btw, pretty much this entire section is also valid for **DisplayPort** and **Thunderbolt**, with with not that very many differences, with Thunderbolt having a few extra features that go beyond what HDMI and DP do)\n\n* (+) Cheaper to implement\n* (+) Much lower, and dependably low latency (important for A/V)\n* (+) Historically, and currently *much* faster than Ethernet\n* (+) Cheaper per bandwidth unit\n* (+) Has special features for A/V transport that aren't easy to implement\n* (-) Single/low number purpose\n\n**Ethernet** was specified to serve a very different purpose than any of these standards. Ethernet's claim to fame is long distance ( > 10m) high bandwidth, something none of the other standards can do. On the other hand it's more expensive to implement, the drivers are clunkier (and don't cover many use cases, i.e. you need lots of stuff on top to cover things like storage or A/V), and Ethernet does not have a guaranteed latency at all, something it inherits from its past of being a shared medium (10Base-2). And lastly, the cabling is rigid, awkward to handle, not specified to me moved around all the time (even flexible Cat cable isn't, really, not the way you move around a mouse cable for instance)\n\n* (-) More expensive to implement (for anything > 1GB still *much* more expensive)\n* (-) Hardware (necessary chips) needs much more space than USB\n* (+/-) Lots of cabling options - > flexibility, but also incompatibility\n* (-) No guaranteed latency\n* (+) Can do much longer distances at high bandwidth than the other options\n* (-) Driver situation is a bit of a mixed bag for anything above layer 2.\n* (-) More expensive per bandwidth unit\n* (-/+) Cabling rigid and hard to move around. Can be a good thing for solidity, but is a bad thing for things like mice or USB sticks",
"ELI5 answer: Because it's easier to have different types of plugs for different things.\n\nAs for a more technical explanation, I'm copy/pasting what I've put elsewhere (only slightly edited)\n\n----\n\n200 meters is the limit for Cat5, 100 for Cat7. The bandwidth for Cat7 which is 10 Gbps which beats USB 3 hands down while the newest standard for HDMI is 18Gbps.\n\nThe form factor of RJ45 is only that way because of standards. It doesn't have to be the size or shape that it is but good luck getting every computer and NIC manufacturer to adopt a new one.\n\nAs for the max length of a cable, there are such things as \"repeaters\" which are insanely cheap these days. \n\nAdditionally, AWS 24 ethernet cables have been used for VGA cables in the past. [Here's a link to a converter just for this purpose](_URL_1_)\n\nHDMI nowadays has bandwidth up to 18 Gbps but previous versions went up to 10 Gbps, same as Cat7. In fact, [there are converters just for this purpose](_URL_0_)\n\nSo, now that you've read all of this, the reason is because of technical standards. After all, it would be hella confusing if everything plugged into the back of your computer via RJ45. On the other hand, it's only eight wires and it's extremely easy to wire in another plug on the cable and save yourself some money.\n\n----\n\nEdit: To add some history as to why we have different plugs: Computers didn't always have standards when it came to hardware. Anyone could make a component and as long as it fit the motherboard, you could sell it even if the drivers, software, and cables were completely proprietary. Along came modems, printers, and sound cards and it became such a nightmare to support that eventually standards for things were introduced and manufacturers were expected to conform. By then, we had so many pieces of hardware out there that the most popular ones were (mostly) the ones who benefited since they had the largest market share and had the highest financial agility to adopt or influence the standards. Because of this, those different cable types were kind of cemented in place and became commonly used, spreading forward to the plethora of cable ends we have now.\n\nSometimes, however, technology advances and we can get more into a smaller area. We see this mostly commonly with USB plug types. Sometimes we only need a limited amount of bandwidth or we just plainly have a very small amount of room. For example, could you imagine using one of [these](_URL_2_) on your PlayStation controller???\n\nSo we have different cable connector types for historical, bandwidth, expense, power requirements, or space reasons.",
"Those other cables do not meet the safety requirements from the insurance industry or government to ensure buildings are safe and cheap. Etherlink usually does meet the safety requirements so it's ok to use inside the walls and ceiling of a building. New cables can and do get invented from time to time but proving they are safe is very expensive, so everyone still uses ethernet.",
"In addition to what everyone has already said, Ethernet cables are extremely inflexible. None of those could be reasonably routed inside of a PC case (ie SATA replacement) and would be clunky and fragile to carry around with you constantly.",
