task
stringlengths 42
101
| input
stringlengths 0
1.28k
| output
stringlengths 1
1.25k
| options
sequence | pageTitle
stringlengths 28
119
| outputColName
stringlengths 1
130
| url
stringlengths 52
146
| wdcFile
stringlengths 71
74
|
---|---|---|---|---|---|---|---|
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Turn this feature on to block any pop-up windows from being displayed while browsing. [Setting] | Block Pop-ups | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Automatically removes items from the download list, stops Safari from letting AutoFill save information used to complete your entries in the search or address fields as you type, and doesn't save browsing history information. [Setting] | Do Not Track | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Specify whether to accept cookies only from sites you've visited, or to never or always block them. [Setting] | Block Cookies | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Turn on features to enable search engine suggested sites or to let Safari preload top hit sites. [Setting] | Smart Search Field | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Alerts you when you're visiting what could be a fraudulent website. [Setting] | Fraudulent Website Warning | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Tap to clear the history of sites you've visited online in the browser. [Setting] | Clear History | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Clear any cookies that have been created on your iPad. [Setting] | Clear Cookies and Data | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
35da2423_mies_Cheat_Sheet___For_Dummies__Setting | [Description] Displays stored data from websites you've visited and allows you to activate a Debug Console, useful to advanced users. [Setting] | Advanced | [] | iPad All-in-One For Dummies Cheat Sheet - For Dummies | Setting | http://www.dummies.com/how-to/content/ipad-allinone-for-dummies-cheat-sheet.html?cid=RSS_DUMMIES2_CONTENT | 31/1438042988924.75_20150728002308-00306-ip-10-236-191-2_415488831_0.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The abbreviation or code used to designate the stock. [Data Point] | Ticker symbol | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The price at which the last shares of the stock traded hands. [Data Point] | Last sale | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The time of the day the quote information is based on. [Data Point] | Time | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The price the stock closed at in the last trading session. [Data Point] | Previous close | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] Tells you how much the stock price has changed from the previous close. The change is usually given as a dollar amount and percentage. [Data Point] | Net change | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The price a buyer is willing to pay for a share of the stock. [Data Point] | Bid | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The price a seller is willing to accept for a share of the stock. [Data Point] | Ask | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] Tells you where the stock trades. It might be the New York Stock Exchange, NASDAQ, American Stock Exchange, or markets like the Pink Sheets. [Data Point] | Market | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The number of shares that have traded hands during the day. [Data Point] | Volume | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The number of shares that trade hands among investors, on average, over a period of time (such as a quarter). [Data Point] | Average daily volume | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The highest level the stock traded at during the day. [Data Point] | Today’s high | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The lowest level the stock traded at during the day. [Data Point] | Today’s low | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The highest the stock’s price has been over the past year. [Data Point] | 52-week high | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The lowest the stock’s price has been over the past year. [Data Point] | 52-week low | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The number of shares available for shareholders to buy and sell. [Data Point] | Shares outstanding | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The total value of the company based on the current stock price. [Data Point] | Market capitalization | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
