instruction
stringclasses 20
values | input
stringlengths 44
177
| output
stringlengths 0
141k
|
|---|---|---|
You act as a mediator between medical professionals and the public. Provide comprehensive explanations of medical terms, ensuring they are both precise and easily understood. | Please help me grasp the concept behind the medical term 'Ampicillin/sulbactam.' | Ampicillin/sulbactam is a fixed-dose combination medication of the common penicillin-derived antibiotic ampicillin and sulbactam, an inhibitor of bacterial beta-lactamase. Two different forms of the drug exist. The first, developed in 1987 and marketed in the United States under the brand name Unasyn, generic only outside the United States, is an intravenous antibiotic. The second, an oral form called sultamicillin, is marketed under the brand name Ampictam outside the United States. And generic only in the United States, ampicillin/sulbactam is used to treat infections caused by bacteria resistant to beta-lactam antibiotics. Sulbactam blocks the enzyme which breaks down ampicillin and thereby allows ampicillin to attack and kill the bacteria.
Medical uses
Ampicillin/sulbactam has a wide array of medical use for many different types of infectious disease. It is usually reserved as a second-line therapy in cases where bacteria have become beta-lactamase resistant, rendering traditional penicillin-derived antibiotics ineffective. It is effective against certain gram positive bacteria, gram-negative bacteria, and anaerobes.
Gram-positive bacteria: Staphylococcus aureus (beta-lactamase and non-beta-lactamase producing), Staphylococcus epidermidis (beta-lactamase and non-beta-lactamase producing), Staphylococcus saprophyticus (beta-lactamase and non-beta-lactamase producing), Streptococcus faecalis (Enterococcus), Streptococcus pneumoniae, Streptococcus pyogenes, and Streptococcus viridans.
Gram-negative bacteria: Hemophilus influenzae (beta-lactamase and non-beta-lactamase producing), Moraxella (Branhamella) catarrhalis (beta-lactamase and non-beta-lactamase producing), Escherichia coli (beta-lactamase and non-beta-lactamase producing), Klebsiella species (all known species are beta-lactamase producing), Proteus mirabilis (beta-lactamase and non-beta-lactamase producing), Proteus vulgaris, Providencia rettgeri, Providencia stuartii, Morganella morganii, and Neisseria gonorrhoeae (beta-lactamase and non-beta-lactamase producing).
Anaerobes: Clostridium species, Peptococcus species, Peptostreptococcus species, Bacteroides species including B. fragilis.Gynecological Infections
Ampicillin/sulbactam can be used to treat gynecological infections caused by beta-lactamase producing strains of Escherichia coli, and Bacteroides (including B. fragilis).Bone and joint infections
Ampicillin/sulbactam can be used in the treatment of bone and joint infections caused by susceptible beta-lactamase producing bacteria.Intra-abdominal infections
Ampicillin/sulbactam can be used to treat intra-abdominal infections caused by beta-lactamase producing strains of Escherichia coli, Klebsiella (including K. pneumonia), Bacteroides fragilis, and Enterobacter.Skin and skin structure Infections
This medication can be used to treat skin and skin structure infections caused from beta-lactamase-producing strains of Staphylococcus aureus, Enterobacter, Escherichia coli, Klebsiella (including K. pneumoniae), Proteus mirabilis, Bacteroides fragilis, and Acinetobacter calcoaceticus. Examples of skin conditions treated with ampicillin-sulbactam are moderate to severe diabetic foot infections and type 1 Necrotizing fasciitis, commonly referred to as "flesh-eating bacteria".
Contraindications
Ampicillin/sulbactam is contraindicated in individuals who have a history of a penicillin allergy. Symptoms of allergic reactions may range from rash to potentially life-threatening conditions, such as anaphylaxis. Patients who have asthma, eczema, hives, or hay fever are more likely to develop undesirable reactions to any of the penicillins.
Adverse effects
Reported adverse events include both local and systemic reactions. Local adverse reactions are characterized by redness, tenderness, and soreness of the skin at the injection site. The most common local reaction is injection site pain. It has been reported to occur in 16% of patients receiving intramuscular injections, and 3% of patients receiving intravenous injections. Less frequently reported side effects include inflammation of veins (1.2%), sometimes associated with a blood clot (3%). The most commonly reported systemic reactions are diarrhea (3%) and rash (2%). Less frequent systemic reactions to ampicillin/sulbactam include chest pain, fatigue, seizure, headache, painful urination, urinary retention, intestinal gas, nausea, vomiting, itching, hairy tongue, tightness in throat, reddening of the skin, nose bleeding, and facial swelling. These are reported to occur in less than 1% of patients.
Pharmacology
Pharmacodynamics and pharmacokinetics
The addition of sulbactam to ampicillin enhances the effects of ampicillin. This increases the antimicrobial activity by 4- to 32-fold when compared to ampicillin alone. Ampicillin is a time-dependent antibiotic. Its bacterial killing is largely related to the time that drug concentrations in the body remain above the minimum inhibitory concentration (MIC). The duration of exposure will thus correspond to how much bacterial killing will occur. Various studies have shown that, for maximum bacterial killing, drug concentrations must be above the MIC for 50-60% of the time for the penicillin group of antibiotics. This means that longer durations of adequate concentrations are more likely to produce therapeutic success. However, when ampicillin is given in combination with sulbactam, regrowth of bacteria has been seen when sulbactam levels fall below certain concentrations. As with many other antibiotics, under-dosing of ampicillin/sulbactam may lead to resistance.Ampicillin/sulbactam has poor absorption when given orally. The two drugs have similar pharmacokinetic profiles that appear unchanged when given together. Ampicillin and sulbactam are both hydrophilic antibiotics and have a volume of distribution (Vd) similar to the volume of extra-cellular body water. The volume that the drug distributes throughout in healthy patients is approximately 0.2 liters per kilogram of body weight. Patients on hemodialysis, elderly patients, and pediatric patients have shown a slightly increased volume of distribution.
Using typical doses, ampicillin/sulbactam has been shown to reach desired levels to treat infections in the brain, lungs, and abdominal tissues.
Both agents have moderate protein binding, reported at 38% for sulbactam and 28% for ampicillin.15,16 The half-life of ampicillin is approximately 1 hour, when used alone or in combination with sulbactam; therefore it will be eliminated from a healthy person in around 5 hours. It is eliminated primarily by the urinary system, with 75% excreted unchanged in the urine. Only small amounts of each drug were found to be excreted in the bile. Ampicillin/sulbactam should be given with caution in infants less than a week old and premature neonates. This is due to the underdeveloped urinary system in these patients, which can cause a significantly increased half-life for both drugs.16 Based on its elimination, ampicillin/sulbactam is typically given every 6 to 8 hours. Slowed clearance of both drugs has been seen in the elderly, renal disease patients, and critically ill patients on renal replacement therapy. Reduced clearance has been seen in both pediatric and post-operative patients. Adjustments in dosing frequency may be required in these patients due to these changes.
Mechanism of action
Ampicillin/sulbactam is a combination of a β-lactam antibiotic and a β-lactamase inhibitor. Ampicillin works by binding to penicillin-binding proteins (PBPs) to inhibit bacterial cell wall synthesis. This causes disruption of the bacterial cell wall and leads to bacterial cell death. However, resistant pathogens may produce β-lactamase enzymes that can inactivate ampicillin through hydrolysis. This is prevented by the addition of sulbactam, which binds and inhibits the β-lactamase enzymes. It is also capable of binding to the PBP of Bacteroides fragilis and Acinetobacter spp., even when it is given alone. The activity of sulbactam against Acinetobacter spp. seen in in-vitro studies makes it distinctive compared to other β-lactamase inhibitors, such as tazobactam and clavulanic acid.
Chemistry
Ampicillin sodium is derived from the basic penicillin nucleus, 6-aminopenicillanic acid. Its chemical name is monosodium (2S, 5R, 6R)-6-[(R)-2-amino-2-phenylacetamido]-3,3-dimethyl-7-oxo-4-thia-1-azabicyclo[3.2.0]heptane-2-carboxylate. It has a molecular weight of 371.39 grams and its chemical formula is C16H18N3NaO4S.
Sulbactam sodium is also a derivative of 6-aminopenicillanic acid. Chemically, it is known as either sodium penicillinate sulfone or sodium (2S, 5R)-3,3-dimethyl-7-oxo-4-thia-1-azabicyclo[3.2.0]heptane-2-carboxylate 4,4-dioxide. It has a molecular weight of 255.22 grams and its chemical formula is C8H10NNaO5S.
Ampicillin/sulbactam is also used when the cause of an infection is not known (empiric therapy), such as intra-abdominal infections, skin infections, pneumonia, and gynecologic infections. It is active against a wide range of bacterial groups, including Staphylococcus aureus, Enterobacteriaceae, and anaerobic bacteria. Importantly, it is not active against Pseudomonas aeruginosa and should not be used alone when infection with this organism is suspected or known.
History
The introduction and use of ampicillin alone started in 1961. The development and introduction of this drug allowed the use of targeted therapies against gram-negative bacteria. With the rise of beta-lactamase producing bacteria, ampicillin and the other penicillin-derivatives became ineffective to these resistant organisms. With the introduction of beta-lactamase inhibitors such as sulbactam, combined with ampicillin made beta-lactamase producing bacteria susceptible.
Formulation
Ampicillin-sulbactam only comes in a parenteral formulation to be either used as intravenous or intramuscular injections, and can be formulated for intravenous infusion. It is formulated in a 2:1 ratio of ampicillin:sulbactam. The commercial preparations available include:
1.5 grams (1 gram ampicillin and 0.5 gram sulbactam)→Brand names: Unasyn, Unasyn ADD-Vantage, Unasyn Piggyback
3 grams (2 grams ampicillin and 1 gram sulbactam)→Brand names: Unasyn, Unasyn ADD-Vantage, Unasyn Piggyback
15 grams (10 grams ampicillin and 5 grams sulbactam)→Brand name: Unasyn
Society and culture
Names
Unasyn (US)
Subacillin (Taiwan)
Unictam (Egypt)
Ultracillin (Egypt)
Fortibiotic
Sulbin (Egypt)
Novactam (Egypt)
Sulbacin (Kenya)
References
External links
"Ampicillin mixture with Sulbactam". Drug Information Portal. U.S. National Library of Medicine. |
You function as a medical explainer. Your task is to convey the meanings of medical terms in a detailed, yet easy-to-understand manner. | I'm not familiar with the medical term 'Kaposis sarcoma.' Could you provide some insights? | Kaposis sarcoma (KS) is a type of cancer that can form masses in the skin, in lymph nodes, in the mouth, or in other organs. The skin lesions are usually painless, purple and may be flat or raised. Lesions can occur singly, multiply in a limited area, or may be widespread. Depending on the sub-type of disease and level of immune suppression, KS may worsen either gradually or quickly. KS is caused by a combination of immune suppression (such as due to HIV/AIDS) and infection by Human herpesvirus 8 (HHV8 – also called KS-associated herpesvirus (KSHV)).Four sub-types are described: classic, endemic, immunosuppression therapy-related (also called iatrogenic), and epidemic (also called AIDS-related). Classic KS tends to affect older men in regions where KSHV is highly prevalent (Mediterranean, Eastern Europe, Middle East), is usually slow-growing, and most often affects only the legs. Endemic KS is most common in Sub-Saharan Africa and is more aggressive in children, while older adults present similarly to classic KS. Immunosuppression therapy-related KS generally occurs in people following organ transplantation and mostly affects the skin. Epidemic KS occurs in people with AIDS and many parts of the body can be affected. KS is diagnosed by tissue biopsy, while the extent of disease may be determined by medical imaging.Treatment is based on the sub-type, whether the condition is localized or widespread, and the persons immune function. Localized skin lesions may be treated by surgery, injections of chemotherapy into the lesion, or radiation therapy. Widespread disease may be treated with chemotherapy or biologic therapy. In those with HIV/AIDS, highly active antiretroviral therapy (HAART) prevents and often treats KS. In certain cases the addition of chemotherapy may be required. With widespread disease, death may occur.The condition is relatively common in people with HIV/AIDS and following organ transplant. Over 35% of people with AIDS may be affected. KS was first described by Moritz Kaposi in 1872. It became more widely known as one of the AIDS-defining illnesses in the 1980s. KSHV was discovered as a causative agent in 1994.
Signs and symptoms
KS lesions are nodules or blotches that may be red, purple, brown, or black, and are usually papular.They are typically found on the skin, but spread elsewhere is common, especially the mouth, gastrointestinal tract and respiratory tract. Growth can range from very slow to explosively fast, and is associated with significant mortality and morbidity.The lesions are painless, but become cosmetically disfiguring or interruptive to organs.
Skin
Commonly affected areas include the lower limbs, back, face, mouth, and genitalia. The lesions are usually as described above, but may occasionally be plaque-like (often on the soles of the feet) or even involved in skin breakdown with resulting fungating lesions.
Associated swelling may be from either local inflammation or lymphoedema (obstruction of local lymphatic vessels by the lesion). Skin lesions may be quite disfiguring for the patient, and a cause of much psychosocial pathology.
Mouth
The mouth is involved in about 30% of cases, and is the initial site in 15% of AIDS-related KS. In the mouth, the hard palate is most frequently affected, followed by the gums. Lesions in the mouth may be easily damaged by chewing and bleed or develop secondary infection, and even interfere with eating or speaking.
Gastrointestinal tract
Involvement can be common in those with transplant-related or AIDS-related KS, and it may occur in the absence of skin involvement. The gastrointestinal lesions may be silent or cause weight loss, pain, nausea/vomiting, diarrhea, bleeding (either vomiting blood or passing it with bowel movements), malabsorption, or intestinal obstruction.
Respiratory tract
Involvement of the airway can present with shortness of breath, fever, cough, coughing up blood or chest pain, or as an incidental finding on chest x-ray. The diagnosis is usually confirmed by bronchoscopy, when the lesions are directly seen and often biopsied. Kaposis sarcoma of the lung has a poor prognosis.
Cause
Kaposis sarcoma-associated herpesvirus (KSHV), also called HHV-8, is present in almost 100% of Kaposi sarcoma lesions, whether HIV-related, classic, endemic, or iatrogenic. KSHV encodes oncogenes, microRNAs and circular RNAs that promote cancer cell proliferation and escape from the immune system.
Transmission
In Europe and North America, KSHV is transmitted through saliva. Thus, kissing is a risk factor for transmission. Higher rates of transmission among gay and bisexual men have been attributed to "deep kissing" sexual partners with KSHV. Another alternative theory suggests that use of saliva as a sexual lubricant might be a major mode for transmission. Prudent advice is to use commercial lubricants when needed and avoid deep kissing with partners with KSHV infection or whose status is unknown.KSHV is also transmissible via organ transplantation and blood transfusion. Testing for the virus before these procedures is likely to effectively limit iatrogenic transmission.
Pathology
Despite its name, in general it is not considered a true sarcoma, which is a tumor arising from mesenchymal tissue. The histogenesis of KS remains controversial. KS may arise as a cancer of lymphatic endothelium and forms vascular channels that fill with blood cells, giving the tumor its characteristic bruise-like appearance. KSHV proteins are uniformly detected in KS cancer cells.KS lesions contain tumor cells with a characteristic abnormal elongated shape, called spindle cells. The most typical feature of Kaposi sarcoma is the presence of spindle cells forming slits containing red blood cells. Mitotic activity is only moderate and pleomorphism is usually absent. The tumor is highly vascular, containing abnormally dense and irregular blood vessels, which leak red blood cells into the surrounding tissue and give the tumor its dark color. Inflammation around the tumor may produce swelling and pain. Variously sized PAS positive hyaline bodies are often seen in the cytoplasm or sometimes extracellularly.The spindle cells of Kaposi sarcoma differentiate toward endothelial cells, probably of lymph vessel rather than blood vessel origin. The consistent immunoreactivity for podoplanin supports the lymphatic nature of the lesion.
Diagnosis
Although KS may be suspected from the appearance of lesions and the patients risk factors, a definite diagnosis can be made only by biopsy and microscopic examination. Detection of the KSHV protein LANA in tumor cells confirms the diagnosis.In differential diagnosis, arteriovenous malformations, pyogenic granuloma and other vascular proliferations can be microscopically confused with KS.
Differential diagnosis of Kaposis sarcoma
Source:
Naevus
Histiocytoma
Cryptococcosis
Histoplasmosis
Leishmaniasis
Pneumocystis lesions
Dermatophytosis
Angioma
Bacillary angiomatosis
Pyogenic granuloma
Melanoma
Classification
HHV-8 is responsible for all varieties of KS. Since Moritz Kaposi first described the cancer, the disease has been reported in five separate clinical settings, with different presentations, epidemiology, and prognoses.: 599 All of the forms are infected with KSHV and are different manifestations of the same disease but have differences in clinical aggressiveness, prognosis, and treatment.
Classic Kaposi sarcoma most commonly appears early on the toes and soles as reddish, violaceous, or bluish-black macules and patches that spread and coalesce to form nodules or plaques.: 599 A small percentage of these patients may have visceral lesions. In most cases the treatment involves surgical removal of the lesion. The condition tends to be indolent and chronic, affecting elderly men from the Mediterranean region, Arab countries, or of Eastern European descent. Israeli Jews have a higher rate of KSHV/HHV-8 infection than European peoples.
Endemic KS, which has two types. Although this may be present worldwide, it has been originally described later in young African peoples, mainly those from sub-Saharan Africa. This variant is not related to HIV infection and is a more aggressive disease that infiltrates the skin extensively.African lymphadenopathic Kaposi sarcoma is aggressive, occurring in children under 10 years of age, presenting with lymph node involvement, with or without skin lesions.: 599
African cutaneous Kaposi sarcoma presents with nodular, infiltrative, vascular masses on the extremities, mostly in men between the ages of 20 and 50, and is endemic in tropical Africa.: 599
Immunosuppression-associated Kaposi sarcoma had been described, but only rarely until the advent of calcineurin inhibitors (such as ciclosporines, which are inhibitors of T-cell function) for transplant patients in the 1980s, when its incidence grew rapidly. The tumor arises either when an HHV 8-infected organ is transplanted into someone who has not been exposed to the virus or when the transplant recipient already harbors pre-existing HHV 8 infection. Unlike classic Kaposi sarcoma, the site of presentation is more variable.: 600
AIDS-associated Kaposi sarcoma typically presents with cutaneous lesions that begin as one or several red to purple-red macules, rapidly progressing to papules, nodules, and plaques, with a predilection for the head, back, neck, trunk, and mucous membranes. In more advanced cases, lesions can be found in the stomach and intestines, the lymph nodes, and the lungs.: 599 Compared to other forms of KS, KS-AIDS stimulated more interest in KS research, as it was one of the first illnesses associated with AIDS and first described in 1981. This form of KS is over 300 times more common in AIDS patients than in renal transplant recipients. In this case, HHV 8 is sexually transmitted among people also at risk for sexually transmitted HIV infection.
Prevention
Blood tests to detect antibodies against KSHV have been developed and can be used to determine whether a person is at risk for transmitting the infection to their sexual partner, or whether an organ is infected before transplantation. However, these tests are not available except as research tools, and, thus, there is little screening for persons at risk for becoming infected with KSHV, such as people following a transplant.
Treatment
Kaposi sarcoma is not curable, but it can often be treatable for many years. In KS associated with immunodeficiency or immunosuppression, treating the cause of the immune system dysfunction can slow or stop the progression of KS. In 40% or more of patients with AIDS-associated Kaposi sarcoma, the Kaposi lesions will shrink upon first starting highly active antiretroviral therapy (HAART). Therefore, HAART is considered the cornerstone of therapy in AIDS-associated Kaposi sarcoma. However, in a certain percentage of such people, Kaposi sarcoma may recur after many years on HAART, especially if HIV is not completely suppressed.
People with a few local lesions can often be treated with local measures such as radiation therapy or cryosurgery. Weak evidence suggests that antiretroviral therapy in combination with chemotherapy is more effective than either of those two therapies individually. Limited basic and clinical evidence suggest that topical beta-blockers, such as timolol, may induce regression of localized lesions in classic as well as HIV-associated Kaposi sarcoma. In general, surgery is not recommended, as Kaposi sarcoma can appear in wound edges. In general, more widespread disease, or disease affecting internal organs, is treated with systemic therapy with interferon alpha, liposomal anthracyclines (such as liposomal doxorubicin or daunorubicin), thalidomide, or paclitaxel.Alitretinoin, applied to the lesion, may be used when the lesion is not getting better with standard treatment of HIV/AIDS and chemotherapy or radiation therapy cannot be used.
Epidemiology
With the decrease in the death rate among people with HIV/AIDS receiving new treatments in the 1990s, the rates and severity of epidemic KS also decreased. However, the number of people living with HIV/AIDS is increasing in the United States, and it is possible that the number of people with AIDS-associated Kaposi sarcoma will again rise as these people live longer with HIV infection.
Society
Because of their highly visible nature, external lesions are sometimes the presenting symptom of AIDS. Kaposi sarcoma entered the awareness of the general public with the release of the film Philadelphia, in which the main character was fired after his employers found out he was HIV-positive due to visible lesions. By the time KS lesions appear, likely, the immune system has already been severely weakened. It has been reported that only 6% of men who have sex with men are aware that KS is caused by a virus different from HIV. Thus, there is little community effort to prevent KSHV infection. Likewise, no systematic screening of organ donations is in place.
In people with AIDS, Kaposi sarcoma is considered an opportunistic infection, a disease that can gain a foothold in the body because the immune system has been weakened. With the rise of HIV/AIDS in Africa, where KSHV is widespread, KS has become the most frequently reported cancer in some countries.
References
External links
Kaposi sarcoma photo library at Dermnet |
You are a facilitator of medical knowledge. Provide thorough and accessible explanations of medical terms, catering to both specialists and non-specialists. | Could you offer a clear explanation of the term 'Thrombotic microangiopathy' as used in the medical field? | Thrombotic microangiopathy (TMA) is a pathology that results in thrombosis in capillaries and arterioles, due to an endothelial injury. It may be seen in association with thrombocytopenia, anemia, purpura and kidney failure.
The classic TMAs are hemolytic uremic syndrome and thrombotic thrombocytopenic purpura. Other conditions with TMA include atypical hemolytic uremic syndrome, disseminated intravascular coagulation, scleroderma renal crisis, malignant hypertension,
antiphospholipid antibody syndrome, and drug toxicities, e.g. calcineurin inhibitor toxicity.
Signs and symptoms
The clinical presentation of TMA, although dependent on the type, typically includes: fever, microangiopathic hemolytic anemia (see schistocytes in a blood smear), kidney failure, thrombocytopenia and neurological manifestations. Generally, renal complications are particularly predominant with Shiga-toxin-associated hemolytic uremic syndrome (STx-HUS) and atypical HUS, whereas neurologic complications are more likely with TTP. Individuals with milder forms of TTP may have recurrent symptomatic episodes, including seizures and vision loss. With more threatening cases of TMA, and also as the condition progresses without treatment, multi-organ failure or injury is also possible, as the hyaline thrombi can spread to and affect the brain, kidneys, heart, liver, and other major organs.
Cause
The specific cause is dependent of the type of TMA that is presented, but the two main pathways that lead to TMA are external triggers of vascular injury, such as viruses, bacterial Shiga toxins or endotoxins, antibodies, and drugs; and congenital predisposing conditions, including decreased levels of tissue factors necessary for the coagulation cascade. Either of these pathways will result in decreased endothelial thromboresistance, leukocyte adhesion to damaged endothelium, complement consumption, enhanced vascular shear stress, and abnormal vWF fragmentation. The central and primary event in this progression is injury to the endothelial cells, which reduces the production of prostaglandin and prostacyclin, ultimately resulting in the loss of physiological thromboresistance, or high thrombus formation rate in blood vessels. Leukocyte adhesion to the damaged endothelial wall and abnormal von Willebrand factor (or vWF) release can also contribute to the increase in thrombus formation. More recently, researchers have attributed both TTP and HUS to targeted agents, such as targeted cancer therapies, immunotoxins, and anti-VEGF therapy.Bacterial toxins are the primary cause of one category of thrombotic microangiopathy known as HUS or hemolytic uremic syndrome. HUS can be divided into two main categories: Shiga-toxin-associated HUS (STx-HUS), which normally presents with diarrhea, and atypical HUS. The Shiga-toxin inhibits the binding of eEF-1-dependent binding of aminoacyl tRNA to the 60S subunit of the ribosome, thus inhibiting protein synthesis. The cytotoxicity from the lack of protein damages glomerular endothelial cells by creating voids in the endothelial wall and detaching the basement membrane of the endothelial layer, activating the coagulation cascade. Atypical HUS may be caused by an infection or diarrheal illness or it may be genetically transmitted. This category of TMA encompasses all forms that do not have obvious etiologies. Mutations in three of the proteins in the complement cascade have been identified in patients with atypical HUS. Several chemotherapeutic drugs have also been shown to cause damage to the epithelial layer by reducing the ability for the cells to produce prostacyclin, ultimately resulting in chemotherapy-associated HUS, or C-HUS.The second category of TMAs is TTP thrombotic thrombocytopenic purpura, which can be divided into 3 categories: congenital, idiopathic, and non-idiopathic. Congenital and idiopathic TTP are generally associated with deficiencies in ADAMTS13, a zinc metalloprotease responsible for cleaving Very Large vWF Multimers in order to prevent inappropriate platelet aggregation and thrombosis in the microvasculature. Natural genetic mutations resulting in the deficiency of ADAMTS13 have been found in homozygous and heterozygous pedigrees in Europe. Researchers have identified common pathways and links between TTP and HUS, while other sources express skepticism about their common pathophysiology.The repression of the vascular endothelial growth factor (VEGF) can also cause glomerular TMA (damage to the glomerular microvasculature). It is likely that the absence of VEGF results in the collapse of fenestrations in the glomerular endothelium, thus causing microvascular injury and blockages associated with TMA.Manifestations resembling thrombotic microangiopathy have been reported in clinical trials evaluating high doses of valacyclovir (8000 mg/day) administered for prolonged periods (months to years) for prophylaxis of cytomegalovirus (CMV) infection and disease, particularly in persons with HIV infection. A number of factors may have contributed to the incidence of thrombotic microangiopathy in those trials including profound immunosuppression, underlying diseases (advanced HIV disease, graft-versus-host disease), and other classes of drug, particularly antifungal agents. There were no reports of thrombotic microangiopathy among the 3050 subjects in the four trials evaluating Valacyclovir for suppression of recurrent genital herpes. Although one of the trials was in HIV-infected subjects, the patients did not have advanced HIV disease. The implication is that the occurrence of thrombotic microangiopathy is restricted to severely immunosuppressed persons receiving higher Valacyclovir dosages than are required to control HSV infection.
Diagnosis
CBC and blood film: decreased platelets and schistocytes PT, aPTT, fibrinogen: normal markers of hemolysis: increased unconjugated bilirubin, increased LDH, decreased haptoglobin negative Coombs test. Creatinine, urea, to follow renal function ADAMSTS-13 gene, activity or inhibitor testing (TTP).
Treatment
The course of treatment and the success rate is dependent on the type of TMA. Some patients with atypical HUS and TTP have responded to plasma infusions or exchanges, a procedure which replaces proteins necessary for the complement cascade that the patient does not have; however, this is not a permanent solution or treatment, especially for patients with congenital predispositions. Monoclonal antibodies like eculizumab and caplacizumab can assist with atypical hemolytic uremic syndrome and acquired thrombotic thrombocytopenic purpura respectively whilst dexamethasone can help with immune thrombotic thrombocytopenic purpura and low molecular weight heparin can help with disseminated intravascular coagulation.
See also
Microangiopathy
Microangiopathic hemolytic anemia
References
== External links == |
You are a medical educator. Your role is to provide detailed and clear explanations for medical terms, suitable for both professionals and laypersons. | I'm curious about the meaning of the medical term 'Finasteride.' Can you give me some insights? | Finasteride, sold under the brand names Proscar and Propecia among others, is a medication used to treat hair loss and benign prostatic hyperplasia in men. It can also be used to treat excessive hair growth in women and as a part of hormone therapy for transgender women. It is taken by mouth.Finasteride is a 5α-reductase inhibitor and therefore an antiandrogen. It works by decreasing the production of dihydrotestosterone (DHT) by about 70%, including in the prostate gland and the scalp.In addition to DHT, finasteride also inhibits the production of several anticonvulsant neurosteroids including allopregnanolone, androstanediol and THDOC.Adverse effects from finasteride are rare, however some men experience sexual dysfunction, depression, and breast enlargement. In some men, sexual dysfunction may persist after stopping the medication. It may also hide the early symptoms of certain forms of prostate cancer.Finasteride was patented in 1984 and approved for medical use in 1992. It is available as a generic medication. In 2019, it was the 86th most commonly prescribed medication in the United States, with more than 8 million prescriptions.
Medical uses
Finasteride is indicated for the treatment of symptomatic benign prostatic hyperplasia (BPH) in men with an enlarged prostate and for the treatment of male pattern hair loss (androgenetic alopecia) in men.
Enlarged prostate
Physicians sometimes prescribe finasteride for the treatment of benign prostatic hyperplasia (BPH), informally known as an enlarged prostate. Finasteride may improve the symptoms associated with BPH such as difficulty urinating, getting up during the night to urinate, hesitation at the start and end of urination, and decreased urinary flow. It provides less symptomatic relief than alpha-1 blockers such as tamsulosin and symptomatic relief is slower in onset (six months or more of treatment with finasteride may be required to determine the therapeutic results of treatment). Symptomatic benefits are mainly seen in those with prostate volume > 40 cm3. In long-term studies finasteride but not alpha-1 inhibitors reduce the risk of acute urinary retention (−57% at 4 years) and the need for surgery (−54% at 4 years). If the drug is discontinued, any therapeutic benefits are reversed within about 6–8 months.
Scalp hair loss
Finasteride is also used to treat male pattern baldness (androgenic alopecia) in men, a condition that develops in up to 80% of Caucasian men. In the United States, finasteride and minoxidil are the only two FDA approved drugs for the treatment of male pattern hair loss as of 2017. Treatment with finasteride slows further hair loss and provides about 30% improvement in hair loss after six months of treatment, with effectiveness persisting as long as the drug is taken. Taking finasteride leads to a reduction in scalp and serum DHT levels; by lowering scalp levels of DHT, finasteride can maintain or increase the amount of terminal hairs in the anagen phase by inhibiting and sometimes reversing miniaturization of the hair follicle. Finasteride is most effective on the crown but can reduce hair loss in all areas of the scalp. Finasteride has also been tested for pattern hair loss in women; however, the results were no better than placebo. Finasteride is less effective in the treatment of scalp hair loss than dutasteride.
Prostate cancer
In males over 55 years old finasteride decreases the risk of low-grade prostate cancer but may increase the risk of high-grade prostate cancer and has no effect on overall survival.A 2010 review found a 25% reduction in the risk of prostate cancer with 5α-reductase inhibitor. A follow-up study of the Medicare claims of participants in a 10-year Prostate Cancer Prevention Trial suggests the reduction in prostate cancer is maintained even after discontinuation of treatment. However, 5α-reductase inhibitors have been found to increase the risk of developing certain rare but aggressive forms of prostate cancer (27% risk increase), although not all studies have observed this. No impact of 5-α-reductase inhibitor on survival has been found in people with prostate cancer.
Excessive hair growth
Finasteride has been found to be effective in the treatment of hirsutism (excessive facial and/or body hair growth) in women. In a study of 89 women with hyperandrogenism due to persistent adrenarche syndrome, finasteride produced a 93% reduction in facial hirsutism and a 73% reduction bodily hirsutism after 2 years of treatment. Other studies using finasteride for hirsutism have also found it to be clearly effective.
Transgender hormone therapy
Finasteride is sometimes used in hormone replacement therapy for transgender women due to its antiandrogenic effects, in combination with a form of estrogen. However, little clinical research of finasteride use for this purpose has been conducted and evidence of safety or efficacy is limited. Moreover, caution has been recommended when prescribing finasteride to transgender women, as finasteride may be associated with side effects such as depression, anxiety, and suicidal ideation, symptoms that are particularly prevalent in the transgender population and in others at high risk already.
Adverse effects
A 2010 Cochrane review of finasteride for BPH found that, in men with a weighted mean age of 62.4, adverse effects are "rare; nevertheless, men taking finasteride are at increased risk for impotence, erectile dysfunction, decreased libido, and ejaculation disorder, versus placebo." As of 2016 fresh evidence suggested such effects, along with disturbed neurosteroid production, may persist after finasteride use is stopped.Finasteride is contraindicated in pregnancy. The Food and Drug Administration advises that donation of blood or plasma be deferred for at least one month after taking the last dose of finasteride.The FDA has added a warning to 5α-reductase inhibitors concerning an increased risk of high-grade prostate cancer, as the treatment of BPH lowers PSA (prostate-specific antigen), which could mask the development of prostate cancer. Although overall incidence of male breast cancer in clinical trials for finasteride 5 mg was not increased, there are post-marketing reports of breast cancer in association with its use, though available evidence does not provide clarity as to whether there is a causative relationship between finasteride and these cancers. A 2018 meta-analysis found no higher risk of breast cancer with 5α-reductase inhibitors. Some men develop gynecomastia (breast development or enlargement) following finasteride usage. The risk of gynecomastia with 5α-reductase inhibitors is low at about 1.5%. Depressive symptoms and suicidality have been reported.
Sexual adverse effects
Use of finasteride is associated with an increased risk of sexual dysfunction including erectile dysfunction, decreased libido and ejaculatory dysfunction. Sexual adverse effects of finasteride and dutasteride have been linked to lower quality of life and ability to maintain an intimate relationship, and can cause stress in relationships.The adverse effect profiles of finasteride are somewhat different for its indications of hair loss and BPH.
Finasteride for androgenetic alopecia (hair loss in men)
The most common adverse effects of finasteride taken for hair loss are: decrease in sex drive, erectile dysfunction and decrease in amount of semen.: 17 In addition, finasteride has been reported in case reports to cause sexual problems which persist after stopping the medication. A 2012 update to the FDA label noted reports of decreased sex drive, problems with ejaculation and difficulty achieving an erection which continued after stopping the medication. The update also referenced reports of testicular pain and "male infertility and/or poor quality of semen.": 17
Finasteride for BPH
The most common adverse sexual effects of finasteride for BPH are: trouble getting or keeping an erection, decrease in sex drive, decreased volume of ejaculate and ejaculation disorders.: 16 A 2010 Cochrane review found that men taking finasteride for BPH (with a mean age of 62.4) are at increased risk for impotence, erectile dysfunction, decreased libido, and ejaculation disorder for the first year of treatment. The rates became indistinguishable from placebo after 2–4 years and these side effects usually got better over time.
Long-term
Finasteride may cause persistent adverse sexual, neurological and physical effects in a subset of men. A 2019 metastudy surveyed the literature on the reversibility of finasterides side effects. It identified three studies which demonstrated full reversibility of side effects and eleven that describe patients with irreversible adverse events. The findings were most convincing in a retrospective review of about 12,000 patients that 1.4% of the cohort developed persistent ED (ED lasting longer than 90 days post-withdrawal).
Post-finasteride syndrome
Men in the U.S. and Canada concerned about persistent sexual side effects "coined the phrase post-finasteride syndrome, which they say is characterized by sexual, neurological, hormonal and psychological side effects that can persist in men who have taken finasteride for hair loss or an enlarged prostate". As of 2016, Merck was a defendant in approximately 1,370 product liability lawsuits which had been filed by customers alleging they have experienced persistent sexual side effects following cessation of treatment with finasteride.A 2019 editorial in The BMJ called post finasteride syndrome "ill defined and controversial". It has common features with other self-diagnosed "mystery syndromes" such as morgellons syndrome or multiple chemical sensitivity. There is no known underlying biological mechanism for the proposed syndrome, and its incidence is also unclear. A lack of clear diagnostic criteria and the variable reporting fraction in different health-care settings make the problem challenging to evaluate.Self-reported symptoms of post-finasteride syndrome include penile atrophy and tissue changes, decreased ejaculate volume and quality, libido loss, erectile dysfunction, loss of penile sensitivity, decreased orgasm sensation, dry skin, metabolic changes, muscle and strength loss, gynecomastia, depression, anxiety, panic attacks, insomnia, anhedonia, concentration problems, memory impairment and suicidal ideation. A meta-analysis found significant association between finasteride use and post-discontinuation depression, suicide ideation, and sexual dysfunction, but the quality of evidence was limited.Plaintiffs have filed over one thousand court cases against Merck over the effects of finasteride. Most were settled by 2018 when Merck paid a lump sum of US$4.3 million to be distributed. As of September 2019, 25 cases remained outstanding in the United States.In 2019 Reuters reported that faulty redactions in court documents revealed allegations from plaintiffs that Merck had known of persistent side effects in their original clinical trials but chose not to disclose them in warning labels.
Overdose
Finasteride has been studied in humans at single doses of up to 400 mg and at continuous dosages of up to 80 mg/day for three months, without adverse effects observed. There is no specific recommended antidote for finasteride overdose.
Interactions
No significant drug interactions have been observed between finasteride and a limited selection of medications.
Pharmacology
Pharmacodynamics
Finasteride is a 5α-reductase inhibitor. It is specifically a selective inhibitor of the type II and III isoforms of the enzyme. By inhibiting these two isozymes of 5α-reductase, finasteride reduces the formation of the potent androgen dihydrotestosterone (DHT) from its precursor testosterone in certain tissues in the body such as the prostate gland, skin, and hair follicles. As such, finasteride is a type of antiandrogen, or more specifically, an androgen synthesis inhibitor. However, some authors do not define finasteride as an "antiandrogen," a term which can refer more specifically to antagonists of the androgen receptor.Finasteride results in a decrease of circulating DHT levels by about 65 to 70% with an oral dosage of 5 mg/day and of DHT levels in the prostate gland by up to 80 to 90% with an oral dosage of 1 or 5 mg/day. In parallel, circulating levels of testosterone increase by approximately 10%, while local concentrations of testosterone in the prostate gland increase by about 7-fold and local testosterone levels in hair follicles increase by around 27 to 53%. An oral dosage of finasteride of only 0.2 mg/day has been found to achieve near-maximal suppression of DHT levels (68.6% for 0.2 mg/day relative to 72.2% for 5 mg/day). Finasteride does not completely suppress DHT production because it lacks significant inhibitory effects on the 5α-reductase type I isoenzyme, with more than 100-fold less inhibitory potency for type I as compared to type II (IC50 = 313 nM and 11 nM, respectively). This is in contrast to inhibitors of all three isoenzymes of 5α-reductase like dutasteride, which can reduce DHT levels in the entire body by more than 99%. In addition to inhibiting 5α-reductase, finasteride has also been found to competitively inhibit 5β-reductase (AKR1D1). However, its affinity for the enzyme is substantially less than for 5α-reductase (an order of magnitude less than for 5α-reductase type I) and hence is unlikely to be of clinical significance.As of 2012, the tissues in which the different isozymes of 5α-reductase are expressed are not fully clear. This is because different investigators have obtained varying results with different reagents, methods, and tissues examined. However, the different isozymes of 5α-reductase appear to be widely expressed, with notable tissues including the prostate gland, seminal vesicles, testes, epididymides, skin, hair follicles, liver, kidneys, and brain, among others.By inhibiting 5α-reductase and thus preventing DHT production, finasteride reduces androgen signaling in tissues like the prostate gland and the scalp. In the prostate, this reduces prostate volume, which improves BPH and reduces risk of prostate cancer. Finasteride reduces prostate volume by 20 to 30% in men with benign prostatic hyperplasia. Inhibition of 5α-reductase also reduces epididymal weight, and decreases motility and normal morphology of spermatozoa in the epididymis.Neurosteroids like 3α-androstanediol (derived from DHT) and allopregnanolone (derived from progesterone) activate the GABAA receptor in the brain; because finasteride prevents the formation of neurosteroids, it functions as a neurosteroidogenesis inhibitor and may contribute to a reduction of GABAA activity. Reduction of GABAA receptor activation by these neurosteroids has been implicated in depression, anxiety, and sexual dysfunction.In accordance with finasteride being a potent 5α-reductase inhibitor but a weak inhibitor of 5β-reductase, the medication decreases circulating levels of 5α-reduced steroids like allopregnanolone but does not reduce concentrations of 5β-reduced steroids like pregnanolone. Pregnanolone acts as a potent GABAA receptor positive allosteric modulator similarly to allopregnanolone.
Pharmacokinetics
The mean oral bioavailability of finasteride is approximately 65%. The absorption of finasteride is not affected by food. At steady-state with 1 mg/day finasteride, mean peak concentrations of finasteride were 9.2 ng/mL (25 nmol/L). Conversely, following a single 5 mg dose of finasteride, mean peak levels of finasteride were 37 ng/mL (99 nmol/L), and plasma concentrations increased by 47 to 54% following 2.5 weeks of continued daily administration. The volume of distribution of finasteride is 76 L. Its plasma protein binding is 90%. The drug has been found to cross the blood–brain barrier, whereas levels in semen were found to be undetectable.Finasteride is extensively metabolized in the liver, first by hydroxylation via CYP3A4 and then by aldehyde dehydrogenase. It has two major metabolites, which are the tert-butyl side chain monohydroxylated and monocarboxylic acid metabolites. These metabolites show approximately 20% of the inhibitory activity of finasteride on 5α-reductase. Hence, the metabolites of finasteride are not particularly active. The drug has a terminal half-life of 5 to 6 hours in adult men (18–60 years of age) and a terminal half-life of 8 hours or more in elderly men (more than 70 years of age). It is eliminated as its metabolites 57% in the feces and 40% in the urine.
Chemistry
Finasteride, also known as 17β-(N-tert-butylcarbamoyl)-4-aza-5α-androst-1-en-3-one, is a synthetic androstane steroid and 4-azasteroid. It is an analogue of androgen steroid hormones like testosterone and DHT. As an unconjugated steroid, finasteride is a highly lipophilic compound.
History
In 1942, James Hamilton observed that prepubertal castration prevents the later development of male pattern baldness in mature men. In 1974, Julianne Imperato-McGinley of Cornell Medical College in New York attended a conference on birth defects. She reported on a group of intersex children in the Caribbean who appeared sexually ambiguous at birth, and were initially raised as girls, but then grew external male genitalia and other masculine characteristic after onset of puberty. These children, despite being raised as girls until puberty, were generally heterosexual, and were termed "Guevedoces" by their local community, which means "penis at twelve" in Spanish. Her research group found these children shared a genetic mutation, causing deficiency of the 5α-reductase enzyme and male hormone dihydrotestosterone (DHT), which was found to have been the etiology behind abnormalities in male sexual development. Upon maturation, these individuals were observed to have smaller prostates which were underdeveloped, and were also observed to lack incidence of male pattern baldness.In 1975, copies of Imperato-McGinleys presentation were seen by P. Roy Vagelos, who was then serving as Mercks basic-research chief. He was intrigued by the notion that decreased levels of DHT led to the development of smaller prostates. Dr. Vagelos then sought to create a drug which could mimic the condition found in these children to treat older men who had benign prostatic hyperplasia.Finasteride was developed by Merck under the code name MK-906. A team led by chemist Gary Rasmusson and biologist Jerry Brooks developed potential 5α-reductase inhibitors based on transition state inhibitors, using an iterative process of molecular design, testing, and redesign. In 1992, finasteride (5 mg) was approved by the U.S. Food and Drug Administration (FDA) for treatment of BPH, which Merck marketed under the brand name Proscar. Rasmusson and Brooks were awarded IPOs "Inventor of the Year" award in 1993 for their work on finasteride. In 1997, Merck was successful in obtaining FDA approval for a second indication of finasteride (1 mg) for treatment of male pattern hair loss, which was marketed under the brand name Propecia. It was the first 5α-reductase inhibitor to be introduced and was followed by dutasteride in 2001. The first study of finasteride in the treatment of hirsutism in women was published in 1994.
Society and culture
Generic names
Finasteride is the generic name of the drug and its INN, USAN, BAN, and JAN, while finastéride is its DCF. It is also known by its former developmental code names MK-906, YM-152, and L-652,931.
Brand names
Finasteride is marketed primarily under the brand names Propecia, for pattern hair loss, and Proscar, for BPH, both of which are products of Merck & Co. There is 1 mg of finasteride in Propecia and 5 mg in Proscar. Mercks patent on finasteride for the treatment of BPH expired in June 2006. Merck was awarded a separate patent for the use of finasteride to treat pattern hair loss and it expired in November 2013. Finasteride is also marketed under a variety of other brand names throughout the world.
Athletics
From 2005 to 2009, the World Anti-Doping Agency banned finasteride because it was discovered that the drug could be used to mask steroid abuse. It was removed from the list effective 1 January 2009, after improvements in testing methods made the ban unnecessary. Athletes who used finasteride and were banned from international competition include skeleton racer Zach Lund, bobsledder Sebastien Gattuso, footballer Romário, and ice hockey goaltender José Théodore.
Miscellaneous
The U.S. Food and Drug Administration advises that donation of blood or plasma be deferred for at least one month after taking the last dose of finasteride. The UK also has a one-month deferral period.Harold Bornstein, the former personal physician of United States President Donald Trump, stated in 2017 that Trump was taking finasteride to promote hair growth.
Research
Preliminary research suggests that topical finasteride may be effective in the treatment of pattern hair loss. Topical finasteride, like the oral preparation, reduces serum DHT.DHT may be involved in the cause of acne, and 5α-reductase inhibitors might be effective in the treatment of the condition. A small retrospective study reported that finasteride was effective in the treatment of acne in women with normal testosterone levels. A randomized controlled trial found that finasteride was less effective than flutamide or an ethinylestradiol/cyproterone acetate birth control pill in the treatment of acne in women with high androgen levels.Androgens and estrogens may be involved in the cause of hidradenitis suppurativa (acne inversa). Two case series have reported that finasteride is effective in the treatment of hidradenitis suppurativa in girls and women.Finasteride and other antiandrogens might be useful in the treatment of obsessive–compulsive disorder, but more research is needed.
References
External links
"Finasteride". Drug Information Portal. U.S. National Library of Medicine. |
You are an expert in medical terminology. Explain medical terms in a way that is both precise and easy to understand for non-medical audiences. | I've encountered the term 'Cilostazol' while reading about medical topics. What does it refer to exactly? | Cilostazol, sold under the brand name Pletal among others, is a medication used to help the symptoms of intermittent claudication in peripheral vascular disease. If no improvement is seen after 3 months, stopping the medication is reasonable. It may also be used to prevent stroke. It is taken by mouth.Common side effects include headache, diarrhea, dizziness, and cough. Serious side effects may include decreased survival in those with heart failure, low platelets, and low white blood cells. Cilostazol is a phosphodiesterase 3 inhibitor which works by inhibiting platelet aggregation and dilating arteries.Cilostazol was approved for medical use in the United States in 1999. It is available as a generic medication. In 2017, it was the 301st most commonly prescribed medication in the United States, with more than one million prescriptions.
Medical uses
Cilostazol is approved for the treatment of intermittent claudication in the United States and United Kingdom.Cilostazol is also used for secondary stroke prevention, though to date no regulatory body has approved it specifically for that indication.
Heart failure
Cilostazol is dangerous for people with severe heart failure. Cilostazol has been studied in people without heart failure, without evidence of harm, but much more data would be needed to determine no risk exists. Although cilostazol would not be approvable for a trivial condition the Cardio-Renal Advisory Committee and FDA concluded that fully informed patients and physicians should be able to choose to use it to treat intermittent claudication. Patient and physician labeling will describe the basis for concern and the incomplete information available.
Adverse effects
Possible side effects of cilostazol use include headache (the most common), diarrhea, severe heat intolerance, abnormal stools, increased heart rate, and palpitations.
Interactions
Cilostazol is metabolized by CYP3A4 and CYP2C19, two isoenzymes of the cytochrome P450 system. Drugs that inhibit CYP3A4, such as itraconazole, erythromycin, ketoconazole, and diltiazem, are known to interact with cilostazol. The proton pump inhibitor omeprazole, an inhibitor of CYP2C19, increases exposure to the active metabolite of cilostazol.A single report has been made of grapefruit juice possibly increasing the effects of cilostazol; some drug information sources list this as a possible interaction. The FDA-approved labeling of cilostazol notes that grapefruit juice (which is a CYP3A4 inhibitor) increases the drugs maximum concentration by around 50%.
Mechanism
Cilostazol is a selective inhibitor of phosphodiesterase type 3 (PDE3) with therapeutic focus on increasing cAMP. An increase in cAMP results in an increase in the active form of protein kinase A (PKA), which is directly related with an inhibition in platelet aggregation. PKA also prevents the activation of an enzyme (myosin light-chain kinase) that is important in the contraction of smooth muscle cells, thereby exerting its vasodilatory effect.
References
External links
"Cilostazol". Drug Information Portal. U.S. National Library of Medicine. |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | I'm encountering the term 'Carboplatin' in medical literature. What's its definition? | Carboplatin, sold under the trade name Paraplatin among others, is a chemotherapy medication used to treat a number of forms of cancer. This includes ovarian cancer, lung cancer, head and neck cancer, brain cancer, and neuroblastoma. It is used by injection into a vein.Side effects generally occur. Common side effects include low blood cell levels, nausea, and electrolyte problems. Other serious side effects include allergic reactions and increased future risk of another cancer. Use during pregnancy may result in harm to the baby. Carboplatin is in the platinum-based antineoplastic family of medications and works by interfering with duplication of DNA.Carboplatin was patented in 1972 and approved for medical use in 1989. It is on the World Health Organizations List of Essential Medicines.
Medical uses
Carboplatin is used to treat a number of forms of cancer. This includes ovarian cancer, lung cancer, head and neck cancer, brain cancer, and neuroblastoma. It may be used for some types of testicular cancer but cisplatin is generally more effective. It has also been used to treat triple-negative breast cancer.
Side effects
Relative to cisplatin, the greatest benefit of carboplatin is its reduced side effects, particularly the elimination of nephrotoxic effects. Nausea and vomiting are less severe and more easily controlled.
The main drawback of carboplatin is its myelosuppressive effect. This causes the blood cell and platelet output of bone marrow in the body to decrease quite dramatically, sometimes as low as 10% of its usual production levels. The nadir of this myelosuppression usually occurs 21–28 days after the first treatment, after which the blood cell and platelet levels in the blood begin to stabilize, often coming close to its pre-carboplatin levels. This decrease in white blood cells (neutropenia) can cause complications, and is sometimes treated with drugs like filgrastim. The most notable complication of neutropenia is increased probability of infection by opportunistic organisms, which necessitates hospital readmission and treatment with antibiotics.
Chemistry
In terms of its structure, carboplatin differs from cisplatin in that it has a bidentate dicarboxylate (the ligand is CycloButane DiCarboxylic Acid, CBDCA) in place of the two chloride ligands, which are the leaving groups in cisplatin. For this reason, "CBDCA" is sometimes used in the medical literature as an abbreviation referring to carboplatin. Carboplatin exhibits lower reactivity and slower DNA binding kinetics, although it forms the same reaction products in vitro at equivalent doses with cisplatin. Unlike cisplatin, carboplatin may be susceptible to alternative mechanisms. Some results show that cisplatin and carboplatin cause different morphological changes in MCF-7 cell lines while exerting their cytotoxic behaviour. The diminished reactivity limits protein-carboplatin complexes, which are excreted. The lower excretion rate of carboplatin means that more is retained in the body, and hence its effects are longer lasting (a retention half-life of 30 hours for carboplatin, compared to 1.5-3.6 hours in the case of cisplatin).
Mechanism of action
Two theories exist to explain the molecular mechanism of action of carboplatin with DNA:
Aquation, or the like-cisplatin hypothesis.
Activation, or the unlike-cisplatin hypothesis.The former is more accepted owing to the similarity of the leaving groups with its predecessor cisplatin, while the latter hypothesis envisages a biological activation mechanism to release the active Pt2+ species.
Dose
Calverts formula is used to calculate the dose of carboplatin. It takes under consideration the creatinine clearance and the desired area under curve. After 24 hours, close to 70% of carboplatin is excreted in the urine unchanged. This means that the dose of carboplatin must be adjusted for any impairment in kidney function.Calvert formula:
D
o
s
e
(
m
g
)
=
A
U
C
⋅
(
G
F
R
+
25
)
{\displaystyle \mathrm {Dose} (\mathrm {mg} )=\mathrm {AUC} \cdot (\mathrm {GFR} +25)}
The typical area under the curve (AUC) for carboplatin ranges from 3-7 (mg/ml)*min.
History
Carboplatin was discovered at Michigan State University, and developed at the Institute of Cancer Research in London. Bristol-Myers Squibb gained Food and Drug Administration (FDA) approval for carboplatin, under the brand name Paraplatin, in March 1989. Starting in October 2004, generic versions of the drug became available.
Research
Carboplatin has also been used for adjuvant therapy of stage 1 seminomatous testicular cancer. Research has indicated that it is not less effective than adjuvant radiotherapy for this treatment, while having fewer side effects. This has led to carboplatin based adjuvant therapy being generally preferred over adjuvant radiotherapy in clinical practice.Carboplatin combined with hexadecyl chain and polyethylene glycol appears to have increased liposolubility and PEGylation. This is useful in chemotherapy, specifically non-small cell lung cancer.
See also
Cisplatin
Dicycloplatin
References
Additional references
External links
Creatinine Clearence [sic] Calculator
"Carboplatin". Drug Information Portal. U.S. National Library of Medicine. |
You are a medical advisor. Your role is to break down medical terminology into clear, detailed explanations for a general audience. | The term 'Potassium phosphate' keeps coming up in medical discussions. What does it stand for? | Potassium phosphate is a generic term for the salts of potassium and phosphate ions including:
Monopotassium phosphate (KH2PO4) (Molar mass approx: 136 g/mol)
Dipotassium phosphate (K2HPO4) (Molar mass approx: 174 g/mol)
Tripotassium phosphate (K3PO4) (Molar mass approx: 212.27 g/mol)As food additives, potassium phosphates have the E number E340.
== References == |
You are a facilitator of medical knowledge. Provide thorough and accessible explanations of medical terms, catering to both specialists and non-specialists. | What is the significance of the term 'Tabes dorsalis' in the medical field? | Tabes dorsalis is a late consequence of neurosyphilis, characterized by the slow degeneration (specifically, demyelination) of the neural tracts primarily in the dorsal root ganglia of the spinal cord (nerve root). These patients have lancinating nerve root pain which is aggravated by coughing, and features of sensory ataxia with ocular involvement.
Signs and symptoms
Signs and symptoms may not appear for decades after the initial infection and include weakness, diminished reflexes, paresthesias (shooting and burning pains, pricking sensations, and formication), hypoesthesias (abnormally diminished sense of touch), tabetic gait (locomotor ataxia), progressive degeneration of the joints, loss of coordination, episodes of intense pain and disturbed sensation (including glossodynia), personality changes, urinary incontinence, dementia, deafness, visual impairment, positive Rombergs test, and impaired response to light (Argyll Robertson pupil). The skeletal musculature is hypotonic due to destruction of the sensory limb of the spindle reflex. The deep tendon reflexes are also diminished or absent; for example, the "knee jerk" or patellar reflex may be lacking (Westphals sign). A complication of tabes dorsalis can be transient neuralgic paroxysmal pain affecting the eyes and the ophthalmic areas, previously called "Pels crises" after Dutch physician P.K. Pel. Now more commonly called "tabetic ocular crises", an attack is characterized by sudden, intense eye pain, tearing of the eyes and sensitivity to light."Tabes dorsalgia" is a related lancinating back pain."Tabetic gait" is a characteristic ataxic gait of untreated syphilis where the persons feet slap the ground as they strike the floor due to loss of proprioception. In daylight the person can avoid some unsteadiness by watching their own feet.
Cause
Tabes dorsalis is caused by demyelination by advanced syphilis infection (tertiary syphilis), when the primary infection by the causative spirochete bacterium, Treponema pallidum, is left untreated for an extended period of time (past the point of blood infection by the organism). The spirochete invades large myelinated fibers, leading to the involvement of the dorsal column medial leminiscus pathway rather than the spinothalamic tract.
Diagnosis
Routine screening for syphilis.
Treponomal antibody usually positive both in blood and in csf also.
In CSF lymphocytosis and elevated protein found.
Serological tests are usually positive.
Treatment
Intravenously administered penicillin is the treatment of choice. Associated pain can be treated with opiates, valproate, or carbamazepine. Those with tabes dorsalis may also require physical therapy and occupational therapy to deal with muscle wasting and weakness. Preventive treatment for those who come into sexual contact with an individual with syphilis is important.
Prognosis
Left untreated, tabes dorsalis can lead to paralysis, dementia, and blindness. Existing nerve damage cannot be reversed.
Epidemiology
The disease is more frequent in males than in females. Onset is commonly during mid-life. The incidence of tabes dorsalis is rising, in part due to co-associated HIV infection.
History
Although there were earlier clinical accounts of this disease, and descriptions and illustrations of the posterior columns of the spinal cord, it was the Berlin neurologist Romberg whose account became the classical textbook description, first published in German and later translated into English.Sir Arthur Conan Doyle, author of the Sherlock Holmes stories, completed his doctorate on tabes dorsalis in 1885.
Notable patients
German storywriter E.T.A. Hoffmann appears to have had and died from tabes dorsalis.
The French novelist Alphonse Daudet kept a journal of the pain he experienced from this condition which was posthumously published as La Doulou (1930) and translated into English as In the Land of Pain (2002) by Julian Barnes.
Poet Charles Baudelaire contracted syphilis in 1839 and resorted to opium to help alleviate the pain of tabes dorsalis ascending his spine.
Painter Édouard Manet died of syphilis complications, including tabes dorsalis, in 1883, aged 51.
Boxer Charley Mitchell
Meyer Nudelman, the father of author and doctor Sherwin Nuland, who described his fathers condition extensively in his book Lost in America; A Journey with my Father (2003).
See also
General paresis of the insane
Category:Deaths from tabes dorsalis
References
tabes_dorsalis at NINDS
An Essay Upon the Vasomotor Changes in Tabes Dorsalis by Arthur Conan Doyle
== External links == |
You serve as an encyclopedia of medical terms. Deliver clear, detailed explanations, making medical language understandable to a diverse audience. | I'm seeking clarification on the medical term 'Alglucosidase alfa.' Could you explain it? | Alglucosidase alfa, sold under the brand name Myozyme among others, is an enzyme replacement therapy (ERT) orphan drug for treatment of Pompe disease (Glycogen storage disease type II), a rare lysosomal storage disorder (LSD).
Chemically speaking, the drug is an analog of the enzyme that is deficient in patients affected by Pompe disease, alpha-glucosidase. It is the first drug available to treat this disease.It was approved for medical use in the United States in April 2006, as Myozyme and in May 2010, as Lumizyme.
Medical uses
Alglucosidase alfa is indicated for people with Pompe disease (GAA deficiency).In 2014 the U.S. Food and Drug Administration announced the approval of alglucosidase alfa for treatment of people with infantile-onset Pompe disease, including people who are less than eight years of age. In addition, the Risk Evaluation and Mitigation Strategy (REMS) is being eliminated.
Side effects
Common observed adverse reactions to alglucosidase alfa treatment are pneumonia, respiratory complications, infections and fever. More serious reactions reported include heart and lung failure and allergic shock. Myozyme boxes carry warnings regarding the possibility of life-threatening allergic response.
Cost
Some health plans have refused to subsidize Myozyme for adults because it lacks approval for treatment in adults, as well as its high cost (US$300,000 per year for life).In 2015, Lumizyme was ranked the costliest drug per patient, with an average charge of $630,159.
References
External links
"Alglucosidase Alfa". Drug Information Portal. U.S. National Library of Medicine. |
You are a medical lexicon. Explain medical terminology with depth and clarity, making sure the information is both accurate and easy to grasp. | I've come across the term 'Autosomal dominant hypophosphatemic rickets' in a medical context, but I'm not sure what it means. Can you clarify? | Autosomal dominant hypophosphatemic rickets (ADHR) is a rare hereditary disease in which excessive loss of phosphate in the urine leads to poorly formed bones (rickets), bone pain, and tooth abscesses. ADHR is caused by a mutation in the fibroblast growth factor 23 (FGF23). ADHR affects men and women equally; symptoms may become apparent at any point from childhood through early adulthood. Blood tests reveal low levels of phosphate (hypophosphatemia) and inappropriately normal levels of vitamin D. Occasionally, hypophosphatemia may improve over time as urine losses of phosphate partially correct.ADHR may be lumped in with X-linked hypophosphatemia under general terms such as hypophosphatemic rickets. Hypophosphatemic rickets are associated with at least nine other genetic mutations. Clinical management of hypophosphatemic rickets may differ depending on the specific mutations associated with an individual case, but treatments are aimed at raising phosphate levels to promote normal bone formation.
References
Further reading
"Hereditary hypophosphatemic rickets". Genetics Home Reference. September 2010. Archived from the original on 17 September 2012. Retrieved 10 October 2012.
"Hypophosphatemic Rickets". The Merck Manual Home Health Handbook. Merck Sharp & Dohme Corp. December 2006. Archived from the original on 13 October 2012. Retrieved 10 October 2012.
== External links == |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | I'm looking for a concise explanation of the medical term 'Endometrial cancer.' | Endometrial cancer is a cancer that arises from the endometrium (the lining of the uterus or womb). It is the result of the abnormal growth of cells that have the ability to invade or spread to other parts of the body. The first sign is most often vaginal bleeding not associated with a menstrual period. Other symptoms include pain with urination, pain during sexual intercourse, or pelvic pain. Endometrial cancer occurs most commonly after menopause.Approximately 40% of cases are related to obesity. Endometrial cancer is also associated with excessive estrogen exposure, high blood pressure and diabetes. Whereas taking estrogen alone increases the risk of endometrial cancer, taking both estrogen and a progestogen in combination, as in most birth control pills, decreases the risk. Between two and five percent of cases are related to genes inherited from the parents. Endometrial cancer is sometimes loosely referred to as "uterine cancer", although it is distinct from other forms of uterine cancer such as cervical cancer, uterine sarcoma, and trophoblastic disease. The most frequent type of endometrial cancer is endometrioid carcinoma, which accounts for more than 80% of cases. Endometrial cancer is commonly diagnosed by endometrial biopsy or by taking samples during a procedure known as dilation and curettage. A pap smear is not typically sufficient to show endometrial cancer. Regular screening in those at normal risk is not called for.The leading treatment option for endometrial cancer is abdominal hysterectomy (the total removal by surgery of the uterus), together with removal of the Fallopian tubes and ovaries on both sides, called a bilateral salpingo-oophorectomy. In more advanced cases, radiation therapy, chemotherapy or hormone therapy may also be recommended. If the disease is diagnosed at an early stage, the outcome is favorable, and the overall five-year survival rate in the United States is greater than 80%.In 2012, endometrial cancers newly occurred in 320,000 women and caused 76,000 deaths. This makes it the third most common cause of death in cancers which only affect women, behind ovarian and cervical cancer. It is more common in the developed world and is the most common cancer of the female reproductive tract in developed countries. Rates of endometrial cancer have risen in a number of countries between the 1980s and 2010. This is believed to be due to the increasing number of elderly people and increasing rates of obesity.
Signs and symptoms
Vaginal bleeding or spotting in women after menopause occurs in 90% of endometrial cancer. Bleeding is especially common with adenocarcinoma, occurring in two-thirds of all cases. Abnormal menstrual cycles or extremely long, heavy, or frequent episodes of bleeding in women before menopause may also be a sign of endometrial cancer.Symptoms other than bleeding are not common. Other symptoms include thin white or clear vaginal discharge in postmenopausal women. More advanced disease shows more obvious symptoms or signs that can be detected on a physical examination. The uterus may become enlarged or the cancer may spread, causing lower abdominal pain or pelvic cramping. Painful sexual intercourse or painful or difficult urination are less common signs of endometrial cancer. The uterus may also fill with pus (pyometrea). Of women with these less common symptoms (vaginal discharge, pelvic pain, and pus), 10–15% have cancer.
Risk factors
Risk factors for endometrial cancer include obesity, insulin resistance and diabetes mellitus, breast cancer, use of tamoxifen, never having had a child, late menopause, high levels of estrogen, and increasing age. Immigration studies (migration studies), which examine the change in cancer risk in populations moving between countries with different rates of cancer, show that there is some environmental component to endometrial cancer. These environmental risk factors are not well characterized.
Hormones
Most of the risk factors for endometrial cancer involve high levels of estrogens. An estimated 40% of cases are thought to be related to obesity. In obesity, the excess of adipose tissue increases conversion of androstenedione into estrone, an estrogen. Higher levels of estrone in the blood causes less or no ovulation, and exposes the endometrium continuously to high levels of estrogens. Obesity also causes less estrogen to be removed from the blood. Polycystic ovary syndrome (PCOS), which also causes irregular or no ovulation, is associated with higher rates of endometrial cancer for the same reasons as obesity. Specifically, obesity, type II diabetes, and insulin resistance are risk factors for Type I endometrial cancer. Obesity increases the risk for endometrial cancer by 300–400%.Estrogen replacement therapy during menopause when not balanced (or "opposed") with progestin is another risk factor. Higher doses or longer periods of estrogen therapy have higher risks of endometrial cancer. Women of lower weight are at greater risk from unopposed estrogen. A longer period of fertility—either from an early first menstrual period or late menopause—is also a risk factor. Unopposed estrogen raises an individuals risk of endometrial cancer by 2–10 fold, depending on weight and length of therapy. In trans men who take testosterone and have not had a hysterectomy, the conversion of testosterone into estrogen via androstenedione may lead to a higher risk of endometrial cancer.
Genetics
Genetic disorders can also cause endometrial cancer. Overall, hereditary causes contribute to 2–10% of endometrial cancer cases. Lynch syndrome, an autosomal dominant genetic disorder that mainly causes colorectal cancer, also causes endometrial cancer, especially before menopause. Women with Lynch syndrome have a 40–60% risk of developing endometrial cancer, higher than their risk of developing colorectal (bowel) or ovarian cancer. Ovarian and endometrial cancer develop simultaneously in 20% of people. Endometrial cancer nearly always develops before colon cancer, on average, 11 years before. Carcinogenesis in Lynch syndrome comes from a mutation in MLH1 or MLH2: genes that participate in the process of mismatch repair, which allows a cell to correct mistakes in the DNA. Other genes mutated in Lynch syndrome include MSH2, MSH6, and PMS2, which are also mismatch repair genes. Women with Lynch syndrome represent 2–3% of endometrial cancer cases; some sources place this as high as 5%. Depending on the gene mutation, women with Lynch syndrome have different risks of endometrial cancer. With MLH1 mutations, the risk is 54%; with MSH2, 21%; and with MSH6, 16%.Women with a family history of endometrial cancer are at higher risk. Two genes most commonly associated with some other womens cancers, BRCA1 and BRCA2, do not cause endometrial cancer. There is an apparent link with these genes but it is attributable to the use of tamoxifen, a drug that itself can cause endometrial cancer, in breast and ovarian cancers. The inherited genetic condition Cowden syndrome can also cause endometrial cancer. Women with this disorder have a 5–10% lifetime risk of developing endometrial cancer, compared to the 2–3% risk for unaffected women.Common genetic variation has also been found to affect endometrial cancer risk in large-scale genome-wide association studies. Sixteen genomic regions have been associated with endometrial cancer and the common variants explain up to 7% of the familial relative risk.
Other health problems
Some therapies for other forms of cancer increase the lifetime risk of endometrial cancer, which is a baseline 2–3%. Tamoxifen, a drug used to treat estrogen-positive breast cancers, has been associated with endometrial cancer in approximately 0.1% of users, particularly older women, but the benefits for survival from tamoxifen generally outweigh the risk of endometrial cancer. A one to two-year course of tamoxifen approximately doubles the risk of endometrial cancer, and a five-year course of therapy quadruples that risk. Raloxifene, a similar drug, did not raise the risk of endometrial cancer. Previously having ovarian cancer is a risk factor for endometrial cancer, as is having had previous radiotherapy to the pelvis. Specifically, ovarian granulosa cell tumors and thecomas are tumors associated with endometrial cancer.
Low immune function has also been implicated in endometrial cancer. High blood pressure is also a risk factor, but this may be because of its association with obesity. Sitting regularly for prolonged periods is associated with higher mortality from endometrial cancer. The risk is not negated by regular exercise, though it is lowered.
Protective factors
Smoking and the use of progestin are both protective against endometrial cancer. Smoking provides protection by altering the metabolism of estrogen and promoting weight loss and early menopause. This protective effect lasts long after smoking is stopped. Progestin is present in the combined oral contraceptive pill and the hormonal intrauterine device (IUD). Combined oral contraceptives reduce risk more the longer they are taken: by 56% after four years, 67% after eight years, and 72% after twelve years. This risk reduction continues for at least fifteen years after contraceptive use has been stopped. Obese women may need higher doses of progestin to be protected. Having had more than five infants (grand multiparity) is also a protective factor, and having at least one child reduces the risk by 35%. Breastfeeding for more than 18 months reduces risk by 23%. Increased physical activity reduces an individuals risk by 38–46%. There is preliminary evidence that consumption of soy is protective.
Pathophysiology
Endometrial cancer forms when there are errors in normal endometrial cell growth. Usually, when cells grow old or get damaged, they die, and new cells take their place. Cancer starts when new cells form unneeded, and old or damaged cells do not die as they should. The buildup of extra cells often forms a mass of tissue called a growth or tumor. These abnormal cancer cells have many genetic abnormalities that cause them to grow excessively.In 10–20% of endometrial cancers, mostly Grade 3 (the highest histologic grade), mutations are found in a tumor suppressor gene, commonly p53 or PTEN. In 20% of endometrial hyperplasias and 50% of endometrioid cancers, PTEN has a loss-of-function mutation or a null mutation, making it less effective or completely ineffective. Loss of PTEN function leads to up-regulation of the PI3k/Akt/mTOR pathway, which causes cell growth. The p53 pathway can either be suppressed or highly activated in endometrial cancer. When a mutant version of p53 is overexpressed, the cancer tends to be particularly aggressive. P53 mutations and chromosome instability are associated with serous carcinomas, which tend to resemble ovarian and Fallopian carcinomas. Serous carcinomas are thought to develop from endometrial intraepithelial carcinoma.
PTEN and p27 loss of function mutations are associated with a good prognosis, particularly in obese women. The Her2/neu oncogene, which indicates a poor prognosis, is expressed in 20% of endometrioid and serous carcinomas. CTNNB1 (beta-catenin; a transcription gene) mutations are found in 14–44% of endometrial cancers and may indicate a good prognosis, but the data is unclear. Beta-catenin mutations are commonly found in endometrial cancers with squamous cells. FGFR2 mutations are found in approximately 10% of endometrial cancers, and their prognostic significance is unclear. SPOP is another tumor suppressor gene found to be mutated in some cases of endometrial cancer: 9% of clear cell endometrial carcinomas and 8% of serous endometrial carcinomas have mutations in this gene.Type I and Type II cancers (explained below) tend to have different mutations involved. ARID1A, which often carries a point mutation in Type I endometrial cancer, is also mutated in 26% of clear cell carcinomas of the endometrium, and 18% of serous carcinomas. Epigenetic silencing and point mutations of several genes are commonly found in Type I endometrial cancer. Mutations in tumor suppressor genes are common in Type II endometrial cancer. PIK3CA is commonly mutated in both Type I and Type II cancers. In women with Lynch syndrome-associated endometrial cancer, microsatellite instability is common.Development of an endometrial hyperplasia (overgrowth of endometrial cells) is a significant risk factor because hyperplasias can and often do develop into adenocarcinoma, though cancer can develop without the presence of a hyperplasia. Within ten years, 8–30% of atypical endometrial hyperplasias develop into cancer, whereas 1–3% of non-atypical hyperplasias do so. An atypical hyperplasia is one with visible abnormalities in the nuclei. Pre-cancerous endometrial hyperplasias are also referred to as endometrial intraepithelial neoplasia. Mutations in the KRAS gene can cause endometrial hyperplasia and therefore Type I endometrial cancer. Endometrial hyperplasia typically occurs after the age of 40. Endometrial glandular dysplasia occurs with an overexpression of p53, and develops into a serous carcinoma.
Diagnosis
Diagnosis of endometrial cancer is made first by a physical examination, endometrial biopsy, or dilation and curettage (removal of endometrial tissue; D&C). This tissue is then examined histologically for characteristics of cancer. If cancer is found, medical imaging may be done to see whether the cancer has spread or invaded tissue.
Examination
Routine screening of asymptomatic people is not indicated since the disease is highly curable in its early, symptomatic stages. Instead, women, particularly menopausal women, should be aware of the symptoms and risk factors of endometrial cancer. A cervical screening test, such as a Pap smear, is not a useful diagnostic tool for endometrial cancer because the smear will be normal 50% of the time. A Pap smear can detect disease that has spread to the cervix. Results from a pelvic examination are frequently normal, especially in the early stages of disease. Changes in the size, shape or consistency of the uterus or its surrounding, supporting structures may exist when the disease is more advanced. Cervical stenosis, the narrowing of the cervical opening, is a sign of endometrial cancer when pus or blood is found collected in the uterus (pyometra or hematometra).Women with Lynch syndrome should begin to have annual biopsy screening at the age of 35. Some women with Lynch syndrome elect to have a prophylactic hysterectomy and salpingo-oophorectomy to greatly reduce the risk of endometrial and ovarian cancer.Transvaginal ultrasound to examine the endometrial thickness in women with postmenopausal bleeding is increasingly being used to aid in the diagnosis of endometrial cancer in the United States. In the United Kingdom, both an endometrial biopsy and a transvaginal ultrasound used in conjunction are the standard of care for diagnosing endometrial cancer. The homogeneity of the tissue visible on transvaginal ultrasound can help to indicate whether the thickness is cancerous. Ultrasound findings alone are not conclusive in cases of endometrial cancer, so another screening method (for example endometrial biopsy) must be used in conjunction. Other imaging studies are of limited use. CT scans are used for preoperative imaging of tumors that appear advanced on physical exam or have a high-risk subtype (at high risk of metastasis). They can also be used to investigate extrapelvic disease. An MRI can be of some use in determining if the cancer has spread to the cervix or if it is an endocervical adenocarcinoma. MRI is also useful for examining the nearby lymph nodes.Dilation and curettage or an endometrial biopsy are used to obtain a tissue sample for histological examination. Endometrial biopsy is the less invasive option, but it may not give conclusive results every time. Hysteroscopy only shows the gross anatomy of the endometrium, which is often not indicative of cancer, and is therefore not used, unless in conjunction with a biopsy. Hysteroscopy can be used to confirm a diagnosis of cancer. New evidence shows that D&C has a higher false negative rate than endometrial biopsy.Before treatment is begun, several other investigations are recommended. These include a chest x-ray, liver function tests, kidney function tests, and a test for levels of CA-125, a tumor marker that can be elevated in endometrial cancer.
Classification
Endometrial cancers may be tumors derived from epithelial cells (carcinomas), mixed epithelial and mesenchymal tumors (carcinosarcomas), or mesenchymal tumors.
Traditional classification of endometrial carcinomas is based either on clinical and endocrine features (Type I and Type II), or histopathological characteristics (endometrioid, serous, and clear-cell). Some tumors are difficult to classify and have features overlapping more than one category. High grade endometrioid tumors, in particular, tend to have both type I and type II features.
Carcinoma
The vast majority of endometrial cancers are carcinomas (usually adenocarcinomas), meaning that they originate from the single layer of epithelial cells that line the endometrium and form the endometrial glands. There are many microscopic subtypes of endometrial carcinoma, but they are broadly organized into two categories, Type I and Type II, based on clinical features and pathogenesis. The two subtypes are genetically distinct.Type I endometrial carcinomas occur most commonly before and around the time of menopause. In the United States, they are more common in white women, particularly those with a history of endometrial hyperplasia. Type I endometrial cancers are often low-grade, minimally invasive into the underlying uterine wall (myometrium), estrogen-dependent, and have a good outcome with treatment. Type I carcinomas represent 75–90% of endometrial cancer.Type II endometrial carcinomas usually occur in older, post-menopausal people, in the United States are more common in black women, and are not associated with increased exposure to estrogen or a history of endometrial hyperplasia. Type II endometrial cancers are often high-grade, with deep invasion into the underlying uterine wall (myometrium), are of the serous or clear cell type, and carry a poorer prognosis. They can appear to be epithelial ovarian cancer on evaluation of symptoms. They tend to present later than Type I tumors and are more aggressive, with a greater risk of relapse and/or metastasis.
Endometrioid adenocarcinoma
In endometrioid adenocarcinoma, the cancer cells grow in patterns reminiscent of normal endometrium, with many new glands formed from columnar epithelium with some abnormal nuclei. Low-grade endometrioid adenocarcinomas have well differentiated cells, have not invaded the myometrium, and are seen alongside endometrial hyperplasia. The tumors glands form very close together, without the stromal tissue that normally separates them. Higher-grade endometrioid adenocarcinomas have less well-differentiated cells, have more solid sheets of tumor cells no longer organized into glands, and are associated with an atrophied endometrium. There are several subtypes of endometrioid adenocarcinoma with similar prognoses, including villoglandular, secretory, and ciliated cell variants. There is also a subtype characterized by squamous differentiation. Some endometrioid adenocarcinomas have foci of mucinous carcinoma.The genetic mutations most commonly associated with endometrioid adenocarcinoma are in the genes PTEN, a tumor suppressor; PIK3CA, a kinase; KRAS, a GTPase that functions in signal transduction; and CTNNB1, involved in adhesion and cell signaling. The CTNNB1 (beta-catenin) gene is most commonly mutated in the squamous subtype of endometrioid adenocarcinoma.
Serous carcinoma
Serous carcinoma is a Type II endometrial tumor that makes up 5–10% of diagnosed endometrial cancer and is common in postmenopausal women with atrophied endometrium and black women. Serous endometrial carcinoma is aggressive and often invades the myometrium and metastasizes within the peritoneum (seen as omental caking) or the lymphatic system. Histologically, it appears with many atypical nuclei, papillary structures, and, in contrast to endometrioid adenocarcinomas, rounded cells instead of columnar cells. Roughly 30% of endometrial serous carcinomas also have psammoma bodies. Serous carcinomas spread differently than most other endometrial cancers; they can spread outside the uterus without invading the myometrium.The genetic mutations seen in serous carcinoma are chromosomal instability and mutations in TP53, an important tumor suppressor gene.
Clear cell carcinoma
Clear cell carcinoma is a Type II endometrial tumor that makes up less than 5% of diagnosed endometrial cancer. Like serous cell carcinoma, it is usually aggressive and carries a poor prognosis. Histologically, it is characterized by the features common to all clear cells: the eponymous clear cytoplasm when H&E stained and visible, distinct cell membranes. The p53 cell signaling system is not active in endometrial clear cell carcinoma. This form of endometrial cancer is more common in postmenopausal women.
Mucinous carcinoma
Mucinous carcinomas are a rare form of endometrial cancer, making up less than 1–2% of all diagnosed endometrial cancer. Mucinous endometrial carcinomas are most often stage I and grade I, giving them a good prognosis. They typically have well-differentiated columnar cells organized into glands with the characteristic mucin in the cytoplasm. Mucinous carcinomas must be differentiated from cervical adenocarcinoma.
Mixed or undifferentiated carcinoma
Mixed carcinomas are those that have both Type I and Type II cells, with one making up at least 10% of the tumor. These include the malignant mixed Müllerian tumor, which derives from endometrial epithelium and has a poor prognosis.Undifferentiated endometrial carcinomas make up less than 1–2% of diagnosed endometrial cancers. They have a worse prognosis than grade III tumors. Histologically, these tumors show sheets of identical epithelial cells with no identifiable pattern.
Other carcinomas
Non-metastatic squamous cell carcinoma and transitional cell carcinoma are very rare in the endometrium. Squamous cell carcinoma of the endometrium has a poor prognosis. It has been reported fewer than 100 times in the medical literature since its characterization in 1892. For primary squamous cell carcinoma of the endometrium (PSCCE) to be diagnosed, there must be no other primary cancer in the endometrium or cervix and it must not be connected to the cervical epithelium. Because of the rarity of this cancer, there are no guidelines for how it should be treated, nor any typical treatment. The common genetic causes remain uncharacterized. Primary transitional cell carcinomas of the endometrium are even more rare; 16 cases had been reported as of 2008. Its pathophysiology and treatments have not been characterized. Histologically, TCCE resembles endometrioid carcinoma and is distinct from other transitional cell carcinomas.
Sarcoma
In contrast to endometrial carcinomas, the uncommon endometrial stromal sarcomas are cancers that originate in the non-glandular connective tissue of the endometrium. They are generally non-aggressive and, if they recur, can take decades. Metastases to the lungs and pelvic or peritoneal cavities are the most frequent. They typically have estrogen and/or progesterone receptors. The prognosis for low-grade endometrial stromal sarcoma is good, with 60–90% five-year survival. High-grade undifferentiated endometrial sarcoma (HGUS) has a worse prognosis, with high rates of recurrence and 25% five-year survival. HGUS prognosis is dictated by whether or not the cancer has invaded the arteries and veins. Without vascular invasion, the five-year survival is 83%; it drops to 17% when vascular invasion is observed. Stage I ESS has the best prognosis, with five-year survival of 98% and ten-year survival of 89%. ESS makes up 0.2% of uterine cancers.
Metastasis
Endometrial cancer frequently metastasizes to the ovaries and Fallopian tubes when the cancer is located in the upper part of the uterus, and the cervix when the cancer is in the lower part of the uterus. The cancer usually first spreads into the myometrium and the serosa, then into other reproductive and pelvic structures. When the lymphatic system is involved, the pelvic and para-aortic nodes are usually first to become involved, but in no specific pattern, unlike cervical cancer. More distant metastases are spread by the blood and often occur in the lungs, as well as the liver, brain, and bone. Endometrial cancer metastasizes to the lungs 20–25% of the time, more than any other gynecologic cancer.
Histopathology
There is a three-tiered system for histologically classifying endometrial cancers, ranging from cancers with well-differentiated cells (grade I), to very poorly-differentiated cells (grade III). Grade I cancers are the least aggressive and have the best prognosis, while grade III tumors are the most aggressive and likely to recur. Grade II cancers are intermediate between grades I and III in terms of cell differentiation and aggressiveness of disease.The histopathology of endometrial cancers is highly diverse. The most common finding is a well-differentiated endometrioid adenocarcinoma, which is composed of numerous, small, crowded glands with varying degrees of nuclear atypia, mitotic activity, and stratification. This often appears on a background of endometrial hyperplasia. Frank adenocarcinoma may be distinguished from atypical hyperplasia by the finding of clear stromal invasion, or "back-to-back" glands which represent nondestructive replacement of the endometrial stroma by the cancer. With progression of the disease, the myometrium is infiltrated.
Staging
Endometrial carcinoma is surgically staged using the FIGO cancer staging system. The 2009 FIGO staging system is as follows:
Myometrial invasion and involvement of the pelvic and para-aortic lymph nodes are the most commonly seen patterns of spread. A Stage 0 is sometimes included, in this case it is referred to as "carcinoma in situ". In 26% of presumably early-stage cancers, intraoperative staging revealed pelvic and distant metastases, making comprehensive surgical staging necessary.
Management
Surgery
The initial treatment for endometrial cancer is surgery; 90% of women with endometrial cancer are treated with some form of surgery. Surgical treatment typically consists of hysterectomy including a bilateral salpingo-oophorectomy, which is the removal of the uterus, and both ovaries and Fallopian tubes. Lymphadenectomy, or removal of pelvic and para-aortic lymph nodes, is performed for tumors of histologic grade II or above. Lymphadenectomy is routinely performed for all stages of endometrial cancer in the United States, but in the United Kingdom, the lymph nodes are typically only removed with disease of stage II or greater. The topic of lymphadenectomy and what survival benefit it offers in stage I disease is still being debated. In women with presumed stage I disease, a 2017 systematic review found no evidence that lymphadenectomy reduces the risk of death or relapse of cancer when compared with no lymphadenectomy. Women who undergo lymphadenectomy are more likely to experience systemic morbidity related to surgery or lymphoedema/lymphocyst formation. In stage III and IV cancers, cytoreductive surgery is the norm, and a biopsy of the omentum may also be included. In stage IV disease, where there are distant metastases, surgery can be used as part of palliative therapy. Laparotomy, an open-abdomen procedure, is the traditional surgical procedure; however, in those with presumed early stage primary endometrial cancer, laparoscopy (keyhole surgery) is associated with reduced operative morbidity and similar overall and disease free survival. Removal of the uterus via the abdomen is recommended over removal of the uterus via the vagina because it gives the opportunity to examine and obtain washings of the abdominal cavity to detect any further evidence of cancer. Staging of the cancer is done during the surgery.The few contraindications to surgery include inoperable tumor, massive obesity, a particularly high-risk operation, or a desire to preserve fertility. These contraindications happen in about 5–10% of cases. Women who wish to preserve their fertility and have low-grade stage I cancer can be treated with progestins, with or without concurrent tamoxifen therapy. This therapy can be continued until the cancer does not respond to treatment or until childbearing is done. Uterine perforation may occur during a D&C or an endometrial biopsy. Side effects of surgery to remove endometrial cancer can specifically include sexual dysfunction, temporary incontinence, and lymphedema, along with more common side effects of any surgery, including constipation.
Add-on therapy
There are a number of possible additional therapies. Surgery can be followed by radiation therapy and/or chemotherapy in cases of high-risk or high-grade cancers. This is called adjuvant therapy.
Chemotherapy
Adjuvant chemotherapy is a recent innovation, consisting of some combination of paclitaxel (or other taxanes like docetaxel), doxorubicin (and other anthracyclines), and platins (particularly cisplatin and carboplatin). Adjuvant chemotherapy has been found to increase survival in stage III and IV cancer more than added radiotherapy. Mutations in mismatch repair genes, like those found in Lynch syndrome, can lead to resistance against platins, meaning that chemotherapy with platins is ineffective in people with these mutations. Side effects of chemotherapy are common. These include hair loss, low neutrophil levels in the blood, and gastrointestinal problems.In cases where surgery is not indicated, palliative chemotherapy is an option; higher-dose chemotherapy is associated with longer survival. Palliative chemotherapy, particularly using capecitabine and gemcitabine, is also often used to treat recurrent endometrial cancer.Low certainty evidence suggests that in women with recurrent endometrial cancer who have had chemotherapy, receiving drugs that inhibit the mTOR pathway may reduce the risk of disease worsening compared to having more chemotherapy or hormonal therapy. Though, mTOR inhibitors may increase the chance of experiencing digestive tract ulcers.
Radiotherapy
Adjuvant radiotherapy is commonly used in early-stage (stage I or II) endometrial cancer. It can be delivered through vaginal brachytherapy (VBT), which is becoming the preferred route due to its reduced toxicity, or external beam radiotherapy (EBRT). Brachytherapy involves placing a radiation source in the organ affected; in the case of endometrial cancer a radiation source is placed directly in the vagina. External beam radiotherapy involves a beam of radiation aimed at the affected area from outside the body. VBT is used to treat any remaining cancer solely in the vagina, whereas EBRT can be used to treat remaining cancer elsewhere in the pelvis following surgery. However, the benefits of adjuvant radiotherapy are controversial. Though EBRT significantly reduces the rate of relapse in the pelvis, overall survival and metastasis rates are not improved. VBT provides a better quality of life than EBRT.Radiotherapy can also be used before surgery in certain cases. When pre-operative imaging or clinical evaluation shows tumor invading the cervix, radiation can be given before a total hysterectomy is performed. Brachytherapy and EBRT can also be used, singly or in combination, when there is a contraindication for hysterectomy. Both delivery methods of radiotherapy are associated with side effects, particularly in the gastrointestinal tract.
Hormonal therapy
Hormonal therapy is only beneficial in certain types of endometrial cancer. It was once thought to be beneficial in most cases. If a tumor is well-differentiated and known to have progesterone and estrogen receptors, progestins may be used in treatment. There is no evidence to support the use of progestagen in addition to surgery for newly diagnosed endometrial cancer. About 25% of metastatic endometrioid cancers show a response to progestins. Also, endometrial stromal sarcomas can be treated with hormonal agents, including tamoxifen, hydroxyprogesterone caproate, letrozole, megestrol acetate, and medroxyprogesterone. This treatment is effective in endometrial stromal sarcomas because they typically have estrogen and/or progestin receptors. Progestin receptors function as tumor suppressors in endometrial cancer cells. Preliminary research and clinical trials have shown these treatments to have a high rate of response even in metastatic disease.In 2010 hormonal therapy is of unclear effect in those with advanced or recurrent endometrial cancer. There is insufficient evidence to inform women considering hormone replacement therapy after treatment for endometrial cancer.
Targeted therapy
Dostarlimab has been approved by the FDA for therapy of endometrial cancer with specific biomarker
Monitoring
The tumor marker CA-125 is frequently elevated in endometrial cancer and can be used to monitor response to treatment, particularly in serous cell cancer or advanced disease. Periodic MRIs or CT scans may be recommended in advanced disease and women with a history of endometrial cancer should receive more frequent pelvic examinations for the five years following treatment. Examinations conducted every three to four months are recommended for the first two years following treatment, and every six months for the next three years.Women with endometrial cancer should not have routine surveillance imaging to monitor the cancer unless new symptoms appear or tumor markers begin rising. Imaging without these indications is discouraged because it is unlikely to detect a recurrence or improve survival, and because it has its own costs and side effects. If a recurrence is suspected, PET/CT scanning is recommended.
Prognosis
Survival rates
The five-year survival rate for endometrial adenocarcinoma following appropriate treatment is 80%. Most women, over 70%, have FIGO stage I cancer, which has the best prognosis. Stage III and especially Stage IV cancers has a worse prognosis, but these are relatively rare, occurring in only 13% of cases. The median survival time for stage III–IV endometrial cancer is nine to ten months. Older age indicates a worse prognosis. In the United States, white women have a higher survival rate than black women, who tend to develop more aggressive forms of the disease by the time of their diagnosis. Tumors with high progesterone receptor expression have a good prognosis compared to tumors with low progesterone receptor expression; 93% of women with high progesterone receptor disease survived to three years, compared with 36% of women with low progesterone receptor disease. Heart disease is the most common cause of death among those who survive endometrial cancer, with other obesity-related health problems also being common. Following diagnosis, quality of life is also positively associated with a healthy lifestyle (no obesity, high-quality diet, physical activity).
Recurrence rates
Recurrence of early stage endometrial cancer ranges from 3 to 17%, depending on primary and adjuvant treatment. Most recurrences (75–80%) occur outside of the pelvis, and most occur within two to three years of treatment—64% within two years and 87% within three years.Higher-staged cancers are more likely to recur, as are those that have invaded the myometrium or cervix, or that have metastasized into the lymphatic system. Papillary serous carcinoma, clear cell carcinoma, and endometrioid carcinoma are the subtypes at the highest risk of recurrence. High-grade histological subtypes are also at elevated risk for recurrence.The most common site of recurrence is in the vagina; vaginal relapses of endometrial cancer have the best prognosis. If relapse occurs from a cancer that has not been treated with radiation, EBRT is the first-line treatment and is often successful. If a cancer treated with radiation recurs, pelvic exenteration is the only option for curative treatment. Palliative chemotherapy, cytoreductive surgery, and radiation are also performed. Radiation therapy (VBT and EBRT) for a local vaginal recurrence has a 50% five-year survival rate. Pelvic recurrences are treated with surgery and radiation, and abdominal recurrences are treated with radiation and, if possible, chemotherapy. Other common recurrence sites are the pelvic lymph nodes, para-aortic lymph nodes, peritoneum (28% of recurrences), and lungs, though recurrences can also occur in the brain (<1%), liver (7%), adrenal glands (1%), bones (4–7%; typically the axial skeleton), lymph nodes outside the abdomen (0.4–1%), spleen, and muscle/soft tissue (2–6%).