"Mostly it comes down to money, and what tech available at the time was not suitable, or it was just an upgrade. \nHDMI came along cause dvi was big, clunky, and did not support audio, and became a defacto standard for such and today got a nearly 50 gbps. \nUSB came along as a method to connect peripherals, be it mouse, keyboard, and so much more, and with it's 5 voltage it became a nice standard for giving power to peripherals as well as becoming an eventual charging standard thanks to the EU. \nSATA is just an upgraded edition of PATA like HDMI and DisplayPort is an upgraded version of DVI and VGAm, and it was generally faster then ethernet was at the same time. \nLastly there is the ethernet cable itself, the third most sold cable after power and phone, and will probably rise above phone any minute now. \nEthernet cables are big, they are chonky, and the good cables are fairly expensive to make as well. \nSo to summarize, each form of data transfer was made for a certain purpose in mind, and at the time it fit that purpose better then all alternatives, pluss money had quite a bit to say about it. \nIt was a tool fit for it's purpose, however all of them could be used as hammers, but hammers are better hammers then non-hammers even when non-hammers can be used as hammers. \nOh and whats more, the highest bandwidth today on ethernet cable is at a slow 400 gbit/s. \nIn comparison PCI express 5.0 is already up into 512 Gbit/s, while NVLink 1.0 is at 640 Gbit/s NVLink 2.0 at 1.2 Tbit/s, and then you got Infinity Fabric, which is part of HT for communications between cpu and gpu and has a max theoretical bandwidth of 4096 Tbit/s",
"Ethernet plugs are brittle, they're not made to be plugged and unplugged several times. USB and HDMI are designed specifically with this in mind.\n\nas for SATA plugs, it's easier and cheaper to just keep using them, than try to adapt everything to a new standard",
"I think a lot of people on here are caught in the bandwidth of the cable but that's not the answer. The answer is simply that ethernet is made for networking devices. An HDMI for example does that but also a bunch of other stuff because it has 19 pins. If you used ethernet you'd have to add a process that decide what a packet was intended for and that will add latency and cost of manufacturing a new TV or dvd player which would be present with HDMI.",
"Well:\n\n- USB is cheaper.\n\n- USB can transmit power, and a lot of it in certain cases.\n\n- Even USB 3.0 ports can deliver 5Gb speeds, while CAT 5E can only do 1GB.",
"A similar question I always wondered is why we developed all these other cables when regular coax cables have high enough bandwidth for HD signals and fast internet. Also, same question with VGA vs HDMI or Displayport. You could run an HD resolution on a CRT monitor with just a VGA cable 20 years ago. Why did we change these things? I'm sure that they would eventually not be enough, but it seems like we changed them decades before it was necessary.",
"In addition to what everyone else said Ethernet cables are usually solid core wire which doesn't flex very well and would probably work harden and break pretty quick when put in the same usage conditions as a USB cable for a phone or something. The RJ45 connector is also much larger and less durable than any of the standards you mentioned.",
" > can be hundreds of meters long\n\nUh... No? They start to degrade the signal after about 300 feet; which is just under 100 meters. It's gonna be the same for any copper cable.\n\nSource: I install internet for a living. After 300 feet of cable, we have to use switches or repeaters then run more cable from that. Though typically, if we have to move it more than 300ft, we just use a PTP system to deliver it wirelessly.",
"Besides the bits explained already, the biggest advantage HDMI had over other connection forms was that it was built to be HDCP-ready. IE, it was more about control than technical specs."
]
} | [] | [] | [
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[
"https://www.hdmi.org/spec/hdmi2_1"
],
[],
[],
[],
[],
[],
[],
[
"https://www.amazon.com/Q4Tech-Ethernet-Adapter-Extender-Sockets/dp/B01N99EYH7",
"https://www.amazon.com/Converter-MACTIS-Ethernet-Adapter-Female/dp/B074P2SSLX",
"https://images-na.ssl-images-amazon.com/images/I/71FYdynJYsL._AC_SX466_.jpg"
],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[]
] |
||
2i4ze3 | how do the moon's phases work | I have heard so many conflicting views and evidence I don't know what to believe. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2i4ze3/eli5_how_do_the_moons_phases_work/ | {
"a_id": [
"ckyv4uv"
],
"score": [
2
],
"text": [
"The bright part of the moon is simply light reflecting off the sun. So the phase completely depends on the angle between the sun, earth, and moon. So you'll notice on a night with a full moon, the moon is approximately on the complete opposite side of the earth. During a new moon, it's approxmiately in the same area of the sky as the sun. All other phases are simply breaking down the angle. If the sun-earth-moon angle is acute, it'll be a crescent. If it's obtuse, it'll be a gibbeous. At a right angle, it's a half moon.\n\nedit: I say approximately, as they don't always line up perfectly. When they do, we get an eclipse."
]
} | [] | [] | [
[]
] |
|
3x37yd | what is so special about the blu-ray format? | What is it that makes Blu-Ray Blu-Ray? And what differs it from regular 1080p video? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3x37yd/eli5_what_is_so_special_about_the_bluray_format/ | {
"a_id": [
"cy12u5z"
],
"score": [
7
],
"text": [
"Blu Ray isn't a type of video. It is a type of data storage system.\n\nBlu-Ray just uses lower wavelength (bluer) light in the laser it uses to read the disk when compared to a DVD. This lets the system read smaller spots on the disk. The ability to read smaller spots means that a disk of a given size can have more distinct spots (more memory) using blu-ray than using a typical DVD system. The ability to have a single disk with much more memory lets us fit long stretches of high quality video (e.g. 1080p) on a single disk."