f1d78699_ine_Stock_Quotes___For_Dummies_ta_You_Get_from_Quote_Services_Data_Point | [What It Means] The price-to-earnings ratio. A way to determine whether a stock is cheap or expensive. [Data Point] | P/E ratio | [] | The Information You Get from Online Stock Quotes - For Dummies | Data Point | http://www.dummies.com/how-to/content/the-information-you-get-from-online-stock-quotes.navId-406879.html | 31/1438042988924.75_20150728002308-00089-ip-10-236-191-2_417422574_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The product vision statement helps unify the project team's definition of product goals, mitigating the risk of misunderstandings about what the product needs to accomplish. While creating the product vision, the project team may consider risk on a very high level, in conjunction with the marketplace, customers, and organizational strategy. [Artifact or Meeting] | Product vision | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The product roadmap provides a visual overview of the project's requirements and priorities. This visual overview allows the project team to quickly identify gaps in requirements and incorrectly prioritized requirements. [Artifact or Meeting] | Product roadmap | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The product backlog is a tool for accommodating change within the project. Being able to add changes to the product backlog and reprioritize requirements regularly helps turn the traditional risk associated with scope changes into a way to create a better product. Keeping the requirements and the priorities on the product backlog current helps ensure that the development team works on the most important requirements at the right time. [Artifact or Meeting] | Product backlog | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The scrum team discusses risks to the release and how to mitigate those risks. Risk discussions in the release planning meeting should be high-level and relate to the release as a whole. Save risks to individual requirements for the sprint planning meetings. [Artifact or Meeting] | Release planning | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The scrum team discusses risks to the specific requirements and tasks in the sprint and how to mitigate those risks. Risk discussions during sprint planning can be done in depth, but should only relate to the current sprint. [Artifact or Meeting] | Sprint planning | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The burndown chart on the sprint backlog provides a quick view of the sprint status. This quick view helps the scrum team manage risks to the sprint as they arise and minimize impact by addressing problems immediately. [Artifact or Meeting] | Sprint backlog | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] During each daily scrum, development team members discuss roadblocks or impediments that may be or become risks to the project. Talking about roadblocks every day gives the development team and the scrum master the chance to mitigate those risks immediately. [Artifact or Meeting] | Daily scrum | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The task board provides an unavoidable view of the sprint status, allowing the scrum team to catch risks to the sprint and manage them right away. [Artifact or Meeting] | Task board | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The scrum team regularly ensures that the product meets stakeholders' expectations. The sprint review also provides opportunities for stakeholders to discuss changes to the product to accommodate changing business needs. Both features of the sprint review help manage the risk of getting to the end of a project with the wrong product. [Artifact or Meeting] | Sprint review | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
d4a110c7_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Artifact_or_Meeting | [Role in Risk Management] The scrum team discusses issues with the past sprint and identifies which of those issues may be risks in future sprints. The development team needs to determine ways to prevent those risks from becoming problems again. [Artifact or Meeting] | Sprint retrospective | [
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"v",
"i",
"s",
"i",
"o",
"n"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"r",
"o",
"a",
"d",
"m",
"a",
"p"
],
[
"P",
"r",
"o",
"d",
"u",
"c",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"R",
"e",
"l",
"e",
"a",
"s",
"e",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"p",
"l",
"a",
"n",
"n",
"i",
"n",
"g"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"b",
"a",
"c",
"k",
"l",
"o",
"g"
],
[
"D",
"a",
"i",
"l",
"y",
" ",
"s",
"c",
"r",
"u",
"m"
],
[
"T",
"a",
"s",
"k",
" ",
"b",
"o",
"a",
"r",
"d"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"v",
"i",
"e",
"w"
],
[
"S",
"p",
"r",
"i",
"n",
"t",
" ",