Epidemiology
As of 2014, approximately 320,000 women are diagnosed with endometrial cancer worldwide each year and 76,000 die, making it the sixth most common cancer in women. It is more common in developed countries, where the lifetime risk of endometrial cancer in women is 1.6%, compared to 0.6% in developing countries. It occurs in 12.9 out of 100,000 women annually in developed countries.In the United States, endometrial cancer is the most frequently diagnosed gynecologic cancer and, in women, the fourth most common cancer overall, representing 6% of all cancer cases in women. In that country, as of 2014 it was estimated that 52,630 women were diagnosed yearly and 8,590 would die from the disease. Northern Europe, Eastern Europe, and North America have the highest rates of endometrial cancer, whereas Africa and West Asia have the lowest rates. Asia saw 41% of the worlds endometrial cancer diagnoses in 2012, whereas Northern Europe, Eastern Europe, and North America together comprised 48% of diagnoses. Unlike most cancers, the number of new cases has risen in recent years, including an increase of over 40% in the United Kingdom between 1993 and 2013. Some of this rise may be due to the increase in obesity rates in developed countries, increasing life expectancies, and lower birth rates. The average lifetime risk for endometrial cancer is approximately 2–3% in people with uteruses. In the UK, approximately 7,400 cases are diagnosed annually, and in the EU, approximately 88,000.Endometrial cancer appears most frequently during perimenopause (the period just before, just after, and during menopause), between the ages of 50 and 65; overall, 75% of endometrial cancer occurs after menopause. Women younger than 40 make up 5% of endometrial cancer cases and 10–15% of cases occur in women under 50 years of age. This age group is at risk for developing ovarian cancer at the same time. The worldwide median age of diagnosis is 63 years of age; in the United States, the average age of diagnosis is 60 years of age. White American women are at higher risk for endometrial cancer than black American women, with a 2.88% and 1.69% lifetime risk respectively. Japanese-American women and American Latina women have a lower rates and Native Hawaiian women have higher rates.
Research
There are several experimental therapies for endometrial cancer under research, including immunologic, hormonal, and chemotherapeutic treatments. Trastuzumab (Herceptin), an antibody against the Her2 protein, has been used in cancers known to be positive for the Her2/neu oncogene, but research is still underway. Immunologic therapies are also under investigation, particularly in uterine papillary serous carcinoma.Cancers can be analyzed using genetic techniques (including DNA sequencing and immunohistochemistry) to determine if certain therapies specific to mutated genes can be used to treat it. PARP inhibitors are used to treat endometrial cancer with PTEN mutations, specifically, mutations that lower the expression of PTEN. The PARP inhibitor shown to be active against endometrial cancer is olaparib. Research is ongoing in this area as of the 2010s.Research is ongoing on the use of metformin, a diabetes medication, in obese women with endometrial cancer before surgery. Early research has shown it to be effective in slowing the rate of cancer cell proliferation. Preliminary research has shown that preoperative metformin administration can reduce expression of tumor markers. Long-term use of metformin has not been shown to have a preventative effect against developing cancer, but may improve overall survival.Temsirolimus, an mTOR inhibitor, is under investigation as a potential treatment. Research shows that mTOR inhibitors may be particularly effective for cancers with mutations in PTEN. Ridaforolimus (deforolimus) is also being researched as a treatment for people who have previously had chemotherapy. Preliminary research has been promising, and a stage II trial for ridaforolimus was completed by 2013. There has also been research on combined ridaforolimus/progestin treatments for recurrent endometrial cancer. Bevacizumab and tyrosine kinase inhibitors, which inhibit angiogenesis, are being researched as potential treatments for endometrial cancers with high levels of vascular endothelial growth factor. Ixabepilone is being researched as a possible chemotherapy for advanced or recurrent endometrial cancer. Treatments for rare high-grade undifferentiated endometrial sarcoma are being researched, as there is no established standard of care yet for this disease. Chemotherapies being researched include doxorubicin and ifosfamide.There is also research in progress on more genes and biomarkers that may be linked to endometrial cancer. The protective effect of combined oral contraceptives and the IUD is being investigated. Preliminary research has shown that the levonorgestrel IUD placed for a year, combined with six monthly injections of gonadotropin-releasing hormone, can stop or reverse the progress of endometrial cancer in young women; specifically complex atypical hyperplasia however the results have been inconclusive. An experimental drug that combines a hormone with doxorubicin is also under investigation for greater efficacy in cancers with hormone receptors. Hormone therapy that is effective in treating breast cancer, including use of aromatase inhibitors, is also being investigated for use in endometrial cancer. One such drug is anastrozole, which is currently being researched in hormone-positive recurrences after chemotherapy. Research into hormonal treatments for endometrial stromal sarcomas is ongoing as well. It includes trials of drugs like mifepristone, a progestin antagonist, and aminoglutethimide and letrozole, two aromatase inhibitors.Research continues into the best imaging method for detecting and staging endometrial cancer. As current diagnostic methods are invasive and inaccurate, researchers are looking into new ways to catch endometrial cancer, especially in its early stages. A study found that using a technique involving infrared light on simple blood test samples detected uterine cancer with high accuracy (87%), and could detect precancerous growths in all cases. In surgery, research has shown that complete pelvic lymphadenectomy along with hysterectomy in stage 1 endometrial cancer does not improve survival and increases the risk of negative side effects, including lymphedema. Other research is exploring the potential of identifying the sentinel lymph nodes for biopsy by injecting the tumor with dye that shines under infrared light. Intensity modulated radiation therapy is currently under investigation, and already used in some centers, for application in endometrial cancer, to reduce side effects from traditional radiotherapy. Its risk of recurrence has not yet been quantified. Research on hyperbaric oxygen therapy to reduce side effects is also ongoing. The results of the PORTEC 3 trial assessing combining adjuvant radiotherapy with chemotherapy were awaited in late 2014.There is not enough evidence to determine if people with endometrial cancer benefit from additional behavioural and life style interventions that are aimed at losing excess weight.
History and culture
Endometrial cancer is not widely known by the general populace, despite its frequency. There is low awareness of the symptoms, which can lead to later diagnosis and worse survival.
References
External links
American Cancer Societys Detailed Guide: Endometrial Cancer
U.S. National Cancer Institute: Uterine cancer
Anatomical pathology images |
You serve as a medical tutor. Your objective is to demystify medical terms, providing thorough explanations that cater to various levels of medical knowledge. | I'm encountering the term 'Tracheobronchial injury' in medical literature. What's its definition? | Tracheobronchial injury is damage to the tracheobronchial tree (the airway structure involving the trachea and bronchi). It can result from blunt or penetrating trauma to the neck or chest, inhalation of harmful fumes or smoke, or aspiration of liquids or objects.Though rare, TBI is a serious condition; it may cause obstruction of the airway with resulting life-threatening respiratory insufficiency. Other injuries accompany TBI in about half of cases. Of those people with TBI who die, most do so before receiving emergency care, either from airway obstruction, exsanguination, or from injuries to other vital organs. Of those who do reach a hospital, the mortality rate may be as high as 30%.TBI is frequently difficult to diagnose and treat. Early diagnosis is important to prevent complications, which include stenosis (narrowing) of the airway, respiratory tract infection, and damage to the lung tissue. Diagnosis involves procedures such as bronchoscopy, radiography, and x-ray computed tomography to visualize the tracheobronchial tree. Signs and symptoms vary based on the location and severity of the injury; they commonly include dyspnea (difficulty breathing), dysphonia (a condition where the voice can be hoarse, weak, or excessively breathy), coughing, and abnormal breath sounds. In the emergency setting, tracheal intubation can be used to ensure that the airway remains open. In severe cases, surgery may be necessary to repair a TBI.
Signs and symptoms
Signs and symptoms vary depending on what part of the tracheobronchial tree is injured and how severely it is damaged. There are no direct signs of TBI, but certain signs suggest the injury and raise a clinicians suspicion that it has occurred. Many of the signs and symptoms are also present in injuries with similar injury mechanisms such as pneumothorax. Dyspnea and respiratory distress are found in 76–100% of people with TBI, and coughing up blood has been found in up to 25%. However, isolated TBI does not usually cause profuse bleeding; if such bleeding is observed it is likely to be due to another injury such as a ruptured large blood vessel. The patient may exhibit dysphonia or have diminished breath sounds, and rapid breathing is common. Coughing may be present, and stridor, an abnormal, high-pitched breath sound indicating obstruction of the upper airway can also occur.Damage to the airways can cause subcutaneous emphysema (air trapped in the subcutaneous tissue of the skin) in the abdomen, chest, neck, and head. Subcutaneous emphysema, present in up to 85% of people with TBI, is particularly indicative of the injury when it is only in the neck. Air is trapped in the chest cavity outside the lungs (pneumothorax) in about 70% of TBI. Especially strong evidence that TBI has occurred is failure of a pneumothorax to resolve even when a chest tube is placed to rid the chest cavity of the air; it shows that air is continually leaking into the chest cavity from the site of the tear. Air can also be trapped in the mediastinum, the center of the chest cavity (pneumomediastinum). If air escapes from a penetrating injury to the neck, a definite diagnosis of TBI can be made. Hammans sign, a sound of crackling that occurs in time with the heartbeat, may also accompany TBI.
Causes
Injuries to the tracheobronchial tree within the chest may occur due to penetrating forces such as gunshot wounds, but are more often the result of blunt trauma. TBI due blunt forces usually results from high-energy impacts such as falls from height and motor vehicle accidents; the injury is rare in low-impact mechanisms. Injuries of the trachea cause about 1% of traffic-related deaths. Other potential causes are falls from high places and injuries in which the chest is crushed. Explosions are another cause.Gunshot wounds are the commonest form of penetrating trauma that cause TBI. Less commonly, knife wounds and shrapnel from motor vehicle accidents can also penetrate the airways. Most injuries to the trachea occur in the neck, because the airways within the chest are deep and therefore well protected; however, up to a quarter of TBI resulting from penetrating trauma occurs within the chest. Injury to the cervical trachea usually affects the anterior (front) part of the trachea.Certain medical procedures can also injure the airways; these include tracheal intubation, bronchoscopy, and tracheotomy. The back of the trachea may be damaged during tracheotomy. TBI resulting from tracheal intubation (insertion of a tube into the trachea) is rare, and the mechanism by which it occurs is unclear. However, one likely mechanism involves an endotracheal tube catching in a fold of membrane and tearing it as it is advanced downward through the airway. When an endotracheal tube tears the trachea, it typically does so at the posterior (back) membranous wall. Unlike TBI that results from blunt trauma, most iatrogenic injuries to the airway involve longitudinal tears to the back of the trachea or tears on the side that pull the membranous part of the trachea away from the cartilage. Excessive pressure from the cuff of an endotracheal tube can reduce blood supply to the tissues of the trachea, leading to ischemia and potentially causing it to become ulcerated, infected, and, later, narrowed.The mucosal lining of the trachea may also be injured by inhalation of hot gases or harmful fumes such as chlorine gas. This can lead to edema (swelling), necrosis (death of the tissue), scar formation, and ultimately stenosis. However, TBI due to inhalation, foreign body aspiration, and medical procedures is uncommon.
Mechanism
The structures in the tracheobronchial tree are well protected, so it normally takes a large amount of force to injure them. In blunt trauma, TBI is usually the result of violent compression of the chest. Rapid hyperextension of the neck, usually resulting from vehicle crashes, can also injure the trachea, and trauma to the neck can crush the trachea against the vertebrae. A crush injury of the larynx or cervical trachea can occur in head-on collisions when the neck is hyperextended and strikes the steering wheel or dashboard; this has been called a "dashboard injury". The larynx and cervical trachea may also be injured in front-on collisions by the seat belt.Although the mechanism is not well understood, TBI due to blunt trauma is widely thought to be caused by any combination of three possible mechanisms: an increase in pressure within the airways, shearing, and pulling apart. The first type of injury, sometimes called an "explosive rupture", may occur when the chest is violently compressed, for example when a driver strikes the steering wheel in a vehicle accident or when the chest is crushed. The pressure in the airways, especially the larger airways (the trachea and bronchi), quickly rises as a result of the compression, because the glottis reflexively closes off the airways. When this pressure exceeds the elasticity of the tissues, they burst; thus the membranous part of the trachea is more commonly affected by this mechanism of injury than cartilaginous portions.The second mechanism may occur when the chest is suddenly decelerated, as occurs in vehicle accidents, producing a shearing force. The lungs are mobile in the chest cavity but their movement is more restricted near the hilum. Areas near the cricoid cartilage and carina are fixed to the thyroid cartilage and the pericardium respectively; thus if the airways move, they can tear at these points of fixation.The third mechanism occurs when the chest is compressed from front to back, causing it to widen from side to side. The lungs adhere to the chest wall because of the negative pressure between them and the pleural membranes lining the inside of the chest cavity; thus when the chest widens, they are pulled apart. This creates tension at the carina; the airway tears if this tensile force exceeds its elasticity. This mechanism may be the cause of injury when the chest is crushed. Most TBI are probably due to a combination of these three mechanisms.When airways are damaged, air can escape from them and be trapped in the surrounding tissues in the neck (subcutaneous emphysema) and mediastinum (pneumomediastinum); if it builds up to high enough pressures there, it can compress the airways. Massive air leaks from a ruptured airway can also compromise the circulation by preventing blood from returning to the heart from the head and lower body; this causes a potentially deadly reduction in the amount of blood the heart is able to pump out. Blood and other fluids can build up in the airways, and the injury can interfere with the patency of the airway and interfere with its continuity. However, even if the trachea is completely transected, the tissues surrounding it may hold it together enough for adequate air exchange to occur, at least at first.
Anatomy
The trachea and bronchi form the tracheobronchial tree. The trachea is situated between the lower end of the larynx and the center of the chest, where it splits into the two bronchi at a ridge called the carina. The trachea is stabilized and kept open by rings made of cartilage that surround the front and sides of the structure; these rings are not closed and do not surround the back, which is made of membrane. The bronchi split into smaller branches and then to bronchioles that supply air to the alveoli, the tiny air-filled sacs in the lungs responsible for absorbing oxygen. An arbitrary division can be made between the intrathoracic and cervical trachea at the thoracic inlet, an opening at the top of the thoracic cavity. Anatomical structures that surround and protect the tracheobronchial tree include the lungs, the esophagus, large blood vessels, the rib cage, the thoracic spine, and the sternum. Children have softer tracheas and a more elastic tracheobronchial trees than adults; this elasticity, which helps protect the structures from injury when they are compressed, may contribute to the lower incidence of TBI in children.
Diagnosis
Rapid diagnosis and treatment are important in the care of TBI; if the injury is not diagnosed shortly after the injury, the risk of complications is higher. Bronchoscopy is the most effective method to diagnose, locate, and determine the severity of TBI, and it is usually the only method that allows a definitive diagnosis. Diagnosis with a flexible bronchoscope, which allows the injury to be visualized directly, is the fastest and most reliable technique. In people with TBI, bronchoscopy may reveal that the airway is torn, or that the airways are blocked by blood, or that a bronchus has collapsed, obscuring more distal (lower) bronchi from view.Chest x-ray is the initial imaging technique used to diagnose TBI. The film may not have any signs in an otherwise asymptomatic patient. Indications of TBI seen on radiographs include deformity in the trachea or a defect in the tracheal wall. Radiography may also show cervical emphysema, air in the tissues of the neck. X-rays may also show accompanying injuries and signs such as fractures and subcutaneous emphysema. If subcutaneous emphysema occurs and the hyoid bone appears in an X-ray to be sitting unusually high in the throat, it may be an indication that the trachea has been severed. TBI is also suspected if an endotracheal tube appears in an X-ray to be out of place, or if its cuff appears to be more full than normal or to protrude through a tear in the airway. If a bronchus is torn all the way around, the lung may collapse outward toward the chest wall (rather than inward, as it usually does in pneumothorax) because it loses the attachment to the bronchus which normally holds it toward the center. In a person lying face-up, the lung collapses toward the diaphragm and the back. This sign, described in 1969, is called fallen lung sign and is pathognomonic of TBI (that is, it is diagnostic for TBI because it does not occur in other conditions); however it occurs only rarely. In as many as one in five cases, people with blunt trauma and TBI have no signs of the injury on chest X-ray. CT scanning detects over 90% of TBI resulting from blunt trauma, but neither X-ray nor CT are a replacement for bronchoscopy.At least 30% of TBI are not discovered at first; this number may be as high as 50%. In about 10% of cases, TBI has no specific signs either clinically or on chest radiography, and its detection may be further complicated by concurrent injuries, since TBI tends to occur after high-energy accidents. Weeks or months may go by before the injury is diagnosed, even though the injury is better known than it was in the past.
Classification
Lesions can be transverse, occurring between the rings of the trachea, longitudinal or spiral. They may occur along the membranous part of the trachea, the main bronchi, or both. In 8% of ruptures, lesions are complex, occurring in more than one location, with more than one type of lesion, or on both of the main bronchi and the trachea. Transverse tears are more common than longitudinal or complex ones. The laceration may completely transect the airway or it may go only partway around. Partial tears that do not go all the way around the circumference of the airway do not allow a lacerated airway to become completely detached; tears that encircle the whole airway can allow separation to occur. Lacerations may also be classified as complete or incomplete. In an incomplete lesion, a layer of tissue surrounding the bronchus remains intact and can keep the air in the airway, preventing it from leaking into the areas surrounding the airways. Incomplete lacerations may require closer scrutiny to detect and may not be diagnosed right away.Bronchial injuries are divided into those that are accompanied by a disruption of the pleura and those that are not; in the former, air can leak from the hole in the airway and a pneumothorax can form. The latter type is associated with more minor signs; pneumothorax is small if it occurs at all, and although function is lost in the part of the lung supplied by the injured bronchus, unaffected parts of the lungs may be able to compensate.Most TBI that results from blunt trauma occurs within the chest. The most common tracheal injury is a tear near the carina or in the membranous wall of the trachea. In blunt chest trauma, TBI occurs within 2.5 cm of the carina 40–80% of the time. The injury is more common in the right main bronchus than the left, possibly because the former is near vertebrae, which may injure it. Also, the aorta and other tissues in the mid chest that surround the left main bronchus may protect it. Another possibility is that people with left main bronchus injuries are more likely to also have other deadly injuries and therefore die before reaching hospital, making them less likely to be included in studies that determine rates of injuries.
Prevention
Vehicle occupants who wear seat belts have a lower incidence of TBI after a motor vehicle accident. However, if the strap is situated across the front of the neck (instead of the chest), this increases the risk of tracheal injury. Design of medical instruments can be modified to prevent iatrogenic TBI, and medical practitioners can use techniques that reduce the risk of injury with procedures such as tracheotomy.
Treatment
Treatment of TBI varies based on the location and severity of injury and whether the patient is stable or having trouble breathing, but ensuring that the airway is patent so that the patient can breathe is always of paramount importance. Ensuring an open airway and adequate ventilation may be difficult in people with TBI. Intubation, one method to secure the airway, may be used to bypass a disruption in the airway in order to send air to the lungs. If necessary, a tube can be placed into the uninjured bronchus, and a single lung can be ventilated. If there is a penetrating injury to the neck through which air is escaping, the trachea may be intubated through the wound. Multiple unsuccessful attempts at conventional (direct) laryngoscopy may threaten the airway, so alternative techniques to visualize the airway, such as fiberoptic or video laryngoscopy, may be employed to facilitate tracheal intubation. If the upper trachea is injured, an incision can be made in the trachea (tracheotomy) or the cricothyroid membrane (cricothyrotomy, or cricothyroidotomy) in order to ensure an open airway. However, cricothyrotomy may not be useful if the trachea is lacerated below the site of the artificial airway. Tracheotomy is used sparingly because it can cause complications such as infections and narrowing of the trachea and larynx. When it is impossible to establish a sufficient airway, or when complicated surgery must be performed, cardiopulmonary bypass may be used—blood is pumped out of the body, oxygenated by a machine, and pumped back in. If a pneumothorax occurs, a chest tube may be inserted into the pleural cavity to remove the air.
People with TBI are provided with supplemental oxygen and may need mechanical ventilation. Employment of certain measures such as Positive end-expiratory pressure (PEEP) and ventilation at higher-than-normal pressures may be helpful in maintaining adequate oxygenation. However, such measures can also increase leakage of air through a tear, and can stress the sutures in a tear that has been surgically repaired; therefore the lowest possible airway pressures that still maintain oxygenation are typically used. The use of high frequency ventilation has been reported. Mechanical ventilation can also cause pulmonary barotrauma when high pressure is required to ventilate the lungs. Techniques such as pulmonary toilet (removal of secretions), fluid management, and treatment of pneumonia are employed to improve pulmonary compliance (the elasticity of the lungs).While TBI may be managed without surgery, surgical repair of the tear is considered standard in the treatment of most TBI. It is required if a tear interferes with ventilation; if mediastinitis (inflammation of the tissues in the mid-chest) occurs; or if subcutaneous or mediastinal emphysema progresses rapidly; or if air leak or large pneumothorax is persistent despite chest tube placement. Other indications for surgery are a tear more than one third the circumference of the airway, tears with loss of tissue, and a need for positive pressure ventilation. Damaged tissue around a rupture (e.g. torn or scarred tissue) may be removed in order to obtain clean edges that can be surgically repaired. Debridement of damaged tissue can shorten the trachea by as much as 50%. Repair of extensive tears can include sewing a flap of tissue taken from the membranes surrounding the heart or lungs (the pericardium and pleura, respectively) over the sutures to protect them. When lung tissue is destroyed as a result of TBI complications, pneumonectomy or lobectomy (removal of a lung or of one lobe, respectively) may be required. Pneumonectomy is avoided whenever possible due to the high rate of death associated with the procedure. Surgery to repair a tear in the tracheobronchial tree can be successful even when it is performed months after the trauma, as can occur if the diagnosis of TBI is delayed. When airway stenosis results after delayed diagnosis, surgery is similar to that performed after early diagnosis: the stenotic section is removed and the cut airway is repaired.
Prognosis and complications
Most people with TBI who die do so within minutes of the injury, due to complications such as pneumothorax and insufficient airway and to other injuries that occurred at the same time. Most late deaths that occur in TBI are attributed to sepsis or multiple organ dysfunction syndrome (MODS). If the condition is not recognized and treated early, serious complications are more likely to occur; for example, pneumonia and bronchiectasis may occur as late complications. Years can pass before the condition is recognized. Some TBI are so small that they do not have significant clinical manifestations; they may never be noticed or diagnosed and may heal without intervention.If granulation tissue grows over the injured site, it can cause stenosis of the airway, after a week to a month. The granulation tissue must be surgically excised. Delayed diagnosis of a bronchial rupture increases risk of infection and lengthens hospital stay. People with a narrowed airway may develop dyspnea, coughing, wheezing, respiratory tract infection, and difficulty with clearing secretions. If the bronchiole is completely obstructed, atelectasis occurs: the alveoli of the lung collapse. Lung tissue distal to a completely obstructed bronchiole often does not become infected. Because it is filled with mucus, this tissue remains functional. When the secretions are removed, the affected portion of the lung is commonly able to function almost normally. However, infection is common in lungs distal to a partially obstructed bronchiole. Infected lung tissue distal to a stricture can be damaged, and wheezing and coughing may develop due to the narrowing. In addition to pneumonia, the stenosis may cause bronchiectasis, in which bronchi are dilated, to develop. Even after an airway with a stricture is restored to normal, the resulting loss of lung function may be permanent.Complications may also occur with treatment; for example, a granuloma can form at the suture site. Also, the sutured wound can tear again, as occurs when there is excessive pressure in the airways from ventilation. However, for people who do receive surgery soon after the injury to repair the lesion, outcome is usually good; the long-term outcome is good for over 90% of people who have TBI surgically repaired early in treatment. Even when surgery is performed years after the injury, the outlook is good, with low rates of death and disability and good chances of preserving lung function.
Epidemiology
Rupture of the trachea or bronchus is the most common type of blunt injury to the airway. It is difficult to determine the incidence of TBI: in as many as 30–80% of cases, death occurs before the person reaches a hospital, and these people may not be included in studies. On the other hand, some TBI are so small that they do not cause significant symptoms and are therefore never noticed. In addition, the injury sometimes is not associated with symptoms until complications develop later, further hindering estimation of the true incidence. However, autopsy studies have revealed TBI in 2.5–3.2% of people who died after trauma. Of all neck and chest traumas, including people that died immediately, TBI is estimated to occur in 0.5–2%. An estimated 0.5% of polytrauma patients treated in trauma centers have TBI. The incidence is estimated at 2% in blunt chest and neck trauma and 1–2% in penetrating chest trauma. Laryngotracheal injuries occur in 8% of patients with penetrating injury to the neck, and TBI occurs in 2.8% of blunt chest trauma deaths. In people with blunt trauma who do reach a hospital alive, reports have found incidences of 2.1% and 5.3%. Another study of blunt chest trauma revealed an incidence of only 0.3%, but a mortality rate of 67% (possibly due in part to associated injuries). The incidence of iatrogenic TBI (that caused by medical procedures) is rising, and the risk may be higher for women and the elderly. TBI results about once every 20,000 times someone is intubated through the mouth, but when intubation is performed emergently, the incidence may be as high as 15%.The mortality rate for people who reach a hospital alive was estimated at 30% in 1966; more recent estimates place this number at 9%. The number of people reaching a hospital alive has increased, perhaps due to improved prehospital care or specialized treatment centers. Of those who reach the hospital alive but then die, most do so within the first two hours of arrival. The sooner a TBI is diagnosed, the higher the mortality rate; this is likely due to other accompanying injuries that prove fatal.Accompanying injuries often play a key role in the outcome. Injuries that may accompany TBI include pulmonary contusion and laceration; and fractures of the sternum, ribs and clavicles. Spinal cord injury, facial trauma, traumatic aortic rupture, injuries to the abdomen, lung, and head are present in 40–100%. The most common accompanying injury is esophageal perforation or rupture (known as Boerhaave syndrome), which occurs in as many as 43% of the penetrating injuries to the neck that cause tracheal injury.
History
Throughout most of history, the mortality rate of TBI was thought to be 100%. However, in 1871 a healed TBI was noted in a duck that had been killed by a hunter, thus demonstrating that the injury could be survived, at least in the general sense. This report, made by Winslow, was the first record in the medical literature of a bronchus injury. In 1873, Seuvre made one of the earliest reports of TBI in the medical literature: a 74-year-old woman whose chest was crushed by a wagon wheel was found on autopsy to have an avulsion of the right bronchus. Long-term survival of the injury was unknown in humans until a report was made of a person who survived in 1927. In 1931, a report made by Nissen described successful removal of a lung in a 12-year-old girl who had had narrowing of the bronchus due to the injury. Repair of TBI was probably first attempted in 1945, when the first documented case of a successful suturing of a lacerated bronchus was made. Prior to 1950, the mortality rate was 36%; it had fallen to 9% by 2001; this improvement was likely due to improvements in treatments and surgical techniques, including those for injuries commonly associated with TBI.
Notes
References
Riley RD, Miller PR, Meredith JW (2004). "Injury to the esophagus, trachea, and bronchus". In Moore EJ, Feliciano DV, Mattox KL (eds.). Trauma. New York: McGraw-Hill, Medical Pub. Division. pp. 544–52. ISBN 0-07-137069-2. Retrieved 2008-06-15.
== External links == |
You act as a mediator between medical professionals and the public. Provide comprehensive explanations of medical terms, ensuring they are both precise and easily understood. | Could you provide a brief overview of 'Vocal cord cyst' in a medical context? | Vocal fold cysts (also known as vocal cord cysts) are benign masses of the membranous vocal folds. These cysts are enclosed, sac-like structures that are typically of a yellow or white colour. They occur unilaterally on the midpoint of the medial edge of the vocal folds. They can also form on the upper/superior, surface of the vocal folds. There are two types of vocal fold cysts:
Sub-epithelial vocal fold cysts- located in the superficial lamina propria of the vocal folds.
Ligament vocal fold cysts- located within the deeper layers of the lamina propria or on the vocal ligament.The symptoms of vocal fold cysts vary but most commonly include a hoarse voice and problems with the pitch of the voice. Vocal fold cysts are diagnosed based on gathering a case history, perceptual examination, and laryngeal imaging. Practicing good vocal hygiene is recommended to prevent vocal fold cysts. Initial treatment of the cysts involves voice therapy to reduce harmful vocal behaviours. If symptoms remain after voice therapy, patients may require surgery to remove the cyst. Surgery is typically followed by vocal rest and further voice therapy to improve voice function. Cysts may also be treated using vocal fold steroid injection.
Histology
The vocal folds consist of 3 primary layers; the Epithelium, the Lamina Propria (containing superficial, intermediate and deep layers) and the Thyroarytenoid Muscle. Vocal fold cysts commonly appear in the Superficial portion of the Lamina Propria, the cyst size impacts the nature of this layer making it more rigid. The border of vocal fold cysts contains squamous or epithelial cells. In the case of retention cysts, the border consists of glandular epithelium. Epidermoid cysts closely resemble epidermal cysts that can occur anywhere in the body.
Types of Vocal Cord Cysts
Sub-epithelial cysts (also known as mucous retention cysts) are closed lesions that occur from a build-up of tissue on the vocal folds. They are typically found in the middle portion of the upper lamina propria of the vocal folds. Sub-epithelial cysts are small and white in colour. Their presence on the vocal folds usually does not disrupt the vibration of the vocal folds for speech (known as the "mucosal wave").Ligament cysts (also known as epidermoid cysts) are closed lesions that occur near the vocal ligament in the deep layers of the lamina propria. Ligament cysts are usually larger in size than sub-epithelial cysts. They are yellow in colour and unlike sub-epithelial cysts, their presence is usually observed to disrupt the mucosal wave of the vocal folds in the region around the cyst.
Signs and Symptoms
Sub-epithelial vocal fold cysts and ligament vocal fold cysts are characterized by similar symptoms. The presence and severity of symptoms may be influenced by the location and size of the cyst.Common symptoms include:
Hoarse voice
Inability to produce high pitch notes
Fatigue when speaking
Limited pitch range
Pain near the larynx
Variations in pitch when speakingSigns and symptoms of vocal fold cysts may remain stable or increase over time. In rare cases it is also possible for symptoms to improve if the cyst ruptures spontaneously. Symptoms affecting quality of voice tend to worsen after speaking for long periods of time, or when speaking with increased volume. Many individuals who use their voice professionally find even a slight presence of symptoms to be problematic. However, some voice professionals are not impacted by the presence of vocal cysts.
Vocal Dynamics
Vocal fold cysts cause the properties of the vocal folds to change. When a cyst is present on a vocal fold, the cover of the vocal fold becomes more stiff and increases in mass. The increased mass and stiffness tends to result in hyperkinetic muscular movement during phonation. Hyperkinetic movement is characterized by increased rigidity in the affected vocal fold(s). This hyperkinetic movement results in the voice being perceived as hoarse. (see Signs and Symptoms) Specifically, the presence of a vocal fold cyst leads to an asynchronous mucosal wave of the vocal folds during phonation.
Causes
There are several possible causes of vocal fold cysts:
They can be congenital.
They can result from the blockage of a mucous glands excretory duct. In this case, they are sometimes referred to as retention cysts.
They can be the result of phonotrauma. Phonotrauma refers to behaviours that can lead to vocal fold injuries, such as vocal overuse (i.e. too much speaking), vocal misuse (i.e. speaking in an unnaturally high or low pitch), or vocal abuse (i.e. yelling or whispering for prolonged periods). Vocal folds vibrate during phonation resulting in repeated collisions of the right and left vocal folds. Phonotrauma subjects the vocal folds to excessive mechanical forces during these vibratory cycles, which can lead to the development of a wound. It is the healing of these wounds, which leads to tissue re-structuring, that can result in a vocal fold cyst.
Diagnosis
There are generally four components included in the full diagnosis of a vocal cord cyst: a medical and voice history, a head and neck exam, a perceptual assessment of the voice and imaging of the vocal folds. A medical and voice history can help distinguish patterns of misuse and phonotrauma to assist in diagnosis. The primary perceptual sign of vocal fold cysts is hoarseness of the voice. Diagnosis through perceptual means alone is difficult, therefore in the fourth component of diagnosis the patient often undergoes an imaging procedure. Imaging is most commonly done with laryngeal videostroboscopy. A videostroboscopy is an examination of the vocal folds using flashes of light to slow down the image of the vocal fold movement enough to provide a sharp picture of the phases of the movement cycle (mucosal wave.) This procedure provides information about vocal fold vibrations during speech, vocal intensity and vocal frequency. Imaging shows the reduced movement of the vocal folds (mucosal wave) when a vocal fold cyst is present. Further, videostroboscopy tends to show increased submucosal swelling in the affected areas of the vocal fold(s) More recently, other technologies have been introduced to assist with obtaining imaging of the vocal folds, including the use of Narrow-band imaging (NBI.) Narrow-band imaging involves the use of blue and yellow lights to improve the picture quality of an image and accentuate blood vessel visibility. NBI has been found to help improve visual identification of vocal fold cysts in some cases.Vocal fold cysts can be differentiated from other vocal fold growths as they are usually unilateral. The two types of vocal fold cysts (sub-epithelial and ligament cysts) can be differentiated by colour, size and location. (See section on Types of vocal cord cysts for more information.)
If the vocal fold cyst(s) are presumed to be congenital, the patient should have a history of presenting with a hoarse voice.Patients with vocal fold cysts are considered for surgery when presenting with:
Dysphonia
Lack of improvement through voice therapy
Prevention
A key aspect of preventing vocal fold cysts is good vocal hygiene. Good vocal hygiene promotes the healthy use of the vocal apparatus and the avoidance of phonotrauma. Good vocal hygiene practices involve the avoidance of:
Shouting
Whispering loudly or for long periods of time
Frequently of talking over loud background noise
Talking while yawning
Continual clearing of the throat
Speaking in an unnatural voice (i.e. too high or low)
Talking with a cold or laryngitis
Smoking tobacco or marijuana
The consumption of alcohol and coffee
The use of antihistamines, aspirin, steroids, tricyclic antidepressants, or any substance that alters perception (i.e. sleeping pills)
Foul airIn addition, good vocal hygiene involves getting enough rest and drinking sufficient water. It is important to keep the vocal fold tissue healthy and hydrated, and when possible to limit the quantity of speaking in order to avoid damage.
Treatment
Vocal fold cysts are treated using a multidisciplinary approach. Vocal fold cysts are most responsive when surgical intervention is supplemented with voice therapy. Applying vocal therapy techniques in isolation has not yet been proven to remediate and decrease the actual size of the vocal fold cyst.Voice therapy to address harmful vocal behaviours is recommended as the first treatment option. Voice therapy may involve reducing tension in the larynx, reducing loudness, reducing the amount of speech produced, and modifying the environment. If symptoms are significant, treatment usually involves microsurgery to remove the cyst. Although voice therapy is useful for preventing vocal fold cysts caused by phonotrauma and for promoting safe vocal practices, vocal fold cysts tend not to respond to therapy alone and typically require surgery for full repair.During surgery, attempts are made to preserve as much vocal fold tissue as possible, given that glottal insufficiency (a gap in the vocal folds) is a possible consequence of surgery. Vocal fold tissue can be preserved during surgery by raising a micro-flap, removing the cyst, then laying the flap back down. This is intended to lead to minimal scarring and improved voice function. However, if any epithelium from the cyst sac is left behind during surgery, the cyst may regrow. Surgery of the larynx may also be conducted using a CO2 laser, which was reported as early as the 1970s. Congenital ductal cysts (those caused by blockage of a glandular duct) may be treated by marsupialization.Following surgery, patients are recommended to take 2 to 14 days of vocal rest. In absolute vocal rest, activities such as talking, whispering, whistling, straining, coughing, and sneezing are restricted. Once adequate healing has occurred, the patient may be transitioned to relative vocal rest, which typically involves 5 to 10 minutes of breathy voicing per hour. Voice therapy is then required to restore as much function as possible. Post-operative voice therapy may include addressing harmful vocal behaviours, exercises to restrengthen the larynx, and reintegration into normal voice activities.
Professional voice users who do not experience substantial limitations due to their cysts may choose to forego surgery. Considering that some cysts remain stable over long periods of time, voice therapy alone may be an option for those who are resistant to surgery. Another option for those who are unwilling to undergo surgery is vocal fold steroid injection (VFSI). Injection of the vocal folds may be done transorally or percutaneously, through the thyrohyoid membrane, thyroid cartilage, or cricothyroid membrane. After VFSI, patients are recommended to take 1 to 7 days of vocal rest. VFSI may also be used to delay surgery, or as a treatment method when the risks associated with surgery are deemed to be too high.
Prognosis
Following diagnosis, voice therapy should be implemented to optimize vocal hygiene. Vocal fold cysts tend not to improve solely through vocal rest or vocal therapy.Patients with sub-epithelial cysts have a better prognosis for timely recovery of vocal abilities than patients with ligament vocal fold cysts. Typically, patients can resume speaking activities in 7–30 days following surgery, and singing activities 30–90 days post-surgery.Up to 20% of patients show scarring, polyps or vascular changes of the vocal folds following surgery. In severe cases, these resulting symptoms may require further surgery. The patient must always be aware of the impact and potential complications of surgery on their voice, especially if the voice is heavily used occupationally. In these cases, post-operative therapy should be discussed.
See also
Vocal fold nodule
References
External links
Vocal Cord / Voice Disorder Community - Online Support
VoiceInfo.org
Photo Library at VoiceInfo.org |
You serve as a guide in the medical field. Explain medical terms thoroughly, ensuring the information is both insightful and comprehensible. | Could you offer a clear explanation of the term 'Megalencephalic leukoencephalopathy with subcortical cysts' as used in the medical field? | Megalencephalic leukoencephalopathy with subcortical cysts (MLC, or Van der Knaap disease) is a form of hereditary CNS demyelinating disease. It belongs to a group of disorders called leukodystrophies. It is characterized by early-onset enlargement of the head (macrocephaly) as well as delayed-onset neurological deterioration to include spasticity, epilepsy, and lack of muscular coordination. MLC does not appear to be a disease that is fatal at birth or early in life despite its symptoms, although the number of patients throughout history known to have the disease is fairly limited.It belongs to a group of disorders called leukodystrophies. A series of cases with megalencephalic leukodystrophy were described by the Indian neurologist Bhim Sen Singhal (1933-) in 1991. However, it is sometimes referred to as Van der Knaap disease after the Dutch neurologist Marjo van der Knaap who described another series of cases with clinical and radiological features in 1995.There are three types of Megalencephalic leukoencephalopathy distinguished by the affected gene: Type 1 caused by autosomal recessive mutations on the MLC1 gene, Type 2A an autosomal recessive mutation on the HEPACAM gene, and Type 2B an autosomal dominant mutation on the HEPACAM gene.
Signs and Symptoms
Head
Macrocephaly
The disease is characterized by megalencephaly, the enlargement of the brain, which is followed by an increase in the size of the actual head.
Central Nervous System
Megalencephaly
The M in MLC stands for “megalencephaly”, the enlargement of the brain
Ataxia
Slow, progressive and early-onset cerebellar ataxia has been noted in many patients
Spasticity
Patients with MLC often have muscle spasms
Seizures
Delay in motor development
Mild mental retardation
Diffuse swelling of cerebral white matter
Large subcortical cysts in frontal and temporal lobes
Patients develop cysts on the tips of the temporal and subcortical area
Diffuse spongiform leukoencephalopathy
Vacuolizing myelinopathy
The protective myelin sheath on neurons pulls away from their cells forming small holes in nerve fibers – in turn affecting coordination and walking ability.
Genetics
It is associated with MLC1. The MLC1 gene is located in chromosome 22q13.33 and is in the genomic coordinates 22:50,059,390 – 50,085874. The gene contains 12 exons and that contain a start codon in exon 2 and an untranslated region in the 3’ end. The MLC1 gene product is a 377 amino acid protein highly expressed in the brain. The disease is caused by a homozygous or compound heterozygous mutation in the gene, MLC1. Previous research indicates that deficiency of cell surface protein expression of the MLC1 gene is the basis for the disorder. The mutant protein is expressed in intracellular compartments reducing the membrane surface expression when compared to the wild type.
Diagnosis
Diagnosis of Megalencephalic leukoencephalopathy with subcortical cysts is made with a combination of physical and clinical evaluations. The presence of frontal and temporal subcortical cysts is the main factor when diagnosing a patient with this disease. In the late stages of the disease, patients have been noted to develop impaired coordination, overresponsive reflexes, and even seizures. MRI testing is used to study and diagnose patients with this disease. A study conducted on four patients with this disease yielded similar MRI results despite their slightly differing symptoms. Genetic testing can show whether or not the individual has a mutation in the MLC1 gene, which accounts for 75% of all cases.
Management
There currently is not a known cure for this disease. However, there are treatment options to mitigate the effects of symptoms that come with this disease. The drug Carbamazepine is an anticonvulsant drug commonly used to treat seizures and nerve pain. A case with a 5-year-old girl indicated the ability of this drug to reduce the effects of seizures linked to this disease.
Epidemiology
Most of the cases were studied in Turkish families who were part of consanguineous marriages (getting married to relatives or the “same blood”). Nonetheless, Megalencephalic leukoencephalopathy with subcortical cysts does not show genetic heterogeneity which means that there are no mutations in other loci expressing similar phenotypes.
History
A series of cases with megalencephalic leukodystrophy were described by the Indian neurologist Bhim Sen Singhal (1933-)in 1991. However, it is sometimes referred to as Van der Knaap disease after the Dutch neurologist Marjo van der Knaap who described another series of cases with clinical and radiological features in 1995.
References
External links
GeneReview/NIH/UW entry on Megalencephalic Leukoencephalopathy with Subcortical Cysts |
You serve as a medical tutor. Your objective is to demystify medical terms, providing thorough explanations that cater to various levels of medical knowledge. | Please help me grasp the concept behind the medical term 'RID.' | RID may refer to:
Isaiah ben Mali di Trani (the Elder), an Italian Talmudist
Radial immunodiffusion, a scientific technique for measuring the quantity of an antigen
Radionuclide identification device, a hand-held instrument for the detection and identification of radioactive sources
Refractive index detector, a type of chromatography detector
Registry of Interpreters for the Deaf, an American Sign Language interpreters organization
Relative identifier, a component of Microsoft Windows NT security
RID (insect repellent), an Australian brand
Rivista Italiana Difesa, an Italian magazine related to military and geo-strategic issues
Robots in Disguise, an English electro band
Royal Institute Dictionary, a prescriptive dictionary of Thailand
Real-time Inter-network Defense, a reporting method for sharing incident-handling data between networks |
You are a medical advisor. Your role is to break down medical terminology into clear, detailed explanations for a general audience. | I'm seeking clarification on the medical term 'Opisthotonus.' Could you explain it? | Opisthotonus or opisthotonos (from Ancient Greek: ὄπισθεν, romanized: opisthen, lit. behind and τόνος, tonos, tension) is a state of severe hyperextension and spasticity in which an individuals head, neck and spinal column enter into a complete "bridging" or "arching" position.This extreme arched pose is an extrapyramidal effect and is caused by spasm of the axial muscles along the spinal column. It has been shown to occur naturally in birds, snakes suffering from advanced boid inclusion body disease, and placental mammals, among existing animals; it is observed in some articulated dinosaur fossils.
Causes
Opisthotonus is a symptom of some cases of severe cerebral palsy and traumatic brain injury or as a result of the severe muscular spasms associated with tetanus. It can be a feature of severe acute hydrocephalus, poisoning, and drowning.
Infants
Opisthotonus is more pronounced in infants. Opisthotonus in the neonate may be a symptom of meningitis, tetanus, severe kernicterus, or the rare maple syrup urine disease. This marked extensor tone can cause infants to "rear backwards" and stiffen out as the mother or nurse attempts to hold or feed them. Individuals with opisthotonus are quite challenging to position, especially in wheelchairs and car seats.Opisthotonus can be triggered by any attempt at movement, such as smiling, feeding, speech, or by involuntary movement, such as seizures. A similar tonic posturing may be seen in Sandifer syndrome.
Poisoning
Opisthotonus can sometimes be seen in lithium intoxication. It is a rare extrapyramidal side effect of phenothiazines, haloperidol, and metoclopramide.Opisthotonus with the presence of the risus sardonicus is also a symptom of strychnine poisoning and prussic acid (hydrogen cyanide) poisoning.
Drowning and the "dinosaur death pose"
Opisthotonus is seen with drowning victims – called the "opisthotonic death pose". This pose is also common in complete dinosaur skeletal fossils and it has been suggested that this is due to the animal drowning or being immersed in water soon after death.
Vivisection
Opisthotonus can be produced experimentally in animals by transection of the midbrain (between the superior colliculus and the inferior colliculus), which results in severing all the corticoreticular fibers.Severe "arching" (hyperextension) occurs due to stimulus by the anterior reticulospinal tract caused by the loss of the balancing inhibitory counter-stimulus of corticoreticular fibers, which normally act upon the pons reticular formation.
Other causes
Opisthotonus is also described as a potential CNS symptom of heat stroke along with bizarre behavior, hallucinations, decerebrate rigidity, oculogyric crisis, and cerebellar dysfunction.Opisthotonus is a symptom of "lavender foal syndrome", a lethal genetic disorder in horses.Sir Rudolph Peters, in Oxford, introduced thiamine-deprived pigeons as a model for understanding how thiamine deficiency can lead to the pathological-physiological symptoms of beriberi. Indeed, feeding the pigeons upon polished rice leads to an easily recognizable behavior of head retraction, a condition called opisthotonos. If not treated, the animals died after a few days. Administration of thiamine at the stage of opisthotonos led to a complete cure within 30 minutes. As no morphological modifications were observed in the brain of the pigeons before and after treatment with thiamine, Peters introduced the concept of a biochemical lesion.
References
== External links == |
You are a medical knowledge base. Your task is to elucidate medical terminology, offering insights into their meanings, origins, and applications. | I'm curious about the meaning of the medical term 'Zoophilia.' Can you give me some insights? | Zoophilia is a paraphilia involving a sexual fixation on non-human animals. Bestiality is cross-species sexual activity between humans and non-human animals. The terms are often used interchangeably, but some researchers make a distinction between the attraction (zoophilia) and the act (bestiality).In most countries, bestiality is illegal under animal abuse laws or laws dealing with sodomy or crimes against nature.
Terminology
General
Three key terms commonly used in regards to the subject—zoophilia, bestiality, and zoosexuality—are often used somewhat interchangeably. Some researchers distinguish between zoophilia (as a persistent sexual interest in animals) and bestiality (as sexual acts with animals), because bestiality is often not driven by a sexual preference for animals. Some studies have found a preference for animals is rare among people who engage in sexual contact with animals. Furthermore, some zoophiles report they have never had sexual contact with an animal. People with zoophilia are known as "zoophiles", though also sometimes as "zoosexuals", or even very simply "zoos". Zooerasty, sodomy, and zooerastia are other terms closely related to the subject but are less synonymous with the former terms, and are seldom used. "Bestiosexuality" was discussed briefly by Allen (1979), but never became widely established. Ernest Bornemann (1990, cited by Rosenbauer, 1997) coined the separate term zoosadism for those who derive pleasure – sexual or otherwise – from inflicting pain on animals. Zoosadism specifically is one member of the Macdonald triad of precursors to sociopathic behavior.
Zoophilia
The term zoophilia was introduced into the field of research on sexuality in Psychopathia Sexualis (1886) by Krafft-Ebing, who described a number of cases of "violation of animals (bestiality)", as well as "zoophilia erotica", which he defined as a sexual attraction to animal skin or fur. The term zoophilia derives from the combination of two nouns in Greek: ζῷον (zṓion, meaning "animal") and φιλία (philia, meaning "(fraternal) love"). In general contemporary usage, the term zoophilia may refer to sexual activity between human and non-human animals, the desire to engage in such, or to the specific paraphilia (i.e., the atypical arousal) which indicates a definite preference for animals over humans as sexual partners. Although Krafft-Ebing also coined the term zooerasty for the paraphilia of exclusive sexual attraction to animals, that term has fallen out of general use.
Zoosexuality
The term zoosexual was proposed by Hani Miletski in 2002 as a value-neutral term. Usage of zoosexual as a noun (in reference to a person) is synonymous with zoophile, while the adjectival form of the word – as, for instance, in the phrase "zoosexual act" – may indicate sexual activity between a human and an animal. The derivative noun "zoosexuality" is sometimes used by self-identified zoophiles in both support groups and on internet-based discussion forums to designate sexual orientation manifesting as sexual attraction to animals.
Bestiality
The legal term bestiality has three common pronunciations: [ˌbestʃiˈæləti] or [ˌbistʃiˈæləti] in the United States, and [ˌbestiˈæləti] in the United Kingdom. Some zoophiles and researchers draw a distinction between zoophilia and bestiality, using the former to describe the desire to form sexual relationships with animals, and the latter to describe the sex acts alone. Confusing the matter yet further, writing in 1962, Masters used the term bestialist specifically in his discussion of zoosadism.Stephanie LaFarge, an assistant professor of psychiatry at the New Jersey Medical School, and Director of Counseling at the ASPCA, writes that two groups can be distinguished: bestialists, who rape or abuse animals, and zoophiles, who form an emotional and sexual attachment to animals. Colin J. Williams and Martin Weinberg studied self-defined zoophiles via the internet and reported them as understanding the term zoophilia to involve concern for the animals welfare, pleasure, and consent, as distinct from the self-labelled zoophiles concept of "bestialists", whom the zoophiles in their study defined as focused on their own gratification. Williams and Weinberg also quoted a British newspaper saying that zoophilia is a term used by "apologists" for bestiality.
Extent of occurrence
The Kinsey reports rated the percentage of people in the general population who had at least one sexual interaction with animals as 8% for males and 5.1% for females (1.5% for pre-adolescents and 3.6% for post-adolescents females), and claimed it was 40–50% for the rural population and even higher among individuals with lower educational status, but some later writers dispute the figures, because the study lacked a random sample in that it included a disproportionate number of prisoners, causing sampling bias. Martin Duberman has written that it is difficult to get a random sample in sexual research, and that even when Paul Gebhard, Kinseys research successor, removed prison samples from the figures, he found the figures were not significantly changed.By 1974, the farm population in the USA had declined by 80 percent compared with 1940, reducing the opportunity to live with animals; Hunts 1974 study suggests that these demographic changes led to a significant change in reported occurrences of bestiality. The percentage of males who reported sexual interactions with animals in 1974 was 4.9% (1948: 8.3%), and in females in 1974 was 1.9% (1953: 3.6%). Miletski believes this is not due to a reduction in interest but merely a reduction in opportunity.Nancy Fridays 1973 book on female sexuality, My Secret Garden, comprised around 190 fantasies from different women; of these, 23 involve zoophilic activity.In one study, psychiatric patients were found to have a statistically significant higher prevalence rate (55 percent) of reported bestiality, both actual sexual contacts (45 percent) and sexual fantasy (30 percent) than the control groups of medical in-patients (10 percent) and psychiatric staff (15 percent). Crépault and Couture (1980) reported that 5.3 percent of the men they surveyed had fantasized about sexual activity with an animal during heterosexual intercourse. In a 2014 study, 3% of women and 2.2% of men reported fantasies about having sex with an animal. A 1982 study suggested that 7.5 percent of 186 university students had interacted sexually with an animal. A 2021 review estimated zoophilic behavior occurs in 2% of the general population.
Sexual arousal from watching animals mate is known as faunoiphilia.
Perspectives on zoophilia
Research perspectives
Zoophilia has been partly discussed by several sciences: psychology (the study of the human mind), sexology (a relatively new discipline primarily studying human sexuality), ethology (the study of animal behavior), and anthrozoology (the study of human–animal interactions and bonds).
In the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5), zoophilia is placed in the classification "other specified paraphilic disorder" ("paraphilias not otherwise specified" in the DSM-III and IV). The World Health Organization takes the same position, listing a sexual preference for animals in its ICD -10 as "other disorder of sexual preference". In the DSM-5, it rises to the level of a diagnosable disorder only when accompanied by distress or interference with normal functioning.Zoophilia may also be covered to some degree by other fields such as ethics, philosophy, law, animal rights and animal welfare. It may also be touched upon by sociology which looks both at zoosadism in examining patterns and issues related to sexual abuse and at non-sexual zoophilia in examining the role of animals as emotional support and companionship in human lives, and may fall within the scope of psychiatry if it becomes necessary to consider its significance in a clinical context.
The Journal of Forensic and Legal Medicine (Vol. 18, February 2011) states that sexual contact with animals is almost never a clinically significant problem by itself; it also states that there are several kinds of zoophiles:
Additionally, zoophiles in categories 2, 3, and 8 (romantic zoophiles, zoophilic fantasizers, and regular zoophiles) are the most common, while zoophiles found in categories 6 and 7 (sadistic bestials and opportunistic zoophiles) are the least common.Zoophilia may reflect childhood experimentation, sexual abuse or lack of other avenues of sexual expression. Exclusive desire for animals rather than humans is considered a rare paraphilia, and sufferers often have other paraphilias with which they present. Zoophiles will not usually seek help for their condition, and so do not come to the attention of psychiatrists for zoophilia itself.The first detailed studies of zoophilia date from prior to 1910. Peer reviewed research into zoophilia in its own right started around 1960. However, a number of the most oft-quoted studies, such as Miletski, were not published in peer-reviewed journals. There have been several significant modern books, from Masters (1962) to Beetz (2002); their research arrived at the following conclusions:
Most zoophiles have (or have also had) long term human relationships as well or at the same time as zoosexual ones, and that zoosexual partners are usually dogs and/or horses (Masters, Miletski, Beetz)
Zoophiles emotions and care for animals can be real, relational, authentic and (within animals abilities) reciprocal, and not just a substitute or means of expression. Beetz believes zoophilia is not an inclination which is chosen.
Society in general at present is considerably misinformed about zoophilia, its stereotypes, and its meaning. The distinction between zoophilia and zoosadism is a critical one to these researchers, and is highlighted by each of these studies. Masters (1962), Miletski (1999) and Weinberg (2003) each comment significantly on the social harm caused by misunderstandings regarding zoophilia: "This destroy[s] the lives of many citizens".Beetz also states the following:
The phenomenon of sexual contact with animals is starting to lose its taboo: it is appearing more often in scholarly publications, and the public are being confronted with it, too. ... Sexual contact with animals – in the form of bestiality or zoophilia – needs to be discussed more openly and investigated in more detail by scholars working in disciplines such as animal ethics, animal behavior, anthrozoology, psychology, mental health, sociology, and the law.
More recently, research has engaged three further directions: the speculation that at least some animals seem to enjoy a zoophilic relationship assuming sadism is not present, and can form an affectionate bond.Beetz described the phenomenon of zoophilia/bestiality as being somewhere between crime, paraphilia and love, although she says that most research has been based on criminological reports, so the cases have frequently involved violence and psychiatric illness. She says only a few recent studies have taken data from volunteers in the community. As with all volunteer surveys and sexual ones in particular, these studies have a potential for self-selection bias.Medical research suggests that some zoophiles only become aroused by a specific species (such as horses), some zoophiles become aroused by multiple species (which may or may not include humans), and some zoophiles are not attracted to humans at all.
Historical and cultural perspectives
Instances of this behavior have been found in the Bible. In a cave painting from at least 8000 BC in the Northern Italian Val Camonica a man is shown about to penetrate an animal. Raymond Christinger interprets that as a show of power of a tribal chief, and so we do not know if this practice was then more acceptable, and if the scene depicted was usual or unusual or whether it was symbolic or imaginary. The "Cambridge Illustrated History of Prehistoric Art" says the scene may be humorous, as the penetrating man seems to be waving cheerfully with his hand at the same time. Potters seem to have spent time depicting the practice, but this may be because they found the idea amusing. Dr "Jacobus X", said to be the pen name of a French author, said this was clearly "before any known taboos against sex with animals existed". Marc Epprecht states that authors such as Jacobus X do not deserve respect because their methodology is based on hearsay, and was designed for voyeuristic titillation of the reader. Masters said that since pre-historic man is prehistoric it goes without saying that we know little of his sexual behaviour; depictions in cave paintings may only show the artists subjective preoccupations or thoughts.
Pindar, Herodotus, and Plutarch claimed the Egyptians engaged in ritual congress with goats. Such claims about other cultures do not necessarily reflect anything about which the author had evidence, but may be a form of propaganda or xenophobia, similar to blood libel.Bestiality has been accepted in a few North American and Middle Eastern indigenous cultures.Several cultures built temples (Khajuraho, India) or other structures (Sagaholm, barrow, Sweden) with zoophilic carvings on the exterior, however at Khajuraho, these depictions are not on the interior, perhaps depicting that these are things that belong to the profane world rather than the spiritual world, and thus are to be left outside.In the Church-oriented culture of the Middle Ages, zoophilic activity was met with execution, typically burning, and death to the animals involved either the same way or by hanging, as "both a violation of Biblical edicts and a degradation of man as a spiritual being rather than one that is purely animal and carnal". Some witches were accused of having congress with the devil in the form of an animal. As with all accusations and confessions extracted under torture in the witch trials in Early Modern Europe, their validity cannot be ascertained.
Religious perspectives
Passages in Leviticus 18 (Lev 18:23: "And you shall not lie with any beast and defile yourself with it, neither shall any woman give herself to a beast to lie with it: it is a perversion." RSV) and 20:15–16 ("If a man lies with a beast, he shall be put to death; and you shall kill the beast. If a woman approaches any beast and lies with it, you shall kill the woman and the beast; they shall be put to death, their blood is upon them." RSV) are cited by Jewish, Christian, and Muslim theologians as categorical denunciation of bestiality. However, the teachings of the New Testament have been interpreted by some as not expressly forbidding bestiality.In Part II of his Summa Theologica, medieval philosopher Thomas Aquinas ranked various "unnatural vices" (sex acts resulting in "venereal pleasure" rather than procreation) by degrees of sinfulness, concluding that "the most grievous is the sin of bestiality". Some Christian theologians extend Matthews view that even having thoughts of adultery is sinful to imply that thoughts of committing bestial acts are likewise sinful.
There are a few references in Hindu scriptures to religious figures engaging in symbolic sexual activity with animals such as explicit depictions of people having sex with animals included amongst the thousands of sculptures of "Life events" on the exterior of the temple complex at Khajuraho. The depictions are largely symbolic depictions of the sexualization of some animals and are not meant to be taken literally. According to the Hindu tradition of erotic painting and sculpture, having sex with an animal is believed to be actually a human having sex with a god incarnated in the form of an animal. However, in some Hindu scriptures, such as the Bhagavata Purana and the Devi Bhagavata Purana, having sex with animals, especially the cow, leads one to hell, where one is tormented by having ones body rubbed on trees with razor-sharp thorns.
Legal status
In many jurisdictions, all acts of bestiality are prohibited; others outlaw only the mistreatment of animals, without specific mention of sexual activity. In the United Kingdom, Section 63 of the Criminal Justice and Immigration Act 2008 (also known as the Extreme Pornography Act) outlaws images of a person performing or appearing to perform an act of intercourse or oral sex with an animal (whether dead or alive). Despite the UK Ministry of Justices explanatory note on extreme images saying "It is not a question of the intentions of those who produced the image. Nor is it a question of the sexual arousal of the defendant", "it could be argued that a person might possess such an image for the purposes of satire, political commentary or simple grossness," according to The Independent.Many new laws banning sex with animals have been made recently, such as in New Hampshire, Ohio, Germany, Sweden, Iceland, Denmark, Thailand, Costa Rica, Bolivia, and Guatemala. The number of jurisdictions around the world banning it has grown in the 2000s and 2010s.
Germany legalized bestiality in 1969, but banned it again in 2013. The 2013 law was unsuccessfully challenged in 2015.Laws on bestiality are sometimes triggered by specific incidents. While some laws are very specific, others employ vague terms such as "sodomy" or "bestiality", which lack legal precision and leave it unclear exactly which acts are covered. In the past, some bestiality laws may have been made in the belief that sex with an animal could result in monstrous offspring, as well as offending the community. Current anti-cruelty laws focus more specifically on animal welfare while anti-bestiality laws are aimed only at offenses to community "standards".
Notable legal views include Sweden, where a 2005 report by the Swedish Animal Welfare Agency for the government expressed concern over the increase in reports of horse-ripping incidents. The agency believed current animal cruelty legislation was not sufficient in protecting animals from abuse and needed updating, but concluded that on balance it was not appropriate to call for a ban. In New Zealand, the 1989 Crimes Bill considered abolishing bestiality as a criminal offense, and instead viewing it as a mental health issue, but they did not, and people can still be prosecuted for it. Under Section 143 of the Crimes Act 1961, individuals can serve a sentence of seven years duration for animal sexual abuse and the offence is considered complete in the event of penetration.Copulating with a female alpaca is still specifically against the law in Peru.As of 2022, bestiality is illegal in 48 U.S. states. Most state bestiality laws were enacted between 1999 and 2022. Until 2005, there was a farm near Enumclaw, Washington that was described as an "animal brothel", where people paid to have sex with animals. After an incident on 2 July 2005, when a man was pronounced dead in the emergency room of the Enumclaw community hospital after his colon ruptured due to having had anal sex with a horse, the farm garnered police attention. The state legislature of the State of Washington, which had been one of the few states in the United States without a law against bestiality, within six months passed a bill making bestiality illegal. Arizona, Alaska, Florida, Alabama, New Jersey, New Hampshire, Ohio, Texas, Vermont, and Nevada have banned sex with animals between 2006 and the present, with the latter five all banning it in 2017. In 2021, Wyoming and Hawaii passed legislation banning bestiality. When such laws are proposed, they are never questioned or debated.Bestiality remains legal in two states (West Virginia and New Mexico), while 19 other states have statutes that date to the 19th century or even the Colonial period. These new statutes are distinct from older sodomy statutes in that they define the proscribed acts with precision.
Pornography
In the United States, zoophilic pornography would be considered obscene if it did not meet the standards of the Miller Test and therefore is not openly sold, mailed, distributed or imported across state boundaries or within states which prohibit it. Under U.S. law, distribution includes transmission across the Internet.
Similar restrictions apply in Germany (see above). In New Zealand the possession, making or distribution of material promoting bestiality is illegal.
The potential use of media for pornographic movies was seen from the start of the era of silent film. Polissons and Galipettes (re-released 2002 as "The Good Old Naughty Days") is a collection of early French silent films for brothel use, including some animal pornography, dating from around 1905 – 1930.
Material featuring sex with animals is widely available on the Internet. An early film to attain great infamy was "Animal Farm", smuggled into Great Britain around 1980 without details as to makers or provenance. The film was later traced to a crude juxtaposition of smuggled cuts from many of Bodil Joensens 1970s Danish movies.
Today, in Hungary, where production faces no legal limitations, zoophilic materials have become a substantial industry that produces a number of films and magazines, particularly for Dutch companies such as Topscore and Book & Film International, and the genre has stars such as "Hector", a Great Dane dog starring in several films.
In Japan, animal pornography is used to bypass censorship laws, often featuring models performing fellatio on animals, because oral penetration of a non-human penis is not in the scope of Japanese pixelization censorship. While primarily underground, there are a number of animal pornography actresses who specialize in bestiality movies.
In the United Kingdom, Section 63 of the Criminal Justice and Immigration Act 2008 criminalises possession of realistic pornographic images depicting sex with animals (see extreme pornography), including fake images and simulated acts, as well as images depicting sex with dead animals. The law provides for sentences of up to two years in prison; a sentence of 12 months was handed down in one case in 2011.
Zoophiles
Non-sexual zoophilia
The love of animals is not necessarily sexual in nature. In psychology and sociology the word "zoophilia" is sometimes used without sexual implications. Being fond of animals in general, or as pets, is accepted in Western society, and is usually respected or tolerated. However, the word zoophilia is used to mean a sexual preference towards animals, which makes it a paraphilia. Some zoophiles may not act on their sexual attraction to animals. People who identify as zoophiles may feel their love for animals is romantic rather than purely sexual, and say this makes them different from those committing entirely sexually motivated acts of bestiality.
Zoophile community
An online survey which recruited participants over the internet concluded that prior to the arrival of widespread computer networking, most zoophiles would not have known other zoophiles, and for the most part, zoophiles engaged in bestiality secretly, or told only trusted friends, family or partners. The internet and its predecessors made people able to search for information on topics which were not otherwise easily accessible and to communicate with relative safety and anonymity. Because of the diary-like intimacy of blogs and the anonymity of the internet, zoophiles had the ideal opportunity to "openly" express their sexuality. As with many other alternate lifestyles, broader networks began forming in the 1980s when participating in networked social groups became more common at home and elsewhere. Such developments in general were described by Markoff in 1990; the linking of computers meant that people thousands of miles apart could feel the intimacy akin to being in a small village together. The popular newsgroup alt.sex.bestiality, said to be in the top 1% of newsgroup interest (i.e. number 50 out of around 5000), – and reputedly started in humor – along with personal bulletin boards and talkers, chief among them Sleepys multiple worlds, Lintilla, and Planes of Existence, were among the first group media of this kind in the late 1980s and early 1990s. These groups rapidly drew together zoophiles, some of whom also created personal and social websites and Internet Forums. By around 1992–1994, the wide social net had evolved. This was initially centered around the above-mentioned newsgroup, alt.sex.bestiality, which during the six years following 1990 had matured into a discussion and support group. The newsgroup included information about health issues, laws governing zoophilia, bibliography relating to the subject, and community events.Weinberg and Williams observe that the internet can socially integrate an incredibly large number of people. In Kinseys day contacts between animal lovers were more localized and limited to male compatriots in a particular rural community. Further, while the farm boys Kinsey researched might have been part of a rural culture in which sex with animals was a part, the sex itself did not define the community. The zoophile community is not known to be particularly large compared to other subcultures which make use of the internet, so Weinberg and Williams surmised its aims and beliefs would likely change little as it grew. Those particularly active on the internet may not be aware of a wider subculture, as there is not much of a wider subculture, Weinberg and Williams felt the virtual zoophile group would lead the development of the subculture.Websites aim to provide support and social assistance to zoophiles (including resources to help and rescue abused or mistreated animals), but these are not usually well publicized. Such work is often undertaken as needed by individuals and friends, within social networks, and by word of mouth.Zoophiles tend to experience their first zoosexual feelings during adolescence, and tend to be secretive about it, hence limiting the ability for non-Internet communities to form.
See also
References and footnotes
External links
Encyclopedia of Human Sexuality entry for "Bestiality" at Sexology Department of Humboldt University, Berlin.
Zoophilia References Database Bestiality and zoosadism criminal executions.
Animal Abuse Crime Database search form for the U.S. and UK. |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | Can you break down the meaning of the medical term 'Ganciclovir' for me? | Ganciclovir, sold under the brand name Cytovene among others, is an antiviral medication used to treat cytomegalovirus (CMV) infections.
Ganciclovir was patented in 1980 and approved for medical use in 1988.
Medical use
Ganciclovir is indicated for:
Sight-threatening CMV retinitis in severely immunocompromised people
CMV pneumonitis in bone marrow transplant recipients
Prevention of CMV disease in bone marrow and solid organ transplant recipients
Confirmed CMV retinitis in people with AIDS (intravitreal implant)It is also used for acute CMV colitis in HIV/AIDS and CMV pneumonitis in immunosuppressed patients.Ganciclovir has also been used with some success in treating Human herpesvirus 6 infections.Ganciclovir has also been found to be an effective treatment for herpes simplex virus epithelial keratitis.
Adverse effects
Ganciclovir is commonly associated with a range of serious haematological adverse effects. Common adverse drug reactions (≥1% of patients) include: granulocytopenia, neutropenia, anaemia, thrombocytopenia, fever, nausea, vomiting, dyspepsia, diarrhea, abdominal pain, flatulence, anorexia, raised liver enzymes, headache, confusion, hallucination, seizures, pain and phlebitis at injection site (due to high pH), sweating, rash, itch, increased serum creatinine and blood urea concentrations.
Toxicity
Ganciclovir is considered a potential human carcinogen, teratogen, and mutagen. It is also considered likely to cause inhibition of spermatogenesis. Thus, it is used judiciously and handled as a cytotoxic drug in the clinical setting.
Mechanism of action
Ganciclovir is a synthetic analogue of 2′-deoxy-guanosine. It is first phosphorylated to ganciclovir monophosphate by a viral kinase encoded by the cytomegalovirus (CMV) gene UL97 during infection. Subsequently, cellular kinases catalyze the formation of ganciclovir diphosphate and ganciclovir triphosphate, which is present in 10-fold greater concentrations in CMV or herpes simplex virus (HSV)-infected cells than uninfected cells.
Ganciclovir triphosphate is a competitive inhibitor of deoxyguanosine triphosphate (dGTP) incorporation into DNA and preferentially inhibits viral DNA polymerases more than cellular DNA polymerases. In addition, ganciclovir triphosphate serves as a poor substrate for chain elongation, thereby disrupting viral DNA synthesis by a second route.
Pharmacokinetics
Absorption of the oral form is very limited—about 5% fasting, about 8% with food. It achieves a concentration in the central nervous system of about 50% of the plasma level. About 90% of plasma ganciclovir is eliminated unchanged in the urine, with a half-life of 2–6 hours, depending on renal function (elimination takes over 24 hours in end-stage renal disease).
Administration
Acute infections are treated in two phases:
induction phase, 5 mg per kilogram intravenously every 12 hours for 14–21 days, the intravenous dose given as a 1-hour infusion
maintenance phase, 5 mg per kg intravenously every dayStable disease is treated with 1000 mg orally three times daily. Similar dosing is used to prevent disease in high-risk patients, such as those infected with human immunodeficiency virus (HIV) or those with organ transplants.
Ganciclovir is also available in slow-release formulations for insertion into the vitreous humour of the eye, as treatment for CMV retinitis (associated with HIV infection).
A topical ophthalmic gel preparation of ganciclovir was recently approved for the treatment of acute herpes simplex keratitis.
See also
Valganciclovir, the prodrug of ganciclovir
References
Further reading
External links
"Ganciclovir". Drug Information Portal. U.S. National Library of Medicine.
"Ganciclovir sodium". Drug Information Portal. U.S. National Library of Medicine. |
You are a guide to medical language. Please provide in-depth and understandable explanations of medical terms, highlighting their significance in healthcare. | I'm looking for a concise explanation of the medical term 'Pemphigus.' | Pemphigus ( or ) is a rare group of blistering autoimmune diseases that affect the skin and mucous membranes. The name is derived from the Greek root pemphix, meaning "pustule".In pemphigus, autoantibodies form against desmoglein, which forms the "glue" that attaches adjacent epidermal cells via attachment points called desmosomes. When autoantibodies attack desmogleins, the cells become separated from each other and the epidermis becomes detached, a phenomenon called acantholysis. This causes blisters that slough off and turn into sores. In some cases, these blisters can cover a large area of the skin.Originally, the cause of this disease was unknown, and "pemphigus" was used to refer to any blistering disease of the skin and mucosa. In 1964, researchers found that the blood of patients with pemphigus contained antibodies to the layers of skin that separate to form the blisters. In 1971, an article investigating the autoimmune nature of this disease was published.
Types
The several types of pemphigus (pemphigus vulgaris, pemphigus foliaceus, intraepidermal neutrophilic IgA dermatosis, and paraneoplastic pemphigus) vary in severity. Skin lesions caused by pemphigus can lead to fatal infections, so treatment is extremely important.
Pemphigus vulgaris (PV - ICD-10 L10.0) is the most common form of the disorder and occurs when antibodies attack desmoglein 3. Sores often originate in the mouth, making eating difficult and uncomfortable. Although PV may occur at any age, it is most common among people between 40 and 60. It is more frequent among Ashkenazi Jews. Rarely, it is associated with myasthenia gravis. Nail disease may be the only finding and has prognostic value in management.
Pemphigus foliaceus (PF) is the least severe of the three varieties. Desmoglein 1, the protein that is targeted by the autoantibodies, is enriched in the upper skin layers. PF is characterized by crusty sores that often begin on the scalp, and may move to the chest, back, and face. Mouth sores do not occur. This form is also frequent among Ashkenazi Jews. It is not as painful as PV, and is often misdiagnosed as dermatitis or eczema
Intraepidermal neutrophilic IgA dermatosis is characterized histologically by intraepidermal bullae with neutrophils, some eosinophils, and acantholysis.
The least common and most severe type of pemphigus is paraneoplastic pemphigus (PNP). This disorder is a complication of cancer, usually lymphoma or Castlemans disease. It may precede the diagnosis of the tumor. Painful sores appear on the mouth, lips, and the esophagus. In this variety of pemphigus, the disease process often involves the lungs, causing bronchiolitis obliterans (constrictive bronchiolitis). Though much less frequent, it is still found the most in the Ashkenazi Jewish population. Complete removal of and/or cure of the tumor may improve the skin disease, but lung damage is generally irreversible.
Endemic pemphigus foliaceus includes fogo selvagem, the new variant of endemic pemphigus foliaceus in El Bagre, Colombia, and the Tunisian endemic pemphigus in North Africa.Hailey-Hailey disease, also called familial benign pemphigus, is an inherited skin disease, not an autoimmune disease, so it is not considered part of the pemphigus group of diseases.
Diagnosis
Pemphigus defines a group of autoimmune intraepithelial blistering diseases that are characterized by loss of normal cell-cell adhesion (acantholysis), and by the presence of pathogenic (predominantly IgG) autoantibodies reacting against epithelial adhesion molecules. Pemphigus is further divided in two major subtypes: pemphigus vulgaris (PV) and pemphigus foliaceus (PF). However, several other disorders such as IgA pemphigus, IgE pemphigus, pemphigus herpetiformis, drug-induced pemphigus, Senear Usher syndrome, and endemic pemphigus foliaceus exist, and are recognized by a dermatologist from the appearance and distribution of the skin lesions. It is also commonly diagnosed by specialists practicing otolaryngology- head and neck surgery, periodontists, oral and maxillofacial surgeons, and eye doctors, as lesions can affect the eyes and mucous membranes of the oral cavity. Intraorally, it resembles the more common diseases lichen planus and mucous membrane pemphigoid. Definitive diagnosis requires examination of a skin or mucous membrane biopsy by a dermatopathologist or oral pathologist. The skin biopsy is taken from the edge of a blister, prepared for histopathology and examined with a microscope. The pathologist looks for an intraepidermal vesicle caused by the breaking apart of epidermal cells (acantholysis). Thus, the superficial (upper) portion of the epidermis sloughs off, leaving the bottom layer of cells on the "floor" of the blister. This bottom layer of cells is said to have a "tombstone" appearance.
Definitive diagnosis also requires the demonstration of antidesmoglein autoantibodies by direct immunofluorescence on the skin biopsy. These antibodies appear as IgG deposits along the desmosomes between epidermal cells, a pattern reminiscent of chicken wire. Antidesmoglein antibodies can also be detected in a blood sample using the ELISA technique.
Classification
Pemphigus is a group of autoimmune blistering diseases that may be classified into these types:
Pemphigus vulgaris
Pemphigus vegetans
Pemphigus vegetans of Hallopeau
Pemphigus vegetans of Neumann
Pemphigus foliaceus, of which there several forms:
Pemphigus erythematosus or Senear–Usher Syndrome
Endemic pemphigus foliaceus with its three variants, Fogo Selvagem, the new variant endemic pemphigus Foliaeus and Tunisian endemic pemphigus foliaceus
Paraneoplastic pemphigus
IgA pemphigus, of which there several forms:
Subcorneal pustular dermatosis
Intraepidermal neutrophilic IgA dermatosis
Drug induced pemphigus
Treatment
If not treated, pemphigus can be fatal, usually from overwhelming opportunistic infection of lesions. The most common treatment is the administration of oral steroids, especially prednisone, often in high doses. The side effects of corticosteroids may require the use of so-called steroid-sparing or adjuvant drugs. One of the most dangerous side effects of high-dosage steroid treatments is intestinal perforations, which may lead to sepsis. Steroids and other medications being taken to treat pemphigus may also mask the effects of the perforations. Patients on high dosages of oral steroids should closely monitor their gastrointestinal health. As lesions are usually terribly painful, pain medication likely complicate and exacerbate the gastrointestinal issues caused by steroids.
Treatment options
Topical steroids, such as clobetasol
Intralesional injection of steroids, such as dexamethasone
Immunosuppressant drugs, such as CellCept (mycophenolic acid): In recent years, adjuvant drugs, especially biologics, have shown great promise.
Serum- or plasma-pooled products, such as intravenous gamma globulin (IVIG) may be useful in severe cases, especially paraneoplastic pemphigus.
Biologics such as Rituximab, an anti-CD20 antibody, which was found to improve otherwise severe cases of recalcitrant pemphigus vulgaris.All of these drugs may cause severe side effects, so patients should be closely monitored by doctors. Once the outbreaks are under control, dosage is often reduced, to lessen side effects.
A meta-analysis of the literature found insufficient evidence to determine the optimal treatment regimen for pemphigus vulgaris and pemphigus foliaceus, but it found that adding cyclophosphamid and azathioprine to a glucocorticoid regimen reduced the amount of glucocorticoid needed for treatment, and topical epidermal growth factor significantly reduced lesion healing time.If skin lesions do become infected, antibiotics may be prescribed. Tetracycline antibiotics have a mildly beneficial effect on the disease and are sometimes enough for pemphigus foliaceus. In addition, talcum powder is helpful to prevent oozing sores from adhering to bedsheets and clothes. Wound care and treatments are often akin to those used in burn units, including careful use of dressings that dont stick to the wounds, etc.
If paraneoplastic pemphigus is diagnosed with pulmonary disease, a powerful cocktail of immunosuppressant drugs is sometimes used in an attempt to halt the rapid progression of bronchiolitis obliterans, including methylprednisolone, ciclosporin, azathioprine, and thalidomide. Plasmapheresis may also be useful.
Animals affected
Pemphigus foliaceus has been recognized in pet dogs, cats, and horses, and is the most common autoimmune skin disease diagnosed in veterinary medicine. PF in animals produces clusters of small vesicles that quickly evolve into pustules. Pustules may rupture, forming erosions or become crusted. Left untreated, PF in animals is life-threatening, leading to not only loss of condition, but also secondary infection.
PV is a very rare disorder described in pet dogs and cats. Paraneoplastic pemphigus has been identified in pet dogs.
See also
List of conditions caused by problems with junctional proteins
List of cutaneous conditions
List of immunofluorescence findings for autoimmune bullous conditions
List of target antigens in pemphigus
Pemphigoid
Pemphigus herpetiformis
References
External links
National Organization of Rare Diseases: Pemphigus |
You are an expert in medical terminology. Explain medical terms in a way that is both precise and easy to understand for non-medical audiences. | I'd like to learn more about the medical term 'Dissociative identity disorder.' Can you provide some details? | Dissociative identity disorder (DID), previously known as multiple personality disorder (MPD), and colloquially known as split personality disorder, is a mental disorder characterized by the maintenance of at least two distinct and relatively enduring personality states.The disorder is accompanied by memory gaps more severe than could be explained by ordinary forgetfulness. The personality states alternately show in a persons behavior; however, presentations of the disorder vary. Other conditions that often occur in people with DID include post-traumatic stress disorder, personality disorders (especially borderline and avoidant), depression, substance use disorders, conversion disorder, somatic symptom disorder, eating disorders, obsessive–compulsive disorder, and sleep disorders. Self-harm, non-epileptic seizures, flashbacks with amnesia for content of flashbacks, anxiety disorders, and suicidality are also common.
Overview
The following three subsections give brief overviews of the proposed cause of dissociative identity disorder (DID) and how it is recognized; conventional treatment of DID, and how frequently it occurs; and finally how it is perceived in present western culture. All of the topics are treated in greater detail in later sections.
Cause and diagnosis
DID is associated with overwhelming traumas or abuse during childhood.(p 294) In about 90% of cases, there is a history of neglect or abuse in childhood, while other cases are linked to experiences of war, or severe medical procedures during childhood. Genetic and biological factors are also believed to play a role.
The diagnosis should not be made if the persons condition is better accounted for by substance use disorder, seizures, other mental health problems, imaginative play in children, or religious practices.
Treatment and epidemiology
Treatment generally involves supportive care and psychotherapy. The condition usually persists without treatment. It is believed to affect about 1.5% of the general population (based on a small US community sample) and 3% of those admitted to hospitals with mental health issues in Europe and North America. DID is diagnosed about six times more often in women than in men. The number of recorded cases increased significantly in the latter half of the 20th century, along with the number of identities reported by those affected.
Society and culture
DID is controversial within both the field of psychiatry and the legal system. Claims of DID have been used only rarely to argue criminal insanity in court.It is unclear whether increased rates of the disorder are due to better recognition or sociocultural factors such as mass media portrayals. The typical presenting symptoms in different regions of the world may also vary depending on culture, for example alter identities taking the form of possessing spirits, deities, ghosts, or mythical figures in cultures where normative possession states are common.(pp 295, 801) The possession form of dissociative identity disorder is involuntary and distressing, and occurs in a way that violates cultural or religious norms.(p 295)
Definitions
Dissociation, the term that underlies dissociative disorders including DID, lacks a precise, empirical, and generally agreed upon definition.A large number of diverse experiences have been termed dissociative, ranging from normal failures in attention to the breakdowns in memory processes characterized by the dissociative disorders. It is therefore unknown if there is a commonality between all dissociative experiences, or if the range of mild to severe symptoms is a result of different etiologies and biological structures. Other terms used in the literature, including personality, personality state, identity, ego state, and amnesia, also have no agreed upon definitions. Multiple competing models exist that incorporate some non-dissociative symptoms while excluding dissociative ones.Due to the lack of consensus regarding terminology in the study of DID, several terms have been proposed. One is ego state (behaviors and experiences possessing permeable boundaries with other such states but united by a common sense of self), while the other term is alters (each of which may have a separate autobiographical memory, independent initiative and a sense of ownership over individual behavior).Ellert Nijenhuis and colleagues suggest a distinction between personalities responsible for day-to-day functioning (associated with blunted physiological responses and reduced emotional reactivity, referred to as the "apparently normal part of the personality" or ANP) and those emerging in survival situations (involving fight-or-flight responses, vivid traumatic memories and strong, painful emotions – the "emotional part of the personality" or EP). "Structural dissociation of the personality" is used by Otto van der Hart and colleagues to distinguish dissociation they attribute to traumatic or pathological causes, which in turn is divided into primary, secondary and tertiary dissociation. According to this hypothesis, primary dissociation involves one ANP and one EP, while secondary dissociation involves one ANP and at least two EPs and tertiary dissociation, which is unique to DID, is described as having at least two ANPs and at least two EPs. Others have suggested dissociation can be separated into two distinct forms, detachment and compartmentalization, the latter of which, involving a failure to control normally controllable processes or actions, is most evident in DID. Efforts to psychometrically distinguish between normal and pathological dissociation have been made.
Signs and symptoms
According to the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5), symptoms of DID include "the presence of two or more distinct personality states" accompanied by the inability to recall personal information beyond what is expected through normal memory issues. Other DSM-5 symptoms include a loss of identity as related to individual distinct personality states, loss of ones subjective experience of the passage of time, and degradation of a sense of self and consciousness. In each individual, the clinical presentation varies and the level of functioning can change from severe impairment to minimal impairment. The symptoms of dissociative amnesia are subsumed under a DID diagnosis, and thus should not be diagnosed separately if DID criteria are met. Individuals with DID may experience distress from both the symptoms of DID (intrusive thoughts or emotions) and the consequences of the accompanying symptoms (dissociation rendering them unable to remember specific information). The majority of patients with DID report childhood sexual or physical abuse, though the accuracy of these reports is controversial. Amnesia between identities may be asymmetrical; identities may or may not be aware of what is known by another. Individuals with DID may be reluctant to discuss symptoms due to associations with abuse, shame, and fear. DID patients may also frequently and intensely experience time disturbances.Around half of people with DID have fewer than 10 identities and most have fewer than 100; although as many as 4,500 have been reported.(p 503) The average number of identities has increased over the past few decades, from two or three to now an average of approximately 16. However, it is unclear whether this is due to an actual increase in identities, or simply that the psychiatric community has become more accepting of a high number of compartmentalized memory components.
Comorbid disorders
The psychiatric history frequently contains multiple previous diagnoses of various disorders and treatment failures. The most common presenting complaint of DID is depression, with headaches being a common neurological symptom. Comorbid disorders can include substance use disorder, eating disorders, anxiety disorders, bipolar disorder, and personality disorders. A significant percentage of those diagnosed with DID have histories of borderline personality disorder and post-traumatic stress disorder (PTSD). Presentations of dissociation in people with schizophrenia differ from those with DID as not being rooted in trauma, and this distinction can be effectively tested, although both conditions share a high rate of dissociative auditory hallucinations. Other disorders that have been found to be comorbid with DID are somatization disorders, major depressive disorder, as well as history of a past suicide attempt, in comparison to those without a DID diagnosis. Individuals diagnosed with DID demonstrate the highest hypnotizability of any clinical population. Although DID has high comorbidity and its development is related to trauma, there exists evidence to suggest that DID merits a separate diagnosis from other conditions like PTSD.
Borderline personality disorder
The DSM-IV-TR states that self-harm, impulsivity, and rapid changes in interpersonal relationships "may warrant a concurrent diagnosis of borderline personality disorder." Steven Lynn and colleagues have suggested that the significant overlap between BPD and DID may be a contributing factor to the development of therapy induced DID, in that the suggestion of hidden alters by therapists who propose a diagnosis of DID provides an explanation to patients for the behavioral instability, self-mutilation, unpredictable mood changes and actions they experience. In 1993 a group of researchers reviewed both DID and borderline personality disorder (BPD), concluding that DID was an epiphenomenon of BPD, with no tests or clinical description capable of distinguishing between the two. Their conclusions about the empirical proof of DID were echoed by a second group, who still believed the diagnosis existed, but while the knowledge to date did not justify DID as a separate diagnosis, it also did not disprove its existence. Reviews of medical records and psychological tests indicated that the majority of DID patients could be diagnosed with BPD instead, though about a third could not, suggesting that DID does exist but may be over-diagnosed. Both groups also report higher rates of physical and sexual abuse than the general population, and patients with BPD also score highly on measures of dissociation. Even using strict diagnostic criteria, it can be difficult to distinguish between dissociative disorders and BPD (as well as bipolar disorder and schizophrenia), though the presence of comorbid anxiety disorders may help.}}
Causes
General
DID is etiologically complex. Şar et al. state, "Dissociative identity disorder (DID) is multifactorial in its etiology. Whereas psychosocial etiologies of DID include developmental traumatization and sociocognitive sequelae, biological factors include trauma-generated neurobiological responses. Biologically derived traits and epigenetic mechanisms are also likely to be at play. At this point, no direct examination of genetics has occurred in DID. However, it is likely to exist, given the genetic link to dissociation in general and in relation to childhood adversity in particular." Stating that there is "a lack of understanding regarding the etiopathology of DID", Blihar adds that "many researchers and psychiatrists regard DID as the most severe form of a childhood onset post-traumatic stress disorder (PTSD) because it is virtually impossible to find a DID patient without a history of PTSD. ... There are currently two competing theories regarding the relationship between trauma and dissociation: the trauma-related model and the fantasy-prone model."The DSM-5 diagnostic manual states that DID is "associated with overwhelming experiences, traumatic events, and/or abuse during childhood".(p 294) Other risk factors reported include childhood neglect, childhood medical procedures, war, terrorism, and childhood prostitution.(p 295) Dissociative disorders frequently occur after trauma, and the DSM5 places them after the trauma and stressor-related disorders to reflect this close relationship.(p 291) Disturbed and altered sleep has also been suggested as having a role in dissociative disorders in general and specifically in DID, alterations in environments also largely affecting the DID patient.
Developmental trauma
People diagnosed with DID often report that they have experienced physical or sexual abuse during childhood (although the accuracy of these reports has been disputed); others report overwhelming stress, serious medical illness or other traumatic events during childhood. They also report more historical psychological trauma than those diagnosed with any other mental illness.
Severe sexual, physical, or psychological trauma in childhood has been proposed as an explanation for its development; awareness, memories and emotions of harmful actions or events caused by the trauma are removed from consciousness, and alternate personalities or subpersonalities form with differing memories, emotions and behavior. DID is attributed to extremes of stress or disorders of attachment. What may be expressed as post-traumatic stress disorder (PTSD) in adults may become DID when occurring in children, possibly due to their greater use of imagination as a form of coping.Possibly due to developmental changes and a more coherent sense of self past the age of six, the experience of extreme trauma may result in different, though also complex, dissociative symptoms and identity disturbances. A specific relationship between childhood abuse, disorganized attachment, and lack of social support are thought to be a necessary component of DID. Although what role a childs biological capacity to dissociate to an extreme level remains unclear, some evidence indicates a neurobiological impact of developmental stress.Delinking early trauma from the etiology of dissociation has been explicitly rejected by those supporting the early trauma model. However, a 2012 review article supports the hypothesis that current or recent trauma may affect an individuals assessment of the more distant past, changing the experience of the past and resulting in dissociative states. Giesbrecht et al. have suggested there is no actual empirical evidence linking early trauma to dissociation, and instead suggest that problems with neuropsychological functioning, such as increased distractibility in response to certain emotions and contexts, account for dissociative features. A middle position hypothesizes that trauma, in some situations, alters neuronal mechanisms related to memory. Evidence is increasing that dissociative disorders are related both to a trauma history and to "specific neural mechanisms". It has also been suggested that there may be a genuine but more modest link between trauma and DID, with early trauma causing increased fantasy-proneness, which may in turn render individuals more vulnerable to socio-cognitive influences surrounding the development of DID. Another suggestion made by Hart indicates that there are triggers in the brain that can be the catalyst for different self-states, and that victims of trauma are more susceptible to these triggers than non-victims of trauma; these triggers are said to be related to DID.Paris states that the trauma model of DID increased the appeal of the diagnosis among health care providers, patients and the public as it validated the idea that child abuse had lifelong, serious effects. Paris asserts that there is very little experimental evidence supporting the trauma-dissociation hypothesis, and no research showing that dissociation consistently links to long-term memory disruption.
Therapist-induced
The prevailing post-traumatic model of dissociation and dissociative disorders is contested. It has been hypothesized that symptoms of DID may be created by therapists using techniques to "recover" memories (such as the use of hypnosis to "access" alter identities, facilitate age regression or retrieve memories) on suggestible individuals. Referred to as the "sociocognitive model" (SCM), it proposes that DID is due to a person consciously or unconsciously behaving in certain ways promoted by cultural stereotypes, with unwitting therapists providing cues through improper therapeutic techniques. This model posits that behavior is enhanced by media portrayals of DID.Proponents of the SCM note that the bizarre dissociative symptoms are rarely present before intensive therapy by specialists in the treatment of DID who, through the process of eliciting, conversing with and identifying alters, shape or possibly create the diagnosis. While proponents note that DID is accompanied by genuine suffering and the distressing symptoms, and can be diagnosed reliably using the DSM criteria, they are skeptical of the traumatic etiology suggested by proponents. The characteristics of people diagnosed with DID (hypnotizability, suggestibility, frequent fantasization and mental absorption) contributed to these concerns and those regarding the validity of recovered memories of trauma. Skeptics note that a small subset of doctors are responsible for diagnosing the majority of individuals with DID. Psychologist Nicholas Spanos and others have suggested that in addition to therapy caused cases, DID may be the result of role-playing rather than alternative identities, though others disagree, pointing to a lack of incentive to manufacture or maintain separate identities and point to the claimed histories of abuse. Other arguments that therapy can cause DID, include the lack of children diagnosed with DID, the sudden spike in rates of diagnosis after 1980 (although DID was not a diagnosis until DSM-IV, published in 1994), the absence of evidence of increased rates of child abuse, the appearance of the disorder almost exclusively in individuals undergoing psychotherapy, particularly involving hypnosis, the presences of bizarre alternate identities (such as those claiming to be animals or mythological creatures) and an increase in the number of alternate identities over time (as well as an initial increase in their number as psychotherapy begins in DID-oriented therapy). These various cultural and therapeutic causes occur within a context of pre-existing psychopathology, notably borderline personality disorder, which is commonly comorbid with DID. In addition, presentations can vary across cultures, such as Indian patients who only switch alters after a period of sleep – which is commonly how DID is presented by the media within that country.Proponents of psychotherapy as a cause of DID state that DID is strongly linked to (possibly suggestive) psychotherapy, often involving recovered memories (memories that the person previously had amnesia for) or false memories, and that such therapy could cause additional identities. Such memories could be used to make an allegation of child sexual abuse. There is little agreement between those who see therapy as a cause and trauma as a cause. Supporters of therapy as a cause of DID suggest that a small number of clinicians diagnosing a disproportionate number of cases would provide evidence for their position though it has also been claimed that higher rates of diagnosis in specific countries like the United States may be due to greater awareness of DID. Lower rates in other countries may be due to artificially low recognition of the diagnosis. However, false memory syndrome per se is not regarded by mental health experts as a valid diagnosis, and has been described as "a non-psychological term originated by a private foundation whose stated purpose is to support accused parents," and critics argue that the concept has no empirical support, and further describe the False Memory Syndrome Foundation as an advocacy group that has distorted and misrepresented memory research.