]
} | [] | [] | [
[]
] |
|
1hs9zm | i'm 27 and i'm starting to notice something. are adults looking and acting younger? or is it my perspective on age that's changing? | As I become more of an adult I see what seems like grown people look less like grown people to me. A forty year old looks a lot younger than what a forty year old looked like to me at fifteen. Even when I look at older pictures of forty year olds from the past they look older. Not that I don't see forty year olds who look run down and disinterested in life (something I used to assume they all were).
Not only that, but it seems like more adults are into things I used to associate with young people. Sometimes it seems like more than ever people are trying to hold on to that feeling of nostalgia and being young. Is it a cultural thing? I've heard many people talk about the divide between baby boomers and adults over 45 and those like me under 45.
Or is it my own changing perspective of age as I get older? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1hs9zm/eli5_im_27_and_im_starting_to_notice_something/ | {
"a_id": [
"caxdu3l",
"caxdyci",
"caxed42",
"caxh0ce",
"caxia3y",
"caxj8lm",
"caxllne",
"caxm7x9",
"caxmd1q",
"caxmkvd",
"caxmxlf"
],
"score": [
6,
70,
3,
2,
3,
31,
3,
12,
6,
6,
3
],
"text": [
"That's just ageing. Everyone notices that sooner or later. I'll be 40 this year, and the local university students look like they shouldn't even be able to drive yet. I can remember thinking my parents were old at an time when, in retrospect, they were a fair amount younger than I am now. Then again, that might have been the 70s and 80s fashions :)\n\nDon't worry about it :)",
"I think it's the fact that you're aging. I'm in my early 40's and I see little kids driving cars and working, having spouses and even babies! Little kids I say.\n\nThe \"hot\" young guys look like *potentially* hot men. I don't look at them and think, \"Hmm, I could eat him up.\" Instead, I think he will be a good looking man when he grows up.\n\nI look in the mirror these days and wonder who the heck is looking back at me, and where this roll of belly fat came from (cause my size 0 jeans don't fit for the first time in my life). \n\nI see men in their late 40's, with gray hair and wrinkles, and I think of them as the opposite sex instead of my dad's buddies.\n\nI read what utes say about politics on the internet, and chuckle because I used to think that way too.\n\nYou're only 27. Just wait, it gets funner! (Ok, not really funner...)",
"Tastes change over time, and often those tastes associated with \"young\" people get locked into a set of ages and are just carried on through. Rock n' Roll is generally now considered something older folks listen to. But, long ago, it was considered soemthing radical and only young folks listened to it. Tastes in clothing do tend to get \"older\" but this is also a function of taste. Most of the things common to a generation are created during that generations teens and early twenties. \n\nCurrently thirty-forty somethings play the most video games. Younger kids are picking them up, but often not the same kinds. \n\nWho knows what kids will pick up in twenty years. ",
"Your perspective is changing. Do you remember TGIF, I know right!! ",
"It's two things, the first is fashions are changing. You look at top hats and think they were always an older person's style or white wigs and in fact they were the height of fashion even for young people, now it's...oh blast what do the young people wear these days? Eh Hardy and backwards caps. The second is that the people you identified as old are only looking older to you now as you both age so your visual clues of what old looks like is progressing while your internal view of yourself is more or less staying still except for the aha moments where you look in a mirror and say \"Where the fuck did that come from?\"",
"I think that you associate things you did as a kid as things children do, but really, you keep doing those things as you get older, and the new generations have new fads. \n\nFor example: I am 36, and all my friends still play video games and listen to rap music. As a child, I would have never expected to see full grown adults doing those things. My dad, who is 65, hunts and fishes for fun, and listens to country music, which is what he was doing 30 years ago. But he also did those things as a kid, because they didn't have video games or rap music. My friends kids are wearing skinny jeans and listening to dubstep. They will probably be doing that into their 30s, and then into their 60s. ",
"Opinion having also noticed this as well. I think its a combo of things. What we perceive as attractive matures as we do making younger generations appear too young to be as appealing as they used to be (to most). People stay indoors more often and wear more sunscreen making the aging process a bit more forgiving than it used to be. What we do as kids/teenagers are seen as things kids do only but we take some of it with us (yay video games!), making it more of a generational thing later on. Nostalgia happens to everyone but because the generations that are just starting to have these feelings (30 somethings) are more widely integrated into social media than those before them its more easily recognized by the public now than it was before.",
"It's your perspective. I'm 63, and every damn cop in the country looks like an adolescent with a gun. On the other hand, the range of beautiful women keeps increasing. (While my interest decreases.)",
"Culture changes over time. When you're young, the 'equilibrium/balance point' of the dominant culture around you is many years older than you are. But as you get older you converge on that balance point until you look around you and feel like the world seems to mostly reflect your own values. And then you diverge from it as you continue to age and you may start complaining about 'the youth of today...' \n\nIt's not that old people are acting younger. It's that your youth (that defined your values) is now shared by many more people and you feel more affinity with them. ",
"I think part of this is due to social media...follow me for a second. People in their forties and fifties are more in contact with newer fads and styles because they are plugged into FB and Twitter just like their younger counterparts. They aren't disconnected from younger social circles immediately after high school/college like they were fifty years ago. A person in their forties now has similar clothing fashions and hair styles as a person in their early twenties.\n\nAdditionally they have grown up with similar technologies and are attuned to current advances the same, or maybe more so, as younger generations. A forty year old may be more capable of affording the newest iPhone than someone starting out in their twenties. Having access to the newest, most advanced gadgets would be inspiration to stay on top of what said gadget can do. When I was younger, people twenty years older than me swore by older tech...like VHS and cassettes. Now they have the cool new stuff and know how to use it. ",
"* you are getting older, and your perspective is changing\n* adults tend to be more responsible and act more grown up around children and especially teens\n* society is becoming less formal\n* people are waiting longer to have children, and having less of them\n* every generation takes things associated with their childhood and tries to bring them into their adulthood...my dad likes to watch Bugs Bunny cartoons, I still play video game"
]
} | [] | [] | [
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[]
] |
|
4ja8zo | how can margins of error be trusted? | I am not sure how to explain this. I was recently in a wiki hole when I came across two different measurements of Pluto's diameter.