"r",
"e",
"t",
"r",
"o",
"s",
"p",
"e",
"c",
"t",
"i",
"v",
"e"
]
] | How to Manage Risk within Agile Management - For Dummies | Artifact or Meeting | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.navId-410853.html | 31/1438042989018.48_20150728002309-00284-ip-10-236-191-2_411194800_1.json |
5d4c836c_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Emissions_Pollutants | [Energy Source] Biofuel [Pro] Easily grown anywhere [Con] Competes with food crops [Emissions/Pollutants] | Particulates (small particles of solid or liquid material suspended in the air) | [] | The Search for Alternative Energy - For Dummies | Emissions/Pollutants | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
5d4c836c_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Emissions_Pollutants | [Energy Source] Water [Pro] Endlessly renewable, clean [Con] Some habitat destruction [Emissions/Pollutants] | None | [] | The Search for Alternative Energy - For Dummies | Emissions/Pollutants | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
5d4c836c_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Emissions_Pollutants | [Energy Source] Geothermal [Pro] Low cost after installation [Con] Geographically limited [Emissions/Pollutants] | None | [] | The Search for Alternative Energy - For Dummies | Emissions/Pollutants | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
5d4c836c_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Emissions_Pollutants | [Energy Source] Wind [Pro] Low cost to install [Con] Geographically limited [Emissions/Pollutants] | Potential danger to flying organisms (birds, bats, and butterflies) | [] | The Search for Alternative Energy - For Dummies | Emissions/Pollutants | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
5d4c836c_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Emissions_Pollutants | [Energy Source] Solar [Pro] Endlessly renewable [Con] High initial costs [Emissions/Pollutants] | None | [] | The Search for Alternative Energy - For Dummies | Emissions/Pollutants | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
5d4c836c_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Emissions_Pollutants | [Energy Source] Fuel cells [Pro] Very efficient, no pollution [Con] Difficult storage and transport [Emissions/Pollutants] | None (if fossil fuels aren’t needed to process and transport them) | [] | The Search for Alternative Energy - For Dummies | Emissions/Pollutants | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
42b789a9_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] RAW [Description] | Sequence format that doesn't contain any header. Spaces and numbers are usually tolerated. | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 31/1438042988924.75_20150728002308-00196-ip-10-236-191-2_416129188_0.json |
42b789a9_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] FASTA [Description] | This is the default format. Sequence format that contains a header line and the sequence: >name AGCTGTGTGGGTTGGTGGGTT | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 31/1438042988924.75_20150728002308-00196-ip-10-236-191-2_416129188_0.json |
42b789a9_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] PIR [Description] | Sequence format that's similar to FASTA but less common | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 31/1438042988924.75_20150728002308-00196-ip-10-236-191-2_416129188_0.json |
42b789a9_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] MSF [Description] | Multiple sequence alignment format | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 31/1438042988924.75_20150728002308-00196-ip-10-236-191-2_416129188_0.json |
42b789a9_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] CLUSTAL [Description] | Multiple sequence alignment format (works with T-Coffee) | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 31/1438042988924.75_20150728002308-00196-ip-10-236-191-2_416129188_0.json |
42b789a9_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] TXT [Description] | Text format | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 31/1438042988924.75_20150728002308-00196-ip-10-236-191-2_416129188_0.json |
42b789a9_mies_Cheat_Sheet___For_Dummies__Description | [Format Name] GIF, JPEG, PNG, PDF [Description] | Graphic formats. Do not use them to store important information. | [] | Bioinformatics For Dummies Cheat Sheet - For Dummies | Description | http://www.dummies.com/how-to/content/bioinformatics-for-dummies-cheat-sheet.html | 31/1438042988924.75_20150728002308-00196-ip-10-236-191-2_416129188_0.json |
caa4ae54_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Energy_Source | [Pro] Easily grown anywhere [Con] Competes with food crops [Emissions/Pollutants] Particulates (small particles of solid or liquid material suspended in the air) [Energy Source] | Biofuel | [