Children
The rarity of DID diagnosis in children is cited as a reason to doubt the validity of DID, and proponents of both etiologies believe that the discovery of DID in a child who had never undergone treatment would critically undermine the SCM. Conversely, if children are found to develop DID only after undergoing treatment it would challenge the traumagenic model. As of 2011, approximately 250 cases of DID in children have been identified, though the data does not offer unequivocal support for either theory. While children have been diagnosed with DID before therapy, several were presented to clinicians by parents who were themselves diagnosed with DID; others were influenced by the appearance of DID in popular culture or due to a diagnosis of psychosis due to hearing voices – a symptom also found in DID. No studies have looked for children with DID in the general population, and the single study that attempted to look for children with DID not already in therapy did so by examining siblings of those already in therapy for DID. An analysis of diagnosis of children reported in scientific publications, 44 case studies of single patients were found to be evenly distributed (i.e., each case study was reported by a different author) but in articles regarding groups of patients, four researchers were responsible for the majority of the reports.The initial theoretical description of DID was that dissociative symptoms were a means of coping with extreme stress (particularly childhood sexual and physical abuse), but this belief has been challenged by the data of multiple research studies. Proponents of the traumagenic hypothesis claim the high correlation of child sexual and physical abuse reported by adults with DID corroborates the link between trauma and DID. However, the DID–maltreatment link has been questioned for several reasons. The studies reporting the links often rely on self-report rather than independent corroborations, and these results may be worsened by selection and referral bias. Most studies of trauma and dissociation are cross-sectional rather than longitudinal, which means researchers can not attribute causation, and studies avoiding recall bias have failed to corroborate such a causal link. In addition, studies rarely control for the many disorders comorbid with DID, or family maladjustment (which is itself highly correlated with DID). The popular association of DID with childhood abuse is relatively recent, occurring only after the publication of Sybil in 1973. Most previous examples of "multiples" such as Chris Costner Sizemore, whose life was depicted in the book and film The Three Faces of Eve, disclosed no history of child abuse.
Pathophysiology
Despite research on DID including structural and functional magnetic resonance imaging, positron emission tomography, single-photon emission computed tomography, event-related potential, and electroencephalography, no convergent neuroimaging findings have been identified regarding DID, making it difficult to hypothesize a biological basis for DID. In addition, many of the studies that do exist were performed from an explicitly trauma-based position, and did not consider the possibility of therapy as a cause of DID. There is no research to date regarding the neuroimaging and introduction of false memories in DID patients, though there is evidence of changes in visual parameters and support for amnesia between alters. DID patients also appear to show deficiencies in tests of conscious control of attention and memorization (which also showed signs of compartmentalization for implicit memory between alters but no such compartmentalization for verbal memory) and increased and persistent vigilance and startle responses to sound. DID patients may also demonstrate altered neuroanatomy. Experimental tests of memory suggest that patients with DID may have improved memory for certain tasks, which has been used to criticize the hypothesis that DID is a means of forgetting or suppressing memory. Patients also show experimental evidence of being more fantasy-prone, which in turn is related to a tendency to over-report false memories of painful events.
Diagnosis
General
The fifth, revised edition of the American Psychiatric Associations Diagnostic and Statistical Manual of Mental Disorders (DSM-5) diagnoses DID according to the diagnostic criteria found under code 300.14 (dissociative disorders). DID is often initially misdiagnosed because clinicians receive little training about dissociative disorders or DID, and often use standard diagnostic interviews that do not include questions about trauma, dissociation or post-traumatic symptoms.(p 118) This contributes to difficulties diagnosing the disorder and clinician bias.DID is rarely diagnosed in children, despite the average age of appearance of the first alter being three years old. The criteria require that an individual be recurrently controlled by two or more discrete identities or personality states, accompanied by memory lapses for important information that is not caused by alcohol, drugs or medications and other medical conditions such as complex partial seizures. In children the symptoms must not be better explained by "imaginary playmates or other fantasy play". Diagnosis is normally performed by a clinically trained mental health professional such as a psychiatrist or psychologist through clinical evaluation, interviews with family and friends, and consideration of other ancillary material. Specially designed interviews (such as the SCID-D) and personality assessment tools may be used in the evaluation as well. Since most of the symptoms depend on self-report and are not concrete and observable, there is a degree of subjectivity in making the diagnosis. People are often disinclined to seek treatment, especially since their symptoms may not be taken seriously; thus dissociative disorders have been referred to as "diseases of hiddenness".The diagnosis has been criticized by supporters of therapy as a cause or the sociocognitive hypothesis as they believe it is a culture-bound and often health care induced condition. The social cues involved in diagnosis may be instrumental in shaping patient behavior or attribution, such that symptoms within one context may be linked to DID, while in another time or place the diagnosis could have been something other than DID. Other researchers disagree and argue that the existence of the condition and its inclusion in the DSM is supported by multiple lines of reliable evidence, with diagnostic criteria allowing it to be clearly discriminated from conditions it is often mistaken for (schizophrenia, borderline personality disorder, and seizure disorder). That a large proportion of cases are diagnosed by specific health care providers, and that symptoms have been created in nonclinical research subjects given appropriate cueing has been suggested as evidence that a small number of clinicians who specialize in DID are responsible for the creation of alters through therapy. The condition may be under-diagnosed due to skepticism and lack of awareness from mental health professionals, made difficult due to the lack of specific and reliable criteria for diagnosing DID as well as a lack of prevalence rates due to the failure to examine systematically selected and representative populations.
Differential diagnoses
People with DID are diagnosed with five to seven comorbid disorders on average – much higher than other mental illnesses.Due to overlapping symptoms, the differential diagnosis includes schizophrenia, normal and rapid-cycling bipolar disorder, epilepsy, borderline personality disorder, and autism spectrum disorder. Delusions or auditory hallucinations can be mistaken for speech by other personalities. Persistence and consistency of identities and behavior, amnesia, measures of dissociation or hypnotizability and reports from family members or other associates indicating a history of such changes can help distinguish DID from other conditions. A diagnosis of DID takes precedence over any other dissociative disorders. Distinguishing DID from malingering is a concern when financial or legal gains are an issue, and factitious disorder may also be considered if the person has a history of help or attention-seeking. Individuals who state that their symptoms are due to external spirits or entities entering their bodies are generally diagnosed with dissociative disorder not otherwise specified rather than DID due to the lack of identities or personality states. Most individuals who enter an emergency department and are unaware of their names are generally in a psychotic state. Although auditory hallucinations are common in DID, complex visual hallucinations may also occur. Those with DID generally have adequate reality testing; they may have positive Schneiderian symptoms of schizophrenia but lack the negative symptoms. They perceive any voices heard as coming from inside their heads (patients with schizophrenia experience them as external). In addition, individuals with psychosis are much less susceptible to hypnosis than those with DID. Difficulties in differential diagnosis are increased in children.DID must be distinguished from, or determined if comorbid with, a variety of disorders including mood disorders, psychosis, anxiety disorders, PTSD, personality disorders, cognitive disorders, neurological disorders, epilepsy, somatoform disorder, factitious disorder, malingering, other dissociative disorders, and trance states. An additional aspect of the controversy of diagnosis is that there are many forms of dissociation and memory lapses, which can be common in both stressful and nonstressful situations and can be attributed to much less controversial diagnoses. Individuals faking or mimicking DID due to factitious disorder will typically exaggerate symptoms (particularly when observed), lie, blame bad behavior on symptoms and often show little distress regarding their apparent diagnosis. In contrast, genuine people with DID typically exhibit confusion, distress and shame regarding their symptoms and history.A relationship between DID and borderline personality disorder has been posited, with various clinicians noting overlap between symptoms and behaviors and it has been suggested that some cases of DID may arise "from a substrate of borderline traits". Reviews of DID patients and their medical records concluded that the majority of those diagnosed with DID would also meet the criteria for either borderline personality disorder or more generally borderline personality.The DSM-5 elaborates on cultural background as an influence for some presentations of DID.(p 295)
Many features of dissociative identity disorder can be influenced by the individuals cultural background. Individuals with this disorder may present with prominent medically unexplained neurological symptoms, such as non-epileptic seizures, paralyses, or sensory loss, in cultural settings where such symptoms are common. Similarly, in settings where normative possession is common (e.g., rural areas in the developing world, among certain religious groups in the United States and Europe), the fragmented identities may take the form of possessing spirits, deities, demons, animals, or mythical figures. Acculturation or prolonged intercultural contact may shape the characteristics of other identities (e.g., identities in India may speak English exclusively and wear Western clothes). Possession-form dissociative identity disorder can be distinguished from culturally accepted possession states in that the former is involuntary, distressing, uncontrollable, and often recurrent or persistent; involves conflict between the individual and his or her surrounding family, social, or work milieu; and is manifested at times and in places that violate the norms of the culture or religion.
Controversy
DID is among the most controversial of the dissociative disorders and among the most controversial disorders found in the DSM-5. The primary dispute is between those who believe DID is caused by traumatic stresses forcing the mind to split into multiple identities, each with a separate set of memories, and the belief that the symptoms of DID are produced artificially by certain psychotherapeutic practices or patients playing a role they believe appropriate for a person with DID. The debate between the two positions is characterized by intense disagreement. Research into this hypothesis has been characterized by poor methodology. Psychiatrist Joel Paris notes that the idea that a personality is capable of splitting into independent alters is an unproven assertion that is at odds with research in cognitive psychology.Some believe that DID is caused by health care, i.e. symptoms of DID are created by therapists themselves via hypnosis. This belief also implies that those with DID are more susceptible to manipulation by hypnosis and suggestion than others. The iatrogenic model also sometimes states that treatment for DID is harmful. According to Brand, Loewenstein and Spiegel, "[t]he claims that DID treatment is harmful are based on anecdotal cases, opinion pieces, reports of damage that are not substantiated in the scientific literature, misrepresentations of the data, and misunderstandings about DID treatment and the phenomenology of DID". Their claim is evinced by the fact that only 5%–10% of people receiving treatment worsen in their symptoms.Psychiatrists August Piper and Harold Merskey have challenged the trauma hypothesis, arguing that correlation does not imply causation – the fact that people with DID report childhood trauma does not mean trauma causes DID – and point to the rareness of the diagnosis before 1980 as well as a failure to find DID as an outcome in longitudinal studies of traumatized children. They assert that DID cannot be accurately diagnosed because of vague and unclear diagnostic criteria in the DSM and undefined concepts such as "personality state" and "identities", and question the evidence for childhood abuse beyond self-reports, the lack of definition of what would indicate a threshold of abuse sufficient to induce DID and the extremely small number of cases of children diagnosed with DID despite an average age of appearance of the first alter of three years. Psychiatrist Colin Ross disagrees with Piper and Merskeys conclusion that DID cannot be accurately diagnosed, pointing to internal consistency between different structured dissociative disorder interviews (including the Dissociative Experiences Scale, Dissociative Disorders Interview Schedule and Structured Clinical Interview for Dissociative Disorders) that are in the internal validity range of widely accepted mental illnesses such as schizophrenia and major depressive disorder. In his opinion, Piper and Merskey are setting the standard of proof higher than they are for other diagnoses. He also asserts that Piper and Merskey have cherry-picked data and not incorporated all relevant scientific literature available, such as independent corroborating evidence of trauma.A study in 2018 revealed that the phenomena of pathological dissociation (including identity alteration) had been portrayed in the ancient Chinese medicine literature, suggesting that pathological dissociation is a cross-cultural condition.
Screening
Perhaps due to their perceived rarity, the dissociative disorders (including DID) were not initially included in the Structured Clinical Interview for DSM-IV (SCID), which is designed to make psychiatric diagnoses more rigorous and reliable. Instead, shortly after the publication of the initial SCID a freestanding protocol for dissociative disorders (SCID-D) was published. This interview takes about 30 to 90 minutes depending on the subjects experiences. An alternative diagnostic instrument, the Dissociative Disorders Interview Schedule, also exists but the SCID-D is generally considered superior. The Dissociative Disorders Interview Schedule (DDIS) is a highly structured interview that discriminates among various DSM-IV diagnoses. The DDIS can usually be administered in 30–45 minutes.Other questionnaires include the Dissociative Experiences Scale (DES), Perceptual Alterations Scale, Questionnaire on Experiences of Dissociation, Dissociation Questionnaire, and the Mini-SCIDD. All are strongly intercorrelated and except the Mini-SCIDD, all incorporate absorption, a normal part of personality involving narrowing or broadening of attention. The DES is a simple, quick, and validated questionnaire that has been widely used to screen for dissociative symptoms, with variations for children and adolescents. Tests such as the DES provide a quick method of screening subjects so that the more time-consuming structured clinical interview can be used in the group with high DES scores. Depending on where the cutoff is set, people who would subsequently be diagnosed can be missed. An early recommended cutoff was 15–20. The reliability of the DES in non-clinical samples has been questioned.
Treatment
Treatment aims to increase integrated functioning. The International Society for the Study of Trauma and Dissociation has published guidelines for phase-oriented treatment in adults as well as children and adolescents that are widely used in the field of DID treatment. The guidelines state that "a desirable treatment outcome is a workable form of integration or harmony among alternate identities". Some experts in treating people with DID use the techniques recommended in the 2011 treatment guidelines. The empirical research includes the longitudinal TOP DD treatment study, which found that patients showed "statistically significant reductions in dissociation, PTSD, distress, depression, hospitalisations, suicide attempts, self-harm, dangerous behaviours, drug use and physical pain" and improved overall functioning. Treatment effects have been studied for over thirty years, with some studies having a follow-up of ten years. Adult and child treatment guidelines exist that suggest a three-phased approach, and are based on expert consensus. Highly experienced therapists have few patients that achieve a unified identity.Common treatment methods include an eclectic mix of psychotherapy techniques, including cognitive behavioral therapy (CBT), insight-oriented therapy, dialectical behavioral therapy (DBT), hypnotherapy and eye movement desensitization and reprocessing (EMDR).Medications can be used for comorbid disorders or targeted symptom relief, for example antidepressants or treatments to improve sleep. Some behavior therapists initially use behavioral treatments such as only responding to a single identity, and then use more traditional therapy once a consistent response is established. Brief treatment due to managed care may be difficult, as individuals diagnosed with DID may have unusual difficulties in trusting a therapist and take a prolonged period to form a comfortable therapeutic alliance. Regular contact (at least weekly) is recommended, and treatment generally lasts years – not weeks or months. Sleep hygiene has been suggested as a treatment option, but has not been tested. In general there are very few clinical trials on the treatment of DID, none of which were randomized controlled trials.Therapy for DID is generally phase oriented. Different alters may appear based on their greater ability to deal with specific situational stresses or threats. While some patients may initially present with a large number of alters, this number may reduce during treatment – though it is considered important for the therapist to become familiar with at least the more prominent personality states as the "host" personality may not be the "true" identity of the patient. Specific alters may react negatively to therapy, fearing the therapists goal is to eliminate the alter (particularly those associated with illegal or violent activities). A more realistic and appropriate goal of treatment is to integrate adaptive responses to abuse, injury or other threats into the overall personality structure. There is debate over issues such as whether exposure therapy (reliving traumatic memories, also known as abreaction), engagement with alters and physical contact during therapy are appropriate and there are clinical opinions both for and against each option with little high-quality evidence for any position.Brandt et al., commenting on the lack of empirical studies of treatment effectiveness, conducted a survey of 36 clinicians expert in treating dissociative disorder (DD) who recommended a three-stage treatment. They agreed that skill building in the first stage is important so the patient can learn to handle high risk, potentially dangerous behavior, as well as emotional regulation, interpersonal effectiveness and other practical behaviors. In addition, they recommended "trauma-based cognitive therapy" to reduce cognitive distortions related to trauma; they also recommended that the therapist deal with the dissociated identities early in treatment. In the middle stage, they recommended graded exposure techniques, along with appropriate interventions as needed. The treatment in the last stage was more individualized; few with DD [sic] became integrated into one identity.The first phase of therapy focuses on symptoms and relieving the distressing aspects of the condition, ensuring the safety of the individual, improving the patients capacity to form and maintain healthy relationships, and improving general daily life functioning. Comorbid disorders such as substance use disorder and eating disorders are addressed in this phase of treatment. The second phase focuses on stepwise exposure to traumatic memories and prevention of re-dissociation. The final phase focuses on reconnecting the identities of disparate alters into a single functioning identity with all its memories and experiences intact.A study was conducted to develop an "expertise-based prognostic model for the treatment of complex post-traumatic stress disorder (PTSD) and dissociative identity disorder (DID)". Researchers constructed a two-stage survey and factor analyses performed on the survey elements found 51 factors common to complex PTSD and DID. The authors concluded from their findings: "The model is supportive of the current phase-oriented treatment model, emphasizing the strengthening of the therapeutic relationship and the patients resources in the initial stabilization phase. Further research is needed to test the models statistical and clinical validity."
Prognosis
Little is known about prognosis of untreated DID. It rarely, if ever, goes away without treatment, but symptoms may resolve from time to time or wax and wane spontaneously. Patients with mainly dissociative and post-traumatic symptoms face a better prognosis than those with comorbid disorders or those still in contact with abusers, and the latter groups often face lengthier and more difficult treatment. Suicidal ideation, suicide attempts, and self-harm also may occur. Duration of treatment can vary depending on patient goals, which can range from merely improving inter-alter communication and cooperation, to reducing inter-alter amnesia, to integration of all alters, but generally takes years.
Epidemiology
General
According to the American Psychiatric Association, the 12-month prevalence of DID among adults in the US is 1.5%, with similar prevalence between women and men. Population prevalence estimates have been described to widely vary, with some estimates of DID in inpatient settings suggesting 1-9.6%." Reported rates in the community vary from 1% to 3% with higher rates among psychiatric patients. As of 2017, evidence suggested a prevalence of DID of 2–5% among psychiatric inpatients, 2–3% among outpatients, and 1% in the general population, with rates reported as high as 16.4% for teenagers in psychiatric outpatient services. Dissociative disorders in general have a prevalence of 12.0%–13.8% for psychiatric outpatients.As of 2012, DID was diagnosed 5 to 9 times more common in women than men during young adulthood, although this may have been due to selection bias as men meeting DID diagnostic criteria were suspected to end up in the criminal justice system rather than hospitals. In children, rates among men and women are approximately the same (5:4). DID diagnoses are extremely rare in children; much of the research on childhood DID occurred in the 1980s and 1990s and does not address ongoing controversies surrounding the diagnosis. DID occurs more commonly in young adults and declines in prevalence with age.There is a poor awareness of DID in the clinical settings and the general public. Poor clinical education (or lack thereof) for DID and other dissociative disorders has been described in literature: "most clinicians have been taught (or assume) that DID is a rare disorder with a florid, dramatic presentation." Symptoms in patients are often not easily visible, which complicates diagnosis. DID has a high correlation with, and has been described as a form of, complex post-traumatic stress disorder. There is a significant overlap of symptoms between borderline personality disorder and DID, although symptoms are understood to originate from different underlying causes.
Historical prevalence
Rates of diagnosed DID were increasing in the late 20th century, reaching a peak of diagnoses at approximately 40,000 cases by the end of the 20th century, up from less than 200 diagnoses before 1970. Initially DID along with the rest of the dissociative disorders were considered the rarest of psychological conditions, diagnosed in less than 100 by 1944, with only one further case reported in the next two decades. In the late 1970s and 80s, the number of diagnoses rose sharply. An estimate from the 1980s placed the incidence at 0.01%. Accompanying this rise was an increase in the number of alters, rising from only the primary and one alter personality in most cases, to an average of 13 in the mid-1980s (the increase in both number of cases and number of alters within each case are both factors in professional skepticism regarding the diagnosis). Others explain the increase as being due to the use of inappropriate therapeutic techniques in highly suggestible individuals, though this is itself controversial while proponents of DID claim the increase in incidence is due to increased recognition of and ability to recognize the disorder. Figures from psychiatric populations (inpatients and outpatients) show a wide diversity from different countries.A 1996 essay suggested three possible causes for the sudden increase of DID diagnoses, among which the author suspects the first being most likely:
The result of therapist suggestions to suggestible people, much as Charcots hysterics acted in accordance with his expectations.
Psychiatrists past failure to recognize dissociation being redressed by new training and knowledge.
Dissociative phenomena are actually increasing, but this increase only represents a new form of an old and protean entity: "hysteria".Dissociative disorders were excluded from the Epidemiological Catchment Area Project.
North America
DID is considered a controversial diagnosis and condition, with much of the literature on DID still being generated and published in North America, to the extent that it was once regarded as a phenomenon confined to that continent though research has appeared discussing the appearance of DID in other countries and cultures. Although the condition has been described in non-English speaking nations and non-Western cultures, these reports all occur in English-language journals authored by international researchers who cite Western scientific literature and are therefore not isolated from Western influences. Etzel Cardena and David Gleaves believed the over-representation of DID in North America was the result of increased awareness and training about the condition which had formerly been missing.
History
Early references
In the 19th century, "dédoublement", or "double consciousness", the historical precursor to DID, was frequently described as a state of sleepwalking, with scholars hypothesizing that the patients were switching between a normal consciousness and a "somnambulistic state".An intense interest in spiritualism, parapsychology and hypnosis continued throughout the 19th and early 20th centuries, running in parallel with John Lockes views that there was an association of ideas requiring the coexistence of feelings with awareness of the feelings. Hypnosis, which was pioneered in the late 18th century by Franz Mesmer and Armand-Marie Jacques de Chastenet, Marques de Puységur, challenged Lockes association of ideas. Hypnotists reported what they thought were second personalities emerging during hypnosis and wondered how two minds could coexist.
In the 19th century, there were a number of reported cases of multiple personalities which Rieber estimated would be close to 100. Epilepsy was seen as a factor in some cases, and discussion of this connection continues into the present era.By the late 19th century, there was a general acceptance that emotionally traumatic experiences could cause long-term disorders which might display a variety of symptoms. These conversion disorders were found to occur in even the most resilient individuals, but with profound effect in someone with emotional instability like Louis Vivet (1863–?), who had a traumatic experience as a 17-year-old when he encountered a viper. Vivet was the subject of countless medical papers and became the most studied case of dissociation in the 19th century.
Between 1880 and 1920, various international medical conferences devoted time to sessions on dissociation. It was in this climate that Jean-Martin Charcot introduced his ideas of the impact of nervous shocks as a cause for a variety of neurological conditions. One of Charcots students, Pierre Janet, took these ideas and went on to develop his own theories of dissociation. One of the first individuals diagnosed with multiple personalities to be scientifically studied was Clara Norton Fowler, under the pseudonym Christine Beauchamp; American neurologist Morton Prince studied Fowler between 1898 and 1904, describing her case study in his 1906 monograph, Dissociation of a Personality.
20th century
In the early 20th century, interest in dissociation and multiple personalities waned for several reasons. After Charcots death in 1893, many of his so-called hysterical patients were exposed as frauds, and Janets association with Charcot tarnished his theories of dissociation. Sigmund Freud recanted his earlier emphasis on dissociation and childhood trauma.In 1908, Eugen Bleuler introduced the term "schizophrenia" to represent a revised disease concept for Emil Kraepelins dementia praecox. Whereas Kraepelins natural disease entity was anchored in the metaphor of progressive deterioration and mental weakness and defect, Bleuler offered a reinterpretation based on dissociation or "splitting" (Spaltung) and widely broadened the inclusion criteria for the diagnosis. A review of the Index medicus from 1903 through 1978 showed a dramatic decline in the number of reports of multiple personality after the diagnosis of schizophrenia became popular, especially in the United States. The rise of the broad diagnostic category of dementia praecox has also been posited in the disappearance of "hysteria" (the usual diagnostic designation for cases of multiple personalities) by 1910. A number of factors helped create a large climate of skepticism and disbelief; paralleling the increased suspicion of DID was the decline of interest in dissociation as a laboratory and clinical phenomenon.Starting in about 1927, there was a large increase in the number of reported cases of schizophrenia, which was matched by an equally large decrease in the number of multiple personality reports. With the rise of a uniquely American reframing of dementia praecox/schizophrenia as a functional disorder or "reaction" to psychobiological stressors – a theory first put forth by Adolf Meyer in 1906—many trauma-induced conditions associated with dissociation, including "shell shock" or "war neuroses" during World War I, were subsumed under these diagnoses. It was argued in the 1980s that DID patients were often misdiagnosed with schizophrenia.The public, however, was exposed to psychological ideas which took their interest. Mary Shelleys Frankenstein, Robert Louis Stevensons Strange Case of Dr Jekyll and Mr Hyde, and many short stories by Edgar Allan Poe, had a formidable impact.
Book and film The Three Faces of Eve
In 1957, with the publication of the bestselling book The Three Faces of Eve by psychiatrists Corbett H. Thigpen and Hervey M. Cleckley, based on a case study of their patient Chris Costner Sizemore, and the subsequent popular movie of the same name, the American publics interest in multiple personality was revived. More cases of dissociative identity disorder were diagnosed in the following years. The cause of the sudden increase of cases is indefinite, but it may be attributed to the increased awareness, which revealed previously undiagnosed cases or new cases may have been induced by the influence of the media on the behavior of individuals and the judgement of therapists. During the 1970s an initially small number of clinicians campaigned to have it considered a legitimate diagnosis.
History in the DSM
The DSM-II used the term hysterical neurosis, dissociative type. It described the possible occurrence of alterations in the patients state of consciousness or identity, and included the symptoms of "amnesia, somnambulism, fugue, and multiple personality". The DSM-III grouped the diagnosis with the other four major dissociative disorders using the term "multiple personality disorder". The DSM-IV made more changes to DID than any other dissociative disorder, and renamed it DID. The name was changed for two reasons: First, the change emphasizes the main problem is not a multitude of personalities, but rather a lack of a single, unified identity and an emphasis on "the identities as centers of information processing". Second, the term "personality" is used to refer to "characteristic patterns of thoughts, feelings, moods, and behaviors of the whole individual", while for a patient with DID, the switches between identities and behavior patterns is the personality. It is for this reason the DSM-IV-TR referred to "distinct identities or personality states" instead of personalities. The diagnostic criteria also changed to indicate that while the patient may name and personalize alters, they lack independent, objective existence. The changes also included the addition of amnesia as a symptom, which was not included in the DSM-III-R because despite being a core symptom of the condition, patients may experience "amnesia for the amnesia" and fail to report it. Amnesia was replaced when it became clear that the risk of false negative diagnoses was low because amnesia was central to DID.The ICD-10 places the diagnosis in the category of "dissociative disorders", within the subcategory of "other dissociative (conversion) disorders", but continues to list the condition as multiple personality disorder.The DSM-IV-TR criteria for DID have been criticized for failing to capture the clinical complexity of DID, lacking usefulness in diagnosing individuals with DID (for instance, by focusing on the two least frequent and most subtle symptoms of DID) producing a high rate of false negatives and an excessive number of DDNOS diagnoses, for excluding possession (seen as a cross-cultural form of DID), and for including only two "core" symptoms of DID (amnesia and self-alteration) while failing to discuss hallucinations, trance-like states, somatoform, depersonalization, and derealization symptoms. Arguments have been made for allowing diagnosis through the presence of some, but not all of the characteristics of DID rather than the current exclusive focus on the two least common and noticeable features. The DSM-IV-TR criteria have also been criticized for being tautological, using imprecise and undefined language and for the use of instruments that give a false sense of validity and empirical certainty to the diagnosis.
The DSM-5 updated the definition of DID in 2013, summarizing the changes as:
Several changes to the criteria for dissociative identity disorder have been made in DSM-5. First, Criterion A has been expanded to include certain possession-form phenomena and functional neurological symptoms to account for more diverse presentations of the disorder. Second, Criterion A now specifically states that transitions in identity may be observable by others or self-reported. Third, according to Criterion B, individuals with dissociative identity disorder may have recurrent gaps in recall for everyday events, not just for traumatic experiences. Other text modifications clarify the nature and course of identity disruptions.
Between 1968 and 1980, the term that was used for dissociative identity disorder was "Hysterical neurosis, dissociative type". The APA wrote in the second edition of the DSM: "In the dissociative type, alterations may occur in the patients state of consciousness or in his identity, to produce such symptoms as amnesia, somnambulism, fugue, and multiple personality." The number of cases sharply increased in the late 1970s and throughout the 80s, and the first scholarly monographs on the topic appeared in 1986.
Book and film Sybil
In 1974, the highly influential book Sybil was published, and later made into a miniseries in 1976 and again in 2007. Describing what Robert Rieber called "the third most famous of multiple personality cases," it presented a detailed discussion of the problems of treatment of "Sybil Isabel Dorsett", a pseudonym for Shirley Ardell Mason.
Though the book and subsequent films helped popularize the diagnosis and trigger an epidemic of the diagnosis, later analysis of the case suggested different interpretations, ranging from Masons problems having been caused by the therapeutic methods used by her psychiatrist, C.B. Wilbur, or an inadvertent hoax due in part to the lucrative publishing rights, though this conclusion has itself been challenged.David Spiegel, a Stanford psychiatrist whose father treated Shirley Ardell Mason on occasion, says that his father described Mason as "a brilliant hysteric. He felt that Wilbur tended to pressure her to exaggerate on the dissociation she already had." As media attention on DID increased, so too did the controversy surrounding the diagnosis.
Re-classifications
With the publication of the DSM-III, which omitted the terms "hysteria" and "neurosis" (and thus the former categories for dissociative disorders), dissociative diagnoses became "orphans" with their own categories with dissociative identity disorder appearing as "multiple personality disorder".In the opinion of McGill University psychiatrist Joel Paris, this inadvertently legitimized them by forcing textbooks, which mimicked the structure of the DSM, to include a separate chapter on them and resulted in an increase in diagnosis of dissociative conditions. Once a rarely occurring spontaneous phenomenon (research in 1944 showed only 76 cases), the diagnosis became "an artifact of bad (or naïve) psychotherapy" as patients capable of dissociating were accidentally encouraged to express their symptoms by "overly fascinated" therapists.In a 1986 book chapter (later reprinted in another volume), philosopher of science Ian Hacking focused on multiple personality disorder as an example of "making up people" through the untoward effects on individuals of the "dynamic nominalism" in medicine and psychiatry. With the invention of new terms entire new categories of "natural kinds" of people are assumed to be created, and those thus diagnosed respond by re-creating their identity in light of the new cultural, medical, scientific, political and moral expectations. Hacking argued that the process of "making up people" is historically contingent, hence it is not surprising to find the rise, fall, and resurrection of such categories over time. Hacking revisited his concept of "making up people" in a 2006."Interpersonality amnesia" was removed as a diagnostic feature from the DSM III in 1987, which may have contributed to the increasing frequency of the diagnosis. There were 200 reported cases of DID as of 1980, and 20,000 from 1980 to 1990. Joan Acocella reports that 40,000 cases were diagnosed from 1985 to 1995. Scientific publications regarding DID peaked in the mid-1990s then rapidly declined.There were several contributing factors to the rapid decline of reports of multiple personality disorder/dissociative identity disorder. One was the discontinuation in December 1997 of Dissociation: Progress in the Dissociative Disorders, the journal of The International Society for the Study of Multiple Personality and Dissociation. The society and its journal were perceived as uncritical sources of legitimacy for the extraordinary claims of the existence of intergenerational satanic cults responsible for a "hidden holocaust" of Satanic ritual abuse that was linked to the rise of MPD reports. In an effort to distance itself from the increasing skepticism regarding the clinical validity of MPD, the organization dropped "multiple personality" from its official name in 1993, and then in 1997 changed its name again to the International Society for the Study of Trauma and Dissociation.In 1994, the fourth edition of the DSM replaced the criteria again and changed the name of the condition from "multiple personality disorder" to the current "dissociative identity disorder" to emphasize the importance of changes to consciousness and identity rather than personality. The inclusion of interpersonality amnesia helped to distinguish DID from dissociative disorder not otherwise specified (DDNOS), but the condition retains an inherent subjectivity due to difficulty in defining terms such as personality, identity, ego-state, and even amnesia. The ICD-10 classified DID as a "Dissociative [conversion] disorder" and used the name "multiple personality disorder" with the classification number of F44.81. In the ICD-11, the World Health Organization have classified DID under the name "dissociative identity disorder" (code 6B64), and most cases formerly diagnosed as DDNOS are classified as "partial dissociative identity disorder" (code 6B65).
21st century
A 2006 study compared scholarly research and publications on DID and dissociative amnesia to other mental health conditions, such as anorexia nervosa, alcohol use disorder, and schizophrenia from 1984 to 2003. The results were found to be unusually distributed, with a very low level of publications in the 1980s followed by a significant rise that peaked in the mid-1990s and subsequently rapidly declined in the decade following. Compared to 25 other diagnosis, the mid-1990s "bubble" of publications regarding DID was unique. In the opinion of the authors of the review, the publication results suggest a period of "fashion" that waned, and that the two diagnoses "[did] not command widespread scientific acceptance."
Society and culture
General
The publics long fascination with DID has led to a number of different books and films,(p 169) with many representations described as increasing stigma by perpetuating the myth that people with mental illness are usually dangerous. Movies about DID have been also criticized for poor representation of both DID and its treatment, including "greatly overrepresenting" the role of hypnosis in therapy, showing a significantly smaller number of personalities than many people with DID have, and misrepresenting people with DID as having flamboyant and obvious personalities. Some movies are parodies and ridicule DID, for instance Me, Myself & Irene, which also incorrectly states that DID is schizophrenia. In some stories DID is used as a plot device, e.g. in Fight Club, and in whodunnit stories like Secret Window.United States of Tara was reported to be the first US television series with DID as its focus, and a professional commentary on each episode was published by the International Society for the Study of Trauma and Dissociation. More recently, the award winning Korean TV series Kill Me, Heal Me (Korean: 킬미, 힐미; RR: Kilmi, Hilmi) featured a wealthy young man with seven personalities, one of whom falls in love with the beautiful psychiatry resident who tries to help him.Most people with DID are believed to downplay or minimize their symptoms rather than seeking fame, often due to fear of the effects of stigma, or shame. Therapists may discourage them from media work due to concerns that they may feel exploited or traumatized, for example as a result of demonstrating switching between personality states to entertain others.(p 169)However, a number of people with DID have publicly spoken about their experiences, including comedian and talk show host Roseanne Barr, who interviewed Truddi Chase, author of When Rabbit Howls; Chris Costner Sizemore, the subject of The Three Faces of Eve, Cameron West, author of First Person Plural: My life as a multiple, and NFL player Herschel Walker, author of Breaking Free: My life with dissociative identity disorder.In The Three Faces of Eve (1957) hypnosis is used to identify a childhood trauma which then allows her to merge from three identities into just one. However, Sizemores own books Im Eve and A Mind of My Own revealed that this did not last; she later attempted suicide, sought further treatment, and actually had twenty-two personalities rather than three. Sizemore re-entered therapy and by 1974 had achieved a lasting recovery. Voices Within: The Lives of Truddi Chase portrays many of the 92 personalities Chase described in her book When Rabbit Howls, and is unusual in breaking away from the typical ending of integrating into one. Frankie & Alice (2010), starring Halle Berry; and the TV mini-series Sybil were also based on real people with DID. In popular culture dissociative identity disorder is often confused with schizophrenia, and some movies advertised as representing dissociative identity disorder may be more representative of psychosis or schizophrenia, for example Psycho (1960).In his book The C.I.A. Doctors: Human Rights Violations by American Psychiatrists, psychiatrist Colin A. Ross states that based on documents obtained through freedom of information legislation, a psychiatrist linked to Project MKULTRA reported being able to deliberately induce dissociative identity disorder using a variety of aversive or abusive techniques, creating a Manchurian Candidate for military purposes.A DID community exists on social media, including YouTube and TikTok. However, numerous high-profile members of this community have been criticized for faking their condition for views, or for portraying the disorder lightheartedly. Conversely, psychologist Naomi Torres-Mackie, head of research at The Mental Health Coalition, has stated "All of a sudden, all of my adolescent patients think that they have this, and they dont ... Folks start attaching clinical meaning and feeling like, I should be diagnosed with this. I need medication for this, when actually a lot of these experiences are normative and dont need to be pathologized or treated."In the USA Network television production Mr. Robot, the protagonist Elliot Alderson is shown to have signs of DID and schizophrenia.In M. Night Shyamalans Unbreakable superhero film series (specifically the second film, Split), one character is diagnosed with DID, and that some of the personalities have super-human powers. Some advocates believe that the film is a negative portrayal.In Marvel Comics, the character of Moon Knight is shown to have DID. In the TV series Moon Knight based on the comic book character, protagonist Marc Spector is depicted with DID; the website for the National Alliance on Mental Illness appears in the series end credits. Another Marvel character, Legion, has DID in the comics, although he has schizophrenia in the TV show version.
Legal issues
People with dissociative identity disorder may be involved in legal cases as a witness, defendant, or as the victim/injured party. In the United States dissociative identity disorder has previously been found to meet the Frye test as a generally accepted medical condition, and the newer Daubert standard. Within legal circles, DID has been described as one of the most disputed psychiatric diagnoses and forensic assessments are needed. For defendants whose defense states they have a diagnosis of DID, courts must distinguish between those who genuinely have DID and those who are malingering to avoid responsibility, as shown in the fictional book and film Primal Fear. Expert witnesses are typically used to assess defendants in such cases, although some of the standard assessments like the MMPI-2 were not developed for people with a trauma history and the validity scales may incorrectly suggest malingering. The Multiscale Dissociation Inventory (Briere, 2002) is well suited to assessing malingering and dissociative disorders, unlike the self-report Dissociative Experiences Scale. In DID, evidence about the altered states of consciousness, actions of alter identities and episodes of amnesia may be excluded from a court if they not considered relevant, although different countries and regions have different laws. A diagnosis of DID may be used to claim a defense of not guilty by reason of insanity, but this very rarely succeeds, or of diminished capacity, which may reduce the length of a sentence. DID may also affect competency to stand trial. A not guilty by reason of insanity plea was first used successfully in an American court in 1978, in the State of Ohio v. Milligan case. However, a DID diagnosis is not automatically considered a justification for an insanity verdict, and since Milligan the few cases claiming insanity have largely been unsuccessful.
Advocacy movement
In the context of neurodiversity, the experience of dissociative identities has been called multiplicity and has led to advocacy for the recognition of positive plurality and the use of plural pronouns such as "we" and "our". Liz Fong-Jones states those with this condition might have fear in regard to "coming out" about their DID, as it could put them in a vulnerable position.In particular, advocates have challenged the necessity of integration. Timothy Baynes argues that alters have full moral status, just as their host does. He states that as integration may entail the (involuntary) elimination of such an entity, forcing people to undergo it as a therapeutic treatment is "seriously immoral".A DID (or Dissociative Identities) Awareness Day takes place on March 5 annually, and a multicolored awareness ribbon is used, based on the idea of a "crazy quilt".
Footnotes
References
External links
"International Society for the Study of Trauma and Dissociation". |
You are an assistant in medical learning. Your role is to clarify medical terminology, ensuring the information is both accurate and accessible. | I'm trying to expand my medical knowledge. Can you elucidate the term 'Hair follicle nevus'? | Hair follicle nevus is a cutaneous condition that presents as a small papule from which fine hairs protrude evenly from the surface.
See also
Skin lesion
List of cutaneous conditions
== References == |
You are a medical educator. Your role is to provide detailed and clear explanations for medical terms, suitable for both professionals and laypersons. | I need a basic explanation for the medical term 'Obiltoxaximab.' | Obiltoxaximab, sold under the brand name Anthim, is a monoclonal antibody medication designed for the treatment of exposure to Bacillus anthracis spores (etiologic agent of anthrax).The medication was developed by Elusys Therapeutics, Inc.
Medical uses
Obiltoxaximab is indicated in combination with appropriate antibacterial drugs in all age groups for treatment of inhalational anthrax due to Bacillus anthracis. It is also indicated in all age groups for post-exposure prophylaxis of inhalational anthrax when alternative therapies are not appropriate or are not available.
Society and culture
Legal status
In March 2016, obiltoxaximab was approved by the U.S. Food and Drug Administration (FDA) for the treatment and prophylaxis of inhalational anthrax.On 17 September 2020, the Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency (EMA) adopted a positive opinion, recommending the granting of a marketing authorization under exceptional circumstances for obiltoxaximab, intended for the treatment or post-exposure prophylaxis of inhalational anthrax. The applicant for this medicinal product is SFL Pharmaceuticals Deutschland GmbH. It was approved for medical use in the European Union in November 2020.
References
External links
"Obiltoxaximab". Drug Information Portal. U.S. National Library of Medicine. |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | Can you demystify the medical term 'Bee sting' for me? | A bee sting is the wound and pain caused by the stinger of a female bee puncturing skin. Bee stings differ from insect bites, with the venom of stinging insects having considerable chemical variation. The reaction of a person to a bee sting may vary according to the bee species. While bee stinger venom is slightly acidic and causes only mild pain in most people, allergic reactions may occur in people with allergies to venom components.
Honey bee stings
A honey bee that is away from the hive foraging for nectar or pollen will rarely sting, except when stepped on or roughly handled. Honey bees will actively seek out and sting when they perceive the hive to be threatened, often being alerted to this by the release of attack pheromones (below).
Although it is widely believed that a worker honey bee can sting only once, this is a partial misconception: although the stinger is in fact barbed so that it lodges in the victims skin, tearing loose from the bees abdomen and leading to its death in minutes, this only happens if the skin of the victim is sufficiently thick, such as a mammals. Honey bees are the only hymenoptera with a strongly barbed sting, though yellow jackets and some other wasps have small barbs.
The venom of the honeybee contains histamine, mast cell degranulating peptide, melittin, phospholipase A2, hyaluronidase and acid phosphatase. The three proteins in honeybee venom which are important allergens are phospholipase A2, hyaluronidase and acid phosphatase. In addition, the polypeptide melittin is also antigenic. Bumblebee venom appears to be chemically and antigenically related to honeybee venom.Bees with barbed stingers can often sting other insects without harming themselves. Queen honeybees and bees of many other species, including bumblebees and many solitary bees, have smoother stingers with smaller barbs, and can sting mammals repeatedly.The stings injection of apitoxin into the victim is accompanied by the release of alarm pheromones, a process which is accelerated if the bee is fatally injured. The release of alarm pheromones near a hive may attract other bees to the location, where they will likewise exhibit defensive behaviors until there is no longer a threat, typically because the victim has either fled or been killed. (Note: A bee swarm, seen as a mass of bees flying or clumped together, is generally not hostile; it has deserted its hive and has no comb or young to defend.) These pheromones do not dissipate or wash off quickly, and if their target enters water, bees will resume their attack as soon as it leaves the water. The alarm pheromone emitted when a bee stings another animal smells like a banana.Drone bees, the males, are larger and do not have stingers. The female bees (worker bees and queens) are the only ones that can sting, and their stinger is a modified ovipositor. The queen bee has a barbed but smoother stinger and can, if need be, sting skin-bearing creatures multiple times, but the queen does not leave the hive under normal conditions. Her sting is not for defense of the hive; she only uses it for dispatching rival queens, ideally before they can emerge from their cells. Queen breeders who handle multiple queens and have the queen odor on their hands are sometimes stung by a queen.
The stinger consists of three parts: a stylus and two barbed slides (or lancets), one on either side of the stylus. The bee does not push the stinger in but it is drawn in by the barbed slides. The slides move alternately up and down the stylus so when the barb of one slide has caught and retracts, it pulls the stylus and the other barbed slide into the wound. When the other barb has caught, it also retracts up the stylus pulling the sting further in. This process is repeated until the sting is fully in and even continues after the sting and its mechanism is detached from the bees abdomen. When a female honey bee stings a person, it cannot pull the barbed stinger back out, but rather leaves behind not only the stinger, but also part of its abdomen and digestive tract, plus muscles and nerves. This massive abdominal rupture kills the honey bee. Honey bees are the only bees to die after stinging.
Venom and apitherapy
The main component of bee venom responsible for pain in vertebrates is the toxin melittin; histamine and other biogenic amines may also contribute to pain and itching. In one of the alternative medical uses of honey bee products, apitherapy, bee venom has been used to treat arthritis and other painful conditions. All currently available evidence supporting this practice is either anecdotal, animal studies, or preliminary evidence, most of which has poor methodology. Apitherapy is not currently accepted as a viable medical treatment for any condition or disease; the risk of allergic reaction and anaphylaxis outweighs any benefits. According to the American Cancer Society, there is no scientific evidence that apitherapy or bee venom therapy can treat or change the course of cancer or any other disease. Clinical trials have shown that apitherapy is ineffective in treating multiple sclerosis or any other disease, and can exacerbate multiple sclerosis symptoms.
Treatment
The first step in treatment following a honey bee sting is removal of the stinger itself. The stinger should be removed as quickly as possible without regard to method: a study has shown the amount of venom delivered does not differ whether the sting is pinched or scraped off and even a delay of a few seconds leads to more venom being injected. Once the stinger is removed, pain and swelling should be reduced with a cold compress. A topical anesthetic containing benzocaine will relieve pain quickly and menthol is an effective anti-itch treatment. Itching can also be relieved by antihistamine or by a topical steroid cream.Many traditional remedies have been suggested for bee stings. No interventions have been proven to be effective in scientific studies and a randomized trial of aspirin paste and topical ice packs showed that aspirin was not effective in reducing the duration of swelling or pain in bee and wasp stings, and significantly increased the duration of redness. The study concluded that ice alone is a better treatment for bee and wasp stings than aspirin.For about 2 percent of people, a hypersensitivity can develop after being stung, creating a more severe reaction. This sensitisation may happen after a single sting, or after a series of stings. An allergic person may suffer anaphylactic shock from certain proteins in the venom, which can be life-threatening and requires emergency treatment. People known to be highly allergic may carry around epinephrine (adrenaline) in the form of a self-injectable EpiPen for the treatment of an anaphylactic shock. For people who experience severe or life-threatening reactions to insect stings, allergy injections composed of increasing concentrations of naturally occurring venom may provide protection against future insect stings.
See also
Apitoxin
Bee venom therapy
Characteristics of common wasps and bees
Hornet stings
Schmidt sting pain index
Topical tobacco paste
References
== External links == |
You are a guide to medical language. Please provide in-depth and understandable explanations of medical terms, highlighting their significance in healthcare. | Can you demystify the medical term 'Bleeding' for me? | Bleeding, hemorrhage, haemorrhage or blood loss, is blood escaping from the circulatory system from damaged blood vessels. Bleeding can occur internally, or externally either through a natural opening such as the mouth, nose, ear, urethra, vagina or anus, or through a puncture in the skin.
Hypovolemia is a massive decrease in blood volume, and death by excessive loss of blood is referred to as exsanguination. Typically, a healthy person can endure a loss of 10–15% of the total blood volume without serious medical difficulties (by comparison, blood donation typically takes 8–10% of the donors blood volume). The stopping or controlling of bleeding is called hemostasis and is an important part of both first aid and surgery.
Types
Upper head
Intracranial hemorrhage – bleeding in the skull.
Cerebral hemorrhage – a type of intracranial hemorrhage, bleeding within the brain tissue itself.
Intracerebral hemorrhage – bleeding in the brain caused by the rupture of a blood vessel within the head. See also hemorrhagic stroke.
Subarachnoid hemorrhage (SAH) implies the presence of blood within the subarachnoid space from some pathologic process. The common medical use of the term SAH refers to the nontraumatic types of hemorrhages, usually from rupture of a berry aneurysm or arteriovenous malformation (AVM). The scope of this article is limited to these nontraumatic hemorrhages.
Eyes
Subconjunctival hemorrhage – bloody eye arising from a broken blood vessel in the sclera (whites of the eyes). Often the result of strain, including sneezing, coughing, vomiting or other kind of strain
Nose
Epistaxis – nosebleed
Mouth
Tooth eruption – losing a tooth
Hematemesis – vomiting fresh blood
Hemoptysis – coughing up blood from the lungs
Lungs
Pulmonary hemorrhage
Gastrointestinal
Upper gastrointestinal bleed
Lower gastrointestinal bleed
Occult gastrointestinal bleed
Urinary tract
Hematuria – blood in the urine from urinary bleeding
Gynecologic
Vaginal bleeding
Postpartum hemorrhage
Breakthrough bleeding
Ovarian bleeding – This is a potentially catastrophic and not so rare complication among lean patients with polycystic ovary syndrome undergoing transvaginal oocyte retrieval.
Anus
Melena – upper gastrointestinal bleeding
Hematochezia – lower gastrointestinal bleeding, or brisk upper gastrointestinal bleeding
Vascular
Ruptured aneurysm
Aortic transection
Iatrogenic injury
Causes
Bleeding arises due to either traumatic injury, underlying medical condition, or a combination.
Traumatic injury
Traumatic bleeding is caused by some type of injury. There are different types of wounds which may cause traumatic bleeding. These include:
Abrasion – Also called a graze, this is caused by transverse action of a foreign object against the skin, and usually does not penetrate below the epidermis.
Excoriation – In common with Abrasion, this is caused by mechanical destruction of the skin, although it usually has an underlying medical cause.
Hematoma – Caused by damage to a blood vessel that in turn causes blood to collect in an enclosed area.
Laceration – Irregular wound caused by blunt impact to soft tissue overlying hard tissue or tearing such as in childbirth. In some instances, this can also be used to describe an incision.
Incision – A cut into a body tissue or organ, such as by a scalpel, made during surgery.
Puncture Wound – Caused by an object that penetrated the skin and underlying layers, such as a nail, needle or knife.
Contusion – Also known as a bruise, this is a blunt trauma damaging tissue under the surface of the skin.
Crushing Injuries – Caused by a great or extreme amount of force applied over a period of time. The extent of a crushing injury may not immediately present itself.
Ballistic Trauma – Caused by a projectile weapon such as a firearm. This may include two external wounds (entry and exit) and a contiguous wound between the two.The pattern of injury, evaluation and treatment will vary with the mechanism of the injury. Blunt trauma causes injury via a shock effect; delivering energy over an area. Wounds are often not straight and unbroken skin may hide significant injury. Penetrating trauma follows the course of the injurious device. As the energy is applied in a more focused fashion, it requires less energy to cause significant injury. Any body organ, including bone and brain, can be injured and bleed. Bleeding may not be readily apparent; internal organs such as the liver, kidney and spleen may bleed into the abdominal cavity. The only apparent signs may come with blood loss. Bleeding from a bodily orifice, such as the rectum, nose, or ears may signal internal bleeding, but cannot be relied upon. Bleeding from a medical procedure also falls into this category.
Medical condition
"Medical bleeding" denotes hemorrhage as a result of an underlying medical condition (i.e. causes of bleeding that are not directly due to trauma). Blood can escape from blood vessels as a result of 3 basic patterns of injury:
Intravascular changes – changes of the blood within vessels (e.g. ↑ blood pressure, ↓ clotting factors)
Intramural changes – changes arising within the walls of blood vessels (e.g. aneurysms, dissections, AVMs, vasculitides)
Extravascular changes – changes arising outside blood vessels (e.g. H pylori infection, brain abscess, brain tumor)The underlying scientific basis for blood clotting and hemostasis is discussed in detail in the articles, coagulation, hemostasis and related articles. The discussion here is limited to the common practical aspects of blood clot formation which manifest as bleeding.
Some medical conditions can also make patients susceptible to bleeding. These are conditions that affect the normal hemostatic (bleeding-control) functions of the body. Such conditions either are, or cause, bleeding diatheses. Hemostasis involves several components. The main components of the hemostatic system include platelets and the coagulation system.
Platelets are small blood components that form a plug in the blood vessel wall that stops bleeding. Platelets also produce a variety of substances that stimulate the production of a blood clot. One of the most common causes of increased bleeding risk is exposure to nonsteroidal anti-inflammatory drugs (NSAIDs). The prototype for these drugs is aspirin, which inhibits the production of thromboxane. NSAIDs inhibit the activation of platelets, and thereby increase the risk of bleeding. The effect of aspirin is irreversible; therefore, the inhibitory effect of aspirin is present until the platelets have been replaced (about ten days). Other NSAIDs, such as "ibuprofen" (Motrin) and related drugs, are reversible and therefore, the effect on platelets is not as long-lived.There are several named coagulation factors that interact in a complex way to form blood clots, as discussed in the article on coagulation. Deficiencies of coagulation factors are associated with clinical bleeding. For instance, deficiency of Factor VIII causes classic hemophilia A while deficiencies of Factor IX cause "Christmas disease"(hemophilia B). Antibodies to Factor VIII can also inactivate the Factor VII and precipitate bleeding that is very difficult to control. This is a rare condition that is most likely to occur in older patients and in those with autoimmune diseases. Another common bleeding disorder is Von Willebrand disease. It is caused by a deficiency or abnormal function of the "Von Willebrand" factor, which is involved in platelet activation. Deficiencies in other factors, such as factor XIII or factor VII are occasionally seen, but may not be associated with severe bleeding and are not as commonly diagnosed.
In addition to NSAID-related bleeding, another common cause of bleeding is that related to the medication, warfarin ("Coumadin" and others). This medication needs to be closely monitored as the bleeding risk can be markedly increased by interactions with other medications. Warfarin acts by inhibiting the production of Vitamin K in the gut. Vitamin K is required for the production of the clotting factors, II, VII, IX, and X in the liver. One of the most common causes of warfarin-related bleeding is taking antibiotics. The gut bacteria make vitamin K and are killed by antibiotics. This decreases vitamin K levels and therefore the production of these clotting factors.
Deficiencies of platelet function may require platelet transfusion while deficiencies of clotting factors may require transfusion of either fresh frozen plasma or specific clotting factors, such as Factor VIII for patients with hemophilia.
Infection
Infectious diseases such as Ebola, Marburg virus disease and yellow fever can cause bleeding.
Diagnosis/Imaging
Dioxaborolane chemistry enables radioactive fluoride (18F) labeling of red blood cells, which allows for positron emission tomography (PET) imaging of intracerebral hemorrhages.
Classification
Blood loss
Hemorrhaging is broken down into four classes by the American College of Surgeons advanced trauma life support (ATLS).
Class I Hemorrhage involves up to 15% of blood volume. There is typically no change in vital signs and fluid resuscitation is not usually necessary.
Class II Hemorrhage involves 15-30% of total blood volume. A patient is often tachycardic (rapid heart beat) with a reduction in the difference between the systolic and diastolic blood pressures. The body attempts to compensate with peripheral vasoconstriction. Skin may start to look pale and be cool to the touch. The patient may exhibit slight changes in behavior. Volume resuscitation with crystalloids (Saline solution or Lactated Ringers solution) is all that is typically required. Blood transfusion is not usually required.
Class III Hemorrhage involves loss of 30-40% of circulating blood volume. The patients blood pressure drops, the heart rate increases, peripheral hypoperfusion (shock) with diminished capillary refill occurs, and the mental status worsens. Fluid resuscitation with crystalloid and blood transfusion are usually necessary.
Class IV Hemorrhage involves loss of >40% of circulating blood volume. The limit of the bodys compensation is reached and aggressive resuscitation is required to prevent death.This system is basically the same as used in the staging of hypovolemic shock.
Individuals in excellent physical and cardiovascular shape may have more effective compensatory mechanisms before experiencing cardiovascular collapse. These patients may look deceptively stable, with minimal derangements in vital signs, while having poor peripheral perfusion. Elderly patients or those with chronic medical conditions may have less tolerance to blood loss, less ability to compensate, and may take medications such as betablockers that can potentially blunt the cardiovascular response. Care must be taken in the assessment.
Massive hemorrhage
Although there is no universally accepted definition of massive hemorrhage, the following can be used to identify the condition: "(i) blood loss exceeding circulating blood volume within a 24-hour period, (ii) blood loss of 50% of circulating blood volume within a 3-hour period, (iii) blood loss exceeding 150 ml/min, or (iv) blood loss that necessitates plasma and platelet transfusion."
World Health Organization
The World Health Organization made a standardized grading scale to measure the severity of bleeding.
Management
Acute bleeding from an injury to the skin is often treated by the application of direct pressure. For severely injured patients, tourniquets are helpful in preventing complications of shock. Anticoagulant medications may need to be discontinued and possibly reversed in patients with clinically significant bleeding. Patients that have lost excessive amounts of blood may require a blood transfusion.The use of cyanoacrylate glue to prevent bleeding and seal battle wounds was designed and first used in the Vietnam War. Skin glue, a medical version of "super glue", is sometimes used instead of using traditional stitches used for small wounds that need to be closed at the skin level.
Etymology
The word "Haemorrhage" (or hæmorrhage; using the æ ligature) comes from Latin haemorrhagia, from Ancient Greek αἱμορραγία (haimorrhagía, "a violent bleeding"), from αἱμορραγής (haimorrhagḗs, "bleeding violently"), from αἷμα (haîma, "blood") + -ραγία (-ragía), from ῥηγνύναι (rhēgnúnai, "to break, burst").
See also
Anaesthesia Trauma and Critical Care
Aneurysm
Autohemorrhaging
Anemia
Coagulation
Contusion
Exsanguination
Hemophage
Hemophilia
Hematoma
Istihadha
References
== External links == |
You are an expert in medical terminology. Explain medical terms in a way that is both precise and easy to understand for non-medical audiences. | I'm seeking clarification on the medical term 'Pyaemia.' Could you explain it? | Pyaemia (or pyemia) is a type of sepsis that leads to widespread abscesses of a metastatic nature. It is usually caused by the staphylococcus bacteria by pus-forming organisms in the blood. Apart from the distinctive abscesses, pyaemia exhibits the same symptoms as other forms of septicaemia. It was almost universally fatal before the introduction of antibiotics.
Sir William Osler included a three-page discussion of pyaemia in his textbook The Principles and Practice of Medicine, published in 1892. He defined pyaemia as follows:
A general disease, characterized by recurring chills and intermittent fever and the formation of abscesses in various parts, all of which result from the contamination of the blood by products arising from a focus contaminated by the bacteria of suppuration.
Earlier still, Ignaz Semmelweis – who later died of the disease – included a section titled "Childbed fever is a variety of pyaemia" in his treatise, The Etiology of Childbed Fever (1861). Jane Grey Swisshelm, in her autobiography titled Half a Century, describes the treatment of pyaemia in 1862 during the American Civil War.
Types
arterial p. Pyaemia resulting from dissemination of emboli from a thrombus in cardiac vessels.
cryptogenic p. Pyaemia of an origin that is hidden in the deeper tissues.
metastatic p. Multiple abscesses resulting from infected pyaemic thrombi.
portal p. Suppurative inflammation of the portal vein.
Symptoms
The disease is characterized by intermittent high temperature with recurrent chills; metastatic processes in various parts of the body, especially in the lungs; septic pneumonia; empyema. It may be fatal.
Clinical sign and symptoms can be differ according to system it involves.
Diagnosis
features of systemic inflammatory response syndrome tachycardia >90beats/min
tachypnea >24/min
temperature >38 or <36
Treatment
Antibiotics are effective. Prophylactic treatment consists in prevention of suppuration.
Cultural references
Ignaz Semmelweis, the original proponent of hand-washing in the practice of medicine, was widely scorned for his belief and was committed to an insane asylum where he died at age 47 of pyaemia, after being beaten by the guards, only 14 days after he was committed.
The nihilistic character Bazarov in Ivan Turgenevs Fathers and Sons dies of pyaemia.
Miller Huggins, manager of the New York Yankees, died of pyaemia while managing the team during the 1929 season.
Blind Boy Fuller died at his home in Durham, North Carolina on February 13, 1941, at 5 p.m. of pyemia due to an infected bladder, gastrointestinal tract and perineum, plus kidney failure.
Casper, a wounded soldier in "Nostalgia," by Dennis McFarland, is dying of pyemia after his lower arm is amputated.
References
== External links == |
You are a conduit for medical education. Your task is to offer detailed explanations of medical terms, ensuring they are understandable and precise. | The term 'Chromhidrosis' keeps coming up in medical discussions. What does it stand for? | Chromhidrosis is a rare condition characterized by the secretion of colored sweat. It is caused by the deposition of lipofuscin in the sweat glands. Cases of red, blue, green, yellow, pink, and black sweat have been reported.
Usually, chromhidrosis affects the apocrine glands, mainly on the face and underarms. A limited number of treatment options exist, including regular application of capsaicin cream, and prolonged relief may be provided by botulinum toxin treatment. Chromogenic pigments produced by bacteria (Corynebacterium in particular) are implicated in this condition, but their exact role still requires careful microbiological elucidation.
Chromhidrosis of the eccrine glands is rare; it occurs mainly after the ingestion of certain dyes or drugs.
See also
List of cutaneous conditions
References
Further reading
Schwarz, T; Neumann, R; Duschet, P; Brückler, B; Klein, W; Oppolzer, G; Bardach, H; Gschnait, F (1989). "Apokrine Chromhidrose" [Apocrine chromhidrosis]. Der Hautarzt (in German). 40 (2): 106–9. PMID 2714985.
Marksjr, J (1989). "Treatment of apocrine chromhidrosis with topical capsaicin". Journal of the American Academy of Dermatology. 21 (2 Pt 2): 418–20. doi:10.1016/S0190-9622(89)80050-7. PMID 2474015.
Bartels, Eva (2008). "Farbkodierte Dopplersonographie der Vertebralarterien. Vergleich mit der konventionellen Duplexsonographie" [Color coded Doppler sonography of the vertebral arteries. Comparison with conventional duplex sonography]. Ultraschall in der Medizin. 13 (2): 59–66. doi:10.1055/s-2007-1005277. PMID 1604294.
== External links == |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | I've encountered the term 'Medical procedure' while reading about medical topics. What does it refer to exactly? | A medical procedure is a course of action intended to achieve a result in the delivery of healthcare.
A medical procedure with the intention of determining, measuring, or diagnosing a patient condition or parameter is also called a medical test. Other common kinds of procedures are therapeutic (i.e., intended to treat, cure, or restore function or structure), such as surgical and physical rehabilitation procedures.
Definition
"An activity directed at or performed on an individual with the object of improving health, treating disease or injury, or making a diagnosis."
"The act or conduct of diagnosis, treatment, or operation."
"A series of steps by which a desired result is accomplished."
"The sequence of steps to be followed in establishing some course of action."
List of medical procedures
Propaedeutic
Auscultation
Medical inspection (body features)
Palpation
Percussion (medicine)
Vital signs measurement, such as blood pressure, body temperature, or pulse (or heart rate)
Diagnostic
Lab tests
Biopsy test
Blood test
Stool test
Urinalysis
Cardiac stress test
Electrocardiography
Electrocorticography
Electroencephalography
Electromyography
Electroneuronography
Electronystagmography
Electrooculography
Electroretinography
Endoluminal capsule monitoring
Endoscopy
Colonoscopy
Colposcopy
Cystoscopy
Gastroscopy
Laparoscopy
Laryngoscopy
Ophthalmoscopy
Otoscopy
Sigmoidoscopy
Esophageal motility study
Evoked potential
Magnetoencephalography
Medical imaging
Angiography
Aortography
Cerebral angiography
Coronary angiography
Lymphangiography
Pulmonary angiography
Ventriculography
Chest photofluorography
Computed tomography
Echocardiography
Electrical impedance tomography
Fluoroscopy
Magnetic resonance imaging
Diffuse optical imaging
Diffusion tensor imaging
Diffusion-weighted imaging
Functional magnetic resonance imaging
Positron emission tomography
Radiography
Scintillography
SPECT
Ultrasonography
Contrast-enhanced ultrasound
Gynecologic ultrasonography
Intravascular ultrasound
Obstetric ultrasonography
Thermography
Virtual colonoscopy
Neuroimaging
Posturography
Therapeutic
Thrombosis prophylaxis
Precordial thump
Politzerization
Hemodialysis
Hemofiltration
Plasmapheresis
Apheresis
Extracorporeal membrane oxygenation (ECMO)
Cancer immunotherapy
Cancer vaccine
Cervical conization
Chemotherapy
Cytoluminescent therapy
Insulin potentiation therapy
Low-dose chemotherapy
Monoclonal antibody therapy
Photodynamic therapy
Radiation therapy
Targeted therapy
Tracheal intubation
Unsealed source radiotherapy
Virtual reality therapy
Physical therapy/Physiotherapy
Speech therapy
Phototerapy
Hydrotherapy
Heat therapy
Shock therapy
Insulin shock therapy
Electroconvulsive therapy
Symptomatic treatment
Fluid replacement therapy
Palliative care
Hyperbaric oxygen therapy
Oxygen therapy
Gene therapy
Enzyme replacement therapy
Intravenous therapy
Phage therapy
Respiratory therapy
Vision therapy
Electrotherapy
Transcutaneous electrical nerve stimulation (TENS)
Laser therapy
Combination therapy
Occupational therapy
Immunization
Vaccination
Immunosuppressive therapy
Psychotherapy
Drug therapy
Acupuncture
Antivenom
Magnetic therapy
Craniosacral therapy
Chelation therapy
Hormonal therapy
Hormone replacement therapy
Opiate replacement therapy
Cell therapy
Stem cell treatments
Intubation
Nebulization
Inhalation therapy
Particle therapy
Proton therapy
Fluoride therapy
Cold compression therapy
Animal-Assisted Therapy
Negative Pressure Wound Therapy
Nicotine replacement therapy
Oral rehydration therapy
Surgical
Ablation
Amputation
Biopsy
Cardiopulmonary resuscitation (CPR)
Cryosurgery
Endoscopic surgery
Facial rejuvenation
General surgery
Hand surgery
Hemilaminectomy
Image-guided surgery
Knee cartilage replacement therapy
Laminectomy
Laparoscopic surgery
Lithotomy
Lithotriptor
Lobotomy
Neovaginoplasty
Radiosurgery
Stereotactic surgery
Radiosurgery
Vaginoplasty
Xenotransplantation
Anesthesia
Dissociative anesthesia
General anesthesia
Local anesthesia
Topical anesthesia (surface)
Epidural (extradural) block
Spinal anesthesia (subarachnoid block)
Regional anesthesia
Other
Interventional radiology
Screening (medicine)
See also
Algorithm (medical)
Autopsy
Complication (medicine)
Consensus (medical)
Contraindication
Course (medicine)
Drug interaction
Extracorporeal
Guideline (medical)
Iatrogenesis
Invasive (medical)
List of surgical instruments
Medical error
Medical prescription
Medical test
Minimally invasive
Nocebo
Non-invasive
Physical examination
Responsible drug use
Surgical instruments
Vital signs
== References == |
You are a medical knowledge base. Your task is to elucidate medical terminology, offering insights into their meanings, origins, and applications. | Can you demystify the medical term 'Ectropion' for me? | Ectropion is a medical condition in which the lower eyelid turns outwards. It is one of the notable aspects of newborns exhibiting congenital Harlequin-type ichthyosis, but ectropion can occur due to any weakening of tissue of the lower eyelid. The condition can be repaired surgically. Ectropion is also found in dogs as a genetic disorder in certain breeds.
Causes
Congenital
Aging
Scarring
Mechanical
Allergic
Facial nerve palsy
Anti-cancer treatments such as erlotinib, cetuximab, and panitumumab, which block the function of EGFR (the epidermal growth factor receptor).
Diagnosis
Ectropion can usually be diagnosed with a routine eye exam and physical. The eyelids muscle tone and tightness can be assessed by pulling gently on the eyelid.
Ectropion in dogs
Ectropion in dogs usually involves the lower eyelid. Often the condition has no symptoms, but tearing and conjunctivitis may be seen. Breeds associated with ectropion include the Cocker Spaniel, the Saint Bernard, the Bloodhound, the Clumber Spaniel, and the Basset Hound. It can also result from trauma or nerve damage. Treatment (surgery) is recommended only if there is chronic conjunctivitis or if there is corneal damage. A small part of the affected lid is removed and then the lid is sewn back together.
See also
Cervical ectropion
Entropion
References
== External links == |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | I'm looking for a concise explanation of the medical term 'Sarcosinemia.' | Sarcosinemia (SAR), also called hypersarcosinemia and SARDH deficiency, is a rare autosomal recessive metabolic disorder characterized by an increased concentration of sarcosine in blood plasma and urine ("sarcosinuria"). It can result from an inborn error of sarcosine metabolism, or from severe folate deficiency related to the folate requirement for the conversion of sarcosine to glycine. It is thought to be a relatively benign condition.
Cause
Sarcosinemia is thought to be caused by a mutation in the sarcosine dehydrogenase (SARDH) gene, which is located at human chromosome 9q34.The disease is inherited in an autosomal recessive manner, which means the defective gene responsible for the disorder is located on an autosome (chromosome 9 is an autosome), and two copies of the defective gene (one inherited from each parent) are required in order to be born with the disorder. The parents of an individual with an autosomal recessive disorder both carry one copy of the defective gene, but usually do not experience any signs or symptoms of the disorder.
Diagnosis
Treatment
See also
Inborn errors of metabolism
References
External links
Sarcosinemia at NIHs Office of Rare Diseases |
You are a medical lexicon. Explain medical terminology with depth and clarity, making sure the information is both accurate and easy to grasp. | I'm not familiar with the medical term 'Boil.' Could you provide some insights? | A boil, also called a furuncle, is a deep folliculitis, which is an infection of the hair follicle. It is most commonly caused by infection by the bacterium Staphylococcus aureus, resulting in a painful swollen area on the skin caused by an accumulation of pus and dead tissue. Boils which are expanded are basically pus-filled nodules. Individual boils clustered together are called carbuncles.
Most human infections are caused by coagulase-positive S. aureus strains, notable for the bacterias ability to produce coagulase, an enzyme that can clot blood. Almost any organ system can be infected by S. aureus.
Signs and symptoms
Boils are bumpy, red, pus-filled lumps around a hair follicle that are tender, warm, and painful. They range from pea-sized to golf ball-sized. A yellow or white point at the center of the lump can be seen when the boil is ready to drain or discharge pus. In a severe infection, an individual may experience fever, swollen lymph nodes, and fatigue. A recurring boil is called chronic furunculosis. Skin infections tend to be recurrent in many patients and often spread to other family members. Systemic factors that lower resistance commonly are detectable, including: diabetes, obesity, and hematologic disorders. Boils can be caused by other skin conditions that cause the person to scratch and damage the skin.Boils may appear on the buttocks or near the anus, the back, the neck, the stomach, the chest, the arms or legs, or even in the ear canal. Boils may also appear around the eye, where they are called styes. A boil on the gum is called intraoral dental sinus, or more commonly, a gumboil.
Complications
The most common complications of boils are scarring and infection or abscess of the skin, spinal cord, brain, kidneys, or other organs. Infections may also spread to the bloodstream (bacteremia) and become life-threatening. S. aureus strains first infect the skin and its structures (for example, sebaceous glands, hair follicles) or invade damaged skin (cuts, abrasions). Sometimes the infections are relatively limited (such as a stye, boil, furuncle, or carbuncle), but other times they may spread to other skin areas (causing cellulitis, folliculitis, or impetigo). Unfortunately, these bacteria can reach the bloodstream (bacteremia) and end up in many different body sites, causing infections (wound infections, abscesses, osteomyelitis, endocarditis, pneumonia) that may severely harm or kill the infected person. S. aureus strains also produce enzymes and exotoxins that likely cause or increase the severity of certain diseases. Such diseases include food poisoning, septic shock, toxic shock syndrome, and scalded skin syndrome. Almost any organ system can be infected by S. aureus. Squeezing or cutting boils in the danger triangle of the face can be particularly dangerous if done outside a medical setting, as blood vessels in this area drain into the brain and can carry serious infections there.When a boil bursts, a seemingly solid, whitish colored pus initially appears then the pus and some blood follows.
Causes
Bacteria
Naturally the cause is bacteria such as staphylococci that are present on the skin. Bacterial colonisation begins in the hair follicles and can cause local cellulitis and inflammation. Myiasis caused by the tumbu fly in Africa usually presents with cutaneous furuncles. Risk factors for furunculosis include bacterial carriage in the nostrils, diabetes mellitus, obesity, lymphoproliferative neoplasms, malnutrition, and use of immunosuppressive drugs.
Family history
People with recurrent boils are as well more likely to have a positive family history, take antibiotics, and to have been hospitalised, anemic, or diabetic; they are also more likely to have associated skin diseases and multiple lesions.
Other
Other causes include poor immune system function such as from HIV/AIDS, diabetes, malnutrition, or alcoholism. Poor hygiene and obesity have also been linked. It may occur following antibiotic use due to the development of resistance to the antibiotics used. An associated skin disease favors recurrence. This may be attributed to the persistent colonization of abnormal skin with S. aureus strains, such as is the case in persons with atopic dermatitis.
Boils which recur under the arm, breast or in the groin area may be associated with hidradenitis suppurativa (HS).
Diagnosis
Diagnosis is made through clinical evaluation by a physician, which may include culturing of the lesion.
Treatment
A boil may clear up on its own without bursting, but more often it will need to be opened and drained. This will usually happen spontaneously within two weeks. Regular application of a warm moist compress, both before and after a boil opens, can help speed healing. The area must be kept clean, hands washed after touching it, and any dressings disposed of carefully, in order to avoid spreading the bacteria. A doctor may cut open or "lance" a boil to allow it to drain, but squeezing or cutting should not be attempted at home, as this may further spread the infection. Antibiotic therapy may be recommended for large or recurrent boils or those that occur in sensitive areas (such as the groin, breasts, armpits, around or in the nostrils, or in the ear). Antibiotics should not be used for longer than one month, with at least two months (preferably longer) between uses, otherwise it will lose its effectiveness. If the patient has chronic (more than two years) boils, removal by plastic surgery may be indicated.Furuncles at risk of leading to serious complications should be incised and drained if antibiotics or steroid injections are not effective. These include furuncles that are unusually large, last longer than two weeks, or occur in the middle of the face or near the spine. Fever and chills are signs of sepsis and indicate immediate treatment .Staphylococcus aureus has the ability to acquire antimicrobial resistance easily, making treatment difficult. Knowledge of the antimicrobial resistance of S. aureus is important in the selection of antimicrobials for treatment.
See also
Nodule (medicine)
Cutaneous condition
References
External links
DermAtlas 1817374494 |
You are a facilitator of medical knowledge. Provide thorough and accessible explanations of medical terms, catering to both specialists and non-specialists. | The term 'Stomach' keeps coming up in medical discussions. What does it stand for? | The stomach is a muscular, hollow organ in the gastrointestinal tract of humans and many other animals, including several invertebrates. The stomach has a dilated structure and functions as a vital organ in the digestive system. The stomach is involved in the gastric phase of digestion, following chewing. It performs a chemical breakdown by means of enzymes and hydrochloric acid.
In humans and many other animals, the stomach is located between the oesophagus and the small intestine. The stomach secretes digestive enzymes and gastric acid to aid in food digestion. The pyloric sphincter controls the passage of partially digested food (chyme) from the stomach into the duodenum, where peristalsis takes over to move this through the rest of intestines.
Structure
In the human digestive system, the stomach lies between the oesophagus and the duodenum (the first part of the small intestine). It is in the left upper quadrant of the abdominal cavity. The top of the stomach lies against the diaphragm. Lying behind the stomach is the pancreas. A large double fold of visceral peritoneum called the greater omentum hangs down from the greater curvature of the stomach. Two sphincters keep the contents of the stomach contained; the lower oesophageal sphincter (found in the cardiac region), at the junction of the oesophagus and stomach, and the pyloric sphincter at the junction of the stomach with the duodenum.
The stomach is surrounded by parasympathetic (stimulant) and sympathetic (inhibitor) plexuses (networks of blood vessels and nerves in the anterior gastric, posterior, superior and inferior, celiac and myenteric), which regulate both the secretory activity of the stomach and the motor (motion) activity of its muscles.
Because it is a distensible organ, it normally expands to hold about one litre of food. The stomach of a newborn human baby will only be able to retain about 30 millilitres. The maximum stomach volume in adults is between 2 and 4 litres.
Sections
In classical anatomy the human stomach is divided into four sections, beginning at the cardia.
The cardia is where the contents of the oesophagus empty into the stomach.
The fundus (from Latin bottom) is formed in the upper curved part.
The body is the main, central region of the stomach.
The pylorus (from Greek gatekeeper) is the lower section of the stomach that empties contents into the duodenum.The cardia is defined as the region following the "z-line" of the gastroesophageal junction, the point at which the epithelium changes from stratified squamous to columnar. Near the cardia is the lower oesophageal sphincter. Research has shown that the cardia is not an anatomically distinct region of the stomach but a region of the oesophageal lining damaged by reflux.
Anatomical proximity
The stomach bed refers to the structures upon which the stomach rests in mammals. These include the tail of the pancreas, splenic artery, left kidney, left suprarenal gland, transverse colon and its mesocolon, and the left crus of diaphragm, and the left colic flexure. The term was introduced around 1896 by Philip Polson of the Catholic University School of Medicine, Dublin. However this was brought into disrepute by surgeon anatomist J Massey.
Blood supply
The lesser curvature of the human stomach is supplied by the right gastric artery inferiorly and the left gastric artery superiorly, which also supplies the cardiac region. The greater curvature is supplied by the right gastroepiploic artery inferiorly and the left gastroepiploic artery superiorly. The fundus of the stomach, and also the upper portion of the greater curvature, is supplied by the short gastric arteries, which arise from the splenic artery.
Microanatomy
Wall
Like the other parts of the gastrointestinal tract, the human stomach walls consist of a mucosa, submucosa, muscularis externa, subserosa and serosa.The inner part of the lining of the stomach, the gastric mucosa, consists of an outer layer of column-shaped cells, a lamina propria, and a thin layer of smooth muscle called the muscularis mucosa. Beneath the mucosa lies the submucosa, consisting of fibrous connective tissue. Meissners plexus is in this layer interior to the oblique muscle layer.Outside of the submucosa lies another muscular layer, the muscularis externa. It consists of three layers of muscular fibres, with fibres lying at angles to each other. These are the inner oblique, middle circular, and outer longitudinal layers. The presence of the inner oblique layer is distinct from other parts of the gastrointestinal tract, which do not possess this layer. Stomach contains the thickest muscularis layer consisting of three layers, thus maximum peristalsis occurs here.
The inner oblique layer: This layer is responsible for creating the motion that churns and physically breaks down the food. It is the only layer of the three which is not seen in other parts of the digestive system. The antrum has thicker skin cells in its walls and performs more forceful contractions than the fundus.
The middle circular layer: At this layer, the pylorus is surrounded by a thick circular muscular wall, which is normally tonically constricted, forming a functional (if not anatomically discrete) pyloric sphincter, which controls the movement of chyme into the duodenum. This layer is concentric to the longitudinal axis of the stomach.
Auerbachs plexus (myenteric plexus) is found between the outer longitudinal and the middle circular layer and is responsible for the innervation of both (causing peristalsis and mixing).The outer longitudinal layer is responsible for moving the bolus towards the pylorus of the stomach through muscular shortening.
To the outside of the muscularis externa lies a serosa, consisting of layers of connective tissue continuous with the peritoneum.
Glands
The mucosa lining the stomach is lined with a number of these pits, which receive gastric juice, secreted by between 2 and 7 gastric glands. Gastric juice is an acidic fluid containing hydrochloric acid and the digestive enzyme pepsin. The glands contains a number of cells, with the function of the glands changing depending on their position within the stomach.Within the body and fundus of the stomach lie the fundic glands. In general, these glands are lined by column-shaped cells that secrete a protective layer of mucus and bicarbonate. Additional cells present include parietal cells that secrete hydrochloric acid and intrinsic factor, chief cells that secrete pepsinogen (this is a precursor to pepsin- the highly acidic environment converts the pepsinogen to pepsin), and neuroendocrine cells that secrete serotonin.Glands differ where the stomach meets the esophagus and near the pylorus. Near the junction between the stomach and the oesophagus lie cardiac glands, which primarily secrete mucus. They are fewer in number than the other gastric glands and are more shallowly positioned in the mucosa. There are two kinds - either simple tubular with short ducts or compound racemose resembling the duodenal Brunners glands. Near the pylorus lie pyloric glands located in the antrum of the pylorus. They secrete mucus, as well as gastrin produced by their G cells.
Gene and protein expression
About 20,000 protein coding genes are expressed in human cells and nearly 70% of these genes are expressed in the normal stomach. Just over 150 of these genes are more specifically expressed in the stomach compared to other organs, with only some 20 genes being highly specific. The corresponding specific proteins expressed in stomach are mainly involved in creating a suitable environment for handling the digestion of food for uptake of nutrients. Highly stomach-specific proteins include GKN1, expressed in the mucosa; pepsinogen PGC and the lipase LIPF, expressed in chief cells; and gastric ATPase ATP4A and gastric intrinsic factor GIF, expressed in parietal cells.
Development
In early human embryogenesis, the ventral part of the embryo abuts the yolk sac. During the third week of development, as the embryo grows, it begins to surround parts of the sac. The enveloped portions form the basis for the adult gastrointestinal tract. The sac is surrounded by a network of vitelline arteries and veins. Over time, these arteries consolidate into the three main arteries that supply the developing gastrointestinal tract: the celiac artery, superior mesenteric artery, and inferior mesenteric artery. The areas supplied by these arteries are used to define the foregut, midgut, and hindgut. The surrounded sac becomes the primitive gut. Sections of this gut begin to differentiate into the organs of the gastrointestinal tract, and the esophagus, and stomach form from the foregut.
Function
Digestion
In the human digestive system, a bolus (a small rounded mass of chewed up food) enters the stomach through the esophagus via the lower esophageal sphincter. The stomach releases proteases (protein-digesting enzymes such as pepsin) and hydrochloric acid, which kills or inhibits bacteria and provides the acidic pH of 2 for the proteases to work. Food is churned by the stomach through muscular contractions of the wall called peristalsis – reducing the volume of the bolus, before looping around the fundus and the body of stomach as the boluses are converted into chyme (partially digested food). Chyme slowly passes through the pyloric sphincter and into the duodenum of the small intestine, where the extraction of nutrients begins.
Gastric juice in the stomach also contains pepsinogen. Hydrochloric acid activates this inactive form of enzyme into the active form, pepsin. Pepsin breaks down proteins into polypeptides.
Absorption
Although the absorption in the human digestive system is mainly a function of the small intestine, some absorption of certain small molecules nevertheless does occur in the stomach through its lining. This includes:
Water, if the body is dehydrated
Medication, such as aspirin
Amino acids
10–20% of ingested ethanol (e.g. from alcoholic beverages)
Caffeine
To a small extent water-soluble vitamins (most are absorbed in the small intestine)The parietal cells of the human stomach are responsible for producing intrinsic factor, which is necessary for the absorption of vitamin B12. B12 is used in cellular metabolism and is necessary for the production of red blood cells, and the functioning of the nervous system.
Control of secretion and motility
The movement and the flow of chemicals into the stomach are controlled by both the autonomic nervous system and by the various digestive hormones of the digestive system:
Other than gastrin, these hormones all act to turn off the stomach action. This is in response to food products in the liver and gall bladder, which have not yet been absorbed. The stomach needs to push food into the small intestine only when the intestine is not busy. While the intestine is full and still digesting food, the stomach acts as storage for food.
Other
Effects of EGFEpidermal growth factor (EGF) results in cellular proliferation, differentiation, and survival. EGF is a low-molecular-weight polypeptide first purified from the mouse submandibular gland, but since then found in many human tissues including the submandibular gland, and the parotid gland. Salivary EGF, which also seems to be regulated by dietary inorganic iodine, also plays an important physiological role in the maintenance of oro-oesophageal and gastric tissue integrity. The biological effects of salivary EGF include healing of oral and gastroesophageal ulcers, inhibition of gastric acid secretion, stimulation of DNA synthesis, and mucosal protection from intraluminal injurious factors such as gastric acid, bile acids, pepsin, and trypsin and from physical, chemical, and bacterial agents.
Stomach as nutrition sensorThe human stomach can "taste" sodium glutamate using glutamate receptors and this information is passed to the lateral hypothalamus and limbic system in the brain as a palatability signal through the vagus nerve. The stomach can also sense, independently of tongue and oral taste receptors, glucose, carbohydrates, proteins, and fats. This allows the brain to link nutritional value of foods to their tastes.
Thyrogastric syndromeThis syndrome defines the association between thyroid disease and chronic gastritis, which was first described in the 1960s. This term was coined also to indicate the presence of thyroid autoantibodies or autoimmune thyroid disease in patients with pernicious anemia, a late clinical stage of atrophic gastritis. In 1993, a more complete investigation on the stomach and thyroid was published, reporting that the thyroid is, embryogenetically and phylogenetically, derived from a primitive stomach, and that the thyroid cells, such as primitive gastroenteric cells, migrated and specialized in uptake of iodide and in storage and elaboration of iodine compounds during vertebrate evolution. In fact, the stomach and thyroid share iodine-concentrating ability and many morphological and functional similarities, such as cell polarity and apical microvilli, similar organ-specific antigens and associated autoimmune diseases, secretion of glycoproteins (thyroglobulin and mucin) and peptide hormones, the digesting and readsorbing ability, and lastly, similar ability to form iodotyrosines by peroxidase activity, where iodide acts as an electron donor in the presence of H2O2. In the following years, many researchers published reviews about this syndrome.
Clinical significance
Diseases
A series of radiographs can be used to examine the stomach for various disorders. This will often include the use of a barium swallow. Another method of examination of the stomach, is the use of an endoscope. A gastric emptying scan is considered the gold standard to assess gastric emptying rate.A large number of studies have indicated that most cases of peptic ulcers, and gastritis, in humans are caused by Helicobacter pylori infection, and an association has been seen with the development of stomach cancer.A stomach rumble is actually noise from the intestines.
Surgery
In humans, many bariatric surgery procedures involve the stomach, in order to lose weight. A gastric band may be placed around the cardia area, which can adjust to limit intake. The anatomy of the stomach may be modified, or the stomach may be bypassed entirely.
Surgical removal of the stomach is called a gastrectomy, and removal of the cardia area is a called a cardiectomy. "Cardiectomy" is a term that is also used to describe the removal of the heart. A gastrectomy may be carried out because of gastric cancer or severe perforation of the stomach wall.
Fundoplication is stomach surgery in which the fundus is wrapped around the lower esophagus and stitched into place. It is used to treat gastroesophageal reflux disease (GERD).
History
There were previously conflicting statements in the academic anatomy community over whether the cardia is part of the stomach, part of the oesophagus or a distinct entity. Modern surgical and medical textbooks have agreed that "the gastric cardia is now clearly considered to be part of the stomach."
Etymology
The word stomach is derived from the Latin stomachus which has roots from the Greek word stomachos (στόμαχος), ultimately from stoma (στόμα), "mouth". Gastro- and gastric (meaning "related to the stomach") are both derived from the Greek word gaster (γαστήρ, meaning "belly").
Other animals
Although the precise shape and size of the stomach varies widely among different vertebrates, the relative positions of the oesophageal and duodenal openings remain relatively constant. As a result, the organ always curves somewhat to the left before curving back to meet the pyloric sphincter. However, lampreys, hagfishes, chimaeras, lungfishes, and some teleost fish have no stomach at all, with the oesophagus opening directly into the intestine. These animals all consume diets that require little storage of food, no predigestion with gastric juices, or both.The gastric lining is usually divided into two regions, an anterior portion lined by fundic glands and a posterior portion lined with pyloric glands. Cardiac glands are unique to mammals, and even then are absent in a number of species. The distributions of these glands vary between species, and do not always correspond with the same regions as in humans. Furthermore, in many non-human mammals, a portion of the stomach anterior to the cardiac glands is lined with epithelium essentially identical to that of the oesophagus. Ruminants, in particular, have a complex stomach, the first three chambers of which are all lined with oesophageal mucosa.In birds and crocodilians, the stomach is divided into two regions. Anteriorly is a narrow tubular region, the proventriculus, lined by fundic glands, and connecting the true stomach to the crop. Beyond lies the powerful muscular gizzard, lined by pyloric glands, and, in some species, containing stones that the animal swallows to help grind up food.In insects there is also a crop. The insect stomach is called the midgut.
Information about the stomach in echinoderms or molluscs can be found under the respective articles.
Additional images
See also
Gastroesophageal reflux disease
Human gastrointestinal microbiota
Proton-pump inhibitor
References
External links
Stomach at the Human Protein Atlas
"Stomach" article from the Encyclopedia of Nursing & Allied Health, from enotes.com
Digestion of proteins in the stomach or tiyan
Site with details of how ruminants process food
Control of Gastric Emptying Archived 2019-11-12 at the Wayback Machine |
You are a medical advisor. Your role is to break down medical terminology into clear, detailed explanations for a general audience. | Can you break down the meaning of the medical term 'Budd–Chiari syndrome' for me? | Budd–Chiari syndrome is a very rare condition, affecting one in a million adults. The condition is caused by occlusion of the hepatic veins that drain the liver. It presents with the classical triad of abdominal pain, ascites, and liver enlargement. The formation of a blood clot within the hepatic veins can lead to Budd–Chiari syndrome. The syndrome can be fulminant, acute, chronic, or asymptomatic. Subacute presentation is the most common form.
Signs and symptoms
The acute syndrome presents with rapidly progressive severe upper abdominal pain, yellow discoloration of the skin and whites of the eyes, liver enlargement, enlargement of the spleen, fluid accumulation within the peritoneal cavity, elevated liver enzymes, and eventually encephalopathy. The fulminant syndrome presents early with encephalopathy and ascites. Liver cell death and severe lactic acidosis may be present as well. Caudate lobe enlargement is often present. The majority of patients have a slower-onset form of Budd–Chiari syndrome. This can be painless. A system of venous collaterals may form around the occlusion which may be seen on imaging as a "spiders web". Patients may progress to cirrhosis and show the signs of liver failure.On the other hand, incidental finding of a silent, asymptomatic form may not be a cause for concern.
Causes
The cause can be found in more than 80% of patients.
Primary Budd–Chiari syndrome (75%): thrombosis of the hepatic vein
Hepatic vein thrombosis is associated with the following in decreasing order of frequency:Polycythemia vera
Pregnancy
Postpartum state
Use of oral contraceptives
Paroxysmal nocturnal hemoglobinuria
Hepatocellular carcinoma
Lupus anticoagulantsSecondary Budd–Chiari syndrome (25%): compression of the hepatic vein by an outside structure (e.g. a tumor)Budd–Chiari syndrome is also seen in tuberculosis, congenital venous webs and occasionally in inferior vena caval stenosis.
Often, the patient is known to have a tendency towards thrombosis, although Budd–Chiari syndrome can also be the first symptom of such a tendency. Examples of genetic tendencies include protein C deficiency, protein S deficiency, the Factor V Leiden mutation, hereditary anti-thrombin deficiency and prothrombin mutation G20210A. An important non-genetic risk factor is the use of estrogen-containing (combined) forms of hormonal contraception. Other risk factors include the antiphospholipid syndrome, aspergillosis, Behçets disease, dacarbazine, pregnancy, and trauma.Many patients have Budd–Chiari syndrome as a complication of polycythemia vera (myeloproliferative disease of red blood cells). People who have paroxysmal nocturnal hemoglobinuria (PNH) appear to be especially at risk for Budd–Chiari syndrome, more than other forms of thrombophilia: up to 39% develop venous thromboses, and 12% may acquire Budd-Chiari.A related condition is veno-occlusive disease, which occurs in recipients of bone marrow transplants as a complication of their medication. Although its mechanism is similar, it is not considered a form of Budd–Chiari syndrome.Other toxicologic causes of veno-occlusive disease include plant & herbal sources of pyrrolizidine alkaloids such as Borage, Boneset, Coltsfoot, Tu-san-chi, Comfrey, Heliotrope (sunflower seeds), Gordolobo, Germander, and Chaparral.
Pathophysiology
Any obstruction of the venous vasculature of the liver is referred to as Budd–Chiari syndrome, from the venules to the right atrium. This leads to increased portal vein and hepatic sinusoid pressures as the blood flow stagnates. The increased portal pressure causes increased filtration of vascular fluid with the formation of ascites in the abdomen and collateral venous flow through alternative veins leading to esophageal, gastric and rectal varices. Obstruction also causes centrilobular necrosis and peripheral lobule fatty change due to ischemia. If this condition persists chronically what is known as nutmeg liver will develop. Kidney failure may occur, perhaps due to the body sensing an "underfill" state and subsequent activation of the renin-angiotensin pathways and excess sodium retention.
Diagnosis
When Budd–Chiari syndrome is suspected, measurements are made of liver enzyme levels and other organ markers (creatinine, urea, electrolytes, LDH).Budd–Chiari syndrome is most commonly diagnosed using ultrasound studies of the abdomen and retrograde angiography. Ultrasound may show obliteration of hepatic veins, thrombosis or stenosis, spiderweb vessels, large collateral vessels, or a hyperechoic cord replacing a normal vein. Computed tomography (CT) or magnetic resonance imaging (MRI) is sometimes employed although these methods are generally not as sensitive. Liver biopsy is nonspecific but sometimes necessary to differentiate between Budd–Chiari syndrome and other causes of hepatomegaly and ascites, such as galactosemia or Reyes syndrome. Evaluation for a JAK2 V617F mutation is recommended.