< > Current New Horizons Measurement puts Pluto at 2372±4 km
"After New Horizons measured Pluto's diameter as 2372±4 km in July 2015, it was determined that Eris is slightly smaller in diameter than Pluto.[25]"
_URL_1_
< > In 1993 Millis put it at 2306±20
"The correct interpretation of 2306 +/- 20 km is that 2306 km is the most likely value, but, within a certain range of probability, the value could be as low as 2286 or as high as 2326 km"
_URL_0_
There is clearly a conflict. What was the point of even putting a margin of error?
*edit Sources | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4ja8zo/eli5_how_can_margins_of_error_be_trusted/ | {
"a_id": [
"d34zy4j",
"d350njv"
],
"score": [
14,
5
],
"text": [
"The margin of error isn't \"We know we're only possibly wrong by this much\" it's \"This is the known accuracy of our instrument under what we believe are operational conditions.\"\n\nYou can still be wrong.",
"Physics has certain ways to calculate uncertainties such as that.\n\nLet's say you've got a ruler and you use it to measure a piece of wood. Your ruler has 1mm divisions in it, and the piece of wood comes up to the line marked \"195mm\". Now, because the smallest division your ruler has is 1mm, it could be anywhere between 194.5mm or 195.5mm. Without using a more precise tool, you can't get more accurate than that, so you record the length of your piece of wood at 195.0mm +/- 0.5mm. \n\nBut let's say you buy a new, more expensive ruler. The first thing you notice is that your old ruler was marked wrong. It should actually have said 200mm. The divisions in your new ruler are the same, so you say the length of your piece of wood is 200.0mm +/- 0.5mm. This is outside the original uncertainty in your first measurement, but that's because you had no way of knowing that it would be that inaccurate.\n\nSo yeah. In physics, uncertainties tend to be more about how good your measurement tools and techniques are. "
]
} | [] | [
"http://www.mikebrownsplanets.com/2010/11/how-big-is-pluto-anyway.html",
"https://en.wikipedia.org/wiki/Pluto#Mass_and_size"
] | [
[],
[]
] |
|
3vgiyq | in the u.s. why are female locker rooms (showers etc.) so private when male locker rooms are almost always wide open practically forcing young boys and men into group showering etc.? | I work in schools a lot, from middle schools to colleges, and I am yet to see a female locker room with the wide open, group shower situation as the boys/men. In fact, I have been in over 200 locker rooms in the past 2 years and have not seen a single locker room, for boys or adult males, that gives the privacy that females get, which is almost always private (I have seen one that isn't and this school was old as hell).
So why the hell do we do this in the US? Especially making Jr. High boys shower together side by side like it's jail. And student athletes are almost always required to shower before they leave. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3vgiyq/eli5_in_the_us_why_are_female_locker_rooms/ | {
"a_id": [
"cxnc5c2"
],
"score": [
4
],
"text": [
"As a guy who found the shower situation in highschool to be extremely awkward, I think men are just raised to be cool with it. I was never cool with it but my class mates had absolutely no problem with it. I was unaware the girls showers were different. We had a square room with shower heads lining the walls, I thought it was normal and I was the weird one for not being okay with it."