[
"B",
"i",
"o",
"f",
"u",
"e",
"l"
],
[
"W",
"a",
"t",
"e",
"r"
],
[
"G",
"e",
"o",
"t",
"h",
"e",
"r",
"m",
"a",
"l"
],
[
"W",
"i",
"n",
"d"
],
[
"S",
"o",
"l",
"a",
"r"
],
[
"F",
"u",
"e",
"l",
" ",
"c",
"e",
"l",
"l",
"s"
]
] | The Search for Alternative Energy - For Dummies | Energy Source | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
caa4ae54_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Energy_Source | [Pro] Endlessly renewable, clean [Con] Some habitat destruction [Emissions/Pollutants] None [Energy Source] | Water | [
[
"B",
"i",
"o",
"f",
"u",
"e",
"l"
],
[
"W",
"a",
"t",
"e",
"r"
],
[
"G",
"e",
"o",
"t",
"h",
"e",
"r",
"m",
"a",
"l"
],
[
"W",
"i",
"n",
"d"
],
[
"S",
"o",
"l",
"a",
"r"
],
[
"F",
"u",
"e",
"l",
" ",
"c",
"e",
"l",
"l",
"s"
]
] | The Search for Alternative Energy - For Dummies | Energy Source | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
caa4ae54_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Energy_Source | [Pro] Low cost after installation [Con] Geographically limited [Emissions/Pollutants] None [Energy Source] | Geothermal | [
[
"B",
"i",
"o",
"f",
"u",
"e",
"l"
],
[
"W",
"a",
"t",
"e",
"r"
],
[
"G",
"e",
"o",
"t",
"h",
"e",
"r",
"m",
"a",
"l"
],
[
"W",
"i",
"n",
"d"
],
[
"S",
"o",
"l",
"a",
"r"
],
[
"F",
"u",
"e",
"l",
" ",
"c",
"e",
"l",
"l",
"s"
]
] | The Search for Alternative Energy - For Dummies | Energy Source | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
caa4ae54_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Energy_Source | [Pro] Low cost to install [Con] Geographically limited [Emissions/Pollutants] Potential danger to flying organisms (birds, bats, and butterflies) [Energy Source] | Wind | [
[
"B",
"i",
"o",
"f",
"u",
"e",
"l"
],
[
"W",
"a",
"t",
"e",
"r"
],
[
"G",
"e",
"o",
"t",
"h",
"e",
"r",
"m",
"a",
"l"
],
[
"W",
"i",
"n",
"d"
],
[
"S",
"o",
"l",
"a",
"r"
],
[
"F",
"u",
"e",
"l",
" ",
"c",
"e",
"l",
"l",
"s"
]
] | The Search for Alternative Energy - For Dummies | Energy Source | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
caa4ae54_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Energy_Source | [Pro] Endlessly renewable [Con] High initial costs [Emissions/Pollutants] None [Energy Source] | Solar | [
[
"B",
"i",
"o",
"f",
"u",
"e",
"l"
],
[
"W",
"a",
"t",
"e",
"r"
],
[
"G",
"e",
"o",
"t",
"h",
"e",
"r",
"m",
"a",
"l"
],
[
"W",
"i",
"n",
"d"
],
[
"S",
"o",
"l",
"a",
"r"
],
[
"F",
"u",
"e",
"l",
" ",
"c",
"e",
"l",
"l",
"s"
]
] | The Search for Alternative Energy - For Dummies | Energy Source | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
caa4ae54_ternative_Energy___For_Dummies_Alternative_Energy_Resources_Energy_Source | [Pro] Very efficient, no pollution [Con] Difficult storage and transport [Emissions/Pollutants] None (if fossil fuels aren’t needed to process and transport them) [Energy Source] | Fuel cells | [
[
"B",
"i",
"o",
"f",
"u",
"e",
"l"
],
[
"W",
"a",
"t",
"e",
"r"
],
[
"G",
"e",
"o",
"t",
"h",
"e",
"r",
"m",
"a",
"l"
],
[
"W",
"i",
"n",
"d"
],
[
"S",
"o",
"l",
"a",
"r"
],
[
"F",
"u",
"e",
"l",
" ",
"c",
"e",
"l",
"l",
"s"
]
] | The Search for Alternative Energy - For Dummies | Energy Source | http://www.dummies.com/how-to/content/the-search-for-alternative-energy.navId-813972.html | 31/1438042989018.48_20150728002309-00191-ip-10-236-191-2_429928830_1.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] About [Description] | Shows information about downloaded content, apps, memory, iPhone serial number and model, and your Wi-Fi and Bluetooth addresses, plus support, and legal and regulatory jargon. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Software Update [Description] | Use this setting to check for available updates to iOS via iCloud. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Usage [Description] | Check the items that are backed up to iCloud and buy additional storage. Also turn on the display in the status bar for indicating the percentage of your battery power available. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Siri [Description] | Turn the Siri personal assistant feature on or off, set the language to be used, and chose to have Voice Feedback and Raise to Speak settings on or off. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Cellular [Description] | Choose to turn cellular data off so you only download data via available Wi-Fi. Turn LTE on or off, choose Roaming options, activate your Personal Hotspot, and choose which apps to use cellular data from. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] VPN [Description] | Configure and turn on and off virtual private networks (VPN). | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] iTunes Wi-Fi Sync [Description] | Sync wirelessly with the copy of iTunes on a nearby computer when connected to a Wi-Fi network. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Spotlight Search [Description] | Access settings for what types of content the iPhone search feature returns in search results. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Auto-Lock [Description] | Set the amount of time for inactivity at which iPhone automatically locks the screen. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Passcode Lock [Description] | Set a passcode and turn the feature on to require a passcode to unlock iPhone. Set iPhone to erase all data after ten failed attempts to enter the correct passcode. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Restrictions [Description] | Set restrictions on Safariand iTunes, as well as restrict installation of applications and location services. Specify allowed content for music, podcasts, movies, TV shows, and apps. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Date & Time [Description] | Choose 24-hour time and a time zone and set the correct date and time. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Keyboard [Description] | Set keyboard correction features such as Auto-Capitalization and Check Spelling. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] International [Description] | Specify the language for onscreen information and keyboards. Choose a region format for date, time, and phone numbers. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Accessibility [Description] | Set features for using an iPhone for people with visual, hearing, or dexterity challenges. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
e6ef7e9c_General_Settings___For_Dummies__Description | [Setting] Reset [Description] | Reset all settings or selected settings, such as network or keyboard, to factory defaults. | [] | What You Can Do with iPhone 5 General Settings - For Dummies | Description | http://www.dummies.com/how-to/content/what-you-can-do-with-iphone-5-general-settings.html | 31/1438042988924.75_20150728002308-00312-ip-10-236-191-2_414292090_0.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Product vision [Role in Risk Management] | The product vision statement helps unify the project team's definition of product goals, mitigating the risk of misunderstandings about what the product needs to accomplish. While creating the product vision, the project team may consider risk on a very high level, in conjunction with the marketplace, customers, and organizational strategy. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Product roadmap [Role in Risk Management] | The product roadmap provides a visual overview of the project's requirements and priorities. This visual overview allows the project team to quickly identify gaps in requirements and incorrectly prioritized requirements. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Product backlog [Role in Risk Management] | The product backlog is a tool for accommodating change within the project. Being able to add changes to the product backlog and reprioritize requirements regularly helps turn the traditional risk associated with scope changes into a way to create a better product. Keeping the requirements and the priorities on the product backlog current helps ensure that the development team works on the most important requirements at the right time. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Release planning [Role in Risk Management] | The scrum team discusses risks to the release and how to mitigate those risks. Risk discussions in the release planning meeting should be high-level and relate to the release as a whole. Save risks to individual requirements for the sprint planning meetings. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Sprint planning [Role in Risk Management] | The scrum team discusses risks to the specific requirements and tasks in the sprint and how to mitigate those risks. Risk discussions during sprint planning can be done in depth, but should only relate to the current sprint. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Sprint backlog [Role in Risk Management] | The burndown chart on the sprint backlog provides a quick view of the sprint status. This quick view helps the scrum team manage risks to the sprint as they arise and minimize impact by addressing problems immediately. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Daily scrum [Role in Risk Management] | During each daily scrum, development team members discuss roadblocks or impediments that may be or become risks to the project. Talking about roadblocks every day gives the development team and the scrum master the chance to mitigate those risks immediately. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Task board [Role in Risk Management] | The task board provides an unavoidable view of the sprint status, allowing the scrum team to catch risks to the sprint and manage them right away. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Sprint review [Role in Risk Management] | The scrum team regularly ensures that the product meets stakeholders' expectations. The sprint review also provides opportunities for stakeholders to discuss changes to the product to accommodate changing business needs. Both features of the sprint review help manage the risk of getting to the end of a project with the wrong product. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
248cc203_Agile_Management___For_Dummies__Project_Risk_Management_Tools_Role_in_Risk_Management | [Artifact or Meeting] Sprint retrospective [Role in Risk Management] | The scrum team discusses issues with the past sprint and identifies which of those issues may be risks in future sprints. The development team needs to determine ways to prevent those risks from becoming problems again. | [] | How to Manage Risk within Agile Management - For Dummies | Role in Risk Management | http://www.dummies.com/how-to/content/how-to-manage-risk-within-agile-management.html | 31/1438042989018.48_20150728002309-00211-ip-10-236-191-2_417748300_1.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+C [Function] | Copy | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+X [Function] | Cut | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+F [Function] | Find | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+G [Function] | Go To | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] F1 [Function] | Help | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+K [Function] | Hyperlink | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+N [Function] | New | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+O [Function] | Open | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+V [Function] | Paste | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+P [Function] | Print | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+H [Function] | Replace | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+S [Function] | Save | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+A [Function] | Select All | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] F7 [Function] | Spell Check | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+Z [Function] | Undo | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
9d1367a4_yboard_Shortcuts___For_Dummies__Function | [Keystroke] Ctrl+Y [Function] | Redo | [] | Microsoft Office 2013 Keyboard Shortcuts - For Dummies | Function | http://www.dummies.com/how-to/content/microsoft-office-2013-keyboard-shortcuts.navId-815724.html | 31/1438042989018.48_20150728002309-00167-ip-10-236-191-2_410642356_0.json |
c4767415_mies_Cheat_Sheet___For_Dummies__Symptom_s_ | [Possible Cause] Injury [Steps to Perform] Apply pressure; call vet [Symptom(s)] | Bleeding | [] | Horses For Dummies Cheat Sheet - For Dummies | Symptom(s) | http://www.dummies.com/how-to/content/horses-for-dummies-cheat-sheet.navId-323762.html | 31/1438042988924.75_20150728002308-00208-ip-10-236-191-2_415744892_0.json |
c4767415_mies_Cheat_Sheet___For_Dummies__Symptom_s_ | [Possible Cause] Severe infection or bladder injury [Steps to Perform] Call vet immediately [Symptom(s)] | Blood in urine | [] | Horses For Dummies Cheat Sheet - For Dummies | Symptom(s) | http://www.dummies.com/how-to/content/horses-for-dummies-cheat-sheet.navId-323762.html | 31/1438042988924.75_20150728002308-00208-ip-10-236-191-2_415744892_0.json |
c4767415_mies_Cheat_Sheet___For_Dummies__Symptom_s_ | [Possible Cause] Choking [Steps to Perform] Horse can breathe, but call vet immediately [Symptom(s)] | Coughing and salivating with head down as food exits the mouth | [] | Horses For Dummies Cheat Sheet - For Dummies | Symptom(s) | http://www.dummies.com/how-to/content/horses-for-dummies-cheat-sheet.navId-323762.html | 31/1438042988924.75_20150728002308-00208-ip-10-236-191-2_415744892_0.json |
c4767415_mies_Cheat_Sheet___For_Dummies__Symptom_s_ | [Possible Cause] Severe sickness [Steps to Perform] Call vet immediately [Symptom(s)] | Inability to stand; staggering | [] | Horses For Dummies Cheat Sheet - For Dummies | Symptom(s) | http://www.dummies.com/how-to/content/horses-for-dummies-cheat-sheet.navId-323762.html | 31/1438042988924.75_20150728002308-00208-ip-10-236-191-2_415744892_0.json |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.