Treatment
A minority of patients can be treated medically with sodium restriction, diuretics to control ascites, anticoagulants such as heparin and warfarin, and general symptomatic management. However, the majority of patients require further intervention. Milder forms of Budd–Chiari may be treated with surgical shunts to divert blood flow around the obstruction or the liver itself. Shunts must be placed early after diagnosis for best results. The TIPS is similar to a surgical shunt: it accomplishes the same goal but has a lower procedure-related mortality, a factor that has led to a growth in its popularity. If all the hepatic veins are blocked, the portal vein can be approached via the intrahepatic part of inferior vena cava, a procedure called DIPS (direct intrahepatic portocaval shunt). Patients with stenosis or vena caval obstruction may benefit from angioplasty. Limited studies on thrombolysis with direct infusion of urokinase and tissue plasminogen activator into the obstructed vein have shown moderate success in treating Budd–Chiari syndrome; however, it is not routinely attempted.Liver transplantation is an effective treatment for Budd–Chiari. It is generally reserved for patients with fulminant liver failure, failure of shunts, or progression of cirrhosis that reduces the life expectancy to one year. Long-term survival after a transplant ranges from 69 to 87%. The most common complications of transplants are rejection, arterial or venous thromboses, and bleeding due to the need for anticoagulants. Up to 10% of patients may have a recurrence of Budd–Chiari syndrome after the transplant.
Prognosis
Several studies have attempted to predict the survival of patients with Budd–Chiari syndrome. In general, nearly 2/3 of patients with Budd–Chiari are alive at 10 years. Important negative prognostic indicators include ascites, encephalopathy, elevated Child-Pugh scores, elevated prothrombin time, and altered serum levels of various substances (sodium, creatinine, albumin, and bilirubin). Survival is also highly dependent on the underlying cause of the Budd–Chiari syndrome. For example, a patient with an underlying myeloproliferative disorder may progress to acute leukemia, independently of Budd–Chiari syndrome.
Eponym
It is named after George Budd, a British physician, and Hans Chiari, an Austrian pathologist.
References
External links
Syndrome 10-138d.Budd–Chiari Syndrome at Merck Manual of Diagnosis and Therapy Home Edition |
You act as a medical communicator. Your goal is to translate medical terms into comprehensive, yet straightforward language for all readers. | I'm seeking clarification on the medical term 'Neonatal adrenoleukodystrophy.' Could you explain it? | Neonatal adrenoleukodystrophy is an inborn error of peroxisome biogenesis. It is part of the Zellweger spectrum. It has been linked with multiple genes (at least five) associated with peroxisome biogenesis, and has an autosomal recessive pattern of inheritance.
References
== External links == |
You are a medical advisor. Your role is to break down medical terminology into clear, detailed explanations for a general audience. | I'm looking for a concise explanation of the medical term 'Favus.' | Favus (Latin for "honeycomb") or tinea favosa is the severe form of tinea capitis, a skin infectious disease caused by the dermatophyte fungus Trichophyton schoenleinii. Typically the species affects the scalp, but occasionally occurs as onychomycosis, tinea barbae, or tinea corporis.
The word favid is more used than French word favus, which is close to the Latin etymology.
Presentation
The uncomplicated appearance is that of a number of yellowish, circular, cup-shaped crusts (scutulum or shield) grouped in patches like a honeycomb, each crust about the size of a split pea, with a bundle of hair projecting in the center. These increase in size and become crusted over, so that the characteristic lesion can only be seen round the edge of the scab. A mousy odour is often present. Growth continues to take place for several months, when scab and scutulum go away, leaving a shining bare patch destitute of hair. The disease is essentially chronic, lasting from ten to twenty years. It is caused by the growth of a fungus, and pathologically is the reaction of the tissues to the growth.The fungus was named after a microscopic structure termed "achorion" (a term not used in modern science), seen in scrapings of infected skin, which consists of slender, mycelial threads matted together, bearing oval, nucleated fungal substrate-arthroconidia either free or jointed. This structure is currently called "scutula." The fungus itself is now called Trichophyton schoenleinii.
During initial infection, the fungal spores would appear to enter through the unbroken cutaneous surface, and to germinate mostly in and around the hair follicle and sometimes in the shaft of the hair.
Species
Favus is the first human fungal disease in which a fungus was definitely identified by J. L. Schönlein in 1839. The discovery was published in a brief note of twenty lines in Müllers Archiv for that year (p. 82). In 1841, the Hungary-born French physician David Gruby independently described the fungus associated favus. The fungus was subsequently named by Robert Remak as Achorion schoenleinii in honor of its discoverer.
In 1892, two additional "species" of the fungus were described by Paul Gerson Unna, the Favus griseus, giving rise to greyish-yellow scutula, and the Favus sulphureus celerior, causing sulfur-yellow scutula of a rapid growth. This was in the days before scientists learned to rigorously distinguish microorganism identities from disease identities, and these antique, ambiguous disease-based names no longer have status either in mycology or in dermatology today.
Similar looking infections, sometimes diagnosed as favid but more often as atypical inflammatory tinea, may be caused by more common dermatophyte infections, in particular Microsporum gypseum, the most common soil-borne dermatophyte, and Trichophyton quinckeanum. The latter was previously called Trichophyton mentagrophytes var. quinckeanum, the agent of mouse favus infection.
Treatment
Up until the advent of modern therapies, favus was widespread worldwide; prior to Schönleins recognition of it as a fungal disease, it was frequently confused with Hansens disease, better known as leprosy, and affected Europeans were sometimes committed to leprosaria. Today, due to this species high susceptibility to the antifungal drug griseofulvin, it has been eliminated from most parts of the world except rural central Asia and scattered rural areas of Africa. It is mainly a disease connected to demographic poverty and isolation, but is so readily treatable that it is among the diseases most likely to be eliminated by modern medicine.
References
This article incorporates text from a publication now in the public domain: Chisholm, Hugh, ed. (1911). "Favus". Encyclopædia Britannica. Vol. 10 (11th ed.). Cambridge University Press. p. 215.
Kane, J., R.C. Summerbell, L. Sigler, S. Krajden, G. Land. 1997. Laboratory Handbook of Dermatophytes: A clinical guide and laboratory manual of dermatophytes and other filamentous fungi from skin, hair and nails. Star Publishers, Belmont, CA.
Gräser Y, Kuijpers AF, Presber W, De Hoog GS (October 1999). "Molecular taxonomy of Trichophyton mentagrophytes and T. tonsurans". Med. Mycol. 37 (5 Cpages=315–30): 315–30. doi:10.1046/j.1365-280x.1999.00234.x. PMID 10520156.
== External links == |
You are a medical advisor. Your role is to break down medical terminology into clear, detailed explanations for a general audience. | Could you offer a clear explanation of the term 'Orbital lymphoma' as used in the medical field? | Orbital lymphoma is a common type of non-Hodgkin lymphoma that occurs near or on the eye. Common symptoms include decreased vision and uveitis. Orbital lymphoma can be diagnosed via a biopsy of the eye and is usually treated with radiotherapy or in combination with chemotherapy.
Types
There are two main types of intraocular lymphomas: primary central nervous system involvement (PCNSL) and primary central nervous system with ocular involvement (PCNSLO). The difference between PCNSL and PCNSLO is that PNSCL involves the central nervous system, while PCNSLO does not. 56-86% of orbital lymphomas are classified PCNSL and 15-25% are classified PCNSLO.PCNSLO is common in people who are severely immunosuppressed.
Symptoms of this form of ocular lymphoma include painless decreased vision, sensitivity to light, a red eye, and floaters. Diagnosis is difficult due to its gradual onset and the fact that the symptoms are the same as other diseases.
PCNSLO is usually bilateral, but sometimes grows unevenly. Like other metastatic tumors of the eye, it is usually confined to the choroid.
Signs and symptoms
Primary visible signs of ocular lymphoma include proptosis and a visible mass in the eye. Symptoms are due to mass effect.
Pathophysiology
Recent studies have detected the presence of viral DNA in ocular lymphoma cells. This implies that pathogens play a role in ocular lymphoma. Other studies have found that the aging population, the increasing number of immunosuppressive drugs, and the AIDS epidemic have also contributed to the increased incidence of Non-Hodgkin lymphomas.
Ocular MALT lymphomas may also be associated with Chlamydia psittaci, although whether or not this is the case is still debated.Follicular lymphoma, diffuse large B cell lymphoma, mantle cell lymphoma, B-cell chronic lymphocytic leukemia, peripheral T-cell lymphoma, and natural killer cell lymphoma have also been reported to affect the orbit.
Diagnosis
Classification
There are two types of ocular lymphomas: intraocular lymphomas and adnexal lymphomas. An intraocular lymphoma occurs within the eye, while an adnexal lymphoma occurs outside, but adjoined to the eye.
Treatment
Radiotherapy is the most effective treatment for local disease either as the sole treatment for low-grade lymphoma or in combination with chemotherapy for intermediate- and high-grade lymphoma. Radiotherapy dose in range of 30-45 Gy administered in fractions are advised in treating the local orbital lymphomas.
Epidemiology
Orbital lymphoma accounts for 55% of malignant orbital tumors in adults. In one study, this was 10% of patients presenting with orbital tumors or similar lesions. Orbital lymphoma is more prevalent in Asia and Europe than in the United States.Although intraocular lymphoma is rare, the number of cases per year is rising, affecting mainly people in their seventies and immunocompromised patients. A recent study has shown that ocular lymphoma is more prevalent in women than men.The survival rate is approximately 60% after 5 years.
References
== External links == |
You serve as an encyclopedia of medical terms. Deliver clear, detailed explanations, making medical language understandable to a diverse audience. | I'm seeking clarification on the medical term 'Acrocephalosyndactyly.' Could you explain it? | In pediatric medicine, acrocephalosyndactyly is the common presentation of craniosynostosis and syndactyly. When there is also polydactyly the classification is acrocephalopolysyndactyly.
Cause
Diagnosis
Classification
It has several different types:
type I – Apert syndrome: 577
type II – Crouzon syndrome: 577
type III – Saethre–Chotzen syndrome
type IV – Goodman Syndrome
type V – Pfeiffer syndromeA related term, acrocephalopolysyndactyly, refers to the inclusion of polydactyly to the presentation. It also has multiple types:
type I – Noack syndrome; now classified with Pfeiffer syndrome
type II – Carpenter syndrome
type III – Sakati–Nyhan–Tisdale syndrome
type IV – Goodman syndrome; now classified with Carpenter syndrome
type V – Pfeiffer syndromeIt has been suggested that the distinction between "acrocephalosyndactyly" versus "acrocephalopolysyndactyly" should be abandoned.
Treatment
See also
List of skin conditions
Oxycephaly
References
External links
Acrocephalosyndactylia at the US National Library of Medicine Medical Subject Headings (MeSH) |
You are a conduit for medical education. Your task is to offer detailed explanations of medical terms, ensuring they are understandable and precise. | I've come across the term 'Cooks syndrome' in a medical context, but I'm not sure what it means. Can you clarify? | Cooks syndrome is a hereditary disorder which is characterized in the hands by bilateral nail hypoplasia on the thumb, index finger, and middle finger, absence of fingernails (anonychia) on the ring finger and little finger, lengthening of the thumbs, and bulbousness of the fingers. In the feet, it is characterized by absence of toenails and absence/hypoplasia of the distal phalanges. In the second study of this disorder, it was found that the intermediate phalanges, proximal phalanges, and metacarpals were unaffected.The disorder was first described by Cooks et al. in 1985 after being discovered in two generations of one family. It was proposed that the inheritance of the disorder is autosomal dominant. A second family, this with three affected generations, confirmed that the inheritance of the disorder is autosomal dominant. Although several genetic disorders exist which can cause anonychia and onychodystrophy, such disorders often cause other anomalies such as deafness, mental retardation, and defects of the hair, eyes, and teeth. Cooks syndrome is not known to cause any such anomalies.In 1999, a pair of siblings was found with brachydactyly type B. Because the disorder primarily affected the nails and distal phalanges, the research group concluded that brachydactyly type B and Cooks syndrome are the same disorder. However, in 2007, a 2-year-old girl was found with symptoms consistent with both brachydactyly type B and Cooks syndrome. It was found that the two syndromes were distinct clinically, radiologically, and genetically.
Notes
== External links == |
You serve as a medical tutor. Your objective is to demystify medical terms, providing thorough explanations that cater to various levels of medical knowledge. | Could you please explain the term 'Levofloxacin' in simple language? | Levofloxacin, sold under the brand name Levaquin among others, is an antibiotic medication. It is used to treat a number of bacterial infections including acute bacterial sinusitis, pneumonia, H. pylori (in combination with other medications), urinary tract infections, chronic prostatitis, and some types of gastroenteritis. Along with other antibiotics it may be used to treat tuberculosis, meningitis, or pelvic inflammatory disease. Use is generally recommended only when other options are not available. It is available by mouth, intravenously, and in eye drop form.Common side effects include nausea, diarrhea, and trouble sleeping. Serious side effects may include tendon rupture, tendon inflammation, seizures, psychosis, and potentially permanent peripheral nerve damage. Tendon damage may appear months after treatment is completed. People may also sunburn more easily. In people with myasthenia gravis, muscle weakness and breathing problems may worsen. While use during pregnancy is not recommended, risk appears to be low. The use of other medications in this class appear to be safe while breastfeeding; however, the safety of levofloxacin is unclear. Levofloxacin is a broad-spectrum antibiotic of the fluoroquinolone drug class. It usually results in death of the bacteria. It is the left-handed isomer of the medication ofloxacin.Levofloxacin was patented in 1985 and approved for medical use in the United States in 1996. It is on the World Health Organizations List of Essential Medicines. It is available as a generic medication. In 2019, it was the 182nd most commonly prescribed medication in the United States, with more than 3 million prescriptions.
Medical uses
Levofloxacin is used to treat infections including: respiratory tract infections, cellulitis, urinary tract infections, prostatitis, anthrax, endocarditis, meningitis, pelvic inflammatory disease, travelers diarrhea, tuberculosis, and plague and is available by mouth, intravenously, and in eye drop form.As of 2016, the US Food and Drug Administration (FDA) recommended that "serious side effects associated with fluoroquinolone antibacterial drugs generally outweigh the benefits for patients with acute sinusitis, acute bronchitis, and uncomplicated urinary tract infections who have other treatment options. For patients with these conditions, fluoroquinolones should be reserved for those who do not have alternative treatment options."Levofloxacin is used for the treatment of pneumonia, urinary tract infections, and abdominal infections. As of 2007 the Infectious Disease Society of America (IDSA) and the American Thoracic Society recommended levofloxacin and other respiratory fluoroquinolines as first line treatment for community acquired pneumonia when co-morbidities such as heart, lung, or liver disease are present or when in-patient treatment is required. Levofloxacin also plays an important role in recommended treatment regimens for ventilator-associated and healthcare-associated pneumonia.As of 2010 it was recommended by the IDSA as a first-line treatment option for catheter-associated urinary tract infections in adults. In combination with metronidazole it is recommended as one of several first-line treatment options for adult patients with community-acquired intra-abdominal infections of mild-to-moderate severity. The IDSA also recommends it in combination with rifampicin as a first-line treatment for prosthetic joint infections. The American Urological Association recommends levofloxacin as a first-line treatment to prevent bacterial prostatitis when the prostate is biopsied. and as of 2004 it was recommended to treat bacterial prostatitis by the NIH research network studying the condition.Levofloxacin and other fluoroquinolones have also been widely used for the treatment of uncomplicated community-acquired respiratory and urinary tract infections, indications for which major medical societies generally recommend the use of older, narrower spectrum drugs to avoid fluoroquinolone resistance development. Due to its widespread use, common pathogens such as Escherichia coli and Klebsiella pneumoniae have developed resistance. In many countries as of 2013, resistance rates among healthcare-associated infections with these pathogens exceeded 20%.Levofloxacin is also used as antibiotic eye drops to prevent bacterial infection. Usage of levofloxacin eye drops, along with an antibiotic injection of cefuroxime or penicillin during cataract surgery, has been found to lower the chance of developing endophthalmitis, compared to eye drops or injections alone.
Pregnancy and breastfeeding
According to the FDA approved prescribing information, levofloxacin is pregnancy category C. This designation indicates that animal reproduction studies have shown adverse effects on the fetus and there are no adequate and well-controlled studies in humans, but the potential benefit to the mother may in some cases outweigh the risk to the fetus. Available data point to a low risk for the unborn child. Exposure to quinolones, including levofloxacin, during the first-trimester is not associated with an increased risk of stillbirths, premature births, birth defects, or low birth weight.Levofloxacin does penetrate into breastmilk, though the concentration of levofloxacin in the breastfeeding infant is expected to be low. Due to potential risks to the baby, the manufacturer does not recommend that nursing mothers take levofloxacin. However, the risk appears to be very low, and levofloxacin can be used in breastfeeding mothers with proper monitoring of the infant, combined with delaying breastfeeding for 4–6 hours after taking levofloxacin.
Children
Levofloxacin is not approved in most countries for the treatment of children except in unique and life-threatening infections because it is associated with an elevated risk of musculoskeletal injury in this population, a property it shares with other fluoroquinolones.
In the United States levofloxacin is approved for the treatment of anthrax and plague in children over six months of age.Levofloxacin is recommended by the Pediatric Infectious Disease Society and the Infectious Disease Society of America as a first-line treatment for pediatric pneumonia caused by penicillin-resistant Streptococcus pneumoniae, and as a second-line agent for the treatment of penicillin-sensitive cases.In one study, 1534 juvenile patients (age 6 months to 16 years) treated with levofloxacin as part of three efficacy trials were followed up to assess all musculoskeletal events occurring up to 12 months post-treatment. At 12 months follow-up the cumulative incidence of musculoskeletal adverse events was 3.4%, compared to 1.8% among 893 patients treated with other antibiotics. In the levafloxacin-treated group, approximately two-thirds of these musculoskeletal adverse events occurred in the first 60 days, 86% were mild, 17% were moderate, and all resolved without long-term sequelae.
Spectrum of activity
Levofloxacin and later generation fluoroquinolones are collectively referred to as "respiratory quinolones" to distinguish them from earlier fluoroquinolones which exhibited modest activity toward the important respiratory pathogen Streptococcus pneumoniae.The drug exhibits enhanced activity against the important respiratory pathogen Streptococcus pneumoniae relative to earlier fluoroquinolone derivatives like ciprofloxacin. For this reason, it is considered a "respiratory fluoroquinolone" along with more recently developed fluoroquinolones such as moxifloxacin and gemifloxacin. It is less active than ciprofloxacin against Gram-negative bacteria, especially Pseudomonas aeruginosa, and lacks the anti-methicillin-resistant Staphylococcus aureus (MRSA) activity of moxifloxacin and gemifloxacin. Levofloxacin has shown moderate activity against anaerobes, and is about twice as potent as ofloxacin against Mycobacterium tuberculosis and other mycobacteria, including Mycobacterium avium complex.Its spectrum of activity includes most strains of bacterial pathogens responsible for respiratory, urinary tract, gastrointestinal, and abdominal infections, including Gram negative (Escherichia coli, Haemophilus influenzae, Klebsiella pneumoniae, Legionella pneumophila, Moraxella catarrhalis, Proteus mirabilis, and Pseudomonas aeruginosa), Gram positive (methicillin-sensitive but not methicillin-resistant Staphylococcus aureus, Streptococcus pneumoniae, Staphylococcus epidermidis, Enterococcus faecalis, and Streptococcus pyogenes), and atypical bacterial pathogens (Chlamydophila pneumoniae and Mycoplasma pneumoniae). Compared to earlier antibiotics of the fluoroquinoline class such as ciprofloxacin, levofloxacin exhibits greater activity towards Gram-positive bacteria but lesser activity toward Gram-negative bacteria, especially Pseudomonas aeruginosa.
Resistance
Resistance to fluoroquinolones is common in staphylococcus and pseudomonas. Resistance occurs in multiple ways. One mechanism is by an alteration in topoisomerase IV enzyme. A double mutant form of S. pneumoniae Gyr A + Par C bearing Ser-81-->Phe and Ser-79-->Phe mutations were eight to sixteen times less responsive to ciprofloxacin.
Contraindications and interactions
Package inserts mention that levofloxacin is to be avoided in patients with a known hypersensitivity to levofloxacin or other quinolone drugs.Like all fluoroquinolines, levofloxacin is contraindicated in patients with epilepsy or other seizure disorders, and in patients who have a history of quinolone-associated tendon rupture.Levofloxacin may prolong the QT interval in some people, especially the elderly, and levofloxacin should not be used for people with a family history of Long QT syndrome, or who have long QT, chronic low potassium, it should not be prescribed with other drugs that prolong the QT interval.Unlike ciprofloxacin, levofloxacin does not appear to deactivate the drug metabolizing enzyme CYP1A2. Therefore, drugs that use that enzyme, like theophylline, do not interact with levofloxacin. It is a weak inhibitor of CYP2C9, suggesting potential to block the breakdown of warfarin and phenprocoumon. This can result in more action of drugs like warfarin, leading to more potential side effects, such as bleeding.The use of non-steroidal anti-inflammatory drugs (NSAIDs) in combination with high dose fluoroquinolone therapy may lead to seizures.When levofloxacin is taken with anti-acids containing magnesium hydroxide or aluminum hydroxide, the two combine to form insoluble salts that are difficult to absorb from the intestines. Peak serum concentrations of levofloxacin may be reduced by 90% or more, which can prevent the levofloxacin from working. Similar results have been reported when levofloxacin is taken with iron supplements and multi-vitamins containing zinc.A 2011 review examining musculoskeletal complications of fluoroquinolones proposed guidelines with respect to administration to athletes, that called for avoiding all use of fluoroquinolone antibiotics if possible, and if they are used: ensure there is informed consent about the musculoskeletal risks, and inform coaching staff; do not use any corticosteroids if fluoroquinolones are used; consider dietary supplements of magnesium and antioxidants during treatment; reduce training until the course of antibiotic is finished and then carefully increase back to normal; and monitor for six months after the course is finished, and stop all athletic activity if symptoms emerge.
Adverse effects
Adverse effects are typically mild to moderate. However, severe, disabling, and potentially irreversible adverse effects sometimes occur, and for this reason it is recommended that use of fluoroquinolones be limited.
Prominent among these are adverse effects that became the subject of a black box warning by the FDA in 2016. The FDA wrote: "An FDA safety review has shown that fluoroquinolones when used systemically (i.e. tablets, capsules, and injectable) are associated with disabling and potentially permanent serious adverse effects that can occur together. These adverse effects can involve the tendons, muscles, joints, nerves, and central nervous system." Rarely, tendinitis or tendon rupture may occur due to fluoroquinolone antibiotics, including levofloxacin. Such injuries, including tendon rupture, has been observed up to 6 months after cessation of treatment; higher doses of fluoroquinolones, being elderly, transplant patients, and those with a current or historical corticosteroid use are at elevated risk. The U.S. label for levofloxacin also contains a black box warning for the exacerbation of the symptoms of the neurological disease myasthenia gravis. Similarly, the UK Medicines and Healthcare Products Regulatory Agency recommendations warn of rare but disabling and potentially irreversible adverse effects, and to recommend limiting use of these drugs. Increasing age and corticosteroid use appears to increase the risk of musculoskeletal complications.A wide variety of other uncommon but serious adverse events have been associated with fluoroquinolone use, with varying degrees of evidence supporting causation. These include anaphylaxis, hepatotoxicity, central nervous system effects including seizures and psychiatric effects, prolongation of the QT interval, blood glucose disturbances, and photosensitivity, among others. Levofloxacin may produce fewer of these rare serious adverse effects than other fluoroquinolones.There is some disagreement in the medical literature regarding whether and to what extent levofloxacin and other fluoroquinolones produce serious adverse effects more frequently than other broad spectrum antibacterial drugs.There are some case reports of levofloxacin associated with idiopathic intracranial hypertension.With regard to more usual adverse effects, in pooled results from 7537 patients exposed to levofloxacin in 29 clinical trials, 4.3% discontinued treatment due to adverse drug reactions. The most common adverse reactions leading to discontinuation were gastrointestinal, including nausea, vomiting, and constipation. Overall, 7% of patients experienced nausea, 6% headache, 5% diarrhea, 4% insomnia, along with other adverse reactions experienced at lower rates.Administration of levofloxacin or other broad spectrum antibiotics is associated with Clostridium difficile associated diarrhea which may range in severity from mild diarrhea to fatal colitis. Fluoroquinoline administration may be associated with the acquisition and outgrowth of a particularly virulent Clostridium strain.More research is needed to determine the best dose and length of treatment.
Overdose
Overdosing experiments in animals showed loss of body control and drooping, difficulty breathing, tremors, and convulsions. Doses in excess of 1500 mg/kg orally and 250 mg/kg IV produced significant mortality in rodents.In the event of an acute overdosage, authorities recommend unspecific standard procedures such as emptying the stomach, observing the patient and maintaining appropriate hydration. Levofloxacin is not efficiently removed by hemodialysis or peritoneal dialysis.
Pharmacology
Mechanism of action
Levofloxacin is a broad-spectrum antibiotic that is active against both Gram-positive and Gram-negative bacteria. Like all quinolones, it functions by inhibiting the DNA gyrase and topoisomerase IV, two bacterial type II topoisomerases. Topoisomerase IV is necessary to separate DNA that has been replicated (doubled) prior to bacterial cell division. With the DNA not being separated, the process is stopped, and the bacterium cannot divide. DNA gyrase, on the other hand, is responsible for supercoiling the DNA, so that it will fit in the newly formed cells. Both mechanisms amount to killing the bacterium. Levofloxacin acts as a bactericide.As of 2011, the mechanism of action for the drugs musculoskeletal complications were not clear.
Pharmacokinetics
Levofloxacin is rapidly and essentially completely absorbed after oral administration, with a plasma concentration profile over time that is essentially identical to that obtained from intravenous administration of the same amount over 60 minutes. As such, the intravenous and oral formulations of levofloxacin are considered interchangeable. Levofloxacins ability to bind to proteins in the body ranges from 24 to 38%.The drug undergoes widespread distribution into body tissues. Peak levels in skin are achieved 3 hours after administration and exceed those in plasma by a factor of 2. Similarly, lung tissue concentrations range from two-fold to five-fold higher than plasma concentrations in the 24 hours after a single dose.
The mean terminal plasma elimination half-life of levofloxacin ranges from approximately 6 to 8 hours following single or multiple doses of levofloxacin given orally or intravenously. Elimination occurs mainly via excretion of unmetabolized drug in the urine. Following oral administration, 87% of an administered dose was recovered in the urine as unchanged drug within 2 days. Less than 5% was recovered in the urine as the desmethyl and N-oxide metabolites, the only metabolites identified in humans.
Chemistry
Like all fluoroqinolones, levofloxacin is a fluorinated quinolone carboxylic acid. It is a chiral molecule and the pure (−)-(S)-enantiomer of the racemic drug ofloxacin. This enantiomer binds more effectively to the DNA gyrase enzyme and to topoisomerase IV than its (+)-(R)-counterpart. Levofloxacin is referred to as a chiral switch: These are chiral drugs that have already been patent claimed, approved and marketed as racemates (or as mixtures of diastereomers but have since been redeveloped as pure enantiomers. Distinct functional groups on this molecules include a hydroxyl group, carbonyl group, and an aromatic ring.The substance is used as the hemihydrate, which has the empirical formula C18H20FN3O4 · 1⁄2 H2O and a molecular mass of 370.38 g/mol. Levofloxacin is a light-yellowish-white to yellow-white crystal or crystalline powder. A major issue in the synthesis of levofloxacin is identifying correct entries into the benzoxazine core in order to produce the correct chiral form.
History
Levofloxacin is a third-generation fluoroquinolone, being one of the isomers of ofloxacin, which was a broader-spectrum conformationally locked analog of norfloxacin; both ofloxacin and levofloxaxin were synthesized and developed by scientists at Daiichi Seiyaku. The Daiichi scientists knew that ofloxacin was racemic, but tried unsuccessfully to separate the two isomers; in 1985 they succeeded in separately synthesizing the pure levo form and showed that it was less toxic and more potent than the other form.It was first approved for marketing in Japan in 1993, for oral administration, and Daiichi marketed it there under the brand name Cravit. Daiichi, working with Johnson & Johnson as it had with ofloxacin, obtained FDA approval in 1996 under the brand name Levaquin to treat bacterial sinusitus, bacterial exacerbations of bronchitis, community-acquired pneumonia, uncomplicated skin infections, complicated urinary tract infections, and acute pyelonephritis.Levofloxacin is marketed by Sanofi-Aventis under a license agreement signed with Daiichi in 1993, under the brand name "Tavanic".Levofloxacin had reached blockbuster status by this time; combined worldwide sales of levofloxacin and ofloxacin for J&J alone were US$1.6 billion in 2009.The term of the levofloxacin United States patent was extended by the U.S. Patent and Trademark Office 810 days under the provisions of the Hatch Waxman Amendment so that the patent would expire in 2010 instead of 2008. This extension was challenged by generic drug manufacturer Lupin Pharmaceuticals, which did not challenge the validity of the patent, but only the validity of the patent extension, arguing that the patent did not cover a "product" and so Hatch-Waxman was not available for extensions. The federal patent court ruled in favor of J&J and Daiichi, and generic versions of levofloxacin did not enter the U.S. market until 2009.
Society and culture
Availability
Levofloxacin is available in tablet form, injection, and oral solution.
Usage
The FDA estimated that in 2011, over 23 million outpatient prescriptions for fluoroquinolones, of which levofloxacin made up 28%, were filled in the United States.
Litigation
As of 2012, Johnson and Johnson was facing around 3400 state and federal lawsuits filed by people who claimed tendon damage from levofloxacin; about 1900 pending in a class action at the United States District Court in Minnesota and about 1500 pending at a district court in New Jersey.In October 2012, J&J settled 845 cases in the Minnesota action, after Johnson and Johnson prevailed in three of the first four cases to go to trial. By May 2014, all but 363 cases had been settled or adjudicated.
References
External links
"Levofloxacin". Drug Information Portal. U.S. National Library of Medicine. |
You function as a medical explainer. Your task is to convey the meanings of medical terms in a detailed, yet easy-to-understand manner. | I'm seeking clarification on the medical term 'Dactinomycin.' Could you explain it? | Dactinomycin, also known as actinomycin D, is a chemotherapy medication used to treat a number of types of cancer. This includes Wilms tumor, rhabdomyosarcoma, Ewings sarcoma, trophoblastic neoplasm, testicular cancer, and certain types of ovarian cancer. It is given by injection into a vein.Most people develop side effects. Common side effects include bone marrow suppression, vomiting, mouth ulcers, hair loss, liver problems, infections, and muscle pains. Other serious side effects include future cancers, allergic reactions, and tissue death at the site of injection. Use in pregnancy may harm the baby. Dactinomycin is in the cytotoxic antibiotic family of medications. It is believed to work by blocking the creation of RNA.Dactinomycin was approved for medical use in the United States in 1964. It is on the World Health Organizations List of Essential Medicines.
Medical use
Actinomycin is a clear, yellowish liquid administered intravenously and most commonly used in treatment of a variety of cancers, including:
Gestational trophoblastic neoplasia
Wilms tumor
Rhabdomyosarcoma
Ewings sarcoma
Malignant hydatidiform moleSometimes it will be combined with other drugs in chemotherapy regimens, like the VAC regimen (with vincristine and cyclophosphamide) for treating rhabdomyosarcoma and Ewings sarcoma.
It is also used as a radiosensitizer in adjunct to radiotherapies, since it can increase the radiosensitivity of tumor cells by inhibiting repair of sublethal radiation damage and delay the onset of the compensatory hyperplasia that occurs following irradiation.
Side effects
Common adverse drug reaction includes bone marrow suppression, fatigue, hair loss, mouth ulcer, loss of appetite and diarrhea. Actinomycin is a vesicant, if extravasation occurs.
Mechanism
In cell biology, actinomycin D is shown to have the ability to inhibit transcription. Actinomycin D does this by binding DNA at the transcription initiation complex and preventing elongation of RNA chain by RNA polymerase.
History
Actinomycin D was the first antibiotic shown to have anti-cancer activity. It was first isolated by Selman Waksman and his co-worker H. Boyd Woodruff in 1940. It was approved by the U.S. Food and Drug Administration (FDA) on December 10, 1964, and launched by Merck Sharp and Dohme under the trade name Cosmegen.
Research use
Because actinomycin can bind DNA duplexes, it can also interfere with DNA replication, although other chemicals such as hydroxyurea are better suited for use in the laboratory as inhibitors of DNA synthesis.
Actinomycin D and its fluorescent derivative, 7-aminoactinomycin D (7-AAD), are used as stains in microscopy and flow cytometry applications. The affinity of these stains/compounds for GC-rich regions of DNA strands makes them excellent markers for DNA. 7-AAD binds to single stranded DNA; therefore it is a useful tool in determining apoptosis and distinguishing between dead cells and live ones.
References
External links
"Dactinomycin". Drug Information Portal. U.S. National Library of Medicine. |
You are an assistant in medical learning. Your role is to clarify medical terminology, ensuring the information is both accurate and accessible. | I'm trying to expand my medical knowledge. Can you elucidate the term 'Sodium nitrite'? | Sodium nitrite is an inorganic compound with the chemical formula NaNO2. It is a white to slightly yellowish crystalline powder that is very soluble in water and is hygroscopic. From an industrial perspective, it is the most important nitrite salt. It is a precursor to a variety of organic compounds, such as pharmaceuticals, dyes, and pesticides, but it is probably best known as a food additive used in processed meats and (in some countries) in fish products.
Uses
Industrial chemistry
The main use of sodium nitrite is for the industrial production of organonitrogen compounds. It is a reagent for conversion of amines into diazo compounds, which are key precursors to many dyes, such as diazo dyes. Nitroso compounds are produced from nitrites. These are used in the rubber industry.It is used in a variety of metallurgical applications, for phosphatizing and detinning.Sodium nitrite is an effective corrosion inhibitor and is used as an additive in industrial greases, as an aqueous solution in closed loop cooling systems, and in a molten state as a heat transfer medium.
Food additive and preservative
Sodium nitrite is used to speed up the curing of meat and also impart an attractive pink color. Nitrite reacts with the meat myoglobin to cause color changes, first converting to nitrosomyoglobin (bright red), then, on heating, to nitrosohemochrome (a pink pigment).Historically, salt has been used for the preservation of meat. The salt-preserved meatproduct was usually brownish-gray in color. When sodium nitrite is added with the salt, the meat develops a red, then pink color, which is associated with cured meats such as ham, bacon, hot dogs, and bologna.In the early 1900s, irregular curing was commonplace. This led to further research surrounding the use of sodium nitrite as an additive in food, standardizing the amount present in foods to minimize the amount needed while maximizing its food additive role. Through this research, sodium nitrite has been found to give taste and color to the meat and inhibit lipid oxidation that leads to rancidity, with varying degrees of effectiveness for controlling growth of disease-causing microorganisms. The ability of sodium nitrite to address the above-mentioned issues has led to production of meat with extended storage life and has improved desirable color and taste. According to scientists working for the meat industry, nitrite has improved food safety. This view is disputed in the light of its ineffectiveness against botulism and the possible carcinogenic effects caused by adding nitrites to meat.Nitrite has the E number E250. Potassium nitrite (E249) is used in the same way. It is approved for usage in the EU, USA and Australia and New Zealand.In meat-processing, sodium nitrite is never used in a pure state but always mixed with common salt. This mixture is known as nitrited salt, curing salt or nitrited curing salt. In Europe, nitrited curing salt contains between 99.1% and 99.5% common
salt and between 0.5% and 0.9% nitrite. In the US, nitrited curing salt is dosed at 6% and must be remixed with salt before use.
Color and taste
The appearance and taste of meat is an important component of consumer acceptance. Sodium nitrite is responsible for the desirable red color (or shaded pink) of meat. Very little nitrite is needed to induce this change. It has been reported that as little as 2 to 14 parts per million (ppm) is needed to induce this desirable color change. However, to extend the lifespan of this color change, significantly higher levels are needed. The mechanism responsible for this color change is the formation of nitrosylating agents by nitrite, which has the ability to transfer nitric oxide that subsequently reacts with myoglobin to produce the cured meat color. The unique taste associated with cured meat is also affected by the addition of sodium nitrite. However, the mechanism underlying this change in taste is still not fully understood.
Inhibition of microbial growth
A 2018 study by the British Meat Producers Association determined that legally permitted levels of nitrite have no effect on the growth of the Clostridium botulinum bacteria which causes botulism, in line with the UKs Advisory Committee on the Microbiological Safety of Food opinion that nitrites are not required to prevent C. botulinum growth and extend shelf life. In some countries, cured-meat products are manufactured without nitrites. For example, Parma ham, which has been produced without nitrite since 1993, was reported in 2018 to have caused no cases of botulism.Sodium nitrite has shown varying degrees of effectiveness for controlling growth of other spoilage or disease causing microorganisms. Although the inhibitory mechanisms are not well known, its effectiveness depends on several factors including residual nitrite level, pH, salt concentration, reductants present and iron content. The type of bacteria also affects sodium nitrites effectiveness. It is generally agreed that sodium nitrite is not effective for controlling Gram-negative enteric pathogens such as Salmonella and Escherichia coli.Other food additives (such as lactate and sorbate) provide similar protection against bacteria, but do not provide the desired pink color.
Inhibition of lipid peroxidation
Sodium nitrite is also able to effectively delay the development of oxidative rancidity. Lipid peroxidation is considered to be a major reason for the deterioration of quality of meat products (rancidity and unappetizing flavors). Sodium nitrite acts as an antioxidant in a mechanism similar to the one responsible for the coloring effect. Nitrite reacts with heme proteins and metal ions, neutralizing free radicals by nitric oxide (one of its byproducts). Neutralization of these free radicals terminates the cycle of lipid oxidation that leads to rancidity.
Medication
Sodium nitrite is used as a medication together with sodium thiosulfate to treat cyanide poisoning. It is recommended only in severe cases of cyanide poisoning. In those who have both cyanide poisoning and carbon monoxide poisoning sodium thiosulfate by itself is usually recommended. It is given by slow injection into a vein.Side effects can include low blood pressure, headache, shortness of breath, loss of consciousness, and vomiting. Greater care should be taken in people with underlying heart disease. The patients levels of methemoglobin should be regularly checked during treatment. While not well studied during pregnancy, there is some evidence of potential harm to the baby. Sodium nitrite is believed to work by creating methemoglobin that then binds with cyanide and thus removes it from the mitochondria.Sodium nitrite came into medical use in the 1920s and 1930s. It is on the World Health Organizations List of Essential Medicines.
Suicide
Several academic publications in 2020 and 2021 have discussed the toxicity of sodium nitrite, and an apparent recent increase in suicides from using sodium nitrite which had been ordered online. The usage of sodium nitrite as a suicide method has been heavily discussed on suicide forums. Sodium nitrite was also the culprit of the McCarthy et al v Amazon lawsuit alleging that Amazon knowingly assisted in the deaths of healthy children by selling them "suicide kits" as Amazons "frequently bought together" feature recommended buying sodium nitrate, an antiemetic and a suicide instruction book together.
Toxicity
Sodium nitrite is toxic. The LD50 in rats is 180 mg/kg and in human LDLo is 71 mg/kg. Yet, death by sodium nitrite ingestion can happen at lower dose. Sodium nitrite is sometimes used for homicide. The online marketplace eBay has globally prohibited the sale of sodium nitrite since 2019. To prevent accidental intoxication, sodium nitrite (blended with salt) sold as a food additive in the US is dyed bright pink to avoid mistaking it for plain salt or sugar. In other countries, nitrited curing salt is not dyed but is strictly regulated.
Occurrence in vegetables
Nitrites are not naturally occurring in vegetables in significant quantities. Boiling vegetables does not affect nitrite levels.The presence of nitrite in animal tissue is a consequence of metabolism of nitric oxide, an important neurotransmitter. Nitric oxide can be created de novo from nitric oxide synthase utilizing arginine or from ingested nitrite.
Pigs
Because of sodium nitrites high level of toxicity to swine (Sus scrofa) it is now being developed in Australia to control feral pigs and wild boar. The sodium nitrite induces methemoglobinemia in swine, i.e. it reduces the amount of oxygen that is released from hemoglobin, so the animal will feel faint and pass out, and then die in a humane manner after first being rendered unconscious. The Texas Parks and Wildlife Department operates a research facility at Kerr Wildlife Management Area, where they examine feral pig feeding preferences and bait tactics to administer sodium nitrite.
Cancer
Carcinogenicity is the ability or tendency of a chemical to induce tumors, increase their incidence or malignancy, or shorten the time of tumor occurrence.Adding nitrites to meat has been shown to generate known carcinogens such as nitrosamines; the World Health Organization (WHO) advises that each 50 g (1.8 oz) of "processed meats" eaten a day would raise the risk of getting bowel cancer by 18% over a lifetime. The World Health Organizations review of more than 400 studies concluded, in 2015, that there was sufficient evidence that "processed meats" caused cancer, particularly colon cancer; the WHOs International Agency for Research on Cancer (IARC) classified "processed meats" as carcinogenic to humans (Group 1); "processed meat" meaning meat that has been transformed through salting, curing, fermentation, smoking, or other processes to enhance flavour or improve preservation.).Nitrosamines can be formed during the curing process used to preserve meats, when sodium nitrite-treated meat is cooked, and also from the reaction of nitrite with secondary amines under acidic conditions (such as occurs in the human stomach). Dietary sources of nitrosamines include US cured meats preserved with sodium nitrite as well as the dried salted fish eaten in Japan. In the 1920s, a significant change in US meat curing practices resulted in a 69% decrease in average nitrite content. This event preceded the beginning of a dramatic decline in gastric cancer mortality. Around 1970, it was found that ascorbic acid (vitamin C), an antioxidant, inhibits nitrosamine formation. Consequently, the addition of at least 550 ppm of ascorbic acid is required in meats manufactured in the United States. Manufacturers sometimes instead use erythorbic acid, a cheaper but equally effective isomer of ascorbic acid. Additionally, manufacturers may include α-tocopherol (vitamin E) to further inhibit nitrosamine production. α-Tocopherol, ascorbic acid, and erythorbic acid all inhibit nitrosamine production by their oxidation-reduction properties. Ascorbic acid, for example, forms dehydroascorbic acid when oxidized, which when in the presence of nitrosonium, a potent nitrosating agent formed from sodium nitrite, reduces the nitrosonium into nitric oxide. The nitrosonium ion formed in acidic nitrite solutions is commonly mislabeled nitrous anhydride, an unstable nitrogen oxide that cannot exist in vitro.Ingesting nitrite under conditions that result in endogenous nitrosation has been classified as "probably carcinogenic to humans" by International Agency for Research on Cancer (IARC).Sodium nitrite consumption has also been linked to the triggering of migraines in individuals who already experience them.One study has found a correlation between highly frequent ingestion of meats cured with pink salt and the COPD form of lung disease. The studys researchers suggest that the high amount of nitrites in the meats was responsible; however, the team did not prove the nitrite theory. Additionally, the study does not prove that nitrites or cured meat caused higher rates of COPD, merely a link. The researchers did adjust for many of COPDs risk factors, but they commented they cannot rule out all possible unmeasurable causes or risks for COPD.
Production
Industrial production of sodium nitrite follows one of two processes, the reduction of nitrate salts, or the oxidation of lower nitrogen oxides.
One method uses molten sodium nitrate as the salt, and lead which is oxidized, while a more modern method uses scrap iron filings to reduce the nitrate.A more commonly used method involves the general reaction of nitrogen oxides in alkaline aqueous solution, with the addition of a catalyst. The exact conditions depend on which nitrogen oxides are used, and what the oxidant is, as the conditions need to be carefully controlled to avoid over oxidation of the nitrogen atom.Sodium nitrite has also been produced by reduction of nitrate salts by exposure to heat, light, ionizing radiation, metals, hydrogen, and electrolytic reduction.
Chemical reactions
In the laboratory, sodium nitrite can be used to destroy excess sodium azide.
2
NaN
3
+
2
NaNO
2
+
4
H
+
⟶
3
N
2
+
2
NO
+
4
Na
+
+
2
H
2
O
{\displaystyle {\ce {2 NaN3 + 2 NaNO2 + 4 H^+ -> 3 N2 + 2 NO + 4 Na^+ + 2 H2O}}}
Above 330 °C sodium nitrite decomposes (in air) to sodium oxide, nitric oxide and nitrogen dioxide.
2
NaNO
2
⟶
Na
2
O
+
NO
+
NO
2
{\displaystyle {\ce {2 NaNO2 -> Na2O + NO + NO2}}}
Sodium nitrite can also be used in the production of nitrous acid:
2
NaNO
2
+
H
2
SO
4
⟶
2
HNO
2
+
Na
2
SO
4
{\displaystyle {\ce {2NaNO2 + H2SO4 ->2 HNO2 + Na2SO4}}}
The nitrous acid then, under normal conditions, decomposes:
2
HNO
2
⟶
NO
2
+
NO
+
H
2
O
{\displaystyle {\ce {2 HNO2 -> NO2 + NO + H2O}}}
The resulting nitrogen dioxide hydrolyzes to a mixture of nitric and nitrous acids:
2
NO
2
+
H
2
O
⟶
HNO
3
+
HNO
2
{\displaystyle {\ce {2 NO2 + H2O -> HNO3 + HNO2}}}
Isotope labelling 15N
In organic synthesis isotope enriched sodium nitrite-15N can be used instead of normal sodium nitrite as their reactivity is nearly identical in most reactions.
The obtained products carry isotope 15N and hence Nitrogen NMR can be efficiently carried out.
References
Further reading
External links
Drug information portal at the U.S. National Library of Medicine
International Chemical Safety Card 1120.
Nitrite in Meat |
You are a guide to medical language. Please provide in-depth and understandable explanations of medical terms, highlighting their significance in healthcare. | I've come across the term 'Mixed affective state' in a medical context, but I'm not sure what it means. Can you clarify? | A mixed affective state, formerly known as a mixed-manic or mixed episode, has been defined as a state wherein features unique to both depression and mania—such as episodes of despair, doubt, anguish, rage or homicidal ideation, suicidal ideation, splitting, racing thoughts, sensory overload, pressure of activity, and heightened irritability—occur either simultaneously or in very short succession.
Previously, the diagnostic criteria for both a manic and depressive episode had to be met in a consistent and sustained fashion, with symptoms enduring for at least a week (or any duration if psychiatric hospitalization was required), thereby restricting the official acknowledgement of mixed affective states to only a minority of patients with bipolar I disorder. In current DSM-5 nomenclature, however, a "mixed episode" no longer stands as an episode of illness unto itself; rather, the symptomology specifier "with mixed features" can be applied to any major affective episode (manic, hypomanic, or depressive), meaning that they are now officially recognized in patients with, in addition to bipolar I disorder, bipolar II disorder and, by convention, major depressive disorder. A depressive mixed state in a patient, however, even in the absence of discrete periods of mania or hypomania, effectively rules out unipolar depression.
Diagnostic criteria
As affirmed by the Diagnostic and Statistical Manual of Mental Disorders, fifth edition (DSM-5), the symptomology specifier "with mixed features" can be applied to manic episodes of bipolar I disorder, hypomanic episodes of either bipolar I disorder or bipolar II disorder and depressive episodes of either bipolar disorder or major depressive disorder, with at least three concurrent features of the opposite polarity being present. As a result, the presence of "mixed features" are now recognized in patients with bipolar II disorder and major depression; as earlier noted, however, although it is customary to withhold a diagnosis of a bipolar disorder until a manic or hypomanic episode appears, the presence of such features in a depressed patient even with no history of discrete mania or hypomania is strongly suggestive of the disorder.
Nevertheless, the DSM-5s narrower definition of mixed episodes may result in fewer patients meeting mixed criteria compared to DSM-IV. A call was made by Tohen in 2017 for introducing changes from a currently phenomenological to a target oriented approach to DSM-5 mixed mood criteria in order to achieve more personalized medical attention.Two features of both mania or hypomania and depression may superficially overlap and even resemble each other, namely "an increase in goal-directed activity" (psychomotor acceleration) vs. psychomotor agitation and "flight of ideas" and "racing thoughts" vs. depressive rumination. Attending to the patients experiences is very important. In the psychomotor agitation commonly seen in depression, the "nervous energy" is always overshadowed by a strong sense of exhaustion and manifests as purposeless movements (e.g., pacing, hand-wringing); in psychomotor acceleration, however, the excess in movement stems from an abundance of energy and is often channelled and purposeful. Likewise, in depressive rumination, the patient experiences the repetitive thoughts as heavy, leaden, and plodding; in psychic acceleration, however, (as seen in mania or hypomania) the thoughts move in a rapid progression, with many themes, rather than a singular one, being touched upon. Even when such experiences are accounted for on the basis of depression, the possibility does still exist, however, that the depressive episode may be complicated by other manic or hypomanic symptoms, in which case it is often prudent to attend to the patients personal and family history (e.g., family history of bipolar disorder, early age of onset) to determine whether or not the patient has bipolar disorder.
Treatment
Treatment of mixed states is typically based upon administration of mood stabilizing medication, which may include anticonvulsants such as valproic acid; atypical antipsychotics such as quetiapine, olanzapine, aripiprazole, and ziprasidone; or first-generation antipsychotics such as haloperidol. There is question of lithiums efficacy for treatment of mixed states due to conflicting conclusions drawn from various trials and research. Mood stabilizers work to reduce the manic symptoms associated with the mixed state, but they are not considered particularly effective for improving concurrent depressive symptoms.
See also
Post-traumatic stress disorder
Dopamine
Mania
Hyperthymic temperament
Cyclothymia
Narcissistic personality disorder
Borderline personality disorder
References
== External links == |
You are a facilitator of medical knowledge. Provide thorough and accessible explanations of medical terms, catering to both specialists and non-specialists. | Can you demystify the medical term 'Vernal keratoconjunctivitis' for me? | Vernal keratoconjunctivitis (VKC) is a recurrent, bilateral, and self-limiting inflammation of conjunctiva, having a periodic seasonal incidence.
Vernal keratopathy
Corneal involvement in VKC may be primary or secondary due to extension of limbal lesions. Vernal keratopathy includes 5 types of lesions.
Punctuate epithelial keratitis.
Ulcerative vernal keratitis (shield ulceration).
Vernal corneal plaques.
Subepithelial scarring.
Pseudogerontoxon.
Sign and symptoms
Symptoms- VKC is characterised by marked burning and itchy sensations which may be intolerable and accentuates when patient comes in a warm humid atmosphere. Associated symptoms include mild photophobia in case of corneal involvement, lacrimation, stringy discharge and heaviness of eyelids.
Signs of VKC can be described in three clinical forms (Cameron Classification):Palpebral form- Usually upper tarsal conjunctiva of both the eyes is involved. Typical lesion is characterized by the presence of hard, flat-topped papillae arranged in cobblestone or pavement stone fashion. In severe cases papillae undergo hypertrophy to produce cauliflower-like excrescences of giant papillae.
Bulbar form- It is characterised by dusky red triangular congestion of bulbar conjunctiva in palpebral area, gelatinous thickened accumulation of tissue around limbus and presence of discrete whitish raised dots along the limbus (Trantas spots).
Mixed form- Shows the features of both palpebral and bulbar types.
Cause
VKC is thought to be an allergic disorder in which IgE mediated mechanism play a role. Such patients often give family history of other atopic diseases such as hay fever, asthma or eczema, and their peripheral blood shows eosinophilia and increased serum IgE levels.
Risk factors
Age and sex – 4–20 years; more common in boys than girls.
Season – More common in summer. Hence, the name Spring catarrh is a misnomer. Recently it is being labelled as Warm weather conjunctivitis.
Climate – More prevalent in the tropics. VKC cases are mostly seen in hot months of summer, therefore, more suitable term for this condition is "summer catarrh" Ref.
Pathology
Conjunctival epithelium undergoes hyperplasia and sends downward projection into sub-epithelial tissue.
Adenoid layer shows marked cellular infiltration by eosinophils, lymphocytes, plasma cells and histiocytes.
Fibrous layer show proliferation which later undergoes hyaline changes.
Conjunctival vessels also show proliferation, increased permeability and vasodilation.
Diagnosis
Classification
Based on severity, authors have classified VKC into clinical grades:Grade 0 - Absence of symptoms
Grade 1 MILD - Symptoms but no corneal involvement
Grade 2 MODERATE - Symptoms with photophobia but no corneal involvement
Grade 3 SEVERE - Symptoms, photophobia, mild to moderate SPKs OR with Diffuse SPK or corneal ulcer
Treatment
Local therapy- Topical steroids are effective. Commonly used solutions are of fluorometholone, medrysone, betamethasone or dexamethasone. Mast cell stabilizers such as sodium cromoglycate (2%) drops 4–5 times a day are quite effective in controlling VKC, especially atopic ones. Azelastine eyedrops are also effective. Topical antihistamines can be used. Acetyl cysteine (0.5%) used topically has mucolytic properties and is useful in the treatment of early plaque formation. Topical Cyclosporine is reserved for unresponsive cases.
Systemic therapy- Oral antihistamines and oral steroids for severe cases.
Treatment of large papillae- Cryo application, surgical excision or supratarsal application of long-acting steroids.
General measures include use of dark goggles to prevent photophobia, cold compresses and ice pack for soothing effects, change of place from hot to cold areas.
Desensitization has also been tried without much rewarding results.
Treatment of vernal keratopathy- Punctuate epithelial keratitis require no extra treatment except that instillation of steroids should be increased. Large vernal plaque requires surgical excision. Ulcerative vernal keratitis require surgical treatment in the form of debridement, superficial keratectomy, excimer laser therapeutic keratectomy, as well as amniotic membrane transplantation to enhance re-epithelialisation.
Recently treatment with tacrolimus ointment (0.1%) used topically twice daily is showing encouraging results.
See also
Conjunctivitis
Allergic conjunctivitis
References
Further reading
Khurana, A. K. (2014). Comprehensive ophthalmology. Anshan. ISBN 978-1-84829-072-3.
== External links == |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | I'm seeking clarification on the medical term 'Pituicytoma.' Could you explain it? | Pituicytoma is a rare brain tumor. It grows at the base of the brain from the pituitary gland. This tumor is thought to be derived from the parenchymal cells of the posterior lobe of the pituitary gland, called pituicytes. Some researchers believe that they arise from the folliculostellate cells in the anterior lobe of the pituitary. As such, it is a low-grade glioma. It occurs in adults and symptoms include visual disturbance and endocrine dysfunction. They are often mistaken for pituitary adenomas which have a similar presentation and occur in the same location. The treatment consists of surgical resection, which is curative in most cases.
References
Further reading
== External links == |
You act as a mediator between medical professionals and the public. Provide comprehensive explanations of medical terms, ensuring they are both precise and easily understood. | I'm encountering the term 'Genital wart' in medical literature. What's its definition? | Genital warts are a sexually transmitted infection caused by certain types of human papillomavirus (HPV). They are generally pink in color and project out from the surface of the skin. Usually they cause few symptoms, but can occasionally be painful. Typically they appear one to eight months following exposure. Warts are the most easily recognized symptom of genital HPV infection.HPV types 6 and 11 are responsible for causing majority of genital warts whereas HPV types 16, 18, 31, 33, and 35 are also occasionally found. It is spread through direct skin-to-skin contact, usually during oral, genital, or anal sex with an infected partner. Diagnosis is generally based on symptoms and can be confirmed by biopsy. The types of HPV that cause cancer are not the same as those that cause warts.Some HPV vaccines can prevent genital warts as may condoms. Treatment options include creams such as podophyllin, imiquimod, and trichloroacetic acid. Cryotherapy or surgery may also be an option. After treatment warts often resolve within six months. Without treatment, in up to a third of cases they resolve on their own.About 1% of people in the United States have genital warts. Many people, however, are infected and do not have symptoms. Without vaccination nearly all sexually active people will get some type of HPV at one point in their lives. The disease has been known at least since the time of Hippocrates in 300 BC.
Signs and symptoms
They may be found anywhere in the anal or genital area, and are frequently found on external surfaces of the body, including the penile shaft, scrotum, or labia majora of the vagina. They can also occur on internal surfaces like the opening to the urethra, inside the vagina, on the cervix, or in the anus.They can be as small as 1-5mm in diameter, but can also grow or spread into large masses in the genital or anal area. In some cases they look like small stalks. They may be hard ("keratinized") or soft. Their color can be variable, and sometimes they may bleed.In most cases, there are no symptoms of HPV infection other than the warts themselves. Sometimes warts may cause itching, redness, or discomfort, especially when they occur around the anus. Although they are usually without other physical symptoms, an outbreak of genital warts may cause psychological distress, such as anxiety, in some people.
Causes
Transmission
HPV is most commonly transmitted through penetrative sex. While HPV can also be transmitted via non-penetrative sexual activity, it is less transmissible than via penetrative sex. There is conflicting evidence about the effect of condoms on transmission of low-risk HPV. Some studies have suggested that they are effective at reducing transmission. Other studies suggest that condoms are not effective at preventing transmission of the low-risk HPV variants that cause genital warts. The effect of condoms on HPV transmission may also be sex-dependent; there is some evidence that condoms are more effective at preventing infection of males than of females.The types of HPV that cause warts are highly transmissible. Roughly three out of four unaffected partners of patients with warts develop them within eight months. Other studies of partner concordance suggest that the presence of visible warts may be an indicator of increased infectivity; HPV concordance rates are higher in couples where one partner has visible warts.
Latency and recurrence
Although 90% of HPV infections are cleared by the body within two years of infection, it is possible for infected cells to undergo a latency (quiet) period, with the first occurrence or a recurrence of symptoms happening months or years later. Latent HPV, even with no outward symptoms, is still transmissible to a sexual partner. If an individual has unprotected sex with an infected partner, there is a 70% chance that he or she will also become infected.In individuals with a history of previous HPV infection, the appearance of new warts may be either from a new exposure to HPV, or from a recurrence of the previous infection. As many as one-third of people with warts will experience a recurrence.
Children
Anal or genital warts may be transmitted during birth. The presence of wart-like lesions on the genitals of young children has been suggested as an indicator of sexual abuse. However, genital warts can sometimes result from autoinoculation by warts elsewhere on the body, such as from the hands. It has also been reported from sharing of swimsuits, underwear, or bath towels, and from non-sexual touching during routine care such as diapering. Genital warts in children are less likely to be caused by HPV subtypes 6 and 11 than adults, and more likely to be caused by HPV types that cause warts elsewhere on the body ("cutaneous types"). Surveys of pediatricians who are child abuse specialists suggest that in children younger than 4 years old, there is no consensus on whether the appearance of new anal or genital warts, by itself, can be considered an indicator of sexual abuse.
Diagnosis
The diagnosis of genital warts is most often made visually, but may require confirmation by biopsy in some cases. Smaller warts may occasionally be confused with molluscum contagiosum.
Genital warts, histopathologically, characteristically rise above the skin surface due to enlargement of the dermal papillae, have parakeratosis and the characteristic nuclear changes typical of HPV infections (nuclear enlargement with perinuclear clearing).
DNA tests are available for diagnosis of high-risk HPV infections. Because genital warts are caused by low-risk HPV types, DNA tests cannot be used for diagnosis of genital warts or other low-risk HPV infections.Some practitioners use an acetic acid solution to identify smaller warts ("subclinical lesions"), but this practice is controversial. Because a diagnosis made with acetic acid will not meaningfully affect the course of the disease, and cannot be verified by a more specific test, a 2007 UK guideline advises against its use.
Prevention
Gardasil (sold by Merck & Co.) is a vaccine that protects against human papillomavirus types 6, 11, 16 and 18. Types 6 and 11 cause genital warts, while 16 and 18 cause cervical cancer. The vaccine is preventive, not therapeutic, and must be given before exposure to the virus type to be effective, ideally before the beginning of sexual activity. The vaccine is approved by the US Food and Drug Administration for use in both males and females as early as 9 years of age.In the UK, Gardasil replaced Cervarix in September 2012 for reasons unrelated to safety. Cervarix had been used routinely in young females from its introduction in 2008, but was only effective against the high-risk HPV types 16 and 18, neither of which typically causes warts.
Management
There is no cure for HPV. Existing treatments are focused on the removal of visible warts, but these may also regress on their own without any therapy. There is no evidence to suggest that removing visible warts reduces transmission of the underlying HPV infection. As many as 80% of people with HPV will clear the infection within 18 months.A healthcare practitioner may offer one of several ways to treat warts, depending on their number, sizes, locations, or other factors. All treatments can potentially cause depigmentation, itching, pain, or scarring.Treatments can be classified as either physically ablative, or topical agents. Physically ablative therapies are considered more effective at initial wart removal, but like all therapies have significant recurrence rates.Many therapies, including folk remedies, have been suggested for treating genital warts, some of which have little evidence to suggest they are effective or safe. Those listed here are ones mentioned in national or international practice guidelines as having some basis in evidence for their use.
Physical ablation
Physically ablative methods are more likely to be effective on keratinized warts. They are also most appropriate for patients with fewer numbers of relatively smaller warts.
Simple excision, such as with scissors under local anesthesia, is highly effective.
Liquid nitrogen cryosurgery is usually performed in an office visit, at weekly intervals. It is effective, inexpensive, safe for pregnancy, and does not usually cause scarring.
Electrocauterization (sometimes called "loop electrical excision procedure" or LEEP) is a procedure with a long history of use and is considered effective.
Laser ablation has less evidence to suggest its use. It may be less effective than other ablative methods. It is extremely expensive, and often used as a last resort.
Formal surgical procedures, performed by a specialist under general anesthesia or spinal anesthesia may be necessary for larger or more extensive warts, intra-anal warts, or warts in children. It carries a greater risk of scarring than other methods.
Topical agents
A 0.15–0.5% podophyllotoxin (also called podofilox) solution in a gel or cream. It can be applied by the patient to the affected area and is not washed off. It is the purified and standardized active ingredient of podophyllin (see below). Podofilox is safer and more effective than podophyllin. Skin erosion and pain are more commonly reported than with imiquimod and sinecatechins. Its use is cycled (2 times per day for 3 days then 4–7 days off); one review states that it should only be used for four cycles.
Imiquimod is a topical immune response cream, applied to the affected area. It causes less local irritation than podofilox but may cause fungal infections (11% in package insert) and flu-like symptoms (less than 5% disclosed in package insert).
Sinecatechins is an ointment of catechins (55% epigallocatechin gallate) extracted from green tea and other components. Mode of action is undetermined. It appears to have higher clearance rates than podophyllotoxin and imiquimod and causes less local irritation, but clearance takes longer than with imiquimod.
Trichloroacetic acid (TCA) is less effective than cryosurgery, and is not recommended for use in the vagina, cervix, or urinary meatus.
Interferon can be used; it is effective, but it is also expensive and its effect is inconsistent.DiscontinuedA 5% 5-fluorouracil (5-FU) cream was used, but it is no longer considered an acceptable treatment due to the side-effects.Podophyllin, podofilox and isotretinoin should not be used during pregnancy, as they could cause birth defects in the fetus.
Epidemiology
Genital HPV infections have an estimated prevalence in the US of 10–20% and clinical manifestations in 1% of the sexually active adult population. US incidence of HPV infection has increased between 1975 and 2006. About 80% of those infected are between the ages of 17–33. Although treatments can remove warts, they do not remove the HPV, so warts can recur after treatment (about 50–73% of the time). Warts can also spontaneously regress (with or without treatment).Traditional theories postulated that the virus remained in the body for a lifetime. However, studies using sensitive DNA techniques have shown that through immunological response, the virus can either be cleared or suppressed to levels below what polymerase chain reaction (PCR) tests can measure. One study testing genital skin for subclinical HPV using PCR found a prevalence of 10%.
Etymology
A condyloma acuminatum is a single genital wart, and condylomata acuminata are multiple genital warts. The word roots mean pointed wart (from Greek κόνδυλος knuckle, Greek -ωμα -oma disease, and Latin acuminatum pointed). Although similarly named, it is not the same as condyloma latum, which is a complication of secondary syphilis.
References
External links
Human Papilloma Virus at Curlie |
You act as a bridge between medical jargon and everyday language. Explain medical terms in a manner that is comprehensive yet approachable for non-experts. | Can you break down the meaning of the medical term 'Ornithine transcarbamylase deficiency' for me? | Ornithine transcarbamylase deficiency also known as OTC deficiency is the most common urea cycle disorder in humans. Ornithine transcarbamylase, the defective enzyme in this disorder is the final enzyme in the proximal portion of the urea cycle, responsible for converting carbamoyl phosphate and ornithine into citrulline. OTC deficiency is inherited in an X-linked recessive manner, meaning males are more commonly affected than females.
In severely affected individuals, ammonia concentrations increase rapidly causing ataxia, lethargy and death without rapid intervention. OTC deficiency is diagnosed using a combination of clinical findings and biochemical testing, while confirmation is often done using molecular genetics techniques.
Once an individual has been diagnosed, the treatment goal is to avoid precipitating episodes that can cause an increased ammonia concentration. The most common treatment combines a low protein diet with nitrogen scavenging agents. Liver transplant is considered curative for this disease. Experimental trials of gene therapy using adenoviral vectors resulted in the death of one participant, Jesse Gelsinger, and have been discontinued.
Signs and symptoms
As with several other metabolic conditions, OTC deficiency can have variable presentations, regarding age of onset and the severity of symptoms. This compounded when considering heterozygous females and the possibility of non-random X-inactivation. In the classic and most well-known presentation, a male infant appears well initially, but by the second day of life they are irritable, lethargic and stop feeding. A metabolic encephalopathy develops, and this can progress to coma and death without treatment. Ammonia is only toxic to the brain, other tissues can handle elevated ammonia concentrations without problems.Later onset forms of OTC deficiency can have variable presentations. Although late onset forms of the disease are often considered milder than the classic infantile presentation, any affected individual is at risk for an episode of hyperammonemia that could still be life-threatening, if presented with the appropriate stressors. These patients will often present with headaches, nausea, vomiting, delayed growth and a variety of psychiatric symptoms (confusion, delirium, aggression, or self-injury). A detailed dietary history of an affected individual with undiagnosed OTC deficiency will often reveal a history of protein avoidance.The prognosis of a patient with severe OTC deficiency is well correlated with the length of the hyperammonemic period rather than the degree of hyperammonemia or the presence of other symptoms, such as seizures. Even for patients with late onset forms of the disease, their overall clinical picture is dependent on the extent of hyperammonemia they have experienced, even if it has remained unrecognized.
Genetics
OTC deficiency is caused by mutations in the OTC gene, which is located on the X chromosome. OTC codes for the mitochondrial enzyme ornithine transcarbamylase, which is expressed only in liver. The functional enzyme consists of three identical subunits. OTC is the last enzyme in the proximal portion of the urea cycle, which consists of the reactions that take place in the mitochondria. The substrates of the reaction catalyzed by ornithine transcarbamylase are ornithine and carbamyl phosphate, while the product is citrulline.There are no common mutations that cause disease, however 10 - 15% of disease causing mutations are deletions. It is inherited in an X-linked recessive manner, meaning males are more commonly affected than females. Females who carry a defective copy of the gene can be severely affected or asymptomatic, largely depending on the random nature of X-inactivation. There is some degree of genotype - phenotype correlation with OTC deficiency, but this depends on a number of situations. Individuals with milder mutations, often associated with late onset disease can still present with severe illness when exposed to sufficient metabolic stress. Correlations are more difficult to ascertain in females, since the residual activity of OTC in the liver is impacted not only by the nature of the mutation, but also by the random pattern of X-inactivation. OTC deficiency is estimated to be the most common urea cycle disorder. An exact incidence is difficult to calculate, due to the varying clinical presentations of later onset forms of the disease. Early estimates of the incidence were as high as 1:14,000 live births, however later studies have decreased these estimates to approximately 1:60,000 - 1:72,000.
Diagnosis
In individuals with marked hyperammonemia, a urea cycle disorder is usually high on the list of possible causes. While the immediate focus is lowering the patients ammonia concentrations, identifying the specific cause of increased ammonia levels is key as well.
Diagnostic testing for OTC deficiency, or any individual with hyperammonemia involves plasma and urine amino acid analysis, urine organic acid analysis (to identify the presence or absence of orotic acid, as well as rule out an organic acidemia) and plasma acylcarnitines (will be normal in OTC deficiency, but can identify some other causes of hyperammonemia). An individual with untreated OTC deficiency will show decreased citrulline and arginine concentrations (because the enzyme block is proximal to these intermediates) and increased orotic acid. The increased orotic acid concentrations result from the buildup of carbamoyl phosphate. This biochemical phenotype (increased ammonia, low citrulline and increased orotic acid) is classic for OTC deficiency, but can also be seen in neonatal presentations of ornithine aminotransferase deficiency. Only severely affected males consistently demonstrate this classic biochemical phenotype.
Heterozygous females can be difficult to diagnose. With the rise of sequencing techniques, molecular testing has become preferred, particularly when the disease causing mutations in the family are known. Historically, heterozygous females were often diagnosed using an allopurinol challenge. In a female with reduced enzyme activity, an oral dose of allopurinol would be metabolized to oxypurinol ribonucleotide, which blocks the pyrimidine biosynthetic pathway. When this induced enzymatic block is combined with reduced physiologic enzyme activity as seen in heterozygotes, the elevation of orotic acid could be used to differentiate heterozygotes from unaffected individuals. This test was not universally effective, as it had both false negative and false positive results.Ornithine transcarbamylase is only expressed in the liver, thus performing an enzyme assay to confirm the diagnosis requires a liver biopsy. Before molecular genetic testing was commonly available, this was one of the only methods for confirmation of a suspected diagnosis. In cases where prenatal diagnosis was requested, a fetal liver biopsy used to be required to confirm if a fetus was affected. Modern molecular techniques have eliminated this need, and gene sequencing is now the preferred method of diagnosis in asymptomatic family members after the diagnosis has been confirmed in a proband.
Treatment
The treatment goal for individuals affected with OTC deficiency is the avoidance of hyperammonemia. This can be accomplished through a strictly controlled low-protein diet, as well as preventative treatment with nitrogen scavenging agents such as sodium benzoate. The goal is to minimize the nitrogen intake while allowing waste nitrogen to be excreted by alternate pathways. Arginine is typically supplemented as well, in an effort to improve the overall function of the urea cycle. If a hyperammonemic episode occurs, the aim of treatment is to reduce the individuals ammonia levels as soon as possible. In extreme cases, this can involve hemodialysis.Gene therapy had been considered a possibility for curative treatment for OTC deficiency, and clinical trials were taking place at the University of Pennsylvania in the late 1990s. These were halted after the death of Jesse Gelsinger, a young man taking part in a phase I trial using an adenovirus vector. Currently, the only option for curing OTC deficiency is a liver transplant, which restores normal enzyme activity. A 2005 review of 51 patients with OTC deficiency who underwent liver transplant estimated 5-year survival rates of greater than 90%. Severe cases of OTC deficiency are typically evaluated for liver transplant by 6 months of age.
Prognosis
A 1999 retrospective study of 74 cases of neonatal onset found that 32 (43%) patients died during their first hyperammonemic episode. Of those who survived, less than 20% survived to age 14. Few of these patients received liver transplants.
References
External links
http://www.nucdf.orghttp://www.otcdeficiency.com |
You act as a bridge between medical jargon and everyday language. Explain medical terms in a manner that is comprehensive yet approachable for non-experts. | I'm not familiar with the medical term 'Cheyletiella.' Could you provide some insights? | Cheyletiella is a genus of mites that live on the skin surface of dogs, cats, and rabbits.The adult mites are about 0.385 millimeters long, have eight legs with combs instead of claws, and have palpi that end in prominent hooks. They do not burrow into the skin, but live in the keratin level. Their entire 21-day life cycle is on one host. They cannot survive off the host for more than 10 days.
Cheyletiellosis
Cheyletiellosis (also known as Cheyletiella dermatitis)," is a mild dermatitis caused by mites of the genus Cheyletiella. It is also known as walking dandruff due to skin scales being carried by the mites.
Cheyletiellosis is seen more commonly in areas where fleas are less prevalent, because of the decreased use of flea products that are also efficacious for the treatment of this mite.Cheyletiellosis is highly contagious. Transmission is by direct contact with an affected animal.
Presentation
Symptoms in animals vary from no signs to intense itching, scales on the skin, and hair loss. The lesions are usually on the back of the animal. Symptoms in humans include multiple red, itchy bumps on the arms, trunk, and buttocks. Because humans are not a host for the mite, the symptoms usually go away in about three weeks. Though the medical community does not consider a human mite infestation a legitimate diagnosis, it will treat the symptoms if necessary.
Diagnosis
Diagnosis is by finding the mites or eggs microscopically in a skin scraping, combing, or on acetate tape applied to the skin.
Treatment
The most common treatment in animals is weekly use of some form of topical pesticide appropriate for the affected animal, often an antiflea product. Fipronil works well, especially in cats. Cats can also be treated with a lime sulfur insecticide dip or a shampoo with non-pyrethrin insecticide for two weeks beyond the conclusion of symptoms.In unresponsive cases, ivermectin is used. Selamectin is also recommended for treatment. None of these products are approved for treatment of cheyletiellosis. Other pets in the same household should also be treated, and the house or kennel must be treated with an environmental flea spray.
Species
Cheyletiella blakei Smiley, 1970 — infests cats (Felis catus), USA (Washington DC)
Cheyletiella parasitivorax — infests rabbits (Oryctolagus cuniculus), France
Cheyletiella romerolagi (Fain, 1972) — infests Romerolagus diazi, USA (New York)
Cheyletiella strandtmanni Smiley, 1970 — infests hares (Lepus spp.), Taiwan
Cheyletiella yasguri Smiley, 1965 — infests dogsC. yasguri and C. blakei can transiently affect humans.
See also
List of mites associated with cutaneous reactions
Mange
== References == |
You act as a mediator between medical professionals and the public. Provide comprehensive explanations of medical terms, ensuring they are both precise and easily understood. | Could you offer a clear explanation of the term 'Granular cell tumor' as used in the medical field? | Granular cell tumor is a tumor that can develop on any skin or mucosal surface, but occurs on the tongue 40% of the time.
It is also known as Abrikossoffs tumor, Granular cell myoblastoma, Granular cell nerve sheath tumor, and Granular cell schwannoma.)Granular cell tumors (GCTs) affect females more often than males.
Pathology
Granular cell tumors are derived from neural tissue, as can be demonstrated by immunohistochemistry and ultrastructural evidence using electron microscopy. These lesions characteristically consist of polygonal cells with bland nuclei, abundant cytoplasm and fine eosinophilic cytoplasmic granules. The tumor cells stain positively for S-100 as they are of Schwann cell origin. Both malignant and benign versions of the tumor exist, where malignant tumors are characterized histologically by features such as spindling, high nuclear to cytoplasmic ratios, pleomorphism, and necrosis. Multiple granular cell tumors may seen in the context of LEOPARD syndrome, due to a mutation in the PTPN11 gene.These tumors, on occasion, may appear similar to neoplasms of renal (relating to the kidneys) origin or other soft tissue neoplasms.
Treatment
The primary method for treatment is surgical, not medical. Radiation and chemotherapy are not needed for benign lesions and are not effective for malignant lesions.
Benign granular cell tumors have a recurrence rate of 2% to 8% when resection margins are deemed clear of tumor infiltration. When the resection margins of a benign granular cell tumor are positive for tumor infiltration the recurrence rate is increased to 20%. Malignant lesions are aggressive and difficult to eradicate with surgery and have a recurrence rate of 32%.
Epidemiology
Granular cell tumors can affect all parts of the body; however, the head and neck areas are affected 45% to 65% of the time. Of the head and neck cases 70% of lesions are located intraorally (tongue, oral mucosa, hard palate). The next most common location that lesions are found in the head and neck area is the larynx (10%). Granular cell tumors are also found in the internal organs, particularly in the upper aerodigestive tract. Vaginal granular cell tumors are generally rare.Breast granular cell tumors arise from intralobular breast stroma and occurs within the distribution of the cutaneous branches of the supraclavicular nerve. As they do follow the innervation of the skin, they may demonstrate skin changes like contraction or shrinkage. Unlike traditional breast cancers, glandular cell tumors are mostly found in the upper inner quadrant of the breast. They can erroneously diagnosed as an invasive ductal carcinoma via ultrasound and mammography, therefore, it is necessary to consider a diagnosis of invasive ductal carcinoma.
The usual presentation is of a slow growing behavior, forming a polygonal accumulation of secondary lysosomes in the cytoplasm. Granular cell tumors are typically solitary and rarely larger than three centimeters. However, proliferative growth and development of an ulcer indicates likely malignancy as this type of tumor can be either benign or malignant. Malignancy is rare and constitutes only 2% of all granular cell tumors.
See also
List of cutaneous conditions
Glassy cell carcinoma
References
== External links == |
You serve as an encyclopedia of medical terms. Deliver clear, detailed explanations, making medical language understandable to a diverse audience. | I've come across the term 'Borderline intellectual functioning' in a medical context, but I'm not sure what it means. Can you clarify? | Borderline intellectual functioning, also called borderline mental retardation (in the ICD-8), is a categorization of intelligence wherein a person has below average cognitive ability (generally an IQ of 70–85), but the deficit is not as severe as intellectual disability (below 70). It is sometimes called below average IQ (BAIQ). This is technically a cognitive impairment; however, this group may not be sufficiently mentally disabled to be eligible for specialized services.
Codes
The DSM-IV-TR code of borderline intellectual functioning is V62.89. DSM-5 diagnosis codes are V62.89 and R41.83.
Learning skills
During school years, individuals with borderline intellectual functioning are often "slow learners". Although a large percentage of this group fails to complete high school and can often achieve only a low socioeconomic status, most adults in this group blend in with the rest of the population.
Differential diagnosis
According to the DSM-5, differentiating borderline intellectual functioning and mild intellectual disability requires careful assessment of adaptive and intellectual functions and their variations, especially in the presence of co-morbid psychiatric disorders that may affect patient compliance with standardized test (for example, attention deficit hyperactivity disorder (ADHD) with severe impulsivity or schizophrenia).
See also
IQ classification
Special education
References
Further reading
Gillberg, Christopher (1995). Clinical child neuropsychiatry. Cambridge: Cambridge University Press. pp. 47–48. ISBN 0-521-54335-5.
Harris, James C. (2006). Intellectual disability : understanding its development, causes, classification, evaluation, and treatment. New York: Oxford University Press. ISBN 0-19-517885-8. |
You are a medical knowledge base. Your task is to elucidate medical terminology, offering insights into their meanings, origins, and applications. | I'm trying to understand 'Asfotase alfa' within a medical context. Could you shed some light on it? | Asfotase alfa, sold under the brand name Strensiq, is a medication used in the treatment of people with perinatal/infantile- and juvenile-onset hypophosphatasia.The most common side effects include injection site reactions, hypersensitivity reactions (such as difficulty breathing, nausea, dizziness and fever), lipodystrophy (a loss of fat tissue resulting in an indentation in the skin or a thickening of fat tissue resulting in a lump under the skin) at the injection site, and ectopic calcifications of the eyes and kidney.The enzyme tissue non-specific alkaline phosphatase (ALP) plays a key role in creating and maintaining healthy bones, and managing calcium and phosphate in the body. People with hypophosphatasia cannot make enough working ALP, which leads to weak bones. Asfotase alfa is a version of the human ALP enzyme and serves as a replacement, thereby increasing levels of working ALP.
Medical uses
In the United States, asfotase alfa is indicated for the treatment of people with perinatal/infantile- and juvenile-onset hypophosphatasia (HPP).In the European Union, asfotase alfa is indicated for long-term enzyme replacement therapy in people with paediatric-onset hypophosphatasia to treat the bone manifestations of the disease.
Adverse effects
The most common adverse effects in studies included injection site reactions (pain, itching, erythema, etc.), headache, limb pain, and haematoma. Possible rare side effects could not be assessed because of the low number of patients.
Interactions
Asfotase alfa interferes with alkaline phosphatase measurements. As asfotase alfa is a glycoprotein (as opposed to a small molecule), no relevant interactions via the cytochrome P450 liver enzymes are expected.
Pharmacology
Mechanism of action
Hypophosphatasia is caused by a genetic defect of tissue-nonspecific alkaline phosphatase (TNSALP), an enzyme that plays a role in bone mineralization. Asfotase alfa is a recombinant glycoprotein that contains the catalytic domain (the active site) of TNSALP. It is thus a form of enzyme replacement therapy.
Pharmacokinetics
After subcutaneous injection, asfotase alfa has a bioavailability of 46–98% and reaches highest blood plasma concentrations after 24 to 48 hours. Elimination half life is five days.
Chemistry
The peptide part of the glycoprotein asfotase alfa consists of two identical chains of 726 amino acids each, containing (1) the catalytic domain of TNSALP, (2) the Fc region of human immunoglobulin G1, and (3) a sequence of ten L-aspartate residues at the carboxy terminus. The two chains are linked by two disulfide bridges. Each chain also contains four internal disulfide bridges.The complete peptide sequence of one chain is
LVPEKEKDPK YWRDQAQETL KYALELQKLN TNVAKNVIMF LGDGMGVSTV TAARILKGQL
HHNPGEETRL EMDKFPFVAL SKTYNTNAQV PDSAGTATAY LCGVKANEGT VGVSAATERS
RCNTTQGNEV TSILRWAKDA GKSVGIVTTT RVNHATPSAA YAHSADRDWY SDNEMPPEAL
SQGCKDIAYQ LMHNIRDIDV IMGGGRKYMY PKNKTDVEYE SDEKARGTRL DGLDLVDTWK
SFKPRYKHSH FIWNRTELLT LDPHNVDYLL GLFEPGDMQY ELNRNNVTDP SLSEMVVVAI
QILRKNPKGF FLLVEGGRID HGHHEGKAKQ ALHEAVEMDR AIGQAGSLTS SEDTLTVVTA
DHSHVFTFGG YTPRGNSIFG LAPMLSDTDK KPFTAILYGN GPGYKVVGGE RENVSMVDYA
HNNYQAQSAV PLRHETHGGE DVAVFSKGPM AHLLHGVHEQ NYVPHVMAYA ACIGANLGHC
APASSLKDKT HTCPPCPAPE LLGGPSVFLF PPKPKDTLMI SRTPEVTCVV VDVSHEDPEV
KFNWYVDGVE VHNAKTKPRE EQYNSTYRVV SVLTVLHQDW LNGKEYKCKV SNKALPAPIE
KTISKAKGQP REPQVYTLPP SREEMTKNQV SLTCLVKGFY PSDIAVEWES NGQPENNYKT
TPPVLDSDGS FFLYSKLTVD KSRWQQGNVF SCSVMHEALH NHYTQKSLSL SPGKDIDDDD
DDDDDD
Asfotase alfa is produced in Chinese hamster ovary cells.
History
Asfotase alfa was granted orphan drug designation by the U.S. Food and Drug Administration (FDA) in September 2008.Asfotase alfa is manufactured by Alexion Pharmaceuticals and it was granted breakthrough therapy designation by the U.S. FDA in 2015 as it is the first and only treatment for perinatal, infantile and juvenile-onset HPP. It was approved in October 2015, in the U.S. and in August 2015, in the EU.The safety and efficacy of asfotase alfa were established in 99 participants with perinatal (disease occurs in utero and is evident at birth), infantile- or juvenile-onset HPP who received treatment for up to 6.5 years during four prospective, open-label studies. Study results showed that participants with perinatal- and infantile-onset HPP treated with asfotase alfa had improved overall survival and survival without the need for a ventilator (ventilator-free survival). Ninety-seven percent of treated participants were alive at one year of age compared to 42 percent of control participants selected from a natural history study group. Similarly, the ventilator-free survival rate at one year of age was 85 percent for treated participants compared to less than 50 percent for the natural history control participants.Participants with juvenile-onset HPP treated with asfotase alfa showed improvements in growth and bone health compared to control participants selected from a natural history database. All treated participants had improvement in low weight or short stature or maintained normal height and weight. In comparison, approximately 20 percent of control participants had growth delays over time, with shifts in height or weight from the normal range for children their age to heights and weights well below normal for age. Juvenile-onset participants also showed improvements in bone mineralization, as measured on a scale that evaluates the severity of rickets and other HPP-related skeletal abnormalities based on x-ray images. All treated participants demonstrated substantial healing of rickets on x-rays while some natural history control participants showed increasing signs of rickets over time.
References
External links
"Asfotase alfa". Drug Information Portal. U.S. National Library of Medicine. |
You function as a medical dictionary. Offer comprehensive and accurate descriptions of medical terms, ensuring clarity and depth in your explanations. | Please help me grasp the concept behind the medical term 'Normocytic anemia.' | Normocytic anemia is a type of anemia and is a common issue that occurs for men and women typically over 85 years old. Its prevalence increases with age, reaching 44 percent in men older than 85 years. The most common type of normocytic anemia is anemia of chronic disease.
Classification
A normocytic anemia is when the red blood cells (RBCs) are of normal size. Normocytic anemia is defined when the mean corpuscular volume (MCV) is between 80 and 100 femtolitres (fL), which is within the normal and expected range. However, the hematocrit and hemoglobin are decreased. In contrast, microcytic anemias are defined as an anemia with a mean corpuscular volume (MCV) less than 80 fL and macrocytic anemias have a mean corpuscular volume over 100 fL.
Diagnosis
To aid with determining the underlying cause of the normocytic anemia, a lab test is done on reticulocyte count. A reticulocyte count that is high, normal or low will aid with the classification process. A high reticulocyte count signifies that bone marrow processes are normal. A low reticulocyte count would signify there is a problem at the level of the bone marrow, which produce the stem cells. Acute blood loss would result in a high reticulocyte count, as bone marrow processes are normal and the bone marrow responds accordingly to the bodys need for blood.
Causes
The issue is thought of as representing any of the following:
An acute loss of blood of a substantial volume;
a decreased production of normal-sized red blood cells (e.g., anemia of chronic disease, aplastic anemia);
an increased production of HbS as seen in sickle cell disease (not sickle cell trait);
an increased destruction or loss of red blood cells (e.g., hemolysis, posthemorrhagic anemia, hypersplenism);
an uncompensated increase in plasma volume (e.g., pregnancy, fluid overload);
a B2 (riboflavin) deficiency
a B6 (pyridoxine) deficiency
or a mixture of conditions producing microcytic and macrocytic anemia.Blood loss, suppressed production of RBCs or hemolysis represent most cases of normocytic anemia. In blood loss, morphologic findings are generally unremarkable, except after 12 to 24 hrs where polychromasia appears. For reduced production of RBCs, like with low erythropoietin, the RBC morphology is unremarkable. Patients with disordered RBC production, e.g. myelodysplastic syndrome, may have a dual population of elliptocytes, teardrop cells, or other poikilocytes as well as a nucleated RBCs. Hemolysis will often demonstrate poikilocytes specific to a cause or mechanism, e.g. bite cells and/or blister cells for oxidative hemolysis, acanthocytes for pyruvate kinase deficiency or McLeod phenotype, sickle cells for sickle cell anemia, spherocytes for immune-mediated hemolysis or hereditary spherocytosis, elliptocytosis for iron deficiency or hereditary elliptocytosis and schistocytes for intravascular hemolysis. Many hemolytic anemias show multiple poikilocytes such as G6PD deficiency, which may show blister and bites cells as well as shistocytes. Neonatal hemolysis may not follow the classic patterns as in adults.
Treatment
Treatment will depend on the cause of the normocytic anemia. Treatment for anemia due to chronic diseases, such as kidney disease, focus on healing the primary condition first. Dietary foods or supplements should be added if anemia is due to a lack of a particular vitamin. Erythropoietin may be considered if anemia is severe. Erythropoietin will stimulate the bone marrow to make more blood cells.
References
External links
Entry on aafp.org |
You are a medical advisor. Your role is to break down medical terminology into clear, detailed explanations for a general audience. | I'd like to learn more about the medical term 'Subacute sclerosing panencephalitis.' Can you provide some details? | Subacute sclerosing panencephalitis (SSPE)—also known as Dawson disease—is a rare form of chronic, progressive brain inflammation caused by slow infection with certain defective strains of hypermutated measles virus. The condition primarily affects children, teens, and young adults. It has been estimated that about 2 in 10,000 people who get measles will eventually develop SSPE. However, a 2016 study estimated that the rate for unvaccinated infants under 15 months was as high as 1 in 609. No cure for SSPE exists, and the condition is almost always fatal. SSPE should not be confused with acute disseminated encephalomyelitis, which can also be caused by the measles virus, but has a very different timing and course.SSPE is caused by the wild-type virus, not by vaccine strains.
Signs and symptoms
SSPE is characterized by a history of primary measles infection, followed by an asymptomatic period that lasts 7 years on average but can range from 1 month to 27 years. After the asymptomatic period, progressive neurological deterioration occurs, characterized by behavior change, intellectual problems, myoclonic seizures, blindness, ataxia, and eventually death.
Progression
Symptoms progress through the following 4 stages:
Stage 1: There may be personality changes, mood swings, or depression. Fever, headache, and memory loss may also be present. This stage may last up to 6 months.
Stage 2: This stage may involve jerking, muscle spasms, seizures, loss of vision, and dementia.
Stage 3: Jerking movements are replaced by writhing (twisting) movements and rigidity. At this stage, complications may result in blindness or death.
Stage 4: Progressive loss of consciousness into a persistent vegetative state, which may be preceded by or concomitant with paralysis, occurs in the final stage, during which breathing, heart rate, and blood pressure are affected. Death usually occurs as a result of fever, heart failure, or the brain’s inability to control the autonomic nervous system.
Pathogenesis
A large number of nucleocapsids are produced in the neurons and the glial cells. In these cells the viral genes that encode envelope proteins have restricted expression. As a result, infectious particles like the M protein are not produced, and the virus is able to survive persistently without evoking an immune response. Eventually the infection will lead to SSPE.
Diagnosis
According to the Merck Manual: "SSPE is suspected in young patients with dementia and neuromuscular irritability. EEG, CT or MRI, CSF examination, and measles serologic testing are done. EEG shows periodic complexes with high-voltage diphasic waves occurring synchronously throughout the recording. CT or MRI may show cortical atrophy or white matter lesions. CSF examination usually reveals normal pressure, cell count, and total protein content; however, CSF globulin is almost always elevated, constituting up to 20 to 60% of CSF protein. Serum and CSF contain elevated levels of measles virus antibodies. Anti-measles IgG appears to increase as the disease progresses.
If test results are inconclusive, brain biopsy may be needed."
Treatment
If the diagnosis is made during stage 1 it may be possible to treat the disease with oral isoprinosine (Inosiplex) and intraventricular interferon alfa, but the response to these drugs varies from patient to patient, and the only accepted treatments are supportive measures such as anticonvulsants. Following onset of stage 2, the disease is invariably fatal.
Prognosis
In the classic presentation of the disease death occurs in 1 to 3 years, but faster and slower progressions can occur. Faster deterioration in cases of acute fulminant SSPE leads to death within 3 months of diagnosis. Although the prognosis is bleak for SSPE past stage 1, there is a 5% spontaneous remission rate—this may be either a full remission that may last many years or an improvement in condition giving a longer progression period or at least a longer period with the less severe symptoms.
Epidemiology
SSPE is a rare condition, although there is still relatively high incidence in Asia and the Middle East. However, the number of reported cases is declining since the introduction of the measles vaccine—eradication of the measles virus prevents the SSPE mutation and therefore the progression of the disease or even the initial infection itself.
References
Further reading
Bonthius D, Stanek N, Grose C (2000). "Subacute sclerosing panencephalitis, a measles complication, in an internationally adopted child". Emerg Infect Dis. 6 (4): 377–81. doi:10.3201/eid0604.000409. PMC 2640885. PMID 10905971.
External links
23-273l. at Merck Manual of Diagnosis and Therapy Home Edition
subacute_panencephalitis at NINDS
PubMed Health: Subacute sclerosing panencephalitis Archived 2014-08-08 at the Wayback Machine
synd/1889 at Who Named It? |
You serve as a guide in the medical field. Explain medical terms thoroughly, ensuring the information is both insightful and comprehensible. | Please help me grasp the concept behind the medical term 'Allergic transfusion reaction.' | An allergic transfusion reaction is when a blood transfusion results in allergic reaction. It is among the most common transfusion reactions to occur. Reported rates depend on the degree of active surveillance versus passing reporting to the blood bank. Overall, they are estimated to complicate up to 3% of all transfusions. The incidence of allergic transfusion reactions is associated with the amount of plasma in the product. More than 90% of these reactions occur during transfusion.