]
} | [] | [] | [
[]
] |
|
465wv3 | what will happen with opec planning to halt production? how does it affect oil prices? who is winning and losing? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/465wv3/eli5_what_will_happen_with_opec_planning_to_halt/ | {
"a_id": [
"d02p8zz",
"d03p80g"
],
"score": [
2,
2
],
"text": [
"No one is planning to halt production. Saudi Arabia and Russia have agreed to freeze production at current levels. Considering Russia is already running 100% production and Saudi Arabia is damn near 100% and neither Iraq nor Iran will agree to the freeze it is unlikely to mean much of anything.",
"Picture this oil gig as one big race, where different oil producing nations are runners.\n\nRight now, some nations are much faster than others - because they can produce at lower costs. Saudi Arabia (the Usain Bolt of oil production) and Iran (also probably very fast - and a newcomer to the race- previously kept out by sanctions, who is going to run extra hard in an effort to catch up) just about lead the pack. Also, they *really* hate each other, which means both are very keen for the other not to win and would love to see their enemy fail.\n\nBut neither of them are going to agree to slow down and allow their slower rivals to catch up and possibly overtake them. They both want other nations to drop out of the race because global interest in this race is waning (fewer people can afford to go, and people are starting to test out other sports - which may someday render the oil race obsolete). Both Saudi Arabia and Iran want fewer nations in this race, to increase their own chances.\n\nAny country that slows down (by cutting production) right now risks being left far behind - and during a similar race in the 80s this is exactly what happened to Saudi Arabia. It was part of a team (OPEC) and they all agreed to run at similar speeds, except it turned out all but the Saudis cheated, and so the Saudis were left far behind in the dust. They ran like mad to catch up, and eventually overtook the others and regained their position, at great cost (oil plunged to $10 a barrel - down from over $100).\n\nSo - no one is going to agree to a cut (they haven't actually agreed to anything in this \"historic OPEC/Russia summit\" except to \"freeze production\" at already record highs and only if Iran comes to the table. Iran has made certain comments suggesting it \"supports\" the deal, but won't participate in it - which is really just waffle. They're really just saying they don't disagree with it - and what could they do if they did? They 'welcome' the deal but have no intention to be part of it, and will not cap their own output, which is about to flood an already flooded market. So we are *firmly* on square one - and if anything we've gone backwards as it very firmly demonstrates an agreement on this is a pipe dream). Really all any of these countries agreeing to a freeze have done (and by the way they've only agreed to one if other countries agree) is rephrased \"we're not going to cut production\" and paid a bit of lip service to their competitors. Also, even if all of OPEC and Russia did freeze, that's a whisker over 50% of the global market - so if other countries don't agree to cut (and let's face it, that's not feasible) nothing useful will come of this but those countries who refuse gaining ground.\n\nCountries like Russia and Venezuela are only calling for a cut now because they are some of the slower members in this race, and are dangerously close to falling behind their break-even prices. And at the end of the day, none of that matters - because a race is a race. Saudi Arabia and Iran would be beyond stupid to slow down now. They want to win."
]
} | [] | [] | [
[],
[]
] |
||
62w1df | why aren't our pupils always dilated so that we see more all the time? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/62w1df/eli5_why_arent_our_pupils_always_dilated_so_that/ | {
"a_id": [
"dfphwys",
"dfpir6t"
],
"score": [
34,
3
],
"text": [
"Stare into a bright light. How much can you see?\n\nWhen your pupils dilate it is to allow more light into your eyes. Letting in more light in dark situations helps you see better, but letting in more light in a bright situation makes it harder to see and can damage your eyes.",
"Pupils dilate to let more light in, that only means you see more if you are in an area with dim lighting. If you are in an area with bright lighting it means you will see less because you will be blinded. "
]
} | [] | [] | [
[],
[]
] |
||
6rq8s0 | how can there be cameras with large resolutions like 42mp and be just a couple thousand dollars, yet a video camera of that resolution be $40-70,000? why does it seem to be so much more difficult to make? | I'm comparing something like the a7rii vs a RED Helium. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/6rq8s0/eli5_how_can_there_be_cameras_with_large/ | {
"a_id": [
"dl6ypte",
"dl733tn",
"dl74rv2"
],
"score": [
6,
2,
2
],
"text": [
" Take your phone into a dim room and take a picture. Now take a video. The picture will be brighter and more detailed even though it's using the exact same sensor. It requires a lot more light sensitivity to take 30 pictures a second than one picture. \n\nIt also takes a lot faster data transfer. (Even if you set your phone to save photos on an SD card, videos will still be recorded on the faster phone memory and transferred later) one photo can fit on a small memory chip and slowly transfer to the removable card. A video doesn't have that luxury because there are continual pictures coming. ",
"Sensor size isn't the most important feature of a camera. The optics and the data processing are typically more important. As evidenced by OP's question, large sensor sizes can be made relatively inexpensively but the rest of the features are costly.",
"Sensor size + quality (greatly contributes to how much light is being captured by camera), DRAM (How many frames you can shoot per second: the camera has to process the images, so you can't take 5000fps videos even if your smartphone can have a shutter speed of 1/5000s)\n\nRED is also known to be quite expensive"
]
} | [] | [] | [
[],
[],
[]
] |
|
au1umt | why dont car batteries need recharging? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/au1umt/eli5_why_dont_car_batteries_need_recharging/ | {
"a_id": [
"eh4yuig",
"eh4yye9",
"eh4yz41",
"eh4z2sd"
],
"score": [
5,
2,
2,
2
],
"text": [
"The alternator uses engine power to charge it while you’re driving. So it is being recharged, but you don’t need to plug it in. ",
"They actually do have to be recharged, and they get recharged while the car is running by a belt moved by what's called the \"alternator\". \n\nHere's a video made by an overly excited guy who does a really great job explaining everything in more detail: _URL_0_",
"The alternator recharged them but it works by converting the engines movement into electricity to charge the battery. Which is why the battery can die if you leave your lights on while not moving",
"The engine constantly charges them while driving along. As long as you have a decent battery and don't leave electrics running for long periods while stationary that's enough to keep it fully charged. "
]
} | [] | [] | [
[],
[
"https://www.youtube.com/watch?v=nuLl_Z9_T9E"
],
[],
[]
] |
||
2lnwvz | why are humans and most other species dependant on water? is it just coincidence that 70% of earth is covered in it? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2lnwvz/eli5_why_are_humans_and_most_other_species/ | {
"a_id": [
"clwj3y9",
"clwjasb",
"clwqoyo",
"clwqtwr",
"clwr7ga",
"clx84n9"
],
"score": [
3,
25,
2,
5,
3,
2
],
"text": [
"If 70% of earth was covered in liquid methane, it's likely we would have evolved to drink methane.",
"We need a liquid that can act as a medium for our bodies to do all the important things it does. \n\nWater is an easily accessible one that is made up of two commonly found atoms. It's electrically neutral, non corrosive/toxic/flammable and doesn't react with a lot of stuffs. It's melting and boiling temperature range is just right to not damage the structure of cells at the distance that the Earth is from the sun. \n\nThere is no other liquid that fulfills all of the aforementioned criteria. ",
"Evolution. If it were another liquid substance primarily on earth perhaps we'd require that. ",
"Our bodies are basically space ships for single celled organisms that are supposed to live in water.",
"it's important to understand that we evolved on this planet. evolution will increase our ability to survive our environment, and the environment happens to be water-rich. in simpler terms, we (living beings) use water because it's abundant",
"Hydrogen is abundant in our galaxy, the Milky Way and our sun is mostly and produces lots and lots of the stuff, paired with two oxygen atoms, another abundant element, creates a polar molecule with properties that are convenient for reactions and stuff due to its bent structure, electron configuration of the molecule (I forget the term for that), mass, etc. \n\nWater is especially handy in keeping things alive because of its chemistry and reactivity. Life anywhere in any case would require consistent conditions, and water is especially good at it because it takes a decent amount of energy to increase the energy between molecules and raise its temperature (specific heat capacity). Water is also pretty light in mass, so for things like a brain or veins water is not extremely large or massive, so it won't clog or land in a spot. Water is also polar, meaning it has a difference in positive charge and negative charge and it can attract or separate other polar molecules, which is useful for rxns."
]
} | [] | [] | [
[],
[],
[],
[],
[],
[]
] |
||
1ukwox | why do middle/high schools start so early when students are going through growth spurts and need the most sleep? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1ukwox/eli5_why_do_middlehigh_schools_start_so_early/ | {
"a_id": [
"cej3xit",
"cej49wr"
],
"score": [
4,
9
],
"text": [
"It's mostly for extra-curricular activities. Most sports need reasonable daylight hours, and it would be tough to get faculty to work later through normal dinner / family hours.\n\nIt students need more sleep, they can go to bed earlier.",
"I was once told that elementary, middle and high school start time were offset so they could use the same buses for all three. \n\nAs to why the older students get the earliest start? I'd guess it's because older students can take care of themselves for the time between when they get off school and their parents get off work. "
]
} | [] | [] | [
[],
[]
] |
||
a4nmr5 | how do you order complex numbers? | More specifically:
If imaginary numbers don't belong to the real number line, does it make sense to say 3i > 2i? This is talking about pure imaginary numbers, but I extend the question further with ''mixed'' complex numbers. Does it make sense to say 2+i < 2+3i? Or 3+i > 2+i? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/a4nmr5/eli5_how_do_you_order_complex_numbers/ | {
"a_id": [
"ebg1fj9",
"ebg3gvj",
"ebg50ya"
],
"score": [
3,
2,
7
],
"text": [
"There's no total order for complex numbers, at least not one that is consistent with the arithmetic operations on the complex numbers. ",
"I suppose if you want order, the magnitude would help not only with purely imaginary numbers following the real numbers (i, 2i, 3i...) But also with complex numbers with real and imaginary parts. ",
"Only one-dimensional quantities have the property of 'order' you're talking about.\n\nAs a result, if you want to 'order' a multi-dimensional value you first need to project it into a single dimension. The common ways to do this for complex numbers would be to either take the magnitude (distance away from the origin) or the angle (rotation off the x-axis)."