Signs and symptoms
Cause
Allergic reactions from blood transfusion may occur from the presence of allergy-causing antigens within the donors blood, or transfusion of antibodies from a donor who has allergies, followed by antigen exposure.An allergic transfusion reaction is a type of transfusion reaction that is defined according to the Center for Disease Control (CDC) as:
Diagnosis
An allergic transfusion reaction is diagnosed if two or more of the following occur within 4 hours of cessation of transfusion:
A probable diagnosis results if any one of the following occurring within 4 hours of cessation of transfusion:
The UK hemovigilance reporting system (SHOT), has classified allergic reactions in to mild, moderate and severe. Reactions can occur that have features of both allergic and febrile reactions.
Mild
A rash, urticaria, or flushing
Moderate
Wheeze (bronchospasm) or angioedema but blood pressure normal and no respiratory compromise. There may or may not be an associated rash or urticaria.
Severe
This can be due to:
Severe breathing problems (Bronchospasm, stridor), angioedema, or circulatory problems (e.g. hypotension) which require immediate medical treatment OR admission to hospital OR lengthens the duration of hospital admission.
Anaphylaxis
Prevention
To prevent allergic transfusion reaction it is possible to use patients own blood for transfusion, this is referred to as autologous blood transfusion. Patients own blood is collected and washed to produce concentrated red blood cells (this blood product is also called packed red blood cells). There are multiple ways to wash red blood cells. The two main methods that are used to wash the cells are centrifugation, or filtration methods like the Hemoclear microfilter. The last option is reinfusion without washing. This is the least preferred method because of the chance of complications.There is no evidence that antihistamine premedication prevents allergic transfusion reactions, although these drugs can mitigate symptoms once they occur.
Treatment
Treatment of an allergic transfusion reaction is to immediately stop the transfusion. If the only symptoms are mild (i.e., hives and itching), the patient may be treated with an antihistamine and if the symptoms completely disappear and the patient feels well, the transfusion may be restarted. A mild transfusion reaction during infusion usually does not progress to a more severe anaphylactic reaction after infusion of additional product from the same unit. If the symptoms are more than mild, the transfusion should not be restarted.
== References == |
You are an expert in medical terminology. Explain medical terms in a way that is both precise and easy to understand for non-medical audiences. | Can you demystify the medical term 'Cabergoline' for me? | Cabergoline, sold under the brand name Dostinex among others, is a dopaminergic medication used in the treatment of high prolactin levels, prolactinomas, Parkinsons disease, and for other indications. It is taken by mouth.
Cabergoline is an ergot derivative and a potent dopamine D2 receptor agonist.Cabergoline was patented in 1980 and approved for medical use in 1993.
Medical uses
Lactation suppression
Hyperprolactinemia
Adjunctive therapy of prolactin-producing pituitary gland tumors (prolactinomas);
Monotherapy of Parkinsons disease in the early phase;
Combination therapy, together with levodopa and a decarboxylase inhibitor such as carbidopa, in progressive-phase Parkinsons disease;
In some countries also: ablactation and dysfunctions associated with hyperprolactinemia (amenorrhea, oligomenorrhea, anovulation, nonpuerperal mastitis and galactorrhea);
Treatment of uterine fibroids.
Adjunctive therapy of acromegaly, cabergoline has low efficacy in suppressing growth hormone levels and is highly efficient in suppressing hyperprolactinemia that is present in 20-30% of acromegaly cases; growth hormone and prolactin are similar structurally and have similar effects in many target tissues, therefore targeting prolactin may help symptoms when growth hormone secretion can not be sufficiently controlled by other methods;Cabergoline is frequently used as a first-line agent in the management of prolactinomas due to its higher affinity for D2 receptor sites, less severe side effects, and more convenient dosing schedule than the older bromocriptine, though in pregnancy bromocriptine is often still chosen since there is less data on safety in pregnancy for cabergoline.
Off-label
It has at times been used as an adjunct to SSRI antidepressants as there is some evidence that it counteracts certain side effects of those drugs, such as reduced libido and anorgasmia. It also has been suggested that it has a possible recreational use in reducing or eliminating the male refractory period, thereby allowing men to experience multiple ejaculatory orgasms in rapid succession, and at least two scientific studies support those speculations.: e28–e33 Additionally, a systematic review and meta-analysis concluded that prophylactic treatment with cabergoline reduces the incidence, but not the severity, of ovarian hyperstimulation syndrome (OHSS), without compromising pregnancy outcomes, in females undergoing stimulated cycles of in vitro fertilization (IVF). Also, a study on rats found that cabergoline reduces voluntary alcohol consumption, possibly by increasing GDNF expression in the ventral tegmental area. It may be used in the treatment of restless legs syndrome.
Pregnancy and lactation
Relatively little is known about the effects of this medication during pregnancy and lactation. In some cases the related bromocriptine may be an alternative when pregnancy is expected.
Pregnancy: available preliminary data indicates a somewhat increased rate of congenital abnormalities in patients who became pregnant while treated with cabergoline.. However, one study concluded that "foetal exposure to cabergoline through early pregnancy does not induce any increase in the risk of miscarriage or foetal malformation."
Lactation: In rats cabergoline was found in the maternal milk. Since it is not known if this effect also occurs in humans, breastfeeding is usually not recommended if/when treatment with cabergoline is necessary.
Lactation suppression: In some countries cabergoline (Dostinex) is sometimes used as a lactation suppressant. It is also used in veterinary medicine to treat false pregnancy in dogs.
Contraindications
Hypersensitivity to ergot derivatives
Pediatric patients (no clinical experience)
Severely impaired liver function or cholestasis
Concomitant use with drugs metabolized mainly by CYP450 enzymes such as erythromycin and ketoconazole, because increased plasma levels of cabergoline may result (although cabergoline undergoes minimal CYP450 metabolism).
Cautions: severe cardiovascular disease, Raynauds disease, gastroduodenal ulcers, active gastrointestinal bleeding, hypotension.
Side effects
Side effects are mostly dose dependent. Much more severe side effects are reported for treatment of Parkinsons disease and (off-label treatment) for restless leg syndrome which both typically require very high doses. The side effects are considered mild when used for treatment of hyperprolactinemia and other endocrine disorders or gynecologic indications where the typical dose is one hundredth to one tenth that for Parkinsons disease.Cabergoline requires slow dose titration (2–4 weeks for hyperprolactinemia, often much longer for other conditions) to minimise side effects. The extremely long bioavailability of the medication may complicate dosing regimens during titration and require particular precautions.
Cabergoline is considered the best tolerable option for hyperprolactinemia treatment although the newer and less tested quinagolide may offer similarly favourable side effect profile with quicker titration times.
Approximately 200 patients with newly diagnosed Parkinsons disease participated in a clinical study of cabergoline monotherapy. Seventy-six (76) percent reported at least one side effect. These side effects were chiefly mild or moderate:
GI tract: Side effects were extremely frequent. Fifty-three percent of patients reported side effects. Very frequent: Nausea (30%), constipation (22%), and dry mouth (10%). Frequent: Gastric irritation (7%), vomiting (5%), and dyspepsia (2%).
Psychiatric disturbances and central nervous system (CNS): Altogether 51 percent of patients were affected. Very frequent: Sleep disturbances (somnolence 18%, insomnia 11%), vertigo (27%), and depression (13%). Frequent: dyskinesia (4%) and hallucinations (4%).
Cardiovascular: Approximately 30 percent of patients experienced side effects. Most frequent were hypotension (10%), peripheral edema (14%) and non-specific edema (2%). Arrhythmias were encountered in 4.8%, palpitations in 4.3%, and angina pectoris in 1.4%.In a combination study with 2,000 patients also treated with levodopa, the incidence and severity of side effects was comparable to monotherapy. Encountered side effects required a termination of cabergoline treatment in 15% of patients. Additional side effects were infrequent cases of hematological side effects, and an occasional increase in liver enzymes or serum creatinine without signs or symptoms.
As with other ergot derivatives, pleuritis, exudative pleura disease, pleura fibrosis, lung fibrosis, and pericarditis are seen. These side effects are noted in less than 2% of patients. They require immediate termination of treatment. Clinical improvement and normalization of X-ray findings are normally seen soon after cabergoline withdrawal. It appears that the dose typically used for treatment of hyperprolactinemia is too low to cause this type of side effects.
Valvular heart disease
In two studies published in the New England Journal of Medicine on January 4, 2007, cabergoline was implicated along with pergolide in causing valvular heart disease. As a result of this, the FDA removed pergolide from the U.S. market on March 29, 2007. Since cabergoline is not approved in the U.S. for Parkinsons Disease, but for hyperprolactinemia, the drug remains on the market. The lower doses required for treatment of hyperprolactinemia have been found to be not associated with clinically significant valvular heart disease or cardiac valve regurgitation.
Interactions
No interactions were noted with levodopa or selegiline. The drug should not be combined with other ergot derivatives. Dopamine antagonists such as antipsychotics and metoclopramide counteract some effects of cabergoline. The use of antihypertensive drugs should be intensively monitored because excessive hypotension may result from the combination.
Pharmacology
Pharmacodynamics
Cabergoline is a long-acting dopamine D2 receptor agonist. In-vitro rat studies show a direct inhibitory effect of cabergoline on the prolactin secretion in the lactotroph cells of the pituitary gland and cabergoline decreases serum prolactin levels in reserpinized rats. Although cabergoline is commonly described principally as a D2 receptor agonist, it also possesses significant affinity for the dopamine D3, and D4, serotonin 5-HT1A, 5-HT2A, 5-HT2B, and 5-HT2C, and α2-adrenergic receptors, as well as moderate/low affinity for the dopamine D1, serotonin 5-HT7, and α1-adrenergic receptors. Cabergoline functions as an partial or full agonist at all of these receptors except for the 5-HT7, α1-adrenergic, and α2-adrenergic receptors, where it acts as an antagonist. Cabergoline has been associated with cardiac valvulopathy due to activation of 5-HT2B receptors.
Pharmacokinetics
Following a single oral dose, resorption of cabergoline from the gastrointestinal (GI) tract is highly variable, typically occurring within 0.5 to 4 hours. Ingestion with food does not alter its absorption rate. Human bioavailability has not been determined since the drug is intended for oral use only. In mice and rats the absolute bioavailability has been determined to be 30 and 63 percent, respectively. Cabergoline is rapidly and extensively metabolized in the liver and excreted in bile and to a lesser extent in urine. All metabolites are less active than the parental drug or inactive altogether. The human elimination half-life is estimated to be 63 to 68 hours in patients with Parkinsons disease and 79 to 115 hours in patients with pituitary tumors. Average elimination half-life is 80 hours.
The therapeutic effect in treatment of hyperprolactinemia will typically persist for at least 4 weeks after cessation of treatment.
History
Cabergoline was first synthesized by scientists working for the Italian drug company Farmitalia-Carlo Erba in Milan who were experimenting with semisynthetic derivatives of the ergot alkaloids, and a patent application was filed in 1980. The first publication was a scientific abstract at the Society for Neuroscience meeting in 1991.Farmitalia-Carlo Erba was acquired by Pharmacia in 1993, which in turn was acquired by Pfizer in 2003.Cabergoline was first marketed in The Netherlands as Dostinex in 1992. The drug was approved by the FDA on December 23, 1996. It went generic in late 2005 following US patent expiration.
Society and culture
Brand names
Brand names of cabergoline include Cabaser, Dostinex, Galastop (veterinary), and Kelactin (veterinary), among others.
Research
Cabergoline was studied in one person with Cushings disease, to lower adrenocorticotropic hormone (ACTH) levels and cause regression of ACTH-producing pituitary adenomas.
References
External links
Cabergoline, Mayo Clinic |
You act as a medical communicator. Your goal is to translate medical terms into comprehensive, yet straightforward language for all readers. | The term 'Amphetamine' keeps coming up in medical discussions. What does it stand for? | Amphetamine (contracted from alpha-methylphenethylamine) is a strong central nervous system (CNS) stimulant that is used in the treatment of attention deficit hyperactivity disorder (ADHD), narcolepsy, and obesity. Amphetamine was discovered in 1887 and exists as two enantiomers: levoamphetamine and dextroamphetamine. Amphetamine properly refers to a specific chemical, the racemic free base, which is equal parts of the two enantiomers in their pure amine forms. The term is frequently used informally to refer to any combination of the enantiomers, or to either of them alone. Historically, it has been used to treat nasal congestion and depression. Amphetamine is also used as an athletic performance enhancer and cognitive enhancer, and recreationally as an aphrodisiac and euphoriant. It is a prescription drug in many countries, and unauthorized possession and distribution of amphetamine are often tightly controlled due to the significant health risks associated with recreational use.The first amphetamine pharmaceutical was Benzedrine, a brand which was used to treat a variety of conditions. Currently, pharmaceutical amphetamine is prescribed as racemic amphetamine, Adderall, dextroamphetamine, or the inactive prodrug lisdexamfetamine. Amphetamine increases monoamine and excitatory neurotransmission in the brain, with its most pronounced effects targeting the norepinephrine and dopamine neurotransmitter systems.At therapeutic doses, amphetamine causes emotional and cognitive effects such as euphoria, change in desire for sex, increased wakefulness, and improved cognitive control. It induces physical effects such as improved reaction time, fatigue resistance, and increased muscle strength. Larger doses of amphetamine may impair cognitive function and induce rapid muscle breakdown. Addiction is a serious risk with heavy recreational amphetamine use, but is unlikely to occur from long-term medical use at therapeutic doses. Very high doses can result in psychosis (e.g., delusions and paranoia) which rarely occurs at therapeutic doses even during long-term use. Recreational doses are generally much larger than prescribed therapeutic doses and carry a far greater risk of serious side effects.Amphetamine belongs to the phenethylamine class. It is also the parent compound of its own structural class, the substituted amphetamines, which includes prominent substances such as bupropion, cathinone, MDMA, and methamphetamine. As a member of the phenethylamine class, amphetamine is also chemically related to the naturally occurring trace amine neuromodulators, specifically phenethylamine and N-methylphenethylamine, both of which are produced within the human body. Phenethylamine is the parent compound of amphetamine, while N-methylphenethylamine is a positional isomer of amphetamine that differs only in the placement of the methyl group.
Uses
Medical
Amphetamine is used to treat attention deficit hyperactivity disorder (ADHD), narcolepsy (a sleep disorder), and obesity, and is sometimes prescribed off-label for its past medical indications, particularly for depression and chronic pain.
Long-term amphetamine exposure at sufficiently high doses in some animal species is known to produce abnormal dopamine system development or nerve damage, but in humans with ADHD, pharmaceutical amphetamines at therapeutic dosages appear to improve brain development and nerve growth. Reviews of magnetic resonance imaging (MRI) studies suggest that long-term treatment with amphetamine decreases abnormalities in brain structure and function found in subjects with ADHD, and improves function in several parts of the brain, such as the right caudate nucleus of the basal ganglia.Reviews of clinical stimulant research have established the safety and effectiveness of long-term continuous amphetamine use for the treatment of ADHD. Randomized controlled trials of continuous stimulant therapy for the treatment of ADHD spanning 2 years have demonstrated treatment effectiveness and safety. Two reviews have indicated that long-term continuous stimulant therapy for ADHD is effective for reducing the core symptoms of ADHD (i.e., hyperactivity, inattention, and impulsivity), enhancing quality of life and academic achievement, and producing improvements in a large number of functional outcomes across 9 categories of outcomes related to academics, antisocial behavior, driving, non-medicinal drug use, obesity, occupation, self-esteem, service use (i.e., academic, occupational, health, financial, and legal services), and social function. One review highlighted a nine-month randomized controlled trial of amphetamine treatment for ADHD in children that found an average increase of 4.5 IQ points, continued increases in attention, and continued decreases in disruptive behaviors and hyperactivity. Another review indicated that, based upon the longest follow-up studies conducted to date, lifetime stimulant therapy that begins during childhood is continuously effective for controlling ADHD symptoms and reduces the risk of developing a substance use disorder as an adult.Current models of ADHD suggest that it is associated with functional impairments in some of the brains neurotransmitter systems; these functional impairments involve impaired dopamine neurotransmission in the mesocorticolimbic projection and norepinephrine neurotransmission in the noradrenergic projections from the locus coeruleus to the prefrontal cortex. Psychostimulants like methylphenidate and amphetamine are effective in treating ADHD because they increase neurotransmitter activity in these systems. Approximately 80% of those who use these stimulants see improvements in ADHD symptoms. Children with ADHD who use stimulant medications generally have better relationships with peers and family members, perform better in school, are less distractible and impulsive, and have longer attention spans. The Cochrane reviews on the treatment of ADHD in children, adolescents, and adults with pharmaceutical amphetamines stated that short-term studies have demonstrated that these drugs decrease the severity of symptoms, but they have higher discontinuation rates than non-stimulant medications due to their adverse side effects. A Cochrane review on the treatment of ADHD in children with tic disorders such as Tourette syndrome indicated that stimulants in general do not make tics worse, but high doses of dextroamphetamine could exacerbate tics in some individuals.
Enhancing performance
Cognitive performance
In 2015, a systematic review and a meta-analysis of high quality clinical trials found that, when used at low (therapeutic) doses, amphetamine produces modest yet unambiguous improvements in cognition, including working memory, long-term episodic memory, inhibitory control, and some aspects of attention, in normal healthy adults; these cognition-enhancing effects of amphetamine are known to be partially mediated through the indirect activation of both dopamine receptor D1 and adrenoceptor α2 in the prefrontal cortex. A systematic review from 2014 found that low doses of amphetamine also improve memory consolidation, in turn leading to improved recall of information. Therapeutic doses of amphetamine also enhance cortical network efficiency, an effect which mediates improvements in working memory in all individuals. Amphetamine and other ADHD stimulants also improve task saliency (motivation to perform a task) and increase arousal (wakefulness), in turn promoting goal-directed behavior. Stimulants such as amphetamine can improve performance on difficult and boring tasks and are used by some students as a study and test-taking aid. Based upon studies of self-reported illicit stimulant use, 5–35% of college students use diverted ADHD stimulants, which are primarily used for enhancement of academic performance rather than as recreational drugs. However, high amphetamine doses that are above the therapeutic range can interfere with working memory and other aspects of cognitive control.
Physical performance
Amphetamine is used by some athletes for its psychological and athletic performance-enhancing effects, such as increased endurance and alertness; however, non-medical amphetamine use is prohibited at sporting events that are regulated by collegiate, national, and international anti-doping agencies. In healthy people at oral therapeutic doses, amphetamine has been shown to increase muscle strength, acceleration, athletic performance in anaerobic conditions, and endurance (i.e., it delays the onset of fatigue), while improving reaction time. Amphetamine improves endurance and reaction time primarily through reuptake inhibition and release of dopamine in the central nervous system. Amphetamine and other dopaminergic drugs also increase power output at fixed levels of perceived exertion by overriding a "safety switch", allowing the core temperature limit to increase in order to access a reserve capacity that is normally off-limits. At therapeutic doses, the adverse effects of amphetamine do not impede athletic performance; however, at much higher doses, amphetamine can induce effects that severely impair performance, such as rapid muscle breakdown and elevated body temperature.
Contraindications
According to the International Programme on Chemical Safety (IPCS) and the United States Food and Drug Administration (USFDA), amphetamine is contraindicated in people with a history of drug abuse, cardiovascular disease, severe agitation, or severe anxiety. It is also contraindicated in individuals with advanced arteriosclerosis (hardening of the arteries), glaucoma (increased eye pressure), hyperthyroidism (excessive production of thyroid hormone), or moderate to severe hypertension. These agencies indicate that people who have experienced allergic reactions to other stimulants or who are taking monoamine oxidase inhibitors (MAOIs) should not take amphetamine, although safe concurrent use of amphetamine and monoamine oxidase inhibitors has been documented. These agencies also state that anyone with anorexia nervosa, bipolar disorder, depression, hypertension, liver or kidney problems, mania, psychosis, Raynauds phenomenon, seizures, thyroid problems, tics, or Tourette syndrome should monitor their symptoms while taking amphetamine. Evidence from human studies indicates that therapeutic amphetamine use does not cause developmental abnormalities in the fetus or newborns (i.e., it is not a human teratogen), but amphetamine abuse does pose risks to the fetus. Amphetamine has also been shown to pass into breast milk, so the IPCS and the USFDA advise mothers to avoid breastfeeding when using it. Due to the potential for reversible growth impairments, the USFDA advises monitoring the height and weight of children and adolescents prescribed an amphetamine pharmaceutical.
Adverse effects
The adverse side effects of amphetamine are many and varied, and the amount of amphetamine used is the primary factor in determining the likelihood and severity of adverse effects. Amphetamine products such as Adderall, Dexedrine, and their generic equivalents are currently approved by the USFDA for long-term therapeutic use. Recreational use of amphetamine generally involves much larger doses, which have a greater risk of serious adverse drug effects than dosages used for therapeutic purposes.
Physical
Cardiovascular side effects can include hypertension or hypotension from a vasovagal response, Raynauds phenomenon (reduced blood flow to the hands and feet), and tachycardia (increased heart rate). Sexual side effects in males may include erectile dysfunction, frequent erections, or prolonged erections. Gastrointestinal side effects may include abdominal pain, constipation, diarrhea, and nausea. Other potential physical side effects include appetite loss, blurred vision, dry mouth, excessive grinding of the teeth, nosebleed, profuse sweating, rhinitis medicamentosa (drug-induced nasal congestion), reduced seizure threshold, tics (a type of movement disorder), and weight loss. Dangerous physical side effects are rare at typical pharmaceutical doses.Amphetamine stimulates the medullary respiratory centers, producing faster and deeper breaths. In a normal person at therapeutic doses, this effect is usually not noticeable, but when respiration is already compromised, it may be evident. Amphetamine also induces contraction in the urinary bladder sphincter, the muscle which controls urination, which can result in difficulty urinating. This effect can be useful in treating bed wetting and loss of bladder control. The effects of amphetamine on the gastrointestinal tract are unpredictable. If intestinal activity is high, amphetamine may reduce gastrointestinal motility (the rate at which content moves through the digestive system); however, amphetamine may increase motility when the smooth muscle of the tract is relaxed. Amphetamine also has a slight analgesic effect and can enhance the pain relieving effects of opioids.USFDA-commissioned studies from 2011 indicate that in children, young adults, and adults there is no association between serious adverse cardiovascular events (sudden death, heart attack, and stroke) and the medical use of amphetamine or other ADHD stimulants. However, amphetamine pharmaceuticals are contraindicated in individuals with cardiovascular disease.
Psychological
At normal therapeutic doses, the most common psychological side effects of amphetamine include increased alertness, apprehension, concentration, initiative, self-confidence and sociability, mood swings (elated mood followed by mildly depressed mood), insomnia or wakefulness, and decreased sense of fatigue. Less common side effects include anxiety, change in libido, grandiosity, irritability, repetitive or obsessive behaviors, and restlessness; these effects depend on the users personality and current mental state. Amphetamine psychosis (e.g., delusions and paranoia) can occur in heavy users. Although very rare, this psychosis can also occur at therapeutic doses during long-term therapy. According to the USFDA, "there is no systematic evidence" that stimulants produce aggressive behavior or hostility.Amphetamine has also been shown to produce a conditioned place preference in humans taking therapeutic doses, meaning that individuals acquire a preference for spending time in places where they have previously used amphetamine.
Reinforcement disorders
Addiction
Addiction is a serious risk with heavy recreational amphetamine use, but is unlikely to occur from long-term medical use at therapeutic doses; in fact, lifetime stimulant therapy for ADHD that begins during childhood reduces the risk of developing substance use disorders as an adult. Pathological overactivation of the mesolimbic pathway, a dopamine pathway that connects the ventral tegmental area to the nucleus accumbens, plays a central role in amphetamine addiction. Individuals who frequently self-administer high doses of amphetamine have a high risk of developing an amphetamine addiction, since chronic use at high doses gradually increases the level of accumbal ΔFosB, a "molecular switch" and "master control protein" for addiction. Once nucleus accumbens ΔFosB is sufficiently overexpressed, it begins to increase the severity of addictive behavior (i.e., compulsive drug-seeking) with further increases in its expression. While there are currently no effective drugs for treating amphetamine addiction, regularly engaging in sustained aerobic exercise appears to reduce the risk of developing such an addiction. Sustained aerobic exercise on a regular basis also appears to be an effective treatment for amphetamine addiction; exercise therapy improves clinical treatment outcomes and may be used as an adjunct therapy with behavioral therapies for addiction.
Biomolecular mechanisms
Chronic use of amphetamine at excessive doses causes alterations in gene expression in the mesocorticolimbic projection, which arise through transcriptional and epigenetic mechanisms. The most important transcription factors that produce these alterations are Delta FBJ murine osteosarcoma viral oncogene homolog B (ΔFosB), cAMP response element binding protein (CREB), and nuclear factor-kappa B (NF-κB). ΔFosB is the most significant biomolecular mechanism in addiction because ΔFosB overexpression (i.e., an abnormally high level of gene expression which produces a pronounced gene-related phenotype) in the D1-type medium spiny neurons in the nucleus accumbens is necessary and sufficient for many of the neural adaptations and regulates multiple behavioral effects (e.g., reward sensitization and escalating drug self-administration) involved in addiction. Once ΔFosB is sufficiently overexpressed, it induces an addictive state that becomes increasingly more severe with further increases in ΔFosB expression. It has been implicated in addictions to alcohol, cannabinoids, cocaine, methylphenidate, nicotine, opioids, phencyclidine, propofol, and substituted amphetamines, among others.ΔJunD, a transcription factor, and G9a, a histone methyltransferase enzyme, both oppose the function of ΔFosB and inhibit increases in its expression. Sufficiently overexpressing ΔJunD in the nucleus accumbens with viral vectors can completely block many of the neural and behavioral alterations seen in chronic drug abuse (i.e., the alterations mediated by ΔFosB). Similarly, accumbal G9a hyperexpression results in markedly increased histone 3 lysine residue 9 dimethylation (H3K9me2) and blocks the induction of ΔFosB-mediated neural and behavioral plasticity by chronic drug use, which occurs via H3K9me2-mediated repression of transcription factors for ΔFosB and H3K9me2-mediated repression of various ΔFosB transcriptional targets (e.g., CDK5). ΔFosB also plays an important role in regulating behavioral responses to natural rewards, such as palatable food, sex, and exercise. Since both natural rewards and addictive drugs induce the expression of ΔFosB (i.e., they cause the brain to produce more of it), chronic acquisition of these rewards can result in a similar pathological state of addiction. Consequently, ΔFosB is the most significant factor involved in both amphetamine addiction and amphetamine-induced sexual addictions, which are compulsive sexual behaviors that result from excessive sexual activity and amphetamine use. These sexual addictions are associated with a dopamine dysregulation syndrome which occurs in some patients taking dopaminergic drugs.The effects of amphetamine on gene regulation are both dose- and route-dependent. Most of the research on gene regulation and addiction is based upon animal studies with intravenous amphetamine administration at very high doses. The few studies that have used equivalent (weight-adjusted) human therapeutic doses and oral administration show that these changes, if they occur, are relatively minor. This suggests that medical use of amphetamine does not significantly affect gene regulation.
Pharmacological treatments
As of December 2019, there is no effective pharmacotherapy for amphetamine addiction. Reviews from 2015 and 2016 indicated that TAAR1-selective agonists have significant therapeutic potential as a treatment for psychostimulant addictions; however, as of February 2016, the only compounds which are known to function as TAAR1-selective agonists are experimental drugs. Amphetamine addiction is largely mediated through increased activation of dopamine receptors and co-localized NMDA receptors in the nucleus accumbens; magnesium ions inhibit NMDA receptors by blocking the receptor calcium channel. One review suggested that, based upon animal testing, pathological (addiction-inducing) psychostimulant use significantly reduces the level of intracellular magnesium throughout the brain. Supplemental magnesium treatment has been shown to reduce amphetamine self-administration (i.e., doses given to oneself) in humans, but it is not an effective monotherapy for amphetamine addiction.A systematic review and meta-analysis from 2019 assessed the efficacy of 17 different pharmacotherapies used in randomized controlled trials (RCTs) for amphetamine and methamphetamine addiction; it found only low-strength evidence that methylphenidate might reduce amphetamine or methamphetamine self-administration. There was low- to moderate-strength evidence of no benefit for most of the other medications used in RCTs, which included antidepressants (bupropion, mirtazapine, sertraline), antipsychotics (aripiprazole), anticonvulsants (topiramate, baclofen, gabapentin), naltrexone, varenicline, citicoline, ondansetron, prometa, riluzole, atomoxetine, dextroamphetamine, and modafinil.
Behavioral treatments
A 2018 systematic review and network meta-analysis of 50 trials involving 12 different psychosocial interventions for amphetamine, methamphetamine, or cocaine addiction found that combination therapy with both contingency management and community reinforcement approach had the highest efficacy (i.e., abstinence rate) and acceptability (i.e., lowest dropout rate). Other treatment modalities examined in the analysis included monotherapy with contingency management or community reinforcement approach, cognitive behavioral therapy, 12-step programs, non-contingent reward-based therapies, psychodynamic therapy, and other combination therapies involving these.Additionally, research on the neurobiological effects of physical exercise suggests that daily aerobic exercise, especially endurance exercise (e.g., marathon running), prevents the development of drug addiction and is an effective adjunct therapy (i.e., a supplemental treatment) for amphetamine addiction. Exercise leads to better treatment outcomes when used as an adjunct treatment, particularly for psychostimulant addictions. In particular, aerobic exercise decreases psychostimulant self-administration, reduces the reinstatement (i.e., relapse) of drug-seeking, and induces increased dopamine receptor D2 (DRD2) density in the striatum. This is the opposite of pathological stimulant use, which induces decreased striatal DRD2 density. One review noted that exercise may also prevent the development of a drug addiction by altering ΔFosB or c-Fos immunoreactivity in the striatum or other parts of the reward system.
Dependence and withdrawal
Drug tolerance develops rapidly in amphetamine abuse (i.e., recreational amphetamine use), so periods of extended abuse require increasingly larger doses of the drug in order to achieve the same effect.
According to a Cochrane review on withdrawal in individuals who compulsively use amphetamine and methamphetamine, "when chronic heavy users abruptly discontinue amphetamine use, many report a time-limited withdrawal syndrome that occurs within 24 hours of their last dose." This review noted that withdrawal symptoms in chronic, high-dose users are frequent, occurring in roughly 88% of cases, and persist for 3–4 weeks with a marked "crash" phase occurring during the first week. Amphetamine withdrawal symptoms can include anxiety, drug craving, depressed mood, fatigue, increased appetite, increased movement or decreased movement, lack of motivation, sleeplessness or sleepiness, and lucid dreams. The review indicated that the severity of withdrawal symptoms is positively correlated with the age of the individual and the extent of their dependence. Mild withdrawal symptoms from the discontinuation of amphetamine treatment at therapeutic doses can be avoided by tapering the dose.
Overdose
An amphetamine overdose can lead to many different symptoms, but is rarely fatal with appropriate care. The severity of overdose symptoms increases with dosage and decreases with drug tolerance to amphetamine. Tolerant individuals have been known to take as much as 5 grams of amphetamine in a day, which is roughly 100 times the maximum daily therapeutic dose. Symptoms of a moderate and extremely large overdose are listed below; fatal amphetamine poisoning usually also involves convulsions and coma. In 2013, overdose on amphetamine, methamphetamine, and other compounds implicated in an "amphetamine use disorder" resulted in an estimated 3,788 deaths worldwide (3,425–4,145 deaths, 95% confidence).
Toxicity
In rodents and primates, sufficiently high doses of amphetamine cause dopaminergic neurotoxicity, or damage to dopamine neurons, which is characterized by dopamine terminal degeneration and reduced transporter and receptor function. There is no evidence that amphetamine is directly neurotoxic in humans. However, large doses of amphetamine may indirectly cause dopaminergic neurotoxicity as a result of hyperpyrexia, the excessive formation of reactive oxygen species, and increased autoxidation of dopamine. Animal models of neurotoxicity from high-dose amphetamine exposure indicate that the occurrence of hyperpyrexia (i.e., core body temperature ≥ 40 °C) is necessary for the development of amphetamine-induced neurotoxicity. Prolonged elevations of brain temperature above 40 °C likely promote the development of amphetamine-induced neurotoxicity in laboratory animals by facilitating the production of reactive oxygen species, disrupting cellular protein function, and transiently increasing blood–brain barrier permeability.
Psychosis
An amphetamine overdose can result in a stimulant psychosis that may involve a variety of symptoms, such as delusions and paranoia. A Cochrane review on treatment for amphetamine, dextroamphetamine, and methamphetamine psychosis states that about 5–15% of users fail to recover completely. According to the same review, there is at least one trial that shows antipsychotic medications effectively resolve the symptoms of acute amphetamine psychosis. Psychosis rarely arises from therapeutic use.
Drug interactions
Many types of substances are known to interact with amphetamine, resulting in altered drug action or metabolism of amphetamine, the interacting substance, or both. Inhibitors of enzymes that metabolize amphetamine (e.g., CYP2D6 and FMO3) will prolong its elimination half-life, meaning that its effects will last longer. Amphetamine also interacts with MAOIs, particularly monoamine oxidase A inhibitors, since both MAOIs and amphetamine increase plasma catecholamines (i.e., norepinephrine and dopamine); therefore, concurrent use of both is dangerous. Amphetamine modulates the activity of most psychoactive drugs. In particular, amphetamine may decrease the effects of sedatives and depressants and increase the effects of stimulants and antidepressants. Amphetamine may also decrease the effects of antihypertensives and antipsychotics due to its effects on blood pressure and dopamine respectively. Zinc supplementation may reduce the minimum effective dose of amphetamine when it is used for the treatment of ADHD.In general, there is no significant interaction when consuming amphetamine with food, but the pH of gastrointestinal content and urine affects the absorption and excretion of amphetamine, respectively. Acidic substances reduce the absorption of amphetamine and increase urinary excretion, and alkaline substances do the opposite. Due to the effect pH has on absorption, amphetamine also interacts with gastric acid reducers such as proton pump inhibitors and H2 antihistamines, which increase gastrointestinal pH (i.e., make it less acidic).
Pharmacology
Pharmacodynamics
Amphetamine exerts its behavioral effects by altering the use of monoamines as neuronal signals in the brain, primarily in catecholamine neurons in the reward and executive function pathways of the brain. The concentrations of the main neurotransmitters involved in reward circuitry and executive functioning, dopamine and norepinephrine, increase dramatically in a dose-dependent manner by amphetamine because of its effects on monoamine transporters. The reinforcing and motivational salience-promoting effects of amphetamine are due mostly to enhanced dopaminergic activity in the mesolimbic pathway. The euphoric and locomotor-stimulating effects of amphetamine are dependent upon the magnitude and speed by which it increases synaptic dopamine and norepinephrine concentrations in the striatum.Amphetamine has been identified as a potent full agonist of trace amine-associated receptor 1 (TAAR1), a Gs-coupled and Gq-coupled G protein-coupled receptor (GPCR) discovered in 2001, which is important for regulation of brain monoamines. Activation of TAAR1 increases cAMP production via adenylyl cyclase activation and inhibits monoamine transporter function. Monoamine autoreceptors (e.g., D2 short, presynaptic α2, and presynaptic 5-HT1A) have the opposite effect of TAAR1, and together these receptors provide a regulatory system for monoamines. Notably, amphetamine and trace amines possess high binding affinities for TAAR1, but not for monoamine autoreceptors. Imaging studies indicate that monoamine reuptake inhibition by amphetamine and trace amines is site specific and depends upon the presence of TAAR1 co-localization in the associated monoamine neurons.In addition to the neuronal monoamine transporters, amphetamine also inhibits both vesicular monoamine transporters, VMAT1 and VMAT2, as well as SLC1A1, SLC22A3, and SLC22A5. SLC1A1 is excitatory amino acid transporter 3 (EAAT3), a glutamate transporter located in neurons, SLC22A3 is an extraneuronal monoamine transporter that is present in astrocytes, and SLC22A5 is a high-affinity carnitine transporter. Amphetamine is known to strongly induce cocaine- and amphetamine-regulated transcript (CART) gene expression, a neuropeptide involved in feeding behavior, stress, and reward, which induces observable increases in neuronal development and survival in vitro. The CART receptor has yet to be identified, but there is significant evidence that CART binds to a unique Gi/Go-coupled GPCR. Amphetamine also inhibits monoamine oxidases at very high doses, resulting in less monoamine and trace amine metabolism and consequently higher concentrations of synaptic monoamines. In humans, the only post-synaptic receptor at which amphetamine is known to bind is the 5-HT1A receptor, where it acts as an agonist with low micromolar affinity.The full profile of amphetamines short-term drug effects in humans is mostly derived through increased cellular communication or neurotransmission of dopamine, serotonin, norepinephrine, epinephrine, histamine, CART peptides, endogenous opioids, adrenocorticotropic hormone, corticosteroids, and glutamate, which it affects through interactions with CART, 5-HT1A, EAAT3, TAAR1, VMAT1, VMAT2, and possibly other biological targets. Amphetamine also activates seven human carbonic anhydrase enzymes, several of which are expressed in the human brain.Dextroamphetamine is a more potent agonist of TAAR1 than levoamphetamine. Consequently, dextroamphetamine produces greater CNS stimulation than levoamphetamine, roughly three to four times more, but levoamphetamine has slightly stronger cardiovascular and peripheral effects.
Dopamine
In certain brain regions, amphetamine increases the concentration of dopamine in the synaptic cleft. Amphetamine can enter the presynaptic neuron either through DAT or by diffusing across the neuronal membrane directly. As a consequence of DAT uptake, amphetamine produces competitive reuptake inhibition at the transporter. Upon entering the presynaptic neuron, amphetamine activates TAAR1 which, through protein kinase A (PKA) and protein kinase C (PKC) signaling, causes DAT phosphorylation. Phosphorylation by either protein kinase can result in DAT internalization (non-competitive reuptake inhibition), but PKC-mediated phosphorylation alone induces the reversal of dopamine transport through DAT (i.e., dopamine efflux). Amphetamine is also known to increase intracellular calcium, an effect which is associated with DAT phosphorylation through an unidentified Ca2+/calmodulin-dependent protein kinase (CAMK)-dependent pathway, in turn producing dopamine efflux. Through direct activation of G protein-coupled inwardly-rectifying potassium channels, TAAR1 reduces the firing rate of dopamine neurons, preventing a hyper-dopaminergic state.Amphetamine is also a substrate for the presynaptic vesicular monoamine transporter, VMAT2. Following amphetamine uptake at VMAT2, amphetamine induces the collapse of the vesicular pH gradient, which results in the release of dopamine molecules from synaptic vesicles into the cytosol via dopamine efflux through VMAT2. Subsequently, the cytosolic dopamine molecules are released from the presynaptic neuron into the synaptic cleft via reverse transport at DAT.
Norepinephrine
Similar to dopamine, amphetamine dose-dependently increases the level of synaptic norepinephrine, the direct precursor of epinephrine. Based upon neuronal TAAR1 mRNA expression, amphetamine is thought to affect norepinephrine analogously to dopamine. In other words, amphetamine induces TAAR1-mediated efflux and non-competitive reuptake inhibition at phosphorylated NET, competitive NET reuptake inhibition, and norepinephrine release from VMAT2.
Serotonin
Amphetamine exerts analogous, yet less pronounced, effects on serotonin as on dopamine and norepinephrine. Amphetamine affects serotonin via VMAT2 and, like norepinephrine, is thought to phosphorylate SERT via TAAR1. Like dopamine, amphetamine has low, micromolar affinity at the human 5-HT1A receptor.
Other neurotransmitters, peptides, hormones, and enzymes
Acute amphetamine administration in humans increases endogenous opioid release in several brain structures in the reward system. Extracellular levels of glutamate, the primary excitatory neurotransmitter in the brain, have been shown to increase in the striatum following exposure to amphetamine. This increase in extracellular glutamate presumably occurs via the amphetamine-induced internalization of EAAT3, a glutamate reuptake transporter, in dopamine neurons. Amphetamine also induces the selective release of histamine from mast cells and efflux from histaminergic neurons through VMAT2. Acute amphetamine administration can also increase adrenocorticotropic hormone and corticosteroid levels in blood plasma by stimulating the hypothalamic–pituitary–adrenal axis.In December 2017, the first study assessing the interaction between amphetamine and human carbonic anhydrase enzymes was published; of the eleven carbonic anhydrase enzymes it examined, it found that amphetamine potently activates seven, four of which are highly expressed in the human brain, with low nanomolar through low micromolar activating effects. Based upon preclinical research, cerebral carbonic anhydrase activation has cognition-enhancing effects; but, based upon the clinical use of carbonic anhydrase inhibitors, carbonic anhydrase activation in other tissues may be associated with adverse effects, such as ocular activation exacerbating glaucoma.
Pharmacokinetics
The oral bioavailability of amphetamine varies with gastrointestinal pH; it is well absorbed from the gut, and bioavailability is typically over 75% for dextroamphetamine. Amphetamine is a weak base with a pKa of 9.9; consequently, when the pH is basic, more of the drug is in its lipid soluble free base form, and more is absorbed through the lipid-rich cell membranes of the gut epithelium. Conversely, an acidic pH means the drug is predominantly in a water-soluble cationic (salt) form, and less is absorbed. Approximately 20% of amphetamine circulating in the bloodstream is bound to plasma proteins. Following absorption, amphetamine readily distributes into most tissues in the body, with high concentrations occurring in cerebrospinal fluid and brain tissue.The half-lives of amphetamine enantiomers differ and vary with urine pH. At normal urine pH, the half-lives of dextroamphetamine and levoamphetamine are 9–11 hours and 11–14 hours, respectively. Highly acidic urine will reduce the enantiomer half-lives to 7 hours; highly alkaline urine will increase the half-lives up to 34 hours. The immediate-release and extended release variants of salts of both isomers reach peak plasma concentrations at 3 hours and 7 hours post-dose respectively. Amphetamine is eliminated via the kidneys, with 30–40% of the drug being excreted unchanged at normal urinary pH. When the urinary pH is basic, amphetamine is in its free base form, so less is excreted. When urine pH is abnormal, the urinary recovery of amphetamine may range from a low of 1% to a high of 75%, depending mostly upon whether urine is too basic or acidic, respectively. Following oral administration, amphetamine appears in urine within 3 hours. Roughly 90% of ingested amphetamine is eliminated 3 days after the last oral dose.
Lisdexamfetamine is a prodrug of dextroamphetamine. It is not as sensitive to pH as amphetamine when being absorbed in the gastrointestinal tract. Following absorption into the blood stream, lisdexamfetamine is completely converted by red blood cells to dextroamphetamine and the amino acid L-lysine by hydrolysis via undetermined aminopeptidase enzymes. This is the rate-limiting step in the bioactivation of lisdexamfetamine. The elimination half-life of lisdexamfetamine is generally less than 1 hour. Due to the necessary conversion of lisdexamfetamine into dextroamphetamine, levels of dextroamphetamine with lisdexamfetamine peak about one hour later than with an equivalent dose of immediate-release dextroamphetamine. Presumably due to its rate-limited activation by red blood cells, intravenous administration of lisdexamfetamine shows greatly delayed time to peak and reduced peak levels compared to intravenous administration of an equivalent dose of dextroamphetamine. The pharmacokinetics of lisdexamfetamine are similar regardless of whether it is administered orally, intranasally, or intravenously. Hence, in contrast to dextroamphetamine, parenteral use does not enhance the subjective effects of lisdexamfetamine. Because of its behavior as a prodrug and its pharmacokinetic differences, lisdexamfetamine has a longer duration of therapeutic effect than immediate-release dextroamphetamine and shows reduced misuse potential.CYP2D6, dopamine β-hydroxylase (DBH), flavin-containing monooxygenase 3 (FMO3), butyrate-CoA ligase (XM-ligase), and glycine N-acyltransferase (GLYAT) are the enzymes known to metabolize amphetamine or its metabolites in humans. Amphetamine has a variety of excreted metabolic products, including 4-hydroxyamphetamine, 4-hydroxynorephedrine, 4-hydroxyphenylacetone, benzoic acid, hippuric acid, norephedrine, and phenylacetone. Among these metabolites, the active sympathomimetics are 4-hydroxyamphetamine, 4-hydroxynorephedrine, and norephedrine. The main metabolic pathways involve aromatic para-hydroxylation, aliphatic alpha- and beta-hydroxylation, N-oxidation, N-dealkylation, and deamination. The known metabolic pathways, detectable metabolites, and metabolizing enzymes in humans include the following:
Pharmacomicrobiomics
The human metagenome (i.e., the genetic composition of an individual and all microorganisms that reside on or within the individuals body) varies considerably between individuals. Since the total number of microbial and viral cells in the human body (over 100 trillion) greatly outnumbers human cells (tens of trillions), there is considerable potential for interactions between drugs and an individuals microbiome, including: drugs altering the composition of the human microbiome, drug metabolism by microbial enzymes modifying the drugs pharmacokinetic profile, and microbial drug metabolism affecting a drugs clinical efficacy and toxicity profile. The field that studies these interactions is known as pharmacomicrobiomics.Similar to most biomolecules and other orally administered xenobiotics (i.e., drugs), amphetamine is predicted to undergo promiscuous metabolism by human gastrointestinal microbiota (primarily bacteria) prior to absorption into the blood stream. The first amphetamine-metabolizing microbial enzyme, tyramine oxidase from a strain of E. coli commonly found in the human gut, was identified in 2019. This enzyme was found to metabolize amphetamine, tyramine, and phenethylamine with roughly the same binding affinity for all three compounds.
Related endogenous compounds
Amphetamine has a very similar structure and function to the endogenous trace amines, which are naturally occurring neuromodulator molecules produced in the human body and brain. Among this group, the most closely related compounds are phenethylamine, the parent compound of amphetamine, and N-methylphenethylamine, an isomer of amphetamine (i.e., it has an identical molecular formula). In humans, phenethylamine is produced directly from L-phenylalanine by the aromatic amino acid decarboxylase (AADC) enzyme, which converts L-DOPA into dopamine as well. In turn, N-methylphenethylamine is metabolized from phenethylamine by phenylethanolamine N-methyltransferase, the same enzyme that metabolizes norepinephrine into epinephrine. Like amphetamine, both phenethylamine and N-methylphenethylamine regulate monoamine neurotransmission via TAAR1; unlike amphetamine, both of these substances are broken down by monoamine oxidase B, and therefore have a shorter half-life than amphetamine.
Chemistry
Amphetamine is a methyl homolog of the mammalian neurotransmitter phenethylamine with the chemical formula C9H13N. The carbon atom adjacent to the primary amine is a stereogenic center, and amphetamine is composed of a racemic 1:1 mixture of two enantiomers. This racemic mixture can be separated into its optical isomers: levoamphetamine and dextroamphetamine. At room temperature, the pure free base of amphetamine is a mobile, colorless, and volatile liquid with a characteristically strong amine odor, and acrid, burning taste. Frequently prepared solid salts of amphetamine include amphetamine adipate, aspartate, hydrochloride, phosphate, saccharate, sulfate, and tannate. Dextroamphetamine sulfate is the most common enantiopure salt. Amphetamine is also the parent compound of its own structural class, which includes a number of psychoactive derivatives. In organic chemistry, amphetamine is an excellent chiral ligand for the stereoselective synthesis of 1,1-bi-2-naphthol.
Substituted derivatives
The substituted derivatives of amphetamine, or "substituted amphetamines", are a broad range of chemicals that contain amphetamine as a "backbone"; specifically, this chemical class includes derivative compounds that are formed by replacing one or more hydrogen atoms in the amphetamine core structure with substituents. The class includes amphetamine itself, stimulants like methamphetamine, serotonergic empathogens like MDMA, and decongestants like ephedrine, among other subgroups.
Synthesis
Since the first preparation was reported in 1887, numerous synthetic routes to amphetamine have been developed. The most common route of both legal and illicit amphetamine synthesis employs a non-metal reduction known as the Leuckart reaction (method 1). In the first step, a reaction between phenylacetone and formamide, either using additional formic acid or formamide itself as a reducing agent, yields N-formylamphetamine. This intermediate is then hydrolyzed using hydrochloric acid, and subsequently basified, extracted with organic solvent, concentrated, and distilled to yield the free base. The free base is then dissolved in an organic solvent, sulfuric acid added, and amphetamine precipitates out as the sulfate salt.A number of chiral resolutions have been developed to separate the two enantiomers of amphetamine. For example, racemic amphetamine can be treated with d-tartaric acid to form a diastereoisomeric salt which is fractionally crystallized to yield dextroamphetamine. Chiral resolution remains the most economical method for obtaining optically pure amphetamine on a large scale. In addition, several enantioselective syntheses of amphetamine have been developed. In one example, optically pure (R)-1-phenyl-ethanamine is condensed with phenylacetone to yield a chiral Schiff base. In the key step, this intermediate is reduced by catalytic hydrogenation with a transfer of chirality to the carbon atom alpha to the amino group. Cleavage of the benzylic amine bond by hydrogenation yields optically pure dextroamphetamine.A large number of alternative synthetic routes to amphetamine have been developed based on classic organic reactions. One example is the Friedel–Crafts alkylation of benzene by allyl chloride to yield beta chloropropylbenzene which is then reacted with ammonia to produce racemic amphetamine (method 2). Another example employs the Ritter reaction (method 3). In this route, allylbenzene is reacted acetonitrile in sulfuric acid to yield an organosulfate which in turn is treated with sodium hydroxide to give amphetamine via an acetamide intermediate. A third route starts with ethyl 3-oxobutanoate which through a double alkylation with methyl iodide followed by benzyl chloride can be converted into 2-methyl-3-phenyl-propanoic acid. This synthetic intermediate can be transformed into amphetamine using either a Hofmann or Curtius rearrangement (method 4).A significant number of amphetamine syntheses feature a reduction of a nitro, imine, oxime, or other nitrogen-containing functional groups. In one such example, a Knoevenagel condensation of benzaldehyde with nitroethane yields phenyl-2-nitropropene. The double bond and nitro group of this intermediate is reduced using either catalytic hydrogenation or by treatment with lithium aluminium hydride (method 5). Another method is the reaction of phenylacetone with ammonia, producing an imine intermediate that is reduced to the primary amine using hydrogen over a palladium catalyst or lithium aluminum hydride (method 6).
Detection in body fluids
Amphetamine is frequently measured in urine or blood as part of a drug test for sports, employment, poisoning diagnostics, and forensics. Techniques such as immunoassay, which is the most common form of amphetamine test, may cross-react with a number of sympathomimetic drugs. Chromatographic methods specific for amphetamine are employed to prevent false positive results. Chiral separation techniques may be employed to help distinguish the source of the drug, whether prescription amphetamine, prescription amphetamine prodrugs, (e.g., selegiline), over-the-counter drug products that contain levomethamphetamine, or illicitly obtained substituted amphetamines. Several prescription drugs produce amphetamine as a metabolite, including benzphetamine, clobenzorex, famprofazone, fenproporex, lisdexamfetamine, mesocarb, methamphetamine, prenylamine, and selegiline, among others. These compounds may produce positive results for amphetamine on drug tests. Amphetamine is generally only detectable by a standard drug test for approximately 24 hours, although a high dose may be detectable for 2–4 days.For the assays, a study noted that an enzyme multiplied immunoassay technique (EMIT) assay for amphetamine and methamphetamine may produce more false positives than liquid chromatography–tandem mass spectrometry. Gas chromatography–mass spectrometry (GC–MS) of amphetamine and methamphetamine with the derivatizing agent (S)-(−)-trifluoroacetylprolyl chloride allows for the detection of methamphetamine in urine. GC–MS of amphetamine and methamphetamine with the chiral derivatizing agent Moshers acid chloride allows for the detection of both dextroamphetamine and dextromethamphetamine in urine. Hence, the latter method may be used on samples that test positive using other methods to help distinguish between the various sources of the drug.
History, society, and culture
Amphetamine-type stimulants were originally derived from the plant Ephedra, which contains the amphetamine-like stimulant ephedrine and had been used for its effects in China dating back an estimated 5,000 years. Ephedrine was isolated from Ephedra vulgaris in Japan in 1885 and was studied for its medicinal properties through the 1920s. The scarce amounts of ephedrine in the Ephedra plant led to investigations of synthetic analogues of ephedrine.Amphetamine was first synthesized in 1887 in Germany by Romanian chemist Lazăr Edeleanu who named it phenylisopropylamine; its stimulant effects remained unknown until 1927, when it was independently resynthesized by Gordon Alles and reported to have sympathomimetic properties. Amphetamine had no medical use until late 1933, when Smith, Kline and French began selling it as an inhaler under the brand name Benzedrine as a decongestant. Benzedrine sulfate was introduced 3 years later and was used to treat a wide variety of medical conditions, including narcolepsy, obesity, low blood pressure, low libido, and chronic pain, among others. During World War II, amphetamine and methamphetamine were used extensively by both the Allied and Axis forces for their stimulant and performance-enhancing effects. As the addictive properties of the drug became known, governments began to place strict controls on the sale of amphetamine. For example, during the early 1970s in the United States, amphetamine became a schedule II controlled substance under the Controlled Substances Act. In spite of strict government controls, amphetamine has been used legally or illicitly by people from a variety of backgrounds, including authors, musicians, mathematicians, and athletes.Amphetamine is still illegally synthesized today in clandestine labs and sold on the black market, primarily in European countries. Among European Union (EU) member states in 2018, 11.9 million adults of ages 15–64 have used amphetamine or methamphetamine at least once in their lives and 1.7 million have used either in the last year. During 2012, approximately 5.9 metric tons of illicit amphetamine were seized within EU member states; the "street price" of illicit amphetamine within the EU ranged from €6–38 per gram during the same period. Outside Europe, the illicit market for amphetamine is much smaller than the market for methamphetamine and MDMA.
Legal status
As a result of the United Nations 1971 Convention on Psychotropic Substances, amphetamine became a schedule II controlled substance, as defined in the treaty, in all 183 state parties. Consequently, it is heavily regulated in most countries. Some countries, such as South Korea and Japan, have banned substituted amphetamines even for medical use. In other nations, such as Canada (schedule I drug), the Netherlands (List I drug), the United States (schedule II drug), Australia (schedule 8), Thailand (category 1 narcotic), and United Kingdom (class B drug), amphetamine is in a restrictive national drug schedule that allows for its use as a medical treatment.
Pharmaceutical products
Several currently marketed amphetamine formulations contain both enantiomers, including those marketed under the brand names Adderall, Adderall XR, Mydayis, Adzenys ER, Adzenys XR-ODT, Dyanavel XR, Evekeo, and Evekeo ODT. Of those, Evekeo (including Evekeo ODT) is the only product containing only racemic amphetamine (as amphetamine sulfate), and is therefore the only one whose active moiety can be accurately referred to simply as "amphetamine". Dextroamphetamine, marketed under the brand names Dexedrine and Zenzedi, is the only enantiopure amphetamine product currently available. A prodrug form of dextroamphetamine, lisdexamfetamine, is also available and is marketed under the brand name Vyvanse. As it is a prodrug, lisdexamfetamine is structurally different from dextroamphetamine, and is inactive until it metabolizes into dextroamphetamine. The free base of racemic amphetamine was previously available as Benzedrine, Psychedrine, and Sympatedrine. Levoamphetamine was previously available as Cydril. Many current amphetamine pharmaceuticals are salts due to the comparatively high volatility of the free base. However, oral suspension and orally disintegrating tablet (ODT) dosage forms composed of the free base were introduced in 2015 and 2016, respectively. Some of the current brands and their generic equivalents are listed below.
Notes
Image legend
Reference notes
References
External links
"Amphetamine". Drug Information Portal. United States National Library of Medicine.
CID 5826 from PubChem – Dextroamphetamine
CID 32893 from PubChem – Levoamphetamine
Comparative Toxicogenomics Database entry: Amphetamine
Comparative Toxicogenomics Database entry: CARTPT |
You act as a bridge between medical jargon and everyday language. Explain medical terms in a manner that is comprehensive yet approachable for non-experts. | The term 'Pyridoxine-dependent epilepsy' keeps coming up in medical discussions. What does it stand for? | Pyridoxine-dependent epilepsy (PDE) is a rare genetic disorder characterized by intractable seizures in the prenatal and neonatal period. The disorder was first recognized in the 1950s, with the first description provided by Hunt et al. in 1954. More recently, pathogenic variants within the ALDH7A1 gene have been identified to cause PDE.
Genetics
PDE is inherited in an autosomal recessive manner and is estimated to affect around 1 in 400,000 to 700,000 births, though one study conducted in Germany estimated a prevalence of 1 in 20,000 births. The ALDH7A1 gene encodes for the enzyme antiquitin or α-aminoadipic semialdehyde dehydrogenase, which is involved with the catabolism of lysine.
Treatment
Patients with PDE do not respond to anticonvulsant medications, but seizures rapidly cease with therapeutic intravenous doses of vitamin B6 and remission from seizures are often maintained on daily therapeutic doses of vitamin B6. An optimal dose has not yet been established, but doses of 50–100 mg/day or 15–30 mg/kg/day have been proposed. Importantly, excessive doses of vitamin B6 can result in irreversible neurological damage, and therefore several guidelines recommend between 200 mg (neonates) and 500 mg per day as the maximal daily dose.Despite remission of seizure activity with vitamin B6 supplementation, intellectual disability is frequently seen in patients with PDE. Because the affected enzyme antiquitin is involved in the cerebral lysine degradation pathway, lysine restriction as an additional treatment modality has recently been explored. Studies have been published which demonstrate potential for improved biomarkers, development, and behavior in patients treated with lysine restriction in addition to pyridoxine supplementation. In trial, lysine restriction of 70–100 mg/kg/day in children less than 1 year of age, 45–80 mg/kg/day in children between 1–7 years of age, and 20–45 mg/kg/day in children older than 7 years of age were prescribed. Despite the potential of additional benefit from lysine restriction, vitamin B6 supplementation remains the main-stay of treatment given lack of studies thus far demonstrating the safety and efficacy of lysine restriction for this purpose.
Monitoring
Plasma and cerebrospinal fluid levels of pipecolic acid are frequently elevated in patients with PDE, though it is a non-specific biomarker. α-aminodipic semialdehyde is elevated in urine and plasma and is a more specific biomarker for PDE. Improvements in these biomarkers have been reported with the implementation of a lysine-restricted diet. Initial studies evaluating the safety and efficacy of lysine restriction evaluated developmental and cognitive outcomes by age-appropriate tests and parental observations.
References
External links
GeneReview/NCBI/NIH/UW entry on Pyridoxine-Dependent Seizures
Pyridoxine-dependent epilepsy. Genetics Home Reference. June 17, 2013. |
You act as a mediator between medical professionals and the public. Provide comprehensive explanations of medical terms, ensuring they are both precise and easily understood. | Can you break down the meaning of the medical term 'Tufted folliculitis' for me? | Tufted folliculitis presents with dolls hair-like bundling of follicular units, and is seen in a wide range of scarring conditions including chronic staphylococcal infection, chronic lupus erythematosus, lichen planopilaris, Graham-Little syndrome, folliculitis decalvans, acne keloidalis nuchae, immunobullous disorders, and dissecting cellulitis.: 761
See also
Cicatricial alopecia
List of cutaneous conditions
== References == |
You act as a medical communicator. Your goal is to translate medical terms into comprehensive, yet straightforward language for all readers. | I'm seeking clarification on the medical term 'Familial progressive hyperpigmentation.' Could you explain it? | Familial progressive hyperpigmentation is characterized by patches of hyperpigmentation, present at birth, which increase in size and number with age. This is a genetic disease, however the gene that accounts for this spotty darkening of the skin has yet to be discovered. Although rare, the congenital disease is most prevalent among populations originating from China.: 858
See also
Skin lesion
References
The American Journal of Human Genetics 84, 672–677, May 15, 2009
== External links == |
You act as a medical communicator. Your goal is to translate medical terms into comprehensive, yet straightforward language for all readers. | I'm trying to understand 'Metoprolol' within a medical context. Could you shed some light on it? | Metoprolol, sold under the brand name Lopressor, among others, is a selective β1 receptor blocker medication. It is used to treat high blood pressure, chest pain due to poor blood flow to the heart, and a number of conditions involving an abnormally fast heart rate. By working on the beta-1 receptor of the cardiac muscle cells, it yields both a chronotropic and inotropic effect. It is also used to prevent further heart problems after myocardial infarction and to prevent headaches in those with migraines.Metoprolol is sold in formulations that can be taken by mouth or given intravenously. The medication is often taken twice a day. The extended-release formulation is taken once per day. Metoprolol may be combined with hydrochlorothiazide (a diuretic) in a single tablet.Common side effects include trouble sleeping, feeling tired, feeling faint, and abdominal discomfort. Large doses may cause serious toxicity. Risk in pregnancy has not been ruled out. It appears to be safe in breastfeeding. The metabolism of metoprolol can vary widely between patients, often as a result of hepatic impairment or CYP2D6 polymorphism. Care should be taken in patients with asthma; metoprolol should only be used in these patients when the benefits outweigh the risks, for example in heart failure. Stopping this drug should be done slowly to decrease the risk of further health problems.Metoprolol was first made in 1969, patented in 1970, and approved for medical use in 1982. It is on the World Health Organizations List of Essential Medicines. It is available as a generic drug. In 2020, it was the sixth most commonly prescribed medication in the United States, with more than 66 million prescriptions.
Medical uses
Metoprolol is used for a number of conditions, including hypertension, angina, acute myocardial infarction, supraventricular tachycardia, ventricular tachycardia, congestive heart failure, and prevention of migraine headaches. It is an adjunct in the treatment of hyperthyroidism.The different salt versions of metoprolol – metoprolol tartrate and metoprolol succinate – are approved for different conditions and are not interchangeable.Off-label uses include supraventricular tachycardia and thyroid storm.
Available forms
Metoprolol is sold in formulations that can be taken by mouth or given intravenously. The medication is often taken twice a day. The extended-release formulation is taken once a day. Metoprolol may be combined with hydrochlorothiazide (a diuretic) in a single tablet.
Adverse effects
Adverse effects, especially with higher doses, include dizziness, drowsiness, fatigue, diarrhea, unusual dreams, trouble sleeping, depression, and vision problems. β-blockers, including metoprolol, reduce salivary flow via inhibition of the direct sympathetic innervation of the salivary glands. Metoprolol may also cause the hands and feet to feel cold. Due to the high penetration across the blood-brain barrier, lipophilic beta blockers such as propranolol and metoprolol are more likely than other less lipophilic beta blockers to cause sleep disturbances such as insomnia, vivid dreams and nightmares.Serious side effects that are advised to be reported immediately include symptoms of bradycardia (resting heart rate slower than 60 beats per minute), persistent symptoms of dizziness, fainting and unusual fatigue, bluish discoloration of the fingers and toes and/or lips, numbness/tingling/swelling of the hands or feet, sexual dysfunction, erectile dysfunction, hair loss, mental/mood changes, depression, breathing difficulty, cough, dyslipidemia and increased thirst. Consuming alcohol while taking metoprolol may cause mild body rashes and is not advised.
Precautions
It’s well documented that metoprolol reduces long-term mortality and hospitalisation due to worsening heart failure. A meta-analysis further supports reduced incidence of heart failure worsening in patients treated with beta-blockers compared to placebo. However, in some circumstances, particularly when initiating metoprolol in patients with more symptomatic disease, an increased prevalence of hospitalisation and mortality has been reported within the first two months of starting. Patients should monitor for swelling of extremities, fatigue, and shortness of breath.This medicine may cause changes in blood sugar levels or cover up signs of low blood sugar, such as a rapid pulse rate. It also may cause some people to become less alert than they are normally, making it dangerous for them to drive or use machines.Greater care is required with use in those with liver problems or asthma. Stopping this drug should be done slowly to decrease the risk of further health problems.
Pregnancy and breastfeeding
Risk for the fetus has not been ruled out, per being rated pregnancy category C in the United States. Metoprolol is category C in Australia, meaning that it may be suspected of causing harmful effects on the human fetus (but no malformations). It appears to be safe in breastfeeding.
Overdose
Excessive doses of metoprolol can cause severe hypotension, bradycardia, metabolic acidosis, seizures, and cardiorespiratory arrest. Blood or plasma concentrations may be measured to confirm a diagnosis of overdose or poisoning in hospitalized patients or to assist in a medicolegal death investigation. Plasma levels are usually less than 200 μg/L during therapeutic administration, but can range from 1–20 mg/L in overdose victims.
Pharmacology
General pharmacological principles of metoprolol:
beta-1 selective
moderately lipophilic
without intrinsic sympathomimetic activity
with weak membrane stabilizing activity
decreases heart rate, contractility, and cardiac output, therefore decreasing blood pressure
Mechanism of action
Metoprolol blocks β1 adrenergic receptors in heart muscle cells, thereby decreasing the slope of phase 4 in the nodal action potential (reducing Na+ uptake) and prolonging repolarization of phase 3 (slowing down K+ release). It also suppresses the norepinephrine-induced increase in the sarcoplasmic reticulum (SR) Ca2+ leak and the spontaneous SR Ca2+ release, which are the major triggers for atrial fibrillation.
Pharmacokinetics
It undergoes α-hydroxylation and O-demethylation as a substrate of the cytochrome liver enzymes CYP2D6.
Chemistry
The active substance metoprolol is employed either as metoprolol succinate or as metoprolol tartrate (where 100 mg metoprolol tartrate corresponds to 95 mg metoprolol succinate). The tartrate is an immediate-release formulation and the succinate is an extended-release formulation.
Stereochemistry
Metoprolol contains a stereocenter and consists of two enantiomers. This is a racemate, i.e. a 1:1 mixture of (R)- and the (S)-form:
Legal status
Metoprolol was discovered in 1969 by Bengt Ablad and Enar Carlsson. Within the UK it is classified as a prescription-only drug in the beta blocker class and is regulated by the Medicines and Healthcare products Regulatory Agency (MHRA). The MHRA is a government body set up in 2003 and is responsible for regulating medicines, medical devices, and equipment used in healthcare. The MHRA acknowledges that no product is completely risk free but takes into account research and evidence to ensure that any risks associated are minimal.The use of beta blockers such as metoprolol was approved in the U.S. by the Food and Drug Administration (FDA) in 1967. The FDA has approved beta blockers for the treatment of cardiac arrhythmias, hypertension, migraines, and others. Prescribers may choose to prescribe beta blockers for other treatments if there is just cause even though it is not approved by the FDA. Drug manufacturers, however, are unable to advertise beta blockers for other purposes that have not been approved by the FDA. Since the FDA does not regulate the practice of medicine after the drug has been approved, it is legal to prescribe beta blockers for other treatments such as performance anxiety.
Legislation
On 23 September 2011, the Medicines and Healthcare products Regulatory Agency (MHRA) granted the Intas Pharmaceuticals Limited marketing authorization (licences) for metoprolol tartrate (50 mg and 100 mg tablets) for medicinal prescription only; this was after it was established that there were no new or unexpected safety concerns and that the benefits of metoprolol tartrate were greater than the risks. Metoprolol tartrate is a generic version of Lopressor, which was licensed and authorized on 6 June 1997 to Novartis Pharmaceuticals.
In sport
Because beta blockers can be used to reduce heart rate and minimize tremors, which can enhance performance in sports such as archery, Metoprolol is banned by the world anti-doping agency in some sports. Some bans, as in all forms of billiards, darts, and golf, apply during competition only. In others, such as riflery competition, any form of beta blocker is banned by the National Collegiate Athletic Association.Urine tests are used to detect if beta blockers are present. Uncharged drugs and/or metabolites of beta blockers can be analysed by gas chromatography-mass spectrometry in selected ion monitoring (GC-MS-SIM). However, in modern times it is increasingly difficult to detect the presence of beta blockers used for sports doping purposes. A disadvantage to using GC-MS-SIM is that prior knowledge of the molecular structure of the target drugs/metabolites is required. Modern times have shown a variance in structures and hence novel beta blockers can go undetected.
Lawsuit
In the 2000s a lawsuit was brought against the manufacturers of Toprol XL (a time-release formula version of metoprolol) and its generic equivalent (metoprolol-succinate) claiming that to increase profits, lower cost generic versions of Toprol XL were intentionally kept off the market. It alleged such action by the pharmaceutical companies AstraZeneca AB, AstraZeneca LP, AstraZeneca Pharmaceuticals LP, and Aktiebolaget Hassle violated antitrust and consumer protection law. A settlement was reached in 2012, with the above manufacturers paying out $11 million in damages.
Environmental presence
In 2021, metoprolol was one of the 12 compounds identified in sludge samples taken from 12 wastewater treatment plants in California that were associated with estrogenic activity in in vitro.
References
Further reading
Dean L (2017). "Metoprolol Therapy and CYP2D6 Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical Genetics Summaries. National Center for Biotechnology Information (NCBI). PMID 28520381. Bookshelf ID: NBK425389.
External links
"Metoprolol". Drug Information Portal. U.S. National Library of Medicine. |
You are a facilitator of medical knowledge. Provide thorough and accessible explanations of medical terms, catering to both specialists and non-specialists. | I need a basic explanation for the medical term 'Left bundle branch block.' | Left bundle branch block (LBBB) is a conduction abnormality in the heart that can be seen on an electrocardiogram (ECG). In this condition, activation of the left ventricle of the heart is delayed, which causes the left ventricle to contract later than the right ventricle.
Causes
Among the causes of LBBB are:
Aortic stenosis
Dilated cardiomyopathy
Acute myocardial infarction
Extensive coronary artery disease
Primary disease of the cardiac electrical conduction system
Long standing hypertension leading to aortic root dilatation and subsequent aortic regurgitation
Lyme disease
Mechanisms
Slow or absent conduction through the left bundle branch means that it takes longer than normal for the left ventricle to fully depolarise. This can be due to a damaged bundle branch that is completely unable to conduct, but may represent intact conduction that is slower than normal. LBBB may be fixed, present at all times, but may be intermittent for example occurring only during rapid heart rates. This may be due to the bundle having a longer refractory period than usual.
Diagnosis
LBBB is diagnosed on a 12-lead ECG. In adults, it is seen as wide QRS complexes lasting ≥120ms with characteristic QRS shapes in the precordial leads, although narrower complexes are seen in children. In lead V1, the QRS complex is often entirely negative (QS morphology), although a small initial R wave may be seen (rS morphology). In the lateral leads (I, aVL, V5-V6) the QRS complexes are usually predominantly positive with a slow upstroke last >60ms to the R-wave peak. Notching may be seen in these leads but this is not universal. The small Q-waves that are usually seen in the lateral leads are absent in LBBB. T-waves usually point in the opposite direction to the terminal portion of the preceding QRS - positive QRS complexes have negative T-waves while negative QRS complexes have positive T-waves. The ST segments typically slur into the T-wave and often appear elevated in leads with negative QRS complexes. The axis may be normal but may be deviated to the left or right.There are also partial blocks of the left bundle branch: "left anterior fascicular block" (LAFB) and a "left posterior fascicular block" (LPFB). This refers to the block after the bifurcation of the left bundle branch.
Diagnostic consequences
The presence of LBBB results in that electrocardiography (ECG) cannot be used to diagnose left ventricular hypertrophy or Q wave infarction, because LBBB in itself results in widened QRS complex, and changes in the ST segment consistent with ischemia or injury.
Treatment
Patients with LBBB require complete cardiac evaluation, and those with LBBB and syncope or near-syncope may require a pacemaker.
Some patients with LBBB, a markedly prolonged QRS (usually > 150 ms), and systolic heart failure may benefit from a biventricular pacemaker, which allows for better synchrony of heart contractions.
See also
Bundle branch block
Right bundle branch block
Sgarbossas criteria
References
== External links == |
You serve as a guide in the medical field. Explain medical terms thoroughly, ensuring the information is both insightful and comprehensible. | I'm trying to understand 'Porokeratosis' within a medical context. Could you shed some light on it? | Porokeratosis is a specific disorder of keratinization that is characterized histologically by the presence of a cornoid lamella, a thin column of closely stacked, parakeratotic cells extending through the stratum corneum with a thin or absent granular layer.: 532
Types
Porokeratosis may be divided into the following clinical types:: 532
Plaque-type porokeratosis (also known as "Classic porokeratosis" and "Porokeratosis of Mibelli") is characterized by skin lesions that start as small, brownish papules that slowly enlarge to form irregular, annular, hyperkeratotic or verrucous plaques.: 533 : 566 Sometimes they may show gross overgrowth and even horn-like structures may develop. Skin malignancy, although rare, is reported from all types of porokeratosis. Squamous cell carcinomas have been reported to develop in Mibellis type porokeratosis over partianal areas involving anal mucosa. This was the first report mentioning mucosal malignancy in any form of porokeratosis.
Disseminated superficial porokeratosis is a more generalized processes and involves mainly the extremities in a bilateral, symmetric fashion.: 533 In about 50% of cases, skin lesions only develop in sun-exposed areas, and this is referred to as disseminated superficial actinic porokeratosis: 533
Porokeratosis palmaris et plantaris disseminata is characterized by skin lesions that are superficial, small, relatively uniform, and demarcated by a distinct peripheral ridge of no more than 1mm in height.: 534 : 1668 : 567
Linear porokeratosis is characterized clinically skin lesions are identical to those of classic porokeratosis, including lichenoid papules, annular lesions, hyperkeratotic plaques with central atrophy, and the characteristic peripheral ridge.: 1668 : 567
Punctate porokeratosis is a skin condition associated with either classic porokeratosis or linear porokeratosis types of porokeratosis, and is characterized by multiple, minute, and discrete punctate, hyperkeratotic, seed-like skin lesions surrounded by a thin, raised margin on the palms and soles.: 535 : 1668
Porokeratosis plantaris discreta is a skin condition that occurs in adults, with a 4:1 female preponderance, characterized by a sharply marginated, rubbery, wide-based papules.: 213 It is also known as "Steinbergs lesion". It was characterized in 1970.
Genetics
Linear porokeratosis has been associated with mutations in the PMVK and MVD genes. The PMVK gene encodes the enzyme phosphomevalonate kinase and the MVD gene encodes the enzyme diphosphomevalonate decarboxylase.
Diagnosis
Pathology
Porokeratosis has a characteristic histomorphologic feature known as a cornoid lamella.
Treatment
Dermabrasion
See also
List of cutaneous conditions
List of cutaneous conditions associated with increased risk of nonmelanoma skin cancer
References
External links
Database of rare diseases at Orphanet
NIHs Genetic and Rare Diseases Information Center |
You are a medical knowledge base. Your task is to elucidate medical terminology, offering insights into their meanings, origins, and applications. | Could you offer a clear explanation of the term 'Pentazocine' as used in the medical field? | Pentazocine, sold under the brand name Talwin among others, is a painkiller used to treat moderate to severe pain. It is believed to work by activating (agonizing) κ-opioid receptors (KOR) and μ-opioid receptors (MOR). As such it is called an opioid as it delivers its effects on pain by interacting with the opioid receptors. It shares many of the side effects of other opioids like constipation, nausea, itching, drowsiness and respiratory depression, but unlike most other opioids it fairly frequently causes hallucinations, nightmares and delusions. It is also, unlike most other opioids, subject to a ceiling effect, which is when at a certain dose (which differs from person-to-person) no more pain relief, or side effects, is obtained by increasing the dose any further.Chemically it is classed as a benzomorphan and it comes in two enantiomers, which are molecules that are exact (non-superimposable) mirror images of one another.
It was patented in 1960 and approved for medical use in 1964. Usually, in its oral formulations, it is combined with naloxone so as to prevent people from crushing the tablets, dissolving them in a solvent (like water) and injecting them for a high (as orally administered naloxone produces no opioid-negating effects, whereas intravenous or intramuscular administration does).
Use
Medical
Pentazocine is used primarily to treat pain, although its analgesic effects are subject to a ceiling effect. It has been discontinued by its corporate sponsor in Australia, although it may be available through the special access scheme.
Recreational
In the 1970s, recreational drug users discovered that combining pentazocine with tripelennamine (a first-generation ethylenediamine antihistamine most commonly dispensed under the brand names Pelamine and Pyribenzamine) produced a euphoric sensation. Since tripelennamine tablets are typically blue in color and brand-name Pentazocine is known as Talwin (hence "Ts"), the pentazocine/tripelennamine combination acquired the slang name Ts and blues.
After health-care professionals and drug-enforcement officials became aware of this scenario, the mu opioid receptor antagonist naloxone was added to oral preparations containing pentazocine to prevent perceived "misuse" via injection, and the reported incidence of its recreational use has declined precipitously since.
Research
In an open-label, add-on, single-day, acute-dose small clinical study, pentazocine was found to rapidly and substantially reduce symptoms of mania in individuals with bipolar disorder that were in the manic phase of the condition. It was postulated that the efficacy observed was due to κ-opioid receptor activation-mediated amelioration of hyperdopaminergia in the reward pathways. Minimal sedation and no side effects including psychotomimetic effects or worsening of psychosis were observed at the dose administered.
Adverse effects
Side effects are similar to those of morphine, but pentazocine, due to its action at the kappa opioid receptor is more likely to invoke psychotomimetic effects. High dose may cause high blood pressure or high heart rate. It may also increase cardiac work after myocardial infarction when given intravenously and hence this use should be avoided where possible. Respiratory depression is a common side effect, but is subject to a ceiling effect, such that at a certain dose the degree of respiratory depression will no longer increase with dose increases. Likewise rarely it has been associated with agranulocytosis, erythema multiforme and toxic epidermal necrolysis.
Tissue damage at injection sites
Severe injection site necrosis and sepsis has occurred (sometimes requiring amputation of limb) with multiple injection of pentazocine lactate. In addition, animal studies have demonstrated that Pentazocine is tolerated less well subcutaneously than intramuscularly.
History
Pentazocine was developed by the Sterling Drug Company, Sterling-Winthrop Research Institute, of Rensselaer, New York. The analgesic compound was first made at Sterling in 1958. U.S. testing was conducted between 1961 and 1967.It was approved by the Food and Drug Administration in June 1967 after being favorably reviewed following testing on 12,000 patients in the United States. By mid 1967 Pentazocine was already being sold in Mexico, England, and Argentina, under different trade names.
Society and culture
Legal status
Pentazocine was originally unclassified under the Controlled Substances Act. A petition was filed with the Drug Enforcement Administration on October 1, 1971, to shift it to Schedule III. The petition was filed by Joseph L. Fink III, a pharmacist and law student at Georgetown University Law Center as part of the course Lawyering in the Public Interest. That petition was accepted for review on November 10, 1971. D.E.A. published a Final Rule transferring it to schedule IV on January 10, 1979, with an effective date of February 9, 1979. This is understood to be the first instance of a successful petition to reclassify a substance under the relatively recently enacted Controlled Substances Act. Pentazocine is still classified in Schedule IV under the Controlled Substances Act in the United States, even with the addition of Naloxone. Some states classify it in Schedule II, such as Illinois and South Carolina (injectable form only), or Schedule III such as Kentucky.) Internationally, pentazocine is a Schedule III drug under the Convention on Psychotropic Substances. Pentazocine has a DEA ACSCN of 9720; being a Schedule IV substance, the DEA does not assign an annual manufacturing quota for pentazocine for the United States.
Brand names
Pentazocine is sold under several brand names, such as Fortral, Sosegon, Talwin NX (with naloxone), Talwin, Talwin PX, Fortwin and Talacen (with paracetamol (acetaminophen)).
See also
Cyclazocine (hallucinogenic)
Volazocine
References
External links
Eurekalert report on PNAS article |
You are an assistant in medical learning. Your role is to clarify medical terminology, ensuring the information is both accurate and accessible. | I've come across the term 'Lopinavir/ritonavir' in a medical context, but I'm not sure what it means. Can you clarify? | Lopinavir/ritonavir (LPV/r), sold under the brand name Kaletra among others, is a fixed-dose combination antiretroviral medication for the treatment and prevention of HIV/AIDS. It combines lopinavir with a low dose of ritonavir. It is generally recommended for use with other antiretrovirals. It may be used for prevention after a needlestick injury or other potential exposure. It is taken by mouth as a tablet, capsule, or solution.Common side effects include diarrhea, vomiting, feeling tired, headaches, and muscle pains. Severe side effects may include pancreatitis, liver problems, and high blood sugar. It is commonly used in pregnancy and it appears to be safe. Both medications are HIV protease inhibitors. Ritonavir functions by slowing down the breakdown of lopinavir.Lopinavir/ritonavir as a single medication was approved for use in the United States in 2000. It is on the World Health Organizations List of Essential Medicines.
Medical uses
Lopinavir/ritonavir was once a preferred combination for HIV first-line therapy in the United States. But due its higher pill burden compared to than other protease inhibitor-based regimens and increased gastrointestinal intolerance, it is no longer recommended to treatment-naive patients.
Adverse effects
The most common adverse effects observed with lopinavir/ritonavir are diarrhea and nausea. In key clinical trials, moderate or severe diarrhea occurred in up to 27% of patients, and moderate/severe nausea in up to 16%. Other common adverse effects include abdominal pain, asthenia, headache, vomiting and, particularly in children, rash.Raised liver enzymes and hyperlipidemia (both hypertriglyceridemia and hypercholesterolemia) are also commonly observed during lopinavir/ritonavir treatment.Lopinavir/ritonavir is anticipated to have varying degrees of interaction with other medications that are also CYP3A and/or P-gp substrates.People with a structural heart disease, preexisting conduction system abnormalities, ischaemic heart disease, or cardiomyopathies should use lopinavir/ritonavir with caution.On 8 March 2011 the U.S. Food and Drug Administration notified healthcare professionals of serious health problems that have been reported in premature babies receiving lopinavir/ritonavir oral solution, probably because of its propylene glycol content. They recommend the use should be avoided in premature babies.
History
Abbott Laboratories (now, via spinoff, Abbvie) was one of the earliest users of the Advanced Photon Source (APS), a national synchrotron-radiation light source at Argonne National Laboratory. One of the early research projects undertaken at the APS focused on proteins from the human immunodeficiency virus (HIV). Using the APS beam line for X-ray crystallography, researchers determined viral protein structures that allowed them to determine their approach to the development of HIV protease inhibitors, a key enzyme target that processes HIV polyproteins after infection, the function of which allows the lifecycle of the virus to proceed. As a result of this structure-based drug design approach using the Argonne APS, Abbott was able to develop new products that inhibit the protease, and therefore stop virus replication.Lopinavir was developed by Abbott in an attempt to improve upon the companys earlier protease inhibitor, ritonavir, specifically with regard to its serum protein-binding properties (reducing the interference by serum on protease enzyme inhibition) and its HIV resistance profile (reducing the ability of virus to evolve resistance to the drug). Administered alone, lopinavir has insufficient bioavailability; however, like several HIV protease inhibitors, its blood levels are greatly increased by low doses of ritonavir, a potent inhibitor of intestinal and hepatic cytochrome P450 3A4, which would otherwise reduce drug levels through catabolism. Abbott, therefore, pursued a strategy of co-administering lopinavir with doses of ritonavir sub-therapeutic with respect to HIV inhibition; hence, lopinavir was only formulated and marketed as a fixed-dose combination medication with ritonavir.Lopinavir/ritonavir was approved by the US Food and Drug Administration (FDA) on 15 September 2000, and in Europe on 19 March 2001. Its patent was scheduled to expire in the US on 26 June 2016.In March 2020, during the COVID-19 pandemic, the Israeli government announced that it would force AbbVie to license its patents for lopinavir/ritonavir. In response, AbbVie announced that it would cease enforcing its patents on the drug entirely.
Society and culture
Cost
As a result of high prices and the spread of HIV infection, the government of Thailand issued a compulsory license on 29 January 2007, to produce and/or import generic versions of lopinavir and ritonavir. In response, Abbott Laboratories withdrew its registration for lopinavir and seven of their other new drugs in Thailand, citing the Thai governments lack of respect for patents. Abbotts attitude has been denounced by several NGOs worldwide, including a netstrike initiated by Act Up-Paris and a public call to boycott all of Abbotts medicines by the French NGO AIDES.
Available forms
Heat-stable pellets that can be taken by mouth have been developed for children.
Research
While data for SARS-CoV-1 looked promising, the benefit in COVID-19 is unclear as of 23 March 2020. In 2020, a non-blinded, randomized trial found lopinavir/ritonavir was not useful to treat severe COVID-19. In this trial the medication was started typically around 13 days after the start of symptoms.
References
External links
"Lopinavir mixture with ritonavir". Drug Information Portal. U.S. National Library of Medicine.
"Fact sheet on lopinavir and ritonavir (Lpv/R) oral pellets". World Health Organization (WHO). Archived from the original on 21 November 2015. |
You are a medical educator. Your role is to provide detailed and clear explanations for medical terms, suitable for both professionals and laypersons. | I've encountered the term 'Thalidomide' while reading about medical topics. What does it refer to exactly? | Thalidomide, sold under the brand names Contergan and Thalomid among others, is a medication used to treat a number of cancers (including multiple myeloma), graft-versus-host disease, and a number of skin conditions including complications of leprosy. While it has been used in a number of HIV-associated conditions, such use is associated with increased levels of the virus. It is administered orally.Common side effects include sleepiness, rash, and dizziness. Severe side effects include tumor lysis syndrome, blood clots, and peripheral neuropathy. Use in pregnancy may harm the fetus, including resulting in malformation of the limbs. In males who are taking the medication, contraception is essential if a partner could become pregnant. It is an immunomodulatory medication and works by a number of mechanisms, including stimulating T cells and decreasing TNF-α production.Thalidomide was first marketed in 1957 in West Germany, where it was available over the counter. When first released, thalidomide was promoted for anxiety, trouble sleeping, "tension", and morning sickness. While it was initially thought to be safe in pregnancy, concerns regarding birth defects arose until the medication was removed from the market in Europe in 1961. The total number of infants affected by use during pregnancy is estimated at 10,000, of whom about 40% died around the time of birth. Those who survived had limb, eye, urinary tract, and heart problems. Its initial entry into the US market was prevented by Frances Kelsey, a reviewer at the FDA. The birth defects caused by thalidomide led to the development of greater drug regulation and monitoring in many countries.It was approved in the United States in 1998 for use as a treatment for cancer. It is on the World Health Organizations List of Essential Medicines. It is available as a generic medication.
Medical uses
Thalidomide is used as a first-line treatment in multiple myeloma in combination with dexamethasone or with melphalan and prednisone to treat acute episodes of erythema nodosum leprosum and for maintenance therapy.The bacterium that causes tuberculosis (TB) is related to leprosy. Thalidomide may be helpful in some cases where standard TB drugs and corticosteroids are not sufficient to resolve severe inflammation in the brain.It is used as a second-line treatment to manage graft versus host disease and aphthous stomatitis in children and has been prescribed for other conditions in children, including actinic prurigo and epidermolysis bullosa; the evidence for these uses is weak. It is recommended only as a third line treatment in graft-versus-host-disease in adults because of lack of efficacy and side effects observed in clinical trials.
Contraindications
Thalidomide should not be used by men or women who are trying to father or conceive a child, or who cannot or will not follow the risk management program to prevent pregnancies, or by women who are breastfeeding or pregnant. The prescribing doctor is required to ensure that contraception is being used, and regular pregnancy tests are taken. Those allergic to thalidomide should not take it. It should be used with caution in people with chronic infections like HIV or hepatitis B.
Adverse effects
Thalidomide causes birth defects. The U.S. Food and Drug Administration (FDA) and other regulatory agencies have approved marketing of the drug only with an auditable risk evaluation and mitigation strategy that ensures that people using the drug are aware of the risks and avoid pregnancy; this applies to both men and women, as the drug can be transmitted in semen.There is a high risk that thalidomide can cause excessive blood clots. There is also a high risk that thalidomide can interfere with formation of various kinds of new blood cells, creating a risk of infection via neutropenia, leukopenia, and lymphopenia, and risks that blood will not clot via thrombocytopenia. There is also a risk of anemia via lack of red blood cells. The drug can also damage nerves, causing potentially irreversible peripheral neuropathy.Thalidomide has several adverse cardiovascular effects, including risk of heart attacks, pulmonary hypertension, and changes in heart rhythm, such as syncope, bradycardia, and atrioventricular block.Thalidomide can cause liver damage and severe skin reactions like Stevens–Johnson syndrome. It tends to make people sleepy, which creates risk when driving and operating other machinery. As it kills cancer cells, it can cause tumor lysis syndrome. Thalidomide can prevent menstruation.In addition, very common (reported in more than 10% of people) adverse effects include tremor, dizziness, tingling, numbness, constipation, and peripheral edema.Common adverse effects (reported by 1–10% of people) include confusion, depressed mood, reduced coordination, heart failure, difficulty breathing, interstitial lung disease, lung inflammation, vomiting, dry mouth, rashes, dry skin, fever, weakness, and a sense of unwellness.
Interactions
There are no expected pharmacokinetic interactions between thalidomide and other medicines due to its neutral effects on P-glycoprotein and the cytochrome P450 family. It may interact with sedatives due to its sedative action and bradycardic agents, like beta-blockers, due to its bradycardia-inducing effects. The risk of peripheral neuropathy may be increased by concomitant treatment with other agents known to cause peripheral neuropathy. The risk of venous thromboembolisms with thalidomide seems to be increased when patients are treated with oral contraceptives or other cytotoxic agents (including doxorubicin and melphalan) concurrently. Thalidomide may interfere with various contraceptives, and hence it is advised that women of reproductive age use at least two different means of contraception to ensure that no child will be conceived while they are taking thalidomide.
Overdose
As of 2013, eighteen cases of overdoses had been reported with doses of up to 14.4 grams, none of them fatal. No specific antidote for overdose exists and treatment is purely supportive.
Pharmacology
The precise mechanism of action for thalidomide is not known, although efforts to identify thalidomides teratogenic action generated 2,000 research papers and the proposal of 15 or 16 plausible mechanisms by 2000. As of 2015, the main theories were inhibition of the process of angiogenesis, its inhibition of cereblon, a ubiquitin ligase, and its ability to generate reactive oxygen species which in turn kills cells. In 2018, results were first published which suggested that thalidomides teratogenic effects are mediated through degradation of the transcription factor, SALL4, an as yet unverified finding.Thalidomide also binds to and acts as an antagonist of the androgen receptor (AR) and hence is a nonsteroidal antiandrogen (NSAA) of some capacity. In accordance, it can produce gynecomastia and sexual dysfunction as side effects in men.
Chirality and biological activity
Thalidomide is provided as a racemic mixture of two enantiomers; while there are reports that only one of the enantiomers may cause birth defects, the body converts each enantiomer into the other through mechanisms that are not well understood. The (R)-enantiomer has the desired sedative effect while the (S)-enantiomer harbors embryo-toxic and teratogenic effect. The hypothesis that the tragedy could be avoided in this case by using a single enantiomer is misleading and pointless, because it was later demonstrated that the “safe” R-thalidomide undergoes an in vivo chiral inversion to the “teratogenic” S-thalidomide. Under biological conditions, the enantiomers interconvert [bidirectional chiral inversion - (R)- to (S)- and vice versa].
Chemistry
Thalidomide is racemic; while S-thalidomide is the bioactive form of the molecule, the individual enantiomers can racemize to each other due to the acidic hydrogen at the chiral centre, which is the carbon of the glutarimide ring bonded to the phthalimide substituent. The racemization process can occur in vivo. The process of conversion of one enantiomer to its mirror-image version with no other change in the molecule is called chiral inversion.Celgene Corporation originally synthesized thalidomide using a three-step sequence starting with L-glutamic acid treatment, but this has since been reformed by the use of L-glutamine. As shown in the image below, N-carbethoxyphthalimide (1) can react with L-glutamine to yield N-phthaloyl-L-glutamine (2). Cyclization of N-phthaloyl-L-glutamine occurs using carbonyldiimidazole, which then yields thalidomide (3). Celgene Corporations original method resulted in a 31% yield of S-thalidomide, whereas the two-step synthesis yields 85–93% product that is 99% pure.