]
} | [] | [] | [
[],
[],
[]
] |
|
1yuuzq | what is groundhog day and why is it important? (i'm from the uk) | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1yuuzq/eli5_what_is_groundhog_day_and_why_is_it/ | {
"a_id": [
"cfnyx2e",
"cfnz2c6"
],
"score": [
5,
3
],
"text": [
"It's February 2nd. If the groundhog sees its shadow (i.e. if it's sunny), then there will be six more weeks of winter, otherwise spring will come early. It is not important whatsoever.",
"Groundhog day is a movie directed by Harold Ramis (who died today) and stars Bill Murray (Reddit Royalty) and also has Stephen Tobolowsky in it who recently did a AMA. It is said to be \"culturally, historically, or aesthetically significant\". "
]
} | [] | [] | [
[],
[]
] |
||
1sxrw4 | why did it snow recently in the middle east and why does it happen so rarely? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1sxrw4/eli5eli5_why_did_it_snow_recently_in_the_middle/ | {
"a_id": [
"ce29xej",
"ce2a8mg",
"ce2azon"
],
"score": [
3,
2,
3
],
"text": [
"Deserts aren't big on precipitation of any kind. They also play host to violent temperature extremes. Below zero temperatures in winter nights contrast with sun hot enough to kill. The cold is just as bad for snow as the heat, as you need water in the air to form the snow, before it can fall.",
"Just a minor point: The Middle East isn't one big desert. It's a huge area with many different climates. ",
"On Earth we live at the bottom of a soup of gases, which are constantly moving in all directions, this is what makes up the atmosphere. The interaction between warm tropical air, the mid-latitude air (medium temperature air) and cold arctic air is what drives most of the weather in the Northern Hemisphere (top half of the planet). When the different sections of air meet, strong winds high above us called *jet streams* are created. \n\nThe jet stream does not move in a straight line. It goes up and down like the humps of a camel. The air can be pulled from different regions of the world because of the jet stream. When cold air was drawn to Western Europe because of changes to the jet stream, the right side of the big lump of cold polar air hit the Middle East region. Cold temperature and rain clouds passing by meant that higher regions encountered snow and lower regions had heavy rain."
]
} | [] | [] | [
[],
[],
[]
] |
||
5nz8cg | if someone really did have multiple personalities and each personality had no idea what the others do, what would happen if one of the personalities murdered someone or committed another terrible crime? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5nz8cg/eli5if_someone_really_did_have_multiple/ | {
"a_id": [
"dcfdubs",
"dcff3hs"
],
"score": [
9,
2
],
"text": [
"Realistically, if we're assuming this is in the United States, this condition would be brought forward and evaluated by a designated mental health official. If it was determined that the crime was committed as a result of these personalities, the individual would likely get to plead insanity and be admitted to a mental hospital for rehabilitation and treatment.",
"This has been answered fairly well by others, but for interest sake: \nThis condition is extremely rare. While dissociative experiences are common, experienced by more than half of the population at some point, the symptoms are vaguely experienced and poorly recalled (perhaps like when you auto-pilot your drive home and can't remember most of the drive and pray you didn't break any laws on the way). Many or most dissociative episodes are fleeting or do not cause significant distress or dysfunction, and therefore do not warrant a specific DSM-5 diagnosis. \n\nAccording to the DSM-5 (latest diagnostic book for psychiatric disorders), it is now dissociative identity disorder. To be diagnosed you need: two or more distinct personalities with noticeable shifts in memories, behaviour, and perceptions of reacting to self and the environment that are persistent. What is new is that the patient can self proclaim this shift rather than if needing to be reported by a third person. The difference between the above common fleeting episode would be the persistence of the different personality types. The second criteria is amnesia must occur, defined as gaps in the recall of everyday events, important personal information and/or traumatic events. The events cannot be brought on by drugs or alcohol, must not be related to culture or religion, and must cause distress. \n"
]
} | [] | [] | [
[],
[]
] |
||
8j7jlm | what is that pressure sensation we feel in our chest when we get a spike of anxiety? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/8j7jlm/eli5_what_is_that_pressure_sensation_we_feel_in/ | {
"a_id": [
"dyxir0t",
"dyxku7f",
"dyxm77g"
],
"score": [
17,
4,
3
],
"text": [
"I believe it is adrenaline, the fight or flight reflex. But modern man doesn’t necessarily have the same fight or flight reflex as our ancestors - it’s more fight, flight or freeze. Most people freeze but the body still release the adrenaline used from the original fight or flight.",
"And in a real fight or flight scenario your last concern is going to be chest pain, it will be survival. After that your body will notice it’s in pain. Have you ever heard of someone chopping their finger off but not noticing? That’s because of the adrenaline.",
"Its literally blood being shunted to vital areas of the body as part of the fight or flight response, which is the body's automatic response to fear. Your sympathetic nervous system signals your heart and lungs through hormones like adrenaline to begin working harder to supply you with extra oxygen in important areas, just in case you actually need it to defend yourself or run away. Your blood pressure, pulse, and respirations will usually measure higher (sometimes dramatically) when you are scared or anxious. You may, in addition to the pressure in your chest, feel things like a cold knot in your stomach (from blood leaving the digestive system), jitteriness or shaking, and/or sweating."
]
} | [] | [] | [
[],
[],
[]
] |
||
662tph | why are people so polarised? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/662tph/eli5_why_are_people_so_polarised/ | {
"a_id": [
"dgf3wct",
"dgf8bl9"
],
"score": [
2,
2
],
"text": [
"In my opinion, that polarization has been there. The difference is that now everyone has an anonmomous voice and the more extreme elements are the ones that get all the attention. Not every Christian wants to kill abortion doctors. Not every Liberal is a Sociallist. Most people just want to live their lives. ",
"Are they? One argument is that re-sorting of political parties has led to the appearance of greater polarization. Actual political attitudes may not have shifted that dramatically. \n\n_URL_0_\n\n"
]
} | [] | [] | [
[],
[
"https://www.washingtonpost.com/news/monkey-cage/wp/2014/06/23/americans-have-not-become-more-politically-polarized/"
]
] |
||
anfgg8 | how does removing a storage device from a computer too soon damage the files on the storage device? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/anfgg8/eli5_how_does_removing_a_storage_device_from_a/ | {
"a_id": [
"efsw72o",
"efsweie"
],
"score": [
3,
5
],
"text": [
"The computer could be in the middle of writing to the device and you'd get corrupted stuff. Especially bad if it was updating the file index which tells the computer where everything is on the drive.\n\nGenerally if you've written your files and give it maybe a second or two more it's perfectly safe. ",
"Imagine you are drinking water out of a cup through a straw and pull the straw out of the cup mid sip, you wont get all the water out. Now imagine you have different cups with different liquids. If you put the straw in the wrong cup, you might get koolaid instead of water. No big deal. However, you could also put it into poison and die. \n\nWith respect to the SD card or flash drive, if you pull it out while it is in the middle of writing data, you run the risk of corrupting the file because the transfer was incomplete because the device was removed. \n\nI am sure this is a terrible explanation, so I will wait until a better one comes along, lol. \n\n"
]
} | [] | [] | [
[],
[]
] |
|
53sqz1 | what would happen if the world were to hit the reset button on the global economy? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/53sqz1/eli5what_would_happen_if_the_world_were_to_hit/ | {
"a_id": [
"d7vvvxb",
"d7vvxct",
"d7vvxef",
"d7vy6m6"
],
"score": [
8,
10,
2,
2
],
"text": [
"If everyone agreed to this, it would be very bad going forward. It would mean all the bonds issued by all countries would have a value of zero, which would destroy retirements, investments, pensions, etc.\n\nA countries currency and bonds are tied to their credit rating. If we can just \"reset\" whenever we want, then what is it's value? As we can see from above, the reset causes a lose of value that is felt by everyone.",
"Nations don't owe each other. If they did the debts would just cancel each other out as logic dictates.\n\nIt's the people the governments take loans from. Suddenly saying \"lol no, you're not getting your money back\" would be a reset button for economics just like a nuke is a reset button for a city, when suddenly millions of investors are left high and dry.",
"Everyone would die. One person's debt (a liability) is another person's income (an asset). If they were all wiped out economy would cease to function. That would mean that businesses wouldn't be able to get what they need.",
"Have you SEEN Mr. Robot?"
]
} | [] | [] | [
[],
[],
[],
[]
] |
||
85759g | if your neurones make a new connection when you learn something new, would it be possible to run out of space in your brain for new connections to form. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/85759g/eli5_if_your_neurones_make_a_new_connection_when/ | {
"a_id": [
"dvv7czo",
"dvv9zff"
],
"score": [
6,
2
],
"text": [
"No, basically a neuron is capable of thousands of potential connection to other neurons, your brain is formed of trillions of these neural pathways (synapses) and they do strengthen and weaken over time. Your brain cleans out old or unused pathways as it develops more. The potential for creating new pathways is always extremely high in our brain and we don't really know the upper limit capacity, but even if you could prolong human life by a significant factor, your brain would never reach full capacity as it would be losing connections as well as creating new ones.\n\nSometimes when you try to remember something and can't do it right away, then it comes back to you later, it's in essence your brain found a new pathway to old information because the old pathway to it was lost. This is an example of how you lose connections, but because there's trillions of connections there is almost always a backdoor to certain information.",
"Applaud the above. \n\nAnother way to visualize it:\n\nTack 2doz pins spaced out on a board. \nTie a string to one and wrap it around a second pin. Then a third. \nTake another string and do the same. \nYou can continue to add connections (strings) without changing the number of pins or space on the board. "
]
} | [] | [] | [
[],
[]
] |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.