History
In 1952, thalidomide was synthesised by Chemical Industry Basel (CIBA), but was found "to have no effect on animals and was discarded" on that basis. In 1957, it was acquired by Chemie Grünenthal in Germany. The German company had been established as a soap maker after World War II ended, to address the urgent market need for antibiotics. Heinrich Mückter was appointed to head the discovery program based on his experience working with the German armys antiviral research. While preparing reagents for the work, Mueckters assistant Wilhelm Kunz isolated a by-product that was recognized by pharmacologist Herbert Keller as an analog of glutethimide, a sedative. The medicinal chemistry work turned to improving the lead compound into a suitable drug: the result was thalidomide. The toxicity was examined in several animals, and the drug was introduced in 1956 as a sedative, but it was never tested on pregnant women.Researchers at Chemie Grünenthal found that thalidomide was a particularly effective antiemetic that had an inhibitory effect on morning sickness. On 1 October 1957, the company launched thalidomide and began marketing it under the trade name Contergan. It was proclaimed a "wonder drug" for insomnia, coughs, colds and headaches.During that period, the use of medications during pregnancy was not strictly controlled, and drugs were not thoroughly tested for potential harm to the fetus. Thousands of pregnant women took the drug to relieve their symptoms. At the time of the drugs development, scientists did not believe any drug taken by a pregnant woman could pass across the placental barrier and harm the developing fetus. There soon appeared reports of abnormalities in children being born to mothers using thalidomide. In late 1959, it was noticed that peripheral neuritis developed in patients who took the drug over a period of time, and it was only after this point that thalidomide ceased to be provided over the counter.While initially considered safe, the drug was responsible for teratogenic deformities in children born after their mothers used it during pregnancies, prior to the third trimester. In November 1961, thalidomide was taken off the market due to massive pressure from the press and public. Experts estimate that thalidomide led to the death of approximately 2,000 children and serious birth defects in more than 10,000 children, with over half of them in West Germany. The regulatory authorities in East Germany never approved thalidomide. One reason for the initially unobserved side effects of the drug and the subsequent approval in West Germany was that at that time drugs did not have to be tested for teratogenic effects. They were tested for toxicity on rodents only, as was usual at the time.In the UK, the British pharmaceutical company The Distillers Company (Biochemicals) Ltd, a subsidiary of Distillers Co. Ltd (now part of Diageo plc), marketed thalidomide throughout the UK, Australia and New Zealand, under the brand name Distaval, as a remedy for morning sickness. Their advertisement claimed that "Distaval can be given with complete safety to pregnant women and nursing mothers without adverse effect on mother or child ... Outstandingly safe Distaval has been prescribed for nearly three years in this country." Globally, more pharmaceutical companies started to produce and market the drug under license from Chemie Grünenthal. By the mid-1950s, 14 pharmaceutical companies were marketing thalidomide in 46 countries under at least 37 different trade names.
In the US, representatives from Chemie Grünenthal approached Smith, Kline & French (SKF), now GlaxoSmithKline (GSK), with a request to market and distribute the drug in North America. A memorandum, rediscovered in 2010 in the archives of the FDA, shows that in 1956–57, as part of its in-licensing approach, Smith, Kline and French conducted animal tests and ran a clinical trial of the drug in the US involving 875 people, including pregnant women. In 1956, researchers involved in clinical trials at SKF noted that, even when used in very high doses, thalidomide could not induce sleep in mice. And when administered at doses 50 to 650 times larger than that claimed by Chemie Grünenthal to be "sleep inducing", the researchers could still not achieve the hypnotic effect in animals that it had on humans. After completion of the trial, and based on reasons kept hidden for decades, SKF declined to commercialize the drug. In 1958, Chemie Grünenthal reached an agreement with William S Merrell Company in Cincinnati, Ohio (later Richardson-Merrell, now part of Sanofi), to market and distribute thalidomide throughout the US.The US FDA refused to approve thalidomide for marketing and distribution. However, the drug was distributed in large quantities for testing purposes, after the American distributor and manufacturer Richardson-Merrell had applied for its approval in September 1960. The official in charge of the FDA review, Frances Oldham Kelsey, did not rely on information from the company, which did not include any test results. Richardson-Merrell was called on to perform tests and report the results. The company demanded approval six times, and was refused each time. Nevertheless, a total of 17 children with thalidomide-induced malformations were born in the US. Oldham Kelsey was given a Presidential award for distinguished service from the federal government for not allowing thalidomide to be approved for sale in the U.S.In Canada, the history of thalidomide dates back to April 1961. There were many different forms sold, with the most common variant being called Talimol. Two months after Talimol went on sale, pharmaceutical companies sent physicians letters warning about the risk of birth defects. It was not until March 1962, that both drugs were banned from the Canadian market by the FDD and, soon afterward, physicians were warned to destroy their supplies.
Leprosy treatment
In 1964, Israeli physician Jacob Sheskin administered thalidomide to a patient critically ill with leprosy. The patient exhibited erythema nodosum leprosum (ENL), a painful skin condition, one of the complications of leprosy. The treatment was attempted despite the ban on thalidomides use, and results were favourable: the patient slept for hours and was able to get out of bed without aid upon awakening. A clinical trial studying the use of thalidomide in leprosy soon followed.Thalidomide has been used by Brazilian physicians as the drug of choice for the treatment of severe ENL since 1965, and by 1996, at least 33 cases of thalidomide embryopathy were recorded in people born in Brazil after 1965. Since 1994, the production, dispensing, and prescription of thalidomide have been strictly controlled, requiring women to use two forms of birth control and submit to regular pregnancy tests. Despite this, cases of thalidomide embryopathy continue, with at least 100 cases identified in Brazil between 2005 and 2010. 5.8 million thalidomide pills were distributed throughout Brazil in this time period, largely to poor Brazilians in areas with poor access to healthcare, and these cases have occurred despite the controls.
In 1998, the FDA approved the drugs use in the treatment of ENL. Because of thalidomides potential for causing birth defects, the drug may be distributed only under tightly controlled conditions. The FDA required that Celgene Corporation, which planned to market thalidomide under the brand name Thalomid, establish a system for thalidomide education and prescribing safety (STEPS) oversight program. The conditions required under the program include limiting prescription and dispensing rights to authorized prescribers and pharmacies only, keeping a registry of all patients prescribed thalidomide, providing extensive patient education about the risks associated with the drug, and providing periodic pregnancy tests for women who take the drug.In 2010, the World Health Organization (WHO) stated that it did not recommend thalidomide for leprosy due to the difficulty of adequately controlling its use, and due to the availability of clofazimine.
Cancer treatment
Shortly after the teratogenic properties of thalidomide were recognized in the mid-1960s, its anti-cancer potential was explored and two clinical trials were conducted in people with advanced cancer, including some people with multiple myeloma; the trials were inconclusive.Little further work was done with thalidomide in cancer until the 1990s.Judah Folkman pioneered studies into the role of angiogenesis (the proliferation and growth of blood vessels) in the development of cancer, and in the early 1970s had shown that solid tumors could not expand without it. In 1993 he surprised the scientific world by hypothesizing the same was true of blood cancers, and the next year he published work showing that a biomarker of angiogenesis was higher in all people with cancer, but especially high in people with blood cancers, and other evidence emerged as well. Meanwhile, a member of his lab, Robert DAmato, who was looking for angiogenesis inhibitors, discovered in 1994 that thalidomide inhibited angiogenesis and was effective in suppressing tumor growth in rabbits. Around that time, the wife of a man who was dying of multiple myeloma and whom standard treatments had failed, called Folkman asking him about his anti-angiogenesis ideas. Folkman persuaded the patients doctor to try thalidomide, and that doctor conducted a clinical trial of thalidomide for people with multiple myeloma in which about a third of the subjects responded to the treatment. The results of that trial were published in the New England Journal of Medicine in 1999.After further work was done by Celgene and others, in 2006 the U.S. Food and Drug Administration granted accelerated approval for thalidomide in combination with dexamethasone for the treatment of newly diagnosed multiple myeloma patients.It was also evaluated whether thalidomide can be combined with melphalan and prednisone for patients with multiple myeloma. This combination of drugs probably results in an increase of the overall survival.
Society and culture
Birth defect crisis
In the late 1950s and early 1960s, more than 10,000 children in 46 countries were born with deformities, such as phocomelia, as a consequence of thalidomide use. The severity and location of the deformities depended on how many days into the pregnancy the mother was before beginning treatment; thalidomide taken on the 20th day of pregnancy caused central brain damage, day 21 would damage the eyes, day 22 the ears and face, day 24 the arms, and leg damage would occur if taken up to day 28. Thalidomide did not damage the fetus if taken after 42 days gestation.It is not known exactly how many worldwide victims of the drug there have been, although estimates range from 10,000 to 20,000. Despite the side effects, thalidomide was sold in pharmacies in Canada until 1962.
Notable cases
Lorraine Mercer MBE of the United Kingdom, born with phocomelia of both arms and legs, is the only thalidomide survivor to carry the Olympic Torch.
Thomas Quasthoff, an internationally acclaimed bass-baritone, who describes himself: "1.34 meters tall, short arms, seven fingers — four right, three left — large, relatively well-formed head, brown eyes, distinctive lips; profession: singer".
Niko von Glasow produced a documentary called NoBodys Perfect, based on the lives of 12 people affected by the drug, which was released in 2008.
Mercédes Benegbi, born with phocomelia of both arms, drove the successful campaign for compensation from her government for Canadians who were affected by thalidomide.
Mat Fraser, born with phocomelia of both arms, is an English rock musician, actor, writer and performance artist. He produced a 2002 television documentary "Born Freak", which looked at this historical tradition and its relevance to modern disabled performers. This work has become the subject of academic analysis in the field of disability studies.
Change in drug regulations
The disaster prompted many countries to introduce tougher rules for the testing and licensing of drugs, such as the 1962 Kefauver Harris Amendment (U.S.), 1965 Directive 65/65/EEC1 (E.U.), and the Medicines Act 1968 (UK). In the United States, the new regulations strengthened the FDA, among other ways, by requiring applicants to prove efficacy and to disclose all side effects encountered in testing. The FDA subsequently initiated the Drug Efficacy Study Implementation to reclassify drugs already on the market.
Quality of life
In the 1960s, thalidomide was successfully marketed as a safer alternative to barbiturates. Due to a successful marketing campaign, thalidomide was widely used by pregnant women during the first trimester of pregnancy. However, thalidomide is a teratogenic substance, and a proportion of children born during the 1960s had thalidomide embryopathy (TE). Of these babies born with TE, "about 40% of them died before their first birthday". The surviving individuals are now middle-aged and they report experiencing challenges (physical, psychological, and socioeconomic) related to TE.
Individuals born with TE frequently experience a wide variety of health problems secondary to their TE. These health conditions include both physical and psychological conditions. When compared to individuals of similar demographic profiles, those born with TE report less satisfaction with their quality of life and their overall health. Access to health care services can also be a challenge for these people, and women in particular have experienced difficulty in locating healthcare professionals who can understand and embrace their needs.
Brand names
Brand names include Contergan, Thalomid, Talidex, Talizer, Neurosedyn, Distaval and many others.
Research
Research efforts have been focused on determining how thalidomide causes birth defects and its other activities in the human body, efforts to develop safer analogs, and efforts to find further uses for thalidomide.
Thalidomide analogs
The exploration of the antiangiogenic and immunomodulatory activities of thalidomide has led to the study and creation of thalidomide analogs. Celgene has sponsored numerous clinical trials with analogues to thalidomide, such as lenalidomide, that are substantially more powerful and have fewer side effects — except for greater myelosuppression. In 2005, Celgene received FDA approval for lenalidomide (Revlimid) as the first commercially useful derivative. Revlimid is available only in a restricted distribution setting to avoid its use during pregnancy. Further studies are being conducted to find safer compounds with useful qualities. Another more potent analog, pomalidomide, is now FDA approved. Additionally, apremilast was approved by the FDA in March 2014. These thalidomide analogs can be used to treat different diseases, or used in a regimen to fight two conditions.Interest turned to pomalidomide, a derivative of thalidomide marketed by Celgene. It is a very active anti-angiogenic agent and also acts as an immunomodulator. Pomalidomide was approved in February 2013 by the U.S. Food and Drug Administration (FDA) as a treatment for relapsed and refractory multiple myeloma. It received a similar approval from the European Commission in August 2013, and is expected to be marketed in Europe under the brand name Imnovid.
Clinical research
There is no conclusive evidence that thalidomide or lenalidomide is useful to bring about or maintain remission in Crohns disease.Thalidomide was studied in a Phase II trial for Kaposis sarcoma, a rare soft-tissue cancer most commonly seen in the immunocompromised, that is caused by the Kaposis sarcoma-associated herpesvirus (KSHV).
References
Further reading
External links
"Thalidomide". Drug Information Portal. U.S. National Library of Medicine.
Daemmrich A (7 December 2015). "Remind me again, what is thalidomide and how did it cause so much harm". The Conversation. |
You are a conduit for medical education. Your task is to offer detailed explanations of medical terms, ensuring they are understandable and precise. | Could you please explain the term 'Tracheal intubation' in simple language? | Tracheal intubation, usually simply referred to as intubation, is the placement of a flexible plastic tube into the trachea (windpipe) to maintain an open airway or to serve as a conduit through which to administer certain drugs. It is frequently performed in critically injured, ill, or anesthetized patients to facilitate ventilation of the lungs, including mechanical ventilation, and to prevent the possibility of asphyxiation or airway obstruction.
The most widely used route is orotracheal, in which an endotracheal tube is passed through the mouth and vocal apparatus into the trachea. In a nasotracheal procedure, an endotracheal tube is passed through the nose and vocal apparatus into the trachea. Other methods of intubation involve surgery and include the cricothyrotomy (used almost exclusively in emergency circumstances) and the tracheotomy, used primarily in situations where a prolonged need for airway support is anticipated.
Because it is an invasive and uncomfortable medical procedure, intubation is usually performed after administration of general anesthesia and a neuromuscular-blocking drug. It can, however, be performed in the awake patient with local or topical anesthesia or in an emergency without any anesthesia at all. Intubation is normally facilitated by using a conventional laryngoscope, flexible fiberoptic bronchoscope, or video laryngoscope to identify the vocal cords and pass the tube between them into the trachea instead of into the esophagus. Other devices and techniques may be used alternatively.
After the trachea has been intubated, a balloon cuff is typically inflated just above the far end of the tube to help secure it in place, to prevent leakage of respiratory gases, and to protect the tracheobronchial tree from receiving undesirable material such as stomach acid. The tube is then secured to the face or neck and connected to a T-piece, anesthesia breathing circuit, bag valve mask device, or a mechanical ventilator. Once there is no longer a need for ventilatory assistance or protection of the airway, the tracheal tube is removed; this is referred to as extubation of the trachea (or decannulation, in the case of a surgical airway such as a cricothyrotomy or a tracheotomy).
For centuries, tracheotomy was considered the only reliable method for intubation of the trachea. However, because only a minority of patients survived the operation, physicians undertook tracheotomy only as a last resort, on patients who were nearly dead. It was not until the late 19th century, however, that advances in understanding of anatomy and physiology, as well an appreciation of the germ theory of disease, had improved the outcome of this operation to the point that it could be considered an acceptable treatment option. Also at that time, advances in endoscopic instrumentation had improved to such a degree that direct laryngoscopy had become a viable means to secure the airway by the non-surgical orotracheal route. By the mid-20th century, the tracheotomy as well as endoscopy and non-surgical tracheal intubation had evolved from rarely employed procedures to becoming essential components of the practices of anesthesiology, critical care medicine, emergency medicine, and laryngology.
Tracheal intubation can be associated with complications such as broken teeth or lacerations of the tissues of the upper airway. It can also be associated with potentially fatal complications such as pulmonary aspiration of stomach contents which can result in a severe and sometimes fatal chemical aspiration pneumonitis, or unrecognized intubation of the esophagus which can lead to potentially fatal anoxia. Because of this, the potential for difficulty or complications due to the presence of unusual airway anatomy or other uncontrolled variables is carefully evaluated before undertaking tracheal intubation. Alternative strategies for securing the airway must always be readily available.
Indications
Tracheal intubation is indicated in a variety of situations when illness or a medical procedure prevents a person from maintaining a clear airway, breathing, and oxygenating the blood. In these circumstances, oxygen supplementation using a simple face mask is inadequate.
Depressed level of consciousness
Perhaps the most common indication for tracheal intubation is for the placement of a conduit through which nitrous oxide or volatile anesthetics may be administered. General anesthetic agents, opioids, and neuromuscular-blocking drugs may diminish or even abolish the respiratory drive. Although it is not the only means to maintain a patent airway during general anesthesia, intubation of the trachea provides the most reliable means of oxygenation and ventilation and the greatest degree of protection against regurgitation and pulmonary aspiration.Damage to the brain (such as from a massive stroke, non-penetrating head injury, intoxication or poisoning) may result in a depressed level of consciousness. When this becomes severe to the point of stupor or coma (defined as a score on the Glasgow Coma Scale of less than 8), dynamic collapse of the extrinsic muscles of the airway can obstruct the airway, impeding the free flow of air into the lungs. Furthermore, protective airway reflexes such as coughing and swallowing may be diminished or absent. Tracheal intubation is often required to restore patency (the relative absence of blockage) of the airway and protect the tracheobronchial tree from pulmonary aspiration of gastric contents.
Hypoxemia
Intubation may be necessary for a patient with decreased oxygen content and oxygen saturation of the blood caused when their breathing is inadequate (hypoventilation), suspended (apnea), or when the lungs are unable to sufficiently transfer gasses to the blood. Such patients, who may be awake and alert, are typically critically ill with a multisystem disease or multiple severe injuries. Examples of such conditions include cervical spine injury, multiple rib fractures, severe pneumonia, acute respiratory distress syndrome (ARDS), or near-drowning. Specifically, intubation is considered if the arterial partial pressure of oxygen (PaO2) is less than 60 millimeters of mercury (mm Hg) while breathing an inspired O2 concentration (FIO2) of 50% or greater. In patients with elevated arterial carbon dioxide, an arterial partial pressure of CO2 (PaCO2) greater than 45 mm Hg in the setting of acidemia would prompt intubation, especially if a series of measurements demonstrate a worsening respiratory acidosis. Regardless of the laboratory values, these guidelines are always interpreted in the clinical context.
Airway obstruction
Actual or impending airway obstruction is a common indication for intubation of the trachea. Life-threatening airway obstruction may occur when a foreign body becomes lodged in the airway; this is especially common in infants and toddlers. Severe blunt or penetrating injury to the face or neck may be accompanied by swelling and an expanding hematoma, or injury to the larynx, trachea or bronchi. Airway obstruction is also common in people who have suffered smoke inhalation or burns within or near the airway or epiglottitis. Sustained generalized seizure activity and angioedema are other common causes of life-threatening airway obstruction which may require tracheal intubation to secure the airway.
Manipulation of the airway
Diagnostic or therapeutic manipulation of the airway (such as bronchoscopy, laser therapy or stenting of the bronchi) may intermittently interfere with the ability to breathe; intubation may be necessary in such situations.
Newborns
Syndromes such as respiratory distress syndrome, congenital heart disease, pneumothorax, and shock may lead to breathing problems in newborn infants that require endotracheal intubation and mechanically assisted breathing (mechanical ventilation). Newborn infants may also require endotracheal intubation during surgery while under general anaesthesia.
Equipment
Laryngoscopes
The vast majority of tracheal intubations involve the use of a viewing instrument of one type or another. The modern conventional laryngoscope consists of a handle containing batteries that power a light and a set of interchangeable blades, which are either straight or curved. This device is designed to allow the laryngoscopist to directly view the larynx. Due to the widespread availability of such devices, the technique of blind intubation of the trachea is rarely practiced today, although it may still be useful in certain emergency situations, such as natural or man-made disasters. In the prehospital emergency setting, digital intubation may be necessitated if the patient is in a position that makes direct laryngoscopy impossible. For example, digital intubation may be used by a paramedic if the patient is entrapped in an inverted position in a vehicle after a motor vehicle collision with a prolonged extrication time.
The decision to use a straight or curved laryngoscope blade depends partly on the specific anatomical features of the airway, and partly on the personal experience and preference of the laryngoscopist. The Macintosh blade is the most widely used curved laryngoscope blade, while the Miller blade is the most popular style of straight blade. Both Miller and Macintosh laryngoscope blades are available in sizes 0 (infant) through 4 (large adult). There are many other styles of straight and curved blades, with accessories such as mirrors for enlarging the field of view and even ports for the administration of oxygen. These specialty blades are primarily designed for use by anesthetists and otolaryngologists, most commonly in the operating room.Fiberoptic laryngoscopes have become increasingly available since the 1990s. In contrast to the conventional laryngoscope, these devices allow the laryngoscopist to indirectly view the larynx. This provides a significant advantage in situations where the operator needs to see around an acute bend in order to visualize the glottis, and deal with otherwise difficult intubations. Video laryngoscopes are specialized fiberoptic laryngoscopes that use a digital video camera sensor to allow the operator to view the glottis and larynx on a video monitor. Other "noninvasive" devices which can be employed to assist in tracheal intubation are the laryngeal mask airway (used as a conduit for endotracheal tube placement) and the Airtraq.
Stylets
An intubating stylet is a malleable metal wire designed to be inserted into the endotracheal tube to make the tube conform better to the upper airway anatomy of the specific individual. This aid is commonly used with a difficult laryngoscopy. Just as with laryngoscope blades, there are also several types of available stylets, such as the Verathon Stylet, which is specifically designed to follow the 60° blade angle of the GlideScope video laryngoscope.The Eschmann tracheal tube introducer (also referred to as a "gum elastic bougie") is specialized type of stylet used to facilitate difficult intubation. This flexible device is 60 cm (24 in) in length, 15 French (5 mm diameter) with a small "hockey-stick" angle at the far end. Unlike a traditional intubating stylet, the Eschmann tracheal tube introducer is typically inserted directly into the trachea and then used as a guide over which the endotracheal tube can be passed (in a manner analogous to the Seldinger technique). As the Eschmann tracheal tube introducer is considerably less rigid than a conventional stylet, this technique is considered to be a relatively atraumatic means of tracheal intubation.The tracheal tube exchanger is a hollow catheter, 56 to 81 cm (22.0 to 31.9 in) in length, that can be used for removal and replacement of tracheal tubes without the need for laryngoscopy. The Cook Airway Exchange Catheter (CAEC) is another example of this type of catheter; this device has a central lumen (hollow channel) through which oxygen can be administered. Airway exchange catheters are long hollow catheters which often have connectors for jet ventilation, manual ventilation, or oxygen insufflation. It is also possible to connect the catheter to a capnograph to perform respiratory monitoring.
The lighted stylet is a device that employs the principle of transillumination to facilitate blind orotracheal intubation (an intubation technique in which the laryngoscopist does not view the glottis).
Tracheal tubes
A tracheal tube is a catheter that is inserted into the trachea for the primary purpose of establishing and maintaining a patent (open and unobstructed) airway. Tracheal tubes are frequently used for airway management in the settings of general anesthesia, critical care, mechanical ventilation, and emergency medicine. Many different types of tracheal tubes are available, suited for different specific applications. An endotracheal tube is a specific type of tracheal tube that is nearly always inserted through the mouth (orotracheal) or nose (nasotracheal). It is a breathing conduit designed to be placed into the airway of critically injured, ill or anesthetized patients in order to perform mechanical positive pressure ventilation of the lungs and to prevent the possibility of aspiration or airway obstruction. The endotracheal tube has a fitting designed to be connected to a source of pressurized gas such as oxygen. At the other end is an orifice through which such gases are directed into the lungs and may also include a balloon (referred to as a cuff). The tip of the endotracheal tube is positioned above the carina (before the trachea divides to each lung) and sealed within the trachea so that the lungs can be ventilated equally. A tracheostomy tube is another type of tracheal tube; this 2–3-inch-long (51–76 mm) curved metal or plastic tube is inserted into a tracheostomy stoma or a cricothyrotomy incision.Tracheal tubes can be used to ensure the adequate exchange of oxygen and carbon dioxide, to deliver oxygen in higher concentrations than found in air, or to administer other gases such as helium, nitric oxide, nitrous oxide, xenon, or certain volatile anesthetic agents such as desflurane, isoflurane, or sevoflurane. They may also be used as a route for administration of certain medications such as bronchodilators, inhaled corticosteroids, and drugs used in treating cardiac arrest such as atropine, epinephrine, lidocaine and vasopressin.Originally made from latex rubber, most modern endotracheal tubes today are constructed of polyvinyl chloride. Tubes constructed of silicone rubber, wire-reinforced silicone rubber or stainless steel are also available for special applications. For human use, tubes range in size from 2 to 10.5 mm (0.1 to 0.4 in) in internal diameter. The size is chosen based on the patients body size, with the smaller sizes being used for infants and children. Most endotracheal tubes have an inflatable cuff to seal the tracheobronchial tree against leakage of respiratory gases and pulmonary aspiration of gastric contents, blood, secretions, and other fluids. Uncuffed tubes are also available, though their use is limited mostly to children (in small children, the cricoid cartilage is the narrowest portion of the airway and usually provides an adequate seal for mechanical ventilation).In addition to cuffed or uncuffed, preformed endotracheal tubes are also available. The oral and nasal RAE tubes (named after the inventors Ring, Adair and Elwyn) are the most widely used of the preformed tubes.There are a number of different types of double-lumen endo-bronchial tubes that have endobronchial as well as endotracheal channels (Carlens, White and Robertshaw tubes). These tubes are typically coaxial, with two separate channels and two separate openings. They incorporate an endotracheal lumen which terminates in the trachea and an endobronchial lumen, the distal tip of which is positioned 1–2 cm into the right or left mainstem bronchus. There is also the Univent tube, which has a single tracheal lumen and an integrated endobronchial blocker. These tubes enable one to ventilate both lungs, or either lung independently. Single-lung ventilation (allowing the lung on the operative side to collapse) can be useful during thoracic surgery, as it can facilitate the surgeons view and access to other relevant structures within the thoracic cavity.The "armored" endotracheal tubes are cuffed, wire-reinforced silicone rubber tubes. They are much more flexible than polyvinyl chloride tubes, yet they are difficult to compress or kink. This can make them useful for situations in which the trachea is anticipated to remain intubated for a prolonged duration, or if the neck is to remain flexed during surgery. Most armored tubes have a Magill curve, but preformed armored RAE tubes are also available. Another type of endotracheal tube has four small openings just above the inflatable cuff, which can be used for suction of the trachea or administration of intratracheal medications if necessary. Other tubes (such as the Bivona Fome-Cuf tube) are designed specifically for use in laser surgery in and around the airway.
Methods to confirm tube placement
No single method for confirming tracheal tube placement has been shown to be 100% reliable. Accordingly, the use of multiple methods for confirmation of correct tube placement is now widely considered to be the standard of care. Such methods include direct visualization as the tip of the tube passes through the glottis, or indirect visualization of the tracheal tube within the trachea using a device such as a bronchoscope. With a properly positioned tracheal tube, equal bilateral breath sounds will be heard upon listening to the chest with a stethoscope, and no sound upon listening to the area over the stomach. Equal bilateral rise and fall of the chest wall will be evident with ventilatory excursions. A small amount of water vapor will also be evident within the lumen of the tube with each exhalation and there will be no gastric contents in the tracheal tube at any time.Ideally, at least one of the methods utilized for confirming tracheal tube placement will be a measuring instrument. Waveform capnography has emerged as the gold standard for the confirmation of tube placement within the trachea. Other methods relying on instruments include the use of a colorimetric end-tidal carbon dioxide detector, a self-inflating esophageal bulb, or an esophageal detection device. The distal tip of a properly positioned tracheal tube will be located in the mid-trachea, roughly 2 cm (1 in) above the bifurcation of the carina; this can be confirmed by chest x-ray. If it is inserted too far into the trachea (beyond the carina), the tip of the tracheal tube is likely to be within the right main bronchus—a situation often referred to as a "right mainstem intubation". In this situation, the left lung may be unable to participate in ventilation, which can lead to decreased oxygen content due to ventilation/perfusion mismatch.
Special situations
Emergencies
Tracheal intubation in the emergency setting can be difficult with the fiberoptic bronchoscope due to blood, vomit, or secretions in the airway and poor patient cooperation. Because of this, patients with massive facial injury, complete upper airway obstruction, severely diminished ventilation, or profuse upper airway bleeding are poor candidates for fiberoptic intubation. Fiberoptic intubation under general anesthesia typically requires two skilled individuals. Success rates of only 83–87% have been reported using fiberoptic techniques in the emergency department, with significant nasal bleeding occurring in up to 22% of patients. These drawbacks limit the use of fiberoptic bronchoscopy somewhat in urgent and emergency situations.Personnel experienced in direct laryngoscopy are not always immediately available in certain settings that require emergency tracheal intubation. For this reason, specialized devices have been designed to act as bridges to a definitive airway. Such devices include the laryngeal mask airway, cuffed oropharyngeal airway and the esophageal-tracheal combitube (Combitube). Other devices such as rigid stylets, the lightwand (a blind technique) and indirect fiberoptic rigid stylets, such as the Bullard scope, Upsher scope and the WuScope can also be used as alternatives to direct laryngoscopy. Each of these devices have its own unique set of benefits and drawbacks, and none of them is effective under all circumstances.
Rapid-sequence induction and intubation
Rapid sequence induction and intubation (RSI) is a particular method of induction of general anesthesia, commonly employed in emergency operations and other situations where patients are assumed to have a full stomach. The objective of RSI is to minimize the possibility of regurgitation and pulmonary aspiration of gastric contents during the induction of general anesthesia and subsequent tracheal intubation. RSI traditionally involves preoxygenating the lungs with a tightly fitting oxygen mask, followed by the sequential administration of an intravenous sleep-inducing agent and a rapidly acting neuromuscular-blocking drug, such as rocuronium, succinylcholine, or cisatracurium besilate, before intubation of the trachea.One important difference between RSI and routine tracheal intubation is that the practitioner does not manually assist the ventilation of the lungs after the onset of general anesthesia and cessation of breathing, until the trachea has been intubated and the cuff has been inflated. Another key feature of RSI is the application of manual cricoid pressure to the cricoid cartilage, often referred to as the "Sellick maneuver", prior to instrumentation of the airway and intubation of the trachea.Named for British anesthetist Brian Arthur Sellick (1918–1996) who first described the procedure in 1961, the goal of cricoid pressure is to minimize the possibility of regurgitation and pulmonary aspiration of gastric contents. Cricoid pressure has been widely used during RSI for nearly fifty years, despite a lack of compelling evidence to support this practice. The initial article by Sellick was based on a small sample size at a time when high tidal volumes, head-down positioning and barbiturate anesthesia were the rule. Beginning around 2000, a significant body of evidence has accumulated which questions the effectiveness of cricoid pressure. The application of cricoid pressure may in fact displace the esophagus laterally instead of compressing it as described by Sellick. Cricoid pressure may also compress the glottis, which can obstruct the view of the laryngoscopist and actually cause a delay in securing the airway.Cricoid pressure is often confused with the "BURP" (Backwards Upwards Rightwards Pressure) maneuver. While both of these involve digital pressure to the anterior aspect (front) of the laryngeal apparatus, the purpose of the latter is to improve the view of the glottis during laryngoscopy and tracheal intubation, rather than to prevent regurgitation. Both cricoid pressure and the BURP maneuver have the potential to worsen laryngoscopy.RSI may also be used in prehospital emergency situations when a patient is conscious but respiratory failure is imminent (such as in extreme trauma). This procedure is commonly performed by flight paramedics. Flight paramedics often use RSI to intubate before transport because intubation in a moving fixed-wing or rotary-wing aircraft is extremely difficult to perform due to environmental factors. The patient will be paralyzed and intubated on the ground before transport by aircraft.
Cricothyrotomy
A cricothyrotomy is an incision made through the skin and cricothyroid membrane to establish a patent airway during certain life-threatening situations, such as airway obstruction by a foreign body, angioedema, or massive facial trauma. A cricothyrotomy is nearly always performed as a last resort in cases where orotracheal and nasotracheal intubation are impossible or contraindicated. Cricothyrotomy is easier and quicker to perform than tracheotomy, does not require manipulation of the cervical spine and is associated with fewer complications.The easiest method to perform this technique is the needle cricothyrotomy (also referred to as a percutaneous dilational cricothyrotomy), in which a large-bore (12–14 gauge) intravenous catheter is used to puncture the cricothyroid membrane. Oxygen can then be administered through this catheter via jet insufflation. However, while needle cricothyrotomy may be life-saving in extreme circumstances, this technique is only intended to be a temporizing measure until a definitive airway can be established. While needle cricothyrotomy can provide adequate oxygenation, the small diameter of the cricothyrotomy catheter is insufficient for elimination of carbon dioxide (ventilation). After one hour of apneic oxygenation through a needle cricothyrotomy, one can expect a PaCO2 of greater than 250 mm Hg and an arterial pH of less than 6.72, despite an oxygen saturation of 98% or greater. A more definitive airway can be established by performing a surgical cricothyrotomy, in which a 5 to 6 mm (0.20 to 0.24 in) endotracheal tube or tracheostomy tube can be inserted through a larger incision.Several manufacturers market prepackaged cricothyrotomy kits, which enable one to use either a wire-guided percutaneous dilational (Seldinger) technique, or the classic surgical technique to insert a polyvinylchloride catheter through the cricothyroid membrane. The kits may be stocked in hospital emergency departments and operating suites, as well as ambulances and other selected pre-hospital settings.
Tracheotomy
Tracheotomy consists of making an incision on the front of the neck and opening a direct airway through an incision in the trachea. The resulting opening can serve independently as an airway or as a site for a tracheostomy tube to be inserted; this tube allows a person to breathe without the use of his nose or mouth. The opening may be made by a scalpel or a needle (referred to as surgical and percutaneous techniques respectively) and both techniques are widely used in current practice. In order to limit the risk of damage to the recurrent laryngeal nerves (the nerves that control the voice box), the tracheotomy is performed as high in the trachea as possible. If only one of these nerves is damaged, the patients voice may be impaired (dysphonia); if both of the nerves are damaged, the patient will be unable to speak (aphonia). In the acute setting, indications for tracheotomy are similar to those for cricothyrotomy. In the chronic setting, indications for tracheotomy include the need for long-term mechanical ventilation and removal of tracheal secretions (e.g., comatose patients, or extensive surgery involving the head and neck).
Children
There are significant differences in airway anatomy and respiratory physiology between children and adults, and these are taken into careful consideration before performing tracheal intubation of any pediatric patient. The differences, which are quite significant in infants, gradually disappear as the human body approaches a mature age and body mass index.For infants and young children, orotracheal intubation is easier than the nasotracheal route. Nasotracheal intubation carries a risk of dislodgement of adenoids and nasal bleeding. Despite the greater difficulty, nasotracheal intubation route is preferable to orotracheal intubation in children undergoing intensive care and requiring prolonged intubation because this route allows a more secure fixation of the tube. As with adults, there are a number of devices specially designed for assistance with difficult tracheal intubation in children. Confirmation of proper position of the tracheal tube is accomplished as with adult patients.Because the airway of a child is narrow, a small amount of glottic or tracheal swelling can produce critical obstruction. Inserting a tube that is too large relative to the diameter of the trachea can cause swelling. Conversely, inserting a tube that is too small can result in inability to achieve effective positive pressure ventilation due to retrograde escape of gas through the glottis and out the mouth and nose (often referred to as a "leak" around the tube). An excessive leak can usually be corrected by inserting a larger tube or a cuffed tube.The tip of a correctly positioned tracheal tube will be in the mid-trachea, between the collarbones on an anteroposterior chest radiograph. The correct diameter of the tube is that which results in a small leak at a pressure of about 25 cm (10 in) of water. The appropriate inner diameter for the endotracheal tube is estimated to be roughly the same diameter as the childs little finger. The appropriate length for the endotracheal tube can be estimated by doubling the distance from the corner of the childs mouth to the ear canal. For premature infants 2.5 mm (0.1 in) internal diameter is an appropriate size for the tracheal tube. For infants of normal gestational age, 3 mm (0.12 in) internal diameter is an appropriate size. For normally nourished children 1 year of age and older, two formulae are used to estimate the appropriate diameter and depth for tracheal intubation. The internal diameter of the tube in mm is (patients age in years + 16) / 4, while the appropriate depth of insertion in cm is 12 + (patients age in years / 2).
Newborn infants
Endotrachael suctioning is often used during intubation in newborn infants to reduce the risk of a blocked tube due to secretions, a collapsed lung, and to reduce pain. Suctioning is sometimes used at specifically scheduled intervals, "as needed", and less frequently. Further research is necessary to determine the most effective suctioning schedule or frequency of suctioning in intubated infants.In newborns free flow oxygen used to be recommended during intubation however as there is no evidence of benefit the 2011 NRP guidelines no longer do.
Predicting difficulty
Tracheal intubation is not a simple procedure and the consequences of failure are grave. Therefore, the patient is carefully evaluated for potential difficulty or complications beforehand. This involves taking the medical history of the patient and performing a physical examination, the results of which can be scored against one of several classification systems. The proposed surgical procedure (e.g., surgery involving the head and neck, or bariatric surgery) may lead one to anticipate difficulties with intubation. Many individuals have unusual airway anatomy, such as those who have limited movement of their neck or jaw, or those who have tumors, deep swelling due to injury or to allergy, developmental abnormalities of the jaw, or excess fatty tissue of the face and neck. Using conventional laryngoscopic techniques, intubation of the trachea can be difficult or even impossible in such patients. This is why all persons performing tracheal intubation must be familiar with alternative techniques of securing the airway. Use of the flexible fiberoptic bronchoscope and similar devices has become among the preferred techniques in the management of such cases. However, these devices require a different skill set than that employed for conventional laryngoscopy and are expensive to purchase, maintain and repair.When taking the patients medical history, the subject is questioned about any significant signs or symptoms, such as difficulty in speaking or difficulty in breathing. These may suggest obstructing lesions in various locations within the upper airway, larynx, or tracheobronchial tree. A history of previous surgery (e.g., previous cervical fusion), injury, radiation therapy, or tumors involving the head, neck and upper chest can also provide clues to a potentially difficult intubation. Previous experiences with tracheal intubation, especially difficult intubation, intubation for prolonged duration (e.g., intensive care unit) or prior tracheotomy are also noted.A detailed physical examination of the airway is important, particularly:
the range of motion of the cervical spine: the subject should be able to tilt the head back and then forward so that the chin touches the chest.
the range of motion of the jaw (the temporomandibular joint): three of the subjects fingers should be able to fit between the upper and lower incisors.
the size and shape of the upper jaw and lower jaw, looking especially for problems such as maxillary hypoplasia (an underdeveloped upper jaw), micrognathia (an abnormally small jaw), or retrognathia (misalignment of the upper and lower jaw).
the thyromental distance: three of the subjects fingers should be able to fit between the Adams apple and the chin.
the size and shape of the tongue and palate relative to the size of the mouth.
the teeth, especially noting the presence of prominent maxillary incisors, any loose or damaged teeth, or crowns.Many classification systems have been developed in an effort to predict difficulty of tracheal intubation, including the Cormack-Lehane classification system, the Intubation Difficulty Scale (IDS), and the Mallampati score. The Mallampati score is drawn from the observation that the size of the base of the tongue influences the difficulty of intubation. It is determined by looking at the anatomy of the mouth, and in particular the visibility of the base of palatine uvula, faucial pillars and the soft palate. Although such medical scoring systems may aid in the evaluation of patients, no single score or combination of scores can be trusted to specifically detect all and only those patients who are difficult to intubate. Furthermore, one study of experienced anesthesiologists, on the widely used Cormack–Lehane classification system, found they did not score the same patients consistently over time, and that only 25% could correctly define all four grades of the widely used Cormack–Lehane classification system. Under certain emergency circumstances (e.g., severe head trauma or suspected cervical spine injury), it may be impossible to fully utilize these the physical examination and the various classification systems to predict the difficulty of tracheal intubation. A recent Cochrane systematic review examined the sensitivity and specificity of various bedside tests commonly used for predicting difficulty in airway management. In such cases, alternative techniques of securing the airway must be readily available.
Complications
Tracheal intubation is generally considered the best method for airway management under a wide variety of circumstances, as it provides the most reliable means of oxygenation and ventilation and the greatest degree of protection against regurgitation and pulmonary aspiration. However, tracheal intubation requires a great deal of clinical experience to master and serious complications may result even when properly performed.Four anatomic features must be present for orotracheal intubation to be straightforward: adequate mouth opening (full range of motion of the temporomandibular joint), sufficient pharyngeal space (determined by examining the back of the mouth), sufficient submandibular space (distance between the thyroid cartilage and the chin, the space into which the tongue must be displaced in order for the larygoscopist to view the glottis), and adequate extension of the cervical spine at the atlanto-occipital joint. If any of these variables is in any way compromised, intubation should be expected to be difficult.Minor complications are common after laryngoscopy and insertion of an orotracheal tube. These are typically of short duration, such as sore throat, lacerations of the lips or gums or other structures within the upper airway, chipped, fractured or dislodged teeth, and nasal injury. Other complications which are common but potentially more serious include accelerated or irregular heartbeat, high blood pressure, elevated intracranial and introcular pressure, and bronchospasm.More serious complications include laryngospasm, perforation of the trachea or esophagus, pulmonary aspiration of gastric contents or other foreign bodies, fracture or dislocation of the cervical spine, temporomandibular joint or arytenoid cartilages, decreased oxygen content, elevated arterial carbon dioxide, and vocal cord weakness. In addition to these complications, tracheal intubation via the nasal route carries a risk of dislodgement of adenoids and potentially severe nasal bleeding. Newer technologies such as flexible fiberoptic laryngoscopy have fared better in reducing the incidence of some of these complications, though the most frequent cause of intubation trauma remains a lack of skill on the part of the laryngoscopist.Complications may also be severe and long-lasting or permanent, such as vocal cord damage, esophageal perforation and retropharyngeal abscess, bronchial intubation, or nerve injury. They may even be immediately life-threatening, such as laryngospasm and negative pressure pulmonary edema (fluid in the lungs), aspiration, unrecognized esophageal intubation, or accidental disconnection or dislodgement of the tracheal tube. Potentially fatal complications more often associated with prolonged intubation or tracheotomy include abnormal communication between the trachea and nearby structures such as the innominate artery (tracheoinnominate fistula) or esophagus (tracheoesophageal fistula). Other significant complications include airway obstruction due to loss of tracheal rigidity, ventilator-associated pneumonia and narrowing of the glottis or trachea. The cuff pressure is monitored carefully in order to avoid complications from over-inflation, many of which can be traced to excessive cuff pressure restricting the blood supply to the tracheal mucosa. A 2000 Spanish study of bedside percutaneous tracheotomy reported overall complication rates of 10–15% and procedural mortality of 0%, which is comparable to those of other series reported in the literature from the Netherlands and the United States.Inability to secure the airway, with subsequent failure of oxygenation and ventilation is a life-threatening complication which if not immediately corrected leads to decreased oxygen content, brain damage, cardiovascular collapse, and death. When performed improperly, the associated complications (e.g., unrecognized esophageal intubation) may be rapidly fatal. Without adequate training and experience, the incidence of such complications is high. The case of Andrew Davis Hughes, from Emerald Isle, NC is a widely known case in which the patient was improperly intubated and, due to the lack of oxygen, sustained severe brain damage and died. For example, among paramedics in several United States urban communities, unrecognized esophageal or hypopharyngeal intubation has been reported to be 6% to 25%. Although not common, where basic emergency medical technicians are permitted to intubate, reported success rates are as low as 51%. In one study, nearly half of patients with misplaced tracheal tubes died in the emergency room. Because of this, recent editions of the American Heart Associations Guidelines for Cardiopulmonary Resuscitation have de-emphasized the role of tracheal intubation in favor of other airway management techniques such as bag-valve-mask ventilation, the laryngeal mask airway and the Combitube. However, recent higher quality studies have shown no survival or neurological benefit with endotracheal intubation over supraglottic airway devices (Laryngeal mask or Combitube).One complication—unintentional and unrecognized intubation of the esophagus—is both common (as frequent as 25% in the hands of inexperienced personnel) and likely to result in a deleterious or even fatal outcome. In such cases, oxygen is inadvertently administered to the stomach, from where it cannot be taken up by the circulatory system, instead of the lungs. If this situation is not immediately identified and corrected, death will ensue from cerebral and cardiac anoxia.
Of 4,460 claims in the American Society of Anesthesiologists (ASA) Closed Claims Project database, 266 (approximately 6%) were for airway injury. Of these 266 cases, 87% of the injuries were temporary, 5% were permanent or disabling, and 8% resulted in death. Difficult intubation, age older than 60 years, and female gender were associated with claims for perforation of the esophagus or pharynx. Early signs of perforation were present in only 51% of perforation claims, whereas late sequelae occurred in 65%.During the SARS and COVID-19 pandemics, tracheal intubation has been used with a ventilator in severe cases where the patient struggles to breathe. Performing the procedure carries a risk of the caregiver becoming infected.
Alternatives
Although it offers the greatest degree of protection against regurgitation and pulmonary aspiration, tracheal intubation is not the only means to maintain a patent airway. Alternative techniques for airway management and delivery of oxygen, volatile anesthetics or other breathing gases include the laryngeal mask airway, i-gel, cuffed oropharyngeal airway, continuous positive airway pressure (CPAP mask), nasal BiPAP mask, simple face mask, and nasal cannula.General anesthesia is often administered without tracheal intubation in selected cases where the procedure is brief in duration, or procedures where the depth of anesthesia is not sufficient to cause significant compromise in ventilatory function. Even for longer duration or more invasive procedures, a general anesthetic may be administered without intubating the trachea, provided that patients are carefully selected, and the risk-benefit ratio is favorable (i.e., the risks associated with an unprotected airway are believed to be less than the risks of intubating the trachea).Airway management can be classified into closed or open techniques depending on the system of ventilation used. Tracheal intubation is a typical example of a closed technique as ventilation occurs using a closed circuit. Several open techniques exist, such as spontaneous ventilation, apnoeic ventilation or jet ventilation. Each has its own specific advantages and disadvantages which determine when it should be used.
Spontaneous ventilation has been traditionally performed with an inhalational agent (i.e. gas induction or inhalational induction using halothane or sevoflurane) however it can also be performed using intravenous anaesthesia (e.g. propofol, ketamine or dexmedetomidine). SponTaneous Respiration using IntraVEnous anaesthesia and High-flow nasal oxygen (STRIVE Hi) is an open airway technique that uses an upwards titration of propofol which maintains ventilation at deep levels of anaesthesia. It has been used in airway surgery as an alternative to tracheal intubation.
History
TracheotomyThe earliest known depiction of a tracheotomy is found on two Egyptian tablets dating back to around 3600 BC. The 110-page Ebers Papyrus, an Egyptian medical papyrus which dates to roughly 1550 BC, also makes reference to the tracheotomy. Tracheotomy was described in the Rigveda, a Sanskrit text of ayurvedic medicine written around 2000 BC in ancient India. The Sushruta Samhita from around 400 BC is another text from the Indian subcontinent on ayurvedic medicine and surgery that mentions tracheotomy. Asclepiades of Bithynia (c. 124–40 BC) is often credited as being the first physician to perform a non-emergency tracheotomy. Galen of Pergamon (AD 129–199) clarified the anatomy of the trachea and was the first to demonstrate that the larynx generates the voice. In one of his experiments, Galen used bellows to inflate the lungs of a dead animal. Ibn Sīnā (980–1037) described the use of tracheal intubation to facilitate breathing in 1025 in his 14-volume medical encyclopedia, The Canon of Medicine. In the 12th century medical textbook Al-Taisir, Ibn Zuhr (1092–1162)—also known as Avenzoar—of Al-Andalus provided a correct description of the tracheotomy operation.The first detailed descriptions of tracheal intubation and subsequent artificial respiration of animals were from Andreas Vesalius (1514–1564) of Brussels. In his landmark book published in 1543, De humani corporis fabrica, he described an experiment in which he passed a reed into the trachea of a dying animal whose thorax had been opened and maintained ventilation by blowing into the reed intermittently. Antonio Musa Brassavola (1490–1554) of Ferrara successfully treated a patient with peritonsillar abscess by tracheotomy. Brassavola published his account in 1546; this operation has been identified as the first recorded successful tracheotomy, despite the many previous references to this operation. Towards the end of the 16th century, Hieronymus Fabricius (1533–1619) described a useful technique for tracheotomy in his writings, although he had never actually performed the operation himself. In 1620 the French surgeon Nicholas Habicot (1550–1624) published a report of four successful tracheotomies. In 1714, anatomist Georg Detharding (1671–1747) of the University of Rostock performed a tracheotomy on a drowning victim.Despite the many recorded instances of its use since antiquity, it was not until the early 19th century that the tracheotomy finally began to be recognized as a legitimate means of treating severe airway obstruction. In 1852, French physician Armand Trousseau (1801–1867) presented a series of 169 tracheotomies to the Académie Impériale de Médecine. 158 of these were performed for the treatment of croup, and 11 were performed for "chronic maladies of the larynx". Between 1830 and 1855, more than 350 tracheotomies were performed in Paris, most of them at the Hôpital des Enfants Malades, a public hospital, with an overall survival rate of only 20–25%. This compares with 58% of the 24 patients in Trousseaus private practice, who fared better due to greater postoperative care.In 1871, the German surgeon Friedrich Trendelenburg (1844–1924) published a paper describing the first successful elective human tracheotomy to be performed for the purpose of administration of general anesthesia. In 1888, Sir Morell Mackenzie (1837–1892) published a book discussing the indications for tracheotomy. In the early 20th century, tracheotomy became a life-saving treatment for patients affected with paralytic poliomyelitis who required mechanical ventilation. In 1909, Philadelphia laryngologist Chevalier Jackson (1865–1958) described a technique for tracheotomy that is used to this day.
Laryngoscopy and non-surgical techniques
In 1854, a Spanish singing teacher named Manuel García (1805–1906) became the first man to view the functioning glottis in a living human. In 1858, French pediatrician Eugène Bouchut (1818–1891) developed a new technique for non-surgical orotracheal intubation to bypass laryngeal obstruction resulting from a diphtheria-related pseudomembrane. In 1880, Scottish surgeon William Macewen (1848–1924) reported on his use of orotracheal intubation as an alternative to tracheotomy to allow a patient with glottic edema to breathe, as well as in the setting of general anesthesia with chloroform. In 1895, Alfred Kirstein (1863–1922) of Berlin first described direct visualization of the vocal cords, using an esophagoscope he had modified for this purpose; he called this device an autoscope.In 1913, Chevalier Jackson was the first to report a high rate of success for the use of direct laryngoscopy as a means to intubate the trachea. Jackson introduced a new laryngoscope blade that incorporated a component that the operator could slide out to allow room for passage of an endotracheal tube or bronchoscope. Also in 1913, New York surgeon Henry H. Janeway (1873–1921) published results he had achieved using a laryngoscope he had recently developed. Another pioneer in this field was Sir Ivan Whiteside Magill (1888–1986), who developed the technique of awake blind nasotracheal intubation, the Magill forceps, the Magill laryngoscope blade, and several apparati for the administration of volatile anesthetic agents. The Magill curve of an endotracheal tube is also named for Magill. Sir Robert Macintosh (1897–1989) introduced a curved laryngoscope blade in 1943; the Macintosh blade remains to this day the most widely used laryngoscope blade for orotracheal intubation.Between 1945 and 1952, optical engineers built upon the earlier work of Rudolph Schindler (1888–1968), developing the first gastrocamera. In 1964, optical fiber technology was applied to one of these early gastrocameras to produce the first flexible fiberoptic endoscope. Initially used in upper GI endoscopy, this device was first used for laryngoscopy and tracheal intubation by Peter Murphy, an English anesthetist, in 1967. The concept of using a stylet for replacing or exchanging orotracheal tubes was introduced by Finucane and Kupshik in 1978, using a central venous catheter.By the mid-1980s, the flexible fiberoptic bronchoscope had become an indispensable instrument within the pulmonology and anesthesia communities. The digital revolution of the 21st century has brought newer technology to the art and science of tracheal intubation. Several manufacturers have developed video laryngoscopes which employ digital technology such as the CMOS active pixel sensor (CMOS APS) to generate a view of the glottis so that the trachea may be intubated.
See also
Intratracheal instillation
Notes
References
External links
Video of endotracheal intubation using C-MAC D-blade and bougie used as introducer.
Videos of direct laryngoscopy recorded with the Airway Cam (TM) imaging system
Examples of some devices for facilitation of tracheal intubation
Free image rich resource explaining various types of endotracheal tubes
Tracheal intubation live case 2022 |
You are a conduit for medical education. Your task is to offer detailed explanations of medical terms, ensuring they are understandable and precise. | I'm trying to understand 'Mercaptopurine' within a medical context. Could you shed some light on it? | Mercaptopurine (6-MP), sold under the brand name Purinethol among others, is a medication used for cancer and autoimmune diseases. Specifically it is used to treat acute lymphocytic leukemia (ALL), acute promyelocytic leukemia (APL), Crohns disease, and ulcerative colitis. For acute lymphocytic leukemia it is generally used with methotrexate. It is taken by mouth.Common side effects include bone marrow suppression, liver toxicity, vomiting, and loss of appetite. Other serious side effects include an increased risk of future cancer and pancreatitis. Those with a genetic deficiency in thiopurine S-methyltransferase are at higher risk of side effects. Use in pregnancy may harm the baby. Mercaptopurine
is in the thiopurine and antimetabolite family of medications.Mercaptopurine was approved for medical use in the United States in 1953. It is on the World Health Organizations List of Essential Medicines.
Medical uses
It is used to treat acute lymphocytic leukemia, Crohns disease, and ulcerative colitis.
Side effects
Some of the adverse reactions of taking mercaptopurine may include diarrhea, nausea, vomiting, loss of appetite, fatigue, stomach/abdominal pain, weakness, skin rash, darkening of the skin, and hair loss. Serious adverse reactions include mouth sores, fever, sore throat, easy bruising or bleeding, pinpoint red spots on the skin, yellowing of eyes or skin, dark urine, and painful or difficult urination. Other more serious side effects include black or tarry stools (melena), bloody stools, and bloody urine. Treatment is discontinued in up to 30% of patients due these effects but therapeutic drug monitoring of the biologically active metabolites, i.e. thiopurine nucleotides can help to optimize the efficacy and safety. Clinically, most hospitals resort to on-exchange LC-MS (liquid chromatography - mass spectrometry) but the newly developed approach of porous graphitic carbon based chromatography hyphenated with mass spectrometry appears superior with respect to patient care in this respect.Symptoms of allergic reaction to mercaptopurine include rash, itching, swelling, dizziness, trouble breathing, and inflammation of the pancreas.
In some cases, mercaptopurine may suppress the production of blood cells, both white blood cells and red blood cells. It may be toxic to bone marrow. Quarterly blood counts are necessary for people on mercaptopurine. People should stop taking the medication at least temporarily while considering alternate treatment if there is an unexplained, abnormally large drop in white blood cell count, or any other blood count.
Toxicity of mercaptopurine can be linked to genetic polymorphisms in thiopurine S-methyltransferase (TPMT), nudix hydrolase 15 (NUDT15), and inosine triphosphate pyrophosphatase (ITPA). People with specific allele variants will require dose adjustments, especially for those with homozygous variant genotypes. Large differences of TPMT and NUDT15 among ethnicities in terms of variant allele frequency should be taken into consideration in clinical practice. Caucasian people with a variant allele of the ITPA gene, experience higher rates of febrile neuropenia than people of other ethnic groups, due to differences in allelic frequencies among ethnicities.
Precautions
Mercaptopurine can lower the bodys ability to fight off infection. Those taking it should get permission from a doctor to receive immunizations and vaccinations. It is also recommended that, while on the drug, one should avoid those having recently received oral polio vaccine.
This drug was formerly not recommended during pregnancy and early evidence indicated pregnant women on the drug (or the related azathioprine) showed a seven-fold incidence of fetal abnormalities as well as a 20-fold increase in miscarriage. There were also anecdotal reports linking mercaptopurine with spontaneous abortion, leading to the US FDA rating both AZA and mercaptopurine as category D drugs. However, Davis et al. 1999 found mercaptopurine, compared to methotrexate, was ineffective as a single-agent abortifacient; every woman in the mercaptopurine arm of the study had fetal cardiac activity at follow-up (two weeks later) and was given a suction abortion. A more recent, larger study, however, performed by the Cancers et Surrisque Associe aux Maladies inflamatoires intestinales En France (CESAME) indicated an overall rate of congenital malformations not significantly greater than the general population in France. The European Crohns and Colitis Organisation (ECCO) concluded in a consensus paper in 2010 that while AZA and mercaptopurine have an FDA rating of D, new research in both animals and humans indicates that "thiopurines are safe and well tolerated during pregnancy."Mercaptopurine causes changes to chromosomes in animals and humans, though a study in 1990 found, "while the carcinogenic potential of 6-MP cannot be precluded, it can be only very weak or marginal." Another study in 1999 noted an increased risk of developing leukemia when taking large doses of 6-MP with other cytotoxic drugs.
Drug interactions
Allopurinol inhibits xanthine oxidase, the enzyme that breaks down mercaptopurine. Those taking allopurinol (often used to prevent gout) are at risk for mercaptopurine toxicity. The dose should be reduced or allopurinol should be discontinued.
Several published studies have demonstrated that the use of allopurinol in combination with low dose 6-MP helps reduce 6-MP levels, which are toxic to liver tissue, whilst increasing the therapeutic levels of 6-MP for some inflammatory conditions.
Mechanisms of action
Official information from the package insert for purinethol:
Mercaptopurine is an antimetabolite antineoplastic, as such it interferes with normal metabolic processes within cells, typically by combining with enzymes, to disrupt DNA and RNA synthesis (cell-cycle S phase-specific) leading to death of rapidly proliferating cells, especially malignant ones. Specifically, Mercaptopurine is a purine antimetabolite or purine antagonist as such inhibits DNA synthesis by inhibiting the production of the purine containing nucleotides, adenine and guanine thus halting DNA synthesis. Mercaptopurine also acts as an immunomodulator by inhibiting of several pathways in nucleic acid biosynthesis preventing proliferation of cells involved in the determination and amplification of the immune response.
Mercaptopurine (6-MP) competes with the purine derivatives hypoxanthine and guanine for the enzyme HGPRT and is itself converted to thio inosine monophosphate (TIMP).
TIMP inhibits several chemical reactions involving inosinic acid (IMP), including the conversion of IMP to xanthylic acid (XMP) and the conversion of IMP to adenylic acid (AMP) via adenylosuccinate (SAMP).
In addition, 6-methylthioinosinate (MTIMP) is formed by the methylation of TIMP.
Both TIMP and MTIMP have been reported to inhibit glutamine-5-phosphoribosylpyrophosphate amidotransferase, the first enzyme unique to the de novo pathway for purine ribonucleotide synthesis. Experiments indicate that radiolabeled mercaptopurine may be recovered from the DNA in the form of deoxythioguanosine.
Some mercaptopurine is converted to nucleotide derivatives of 6-thioguanine (6-TG) by the sequential actions of inosinate (IMP) dehydrogenase and xanthylate (XMP) aminase, converting TIMP to thioguanylic acid (TGMP).
Animal tumors that are resistant to mercaptopurine often have lost the ability to convert mercaptopurine to TIMP. However, it is clear that resistance to mercaptopurine may be acquired by other means as well, particularly in human leukemias.
It is not known exactly which of any one or more of the biochemical effects of mercaptopurine and its metabolites are directly or predominantly responsible for cell death.6-MP ribonucleotide inhibits purine nucleotide synthesis and metabolism by inhibiting an enzyme called phosphoribosyl pyrophosphate amidotransferase (PRPP amidotransferase). Since this enzyme is the rate limiting factor for purine synthesis, this alters the synthesis and function of RNA and DNA. Mercaptopurine interferes with nucleotide interconversion and glycoprotein synthesis.
Pharmacogenetics
The enzyme thiopurine S-methyltransferase (TPMT) is responsible, in part, for the inactivation of 6-mercaptopurine. TPMT catalyzes the methylation of 6-mercaptopurine into the inactive metabolite 6-methylmercaptopurine – this methylation prevents mercaptopurine from further conversion into active, cytotoxic thioguanine nucleotide (TGN) metabolites. Certain genetic variations within the TPMT gene can lead to decreased or absent TPMT enzyme activity, and individuals who are homozygous or heterozygous for these types of genetic variations may have increased levels of TGN metabolites and an increased risk of severe bone marrow suppression (myelosuppression) when receiving mercaptopurine. In many ethnicities, TPMT polymorphisms that result in decreased or absent TPMT activity occur with a frequency of approximately 5%, meaning that about 0.25% of people are homozygous for these variants. However, an assay of TPMT activity in red blood cells or a TPMT genetic test can identify people with reduced TPMT activity, allowing for the adjustment of mercaptopurine dose or avoidance of the drug entirely. The FDA-approved drug label for mercaptopurine recommends testing for TPMT activity to identify people at risk for myelotoxicity. Testing for TPMT activity is an example of pharmacogenetics being translated into routine clinical care.
History
6-MP was discovered by Nobel Prize winning scientists Gertrude B. Elion and George H. Hitchings at Burroughs Wellcome in Tuckahoe, New York, and was clinically developed in collaboration with investigators at Memorial Hospital (now Memorial Sloan Kettering Cancer Center in New York City). The collaboration was initiated by Cornelius P. Rhoads who had run chemical weapons programs for the US army and had been involved in the work that led to the discovery that nitrogen mustards could potentially be used as cancer drugs, and had become the director of Memorial in 1948.
See also
Azathioprine
Tioguanine
References
Further reading
Dean L (2012). "Mercaptopurine Therapy and TPMT Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical Genetics Summaries. National Center for Biotechnology Information (NCBI). PMID 28520348. Bookshelf ID: NBK100660.
External links
"Mercaptopurine". Drug Information Portal. U.S. National Library of Medicine. |
You are a resource for medical understanding. Offer detailed explanations of medical terms, making complex concepts clear and comprehensible. | I've come across the term 'Caudal regression syndrome' in a medical context, but I'm not sure what it means. Can you clarify? | Caudal regression syndrome, or sacral agenesis (or hypoplasia of the sacrum), is a rare birth defect. It is a congenital disorder in which the fetal development of the lower spine—the caudal partition of the spine—is abnormal. It occurs at a rate of approximately one per 60,000 live births.Some babies are born with very small differences compared to typical development, and others have significant changes. Most grow up to be otherwise typical adults who have difficulty with walking and incontinence.
Signs and symptoms
This condition exists in a variety of forms, ranging from partial absence of the tail bone regions of the spine to absence of the lower vertebrae, pelvis and parts of the thoracic and/or lumbar areas of the spine. In some cases where only a small part of the spine is absent, there may be no outward sign of the condition. In cases where more substantial areas of the spine are absent, there may be fused, webbed or smaller lower extremities and paralysis. Bowel and bladder control is usually affected.
Cause
The condition arises from some factor or set of factors present during approximately the 3rd week to 7th week of fetal development. Formation of the sacrum/lower back and corresponding nervous system is usually nearing completion by the 4th week of development. Due to abnormal gastrulation, the mesoderm migration is disturbed. This disturbance results in symptoms varying from minor lesions of the lower vertebrae to more severe symptoms such as complete fusion of the lower limbs. While the exact cause is unknown, it has been speculated that the condition has a combination of environmental and genetic causes, and that various types of the condition may have differing causes.Sacral agenesis syndrome (a type of caudal regression syndrome involving agenesis of the lumbar spine, sacrum, and coccyx, and hypoplasia of the lower extremities) is a well-established congenital anomaly associated with maternal diabetes mellitus. Other causes are presumably involved, as demonstrated by the rare overall incidence of caudal regression syndrome (1:60,000) compared to diabetes; however, the condition does have a greatly increased incidence among infants born to mothers with diabetes, estimated at 1 in 350 newborns of mothers with diabetes.The dominant inherited sacral agenesis (also referred to as Currarino syndrome) is very often correlated with a mutation in the Hb9 (also called HlxB9) gene (shown by Sally Ann Lynch, 1995, Nature Genetics).It was previously thought to be related to sirenomelia ("Mermaid syndrome") but has now been determined not to be related to this condition.
Prognosis
There are four levels (or types) of malformation. The least severe indicates partial deformation (unilateral) of the sacrum. The second level indicates a bilateral (uniform) deformation. The most severe types involve a total absence of the sacrum.Depending on the type of sacral agenesis, bowel or urinary bladder deficiencies may be present. A permanent colostomy may be necessary in the case of imperforate anus. Incontinence may also require some type of continence control system (e.g., self-catheterization) be utilized. The condition often impacts the formation of the knees, legs or feet that is sometimes addressed through surgery. For some with tightly webbed, bent knees or knees that are fused straight, disarticulation surgery at the knee may be a viable option to maximize mobility options.Before more comprehensive medical treatment was available, full amputation of the legs at the hip was often performed. More recently, the amputation (actually a disarticulation because no cutting of the bone is involved) is done at the knee for those who have bent knee positions and webbing between thigh and calf to enable more ease of mobility and better seating. Some children with knee disarticulation use prosthetic legs to walk. Prosthetics for children without substantial hip and trunk control is usually abandoned in favor of faster and easier wheelchair mobility as the childs weight and age increase. Children may walk on their hands and generally are able to climb and move about to accomplish whatever they need and want to accomplish. Children more mildly affected may have normal gait and no need for assistive devices for walking. Others may walk with bracing or crutches.There is typically no cognitive impairment associated with this disability. Adults with this disability live independently, attend college, and have careers in various fields. In 2012, Spencer West, a man with sacral agenesis and both legs amputated, climbed Mount Kilimanjaro using only his hands. In 2021, athlete Zion Clark broke the Guinness World Record 20m running on hands.
Society and culture
Notable people
Zion Clark, American track athlete and wrestler, 2022 Guinness World Record holder (20m hand sprint in 4.78 seconds)
Rebecca Dubber, New Zealand para-swimmer and Rio 2016 Paralympic bronze medalist
Kenny Easterday, played a fictionalized version of himself in the film Kenny
Johnny Eck, American freak show performer
Kurt Fearnley, Australian wheelchair racer
Chloé Cooper Jones, American philosopher and author
Bobby Martin, American footballer
Kevin McKee, two-times Olympic champion and two-times world champion in sledge hockey
Sainimili Naivalu, Fijian wheelchair table tennis medallist and disability rights activists
Victoria Pendergast, first female Australian sit-skier at Winter Paralympics
Jessica Rogers, American wheelchair racer and swimmer, founder and President of iSACRA (International Caudal Regression Syndrome Association)
Rose Siggins, actress (American Horror Story: Freak Show)
References
== External links == |
You serve as a medical tutor. Your objective is to demystify medical terms, providing thorough explanations that cater to various levels of medical knowledge. | What does the medical term 'Thyrotoxicosis factitia' encompass? | Thyrotoxicosis factitia (alimentary thyrotoxicosis, exogenous thyrotoxicosis) refers to a condition of thyrotoxicosis caused by the ingestion of exogenous thyroid hormone. It can be the result of mistaken ingestion of excess drug, such as levothyroxine and triiodothyronine, or as a symptom of Munchausen syndrome. It is an uncommon form of hyperthyroidism.
Patients present with hyperthyroidism and may be mistaken for Graves’ disease, if TSH receptor positive, or thyroiditis because of absent uptake on a thyroid radionuclide uptake scan due to suppression of thyroid function by exogenous thyroid hormones. Ingestion of thyroid hormone also suppresses thyroglobulin levels helping to differentiate thyrotoxicosis factitia from other causes of hyperthyroidism, in which serum thyroglobulin is elevated. Caution, however, should be exercised in interpreting thyroglobulin results without thyroglobulin antibodies, since thyroglobulin antibodies commonly interfere in thyroglobulin immunoassays causing false positive and negative results which may lead to clinical misdirection. In such cases, increased faecal thyroxine levels in thyrotoxicosis factitia may help differentiate it from other causes of hyperthyroidism.
See also
Foodborne illness
Liothyronine
References
== External links == |
You are a medical lexicon. Explain medical terminology with depth and clarity, making sure the information is both accurate and easy to grasp. | I'm looking for a concise explanation of the medical term 'Flucytosine.' | Flucytosine, also known as 5-fluorocytosine (5-FC), is an antifungal medication. It is specifically used, together with amphotericin B, for serious Candida infections and cryptococcosis. It may be used by itself or with other antifungals for chromomycosis. Flucytosine is used by mouth and by injection into a vein.Common side effects include bone marrow suppression, loss of appetite, diarrhea, vomiting, and psychosis. Anaphylaxis and other allergic reactions occasionally occur. It is unclear if use in pregnancy is safe for the baby. Flucytosine is in the fluorinated pyrimidine analogue family of medications. It works by being converted into fluorouracil inside the fungus, which impairs its ability to make protein.Flucytosine was first made in 1957. It is on the World Health Organizations List of Essential Medicines. As of 2016, in the United States the medication cost about US$2,000 per day while in the United Kingdom it is about US$22 per day. It is not available in much of the developing world.
Medical uses
Flucytosine by mouth is used for the treatment of serious infections caused by susceptible strains of Candida or Cryptococcus neoformans. It can also be used for the treatment of chromomycosis (chromoblastomycosis), if susceptible strains cause the infection. Flucytosine must not be used as a sole agent in life-threatening fungal infections due to relatively weak antifungal effects and fast development of resistance, but rather in combination with amphotericin B and/or azole antifungals such as fluconazole or itraconazole. Minor infections such as candidal cystitis may be treated with flucytosine alone. In some countries, treatment with slow intravenous infusions for no more than a week is also a therapeutic option, particular if the disease is life-threatening.
Serious fungal infections may occur in those who are immunocompromised. These people benefit from combination therapy including flucytosine, but the incidence of side-effects of a combination therapy, particular with amphotericin B, may be higher.
Pregnancy and breastfeeding
In animal models (rats), flucytosine has been found to be teratogenic. Sufficient human data does not exist. Pregnant women should be given flucytosine only if the potential benefits exceed the potential harm to the fetus.
It is not known if flucytosine is distributed in human breast milk. Given the potential risk to the child, the patient should not breastfeed during treatment with flucytosine.
Children
The efficacy and safety in patients under 18 years of age has not been determined.
Side effects
Patients treated with drugs compromising bone marrow function (e.g. cytostatics) should be treated carefully. Blood cell counts should be taken very frequently.
Patients with renal disease should receive flucytosine cautiously and in reduced doses. Guidelines for proper dosing exist. Serum level determinations are mandatory for these patients.
All patients receiving flucytosine should be under strict medical supervision.
Hematological, renal and liver function studies should be done frequently during therapy (initially daily, twice a week for the rest of treatment).
Patients with preexisting bone marrow depression and liver impairment should be treated with caution.
Antiproliferative actions on bone marrow and GI tissue: Due to the drugs preference for rapidly proliferating tissues, bone marrow depression (anemia, leukopenia, pancytopenia, or even rarely agranulocytosis) may occur. Aplastic anemia has also been seen. Bone marrow toxicity can be irreversible and may cause death, particularly in immunocompromised patients. GI toxicity may be severe or rarely fatal and consists of anorexia, abdominal bloating, abdominal pain, diarrhea, dry mouth, duodenal ulcer, GI hemorrhage, nausea, vomiting, and ulcerative colitis.
Liver function: Elevations of liver enzymes and bilirubin, hepatic dysfunction, jaundice and, in one patient, liver necrosis have all been seen. Some fatal cases have been reported; however, the majority of cases was reversible.
Renal function: Increased BUN and serum creatinine have been noted. Crystalluria (formation of crystals and excretion in the urine) and acute kidney injury have also been seen.
Adverse central nervous system effects are frequent and include confusion, hallucinations, psychosis, ataxia, hearing loss, headache, paresthesia, parkinsonism, peripheral neuropathy, vertigo and sedation.
Skin reactions: Rash, pruritus, and photosensitivity have all been noticed. Toxic epidermal necrolysis (Lyells syndrome) may also be encountered and may be life-threatening.
Anaphylaxis: Sometimes cases of anaphylaxis consisting of diffuse erythema, pruritus, conjunctival injection, fever, abdominal pain, edema, hypotension and bronchospastic reactions are observed.It is not known if flucytosine is a human carcinogen. The issue has been raised because traces of 5-fluorouracil, which is a known carcinogen, are found in the colon resulting from the metabolization of flucytosine.
Interactions
Flucytosine may increase the toxicity of amphotericin B and vice versa, although the combination may be life-saving and should be used whenever indicated (e.g., cryptococcal meningitis). The cytostatic cytarabine inhibits the antimycotic activity of flucytosine.
Overdose
Symptoms and their severities are unknown, because flucytosine is used under close medical supervision, but expected to be an excess of the usually encountered side effects on the bone marrow, gastrointestinal tract, liver and kidney function. Vigorous hydration and hemodialysis may be helpful in removing the drug from the body. Hemodialysis is particular useful in patients with impaired renal function.
Pharmacology
Mechanisms of action
Two major mechanisms of action have been elucidated:
Flucytosine is intrafungally converted into the cytostatic fluorouracil which undergoes further steps of activation and finally interacts as 5-fluorouridinetriphosphate with RNA biosynthesis thus disturbing the building of certain essential proteins.
Flucytosine also undergoes conversion into 5-fluorodeoxyuridinemonophosphate which inhibits fungal DNA synthesis.
Spectrum of susceptible fungi and resistance
Flucytosine is active in vitro as well as in vivo against some strains of Candida and Cryptococcus. Limited studies demonstrate that flucytosine may be of value against infections with Sporothrix, Aspergillus, Cladosporium, Exophiala, and Phialophora.
Resistance is quite commonly seen as well in treatment-naive patients and under current treatment with flucytosine. In different strains of Candida resistance has been noted to occur in 1 to 50% of all specimens obtained from patients.
Pharmacokinetic data
Flucytosine is well absorbed (75 to 90%) from the gastrointestinal tract. Intake with meals slows the absorption, but does not decrease the amount absorbed. Following an oral dose of 2 grams peak serum levels are reached after approximately 6 hours. The time to peak level decreases with continued therapy. After 4 days peak levels are measured after 2 hours. The drug is eliminated renally. In normal patients flucytosine has reportedly a half-life of 2.5 to 6 hours. In patients with impaired renal function higher serum levels are seen and the drug tends to accumulate. The drug is mainly excreted unchanged in the urine (90% of an oral dose) and only traces are metabolized and excreted in the feces. Therapeutic serum levels range from 25 to 100 μg/ml. Serum levels in excess of 100 μg are associated with a higher incidence of side effects. Periodic measurements of serum levels are recommended for all patients and are a must in patients with renal damage.
Economics
Although a generic, off patent medication in the U.S., as of January 2016, there was only one FDA-approved pharmaceutical supplier, Valeant Pharmaceuticals. Due to this monopoly, the cost per 250 mg tablet was $70.46 per tablet for a daily treatment cost of ~$2110/day for a 75 kg adult (165 pounds) adult and $29,591 for a two-week treatment course as of December 2015. This cost of flucytosine is more than 100-fold higher in the U.S. than in the United Kingdom and Europe via Meda AB Pharmaceuticals. Flucytosine tablets are available in India for US$2.00 per tablet via Jolly Healthcare Pvt. Ltd. and are available in 100 tablet packs.
Other animals
In some countries, such as Switzerland, flucytosine has been licensed to treat cats, dogs and birds (in most cases together with amphotericin B) for the same indications as in humans.
References
External links
"Flucytosine". Drug Information Portal. U.S. National Library of Medicine. |
You are an assistant in medical learning. Your role is to clarify medical terminology, ensuring the information is both accurate and accessible. | I'm encountering the term 'Binge eating disorder' in medical literature. What's its definition? | Binge eating disorder (BED) is an eating disorder characterized by frequent and recurrent binge eating episodes with associated negative psychological and social problems, but without the compensatory behaviors common to bulimia nervosa, OSFED, or the binge-purge subtype of anorexia nervosa.
BED is a recently described condition, which was required to distinguish binge eating similar to that seen in bulimia nervosa but without characteristic purging. Individuals who are diagnosed with bulimia nervosa and binge eating disorder exhibit similar patterns of compulsive overeating, neurobiological features of dysfunctional cognitive control and food addiction, and biological and environmental risk factors. Some professionals consider BED to be a milder form of bulimia with the two conditions on the same spectrum.Binge eating is one of the most prevalent eating disorders among adults, though there tends to be less media coverage and research about the disorder in comparison to anorexia nervosa and bulimia nervosa.
Signs and symptoms
Binge eating is the core symptom of BED; however, not everyone who binge eats has BED. An individual may occasionally binge eat without experiencing many of the negative physical, psychological, or social effects of BED. This may be considered disordered eating rather than a clinical disorder. Precisely defining binge eating can be problematic, however binge eating episodes in BED are generally described as having the following potential features:
Eating much faster than normal, perhaps in a short space of time
Eating until feeling uncomfortably full
Eating a large amount when not hungry
Subjective loss of control over how much or what is eaten
Binges may be planned in advance, involving the purchase of special binge foods, and the allocation of specific time for binging, sometimes at night
Eating alone or secretly due to embarrassment over the amount of food consumed
There may be a dazed mental state during the binge
Not being able to remember what was eaten after the binge
Feelings of guilt, shame or disgust following a food binge
Body image disturbanceIn contrast to bulimia nervosa, binge eating episodes are not regularly followed by activities intended to compensate for the amount of food consumed, such as self-induced vomiting, laxative or enema misuse, or strenuous exercise. BED is characterized more by overeating than dietary restriction. Those with BED often have poor body image and frequently diet, but are unsuccessful due to the severity of their binge eating.Obesity is common in persons with BED, as is depression, low self-esteem, stress and boredom. Those with BED are also at risk of Non-alcoholic fatty liver disease, menstrual irregularities such as amenorrhea, and gastrointestinal problems such as acid reflux and heartburn.
Causes
As with other eating disorders, binge eating is an "expressive disorder"—a disorder that is an expression of deeper psychological problems. People who have binge eating disorder have been found to have higher weight bias internalization, which includes low self-esteem, unhealthy eating patterns, and general body dissatisfaction. Binge eating disorder commonly develops as a result or side effect of depression, as it is common for people to turn to comfort foods when they are feeling down.There was resistance to give binge eating disorder the status of a fully fledged eating disorder because many perceived binge eating disorder to be caused by individual choices. Previous research has focused on the relationship between body image and eating disorders, and concludes that disordered eating might be linked to rigid dieting practices. In the majority of cases of anorexia, extreme and inflexible restriction of dietary intake leads at some point to the development of binge eating, weight regain, bulimia nervosa, or a mixed form of eating disorder not otherwise specified. Binge eating may begin when individuals recover from an adoption of rigid eating habits. When under a strict diet that mimics the effects of starvation, the body may be preparing for a new type of behavior pattern, one that consumes a large amount of food in a relatively short period of time.Some studies show that BED aggregates in families and could be genetic. However, very few published studies around the genetics exist.However, other research suggests that binge eating disorder can also be caused by environmental factors and the impact of traumatic events. One study showed that women with binge eating disorder experienced more adverse life events in the year prior to the onset of the development of the disorder, and that binge eating disorder was positively associated with how frequently negative events occur. Additionally, the research found that individuals who had binge eating disorder were more likely to have experienced physical abuse, perceived risk of physical abuse, stress, and body criticism. Other risk factors may include childhood obesity, critical comments about weight, low self-esteem, depression, and physical or sexual abuse in childhood. A systematic review concluded that bulimia nervosa and binge eating disorder are more impacted by family separations, a loss in their lives and negative parent-child interactions compared to those with anorexia nervosa. A few studies have suggested that there could be a genetic component to binge eating disorder, though other studies have shown more ambiguous results. Studies have shown that binge eating tends to run in families and a twin study by Bulik, Sullivan, and Kendler has shown a, "moderate heritability for binge eating" at 41 percent. More research must be done before any firm conclusions can be drawn regarding the heritability of binge eating disorder. Studies have also shown that eating disorders such as anorexia and bulimia reduce coping abilities, which makes it more likely for those suffering to turn to binge eating as a coping strategy.A correlation between dietary restraint and the occurrence of binge eating has been shown in some research. While binge eaters are often believed to be lacking in self-control, the root of such behavior might instead be linked to rigid dieting practices. The relationship between strict dieting and binge eating is characterized by a vicious circle. Binge eating is more likely to occur after dieting, and vice versa. Several forms of dieting include delay in eating (e.g., not eating during the day), restriction of overall calorie intake (e.g., setting calorie limit to 1,000 calories per day), and avoidance of certain types of food (e.g., "forbidden" food, such as sugar, carbohydrates, etc.) Strict and extreme dieting differs from ordinary dieting. Some evidence suggests the effectiveness of moderate calorie restriction in decreasing binge eating episodes among overweight individuals with binge eating disorder, at least in the short-term."In the U.S, it is estimated that 3.5% of young women and 30% to 40% of people who seek weight loss treatments, can be clinically diagnosed with binge eating disorder."
Diagnosis
International Classification of Diseases
BED was first included in the Diagnostic and Statistical Manual of Mental Disorders (DSM) in 1994 simply as a feature of eating disorder. In 2013 it gained formal recognition as a psychiatric condition in the DSM-5.The 2017 update to the American version of the ICD-10 includes BED under F50.81. ICD-11 may contain a dedicated entry (6B62), defining BED as frequent, recurrent episodes of binge eating (once a week or more over a period of several months) which are not regularly followed by inappropriate compensatory behaviors aimed at preventing weight gain.
Diagnostic and Statistical Manual
Previously considered a topic for further research exploration, binge eating disorder was included in the Diagnostic and Statistical Manual of Mental Disorders in 2013. Until 2013, binge eating disorder was categorized as an Eating Disorder Not Otherwise Specified, an umbrella category for eating disorders that dont fall under the categories for anorexia nervosa or bulimia nervosa. Because it was not a recognized psychiatric disorder in the DSM until 2013, it has been difficult to obtain insurance reimbursement for treatments. The disorder now has its own category under DSM-5, which outlines the signs and symptoms that must be present to classify a persons behavior as binge eating disorder. Studies have confirmed the high predictive value of these criteria for diagnosing BED.According to the World Health Organizations ICD-11 classification of BED, the severity of the disorder can be classified as mild (1-3 episodes/week), moderate (4-7 episodes/week), severe (8-13 episodes/week) and extreme (>14 episodes/week).One study claims that the method for diagnosing BED is for a clinician to conduct a structured interview using the DSM-5 criteria or taking the Eating Disorder Examination. The Structured Clinical Interview takes no more than 75 minutes to complete and has a systematic approach which follows the DSM-5 criteria. The Eating Disorder Examination is a semi-structured interview which identifies the frequency of binges and associated eating disorder features.
Treatment
Counselling and certain medication, such as lisdexamfetamine and selective serotonin reuptake inhibitor (SSRIs), may help. Some recommend a multidisciplinary approach in the treatment of the disorder.
Counselling
Cognitive behavioral therapy (CBT) treatment has been demonstrated as a more effective form of treatment for BED than behavioral weight loss programs. 50 percent of BED individuals achieve complete remission from binge eating and 68-90% will reduce the amount of binge eating episodes they have. CBT has also been shown to be an effective method to address self-image issues and psychiatric comorbidities (e.g., depression) associated with the disorder. The goal of CBT is to interrupt binge-eating behaviour, learn to create a normal eating schedule, change the perception around weight and shape and develop positive attitudes about ones body. Although this treatment is successful in eliminating binge eating episodes, it does not lead to losing any weight. Recent reviews have concluded that psychological interventions such as psychotherapy and behavioral interventions are more effective than pharmacological interventions for the treatment of binge eating disorder. A meta-analysis concluded that psychotherapy based on CBT not only significantly improved binge-eating symptomatology but also reduced a clients BMI significantly at posttreatment and longer than 6 and 12 months after treatment. There is the 12-step Overeaters Anonymous or Food Addicts in Recovery Anonymous. Behavioral weight loss treatment has been proven to be effective as a means to achieve weight loss amongst patients.
Medication
Lisdexamfetamine is a USFDA-approved drug that is used for the treatment of moderate to severe binge eating disorder in adults. As of 2021, it is the first and only medication formally approved for the treatment of BED. It is thought that lisdexamfetamine treats BED through a combination of effects on appetite and satiety, reward, and cognitive processes, including attention, impulsivity, and behavioral inhibition.Three other classes of medications are also used in the treatment of binge eating disorder: antidepressants, anticonvulsants, and anti-obesity medications. Antidepressant medications of the selective serotonin reuptake inhibitor (SSRI) have been found to effectively reduce episodes of binge eating and reduce weight. Similarly, anticonvulsant medications such as topiramate and zonisamide may be able to effectively suppress appetite. The long-term effectiveness of medication for binge eating disorder is currently unknown. For BED patients with manic episodes, risperidone is recommended. If BED patients have bipolar depression, lamotrigine is appropriate to use.Trials of antidepressants, anticonvulsants, and anti-obesity medications suggest that these medications are superior to placebo in reducing binge eating. Medications are not considered the treatment of choice because psychotherapeutic approaches, such as CBT, are more effective than medications for binge eating disorder. A meta-analysis concluded that using medications did not reduce binge-eating episodes and BMI posttreatment at 6–12 months. This indicates a potential possibility of relapse after withdrawal from the medications. Medications also do not increase the effectiveness of psychotherapy, though some patients may benefit from anticonvulsant and anti-obesity medications, such as phentermine/topiramate, for weight loss.Blocking opioid receptors leads to less food intake. Additionally, bupropion and naltrexone used together may cause weight loss. Combining these alongside psychotherapies like CBT may lead to better outcomes for BED.
Surgery
Bariatric surgery has also been proposed as another approach to treat BED and a recent meta-analysis showed that approximately two-thirds of individuals who seek this type of surgery for weight loss purposes have BED. Bariatric surgery recipients who had BED prior to receiving the surgery tend to have poorer weight-loss outcomes and are more likely to continue to exhibit eating behaviors characteristic of BED.
Lifestyle Interventions
Other treatments for BED include lifestyle interventions like weight training, peer support groups, and investigation of hormonal abnormalities.
Prognosis
Individuals with BED often have a lower overall quality of life and commonly experience social difficulties. Early behavior change is an accurate prediction of remission of symptoms later.Individuals who have BED commonly have other comorbidities such as major depressive disorder, personality disorder, bipolar disorder, substance abuse, body dysmorphic disorder, kleptomania, irritable bowel syndrome, fibromyalgia, or an anxiety disorder. Individuals may also exhibit varying degrees of panic attacks and a history of attempted suicide.While people of a normal weight may overeat occasionally, an ongoing habit of consuming large amounts of food in a short period of time may ultimately lead to weight gain and obesity. The main physical health consequences of this type of eating disorder are brought on by the weight gain resulting from calorie-laden bingeing episodes. Mental and emotional consequences of binge eating disorder include social weight stigma and emotional loss of control. Up to 70% of individuals with BED may also be obese, and therefore obesity-associated morbidities such as high blood pressure and coronary artery disease type 2 diabetes mellitus gastrointestinal issues (e.g., gallbladder disease), high cholesterol levels, musculoskeletal problems and obstructive sleep apnea may also be present.
Epidemiology
General
The prevalence of BED in the general population is approximately 1-3%.BED cases usually occur between the ages of 12.4 and 24.7, but prevalence rates increase until the age of 40.Binge eating disorder is the most common eating disorder in adults.The limited amount of research that has been done on BED shows that rates of binge eating disorder are fairly comparable among men and women. The lifetime prevalence of binge eating disorder has been observed in studies to be 2.0 percent for men and 3.5 percent for women, higher than that of the commonly recognized eating disorders anorexia nervosa and bulimia nervosa. However another systematic literature review found the prevalence average to be about 2.3% in women and about 0.3% in men. Lifetime prevalence rates for BED in women can range anywhere from 1.5 to 6 times higher than in men. One literature review found that point prevalence rates for BED vary from 0.1 percent to 24.1 percent depending on the sample. This same review also found that the 12-month prevalence rates vary between 0.1 percent to 8.8 percent.Recent studies found that eating disorders which included anorexia nervosa, bulimia nervosa and binge-eating disorder are common among sexual and gender minority populations, including gay, lesbian, bisexual and transgender people. This could be due to the minority stress and discrimination this population experiences.Due to limited and inconsistent information and research on ethnic and racial differences, prevalence rates are hard to determine for BED. Rates of binge eating disorder have been found to be similar among black women, white women, and white men, while some studies have shown that binge eating disorder is more common among black women than among white women. However, majority of the research done around BED is focused on White women. One literature review found information citing no difference between BED prevalence among Hispanic, African American, and White women while other information found that BED prevalence was highest among Hispanics followed by Black individuals and finally White people.
Worldwide Prevalences
Eating disorders have usually been considered something that was specific to Western countries. However, the prevalence of eating disorders is increasing in other non-Western countries. Though the research on binge eating disorders tends to be concentrated in North America, the disorder occurs across cultures. In the US, BED is present in 0.8% of male adults and 1.6% of female adults in a given year.The prevalence of BED is lower in Nordic countries compared to Europe in a study that included Finland, Sweden, Norway, and Iceland. The point prevalence ranged from 0.4 to 1.5 percent and the lifetime prevalence ranged from 0.7 to 5.8 percent for BED in women.In a study that included Argentina, Brazil, Chile, Colombia, Mexico, and Venezuela, the point prevalence for BED was 3.53 percent. Therefore, this particular study found that the prevalence for BED is higher in these Latin American countries compared to Western countries.The prevalence of BED in Europe ranges from <1 to 4 percent.
Co-morbidities
BED is co-morbid with diabetes, hypertension, previous stroke, and heart disease in some individuals.In people who have obsessive-compulsive disorder or bipolar I or II disorders, BED lifetime prevalence was found to be higher.Additionally, 30 to 40 percent of individuals seeking treatment for weight-loss can be diagnosed with binge eating disorder.
Underreporting in men
Eating disorders are oftentimes underreported in men. Underreporting could be a result of measurement bias due to how eating disorders are defined. The current definition for eating disorders focuses on thinness. However, eating disorders in men tend to center on muscularity and would therefore warrant a need for a different measurement definition. Further research should focus on including more men in samples since previous research has focused primarily on women.
Frequency
BED is the most common eating disorder, with 47% of people with eating disorders have BED, 3% of them have anorexia nervosa and 12% of them have bulimia nervosa . In the United States, it has been estimated that 2.8 million people are affected by BED. Over 57% of people with BED are female and it often begins in the late teens or early 20s.
History
The disorder was first described in 1959 by psychiatrist and researcher Albert Stunkard as "night eating syndrome" (NES). The term "binge eating" was coined to describe the same bingeing-type eating behavior but without the exclusive nocturnal component.There is generally less research on binge eating disorder in comparison to anorexia nervosa and bulimia nervosa.
See also
Prader–Willi syndrome
References
Bibliography
External links
Binge Eating Disorder on Medscape
Binge Eating Disorder on National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) |
You serve as a guide in the medical field. Explain medical terms thoroughly, ensuring the information is both insightful and comprehensible. | Could you offer a clear explanation of the term 'Jamaican vomiting sickness' as used in the medical field? | Jamaican vomiting sickness, also known as toxic hypoglycemic syndrome (THS), acute ackee fruit intoxication, or ackee poisoning, is an acute illness caused by the toxins hypoglycin A and hypoglycin B, which are present in fruit of the ackee tree. While in the fully ripened arils, hypoglycin A is at levels of less than 0.1 ppm, in unripe arils it can be over 1000 ppm and can cause vomiting and even death. Some countries in the Caribbean and Western Africa experience frequent cases.
Presentation
Abdominal discomfort begins two to six hours after eating unripe ackee fruit, followed by sudden onset vomiting. In severe cases, profound dehydration, seizures, coma, and death may ensue. Children and those who are malnourished are more susceptible to the disease.
Pathophysiology
When ingested, hypoglycin A is metabolized to produce methylenecyclopropylacetic acid (MCPA). MCPA acts to inhibit the beta-oxidation of fatty acids in two ways. First, it interferes with the transport of long-chain fatty acids into the mitochondria. Also, it inhibits acyl-CoA dehydrogenases, so that only unsaturated fatty acids can be fully oxidized. Fatty acids accumulate in the liver in a microvesicular pattern that can be seen on biopsy. In the absence of fatty acid metabolism, the body becomes dependent on glucose and glycogen for energy. Octreotide can be used to reduce the secretion of insulin by the pancreas, thereby preventing severe hypoglycemia.Inhibition of beta-oxidation of fatty acids, however, also depletes a necessary cofactor for gluconeogenesis. Once the liver glycogen stores are depleted, the body cannot synthesize glucose, and severe hypoglycemia results.Initial symptoms appear after about four hours, and deaths have been reported from 12 to 48 hours following consumption. Supportive care involves carefully metered IV glucose infusion and fluid/eletrolyte replacement; Mortality was 80% before glucose infusion was introduced in 1954. A similar outbreak of lethal hypoglycemic encephalopathy has been linked to the consumption of lychee fruit in Muzaffarpur, India. Urinalysis of children affected by the disease has shown all affected have elevated levels of hypoglycin suggesting the same underlying pathophysiology as Jamaican vomiting sickness.
Diagnosis
In popular culture
The disease appears in the ER episode "Great Expectations", where the symptoms are recognised by Dr Mallucci who, it is later revealed, attended medical school in Grenada.
== References == |
You function as a medical explainer. Your task is to convey the meanings of medical terms in a detailed, yet easy-to-understand manner. | Could you offer a clear explanation of the term 'Entoptic phenomenon' as used in the medical field? | Entoptic phenomena (from Ancient Greek ἐντός (entós) within, and ὀπτικός (optikós) visual) are visual effects whose source is within the human eye itself. (Occasionally, these are called entopic phenomena, which is probably a typographical mistake.)
In Helmholtzs words: "Under suitable conditions light falling on the eye may render visible certain objects within the eye itself. These perceptions are called entoptical."
Overview
Entoptic images have a physical basis in the image cast upon the retina. Hence, they are different from optical illusions, which are caused by the visual system and characterized by a visual percept that (loosely said) appears to differ from reality. Because entoptic images are caused by phenomena within the observers own eye, they share one feature with optical illusions and hallucinations: the observer cannot share a direct and specific view of the phenomenon with others.
Helmholtz[1] commented on entoptic phenomena which could be seen easily by some observers, but could not be seen at all by others. This variance is not surprising because the specific aspects of the eye that produce these images are unique to each individual. Because of the variation between individuals, and the inability for two observers to share a nearly identical stimulus, these phenomena are unlike most visual sensations. They are also unlike most optical illusions which are produced by viewing a common stimulus. Yet, there is enough commonality between the main entoptic phenomena that their physical origin is now well understood.
Examples
Some examples of entoptical effects include:
Floaters or muscae volitantes are slowly drifting blobs of varying size, shape, and transparency, which are particularly noticeable when viewing a bright, featureless background (such as the sky) or a point source of diffuse light very close to the eye. They are shadow images of objects floating in liquid between the retina and the jelly inside the eye (the vitreous) or in the vitreous humor itself. They are visible because they move; if they were pinned to retina by the vitreous or fixed within the vitreous they would be as invisible as ordinary viewing of any stationary object, such as the retinal blood vessels (see Purkinje tree below). Some may be individual red blood cells swollen due to osmotic pressure. Others may be chains of red blood cells stuck together; diffraction patterns can be seen around these.[2] Others may be "coagula of the proteins of the vitreous gel, to embryonic remnants, or the condensation round the walls of Cloquets canal" that exist in pockets of liquid within the vitreous.[3] The first two sort of floaters may collect over the fovea (the center of vision), and therefore be more visible, when a person is lying on his or her back looking upwards.
Blue field entoptic phenomenon has the appearance of tiny bright dots moving rapidly along squiggly lines in the visual field. It is much more noticeable when viewed against a field of pure blue light and is caused by white blood cells moving in the capillaries in front of the retina. White cells are larger than red blood cells and can be larger than the diameter of a capillary, so must deform to fit. As a large, deformed white blood cell goes through a capillary, a space opens up in front of it and red blood cells pile up behind. This makes the dots of light appear slightly elongated with dark tails.[4][5]
Haidingers brush is a very subtle bowtie or hourglass shaped pattern that is seen when viewing a field with a component of blue light that is plane or circularly polarized. Its easier to see if the polarisation is rotating with respect to the observers eye, although some observers can see it in the natural polarisation of sky light. If the light is all blue, it will appear as a dark shadow; if the light is full spectrum, it will appear yellow. It is due to the preferential absorption of blue polarized light by pigment molecules in the fovea.[6][7]
Purkinje images are the reflections from the anterior and posterior surfaces of the cornea and the anterior and posterior surfaces of the lens. Although these first four reflections are not entoptic—they are seen by others who are looking at someone’s eye— Becker[8] described how light can reflect from the posterior surface of the lens and then again from the anterior surface of the cornea to focus a second image on the retina, this one much fainter and inverted. Tscherning[9] referred to this as the sixth image (the fifth image is formed by reflections from the anterior surfaces of the lens and cornea to form an image too far in front of the retina to be visible) and noted it was much fainter and best seen with a relaxed emmetropic eye. To see it, one must be in a dark room, with one eye closed; one must look straight ahead while moving a light back and forth in the field of the open eye. Then one should see the sixth Purkinje as a dimmer image moving in the opposite direction.
The Purkinje tree is an image of the retinal blood vessels in ones own eye, first described by Purkyně in 1823.[10] It can be seen by shining the beam of a small bright light through the pupil from the periphery of a subjects vision. This results in an image of the light being focused on the periphery of the retina. Light from this spot then casts shadows of the blood vessels (which lie on top of the retina) onto unadapted portions of the retina. Normally the image of the retinal blood vessels is invisible because of adaptation. Unless the light moves, the image disappears within a second or so. If the light is moved at about 1 Hz, adaptation is defeated, and a clear image can be seen indefinitely. The vascular figure is often seen by patients during an ophthalmic examination when the examiner is using an ophthalmoscope. Another way in which the shadows of blood vessels may be seen is by holding a bright light against the eyelid at the corner of the eye. The light penetrates the eye and casts a shadow on the blood vessels as described previously. The light must be jiggled to defeat adaptation. Viewing in both cases is improved in a dark room while looking at a featureless background. This topic is discussed in more detail by Helmholtz.
Purkinjes blue arcs are associated with the activity of the nerves sending signals from where a spot of light is focussed on the retina near the fovea to the optic disk. To see it, one needs to look at the right edge of a small red light in a dark room with the right eye (left eye closed) after dark-adapting for about 30 seconds; one should see two faint blue arcs starting at the light and heading towards the blind spot. When one looks at the left edge, one will see a faint blue spike going from the light to the right.[11]
A phosphene is the perception of light without light actually entering the eye, for instance caused by pressure applied to the closed eyes.A phenomenon that could be entoptical if the eyelashes are considered to be part of the eye is seeing light diffracted through the eyelashes. The phenomenon appears as one or more light disks crossed by dark blurry lines (the shadows of the lashes), each having fringes of spectral colour. The disk shape is given by the circular aperture of the pupil.
See also
References
Sources
Jan E. Purkyně, 1823: Beiträge zur Kenntniss des Sehens in subjectiver Hinsicht in Beobachtungen und Versuche zur Physiologie der Sinne, In Commission der J.G. Calveschen Buchhandlung, Prag.
H. von Helmholtz, Handbuch der Physiologischen Optik, published as "Helmholtzs Treatise on Physiological Optics, Translated from the Third German Edition," ed. James P. C. Southall; 1925; The Optical Society of America.
Leonard Zusne, 1990: Anomalistic Psychology: A Study of Magical Thinking; Lea; ISBN 0-8058-0508-7 [12]
Becker, O., 1860, “Über Wahrnehmung eines Reflexbildes im eigenen Auge [About perception of a reflected image in your own eye],” Wiener Medizinische Wochenschrift, pp. 670 672 & 684 688.
M. Tscherning, 1920, Physiologic Optics; Third Edition, (English translation by C. Weiland). Philadelphia: Keystone Publishing Co. pp. 55–56.
White, Harvey E., and Levatin, Paul, 1962, "Floaters in the eye," Scientific American, Vol. 206, No. 6, June, 1962, pp. 199 127.
Duke Elder, W. S. (ed.), 1962, System of Ophthalmology, Volume 7, The Foundations of Ophthalmology: heredity pathology diagnosis and therapeutics, St. Louis, The C.V. Mosby Company. p450.
Snodderly, D.M., Weinhaus, R.S., & Choi, J.C. (1992). Neural-vascular relationships in central retina of Macaque monkeys (Macaca fascicularis). Journal of Neuroscience, 12(4), 1169-1193. Available online at: http://www.jneurosci.org/cgi/reprint/12/4/1169.pdf.
Sinclair, S.H., Azar-Cavanagh, M., Soper, K.A., Tuma, R.F., & Mayrovitz, H.N. (1989). Investigation of the source of the blue field entoptic phenomenon. Investigative Ophthalmology & Visual Science, 30(4), 668-673. Available online at: http://www.iovs.org/.
Giles Skey Brindley, Physiology of the Retina and Visual Pathway, 2nd ed. (Edward Arnold Ltd., London, 1970), pp. 140–141.
Bill Reid, “Haidingers brush,” Physics Teacher, Vol. 28, p. 598 (Dec. 1990).
Walker, J., 1984, “How to stop a spinning object by humming and perceive curious blue arcs around the light,” Scientific American, February, Vol. 250, No. 2, pp. 136 138, 140, 141, 143, 144, 148.
External links
Entoptic+Vision at the US National Library of Medicine Medical Subject Headings (MeSH)
Picture of the entoptic phenomenon: Vitreous Floaters (PDF file, requires an Acrobat Reader or plugin)
Diagram of entoptic subjective visual phenomena
Video describing history and science of first entoptic viewing technique
Video describing history and science of second entoptic viewing technique
The Relation Between Migraine, Typical Migraine Aura and “Visual Snow” |
You are a medical lexicon. Explain medical terminology with depth and clarity, making sure the information is both accurate and easy to grasp. | I've come across the term 'Plasmacytoma' in a medical context, but I'm not sure what it means. Can you clarify? | Plasmacytoma is a plasma cell dyscrasia in which a plasma cell tumour grows within soft tissue or within the axial skeleton.
The International Myeloma Working Group lists three types: solitary plasmacytoma of bone (SPB); extramedullary plasmacytoma (EP), and multiple plasmacytomas that are either primary or recurrent. The most common of these is SPB, accounting for 3–5% of all plasma cell malignancies. SPBs occur as lytic lesions within the axial skeleton and extramedullary plasmacytomas most often occur in the upper respiratory tract (85%), but can occur in any soft tissue. Approximately half of all cases produce paraproteinemia. SPBs and extramedullary plasmacytomas are mostly treated with radiotherapy, but surgery is used in some cases of extramedullary plasmacytoma. The skeletal forms frequently progress to multiple myeloma over the course of 2–4 years.Due to their cellular similarity, plasmacytomas have to be differentiated from multiple myeloma. For SPB and extramedullary plasmacytoma the distinction is the presence of only one lesion (either in bone or soft tissue), normal bone marrow (<5% plasma cells), normal skeletal survey, absent or low paraprotein and no end organ damage.
Signs and symptoms
For SPB the most common presenting symptom is that of pain in the affected bone. Back pain and other consequences of the bone lesion may occur such as spinal cord compression or pathological fracture. Around 85% of extramedullary plasmacytoma presents within the upper respiratory tract mucosa, causing possible symptoms such as epistaxis, rhinorrhoea and nasal obstruction. In some tissues it may be found as a palpable mass.
Diagnosis
The diagnosis of plasmacytoma uses a diverse range of interdisciplinary techniques including serum protein electrophoresis, bone marrow biopsy, urine analysis for Bence Jones protein and complete blood count, plain film radiography, MRI and PET-CT.Serum protein electrophoresis separates the proteins in the liquid part of the blood (serum), allowing the analysis of antibodies. Normal blood serum contains a range of antibodies and are said to be polyclonal, whereas serum from a person with plasmacytoma may show a monoclonal spike. This is due to an outgrowth of a single type of plasma cell that forms the plasmacytoma and produces a single type of antibody. The plasma cells are said to be monoclonal and the excessively produced antibody is known as monoclonal protein or paraprotein. Paraproteins are present in 60% of SPB and less than 25% of extramedullary plasmacytoma.Bone marrow biopsies are performed to ensure the disease is localised; and in SPB or extramedullary plasmacytoma there will not be an increase of monoclonal plasma cells. Tissue biopsies of SPB and extramedullary plasmacytoma are used to assess the phenotype of the plasma cells. Histological analyses can be performed on these biopsies to see what cluster of differentiation (CD) markers are present and to assess monoclonality of the cells. CD markers can aid in the distinction of extramedullary plasmacytoma from lymphomas.Skeletal surveys are used to ensure there are no other primary tumors within the axial skeleton. MRI can be used to assess tumor status and may be advantageous in detecting primary tumors that are not detected by plain film radiography. PET-CT may also be beneficial in detecting extramedullary tumours in individuals diagnosed with SPB. CT imaging may be better than plain film radiography for assessing bone damage.An important distinction to be made is that a true plasmacytoma is present and not a systemic plasma cell disorder, such as multiple myeloma. The difference between plasmacytoma and multiple myeloma is that plasmacytoma lacks increased blood calcium, decreased kidney function, too few red blood cells in the bloodstream, and multiple bone lesions (collectively termed CRAB).
Classification
Plasmacytoma is a tumor of plasma cells. The cells are identical to those seen in multiple myeloma, but they form discrete masses of cells in the skeleton (solitary plasmacytoma of bone; SPB) or in soft tissues (extramedullary plasmacytoma; EP). They do not present with systemic disease, which would classify them as another systemic plasma cell disorder.The International Myeloma Working Group (IMWG) has published criteria for the diagnosis of plasmacytomas. They recognise three distinct entities: SPB, extramedullary plasmacytoma and multiple solitary plasmacytomas (+/- recurrent). The proposed criteria for SPB is the presence of a single bone lesion, normal bone marrow (less than 5% plasma cells), small or no paraprotein, no related organ involvement/damage and a normal skeletal survey (other than the single bone lesion). The criteria for extramedullary plasmacytoma are the same but the tumor is located in soft tissue. No bone lesions should be present. Criteria for multiple solitary plasmacytomas (+/- recurrent) are the same except either multiple solitary bone or soft tissue lesions must be present. They may occur as multiple primary tumors or as a recurrence from a previous plasmacytoma.
Association with the Epstein–Barr virus
Rarely, the Epstein–Barr virus (EBV) is associated with multiple myeloma and plasmacytomas, particularly in individuals who have an immunodeficiency due to e.g. HIV/AIDS, organ transplantation, or a chronic inflammatory condition such as rheumatoid arthritis. EBV-positive multiple myeloma and plasmacytoma are classified together by the World Health Organization (2016) as Epstein–Barr virus-associated lymphoproliferative diseases and termed Epstein–Barr virus-associated plasma cell myeloma. EBV-positivity is more common in plasmacytoma than multiple myeloma. The tissues involved in EBV+ plasmacytoma typically show foci of EBV+ cells with the appearance of rapidly proliferating immature or poorly differentiated plasma cells. These cells express products of EBV genes such as EBER1 and EBER2. EBV-positive plasmacytoma(s) is more likely to progress to multiple myeloma than EBV-negative plasmacytoma(s) suggesting that the virus may play a role in the progression of plasmacytoma to multiple myeloma.
Treatment
Radiotherapy is the main choice of treatment for both SPB and extramedullary plasmacytoma, and local control rates of >80% can be achieved. This form of treatment can be used with curative intent because plasmacytoma is a radiosensitive tumor. Surgery is an option for extramedullary plasmacytoma, but for cosmetic reasons it is generally used when the lesion is not present within the head and neck region. Another option is the possible combination of radiotherapy with anti-multiple myeloma treatment. In a study that included 68 patients, a group of 8 patients who were treated with radio- and chemotherapy (with or without surgery) were less likey to have a relapse of plasmacytoma, progress to multiple myeloma, or die compared with patients who were treated with radiotherapy and/or surgery alone [progression free survival (PFS), overall median: not reached vs. 48.0 months; respectively]. Concerning that study, a large prospective trial is needed to evaluate the impact of adding systemic anti-myeloma treatment to local radiotherapy.
Prognosis
Most cases of SPB progress to multiple myeloma within 2–4 years of diagnosis, but the overall median survival for SPB is 7–12 years. 30–50% of extramedullary plasmacytoma cases progress to multiple myeloma with a median time of 1.5–2.5 years. 15–45% of SPB and 50–65% of extramedullary plasmacytoma are disease free after 10 years.
Epidemiology
Plasmacytomas are a rare form of cancer. SPB is the most common form of the disease and accounts for 3-5% of all plasma cell malignancies. The median age at diagnosis for all plasmacytomas is 55. Both SPB and extramedullary plasmacytoma are more prevalent in males; with a 2:1 male to female ratio for SPB and a 3:1 ratio for extramedullary plasmacytoma.
Terminology
There can be some ambiguity when using the word. "Plasmacytoma" is sometimes equated with "plasma cell dyscrasia" or "solitary myeloma". It is often used as part of the phrase "solitary plasmacytoma". or as part of the phrase "extramedullary plasmacytoma". In this context, "extramedullary" means outside of the bone marrow.
See also
Plasma cell dyscrasia
Multiple myeloma
Monoclonal gammopathy of undetermined significance (MGUS)
Waldenströms macroglobulinemia
Cutaneous B-cell lymphoma
References
External links
Overview at National Cancer Institute |
You are a medical knowledge base. Your task is to elucidate medical terminology, offering insights into their meanings, origins, and applications. | I'm trying to expand my medical knowledge. Can you elucidate the term 'Furosemide'? | Furosemide is a loop diuretic medication used to treat fluid build-up due to heart failure, liver scarring, or kidney disease. It may also be used for the treatment of high blood pressure. It can be taken by injection into a vein or by mouth. When taken by mouth, it typically begins working within an hour, while intravenously, it typically begins working within five minutes.Common side effects include feeling lightheaded with standing, ringing in the ears, and sensitivity to light. Potentially serious side effects include electrolyte abnormalities, low blood pressure, and hearing loss. Blood tests are recommended regularly for those on treatment. Furosemide is a type of loop diuretic that works by decreasing the reabsorption of sodium by the kidneys. Common side effects of furosemide injection include hypokalemia (low potassium level), hypotension (low blood pressure), and dizziness.Furosemide was patented in 1959 and approved for medical use in 1964. It is on the World Health Organizations List of Essential Medicines. In the United States, it is available as a generic medication. In 2020, it was the nineteenth most commonly prescribed medication in the United States, with more than 26 million prescriptions. In 2020/21 it was the twentieth most prescribed medication in England. It is on the World Anti-Doping Agencys banned drug list due to concerns that it may mask other drugs. It has also been used in race horses for the treatment and prevention of exercise-induced pulmonary hemorrhage.
Medical uses
Furosemide is primarily used for the treatment of edema, but also in some cases of hypertension (where there is also kidney or heart impairment). It is often viewed as a first-line agent in most people with edema caused by congestive heart failure because of its anti-vasoconstrictor and diuretic effects. Compared with furosemide, however, torasemide (aka "torsemide") has been demonstrated to show improvements to heart failure symptoms, possibly lowering the rates of rehospitalisation associated with heart failure, with no difference in risk of death. Torsemide may also be safer than furosemide.Furosemide is also used for liver cirrhosis, kidney impairment, nephrotic syndrome, in adjunct therapy for swelling of the brain or lungs where rapid diuresis is required (IV injection), and in the management of severe hypercalcemia in combination with adequate rehydration.
Kidney disease
In chronic kidney diseases with hypoalbuminemia, furosemide is used along with albumin to increase diuresis. It is also used along with albumin in nephrotic syndrome to reduce edema.
Other information
Furosemide is mainly excreted by tubular secretion in the kidney. In kidney impairment, clearance is reduced, increasing the risk of adverse effects. Lower initial doses are recommended in older patients (to minimize side-effects) and high doses may be needed in kidney failure. It can also cause kidney damage; this is mainly by loss of excessive fluid (i.e., dehydration), and is usually reversible.Furosemide acts within 1 hour of oral administration (after IV injection, the peak effect is within 30 minutes). Diuresis is usually complete within 6–8 hours of oral administration, but there is significant variation between individuals.
Adverse effects
Furosemide also can lead to gout caused by hyperuricemia. Hyperglycemia is also a common side effect.
The tendency, as for all loop diuretics, to cause low serum potassium concentration (hypokalemia) has given rise to combination products, either with potassium or with the potassium-sparing diuretic amiloride (Co-amilofruse). Other electrolyte abnormalities that can result from furosemide use include hyponatremia, hypochloremia, hypomagnesemia, and hypocalcemia.In the treatment of heart failure, many studies have shown that the long-term use of furosemide can cause varying degrees of thiamine deficiency, so thiamine supplementation is also suggested.Furosemide is a known ototoxic agent generally causing transient hearing loss but can be permanent. Reported cases of furosemide induced hearing loss appeared to be associated with rapid intravenous administration, high dosages, concomitant renal disease and coadministration with other ototoxic medication. However, a recently reported longitudinal study showed that participants treated with loop diuretics over 10 years were 40% more likely to develop hearing loss and 33% more likely of progressive hearing loss compared to participants who did not use loop diuretics. This suggests the long-term consequences of loop diuretics on hearing could be a more significant than previously thought and further research is required in this area.
Other precautions include: nephrotoxicity, sulfonamide (sulfa) allergy, and increases free thyroid hormone effects with large doses.
Interactions
Furosemide has potential interactions with these medications:
Aspirin and other salicylates
Other diuretics (e.g. ethacrynic acid, hydrochlorothiazide)
Synergistic effects with other antihypertensives (e.g. doxazosin)
SucralfatePotentially hazardous interactions with other drugs:
Analgesics: increased risk of kidney damage (nephrotoxicity) with nonsteroidal anti-inflammatory drugs; antagonism of diuretic effect with NSAIDs
Antiarrhythmics: a risk of cardiac toxicity exists with antiarrhythmics if hypokalemia occurs; the effects of lidocaine and mexiletine are antagonized.
Antibacterials: increased risk of ototoxicity with aminoglycosides, polymyxins and vancomycin; avoid concomitant use with lymecycline
Antidepressants: increased risk of hypokalemia with reboxetine; enhanced hypotensive effect with MAOIs; increased risk of postural hypotension with tricyclic antidepressants
Antiepileptics: increased risk of hyponatremia with carbamazepine
Antifungals: increased risk of hypokalemia with amphotericin
Antihypertensives: enhanced hypotensive effect; increased risk of first dose hypotensive effect with alpha-blockers; increased risk of ventricular arrhythmias with sotalol if hypokalemia occurs
Antipsychotics: increased risk of ventricular arrhythmias with amisulpride, sertindole, or pimozide (avoid with pimozide) if hypokalemia occurs; enhanced hypotensive effect with phenothiazines
Atomoxetine: hypokalemia increases risk of ventricular arrhythmias
Cardiac glycosides: increased toxicity if hypokalemia occurs
Cyclosporine: variable reports of increased nephrotoxicity, ototoxicity and hepatotoxicity
Lithium: risk of toxicity.
Mechanism of action
Furosemide, like other loop diuretics, acts by inhibiting the luminal Na-K-Cl cotransporter in the thick ascending limb of the loop of Henle, by binding to the chloride transport channel, thus causing more sodium, chloride, and potassium to remain in the urine.The action on the distal tubules is independent of any inhibitory effect on carbonic anhydrase or aldosterone; it also abolishes the corticomedullary osmotic gradient and blocks negative, as well as positive, free water clearance. Because of the large NaCl absorptive capacity of the loop of Henle, diuresis is not limited by development of acidosis, as it is with the carbonic anhydrase inhibitors.
Additionally, furosemide is a noncompetitive subtype-specific blocker of GABA-A receptors. Furosemide has been reported to reversibly antagonize GABA-evoked currents of α6β2γ2 receptors at μM concentrations, but not α1β2γ2 receptors. During development, the α6β2γ2 receptor increases in expression in cerebellar granule neurons, corresponding to increased sensitivity to furosemide.
Pharmacokinetics
Molecular weight (daltons) 330.7
% Bioavailability 47-70%
Bioavailability with end-stage renal disease 43 - 46%
% Protein binding 91–99
Volume of distribution (L/kg) 0.07 – 0.2Volume of distribution may be higher in patients with cirrhosis or nephrotic syndrome
Excretion
% Excreted in urine (% of total dose) 60 - 90
% Excreted unchanged in urine (% of total dose) 53.1 - 58.8
% Excreted in feces (% of total dose) 7 - 9
% Excreted in bile (% of total dose) 6 - 9
Approximately 10% is metabolized by the liver in healthy individuals, but this percentage may be greater in individuals with severe kidney failure
Renal clearance (mL/min/kg) 2.0
Elimination half-life (hrs) 2Prolonged in congestive heart failure (mean 3.4 hrs)
Prolonged in severe kidney failure (4 - 6 hrs) and anephric patients (1.5-9 hrs)
Time to peak concentration (hrs)
Intravenous administration 0.3
Oral solution 0.83
Oral tablet 1.45The pharmacokinetics of furosemide are apparently not significantly altered by food.No direct relationship has been found between furosemide concentration in the plasma and furosemide efficacy. Efficacy depends upon the concentration of furosemide in urine.
Names
Furosemide is the INN and BAN. The previous BAN was frusemide.
Brand names under which furosemide is marketed include: Aisemide, Apo-Furosemide, Beronald, Desdemin, Discoid, Diural, Diurapid, Dryptal, Durafurid, Edemid, Errolon, Eutensin, Flusapex, Frudix, Frusemide, Frusetic, Frusid, Fulsix, Fuluvamide, Furesis, Furix, Furo-Puren, Furon, Furosedon, Fusid.frusone, Hydro-rapid, Impugan, Katlex, Lasilix, Lasix, Lodix, Lowpston, Macasirool, Mirfat, Nicorol, Odemase, Oedemex, Profemin, Rosemide, Rusyde, Salix, Seguril, Teva-Furosemide, Trofurit, Uremide, and Urex.
Veterinary uses
The diuretic effects are put to use most commonly in horses to prevent bleeding during a race. Sometime in the early 1970s, furosemides ability to prevent, or at least greatly reduce, the incidence of bleeding (exercise-induced pulmonary hemorrhage) by horses during races was discovered accidentally. In the United States of America, pursuant to the racing rules of most states, horses that bleed from the nostrils three times are permanently barred from racing. Clinical trials followed, and by decades end, racing commissions in some states in the USA began legalizing its use on race horses. In 1995, New York became the last state in the United States to approve such use, after years of refusing to consider doing so. Some states allow its use for all racehorses; some allow it only for confirmed "bleeders". Its use for this purpose is still prohibited in many other countries.
Furosemide is also used in horses for pulmonary edema, congestive heart failure (in combination with other drugs), and allergic reactions. Although it increases circulation to the kidneys, it does not help kidney function, and is not recommended for kidney disease.It is also used to treat congestive heart failure (pulmonary edema, pleural effusion, and/or ascites) in cats and dogs. It can also be used in an attempt to promote urine production in anuric or oliguric acute kidney failure.
Horses
Furosemide is injected either intramuscularly or intravenously, usually 0.5-1.0 mg/kg twice/day, although less before a horse is raced. As with many diuretics, it can cause dehydration and electrolyte imbalance, including loss of potassium, calcium, sodium, and magnesium. Excessive use of furosemide will most likely lead to a metabolic alkalosis due to hypochloremia and hypokalemia. The drug should, therefore, not be used in horses that are dehydrated or experiencing kidney failure. It should be used with caution in horses with liver problems or electrolyte abnormalities. Overdose may lead to dehydration, change in drinking patterns and urination, seizures, gastrointestinal problems, kidney damage, lethargy, collapse, and coma.
Furosemide should be used with caution when combined with corticosteroids (as this increases the risk of electrolyte imbalance), aminoglycoside antibiotics (increases risk of kidney or ear damage), and trimethoprim sulfa (causes decreased platelet count). It may also cause interactions with anesthetics, so its use should be related to the veterinarian if the animal is going into surgery, and it decreases the kidneys ability to excrete aspirin, so dosages will need to be adjusted if combined with that drug.
Furosemide may increase the risk of digoxin toxicity due to hypokalemia.
The drug is best not used during pregnancy or in a lactating mare, as it has been shown to be passed through the placenta and milk in studies with other species. It should not be used in horses with pituitary pars intermedia dysfunction (Cushings).
Furosemide is detectable in urine 36–72 hours following injection. Its use is restricted by most equestrian organizations.
In April 2019, it was announced that Lasix would be banned from use at US racetracks within 24 hours of a horse racing starting in 2021.
References
Further reading
Aventis Pharma (1998). Lasix Approved Product Information. Lane Cove: Aventis Pharma Pty Ltd.
Barbara Forney (2007). Understanding Equine Medications, Revised Edition (Horse Health Care Library). Eclipse Press. ISBN 978-1-58150-151-3.
External links
"Furosemide". Drug Information Portal. U.S. National Library of Medicine.
"Furosemide Injection". MedlinePlus.
Lasix and horse bleeding |
You serve as a medical tutor. Your objective is to demystify medical terms, providing thorough explanations that cater to various levels of medical knowledge. | The term 'Tolvaptan' keeps coming up in medical discussions. What does it stand for? | Tolvaptan, sold under the brand name Samsca among others, is an aquaretic drug that functions as a selective, competitive vasopressin receptor 2 (V2) antagonist used to treat hyponatremia (low blood sodium levels) associated with congestive heart failure, cirrhosis, and the syndrome of inappropriate antidiuretic hormone (SIADH). Tolvaptan was approved by the U.S. Food and Drug Administration (FDA) on May 19, 2009, and is sold by Otsuka Pharmaceutical Co. under the trade name Samsca. Tolvaptan, as Jynarque, was granted approval for medical use in the United States in April 2018.The U.S. Food and Drug Administration (FDA) granted tolvaptan a fast track designation for clinical trials investigating its use for the treatment of polycystic kidney disease. The FDA granted Jynarque an orphan drug designation in April 2012, for the treatment of autosomal dominant polycystic kidney disease.Tolvaptan is available as a generic medication.
Medical uses
Tolvaptan (Samsca) is indicated for the treatment of clinically significant hypervolemic and euvolemic hyponatremia.Tolvaptan (Jynarque) is indicated to slow kidney function decline in adults at risk of rapidly progressing autosomal dominant polycystic kidney disease (ADPKD).Tolvaptan phosphate is a prodrug of tolvaptan, developed for intravenous administration. Tolvaptan phosphate is converted into the active drug tolvaptan in the human body following administration.
Side effects
The FDA has determined that tolvaptan should not be used for longer than 30 days and should not be used in patients with underlying liver disease because it can cause liver injury, potentially leading to liver failure. When using to treat hyponatremia, it may cause too rapid correction of hyponatremia resulting in fatal osmotic demyelination syndrome.
Pharmacology
Tolvaptan is a selective vasopressin V2 receptor antagonist.
Chemistry
Tolvaptan is a racemate, a 1:1 mixture of the following two enantiomers:
References
Further reading
Gheorghiade M, Niazi I, Ouyang J, et al. (2003). "Vasopressin V2-receptor blockade with tolvaptan in patients with chronic heart failure: results from a double-blind, randomized trial". Circulation. 107 (21): 2690–6. doi:10.1161/01.CIR.0000070422.41439.04. PMID 12742979.
External links
"Tolvaptan". Drug Information Portal. U.S. National Library of Medicine. |
You serve as a guide in the medical field. Explain medical terms thoroughly, ensuring the information is both insightful and comprehensible. | I'd like to learn more about the medical term 'Oculopharyngodistal myopathy.' Can you provide some details? | Oculopharyngodistal myopathy is a rare genetic disorder characterized by progressive muscle weakness affecting various parts of the body.
Signs and symptoms
People with this condition exhibit symptoms susch as progressive muscle weakness affecting the eyes, face, and pharynx which consequently results in blepharoptosis, ophthalmoparesis, atrophy of the facial muscles, dysphagia, dysarthria, and muscle weakness and atrophy of the upper and lower distal limbs. These symptoms usually start during adulthood.On rare cases, hearing loss, severe proximal weakness and/or unilateral muscle weakness.
Complications
Complications vary depending on the symptoms and their severity, for example, muscle weakness might leave people unable to work on manual labor jobs.
Diagnosis
This condition can be diagnosed through physical examination and sequencing of the genes associated with the condition.
Genetics
There are four known genetic causes of this disorder:
1. Trinucleotide repeat expansion located in the 5-prime untranslated region of the LRP12 gene. (CGG)2. Trinucleotide repeat expansion located in the 5-prime untranslated region of the G1PC gene. (GGC)3. Trinucleotide repeat expansion located in the non-coding region of the NOTCH2NLC gene. (CGG)4. Trinucleotide repeat expansion located in the 5-prime untranslated region of the RILPL1 gene.All of these mutations are inherited/expressed in an autosomal dominant manner, meaning that for a person to exhibit the symptoms of this condition, they must inherit a copy of the mutated allele from at least one parent, although in other cases, the mutation might not have been inherited, but rather the result of a spontaneous error.
Prevalence
According to three OMIM pages for this condition, about 78 families across the world are known to have this condition, this includes both familial and sporadic cases with confirmed genetic basis (thus, potential to spread to offspring and turn it into a familial case). Most (if not all) of these families are of East Asian (Japanese and Chinese in particular) descent.
OMIM divided this condition into subtypes due to the different genetic causes and slightly different symptoms the three of them exhibit.
The following list comprises the number of families described in medical literature each of these subtypes has:
# 164310OCULOPHARYNGODISTAL MYOPATHY 1; OPDM1: 37 families
# 618940OCULOPHARYNGODISTAL MYOPATHY 2; OPDM2: 30 families
# 619473OCULOPHARYNGODISTAL MYOPATHY 3; OPDM3: 11 families.
History
This condition was first discovered in 1977 by E Sayotoshi et al. when they described an unspecified amount of people from 4 families who suffered from an "autosomal dominant, heredofamilial myopathy" which consisted in "slowly progressive ptosis and extraocular palsy, and weakness of the masseter, facial, and bulbar muscles, as well as distal involvement of the limbs starting around 40 years of age or later."In 2019, Hiroyuki Ishiura et al. discovered a heterozygous trinucleotide repeat expansion in the 5-prime untranslated region of the LRP12 gene in 5 patients with the condition, the trinucleotide sequence consisted of one C (cytosine) and two Gs (guanine). By using Southern blot analysis of leukocytes, it was revealed that the patients (on average) had expanded repeats ranging from 280 to 380 bp which was the equivalent of more than 90 repeats of CGG, when the LRP12 gene of 1,000 control subjects was tested with the same method, it was revealed that they (on average) had between 13 and 45 repeat units of the same nucleotides, with the exception of two out of the 1,000 controls, who had expanded repeats without any symptoms of the condition.In 2020, Deng et al. discovered beterozygous trinucleotide repeat expansions in the 5-prime untranslayed region of the GIPC1 gene of multiple affected members from 3 Chinese families, this trinucleotide sequence consisted of two Gs (guanine) and one C (cytosine). This mutation was later identified by the same team of researchers in 16 patients, of which 9 were Chinese and 7 were Japanese.In 2020, Ogasawara et al. discovered heterozygous trinucleotide repeat expansions in the non-coding region of the NOTCH2NLC gene of 7 un-related Japanese patients with the condition, the trinucleotide sequence consisted of one C (cytosine) and two Gs (guanine), all 5 patients had more than 100 repeats of the trinucleotide sequence, one of which had two expansions consisting of 217 and 674 repeats.
See also
Myopathy
Familial episodic pain syndrome
== References == |
You are a medical lexicon. Explain medical terminology with depth and clarity, making sure the information is both accurate and easy to grasp. | What is the significance of the term 'March fracture' in the medical field? | March fracture, is the fracture of the distal third of one of the metatarsals occurring because of recurrent stress. It is more common in soldiers, but also occurs in hikers, organists, and people whose duties entail much standing (such as hospital doctors). March fractures most commonly occur in the second and third metatarsal bones of the foot. It is a common cause of foot pain, especially when people suddenly increase their activities.
Signs and symptoms
The onset is not dramatic. When the boot or shoes are taken off, there is a cramp-like pain in the affected forefoot, and moderate local edema appears on the dorsal aspect. On moving each toe in turn, that of the involved metatarsal causes pain, and when the bone is palpated from the dorsal surface, a point of tenderness is found directly over the lesion. Radiography at this stage is negative, but the condition is diagnosed correctly by military surgeons without the aid of x-rays. In civil life, it is seldom diagnosed correctly for a week or two, when, because of lack of immobilization, there is an excessive deposit of callus (which may be palpable) around the fracture.
Diagnosis
X-ray is seldom helpful, but a CT scan and an MRI study may help in diagnosis.
Bone scans are positive early on. Dual energy X-ray absorptiometry is also helpful to rule out comorbid osteoporosis.
Differential diagnosis
Acute metatarsal fracture
Hallux rigidus
Jones fracture
Sesamoid stress fracture
Acute sesamoid fracture
Proximal fifth metatarsal avulsion fracture
Treatment
The first line treatment should be reduction of movements for 6 to 12 weeks. Wooden-soled shoes or a cast should be given for this purpose. In rare cases in which stress fracture occurs with a cavus foot, plantar fascia release may be appropriate.
Occurrence
Stress fractures can occur at many sites in the body; "march fracture" simply refers to a stress fracture specifically of the metatarsals, so named because the injury is sometimes sustained by soldiers during sustained periods of marching. Although march fractures can occur to the 5th metatarsal, fractures of this bone are more likely to be trauma-related fractures to the diaphysis, termed Jones fractures. In runners, march fracture occurs most often in the metatarsal neck, while in dancers it occurs in the proximal shaft. In ballet dancers, fracture mostly occurs at the base of the second metatarsal and at Lisfranc joints. This fracture always occurs following a prolonged stress or weight bearing, and the history of direct trauma is very rare. Consideration should always be given to osteoporosis and osteomalacia. Cavus feet are a risk factor for march fracture.
References
== External links == |
You act as a medical communicator. Your goal is to translate medical terms into comprehensive, yet straightforward language for all readers. | Can you break down the meaning of the medical term 'Tethered spinal cord syndrome' for me? | Tethered cord syndrome (TCS) refers to a group of neurological disorders that relate to malformations of the spinal cord. Various forms include tight filum terminale, lipomeningomyelocele, split cord malformations (diastematomyelia), occult, dermal sinus tracts, and dermoids.
All forms involve the pulling of the spinal cord at the base of the spinal canal, literally a tethered cord. The spinal cord normally hangs loose in the canal, free to move up and down with growth, and with bending and stretching. A tethered cord, however, is held taut at the end or at some point in the spinal canal. In children, a tethered cord can force the spinal cord to stretch as they grow. In adults the spinal cord stretches in the course of normal activity, usually leading to progressive spinal cord damage if untreated. TCS is often associated with the closure of a spina bifida. It can be congenital, such as in tight filum terminale, or the result of injury later in life.
Signs and symptoms
In children, symptoms may include:
Lesions, hairy patches, dimples, hemangiomas, or fatty tumours on the lower back
Foot and spinal deformities
Weakness in the legs (loss of muscle strength and tone)
Change in or abnormal gait including awkwardness while running or wearing the tips or side of one shoe
Low back pain
Scoliosis (abnormal curvature of the spine to the left or right)
Urinary irregularities (incontinence or retention)Tethered spinal cord syndrome may go undiagnosed until adulthood, when sensory, motor, bowel, and bladder control issues emerge. This delayed presentation of symptoms relates to the degree of strain on the spinal cord over time.
Tethering may also develop after spinal cord injury. Scar tissue can block the flow of fluids around the spinal cord. Fluid pressure may cause cysts to form in the spinal cord, a condition called syringomyelia. This can lead to additional loss of movement or feeling, or the onset of pain or autonomic nervous system symptoms.
In adults, onset of symptoms typically include:
Severe pain (in the lower back and radiating into the legs, groin, and perineum)
Bilateral muscle weakness and numbness
Loss of feeling and movement in lower extremities
Urinary irregularities (incontinence or retention)
Bowel control issuesNeurological symptoms can include a mixed picture of upper and lower motor neuron findings, such as amyotrophy, hyperreflexia or hyporeflexia, a positive stretch sign, and pathologic plantar response, occurring in the same limb. Profound sensory changes, such as loss of pain, temperature, and proprioceptive sensations, are common. Last, progressive symptoms of a neuropathic bladder are noted on over 70% of adult patients, versus only 20% to 30% of children. These symptoms include urinary frequency and urgency, feeling of incomplete voiding, poor voluntary control, nocturia, and urge and stress incontinence. Chronic recurrent infections are common and occasionally lead to nephrolithiasis (kidney stones), kidney failure, or kidney transplantation. Female patients also give a history of ineffective labor and postpartum rectal prolapse, presumably due to an atonic pelvic floor.
Related disorders
Kyphosis
Scoliosis
Brain herniation
Spina Bifida
Ehlers-Danlos syndrome
Klippel-Feil syndrome
Syringomyelia
Cause
Tethered spinal cord can be caused by various conditions but the main cause is when tissue attachments limit the movement of the spinal cord in the spinal column which causes abnormal stretching of the cord. The tethered spinal cord syndrome is correlated with having the causes:
Spina bifida
Occulta
Mylomeningocele
Meningocele
History of spinal trauma
History of spinal surgery
Tumor(s) in the spinal column
Thickened and/or tight filum terminale
Lipoma(s) in the spinal column
Dermal Sinus Tract (congenital deformity)
Diastematomyelia (split spinal cord)Tethered spinal cord is a disorder and not a mechanism so it does not spread to other people and there are no measures that can be done to prevent it beforehand. The only preventative measure that is successful is to surgically untether the spinal cord though there might already be irreversible damage.
Spina bifida
In tethered spinal cord cases spina bifida can be accompanied by tethering of the spinal cord but in rare cases with Spina bifida occulta. Tethering of the spinal cord tends to occur in the cases of Spina bifida with mylomeningocele. In most people the spine grows faster than the spinal cord during development which causes the end of the spinal cord to appear to rise relative to the bony spine next to it. By the time of birth the spinal cord is located between L1 and L2. In a baby with Spina bifida the spinal cord is still attached to the skin around it preventing it from rising properly. This occurs because the spinal cord in a child with Spina bifida is low lying and tethered at the bottom. At the time of birth the mylomeningocele is separated from the skin but the spinal cord is still stuck in the same place. As the child begins to grow the spinal cord remains in the same place becoming stretched out causing the tight cord and the tethering at the end. With this type of tethering there is an interference with the blood supply to the nerves and body which can then cause the deterioration of the body causing orthopedic, neurological, and urological problems. With milder forms of Spina bifida such as Occulta, may be related to the degree of strain on the cord which can become worse with physical activity, injury, pregnancy, bone spurs, or spinal stenosis. The tethered cord in this case might not be diagnosed until adulthood when it worsens and can still cause neurological, orthopedic, and urological dysfunctions.
Mechanism
Tethered spinal cord syndrome is a clinical entity which is manifested by progressive motor and sensory changes in:
legs
incontinence
back of leg pain
scoliosisIn order to understand the pathophysiology that is involved in a tethered spinal cord, the reduction/oxidation ratio has to be used in vivo of cytochrome alpha and alpha 3 to signal the oxidative metabolic functioning in humans. Studies have found that marked metabolic and electrophysiological susceptibility to hypoxic stress to the lumbar and sacral portion of the spinal cord under traction with various weights. Similar effects were found in redox behavior of tethered spinal cord during the surgical procedures to repair it. This can be due to impairment of mitochondrial oxidative metabolism under constant or intermittent stretching. The act of prolonged stretching can lead to structural damage to the neural perikarya and eventually the axons in neurons. The untethering process can improve the oxidative metabolism and can help to repair injured neurons.
Diagnosis
For children younger than eight weeks of age (and possibly in utero), a tethered cord may be observed using ultrasonography. Ultrasonography may still be useful through age 5 in limited circumstances.
MRI imaging appears to be the gold standard for diagnosing a tethered cord.A tethered cord is often diagnosed as a "low conus." The conus medullaris (or lower termination of the spinal cord) normally terminates at or above the L1-2 disk space (where L1 is the first, or topmost lumbar vertebra). After about 3 months of age, a conus below the L1-2 disk space may indicate a tethered cord and termination below L3-4 is unmistakably tethered. "Cord tethering is often assumed when the conus is below the normal L2-3 level.
TCS, however, is a clinical diagnosis that should be based on "neurological and musculoskeletal signs and symptoms. Imaging features are in general obtained to support rather than make the diagnosis." This is especially true for cases of occult tethered cord, where the patient has the symptoms of tethered cord syndrome but MRI reveals the conus to be above the L2 level. Clinical evaluation may include a simple rectal examination and may also include invasive or non-invasive urological examination. "Bladder dysfunction occurs in ~40% of patients affected by tethered cord syndrome. ... [I]t may be the earliest sign of the syndrome."
Treatment
Because neurological deficits are generally irreversible, early surgery is recommended when symptoms begin to worsen. In children, early surgery is recommended to prevent further neurological deterioration, including but not limited to chronic urinary incontinence.
In adults, surgery to detether (free) the spinal cord can reduce the size and further development of cysts in the cord and may restore some function or alleviate other symptoms. Although detethering is the common surgical approach to TCS, another surgical option for adults is a spine-shortening vertebral osteotomy. A vertebral osteotomy aims to indirectly relieve the excess tension on the spinal cord by removing a portion of the spine, shortening it. This procedure offers a unique benefit in that the spinal cord remains fixated to the spine, preventing retethering and spinal cord injury as possible surgical complications. However, its complexity and limited “track record” presently keeps vertebral osteotomies reserved as an option for patients who have failed in preventing retethering after detethering procedure(s).Other treatment is symptomatic and supportive. Medications such as NSAIDs, opiates, synthetic opiates, COX-2 inhibitors, and off-label applications of tricyclic antidepressants combined with anti-seizure compounds have yet to prove they are of value in treatment of this afflictions pain manifestations. There is anecdotal evidence that TENS units may benefit some patients.
Treatment may be needed in adults who, while previously asymptomatic, begin to experience pain, lower back degeneration, scoliosis, neck and upper back problems and bladder control issues. Surgery on adults with minimal symptoms is somewhat controversial. For example, a website from the Columbia University Department of Neurosurgery says, "For the child that has reached adult height with minimal if any symptoms, some neurosurgeons would advocate careful observation only." However, surgery for those who have worsening symptoms is less controversial. If the only abnormality is a thickened, shortened filum, then a limited lumbosacral laminectomy with division of the filum may be sufficient to relieve the symptoms.This syndrome was first noticed in the late 19th century. While information has been available for years, little widespread blind research has been done. More research has been called for, and doctors have conducted many studies with good results. There is a low morbidity rate, and no complications have been documented other than those typical of any type of back surgery. The association of this condition with others has been noticed, and needs further research to understand such relationships. TCS is causally linked to Chiari malformation and any affirmative diagnosis of TCS must be followed by screening for Chiaris several degrees. TCS may also be related to Ehlers–Danlos syndrome, or Klippel–Feil syndrome, which should also be screened for upon a positive TCS diagnosis. Spinal compression and the resulting relief is a known issue with this disorder. Like with the early-onset form, this disease form is linked to the Arnold–Chiari malformation, in which the brain is pulled or lowers into the top of the spine.
Prognosis
The disorder progresses with age, but the aforementioned treatments can help prevent or sometimes relieve symptoms. With treatment, individuals with tethered spinal cord syndrome have a normal life expectancy. Studies have shown surgery can help improve low back pain, urinary symptoms leg weakness and walking distance. However, most neurological and motor impairments are irreversible.
References
External links
National institute of Health page |
You act as a medical communicator. Your goal is to translate medical terms into comprehensive, yet straightforward language for all readers. | What does the medical term 'Congenital bilateral perisylvian syndrome' encompass? | Congenital bilateral perisylvian syndrome (CBPS) is a rare neurological disease characterized by paralysis of certain facial muscles and epileptic seizures.
Signs and symptoms
Signs and symptoms of CBPS typically appear in infancy or at birth, but can appear later in childhood. These include facial diplegia (paralysis on both sides), facial muscle spasms, pseudobulbar palsy, dysarthria (difficulty speaking), difficulty chewing, dysphagia (difficulty swallowing), epilepsy, and intellectual disability. Epileptic seizures in individuals with CBPS are different between individuals and can vary between episodes.
Pathophysiology
Though the underlying cause of CBPS is unknown, it is thought to arise from improper migration of neuroblasts (neuronal stem cells) to the cerebral cortex in the embryonic brain. This causes the layers of the cerebral cortex to not form properly, and too many small folds (gyri) to form on the surface of the brain. This condition is called bilateral perisylvian polymicrogyria. The sulci, deep grooves on the brain, may also not form correctly. Cranial nerves are affected and cause muscle paralysis and spasms in the face and throat.
Diagnosis
Several disorders may appear similar to CBPS and need to be distinguished in the process of diagnosing CBPS. These include pachygyria, double cortex syndrome, and lissencephaly, all of which are classified along with CBPS as neuronal migration disorders. Diagnostic tests for CBPS include electroencephalograms, CT scanning, and magnetic resonance imaging.
Treatment
CBPS is commonly treated with anticonvulsant therapy to reduce seizures. Therapies include anticonvulsant drugs, adrenocorticotropic hormone therapy, and surgical therapy, including focal corticectomy and callosotomy. Special education, speech therapy, and physical therapy are also used to help children with intellectual disability due to CBPS.
Epidemiology
Males and females have an equal chance of having CBPS.
== References == |
You serve as a medical tutor. Your objective is to demystify medical terms, providing thorough explanations that cater to various levels of medical knowledge. | I'm trying to expand my medical knowledge. Can you elucidate the term 'Chorditis'? | Chorditis is the inflammation of vocal cords (vocal folds) usually as a result of voice abuse but sometimes because of cancer.
Types
Chorditis fibrinosa
Chorditis nodosa
Chorditis tuberosa
See also
Vocal fold nodule
References
== External links == |
You are a medical knowledge base. Your task is to elucidate medical terminology, offering insights into their meanings, origins, and applications. | Could you please explain the term 'Rheumatoid nodule' in simple language? | A rheumatoid nodule is a lump of tissue, or an area of swelling, that appear on the exterior of the skin usually around the olecranon (tip of the elbow) or the interphalangeal joints (finger knuckles), but can appear in other areas. There are four different types of rheumatoid nodules: subcutaneous rheumatoid nodules, cardiac nodules, pulmonary nodules, and central nervous systems nodules. These nodules occur almost exclusively in association with rheumatoid arthritis. Very rarely do rheumatoid nodules occur as rheumatoid nodulosis (multiple nodules on the hands or other areas) in the absence of rheumatoid arthritis. Rheumatoid nodules can also appear in other areas of the body other than the skin. Less commonly they occur in the lining of the lung or other internal organs. The occurrence of nodules in the lung of miners exposed to silica dust was known as Caplan’s syndrome. Rarely, the nodules occur at diverse sites on body (e.g. upper eyelid, distal region of the soles of the feet, vulva and internally in the gallbladder, lung, heart valves, larynx, and spine).Rheumatoid nodules can vary in size from 2 mm to 5 cm and are usually rather firm to the touch. Quite often they are associated with synovial pockets or bursae. About 5% of people with rheumatoid arthritis have such nodules within two years of disease onset, and the cumulative prevalence is about 20 to 30%. Risk factors of developing rheumatoid nodules include as smoking and trauma to small vessels.In the majority of the time, nodules are not painful or disabling in any way. They are usually more of an unsightly nuisance. However, rheumatoid nodules can become painful when infection or ulcers occur on the skin of the nodule. Some nodules can actually disappear over time, but other times, they can grow larger making prediction of nodular size difficult to predict.Treatment also can be quite difficult, but surgical removal and injection of corticosteroids have both shown good results towards the treatment for rheumatoid nodules.
Pathophysiology
Although the exact process is unknown, there are a few hypotheses for the generation of rheumatoid nodules. It has been observed that rheumatoid nodules frequently form over extensor sites and areas vulnerable to trauma. The trauma causes inflammatory particles to build up and leads to a secondary inflammatory response which ultimately causes fibrin release and necrosis. Another hypothesis suggests that the inflammation of blood vessels activates complement components, which leads to the deposit of rheumatoid factors and fibrin.The rheumatoid nodule is the most common cutaneous manifestation of rheumatoid arthritis (RA). Rheumatoid arthritis involves chronic inflammation of synovial membranes, which leads to degradation of articular cartilage and the juxta-articular bone. Inflammation is caused by T cells, B cells and monocytes when endothelial cells are activated. Neovascularization, or the growth of new blood vessels, serves as an additional marker for rheumatoid arthritis. A hyperplastic synovial lining layer can be caused by the expansion of synovial fibroblast and macrophage cells. This expansion of the synovial membrane, sometimes referred to as "pannus," can lead to bony erosions and cartilage degradation at the site of the cartilage-bone junction in the periarticular bone.It is important to note that the cause of rheumatoid arthritis is unknown. It is speculated that genetic and environmental factors can both contribute to the development of rheumatoid arthritis. Gene loci and antigens, such as HLA class II antigens, have been seen as closely associated with rheumatoid arthritis. Environmental risk factors include smoking, periodontitis, viral infections and gut, mouth and lung microbiomes. Researchers have noted that Prevotella species, which are expanded in the gastrointestinal tract in early RA, and Porphyromonas gingivalis, which is associated with periodontitis, may have a role in pathogenesis.
Pathology
Histological examination of nodules shows that they consist of a shell of fibrous tissue surrounding a center of fibrinoid necrosis. Pea-sized nodules have one centre. Larger nodules tend to be multilocular, with many separate shells or with connections between the necrotic centers. Individual necrotic centers may contain a cleft or several centers of necrosis may all open on to a large bursal pocket containing synovial fluid.
The boundary between the necrotic center and the outer fibrous shell is made up of the characteristic feature of the nodule, which is known as a cellular palisade. The palisade is a densely packed layer of macrophages and fibroblasts which tend to be arranged radially, like the seeds of a kiwifruit or fig. Further out into the fibrous shell there is a zone that contains T cells and plasma cells in association with blood vessels. The histology of pulmonary nodules are similar to that of subcutaneous nodules, with central necrosis surrounded by palisading macrophages and inflammatory infiltrate.
Risk Factors
Rheumatoid nodules develop if a person currently has rheumatoid arthritis. However, not all people with rheumatoid arthritis develop rheumatoid nodules. Some risk factors for rheumatoid nodules for people with rheumatoid arthritis may include:
Smoking (strong association)
Elevated levels of serum rheumatoid factors
HLA-DRB1 gene (weak association)
Trauma to small vessels
Having severe rheumatoid arthritis
Taking Methotrexate over other arthritis drugs
Diagnosis
Differential diagnosis of rheumatoid nodules can be classified from localization, depth pathology, age of onset, persistence, rheumatoid factor, concomitant joint disease, and bone erosions. Diagnosis is typically determined clinically by a rheumatologist. Rheumatoid arthritis associated rheumatoid nodules are typically subcutaneous and occur at extensor sites. The onset typically starts in adulthood and presents with rheumatoid factors and bone erosions, and concomitant joint diseases. The pathology is characterized by central necrosis, palisading mononuclear cells, and perivascular lymphocytic infiltrations.Rheumatoid nodulosis is characterized by multiple subcutaneous nodules presenting with rheumatoid factors but an absence of joint complaints. The nodules are typically small and concentrated on the extensor sites of the hands and feet, sometimes accompanied by bone erosions. The onset typically starts in adulthood with a pathology similar to rheumatoid arthritis associated rheumatoid nodules.Benign rheumatoid nodules are often not associated with rheumatoid factors or concomitant joint diseases. They are typically found on the feet, scalp, and pretibial regions. Frequently seen in children before the age of 18, the pathology is similar to that of rheumatoid arthritis associated rheumatoid nodules. The nodules are non-tender and undergo rapid growth, but also resolve spontaneously. A similar presentation occurring more intracutaneously (superficial) is known as granuloma annulare.Rheumatic fever nodules are typically associated with acute rheumatic fever in children. They are not accompanied by rheumatoid factors or bone erosions, but are associated with concomitant joint diseases. No larger than the size of peas, they are typically found at extensor sites and processus spinosi of the vertebrae. The pathology is characterized by central necrosis and little histiocytic/lymphocytic infiltration.
Prevalence
There are 4 different types of rheumatoid nodules: subcutaneous rheumatoid nodules, cardiac nodules, pulmonary nodules and central nervous system nodules.
Subcutaneous rheumatoid nodules
According to a study done by the BARFOT study group, 7% of individuals diagnosed with rheumatoid arthritis reported the presence of subcutaneous rheumatoid nodules upon initial diagnosis. And about 30-40% of all those diagnosed with rheumatoid arthritis reported developing these nodules throughout the course of the disease. Subcutaneous rheumatoid nodules is correlated with the increased risk of cardiovascular and respiratory disease, and those with detected subcutaneous rheumatoid nodules should be assessed for cardiovascular and respiratory risk factors.Cardiac nodules
Rheumatoid nodules may also form in the heart. Specifically, it could develop in the myocardium, pericardium, and other valvular structures, and these nodules can be discovered through echocardiograms. There are little studies with minimal data on the development of cardiac nodules in association with rheumatoid arthritis, but the general consensus is that such occurrences is relatively rare.
Pulmonary Nodules
The reported prevalence of pulmonary nodules has varying depending on the method of detection. In a 1984 study done on lung biopsies in rheumatoid arthritis, the reported prevalence was about 32% in a sample size of 40 individuals. However, another clinical study utilizing a different method of detection; plain film radiographs of the chest; showed that only 2 out of 516 people (~0.4%) diagnosed with rheumatoid arthritis developed pulmonary nodules. Additionally, other clinical studies have reported increased pulmonary nodule growth following treatments with methotrexate, leflunomide, and etanercept.Central nervous system nodules
Like cardiac nodules, nodules developing in the central nervous system is also relatively rare. Most reports of nodule growth on the central nervous system also presented with severe stages of erosive joint diseases. Generally, these nodules can be detected through MRI and confirmed through biopsies. As of right now, there are no known mediations that have been reported in reducing nodules in the central nervous systems.
Prevention
There are no methods as of right now to completely prevent the development of rheumatoid nodules, but for those diagnosed with rheumatoid arthritis, proper management of the disease could reduce the risk of nodule formation. Additionally, proper medication adherence, smoking cessation, increasing physical activity, and keeping up with doctor appointments are just some lifestyle changes that could "prevent" nodules.
Treatment
Treatment for rheumatoid nodules may be tricky as some treatments for rheumatoid arthritis can act against the nodules. Common drug therapies for rheumatoid arthritis may show no benefits towards the treatment for rheumatoid nodules. Common drug therapies, such as anti TNF treatment or other immunosuppressive drugs, for rheumatoid arthritis has shown little effect on the nodules. In fact, it has been shown that Methotrexate, a drug often used in rheumatoid arthritis, is actually correlated with the increased risk of nodule formation. Because rheumatoid nodules also cause pain or nerve entrapment, treatment for these symptoms with nonsteroidal anti-inflammatory drugs may be sufficient. Other drug therapies, such as corticosteroids, have shown to decrease nodular size, however, it can increase the risk of infection as well. Local corticosteroid injections seems to be the most studied treatment for rheumatoid nodules as of now.
Surgery to have the nodule removed is another option that can be done to treat rheumatoid nodules. However, usually these are usually only indicated in the case of eroding/ necrotising skin.
See also
Rheumatoid nodulosis
Rheumatoid arthritis
References
== External links == |
You serve as an encyclopedia of medical terms. Deliver clear, detailed explanations, making medical language understandable to a diverse audience. | The term 'Neu–Laxova syndrome' keeps coming up in medical discussions. What does it stand for? | Neu–Laxova syndrome (also known as Neu syndrome or Neu-Povysilová syndrome, abbreviated as NLS) is a rare autosomal recessive disorder characterized by severe intrauterine growth restriction and multiple congenital malformations. Neu–Laxova syndrome is a very severe disorder, leading to stillbirth or death shortly after birth. It was first described by Dr. Richard Neu in 1971 and Dr. Renata Laxova in 1972 as a lethal disorder in siblings with multiple malformations. Neu–Laxova syndrome is an extremely rare disorder with less than 100 cases reported in medical literature.
Signs and symptoms
Neu-Laxova syndrome presents with severe malformations leading to prenatal or neonatal death. Typically, NLS involves characteristic facial features, decreased fetal movements and skin abnormalities.
Fetuses or newborns with Neu–Laxova syndrome have typical facial characteristics which include proptosis (bulging eyes) with eyelid malformations, nose malformations, round and gaping mouth, micrognathia (small jaw) and low set or malformed ears. Additional facial malformations may be present, such as cleft lip or cleft palate. Limb malformations are common and involve the fingers (syndactyly), hands or feet. Additionally, edema and flexion deformities are often present. Other features of NLS are severe intrauterine growth restriction, skin abnormalities (ichthyosis and hyperkeratosis) and decreased movement.
Malformations in the central nervous system are frequent and may include microcephaly, lissencephaly or microgyria, hypoplasia of the cerebellum and agenesis of the corpus callosum. Other malformations may also be present, such as neural tube defects.
Genetics
Neu-Laxova syndrome is a heterogeneous metabolic disorder caused by homozygous or compound heterozygous mutations in one of three genes: PHGDH, PSAT1 and PSPH These genes are involved in the serine biosynthesis pathway and are essential for cell proliferation.
Mutations in all three genes had been previously identified as the cause of serine-deficiency syndromes. Although there is some clinical overlap between NLS and these neurometabolic disorders, the phenotype in other serine-deficiency disorders is milder.
Diagnosis
The diagnosis is usually based on clinical features present at birth.
Ultrasound in the second trimester may show abnormalities associates with NLS, including polyhydramnios, intrauterine growth restriction, microcephaly, proptosis and decreased fetal motility.
Treatment
Serine and glycine supplementation has shown tentative benefits in those with related serine biosynthesis defects and milder forms of NLS.
Prognosis
The prognosis is poor; affected individuals are either stillborn or die shortly after birth. The longest survival reported in literature is of 134 days.
This syndrome is transmitted as an autosomal recessive disorder and there is a risk for recurrence of 25% in future pregnancies.
References
== External links == |
You function as a medical informant. Please provide in-depth yet accessible descriptions of medical terms, suitable for a broad audience. | What does the medical term 'Partial androgen insensitivity syndrome' encompass? | Partial androgen insensitivity syndrome (PAIS) is a condition that results in the partial inability of the cell to respond to androgens. It is an X linked recessive condition. The partial unresponsiveness of the cell to the presence of androgenic hormones impairs the masculinization of male genitalia in the developing fetus, as well as the development of male secondary sexual characteristics at puberty, but does not significantly impair female genital or sexual development. As such, the insensitivity to androgens is clinically significant only when it occurs in individuals with a Y chromosome (or more specifically, an SRY gene). Clinical features include ambiguous genitalia at birth and primary amenhorrhoea with clitoromegaly with inguinal masses. Mullerian structures are not present in the individual.
PAIS is one of three types of androgen insensitivity syndrome, which is divided into three categories that are differentiated by the degree of genital masculinization: complete androgen insensitivity syndrome (CAIS) is indicated when the external genitalia is that of a typical female, mild androgen insensitivity syndrome (MAIS) is indicated when the external genitalia is that of a typical male, and partial androgen insensitivity syndrome (PAIS) is indicated when the external genitalia is partially, but not fully masculinized.Androgen insensitivity syndrome is the largest single entity that leads to 46,XY undermasculinization.There are differing opinions on whether treatment is necessary. Treatment may include irreversible and far reaching surgical operations such as gonadectomy, as well as hormone replacement therapy, or vaginoplasty if the patient has desire to engage in penetrative sex.
Signs and symptoms
A supplemental system of phenotypic grading that uses seven classes instead of the traditional three was proposed by pediatric endocrinologist Charmian A. Quigley et al. in 1995. The first six grades of the scale, grades 1 through 6, are differentiated by the degree of genital masculinization; grade 1 is indicated when the external genitalia is fully masculinized, grade 6 is indicated when the external genitalia is fully feminized, and grades 2 through 5 quantify four degrees of increasingly feminized genitalia that lie in the interim. Grade 7 is indistinguishable from grade 6 until puberty, and is thereafter differentiated by the presence of secondary terminal hair; grade 6 is indicated when secondary terminal hair is present, whereas grade 7 is indicated when it is absent. The Quigley scale can be used in conjunction with the traditional three classes of AIS to provide additional information regarding the degree of genital masculinization, and is particularly useful when the diagnosis is PAIS.
Partial androgen insensitivity syndrome is diagnosed when the degree of androgen insensitivity in an individual with a 46,XY karyotype is great enough to partially prevent the masculinization of the genitalia, but is not great enough to completely prevent genital masculinization. This includes any phenotype resulting from androgen insensitivity where the genitalia is partially, but not completely masculinized. Genital ambiguities are frequently detected during clinical examination at birth, and consequently, a PAIS diagnosis can be made during infancy as part of a differential diagnostic workup.Pubertal undervirilization is common, including gynecomastia, decreased secondary terminal hair, and / or a high pitched voice. The phallic structure ranges from a penis with varying degrees of diminished size and hypospadias to a slightly enlarged clitoris. Wolffian structures (the epididymides, vasa deferentia, and seminal vesicles) are typically partially or fully developed. The prostate is typically small or impalpable. Müllerian remnants are rare, but have been reported.The gonads in individuals with PAIS are testes, regardless of phenotype; during the embryonic stage of development, testes form in an androgen-independent process that occurs due to the influence of the SRY gene on the Y chromosome. Cryptorchidism is common, and carries with it a 50% risk of germ cell malignancy. If the testes are located intrascrotally, there may still be significant risk of germ cell malignancy; studies have not yet been published to assess this risk.Predominantly male phenotypes vary in the degree of genital undermasculinization to include micropenis, chordee, bifid scrotum, and / or pseudovaginal perineoscrotal hypospadias. Impotence may be fairly common, depending on phenotypic features; in one study of 15 males with PAIS, 80% of those interviewed indicated that they had some degree of impotence. Anejaculation appears to occur somewhat independently of impotence; some men are still able to ejaculate despite impotence, and others without erectile difficulties cannot. Predominantly female phenotypes include a variable degree of labial fusion and clitoromegaly. Ambiguous phenotypic states include a phallic structure that is intermediate between a clitoris and a penis, and a single perineal orifice that connects to both the urethra and the vagina (i.e. urogenital sinus). At birth, it may not be possible to immediately differentiate the external genitalia of individuals with PAIS as being either male or female, although the majority of individuals with PAIS are raised male.
Given the wide diversity of phenotypes associated with PAIS, the diagnosis is often further specified by assessing genital masculinization. Grades 2 through 5 of the Quigley scale quantify four degrees of increasingly feminized genitalia that correspond to PAIS.Grade 2, the mildest form of PAIS, presents with a predominantly male phenotype that presents with minor signs of undermasculinized genitalia, such as isolated hypospadias, which can be severe. Hypospadias may manifest with a partially formed channel from the urethral opening to the glans. Until recently, it was thought that isolated micropenis was not a manifestation of PAIS. However, in 2010, two cases of PAIS manifesting with isolated micropenis were documented.
Grade 3, the most common phenotypic form of PAIS, features a predominantly male phenotype that is more severely undermasculinized, and typically presents with micropenis and pseudovaginal perineoscrotal hypospadias with bifid scrotum.Grade 4 presents with a gender ambiguous phenotype, including a phallic structure that is intermediate between a clitoris and a penis. The urethra typically opens into a common channel with the vagina (i.e. urogenital sinus).Grade 5, the form of PAIS with the greatest degree of androgen insensitivity, presents with a mostly female phenotype, including separate urethral and vaginal orifices, but also shows signs of slight masculinization including mild clitoromegaly and / or partial labial fusion.Previously, it was erroneously thought that individuals with PAIS were always infertile; at least one case report has been published that describes fertile men that fit the criteria for grade 2 PAIS (micropenis, penile hypospadias, and gynecomastia).
Comorbidity
All forms of androgen insensitivity are associated with infertility, though exceptions have been reported for both the mild and partial forms.PAIS is associated with a 50% risk of germ cell malignancy when the testes are undescended. If the testes are located intrascrotally, there may still be significant risk of germ cell malignancy; studies have not yet been published to assess this risk. Some men with PAIS may experience sexual dysfunction including impotence and anejaculation. A few AR mutations that cause PAIS are also associated with prostate and breast cancers.
Vaginal hypoplasia, a relatively frequent finding in CAIS and some forms of PAIS, is associated with sexual difficulties including vaginal penetration difficulties and dyspareunia.There are indications that individuals with an intersex condition may be more prone to psychological difficulties, due at least in part to parental attitudes and behaviors, and concludes that preventative long-term psychological counseling for parents as well as for affected individuals should be initiated at the time of diagnosis. More recent research based on interviews of people with intersex variations indicate a need for more family protection from intervention and more family support.
Lifespan is not thought to be affected by AIS.
Diagnosis
Unfortunately, the number of differentials to consider for PAIS is particularly large. Prompt diagnosis is particularly urgent when a child is born with ambiguous genitalia, as some causes are associated with potentially life-threatening adrenal crises. Determination of testosterone, testosterone precursors and dihydrotestosterone (DHT) at baseline and / or after human chorionic gonadotropin (hCG) stimulation can be used to exclude such defects in androgen biosynthesis.Approximately one half of all 46,XY individuals born with ambiguous genitalia will not receive a definitive diagnosis. Androgen receptor (AR) gene mutations cannot be found in 27% to 72% of individuals with PAIS. As a result, genetic analysis can be used to confirm a diagnosis of PAIS, but it cannot be used to rule out PAIS. Evidence of abnormal androgen binding in a genital skin fibroblast study has long been the gold standard for the diagnosis of PAIS, even when an AR mutation is not present. However, some cases of PAIS, including AR-mutant-positive cases, will show normal androgen binding. A family history consistent with X-linked inheritance is more commonly found in AR-mutant-positive cases than AR-mutant-negative cases.The use of dynamic endocrine tests is particularly helpful in isolating a diagnosis of PAIS. One such test is the human chorionic gonadotropin (hCG) stimulation test. If the gonads are testes, there will be an increase in the level of serum testosterone in response to the hCG, regardless of testicular descent. The magnitude of the testosterone increase can help differentiate between androgen resistance and gonadal dysgenesis, as does evidence of a uterus on ultrasound examination. Testicular function can also be assessed by measuring serum anti-Müllerian hormone levels, which in turn can further differentiate PAIS from gonadal dysgenesis and bilateral anorchia.Another useful dynamic test involves measuring the response to exogenous steroids; individuals with AIS show a decreased response in serum sex hormone binding globulin (SHBG) after a short term administration of anabolic steroids. Two studies indicate that measuring the response in SHBG after the administration of stanozolol could help to differentiate individuals with PAIS from those with other causes of ambiguous genitalia, although the response in individuals with predominantly male phenotypes overlaps somewhat with the response in normal males.
Management
Management of AIS is currently limited to symptomatic management; methods to correct a malfunctioning androgen receptor protein that result from an AR gene mutation are not currently available. Areas of management include sex assignment, genitoplasty, gonadectomy in relation to tumor risk, hormone replacement therapy, and genetic and psychological counseling. Non-consensual interventions are still often performed, although general awareness on the resulting psychological traumatization is rising.
Sex assignment
The decision of whether to raise an individual with PAIS as a boy or a girl may not be obvious; grades 3 and 4 in particular present with a phenotype that may be difficult to classify as primarily male or female, and some will be incapable of virilization at puberty. Parents of an affected newborn should seek immediate help at a center with an experienced multidisciplinary team, and should avoid gender assignment beforehand. Older guidelines from 2006 advised against waiting for the child to decide for themselves. According to them, key considerations involved in assigning gender include the appearance of the genitalia, the extent to which the child can virilize at puberty, surgical options and the postoperative sexual function of the genitalia, genitoplasty complexity, potential for fertility, and the projected gender identity of the child. The majority of individuals with PAIS are raised male. More recently, the interests of intersex people themselves are being taken into consideration by the medical community. Some parents have pushed their children with intersex variations to display gender normative roles and behaviours, or to engage in hormonal and surgical interventions to make their bodies appear more aesthetically normative. Research based on interviews of people with intersex variations indicate a need for more family protection from intervention and more family support.
Virilization capacity can be assessed by measuring the response to a trial of exogenous androgens; some studies have measured the growth of the phallus in response to exogenous testosterone or dihydrotestosterone, while others have measured the change in sex hormone binding globulin (SHBG) in response to the artificial androgen stanozolol to assess androgen sensitivity. Some experts have cautioned that it remains to be proved that a good response to exogenous androgens in neonates is a good predictor of androgen response at puberty. If a mutation in the AR gene is found, it is important to determine whether the mutation is inherited or de novo (i.e. a somatic mutation); a certain amount of the wild-type androgen receptor will be present in cases of somatic mutation, which can induce virilization at puberty. A genital skin fibroblast study and a human chorionic gonadotropin (hCG) stimulation test may also provide information helpful in the assessment of virilization capacity.
Psychosexual development is influenced by many factors, including the timing, amount, and type of androgen exposure, receptor functionality, and environment, and is thus difficult to predict. Gender identity begins to develop before 3 years of age, although the earliest age at which it can be reliably assessed has yet to be determined. Approximately 25% of individuals with PAIS are dissatisfied with their assigned gender, regardless of being raised as male or female. One study reports that 46,XY individuals born with micropenis and no hypospadias are better off being raised male, despite the success of some being raised female. Studies involving the more ambiguous phenotypic forms of PAIS are less decisive. Homosexuality with respect to assigned gender and atypical gender role behavior are known to occur more frequently in individual with PAIS, and may occur with or without gender dysphoria; neither should be interpreted as an indication of incorrect gender assignment. If an affected child does express feelings of gender dysphoria, the opportunity to explore such feelings with a psychologist experienced in treating intersex conditions should be accommodated. If feelings of gender dysphoria persist, gender reassignment should be initiated, possibly with the aid of a specialist in the field.
Genitoplasty
Genitoplasty, unlike gender assignment, can be irreversible, and there is no guarantee that adult gender identity will develop as assigned despite surgical intervention. Some aspects of genitoplasty are still being debated; a variety of different opinions have been presented by professionals, self-help groups, and patients over the last few decades. Points of consideration include what conditions justify genitoplasty, the extent and type of genitoplasty that should be employed, when genitoplasty should be performed, and what the goals of genitoplasty should be. Gender assignment itself does not predicate the need for immediate genitoplasty; in some cases, surgical intervention can be delayed to allow the affected child to reach an age and maturity sufficient to have a role in such decisions. Some studies suggest that early surgeries can still produce satisfactory outcomes, while others suggest it to be unlikely. Even surgeries that are planned as one-stage procedures often require further major surgery. Scarring and tissue loss that result from repeated surgical procedures are of particular concern, due to the presumed negative impact on sexual function.While it is thought that feminizing genitoplasty typically requires fewer surgeries to achieve an acceptable result and results in fewer urologic difficulties, there is no evidence that feminizing surgery results in a better psychosocial outcome. In one study, individuals with grade 3 PAIS who were raised male rated their body image and sexual function similarly to those who were raised female, even though they were more likely to have genitalia that were abnormal in size and appearance; more than half of the male participants had a stretched penile length that was below 2.5 standard deviations of the mean, while only 6% of female participants presented with a short vagina in adulthood, and participating physicians gave a lower cosmetic rating to the surgical results of the men than the women. Both male and female participants cited the appearance of their genitalia as being the greatest contributing factor to their dissatisfaction with their body image. In two larger studies, the common predictor of gender reassignment was stigmatization related to having an intersex condition.
The outcome of masculinizing genitoplasty is dependent on the amount of erectile tissue and the extent of hypospadias. Procedures include correction of penile curvature and chordee, reconstruction of the urethra, hypospadias correction, orchidopexy, and Müllerian remnant removal to prevent infection and pseudo-incontinence. Erectile prosthesis may be inserted in cases of successful neophalloplasty in adulthood, although it has a high morbidity. Additional surgeries may be required to correct postsurgical complications such as stenosis of the anastomosis between the native urethra and the graft, urethral fistulas, and posterior displacement of the balanic meatus. Successful masculinizing genitoplasty performed on individuals with grade 3 PAIS often requires multiple surgeries.
If feminizing genitoplasty is performed in infancy, the result will need to be refined at puberty through additional surgery. Procedures include clitoral reduction / recession, labiaplasty, repair of the common urogenital sinus, vaginoplasty, and vaginal dilation through non-surgical pressure methods. Clitoral reduction / recession surgery carries with it the risk of necrosis as well as the risk of impairing the sexual function of the genitalia, and thus should not be performed for less severe clitoromegaly. Clitoral surgery should be focused on function rather than appearance, with care being taken to spare the erectile function and innervation of the clitoris. If PAIS presents with a common urogenital sinus, the American Academy of Pediatrics currently recommends that surgery to separate the urethra from the vagina be performed at an early age. As is the case for CAIS, vaginal dilation using pressure dilation methods should be attempted before the surgical creation of a neovagina is considered, and neither should be performed before puberty. Complications of feminizing genitoplasty can include vaginal stenosis, meatal stenosis, vaginourethral fistula, female hypospadias, urinary tract injuries, and recurrent clitoromegaly. Successful feminizing genitoplasty performed on individuals with grade 3 PAIS often requires multiple surgeries, although more surgeries are typically required for successful masculinizing genitoplasty in this population.Many surgical procedures have been developed to create a neovagina, as none of them is ideal. Surgical intervention should be considered only after non-surgical pressure dilation methods have failed to produce a satisfactory result. Neovaginoplasty can be performed using skin grafts, a segment of bowel, ileum, peritoneum, Interceed, buccal mucosa, amnion, or dura mater. Success of such methods should be determined by sexual function, and not by vaginal length alone, as has been done in the past. Ileal or cecal segments may be problematic because of a shorter mesentery, which may produce tension on the neovagina, leading to stenosis. The sigmoid neovagina is thought to be self-lubricating, without the excess mucus production associated with segments of small bowel. Vaginoplasty may create scarring at the introitus (the vaginal opening), requiring additional surgery to correct. Vaginal dilators are required postoperatively to prevent vaginal stenosis from scarring. Other complications include bladder and bowel injuries. Yearly exams are required, as neovaginoplasty carries a risk of carcinoma, although carcinoma of the neovagina is uncommon. Neither neovaginoplasty nor vaginal dilation should be performed before puberty.
Gonadectomy
Gonadectomy at time of diagnosis is the current recommendation for PAIS if presenting with cryptorchidism. The risk of malignancy when testes are located intrascrotally is unknown; the current recommendation is to biopsy the testes at puberty, allowing investigation of at least 30 seminiferous tubules, with diagnosis preferably based on OCT3/4 immunohistochemistry, followed by regular examinations. Hormone replacement therapy is required after gonadectomy, and should be modulated over time to replicate the hormone levels naturally present in the body during the various stages of puberty. Artificially induced puberty results in the same, normal development of secondary sexual characteristics, growth spurt, and bone mineral accumulation. Women with PAIS may have a tendency towards bone mineralization deficiency, although this increase is thought to be less than is typically seen in CAIS, and is similarly managed.
Hormonal replacement therapy
Testosterone has been used to successfully treat undervirilization in some but not all men with PAIS, despite having supraphysiological levels of testosterone to start with. Treatment options include transdermal gels or patches, oral or injectable testosterone undecanoate, other injectable testosterone esters, testosterone pellets, or buccal testosterone systems. Supraphysiological doses may be required to achieve the desired physiological effect, which may be difficult to achieve using non-injectable testosterone preparations. Exogenous testosterone supplementation in unaffected men can produce various unwanted side effects, including prostatic hypertrophy, polycythemia, gynecomastia, hair loss, acne, and the suppression of the hypothalamic-pituitary-gonadal axis, resulting in the reduction of gonadotropins (i.e., luteinizing hormone and follicle-stimulating hormone) and spermatogenic defect. These effects may not manifest at all in men with AIS, or might only manifest at a much higher concentration of testosterone, depending on the degree of androgen insensitivity. Those undergoing high dose androgen therapy should be monitored for safety and efficacy of treatment, possibly including regular breast and prostate examinations. Some individuals with PAIS have a sufficiently high sperm count to father children; at least one case report has been published that describes fertile men who fit the criteria for grade 2 PAIS (micropenis, penile hypospadias, and gynecomastia). Several publications have indicated that testosterone treatment can correct low sperm counts in men with MAIS. At least one case report has been published that documents the efficacy of treating a low sperm-count with tamoxifen in an individual with PAIS.
Counseling
Depending on phenotypic features, impotence and other sexual problems such as anejaculation or sexual aversion may be fairly common among individuals with PAIS, but do not necessarily indicate low libido. Support groups for individuals with PAIS may help affected individuals discuss their concerns more comfortably. Some individuals with PAIS may try to avoid intimate relationships out of fear of rejection; individual therapy may help some to overcome social anxiety, and restore focus to interpersonal relationships instead of solely on sexual function and activity.
Society and culture
Adults with partial androgen insensitivity syndrome include Australian-Maltese advocate Tony Briffa, considered to be the worlds first openly intersex mayor and public office-bearer. Briffa served as Deputy Mayor of the City of Hobsons Bay, Victoria, between 2009 and 2011, and Mayor between 2011 and 2012.In history, the Roman sophist and philosopher Favorinus of Arelate has been described as having partial androgen insensitivity syndrome.
Notable people with PAIS
Tony Briffa
Small Luk
Eliana Rubashkyn
Sean Saifa Wall
Sogto Ochirov
Sentencia SU 337/99, Colombia
In Sentencia SU-337/99, of May 12, 1999, the Constitutional Court of Colombia determined that "qualified and persistent" informed consent is required for genital surgeries in children. The Court ruled in the case of XX, an 8-year old with ambiguous genitalia, androgen insensitivity and XY chromosomes, raised as a girl. Doctors recommended feminizing surgeries, including a gonadectomy, vaginoplasty and clitoroplasty before puberty, but the hospital would not proceed without the consent of the Colombian Institute of Family Welfare and the Office of the Public Advocate. The mother brought a case against Institute and Office of the Public Advocate, seeking to provide substitute consent. The mother argued that “the capacity to decide, it would be too late and would prevent normal psychological, physical, and social development”.The Court refused the mothers claim. It questioned the urgency of the case, argued by medical teams. Civil rights advocates and a minority of doctors favored deferring treatment due to lack of evidence and the irreversible nature of the proposed interventions. The Court observed that advocates of surgery were more numerous than opponents, alternatives to surgery were not entirely feasible, and surgeries had improved, “making it less likely that sexual sensitivity would be destroyed; and the medical community was improving communication with parents”.The Court determined that a constitutional protection of a right to free development of personality meant that a childs autonomy increases with age, including the development of a gender identity and bodily awareness. It determined that the best interests of the child were protected by allowing the child to determine their own gender identity. The Court determined that genital surgeries should not be conducted on children over the age of five, and that multidisciplinary teams should assess childrens needs on a case-by-case basis.
References
External links
androgen at NIH/UW GeneTests |
You are an assistant in medical learning. Your role is to clarify medical terminology, ensuring the information is both accurate and accessible. | I'm trying to expand my medical knowledge. Can you elucidate the term 'Hereditary inclusion body myopathy'? | Hereditary inclusion body myopathies (HIBM) are a group of rare genetic disorders which have different symptoms. Generally, they are neuromuscular disorders characterized by muscle weakness developing in young adults. Hereditary inclusion body myopathies comprise both autosomal recessive and autosomal dominant muscle disorders that have a variable expression (phenotype) in individuals, but all share similar structural features in the muscles.
HIBMs are a group of muscle wasting disorders that are uncommon in the general world population. One autosomal recessive form of HIBM is known as IBM2 or GNE myopathy, which is a common genetic disorder amongst people of Iranian Jewish descent. IBM2 has also been identified in other minorities throughout the world, including those of Asian, European, and South American, and Middle Eastern descent. In Japan and other East Asian countries, this disorder is known as Distal Myopathy with Rimmed Vacuoles (DMRV).
IBM2 causes progressive muscle weakness and wasting. Muscle wasting usually starts around the age of 20 – 30 years, although young onset at 17 and old onset at 52 has been recorded. It can progress to marked disability within 10 to 15 years, confining many people with IBM2 to a wheelchair. The weakness and severity can vary from person to person. In some, weakness in the legs is noticed first. In some others, the hands are weakened more rapidly than the legs. IBM2 does not seem to affect the brain, internal organs or sensation. The quadriceps are relatively spared, and remain strong until the late stages of disease, which is the reason IBM2 is often referred to as Quadriceps Sparing Myopathy (QSM).
Signs and symptoms
Some early signs of HIBMs includes:
Difficulty walking on heels, and difficulty running;
Weak index finger;
Frequent loss of balance.
On muscle biopsy, the typical finding includes inclusion bodies, rimmed vacuoles and accumulation of aberrant proteins similar to those found in senile plaques of Alzheimers disease (amyloid beta, hyperphosphorylated tau, amongst others)
Genetics
The different forms have different mutations and inheritance patterns. See the detailed descriptions for details
Mechanisms
The exact mechanisms of these diseases are not well understood. GNE/MNK a key enzyme in the sialic acid biosynthetic pathway, and loss-of-function mutations in GNE/MNK may lead to a lack of sialic acid, which in turn could affect sialoglycoproteins. GNE knockout mice show problems similar to people with IBM and in people with IBM dystroglycan has been found to lack sialic acid. However, the part of the dystroglycan that is important in muscle function does not seem to be affected. Another protein, neural cell adhesion molecule is under-sialyated in people with IBM, but as of 2016 it had no known role in muscle function.
Diagnosis
The most useful information for accurate diagnosis is the symptoms and weakness pattern. If the quadriceps are spared but the hamstrings and iliopsoas are severely affected in a person between ages of 20 - 40, it is very likely HIBM will be at the top of the differential diagnosis. The doctor may order any or all of the following tests to ascertain if a person has IBM2:
Blood test for serum Creatine Kinase (CK or CPK);
Nerve Conduction Study (NCS) / Electomyography (EMG);
Muscle Biopsy;
Magnetic Resonance Imaging (MRI) or Computer Tomography (CT) Scan to determine true sparing of quadriceps;
Blood Test or Buccal swab for genetic testing;
Classification
Types of hereditary inclusion body myopathy:
IBM2 is the most common form, and is an autosomal recessive form, caused by mutations in the GNE gene; this form mainly affects leg muscles, but with an unusual distribution that spares the quadriceps. The incidence of this form is about 10 per million per year. There are two forms: a quadriceps sparing myopathy (autosomal recessive form of inclusion body myopathy) and Nonaka type distal myopathy (distal myopathy with rimmed vacuoles). While occurring worldside it is most common in Jews of Persian origin. The GNE gene ecodes the rate-limiting, bifunctional enzyme of sialic acid biosynthesis, uridine diphosphate-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase. Disease occurs when both copies in the genome are non functional. The pathophysiology is still unclear. Cardiac involvement may occur.
IBM3 is a sometimes autosomal dominant and sometimes autosomal recessive form caused by mutations in MYHC2A; it is relatively mild muscle disorder.
Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia (IBMPFD), now more commonly referred to as multisystem proteinopathy (MSP), is an autosomal dominant condition caused by mutations in VCP, HNRPA2B1 or HNRNPA1; it is a multisystem degenerative disorder that can affect muscle, bone, and/or the central nervous system.The condition now called Desmin-related myofibrillar myopathy (also called myofibrillar myopathy-1) was formerly known as inclusion body myopathy 1 (IBM1).More types of HIMBs, linked to other genes, may be identified in the future.
Treatment
Treatment is palliative, not curative (as of 2009).Treatment options for lower limb weakness such as foot drop can be through the use of Ankle Foot Orthoses (AFOs) which can be designed or selected by an Orthotist based upon clinical need of the individual. Sometimes tuning of rigid AFOs can enhance knee stability.
Prognosis
A 2009 review noted that muscle weakness usually begins after age 20 and after 20–30 years, the person usually requires a wheel chair for mobility. There was no mention of increased mortality.
Research
Because lack of sialic acid appears to be part of the pathology of IBM caused by GNE mutations, clinical trials with sialic acid supplements, and with a precursor of sialic acid, N-Acetylmannosamine, have been conducted, and as of 2016 further trials were planned.
History
Hereditary inclusion body myopathy (IBM) constitutes a unique group of neuromuscular disorders characterized by adult-onset slowly progressive distal and proximal weakness, and a typical muscle pathology including rimmed vacuoles and filamentous inclusions. Autosomal dominant (IMB3; OMIM 605637 [1]) and autosomal recessive (IBM2; OMIM 600737 [2]) forms have been described. The autosomal recessive form, first characterized in Jews of Persian descent, is a myopathy that affects mainly leg muscles, but with an unusual distribution that spares the quadriceps, so-called quadriceps-sparing myopathy (QSM). This disorder was subsequently found in other Middle Eastern families, the gene was mapped to 9p13-p12, and in 104 affected persons from 47 Middle Eastern families the same mutation in homozygous state was found in the GNE gene. Affected individuals in families of other ethnic origins were found to be compound heterozygotes for other distinct mutations in the GNE gene. From OMIM 603824. [3]
See also
Inclusion body myositis, a more common and non-hereditary form.
Valosin-containing protein (VCP); mutations in VCP cause multisystem proteinopathy (MSP) which can present (among others) as a rare form of inclusion body myopathy.
References
External links
GeneReviews/NCBI/NIH/UW entry on Inclusion Body Myopathy 2
GeneReviews/NCBI/NIH/UW entry on Inclusion Body Myopathy with Paget Disease of Bone and/or Frontotemporal Dementia |
You serve as a guide in the medical field. Explain medical terms thoroughly, ensuring the information is both insightful and comprehensible. | I'm not familiar with the medical term 'Hypoprothrombinemia.' Could you provide some insights? | Hypoprothrombinemia is a rare blood disorder in which a deficiency in immunoreactive prothrombin (Factor II), produced in the liver, results in an impaired blood clotting reaction, leading to an increased physiological risk for spontaneous bleeding. This condition can be observed in the gastrointestinal system, cranial vault, and superficial integumentary system, affecting both the male and female population. Prothrombin is a critical protein that is involved in the process of hemostasis, as well as illustrating procoagulant activities. This condition is characterized as an autosomal recessive inheritance congenital coagulation disorder affecting 1 per 2,000,000 of the population, worldwide, but is also attributed as acquired.
Signs and symptoms
There are various symptoms that are presented and are typically associated to a specific site that they appear at. Hypoprothrombinemia is characterized by a poor blood clotting function of prothrombin. Some symptoms are presented as severe, while others are mild, meaning that blood clotting is slower than normal. Areas that are usually affected are muscles, joints, and the brain, however, these sites are more uncommon.The most common symptoms include:
Easy bruising
Oral mucosal bleeding - Bleeding of the membrane mucus lining inside of the mouth.
Soft tissue bleeding.
Hemarthrosis - Bleeding in joint spaces.
Epistaxis - Acute hemorrhages from areas of the nasal cavity, nostrils, or nasopharynx.
Women with this deficiency experience menorrhagia: prolonged, abnormal heavy menstrual bleeding. This is typically a symptom of the disorder when severe blood loss occurs.Other reported symptoms that are related to the condition:
Prolonged periods of bleeding due to surgery, injury, or post birth.
Melena - Associated with acute gastrointestinal bleeding, dark black, tarry feces.
Hematochezia - Lower gastrointestinal bleeding, passage of fresh, bright red blood through the anus secreted in or with stools. If associated with upper gastrointestinal bleeding, suggestive of a more life-threatening issue.Type I: Severe hemorrhages are indicators of a more severe prothrombin deficiency that account for muscle hematomas, intracranial bleeding, postoperative bleeding, and umbilical cord hemorrhage, which may also occur depending on the severity, respectively.
Type II: Symptoms are usually more capricious, but can include a variety of the symptoms described previously. Less severe cases of the disorder typically do not involve spontaneous bleeding.
Causes
Hypoprothrombinemia can be the result of a genetic defect, may be acquired as the result of another disease process, or may be an adverse effect of medication. For example, 5-10% of patients with systemic lupus erythematosus exhibit acquired hypoprothrombinemia due to the presence of autoantibodies which bind to prothrombin and remove it from the bloodstream (lupus anticoagulant-hypoprothrombinemia syndrome). The most common viral pathogen that is involved is Adenovirus, with a prevalence of 50% in postviral cases.
Inheritance
Autosomal recessive condition in which both parents must carry the recessive gene in order to pass the disease on to offspring. If both parents have the autosomal recessive condition, the chance of mutation in offspring increases to 100%. An individual will be considered a carrier if one mutant copy of the gene is inherited, and will not illustrate any symptoms. The disease affects both men and women equally, and overall, is a very uncommon inherited or acquired disorder.
Non-inheritance and other factors
There are two types of prothrombin deficiencies that occur depending on the mutation:Type I (true deficiency), includes a missense or nonsense mutation, essentially decreasing prothrombin production. This is associated with bleeding from birth. Here, plasma levels of prothrombin are typically less than 10% of normal levels.Type II, known as dysprothrombinemia, includes a missense mutation at specific Xa factor cleavage sites and serine protease prothrombin regions. Type II deficiency creates a dysfunctional protein with decreased activity and usually normal or low-normal antigen levels. A vitamin K-dependent clotting factor is seldom seen as a contributor to inherited prothrombin deficiencies, but lack of Vitamin K decreases the synthesis of prothrombin in liver cells.Acquired underlying causes of this condition include severe liver disease, warfarin overdose, platelet disorders, and disseminated intravascular coagulation (DIC).
It may also be a rare adverse effect to ceftriaxone.
Mechanism
Hypoprothrombinemia is found to present itself as either inherited or acquired, and is a decrease in the synthesis of prothrombin. In the process of inheritance, it marks itself as an autosomal recessive disorder, meaning that both parents must be carriers of the defective gene in order for the disorder to be present in a child. Prothrombin is a glycoprotein that occurs in blood plasma and functions as a precursor to the enzyme, thrombin, which acts to convert fibrinogen into fibrin, therefore, fortifying clots. This clotting process is known as coagulation.The mechanism specific to prothrombin (factor II) includes the proteolytically cleaving, breakdown of proteins into smaller polypeptides or amino acids, of this coagulation factor in order to form thrombin at the beginning of the cascade, leading to stemming of blood loss. A mutation in factor II would essentially lead to hypoprothrombinemia. The mutation is presented on chromosome 11.Areas where the disease has been shown to present itself at include the liver, since the glycoprotein is stored in this area.
Acquired cases are results from an isolated factor II deficiency. Specific cases include:
Vitamin K deficiency: In the liver, vitamin K plays an important role in the synthesis of coagulation factor II. Bodys capacity in the storage of vitamin K is typically very low. Vitamin K-dependent coagulation factors have a very short half-life, sometimes leading to a deficiency when a depletion of vitamin K occurs. The liver synthesizes inactive precursor proteins in the absence of vitamin K (liver disease). Vitamin K deficiency leads to impaired clotting of the blood and in some cases, causes internal bleeding without an associated injury.
Disseminated intravascular coagulation (DIC): Involving abnormal, excessive generation of thrombin and fibrin within the blood. Relative to hypoprothrombinemia, due to increased platelet aggregation and coagulation factor consumption involved in the process.
Anticoagulants: warfarin overdose: Used as a treatment for prevention of blood clots, however, like most drugs, side effects have been shown to increase risk of excessive bleeding by functioning in the disruption of hepatic synthesis of coagulation factors II, VII, IX, and X. Vitamin K is an antagonist to warfarin drug, reversing its activity, causing it to be less effective in the process of blood clotting. Warfarin intake has been shown to interfere with Vitamin-K metabolism.
Diagnosis
Diagnosis of inherited hypoprothrombinemia, relies heavily on a patients medical history, family history of bleeding issues, and lab exams performed by a hematologist. A physical examination by a general physician should also be performed in order to determine whether the condition is congenital or acquired, as well as ruling out other possible conditions with similar symptoms. For acquired forms, information must be taken regarding current diseases and medications taken by the patient, if applicable.Lab tests that are performed to determine diagnosis:
Factor assays: To observe the performance of specific factors (II) to identify missing/poorly performing factors. These lab tests are typically performed first in order to determine the status of the factor.
Prothrombin blood test: Determines if patient has deficient or low levels of Factor II.
Vitamin K1 test: Performed to evaluate bleeding of unknown causes, nosebleeds, and identified bruising. To accomplish this, a band is wrapped around the patients arm, 4 inches above the superficial vein site in the elbow pit. The vein is penetrated with the needle and amount of blood required for testing is obtained. Decreased vitamin K levels are suggestive of hypoprothrombinemia. However, this exam is rarely used as a prothrombin blood test is performed beforehand.
Treatment
Treatment is almost always aimed to control hemorrhages, treating underlying causes, and taking preventative steps before performing invasive surgeries.
Hypoprothrombinemia can be treated with periodic infusions of purified prothrombin complexes. These are typically used as treatment methods for severe bleeding cases in order to boost clotting ability and increasing levels of vitamin K-dependent coagulation factors.
A known treatment for hypoprothrombinemia is menadoxime.
Menatetrenone was also listed as an antihemorrhagic vitamin.
4-Amino-2-methyl-1-naphthol (Vitamin K5) is another treatment for hypoprothrombinemia.
Vitamin K forms are administered orally or intravenously.
Other concentrates include Proplex T, Konyne 80, and Bebulin VH.Fresh frozen plasma infusion (FFP) is a method used for continuous bleeding episodes, every 3–5 weeks for mention.
Used to treat various conditions related to low blood clotting factors.
Administered by intravenous injection and typically at a 15-20 ml/kg/dose.
Can be used to treat acute bleeding.Sometimes, underlying causes cannot be controlled or determined, so management of symptoms and bleeding conditions should be priority in treatment.Invasive options, such as surgery or clotting factor infusions, are required if previous methods do not suffice. Surgery is to be avoided, as it causes significant bleeding in patients with hypoprothrombinemia.
Prognosis
Prognosis for patients varies and is dependent on severity of the condition and how early the treatment is managed.
With proper treatment and care, most people go on to live a normal and healthy life.
With more severe cases, a hematologist will need to be seen throughout the patients life in order to deal with bleeding and continued risks.
References
== External links == |
You are an assistant in medical learning. Your role is to clarify medical terminology, ensuring the information is both accurate and accessible. | I've encountered the term 'Drug withdrawal' while reading about medical topics. What does it refer to exactly? | Drug withdrawal, drug withdrawal syndrome, or substance withdrawal syndrome, is the group of symptoms that occur upon the abrupt discontinuation or decrease in the intake of pharmaceutical or recreational drugs.
In order for the symptoms of withdrawal to occur, one must have first developed a form of drug dependence. This may occur as physical dependence, psychological dependence or both. Drug dependence develops from consuming one or more substances over a period of time.
Dependence arises in a dose-dependent manner and produces withdrawal symptoms that vary with the type of drug that is consumed. For example, prolonged use of an antidepressant medication is likely to cause a rather different reaction when discontinued compared to discontinuation of an opioid, such as heroin. Withdrawal symptoms from opiates include anxiety, sweating, vomiting, and diarrhea. Alcohol withdrawal symptoms include irritability, fatigue, shaking, sweating, and nausea. Withdrawal from nicotine can cause irritability, fatigue, insomnia, headache, and difficulty concentrating. Many prescription and legal nonprescription substances can also cause withdrawal symptoms when individuals stop consuming them, even if they were taken as directed by a physician.
The route of administration, whether intravenous, intramuscular, oral or otherwise, can also play a role in determining the severity of withdrawal symptoms. There are different stages of withdrawal as well; generally, a person will start to feel bad (crash or come down), progress to feeling worse, hit a plateau, and then the symptoms begin to dissipate. However, withdrawal from certain drugs (barbiturates, benzodiazepines, alcohol, glucocorticoids) can be fatal. While it is seldom fatal to the user, withdrawal from opiates (and some other drugs) can cause miscarriage, due to fetal withdrawal. The term "cold turkey" is used to describe the sudden cessation use of a substance and the ensuing physiologic manifestations.
The symptoms from withdrawal may be even more dramatic when the drug has masked prolonged malnutrition, disease, chronic pain, infections (common in intravenous drug use), or sleep deprivation, conditions that drug abusers often develop as a secondary consequence of the drug. When the drug is removed, these conditions may resurface and be confused with withdrawal symptoms. Genes that encode for the Alpha5 Nicotinic Acetylcholine Receptor affect nicotine and alcohol withdrawal symptoms.
Effect on homeostasis
Homeostasis is the bodys ability to maintain a certain chemical equilibrium in the brain and throughout the body. For example, the function of shivering in response to cold is to produce heat maintaining internal temperature at around 37 °C (98.6 °F). Homeostasis is impacted in many ways by drug usage and withdrawal. The internal systems perpetuate homeostasis by using different counter-regulatory methods in order to create a new state of balance based on the presence of the drug in the system. These methods include adapting the bodys levels of neurotransmitters, hormones, and other substances present to adjust for the addition of the drug to the body.
Substances
Examples (and ICD-10 code) of withdrawal syndrome include:
F10.3 alcohol withdrawal syndrome (which can lead to delirium tremens)
F11.3 opioid withdrawal, including methadone withdrawal
F12.3 cannabis withdrawal
F13.3 benzodiazepine withdrawal
F14.3 cocaine withdrawal
F15.3 caffeine withdrawal
F17.3 nicotine withdrawal
Prescription medicine
As noted above, many drugs should not be stopped abruptly without the advice and supervision of a physician, especially if the medication induces dependence or if the condition they are being used to treat is potentially dangerous and likely to return once medication is stopped, such as diabetes, asthma, heart conditions and many psychological or neurological conditions, like epilepsy, depression, hypertension, schizophrenia and psychosis. The stopping of antipsychotics in schizophrenia and psychoses needs monitoring. The stopping of antidepressants for example, can lead to antidepressant discontinuation syndrome. With careful physician attention, however, medication prioritization and discontinuation can decrease costs, simplify prescription regimens, decrease risks of adverse drug events and poly-pharmacy, focus therapies where they are most effective, and prevent cost-related under-use of medications.Medication Appropriateness Tool for Comorbid Health Conditions in Dementia (MATCH-D) warns that people with dementia are more likely to experience adverse effects, and to monitor carefully for withdrawal symptoms when ceasing medications for these people as they are both more likely to experience symptoms and less likely to be able to reliably report symptoms.
Anti-hypertensive drugs
The latest evidence does not have evidence of an effect due to discontinuing vs continuing medications used for treating elevated blood pressure or prevention of heart disease in older adults on all-case mortality and incidence of heart attack. The findings are based on low quality evidence suggesting it may be safe to stop anti-hypertensive medications. However, older adults should not stop any of their medications without talking to a healthcare professional.
See also
Chemical dependency
Craving, a psychological withdrawal symptom
Drug detoxification
Drug tolerance
Hangover
Neonatal withdrawal
Rebound effect
Post-acute withdrawal syndrome (PAWS)
== References == |
You act as a bridge between medical jargon and everyday language. Explain medical terms in a manner that is comprehensive yet approachable for non-experts. | I'm curious about the meaning of the medical term 'Pruritic folliculitis of pregnancy.' Can you give me some insights? | Pruritic folliculitis of pregnancy is a skin condition that occurs in one in 3000 people, about 0.2% of cases, who are in their second to third trimester of pregnancy where the hair follicle becomes inflamed or infected, resulting in a pus filled bump. Some dermatologic conditions aside from pruritic folliculitis during pregnancy include "pruritic urticarial papules and plaques of pregnancy, atopic eruption of pregnancy, pemphigoid gestationis, intrahepatic cholestasis of pregnancy, and pustular psoriasis of pregnancy". This pruritic folliculitis of pregnancy differs from typical pruritic folliculitis; in pregnancy, it is characterized by sterile hair follicles becoming inflamed mainly involving the trunk, contrasting how typical pruritic folliculitis is mainly localized on "the upper back, shoulders, and chest." This condition was first observed after some pregnant individuals showed signs of folliculitis that were different than seen before. The inflammation was thought to be caused by hormonal imbalance, infection from bacteria, fungi, viruses or even an ingrown hair. However, there is no known definitive cause as of yet. These bumps usually begin on the belly and then spread to upper regions of the body as well as the thighs. This condition does not harm the fetus or the mother and usually resolves after delivery of the baby. The rate of incidence could possibly be higher but due to the unknown etiology of the condition, misdiagnosis, and varying levels of severity, it is difficult to differentiate. Pruritic folliculitis of pregnancy is currently classified as atopic eruption of pregnancy (AEP) in a retrospective study done in 2006 that compared this condition to eczema and prurigo of pregnancy, which occurred in 49.7% and 0.8% of cases respectively, with eczema clearly being more frequent. Unlike typical pruritic folliculitis which does not resolve on its own, pruritic folliculitis of pregnancy clears spontaneously on delivery or in postpartum period. Fortunately, pruritic folliculitis of pregnancy has no mortality effects or significant adverse effects on the mother or on the fetus.Currently, there are no treatment guidelines for this condition due to the nature of its unknown etiology but symptom relief is strongly emphasized using non-pharmacological interventions such as warm baths or wearing loose clothing. If itchiness and discomfort persists, benzoyl peroxide, low to mid potency topical steroids, or antihistamines can be tried. Novel treatments have also shown potential in treating case studies of pruritic folliculitis of pregnancy, such as using ultraviolet phototherapy. However, further investigation is still required to study its efficacy and safety in second to third trimester pregnant patients.
History
This condition was first observed in six people in 1981 with many different speculations but no real evidence as to a specific cause. These people had papules starting at various times throughout the second to third trimester with varying severity. Biopsies were taken from these people over a 15 month period in order to examine the composition of these papules. After using H&E, hematoxylin and eosin, to stain the samples, the researchers only found some inflammatory cells like neutrophils, monocytes, lymphocytes, and eosinophils. In four of the samples, immunofluorescence microscopy, where fluorescent antibodies bind to a protein of interest and the expression levels are observed through microscopy, was used but there were no signs of immunoglobulins such as IgG, IgM, IgA or C3 found. Since the first description of this condition, there were very few case reports after, indicating the infrequency of pruritic folliculitis. This was also shown by a prospective study that was conducted in 1994 by Roger et al. that concluded with one individual out of 3,192 pregnant mothers (0.03%) had symptoms which were consistent with the diagnosis of pruritic folliculitis.
Pathophysiology
Folliculitis, by itself, is a common inflammation process of hair follicles in response to infection or damage to the hair follicles. This inflammatory response can be caused by bacteria, fungi, viruses, or simply ingrown hair. However, pruritic folliculitis of pregnancy is different in that it only occurs in pregnant individuals and during the second or third trimester of pregnancy. There is no clear mechanism in how pruritic folliculitis of pregnancy develops. Because this is a rare condition, there is still currently not enough research to study the cause of it. Some research suggest that this condition may be due to hormone level imbalance during pregnancy . Other research indicate that this condition could be due to immunological changes, such as the reduction of T helper 1 immune cells and the increase in T helper 2 immune cells that occur specifically when pregnant. However, there is not enough evidence to clearly support these claims. Although the pathophysiology of pruritic folliculitis of pregnancy is currently unknown, it has not been significantly linked to harm to either mother or baby. Moreover, this condition resolves after pregnancy and does not affect the development of the baby or recovery of the mother after delivery.
Suspected risk factors
There are currently no studies into the etiology behind pruritic folliculitis specifically in pregnancy; however, suspected risk factors include:
Dry skin
Genetics affecting hormone production
Poor personal hygiene
Family history of pruritus in pregnancy
Family history of eczema, hay fever, or asthma
Pruritus while taking contraceptive pill prior to pregnancy
Signs and Symptoms
The signs and symptoms of pruritic folliculitis of pregnancy include: redness of the skin, small red bumps that surrounds a hair follicle, and red bumps that are filled with pus "that usually appear first on the abdomen and may spread to the chest, upper portion of the back, shoulders, arms, and thighs" and it occurs during the second or third trimester of pregnancy. These symptoms are typically "mildly pruritic or asymptomatic" lasting between one week to several months. However, symptoms usually self-relieves spontaneously within one month after birth.
Diagnosis
The diagnosis of pruritic folliculitis of pregnancy is established based on clinical features such as redness of the skin consisting of small red bumps that surrounds a hair follicle and histopathologic features such as immune cells within the pus along with microscopic testing that shows there is no bacteria, microorganism, or other conditions that could cause itchy skin. Diagnosis for pruritic folliculitis of pregnancy requires patients to go through a biopsy, which consists of taking samples from the tissue to evaluate whether their lesions match the physical factors of pruritic folliculitis. Other pregnancy associated skin diseases must be ruled out along side obstetric cholestasis, which is a disorder that affects the liver during pregnancy.There is a great deal of overlap between the following conditions in pregnancy: eczema, prurigo, and pruritic folliculitis. Because of this, they are grouped in a class called atopic eruption of pregnancy. Compared to other pregnancy associated skin conditions, conditions in the class of atopic eruption of pregnancy occurs much earlier.
Management/Treatment
There is currently no official treatment guidelines for pruritic folliculitis of pregnancy as its etiology and clinical presentations still require further investigation; however, the goal of treatment is to relieve symptoms without causing harm to the mother or fetus. Non-pharmacological intervention is recommended first before using pharmacological agents to treat symptoms.
Since pruritic folliculitis of pregnancy appears in later stages of pregnancy and self-resolves post-partum, non-pharmacological interventions are recommended first to relieve itching symptoms. These interventions focuses on incorporating lifestyle changes which include: switching to loose-fitting clothes, using emollients, taking warm baths, avoiding harsh soaps, and maintaining good personal hygiene.If itching symptoms still persist, low to mid potency topical corticosteroids and first-generation antihistamines can be considered and may improve appearance of skin lesions. However, they may also not provide complete relief. Commonly used agents to treat pruritic folliculitis of pregnancy include: 10% topical benzoyl peroxide, 1% topical hydrocortisone, first generation H1 receptor blockers such as diphenhydramine or chlorpheniramine, and a short course of systemic corticosteroids such as prednisone.Narrowband ultraviolet B phototherapy has also been explored as a novel treatment option for pruritic folliculitis of pregnancy in one case study. Further investigation that leads to clinical trials is still required to understand the efficacy and safety of this unconventional treatment option.A comprehensive literature review using Medline and Cochrane Database relating to skin disease in pregnancy from 1990-2005 found that pruritic folliculitis of pregnancy has no associated morbidity for the mother or fetus and the condition will go away after pregnancy.An article from American Family Physician in 2007 states pruritic folliculitis of pregnancy has "no identified adverse effects" on pregnancy risks and that pruritic folliculitis of pregnancy can be treated using topical corticosteroids, topical benzoyl peroxide, or ultraviolet B light therapy.
Clinical Studies and Case Reports
There was a case report about a 30 year old women who was in her tenth week of her second pregnancy. She had widespread papulopustular follicular eruption (rash involving hair follicles) mainly affecting her limbs. She was first treated for a bacteria-associated folliculitis, to which she had some symptom relief. However, the continuation of the pruritic folliculitis still persisted. She was later diagnosised with pruritic folliculitis of pregnancy after a histopathologic test was done to confirm sterility and immune cells. She then started "narrowband ultraviolet (UV) B phototherapy at 70% of the minimal erythemal dose with 20% increments using a three times per week treatment schedule" at 11 weeks of her pregnancy. With this treatment, her skin greatly improved after 10 treatments and completely resolved after 20 treatments. She did not have pruritic folliculitis for the remainder of her pregnancy.Treatment, whether it is pharmacological or non-pharmacological, can vary in pregnant individuals with pruritic folliculitis. The patients choice to accept such treatment can vary as well. There have been case reports on resolution of pruritic folliculitis in patients who declined and accepted treatment. There was a case report on a 39-year-old woman who experienced a 2-month long manifestation of pruritic folliculitis during the 27th week of pregnancy. The signs, symptoms, and histology of physical presentation were consistent with pruritic folliculitis. Although benzoyl peroxide was prescribed, the patient declined treatment. Without any treatment, her pruritic folliculitis condition resolved after giving birth. In another case report, a 26 year old woman who was 31 weeks into her pregnancy, reported that these inflamed pustules formed over her upper torso especially around her linea nigra and changed over the course of the last 2 months. The diagnosis was confirmed after laboratory tests showed that there was mainly neutrophils and damaged follicle structures. The symptoms were treated with a 5% topical benzoyl peroxide gel but the pruritic folliculitis completely went away after the first week after delivering the baby.In an effort to establish a possible pathophysiologic mechanism behind pruritic folliculitis of pregnancy, a 2005 case study found pityrosporum yeast in the hair follicles of a pregnant 24 year-old patient. Pityrosporum yeast is typically grouped in hair follicles, leading to an inflammation of the pore causing folliculitis and symptoms of itching. However, it is important to note that this patients pruritic folliculitis lesions did not improve after delivery of the baby. This finding may lead investigators to believe that this patients lesions may not be contributed from the pregnancy, but instead it can be speculated that the reason behind the presence of this patients lesions postpartum is due to hot and humid weather, making her lesions more difficult to heal after giving birth.
See also
Prurigo gestationis
List of cutaneous conditions
Pruritic urticarial papules and plaques of pregnancy (PUPPP) rash
Intrahepatic cholestasis of pregnancy
== References == |
You are a medical knowledge base. Your task is to elucidate medical terminology, offering insights into their meanings, origins, and applications. | I'm encountering the term 'Limb body wall complex' in medical literature. What's its definition? | Limb body wall complex (LBWC) is a rare fetal malformation of unknown origins.
Traditionally diagnosis has been based on the Van Allen et al., criteria, i.e. the presence of two out of three of the following anomalies:
Exencephaly or encephalocele with facial clefts
Thoraco and or abdominoschisis and
Limb defects.LBWC occurs in approximately 0.32 in 100,000 births.At this time, there is no known cause of Limb Body Wall Complex. However, there have been tentative links made between a diagnosis of LBWC and cocaine use. In addition, current research has shown that there may be a genetic cause for a small limited number of LBWC cases.Limb Body Wall Complex is a lethal birth defect. There are only anecdotal stories of survivors.
== References == |
You are an expert in medical terminology. Explain medical terms in a way that is both precise and easy to understand for non-medical audiences. | Could you provide a brief overview of 'Eteplirsen' in a medical context? | Eteplirsen (brand name Exondys 51) is a medication to treat, but not cure, some types of Duchenne muscular dystrophy (DMD), caused by a specific mutation. Eteplirsen only targets specific mutations and can be used to treat about 14% of DMD cases. Eteplirsen is a form of antisense therapy.
Eteplirsen was developed by Steve Wilton, Sue Fletcher and colleagues at the University of Western Australia and commercialized by Sarepta Therapeutics. After a controversial debate surrounding the drugs efficacy, during which two FDA review panel members resigned in protest, eteplirsen received accelerated approval from the US Food and Drug administration in late 2016. The Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency (EMA) refused to authorize the use of eteplirsen.
Adverse effects
The following adverse events were observed in at least 10% of people who received eteplirsen in trials: vomiting, contusion, excoriation, arthralgia, rash, catheter site pain, and upper respiratory tract infection.
Mechanism of action
Duchenne muscular dystrophy is caused when a mutation in the DMD gene changes the DMD mRNA so that it no longer codes for functional dystrophin protein, usually due to a nonsense mutation that introduces a premature stop codon into the mRNA. If an exon with an appropriate number of bases lies near the mutation, by removing the defective exon the downstream reading frame can be corrected and production of partially functional dystrophin can be restored. This is the general strategy used for designing exon-skipping oligos for DMD; as there are 79 exons transcribed in the longest splice form of the dystrophin transcript, many different oligos are needed to address the range of mutations present in the population of people with DMD.Eteplirsen is a morpholino antisense oligomer which triggers excision of exon 51 during pre-mRNA splicing of the dystrophin RNA transcript. Skipping exon 51 changes the downstream reading frame of dystrophin; giving eteplirsen to a healthy person would result in production of dystrophin mRNA which would not code for functional dystrophin protein but, for DMD patients with particular nonsense mutations, giving eteplirsen can restore the reading frame of the dystrophin mRNA and result in production of functional (although modified by having an internal deletion consisting of both the patients original defect, as well as the therapeutically skipped exon) dystrophin. Eteplirsen is given by intravenous infusion for systemic treatment of DMD.
Exon skipping is induced by eteplirsen, a charge-neutral, phosphorodiamidate morpholino oligomer (PMO) that selectively binds to exon 51 of dystrophin pre-mRNA, restoring the phase of the reading frame and enabling production of functional, but internally edited, dystrophin. The uncharged nature of the PMO helps make it resistant to biological degradation. This modified dystrophin protein produced by eteplirsen may cause a less severe form of dystrophinopathy, much like Becker muscular dystrophy. Eteplirsens proposed mechanism of action is to bind to dystrophin pre-mRNA and alter the exon splicing of the RNA so that more almost full-length dystrophin is made. By increasing the quantity of an abnormal, but potentially functional, dystrophin protein, the objective is to slow or prevent the progression of DMD.
Nature and sequence of oligo and target
Eteplirsen is a morpholino phosphorodiamidate antisense oligomer.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488),
30-mer,
20% G,
43% CG,
Predicted Tm: 88.9 °C at 10 μM oligo.
Oligo complement
CTAGAAATGCCATCTTCCTTGATGTTGGAG
DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation.
CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT
CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC
GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA
GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Pharmacokinetics
Following single or multiple intravenous infusions, the majority of drug elimination occurred within 24 hours of intravenous administration. Elimination half-life of eteplirsen was 3 to 4 hours.
History
New Drug Applications (NDA) for eteplirsen and a similar drug drisapersen were filed with the US Food and Drug Administration (FDA) in August 2015. The Prescription Drug User Fee Act (PDUFA) goal dates for these were December 27, 2015 for drisapersen and February 26, 2016, for eteplirsen. Following FDA rejection of drisapersen, the agency announced a three-month time extension for its review of eteplirsen. The FDA panel decision was controversial because the FDA staff and the panel used a stricter standard of evidence than Sarepta and patient groups used. The FDA panel said that it was required by law to apply the standard of "substantial evidence" of effectiveness. This required randomized, controlled trials showing effectiveness of a meaningful clinical outcome, such as the ability to function in daily life. Sarepta and patient groups wanted to use the standard of historical controls, personal testimonies, and the presence of altered dystrophin in the body. On April 25, 2016, the Advisory Committee Panel voted against approval;. However, in June 2016, FDA requested for additional data from Sarepta to confirm findings of dystrophin production by eteplirsen. Janet Woodcock, director of the FDAs Center for Drug Evaluation and Research, overruled the panel, and FDA Commissioner Robert Califf deferred to her decision. Eterplirsen received accelerated approval on September 19, 2016.The European Medicines Agency reviewed the molecule in 2018, and refused to approve it.Following the approval of eteplirsen, two other drugs of a similar kind, golodirsen and viltolarsen received provisional approval from the FDA for the treatment of people with a confirmed mutation of the dystrophin gene that is amenable to exon 53 skipping as well as casimersen for exon 45 skipping.
Society and culture
Economics
The US list price of eteplirsen is US$300,000 per year of treatment. The Institute for Clinical and Economic Review has found the drug not cost effective at the list price when the cost of one Quality-adjusted life year (QALY) was equal to US$150,000.
References
External links
"Eteplirsen". Drug Information Portal. U.S. National Library of Medicine. |
You are a medical educator. Your role is to provide detailed and clear explanations for medical terms, suitable for both professionals and laypersons. | I'm encountering the term 'Lithium (medication)' in medical literature. What's its definition? | Certain lithium compounds, also known as lithium salts, are used as psychiatric medication, primarily for bipolar disorder and for major depressive disorder. In these disorders, it sometimes reduces the risk of suicide. Lithium is taken orally.Common side effects include increased urination, shakiness of the hands, and increased thirst. Serious side effects include hypothyroidism, diabetes insipidus, and lithium toxicity. Blood level monitoring is recommended to decrease the risk of potential toxicity. If levels become too high, diarrhea, vomiting, poor coordination, sleepiness, and ringing in the ears may occur. Lithium is teratogenic, especially during the first trimester of pregnancy and at higher dosages. The use of lithium while breastfeeding is controversial; however, many international health authorities advise against it, and the long-term outcomes of perinatal lithium exposure have not been studied. The American Academy of Pediatrics lists lithium as contraindicated for pregnancy and lactation. The United States Food and Drug Administration categorizes lithium as having positive evidence of risk for pregnancy and possible hazardous risk for lactation.Lithium salts are classified as mood stabilizers. How lithium works is not specifically known.In the nineteenth century, lithium was used in people who had gout, epilepsy, and cancer. Its use in the treatment of mental disorders began with Carl Lange in Denmark and William Alexander Hammond in New York City, who used lithium to treat mania from the 1870s onwards, based on now-discredited theories involving its effect on uric acid. Use of lithium for mental disorders was re-established (on a different theoretical basis) in 1948 by John Cade in Australia. It is on the World Health Organizations List of Essential Medicines, and is available as a generic medication. In 2019, it was the 205th most commonly prescribed medication in the United States, with more than 2 million prescriptions.
Medical uses
In 1970, lithium was approved by the United States Food and Drug Administration (FDA) for the treatment of bipolar disorder, which remains its primary use in the United States. It is sometimes used when other treatments are not effective in a number of other conditions, including major depression, schizophrenia, disorders of impulse control, and some psychiatric disorders in children. Because the FDA has not approved lithium for the treatment of other disorders, such use is off-label. In mood disorders, of which bipolar disorder is one, it decreases the risk of suicide. This benefit is not seen with other medications.
Bipolar disorder
Lithium is primarily used as a maintenance drug in the treatment of bipolar disorder to stabilize mood and prevent manic episodes, but it may also be helpful in the acute treatment of manic episodes. Lithium carbonate treatment was previously considered to be unsuitable for children; however, more recent studies show its effectiveness for treatment of early-onset bipolar disorder in children as young as eight. The required dosage is slightly less than the toxic level (representing a low therapeutic index), requiring close monitoring of blood levels of lithium carbonate during treatment. A limited amount of evidence suggests lithium carbonate may contribute to treatment of substance use disorders for some people with bipolar disorder.
Schizophrenic disorders
Lithium is recommended for the treatment of schizophrenic disorders only after other antipsychotics have failed; it has limited effectiveness when used alone. The results of different clinical studies of the efficacy of combining lithium with antipsychotic therapy for treating schizophrenic disorders have varied.
Major depressive disorder
Lithium is widely prescribed as a treatment for depression.
Augmentation
If therapy with antidepressants does not fully treat the symptoms of major depressive disorder (MDD) then a second augmentation agent is sometimes added to the therapy. Lithium is one of the few augmentation agents for antidepressants to demonstrate efficacy in treating MDD in multiple randomized controlled trials and it has been prescribed (off-label) for this purpose since the 1980s.
Monotherapy
There are a few old studies indicating efficacy of lithium for acute depression with lithium having the same efficacy as tricyclic antidepressants. A recent study concluded that lithium works best on chronic and recurrent depression when compared to modern antidepressant (i.e. citalopram) but not for patients with no history of depression.
Prevention of suicide
Meta-analyses have yielded differing results regarding the efficacy of lithium for preventing suicide and suicidality. Nonetheless, it remains widely used for these purposes.
Monitoring
Those who use lithium should receive regular serum level tests and should monitor thyroid and kidney function for abnormalities, as it interferes with the regulation of sodium and water levels in the body, and can cause dehydration. Dehydration, which is compounded by heat, can result in increasing lithium levels. The dehydration is due to lithium inhibition of the action of antidiuretic hormone, which normally enables the kidney to reabsorb water from urine. This causes an inability to concentrate urine, leading to consequent loss of body water and thirst.Lithium concentrations in whole blood, plasma, serum or urine may be measured using instrumental techniques as a guide to therapy, to confirm the diagnosis in potential poisoning victims or to assist in the forensic investigation in a case of fatal overdosage. Serum lithium concentrations are usually in the range of 0.5–1.3 mmol/L (0.5–1.3 mEq/L) in well-controlled people, but may increase to 1.8–2.5 mmol/L in those who accumulate the drug over time and to 3–10 mmol/L in acute overdose.Lithium salts have a narrow therapeutic/toxic ratio, so should not be prescribed unless facilities for monitoring plasma concentrations are available. Doses are adjusted to achieve plasma concentrations of 0.4 to 1.2 mmol Li+/L on samples taken 12 hours after the preceding dose.
Given the rates of thyroid dysfunction, thyroid parameters should be checked before lithium is instituted and monitored after 3–6 months and then every 6–12 months.Given the risks of kidney malfunction, serum creatinine and eGFR should be checked before lithium is instituted and monitored after 3–6 months at regular interval. Patients who have a rise in creatinine on three or more occasions, even if their eGFR is > 60 ml/min/
1.73m2 require further evaluation, including a urinalysis for haematuria, proteinuria, a review of their medical history with attention paid to cardiovascular, urological and medication history, and blood pressure control and management. Overt proteinuria should be further quantified with a urine protein to creatinine ratio.
Discontinuation
For patients who have achieved long term remission, it is recommended to discontinue lithium gradually and in a controlled fashion.
Cluster headaches, migraine and hypnic headache
Studies testing prophylactic use of lithium in cluster headaches (when compared to verapamil), migraine attacks and hypnic headache indicate good efficacy.
Adverse effects
Sources for the following lists.
Very Common (> 10% incidence) adverse effects of lithium include
Confusion
Constipation (usually transient, but can persist in some)
Decreased memory
Diarrhea (usually transient, but can persist in some)
Dry mouth
EKG changes — usually benign changes in T waves
Hand tremor (usually transient, but can persist in some) with an incidence of 27%. If severe, psychiatrist may lower lithium dosage, change lithium salt type or modify lithium preparation from long to short acting (despite lacking evidence for these procedures) or use pharmacological help
Headache
Hyperreflexia — overresponsive reflexes
Leukocytosis — elevated white blood cell count
Muscle weakness (usually transient, but can persist in some)
Myoclonus — muscle twitching
Nausea (usually transient)
Polydipsia — increased thirst
Polyuria — increased urination
Renal (kidney) toxicity which may lead to chronic kidney failure
Vomiting (usually transient, but can persist in some)
Vertigo
Weight gainCommon (1–10%) adverse effects include
Acne
Extrapyramidal side effects — movement-related problems such as muscle rigidity, parkinsonism, dystonia, etc.
Euthyroid goitre — i.e. the formation of a goitre despite normal thyroid functioning
Hypothyroidism — a deficiency of thyroid hormone.
Hair loss/hair thinningUnknown
Sexual dysfunction
HypoglycemiaLithium carbonate can induce a 1–2 kg of weight gain. Weight gain may be a source of low self-esteem for the clinically depressed.In addition to tremors, lithium treatment appears to be a risk factor for development of parkinsonism-like symptoms, although the causal mechanism remains unknown.Most side effects of lithium are dose-dependent. The lowest effective dose is used to limit the risk of side effects.
Hypothyroidism
The rate of hypothyroidism is around six times higher in people who take lithium. Low thyroid hormone levels in turn increase the likelihood of developing depression. People taking lithium thus should routinely be assessed for hypothyroidism and treated with synthetic thyroxine if necessary.Because lithium competes with the antidiuretic hormone in the kidney, it increases water output into the urine, a condition called nephrogenic diabetes insipidus. Clearance of lithium by the kidneys is usually successful with certain diuretic medications, including amiloride and triamterene. It increases the appetite and thirst ("polydypsia") and reduces the activity of thyroid hormone (hypothyroidism). The latter can be corrected by treatment with thyroxine and does not require the lithium dose to be adjusted. Lithium is also believed to permanently affect renal function, although this does not appear to be common.
Pregnancy and breast feeding
Lithium is a teratogen, causing birth defects in a small number of newborn babies. Case reports and several retrospective studies have demonstrated possible increases in the rate of a congenital heart defect known as Ebsteins anomaly, if taken during a womans pregnancy. As a consequence, fetal echocardiography is routinely performed in pregnant women taking lithium to exclude the possibility of cardiac anomalies. Lamotrigine seems to be a possible alternative to lithium in pregnant women for the treatment of acute bipolar depression or for the management of bipolar patients with normal mood. Gabapentin and clonazepam are also indicated as antipanic medications during the childbearing years and during pregnancy. Valproic acid and carbamazepine also tend to be associated with teratogenicity.
While it appears to be safe to use while breastfeeding a number of guidelines list it as a contraindication including the British National Formulary.
Kidney damage
Lithium has been associated with several forms of kidney injury. It is estimated that impaired urinary concentrating ability is present in at least half of individuals on chronic lithium therapy, a condition called lithium-induced nephrogenic diabetes insipidus. Continued use of lithium can lead to more serious kidney damage in an aggravated form of diabetes insipidus. Chronic kidney disease caused by lithium has not been proven with various contradicting results presented by a 2018 review. In rare cases, some forms of lithium-caused kidney damage may be progressive and lead to end-stage kidney failure with a reported incidence of 0.2% to 0.7%.
Hyperparathyroidism
Lithium-associated hyperparathyroidism is the leading cause of hypercalcemia in lithium-treated patients. Lithium may lead to exacerbation of pre-existing primary hyperparathyroidism or cause an increased set-point of calcium for parathyroid hormone suppression, leading to parathyroid hyperplasia.
Interactions
Lithium plasma concentrations are known to be increased with concurrent use of diuretics—especially loop diuretics (such as furosemide) and thiazides—and non-steroidal anti-inflammatory drugs (NSAIDs) such as ibuprofen. Lithium concentrations can also be increased with concurrent use of ACE inhibitors such as captopril, enalapril, and lisinopril.Lithium is primarily cleared from the body through glomerular filtration, but some is then reabsorbed together with sodium through the proximal tubule. Its levels are therefore sensitive to water and electrolyte balance. Diuretics act by lowering water and sodium levels; this causes more reabsorption of lithium in the proximal tubules so that the removal of lithium from the body is less, leading to increased blood levels of lithium. ACE inhibitors have also been shown in a retrospective case-control study to increase lithium concentrations. This is likely due to constriction of the afferent arteriole of the glomerulus, resulting in decreased glomerular filtration rate and clearance. Another possible mechanism is that ACE inhibitors can lead to a decrease in sodium and water. This will increase lithium reabsorption and its concentrations in the body.There are also drugs that can increase the clearance of lithium from the body, which can result in decreased lithium levels in the blood. These drugs include theophylline, caffeine, and acetazolamide. Additionally, increasing dietary sodium intake may also reduce lithium levels by prompting the kidneys to excrete more lithium.Lithium is known to be a potential precipitant of serotonin syndrome in people concurrently on serotonergic medications such as antidepressants, buspirone and certain opioids such as pethidine (meperidine), tramadol, oxycodone, fentanyl and others. Lithium co-treatment is also a risk factor for neuroleptic malignant syndrome in people on antipsychotics and other antidopaminergic medications.High doses of haloperidol, fluphenazine, or flupenthixol may be hazardous when used with lithium; irreversible toxic encephalopathy has been reported.
Indeed, these and other antipsychotics have been associated with increased risk of lithium neurotoxicity, even with low therapeutic lithium doses.
Overdose
Lithium toxicity, which is also called lithium overdose and lithium poisoning, is the condition of having too much lithium in the blood. This condition also happens in persons that are taking lithium in which the lithium levels are affected by drug interactions in the body.
In acute toxicity, people have primarily gastrointestinal symptoms such as vomiting and diarrhea, which may result in volume depletion. During acute toxicity, lithium distributes later into the central nervous system resulting in mild neurological symptoms, such as dizziness.In chronic toxicity, people have primarily neurological symptoms which include nystagmus, tremor, hyperreflexia, ataxia, and change in mental status. During chronic toxicity, the gastrointestinal symptoms seen in acute toxicity are less prominent. The symptoms are often vague and nonspecific.If the lithium toxicity is mild or moderate, lithium dosage is reduced or stopped entirely. If the toxicity is severe, lithium may need to be removed from the body.
Mechanism of action
The specific biochemical mechanism of lithium action in stabilizing mood is unknown.Upon ingestion, lithium becomes widely distributed in the central nervous system and interacts with a number of neurotransmitters and receptors, decreasing norepinephrine release and increasing serotonin synthesis.Unlike many other psychoactive drugs, Li+ typically produces no obvious psychotropic effects (such as euphoria) in normal individuals at therapeutic concentrations.
Lithium may also increase the release of serotonin by neurons in the brain. In vitro studies performed on serotonergic neurons from rat raphe nuclei have shown that when these neurons are treated with lithium, serotonin release is enhanced during a depolarization compared to no lithium treatment and the same depolarization.Lithium both directly and indirectly inhibits GSK3β (glycogen synthase kinase 3β) which results in the activation of mTOR. This leads to an increase in neuroprotective mechanisms by facilitating the Akt signaling pathway. GSK-3β is a downstream target of monoamine systems. As such, it is directly implicated in cognition and mood regulation. During mania, GSK-3β is activated via dopamine overactivity. GSK-3β inhibits the transcription factors β-catenin and cyclic AMP (cAMP) response element binding protein (CREB), by phosphorylation. This results in a decrease in the transcription of important genes encoding for neurotrophins. In addition, several authors proposed that pAp-phosphatase could be one of the therapeutic targets of lithium. This hypothesis was supported by the low Ki of lithium for human pAp-phosphatase compatible within the range of therapeutic concentrations of lithium in the plasma of people (0.8–1 mM). The Ki of human pAp-phosphatase is ten times lower than that of GSK3β (glycogen synthase kinase 3β). Inhibition of pAp-phosphatase by lithium leads to increased levels of pAp (3′-5′ phosphoadenosine phosphate), which was shown to inhibit PARP-1.Another mechanism proposed in 2007 is that lithium may interact with nitric oxide (NO) signalling pathway in the central nervous system, which plays a crucial role in neural plasticity. The NO system could be involved in the antidepressant effect of lithium in the Porsolt forced swimming test in mice. It was also reported that NMDA receptor blockage augments antidepressant-like effects of lithium in the mouse forced swimming test, indicating the possible involvement of NMDA receptor/NO signaling in the action of lithium in this animal model of learned helplessness.
Lithium possesses neuroprotective properties by preventing apoptosis and increasing cell longevity.Although the search for a novel lithium-specific receptor is ongoing, the high concentration of lithium compounds required to elicit a significant pharmacological effect leads mainstream researchers to believe that the existence of such a receptor is unlikely.
Oxidative metabolism
Evidence suggests that mitochondrial dysfunction is present in patients with bipolar disorder.Oxidative stress and reduced levels of anti-oxidants (such as glutathione) lead to cell death. Lithium may protect against oxidative stress by up-regulating complex I and II of the mitochondrial electron transport chain.
Dopamine and G-protein coupling
During mania, there is an increase in neurotransmission of dopamine that causes a secondary homeostatic down-regulation, resulting in decreased neurotransmission of dopamine, which can cause depression. Additionally, the post-synaptic actions of dopamine are mediated through G-protein coupled receptors. Once dopamine is coupled to the G-protein receptors, it stimulates other secondary messenger systems that modulate neurotransmission. Studies found that in autopsies (which do not necessarily reflect living people), people with bipolar disorder had increased G-protein coupling compared to people without bipolar disorder. Lithium treatment alters the function of certain subunits of the dopamine associated G-protein, which may be part of its mechanism of action.
Glutamate and NMDA receptors
Glutamate levels are observed to be elevated during mania. Lithium is thought to provide long-term mood stabilization and have anti-manic properties by modulating glutamate levels. It is proposed that lithium competes with magnesium for binding to NMDA glutamate receptor, increasing the availability of glutamate in post-synaptic neurons, leading to a homeostatic increase in glutamate re-uptake which reduces glutamatergic transmission.
The NMDA receptor is also affected by other neurotransmitters such as serotonin and dopamine. Effects observed appear exclusive to lithium and have not been observed by other monovalent ions such as rubidium and caesium.
GABA receptors
GABA is an inhibitory neurotransmitter that plays an important role in regulating dopamine and glutamate neurotransmission. It was found that patients with bipolar disorder had lower GABA levels, which results in excitotoxicity and can cause apoptosis (cell loss). Lithium has been shown to increase the level of GABA in plasma and cerebral spinal fluid. Lithium counteracts these degrading processes by decreasing pro-apoptotic proteins and stimulating release of neuroprotective proteins. Lithiums regulation of both excitatory dopaminergic and glutamatergic systems through GABA may play a role in its mood stabilizing effects.
Cyclic AMP secondary messengers
Lithiums therapeutic effects are thought to be partially attributable to its interactions with several signal transduction mechanisms. The cyclic AMP secondary messenger system is shown to be modulated by lithium. Lithium was found to increase the basal levels of cyclic AMP but impair receptor coupled stimulation of cyclic AMP production. It is hypothesized that the dual effects of lithium are due to the inhibition of G-proteins that mediate cyclic AMP production. Over a long period of lithium treatment, cyclic AMP and adenylate cyclase levels are further changed by gene transcription factors.
Inositol depletion hypothesis
Lithium treatment has been found to inhibit the enzyme inositol monophosphatase, involved in degrading inositol monophosphate to inositol required in PIP2 synthesis. This leads to lower levels of inositol triphosphate, created by decomposition of PIP2. This effect has been suggested to be further enhanced with an inositol triphosphate reuptake inhibitor. Inositol disruptions have been linked to memory impairment and depression. It is known with good certainty that signals from the receptors coupled to the phosphoinositide signal transduction are affected by lithium. myo-inositol is also regulated by the high affinity sodium mI transport system (SMIT). Lithium is hypothesized to inhibit mI entering the cells and mitigating the function of SMIT. Reductions of cellular levels of myo-inositol results in the inhibition of the phosphoinositide cycle.
Neurotrophic Factors
Various neurotrophic factors such as BDNF and mesencephalic astrocyte-derived neurotrophic factor have been shown to be modulated by various mood stabilizers.
History
Lithium was first used in the 19th century as a treatment for gout after scientists discovered that, at least in the laboratory, lithium could dissolve uric acid crystals isolated from the kidneys. The levels of lithium needed to dissolve urate in the body, however, were toxic. Because of prevalent theories linking excess uric acid to a range of disorders, including depressive and manic disorders, Carl Lange in Denmark and William Alexander Hammond in New York City used lithium to treat mania from the 1870s onwards. By the turn of the 20th century, as theory regarding mood disorders evolved and so-called "brain gout" disappeared as a medical entity, the use of lithium in psychiatry was largely abandoned; however, a number of lithium preparations were still produced for the control of renal calculi and uric acid diathesis. As accumulating knowledge indicated a role for excess sodium intake in hypertension and heart disease, lithium salts were prescribed to patients for use as a replacement for dietary table salt (sodium chloride). This practice and the sale of lithium itself were both banned in 1949, following publication of reports detailing side effects and deaths.Also in 1949, the Australian psychiatrist John Cade rediscovered the usefulness of lithium salts in treating mania. Cade was injecting rodents with urine extracts taken from manic patients in an attempt to isolate a metabolic compound which might be causing mental symptoms. Since uric acid in gout was known to be psychoactive, (adenosine receptors on neurons are stimulated by it; caffeine blocks them), Cade needed soluble urate for a control. He used lithium urate, already known to be the most soluble urate compound, and observed that it caused the rodents to become tranquil. Cade traced the effect to the lithium ion itself, and after ingesting lithium himself to ensure its safety in humans, he proposed lithium salts as tranquilizers. He soon succeeded in controlling mania in chronically hospitalized patients with them. This was one of the first successful applications of a drug to treat mental illness, and it opened the door for the development of medicines for other mental problems in the next decades.The rest of the world was slow to adopt this treatment, largely because of deaths which resulted from even relatively minor overdosing, including those reported from use of lithium chloride as a substitute for table salt. Largely through the research and other efforts of Denmarks Mogens Schou and Paul Baastrup in Europe, and Samuel Gershon and Baron Shopsin in the U.S., this resistance was slowly overcome. Following the recommendation of the APA Lithium Task Force (William Bunney, Irvin Cohen (Chair), Jonathan Cole, Ronald R. Fieve, Samuel Gershon, Robert Prien, and Joseph Tupin), the application of lithium in manic illness was approved by the United States Food and Drug Administration in 1970, becoming the 50th nation to do so. In 1974, this application was extended to its use as a preventive agent for manic-depressive illness.
Fieve, who had opened the first lithium clinic in North America in 1966, helped popularize the psychiatric use of lithium through his national TV appearances and his bestselling book, Moodswing. In addition, Fieve and David L. Dunner developed the concept of "rapid cycling" bipolar disorder based on non-response to lithium.
Lithium has now become a part of Western popular culture. Characters in Pi, Premonition, Stardust Memories, American Psycho, Garden State, and An Unmarried Woman all take lithium. Its the chief constituent of the calming drug in Ira Levins dystopian This Perfect Day. Sirius XM Satellite Radio in North America has a 1990s alternative rock station called Lithium, and several songs refer to the use of lithium as a mood stabilizer. These include: "Equilibrium met Lithium" by South African artist Koos Kombuis, "Lithium" by Evanescence, "Lithium" by Nirvana, "Lithium and a Lover" by Sirenia, "Lithium Sunset", from the album Mercury Falling by Sting, and "Lithium" by Thin White Rope.
7 Up
As with cocaine in Coca-Cola, lithium was widely marketed as one of a number of patent medicine products popular in the late-19th and early-20th centuries, and was the medicinal ingredient of a refreshment beverage. Charles Leiper Grigg, who launched his St. Louis-based company The Howdy Corporation, invented a formula for a lemon-lime soft drink in 1920. The product, originally named "Bib-Label Lithiated Lemon-Lime Soda", was launched two weeks before the Wall Street Crash of 1929. It contained the mood stabilizer lithium citrate, and was one of a number of patent medicine products popular in the late-19th and early-20th centuries. Its name was soon changed to 7 Up. All American beverage makers were forced to remove lithium in 1948. Despite the 1948 ban, in 1950 the Painesville Telegraph still carried an advertisement for a lithiated lemon beverage.
Salts and product names
Many different lithium salts can be used as medication, including lithium carbonate, lithium acetate, lithium sulfate, lithium citrate, lithium orotate and lithium gluconate.
Lithium carbonate (Li2CO3), sold under several trade names, is the most commonly prescribed, while lithium citrate (Li3C6H5O7) is also used in conventional pharmacological treatments. Lithium orotate (C5H3LiN2O4), has been presented as an alternative. Lithium bromide and lithium chloride have been used in the past as table salt; however, they fell out of use in the 1940s, when it was discovered they were toxic in those large doses. Many other lithium salts and compounds exist, such as lithium fluoride and lithium iodide, but they are presumed to be as toxic or more so than the chloride and have never been evaluated for pharmacological effects.
As of 2017 lithium was marketed under many brand names worldwide, including Cade, Calith, Camcolit, Carbolim, Carbolit, Carbolith, Carbolithium, Carbolitium, Carbonato de Litio, Carboron, Ceglution, Contemnol, D-Gluconsäure, Lithiumsalz, Efadermin (Lithium and Zinc Sulfate), Efalith (Lithium and Zinc Sulfate), Elcab, Eskalit, Eskalith, Frimania, Hypnorex, Kalitium, Karlit, Lalithium, Li-Liquid, Licarb, Licarbium, Lidin, Ligilin, Lilipin, Lilitin, Limas, Limed, Liskonum, Litarex, Lithane, Litheum, Lithicarb, Lithii carbonas, Lithii citras, Lithioderm, Lithiofor, Lithionit, Lithium, Lithium aceticum, Lithium asparagicum, Lithium Carbonate, Lithium Carbonicum, Lithium Citrate, Lithium DL-asparaginat-1-Wasser, Lithium gluconicum, Lithium-D-gluconat, Lithiumcarbonaat, Lithiumcarbonat, Lithiumcitrat, Lithiun, Lithobid, Lithocent, Lithotabs, Lithuril, Litiam, Liticarb, Litijum, Litio, Litiomal, Lito, Litocarb, Litocip, Maniprex, Milithin, Neurolepsin, Plenur, Priadel, Prianil, Prolix, Psicolit, Quilonium, Quilonorm, Quilonum, Téralithe, and Theralite.
Research
Tentative evidence in Alzheimers disease showed that lithium may slow progression. It has been studied for its potential use in the treatment of amyotrophic lateral sclerosis (ALS), but a study showed lithium had no effect on ALS outcomes.
See also
Lithia water
Sodium in biology
References
Further reading
Mota de Freitas, Duarte; Leverson, Brian D.; Goossens, Jesse L. (2016). "Chapter 15. Lithium in Medicine: Mechanisms of Action". In Astrid, Sigel; Helmut, Sigel; Roland K.O., Sigel (eds.). The Alkali Metal Ions: Their Role in Life. Metal Ions in Life Sciences. Vol. 16. Springer. pp. 557–584. doi:10.1007/978-3-319-21756-7_15. PMID 26860311.
External links
"Lithium". Drug Information Portal. U.S. National Library of Medicine.
"Exposing lithiums circadian action"
https://web.archive.org/web/20040811012851/http://www.psycheducation.org/depression/meds/moodstabilizers.htm
"Lithium Basics"
CID 11125 — PubChem Compound Summary (Lithium Carbonate)
N05AN01 (WHO) |
You are a resource for medical understanding. Offer detailed explanations of medical terms, making complex concepts clear and comprehensible. | I need a basic explanation for the medical term 'Thymus hyperplasia.' | Thymus hyperplasia refers to an enlargement ("hyperplasia") of the thymus.It is not always a disease state. The size of the thymus usually peaks during adolescence and atrophies in the following decades. Before the immune function of the thymus was well understood, the enlargement was sometimes seen as a cause for alarm, and justification for surgical reduction. This approach is much less common today.
It can be associated with myasthenia gravis. Magnetic Resonance Imaging can be used to distinguish it from thymoma.
Thymic hyperplasia
Thymic hyperplasia can be divided into three groups namely, those without any pre-existing medical condition, those recovering from a pre-existing medical condition such as pneumonia, corticosteroid therapy, radiation therapy, chemotherapy, surgery, and burns, and those with other disorders such as hyperthyroidism, sarcoidosis, or pure red cell aplasia.
References
== External links == |
You are a medical educator. Your role is to provide detailed and clear explanations for medical terms, suitable for both professionals and laypersons. | Please help me grasp the concept behind the medical term 'Tetrahydrobiopterin.' | Tetrahydrobiopterin (BH4, THB), also known as sapropterin (INN), is a cofactor of the three aromatic amino acid hydroxylase enzymes, used in the degradation of amino acid phenylalanine and in the biosynthesis of the neurotransmitters serotonin (5-hydroxytryptamine, 5-HT), melatonin, dopamine, norepinephrine (noradrenaline), epinephrine (adrenaline), and is a cofactor for the production of nitric oxide (NO) by the nitric oxide synthases. Chemically, its structure is that of a (dihydropteridine reductase) reduced pteridine derivative (quinonoid dihydrobiopterin).
Medical use
Tetrahydrobiopterin is available as a tablet for oral administration in the form of sapropterin dihydrochloride (BH4*2HCL). It was approved for use in the United States as a tablet in December 2007 and as a powder in December 2013. It was approved for use in the European Union in December 2008, Canada in April 2010, and Japan in July 2008. It is sold under the brand names Kuvan and Biopten. The typical cost of treating a patient with Kuvan is US$100,000 per year. BioMarin holds the patent for Kuvan until at least 2024, but Par Pharmaceutical has a right to produce a generic version by 2020.Sapropterin is indicated in tetrahydrobiopterin deficiency caused by GTP cyclohydrolase I (GTPCH) deficiency, or 6-pyruvoyltetrahydropterin synthase (PTPS) deficiency. Also, BH4*2HCL is FDA approved for use in phenylketonuria (PKU), along with dietary measures. However, most people with PKU have little or no benefit from BH4*2HCL.
Adverse effects
The most common adverse effects, observed in more than 10% of people, include headache and a running or obstructed nose. Diarrhea and vomiting are also relatively common, seen in at least 1% of people.
Interactions
No interaction studies have been conducted. Because of its mechanism, tetrahydrobiopterin might interact with dihydrofolate reductase inhibitors like methotrexate and trimethoprim, and NO-enhancing drugs like nitroglycerin, molsidomine, minoxidil, and PDE5 inhibitors. Combination of tetrahydrobiopterin with levodopa can lead to increased excitability.
Functions
Tetrahydrobiopterin has multiple roles in human biochemistry. The major one is to convert amino acids such as phenylalanine, tyrosine, and tryptophan to precursors of dopamine and serotonin, major monoamine neurotransmitters. It works as a cofactor, being required for an enzymes activity as a catalyst, mainly hydroxylases.
Cofactor for tryptophan hydroxylases
Tetrahydrobiopterin is a cofactor for tryptophan hydroxylase (TPH) for the conversion of L-tryptophan (TRP) to 5-hydroxytryptophan (5-HTP).
Cofactor for phenylalanine hydroxylase
Phenylalanine hydroxylase (PAH) catalyses the conversion of L-phenylalanine (PHE) to L-tyrosine (TYR). Therefore, a deficiency in tetrahydrobiopterin can cause a toxic buildup of L-phenylalanine, which manifests as the severe neurological issues seen in phenylketonuria.
Cofactor for tyrosine hydroxylase
Tyrosine hydroxylase (TH) catalyses the conversion of L-tyrosine to L-DOPA (DOPA), which is the precursor for dopamine. Dopamine is a vital neurotransmitter, and is the precursor of norepinephrine and epinephrine. Thus, a deficiency of BH4 can lead to systemic deficiencies of dopamine, norepinephrine, and epinephrine. In fact, one of the primary conditions that can result from GTPCH-related BH4 deficiency is dopamine-responsive dystonia; currently, this condition is typically treated with carbidopa/levodopa, which directly restores dopamine levels within the brain.
Cofactor for nitric oxide synthase
Nitric oxide synthase (NOS) catalyses the conversion of a guanidino nitrogen of L-arginine (L-Arg) to nitric oxide (NO). Among other things, nitric oxide is involved in vasodilation, which improves systematic blood flow. The role of BH4 in this enzymatic process is so critical that some research points to a deficiency of BH4 – and thus, of nitric oxide – as being a core cause of the neurovascular dysfunction that is the hallmark of circulation-related diseases such as diabetes.
Cofactor for ether lipid oxidase
Ether lipid oxidase (alkylglycerol monooxygenase, AGMO) catalyses the conversion of 1-alkyl-sn-glycerol to 1-hydroxyalkyl-sn-glycerol.
History
Tetrahydrobiopterin was discovered to play a role as an enzymatic cofactor. The first enzyme found to use tetrahydrobiopterin is phenylalanine hydroxylase (PAH).
Biosynthesis and recycling
Tetrahydrobiopterin is biosynthesized from guanosine triphosphate (GTP) by three chemical reactions mediated by the enzymes GTP cyclohydrolase I (GTPCH), 6-pyruvoyltetrahydropterin synthase (PTPS), and sepiapterin reductase (SR).BH4 can be oxidized by one or two electron reactions, to generate BH4 or BH3 radical and BH2, respectively. Research shows that ascorbic acid (also known as ascorbate or vitamin C) can reduce BH3 radical into BH4, preventing the BH3 radical from reacting with other free radicals (superoxide and peroxynitrite specifically). Without this recycling process, uncoupling of the endothelial nitric oxide synthase (eNOS) enzyme and reduced bioavailability of the vasodilator nitric oxide occur, creating a form of endothelial dysfunction. Ascorbic acid is oxidized to dehydroascorbic acid during this process, although it can be recycled back to ascorbic acid.
Folic acid and its metabolites seem to be particularly important in the recycling of BH4 and NOS coupling.
Research
Other than PKU studies, tetrahydrobiopterin has participated in clinical trials studying other approaches to solving conditions resultant from a deficiency of tetrahydrobiopterin. These include autism, depression, ADHD, hypertension, endothelial dysfunction, and chronic kidney disease. Experimental studies suggest that tetrahydrobiopterin regulates deficient production of nitric oxide in cardiovascular disease states, and contributes to the response to inflammation and injury, for example in pain due to nerve injury. A 2015 BioMarin-funded study of PKU patients found that those who responded to tetrahydrobiopterin also showed a reduction of ADHD symptoms.
Depression
In psychiatry, tetrahydrobiopterin has been hypothesized to be involved in the pathophysiology of depression, although evidence is inconclusive to date.
Autism
In 1997, a small pilot study was published on the efficacy of tetrahydrobiopterin (BH4) on relieving the symptoms of autism, which concluded that it "might be useful for a subgroup of children with autism" and that double-blind trials are needed, as are trials which measure outcomes over a longer period of time. In 2010, Frye et al. published a paper which concluded that it was safe, and also noted that "several clinical trials have suggested that treatment with BH4 improves ASD symptomatology in some individuals."
Cardiovascular disease
Since nitric oxide production is important in regulation of blood pressure and blood flow, thereby playing a significant role in cardiovascular diseases, tetrahydrobiopterin is a potential therapeutic target. In the endothelial cell lining of blood vessels, endothelial nitric oxide synthase is dependent on tetrahydrobiopterin availability. Increasing tetrahydrobiopterin in endothelial cells by augmenting the levels of the biosynthetic enzyme GTPCH can maintain endothelial nitric oxide synthase function in experimental models of disease states such as diabetes, atherosclerosis, and hypoxic pulmonary hypertension. However, treatment of people with existing coronary artery disease with oral tetrahydrobiopterin is limited by oxidation of tetrahydrobiopterin to the inactive form, dihydrobiopterin, with little benefit on vascular function.
Neuroprotection in prenatal hypoxia
Depletion of tetrahydrobiopterin occurs in the hypoxic brain and leads to toxin production. Preclinical studies in mice reveal that treatment with oral tetrahydrobiopterin therapy mitigates the toxic effects of hypoxia on the developing brain, specifically improving white matter development in hypoxic animals.
Programmed cell death
GTPCH (GCH1) and tetrahydrobiopterin were found to have a secondary role protecting against cell death by ferroptosis in cellular models by limiting the formation of toxic lipid peroxides. Tetrahydrobiopterin acts as a potent, diffusable antioxidant that resists oxidative stress and enables cancer cell survival via promotion of angiogenesis.
References
Further reading
External links
"Sapropterin". Drug Information Portal. U.S. National Library of Medicine.
"Sapropterin dihydrochloride". Drug Information Portal. U.S. National Library of Medicine. |
You function as a medical informant. Please provide in-depth yet accessible descriptions of medical terms, suitable for a broad audience. | I've come across the term 'Late congenital syphilitic oculopathy' in a medical context, but I'm not sure what it means. Can you clarify? | Late congenital syphilitic oculopathy is a disease of the eye, a manifestation of late congenital syphilis. It can appear as:
Interstitial keratitis – this commonly appears between ages 6 and 12. Symptoms include lacrimation and photophobia. Pathological vascularization of the cornea cause it to turn pink or salmon colored. 90% of cases affect both eyes.
Episcleritis or scleritis – nodules appear in or overlying the sclera (white of eye)
Iritis or iris papules – vascular infiltration of the iris causes rosy color change and yellow/red nodules.
Chorioretinitis, papillitis, retinal vasculitis – retinal changes can resemble retinitis pigmentosa.
Exudative retinal detachmentCongenital syphilis is categorized by the age of the child. Early congenital syphilis occurs in children under 2 years old, and late congenital syphilis in children at or greater than 2 years old. Manifestations of late congenital syphilis are similar to those of secondary syphilis and tertiary syphilis in adults.
References
eMedicine: Ocular Manifestations of Syphilis
== External links == |
You are a facilitator of medical knowledge. Provide thorough and accessible explanations of medical terms, catering to both specialists and non-specialists. | Could you provide a brief overview of 'Bloodstream infections' in a medical context? | Bloodstream infections (BSIs), which include bacteremias when the infections are bacterial and fungemias when the infections are fungal, are infections present in the blood. Blood is normally a sterile environment, so the detection of microbes in the blood (most commonly accomplished by blood cultures) is always abnormal. A bloodstream infection is different from sepsis, which is the host response to bacteria.Bacteria can enter the bloodstream as a severe complication of infections (like pneumonia or meningitis), during surgery (especially when involving mucous membranes such as the gastrointestinal tract), or due to catheters and other foreign bodies entering the arteries or veins (including during intravenous drug abuse). Transient bacteremia can result after dental procedures or brushing of teeth.Bacteremia can have several important health consequences. The immune response to the bacteria can cause sepsis and septic shock, which has a high mortality rate. Bacteria can also spread via the blood to other parts of the body (which is called hematogenous spread), causing infections away from the original site of infection, such as endocarditis or osteomyelitis. Treatment for bacteremia is with antibiotics, and prevention with antibiotic prophylaxis can be given in high risk situations.
Presentation
Bacteremia is typically transient and is quickly removed from the blood by the immune system.Bacteremia frequently evokes a response from the immune system called sepsis, which consists of symptoms such as fever, chills, and hypotension. Severe immune responses to bacteremia may result in septic shock and multiple organ dysfunction syndrome, which are potentially fatal.
Causes
Bacteria can enter the bloodstream in a number of different ways. However, for each major classification of bacteria (gram negative, gram positive, or anaerobic) there are characteristic sources or routes of entry into the bloodstream that lead to bacteremia. Causes of bacteremia can additionally be divided into healthcare-associated (acquired during the process of receiving care in a healthcare facility) or community-acquired (acquired outside of a health facility, often prior to hospitalization).
Gram positive bacteremia
Gram positive bacteria are an increasingly important cause of bacteremia. Staphylococcus, streptococcus, and enterococcus species are the most important and most common species of gram-positive bacteria that can enter the bloodstream. These bacteria are normally found on the skin or in the gastrointestinal tract.Staphylococcus aureus is the most common cause of healthcare-associated bacteremia in North and South America and is also an important cause of community-acquired bacteremia. Skin ulceration or wounds, respiratory tract infections, and IV drug use are the most important causes of community-acquired staph aureus bacteremia. In healthcare settings, intravenous catheters, urinary tract catheters, and surgical procedures are the most common causes of staph aureus bacteremia.There are many different types of streptococcal species that can cause bacteremia. Group A streptococcus (GAS) typically causes bacteremia from skin and soft tissue infections. Group B streptococcus is an important cause of bacteremia in neonates, often immediately following birth. Viridans streptococci species are normal bacterial flora of the mouth. Viridans strep can cause temporary bacteremia after eating, toothbrushing, or flossing. More severe bacteremia can occur following dental procedures or in patients receiving chemotherapy. Finally, Streptococcus bovis is a common cause of bacteremia in patients with colon cancer.Enterococci are an important cause of healthcare-associated bacteremia. These bacteria commonly live in the gastrointestinal tract and female genital tract. Intravenous catheters, urinary tract infections and surgical wounds are all risk factors for developing bacteremia from enterococcal species. Resistant enterococcal species can cause bacteremia in patients who have had long hospital stays or frequent antibiotic use in the past (see antibiotic misuse).
Gram negative bacteremia
Gram negative bacterial species are responsible for approximately 24% of all cases of healthcare-associated bacteremia and 45% of all cases of community-acquired bacteremia. In general, gram negative bacteria enter the bloodstream from infections in the respiratory tract, genitourinary tract, gastrointestinal tract, or hepatobiliary system. Gram-negative bacteremia occurs more frequently in elderly populations (65 years or older) and is associated with higher morbidity and mortality in this population.E.coli is the most common cause of community-acquired bacteremia accounting for approximately 75% of cases. E.coli bacteremia is usually the result of a urinary tract infection. Other organisms that can cause community-acquired bacteremia include Pseudomonas aeruginosa, Klebsiella pneumoniae, and Proteus mirabilis. Salmonella infection, despite mainly only resulting in gastroenteritis in the developed world, is a common cause of bacteremia in Africa. It principally affects children who lack antibodies to Salmonella and HIV+ patients of all ages.Among healthcare-associated cases of bacteremia, gram negative organisms are an important cause of bacteremia in the ICU. Catheters in the veins, arteries, or urinary tract can all create a way for gram negative bacteria to enter the bloodstream. Surgical procedures of the genitourinary tract, intestinal tract, or hepatobiliary tract can also lead to gram negative bacteremia. Pseudomonas and Enterobacter species are the most important causes of gram negative bacteremia in the ICU.
Bacteremia risk factors
There are several risk factors that increase the likelihood of developing bacteremia from any type of bacteria. These include:
HIV infection
Diabetes Mellitus
Chronic hemodialysis
Solid organ transplant
Stem cell transplant
Treatment with glucocorticoids
Liver failure
Asplenia
Mechanism
Bacteremia can travel through the blood stream to distant sites in the body and cause infection (hematogenous spread). Hematogenous spread of bacteria is part of the pathophysiology of certain infections of the heart (endocarditis), structures around the brain (meningitis), and tuberculosis of the spine (Potts disease). Hematogenous spread of bacteria is responsible for many bone infections (osteomyelitis).Prosthetic cardiac implants (for example artificial heart valves) are especially vulnerable to infection from bacteremia. Prior to widespread use of vaccines, occult bacteremia was an important consideration in febrile children that appeared otherwise well.
Diagnosis
Bacteremia is most commonly diagnosed by blood culture, in which a sample of blood drawn from the vein by needle puncture is allowed to incubate with a medium that promotes bacterial growth. If bacteria are present in the bloodstream at the time the sample is obtained, the bacteria will multiply and can thereby be detected.Any bacteria that incidentally find their way to the culture medium will also multiply. For example, if the skin is not adequately cleaned before needle puncture, contamination of the blood sample with normal bacteria that live on the surface of the skin can occur. For this reason, blood cultures must be drawn with great attention to sterile process. The presence of certain bacteria in the blood culture, such as Staphylococcus aureus, Streptococcus pneumoniae, and Escherichia coli almost never represent a contamination of the sample. On the other hand, contamination may be more highly suspected if organisms like Staphylococcus epidermidis or Cutibacterium acnes grow in the blood culture.Two blood cultures drawn from separate sites of the body are often sufficient to diagnose bacteremia. Two out of two cultures growing the same type of bacteria usually represents a real bacteremia, particularly if the organism that grows is not a common contaminant. One out of two positive cultures will usually prompt a repeat set of blood cultures to be drawn to confirm whether a contaminant or a real bacteremia is present. The patients skin is typically cleaned with an alcohol-based product prior to drawing blood to prevent contamination. Blood cultures may be repeated at intervals to determine if persistent — rather than transient — bacteremia is present.Prior to drawing blood cultures, a thorough patient history should be taken with particular regard to presence of both fevers and chills, other focal signs of infection such as in the skin or soft tissue, a state of immunosuppression, or any recent invasive procedures.Ultrasound of the heart is recommended in all those with bacteremia due to Staphylococcus aureus to rule out infectious endocarditis.
Definition
Bacteremia is the presence of bacteria in the bloodstream that are alive and capable of reproducing. It is a type of bloodstream infection. Bacteremia is defined as either a primary or secondary process. In primary bacteremia, bacteria have been directly introduced into the bloodstream. Injection drug use may lead to primary bacteremia. In the hospital setting, use of blood vessel catheters contaminated with bacteria may also lead to primary bacteremia. Secondary bacteremia occurs when bacteria have entered the body at another site, such as the cuts in the skin, or the mucous membranes of the lungs (respiratory tract), mouth or intestines (gastrointestinal tract), bladder (urinary tract), or genitals. Bacteria that have infected the body at these sites may then spread into the lymphatic system and gain access to the bloodstream, where further spread can occur.Bacteremia may also be defined by the timing of bacteria presence in the bloodstream: transient, intermittent, or persistent. In transient bacteremia, bacteria are present in the bloodstream for minutes to a few hours before being cleared from the body, and the result is typically harmless in healthy people. This can occur after manipulation of parts of the body normally colonized by bacteria, such as the mucosal surfaces of the mouth during tooth brushing, flossing, or dental procedures, or instrumentation of the bladder or colon. Intermittent bacteremia is characterized by periodic seeding of the same bacteria into the bloodstream by an existing infection elsewhere in the body, such as an abscess, pneumonia, or bone infection, followed by clearing of that bacteria from the bloodstream. This cycle will often repeat until the existing infection is successfully treated. Persistent bacteremia is characterized by the continuous presence of bacteria in the bloodstream. It is usually the result of an infected heart valve, a central line-associated bloodstream infection (CLABSI), an infected blood clot (suppurative thrombophlebitis), or an infected blood vessel graft. Persistent bacteremia can also occur as part of the infection process of typhoid fever, brucellosis, and bacterial meningitis. Left untreated, conditions causing persistent bacteremia can be potentially fatal.Bacteremia is clinically distinct from sepsis, which is a condition where the blood stream infection is associated with an inflammatory response from the body, often causing abnormalities in body temperature, heart rate, breathing rate, blood pressure, and white blood cell count.
Treatment
The presence of bacteria in the blood almost always requires treatment with antibiotics. This is because there are high mortality rates from progression to sepsis if antibiotics are delayed.The treatment of bacteremia should begin with empiric antibiotic coverage. Any patient presenting with signs or symptoms of bacteremia or a positive blood culture should be started on intravenous antibiotics. The choice of antibiotic is determined by the most likely source of infection and by the characteristic organisms that typically cause that infection. Other important considerations include the patients history of antibiotic use, the severity of the presenting symptoms, and any allergies to antibiotics. Empiric antibiotics should be narrowed, preferably to a single antibiotic, once the blood culture returns with a particular bacteria that has been isolated.
Gram positive bacteremia
The Infectious Disease Society of America (IDSA) recommends treating uncomplicated methicillin resistant staph aureus (MRSA) bacteremia with a 14-day course of intravenous vancomycin. Uncomplicated bacteremia is defined as having positive blood cultures for MRSA, but having no evidence of endocarditis, no implanted prostheses, negative blood cultures after 2–4 days of treatment, and signs of clinical improvement after 72 hrs.The antibiotic treatment of choice for streptococcal and enteroccal infections differs by species. However, it is important to look at the antibiotic resistance pattern for each species from the blood culture to better treat infections caused by resistant organisms.
Gram negative bacteremia
The treatment of gram negative bacteremia is also highly dependent on the causative organism. Empiric antibiotic therapy should be guided by the most likely source of infection and the patients past exposure to healthcare facilities. In particular, a recent history of exposure to a healthcare setting may necessitate the need for antibiotics with pseudomonas aeruginosa coverage or broader coverage for resistant organisms. Extended generation cephalosporins such as ceftriaxone or beta lactam/beta lactamase inhibitor antibiotics such as piperacillin-tazobactam are frequently used for the treatment of gram negative bacteremia.
Catheter-associated infections
For healthcare-associated bacteremia due to intravenous catheters, the IDSA has published guidelines for catheter removal. Short term catheters (in place <14 days) should be removed if bacteremia is caused by any gram negative bacteria, staph aureus, enterococci or mycobacteria. Long term catheters (>14 days) should be removed if the patient is developing signs or symptoms of sepsis or endocarditis, or if blood cultures remain positive for more than 72 hours.
See also
Antibiotic prophylaxis
Dental antibiotic prophylaxis
Fungemia
Viremia
References
External links
Bacteremia at Medscape eMedicine |
You act as a bridge between medical jargon and everyday language. Explain medical terms in a manner that is comprehensive yet approachable for non-experts. | I'm seeking clarification on the medical term 'Eclampsia.' Could you explain it? | Eclampsia is the onset of seizures (convulsions) in a woman with pre-eclampsia. Pre-eclampsia is one of the hypertensive disorders of pregnancy that presents with three main features: new onset of high blood pressure, large amounts of protein in the urine or other organ dysfunction, and edema. The diagnostic criteria for pre-eclampsia is high blood pressure occurring after 20 weeks gestation or during the second half of pregnancy. Most often it occurs during the 3rd trimester of pregnancy and may occur before, during, or after delivery. The seizures are of the tonic–clonic type and typically last about a minute. Following the seizure, there is either a period of confusion or coma. Other complications include aspiration pneumonia, cerebral hemorrhage, kidney failure, pulmonary edema, HELLP syndrome, coagulopathy, placental abruption and cardiac arrest.Low dose aspirin is recommended to prevent pre-eclampsia and eclampsia in those at high risk. Other preventative recommendation include calcium supplementation in areas with low calcium intake and treatment of prior hypertension with anti-hypertensive medications. Exercise during pregnancy may also be useful. The use of intravenous or intramuscular magnesium sulfate improves outcomes in those with severe pre-eclampsia and eclampsia and is generally safe. Treatment options include blood pressure medications such as hydralazine and emergency delivery of the baby either vaginally or by cesarean section.Pre-eclampsia is estimated to globally affect about 5% of deliveries while eclampsia affects about 1.4% of deliveries. In the developed world eclampsia rates are about 1 in 2,000 deliveries due to improved medical care whereas in developing countries it can impact 10-30 times as many women. Hypertensive disorders of pregnancy are one of the most common causes of death in pregnancy. They resulted in 46,900 deaths in 2015. Around one percent of women with eclampsia die. The word eclampsia is from the Greek term for lightning. The first known description of the condition was by Hippocrates in the 5th century BC.
Signs and symptoms
Eclampsia is a disorder of pregnancy characterized by seizures in the setting of pre-eclampsia. Most women have premonitory signs/symptoms in the hours before the initial seizure. Typically the woman develops hypertension before the onset of a convulsion (seizure). Other signs and symptoms to looks out for include:
Long-lasting (persistent) frontal or occipital headaches or thunderclap headaches)
Visual disturbance (blurred vision, photophobia, diplopopia)
Photophobia (i.e. bright light causes discomfort)
Abdominal pain
Either in the epigastric region (the center of the abdomen above the navel, or belly-button)
And/or in the right upper quadrant of the abdomen (below the right side of the rib cage)
Altered mental status (confusion)Any of these symptoms may be present before or after the seizure. It is also possible for the woman to be asymptomatic prior to the onset of the seizure.
Other cerebral signs that may precede the convulsion include nausea, vomiting, headaches, and cortical blindness. If the complication of multi-organ failure ensues, signs and symptoms of those failing organs will appear, such as abdominal pain, jaundice, shortness of breath, and diminished urine output.
Onset
The seizures of eclampsia typically present during pregnancy and prior to delivery (the antepartum period), but may also occur during labor and delivery (the intrapartum period) or after the baby has been delivered (the postpartum period). If postpartum seizures develop, it is most likely to occur within the first 48 hours after delivery. However, late postpartum seizures of eclampsia may occur as late as 4 weeks after delivery.
Characteristics
Eclamptic seizure is typically described as a tonic–clonic seizure which may cause an abrupt loss of consciousness at onset. This is often associated with a shriek or scream followed by stiffness of the muscles of the arms, legs, back and chest. During the tonic phase, the mother may begin to appear cyanotic. This presentation lasts for about a minute, after which the muscles begin in jerk and twitch for an additional one to two minutes. Other signs include tongue biting, frothy and bloody sputum coming out of the mouth.
Complications
There are risks to both the mother and the fetus when eclampsia occurs. The fetus may grow more slowly than normal within the womb (uterus) of a woman with eclampsia, which is termed intrauterine growth restriction and may result in the child appearing small for gestational age or being born with low birth weight. Eclampsia may also cause problems with the placenta. The placenta may bleed (hemorrhage) or begin to separate early from the wall of the uterus. It is normal for the placenta to separate from the uterine wall during delivery, but it is abnormal for it to separate prior to delivery; this condition is called placental abruption and can be dangerous for the fetus. Placental insufficiency may also occur, a state in which the placenta fails to support appropriate fetal development because it cannot deliver the necessary amount of oxygen or nutrients to the fetus. During an eclamptic seizure, the beating of the fetal heart may become slower than normal (bradycardia). If any of these complications occurs, fetal distress may develop. Treatment of the mothers seizures may also manage fetal bradycardia. If the risk to the health of the fetus or the mother is high, the definitive treatment for eclampsia is delivery of the baby. Delivery by cesarean section may be necessary, especially if the instance of fetal bradycardia does not resolve after 10 to 15 minutes of resuscitative interventions. It may be safer to deliver the infant preterm than to wait for the full 40 weeks of fetal development to finish, and as a result prematurity is also a potential complication of eclampsia.In the mother, changes in vision may occur as a result of eclampsia, and these changes may include blurry vision, one-sided blindness (either temporary due to amaurosis fugax or potentially permanent due to retinal detachment), or cortical blindness, which affects the vision from both eyes. There are also potential complications in the lungs. The woman may have fluid slowly collecting in the lungs in a process known as pulmonary edema. During an eclamptic seizure, it is possible for a person to vomit the contents of the stomach and to inhale some of this material in a process known as aspiration. If aspiration occurs, the woman may experience difficulty breathing immediately or could develop an infection in the lungs later, called aspiration pneumonia. It is also possible that during a seizure breathing will stop temporarily or become inefficient, and the amount of oxygen reaching the womans body and brain will be decreased (in a state known as hypoxia). If it becomes difficult for the woman to breathe, she may need to have her breathing temporarily supported by an assistive device in a process called mechanical ventilation. In some severe eclampsia cases, the mother may become weak and sluggish (lethargy) or even comatose. These may be signs that the brain is swelling (cerebral edema) or bleeding (intracerebral hemorrhage).
Risk factors
Eclampsia, like pre-eclampsia, tends to occur more commonly in first pregnancies than subsequent pregnancies. Women who have long term high blood pressure before becoming pregnant have a greater risk of pre-eclampsia. Patients who have gestational hypertension and pre-eclampsia have an increased risk of eclampsia. Furthermore, women with other pre-existing vascular diseases (diabetes or nephropathy) or thrombophilia disease such as the antiphospholipid syndrome are at higher risk to develop pre-eclampsia and eclampsia. Having a placenta that is enlarged by multiple gestation or hydatidiform mole also increases risk of eclampsia. In addition, there is a genetic component: a woman whose mother or sister had the condition is at higher risk than otherwise. Patients who have experienced eclampsia are at increased risk for pre-eclampsia/eclampsia in a later pregnancy. The occurrence of pre-eclampsia was 5% in white, 9% in Hispanic, and 11% in African American patients and this may reflect disproportionate risk of developing pre-eclampsia among ethnic groups. Additionally, black patients were also shown to have a disproportionately higher risk of dying from eclampsia.
Mechanism
The mechanisms of eclampsia and preeclampsia are not definitively understood, but following provides some insight. The presence of a placenta is required, and eclampsia resolves if it is removed. Reduced blood flow to the placenta (placental hypoperfusion) may be a key feature of the process. It is typically accompanied by increased sensitivity of the maternal vasculature to agents which cause constriction of the small arteries, leading to reduced blood flow to multiple organs. Vascular dysfunction-associated maternal conditions such as Lupus, hypertension, and renal disease, or obstetric conditions that increase placental volume without an increase in placental blood flow (such as multifetal gestation) may increase risk for pre-eclampsia. Also, activation of the coagulation cascade can lead to microthrombi formation, which may further impair blood flow. Thirdly, increased vascular permeability results in the shift of extracellular fluid from the blood to the interstitial space which reduces blood flow and causes edema. These events can lead to hypertension, renal dysfunction, pulmonary dysfunction, hepatic dysfunction, and cerebral edema with cerebral dysfunction and convulsions. In clinical context, increased platelet and endothelial activation may be detected before symptoms appear.Hypoperfusion of the placenta is associated with abnormal modelling of the fetal–maternal placental interface that may be immunologically mediated. The pathogenesis of pre-eclampsia is poorly understood and may be attributed to factors related to the woman and placenta since pre-eclampsia is seen in molar pregnancies absent of a fetus or fetal tissue. The placenta normally produces the potent vasodilator adrenomedullin but it is reduced in pre-eclampsia and eclampsia. Other vasodilators, including prostacyclin, thromboxane A2, nitric oxide, and endothelins, are reduced in eclampsia and may lead to vasoconstriction.Eclampsia is associated with hypertensive encephalopathy in which cerebral vascular resistance is reduced, leading to increased blood flow to the brain, cerebral edema and resultant convulsions. An eclamptic convulsion usually does not cause chronic brain damage unless intracranial haemorrhage occurs.
Diagnosis
If a pregnant woman has already been diagnosed with pre-eclampsia during the current pregnancy and then develops a seizure, she may be assigned a clinical diagnosis of eclampsia without further workup. While seizures are most common in the third trimester, they may occur any time from 20 weeks of pregnancy until 6 weeks after birth. Because pre-eclampsia and eclampsia are common conditions in women, eclampsia can be assumed to be the correct diagnosis until proven otherwise in pregnant or postpartum women who experience seizures. However, if a woman has a seizure and it is unknown whether or not they have pre-eclampsia, testing can help make the diagnosis clear.
Pre-eclampsia is diagnosed when repeated blood pressure measurements are greater or equal to 140/90mmHg, in addition to any signs of organ dysfunction, including: proteinuria, thrombocytopenia, renal insufficiency, impaired liver function, pulmonary edema, cerebral symptoms, or abdominal pain.
Vital signs
One of the core features of pre-eclampsia is the new onset of high blood pressure. Blood pressure is a measurement of two numbers: systolic blood pressure and diastolic blood pressure. A systolic blood pressure (the top number) of greater than 140 mmHg and/or a diastolic blood pressure (the bottom number) of greater than 90 mmHg is higher than the normal range. If the blood pressure is high on at least two separate occasions after the first 20 weeks of pregnancy and the woman has signs of organ dysfunction (e.g. proteinuria), then they meet the criteria for a diagnosis of pre-eclampsia. If the systolic blood pressure is greater than 160 or the diastolic pressure is greater than 110, the hypertension is considered to be severe.
Laboratory testing
Another common feature of pre-eclampsia is proteinuria, which is the presence of excess protein in the urine. To determine if proteinuria is present, the urine can be collected and tested for protein; if there is 0.3 grams of protein or more in the urine of a pregnant woman collected over 24 hours, this is one of the diagnostic criteria for pre-eclampsia and raises the suspicion that a seizure is due to eclampsia.In cases of severe eclampsia or pre-eclampsia, the woman can have low levels of platelets in the blood, a condition termed thrombocytopenia. A complete blood count, or CBC, is a test of the blood that can be performed to check platelet levels.
Other investigations include: kidney function test, liver function tests (LFT), coagulation screen, 24-hour urine creatinine, and fetal/placental ultrasound.
Differential diagnosis
Convulsions during pregnancy that are unrelated to pre-eclampsia need to be distinguished from eclampsia. Such disorders include seizure disorders as well as brain tumor, aneurysm of the brain, and medication- or drug-related seizures. Usually, the presence of the signs of severe pre-eclampsia precede and accompany eclampsia, facilitating the diagnosis.
Prevention
Detection and management of pre-eclampsia is critical to reduce the risk of eclampsia. The USPSTF recommends regular checking of blood pressure through pregnancy in order to detect preeclampsia. Appropriate management of a woman with pre-eclampsia generally involves the use of magnesium sulfate to prevent eclamptic seizures. In some cases, low-dose aspirin has been shown to decrease the risk of pre-eclampsia in women, especially when taken in the late first trimester.
Treatment
The four goals of the treatment of eclampsia are to stop and prevent further convulsions, to control the elevated blood pressure, to deliver the baby as promptly as possible, and to monitor closely for the onset of multi-organ failure.
Convulsions
Convulsions are prevented and treated using magnesium sulfate. The study demonstrating the effectiveness of magnesium sulfate for the management of eclampsia was first published in 1955. Effective anticonvulsant serum levels range from 2.5 to 7.5 mEq/L.With intravenous administration, the onset of anticonvulsant action is fast and lasts about 30 minutes. Following intramuscular administration the onset of action is about one hour and lasts for three to four hours. Magnesium is excreted solely by the kidneys at a rate proportional to the plasma concentration (concentration in the blood) and glomerular filtration (rate at which the blood is filtered through the kidneys). Magnesium sulfate is associated with several minor side effects; serious side effects are uncommon, occurring at elevated magnesium serum concentrations greater than 7.0 mEq/L. Serious toxicity can be counteracted with calcium gluconate.Even with therapeutic serum magnesium concentrations, recurrent convulsions may occur, and additional magnesium may be needed, but with close monitoring for respiratory, cardiac, and neurological depression. If magnesium administration with resultant high serum concentrations fails to control convulsions, the addition of other intravenous anticonvulsants may be used and intubation and mechanical ventilation may be initiated. It is important to avoid magnesium toxicity, including thoracic muscle paralysis, which could cause respiratory failure and death.
Magnesium sulfate results in better outcomes than diazepam, phenytoin or a combination of chlorpromazine, promethazine, and pethidine.
Blood pressure management
Blood pressure control is used to prevent stroke, which accounts for 15 to 20 percent of deaths in women with eclampsia. The agents of choice for blood pressure control during eclampsia are hydralazine or labetalol. This is because of their effectiveness, lack of negative effects on the fetus, and mechanism of action. Blood pressure management is indicated with a diastolic blood pressure above 105–110 mm Hg.
Delivery
If the baby has not yet been delivered, steps need to be taken to stabilize the woman and deliver her speedily. This needs to be done even if the baby is immature, as the eclamptic condition is unsafe for both baby and mother. As eclampsia is a manifestation of a type of non-infectious multiorgan dysfunction or failure, other organs (liver, kidney, lungs, cardiovascular system, and coagulation system) need to be assessed in preparation for a delivery (often a caesarean section), unless the woman is already in advanced labor. Regional anesthesia for caesarean section is contraindicated when a coagulopathy has developed.
There is limited to no evidence in favor of a particular delivery method for women with eclampsia. Therefore, the delivery method of choice is an individualized decision.
Monitoring
Invasive hemodynamic monitoring may be elected in an eclamptic woman at risk for or with heart disease, kidney disease, refractory hypertension, pulmonary edema, or poor urine output.
Etymology
The Greek noun ἐκλαμψία, eklampsía, denotes a "light burst"; metaphorically, in this context, "sudden occurrence." The New Latin term first appeared in Johannes Varandaeus’ 1620 treatise on gynaecology Tractatus de affectibus Renum et Vesicae. The term toxemia of pregnancy is no longer recommended: placental toxins are not the cause of eclampsia occurrences, as previously believed.
Popular culture
In Downton Abbey, a historical drama television series, the character Lady Sybil dies (in series 3, episode 5) of eclampsia shortly after child birth.
In Call the Midwife, a medical drama television series set in London in the 1950s and 1960s, the character (in series 1, episode 4) named Margaret Jones is struck with pre-eclampsia, ultimately proceeding from a comatose condition to death. The term "toxemia" was also used for the condition, in the dialogue.
In House M.D., a medical drama television series set in the U.S., Dr. Cuddy, the hospital director, adopts a baby whose teenage mother dies from eclampsia and had no other parental figures available.
In The Lemon Drop Kid, the main characters wife dies of eclampsia shortly after giving birth to a boy.
References
External links
Eclampsia at Curlie |
You are an expert in medical terminology. Explain medical terms in a way that is both precise and easy to understand for non-medical audiences. | I've encountered the term 'Congenital disorder of glycosylation' while reading about medical topics. What does it refer to exactly? | A congenital disorder of glycosylation (previously called carbohydrate-deficient glycoprotein syndrome) is one of several rare inborn errors of metabolism in which glycosylation of a variety of tissue proteins and/or lipids is deficient or defective. Congenital disorders of glycosylation are sometimes known as CDG syndromes. They often cause serious, sometimes fatal, malfunction of several different organ systems (especially the nervous system, muscles, and intestines) in affected infants. The most common sub-type is PMM2-CDG (formally known as CDG-Ia) where the genetic defect leads to the loss of phosphomannomutase 2 (PMM2), the enzyme responsible for the conversion of mannose-6-phosphate into mannose-1-phosphate.
Presentation
The specific problems produced differ according to the particular abnormal synthesis involved. Common manifestations include ataxia; seizures; retinopathy; liver disease; coagulopathies; failure to thrive (FTT); dysmorphic features (e.g., inverted nipples and subcutaneous fat pads), pericardial effusion, and hypotonia. If an MRI is obtained; cerebellar hypoplasia is a common finding.Ocular abnormalities of CDG-Ia include: myopia, infantile esotropia, delayed visual maturation, peripheral neuropathy (PN), strabismus, nystagmus, optic disc pallor, and reduced rod function on electroretinography.Three subtypes PMM2-CDG, PMI-CDG, ALG6-CDG can cause congenital hyperinsulinism with hyperinsulinemic hypoglycemia in infancy.
N-Glycosylation and known defects
A biologically very important group of carbohydrates is the asparagine (Asn)-linked, or N-linked, oligosaccharides. Their biosynthetic pathway is very complex and involves a hundred or more glycosyltransferases, glycosidases, transporters and synthases. This plethora allows for the formation of a multitude of different final oligosaccharide structures, involved in protein folding, intracellular transport/localization, protein activity, and degradation/half-life. A vast amount of carbohydrate binding molecules (lectins) depend on correct glycosylation for appropriate binding; the selectins, involved in leukocyte extravasation, is a prime example. Their binding depends on a correct fucosylation of cell surface glycoproteins. Lack thereof leads to leukocytosis and increase sensitivity to infections as seen in SLC35C1-CDG(CDG-IIc); caused by a GDP-fucose (Fuc) transporter deficiency.All N-linked oligosaccharides originate from a common lipid-linked oligosaccharide (LLO) precursor, synthesized in the ER on a dolichol-phosphate (Dol-P) anchor. The mature LLO is transferred co-translationally to consensus sequence Asn residues in the nascent protein, and is further modified by trimming and re-building in the Golgi.
Deficiencies in the genes involved in N-linked glycosylation constitute the molecular background to most of the CDGs.
Type I defects involve the synthesis and transfer of the LLO
Type II defects impair the modification process of protein-bound oligosaccharides.
Type I
Type II
The mature LLO chain is next transferred to the growing protein chain, a process catalysed by the oligosaccharyl transferase (OST) complex.
Once transferred to the protein chain, the oligosaccharide is trimmed by specific glycosidases. This process is vital since the lectin chaperones calnexin and calreticulin, involved in protein quality, bind to the Glc1Man9GlcNAc-structure and assure proper folding. Lack of the first glycosidase (GCS1) causes CDG-IIb.
Removal of the Glc residues and the first Man residue occurs in the ER.
The glycoprotein then travels to the Golgi, where a multitude of different structures with different biological activities are formed.
Mannosidase I creates a Man5GlcNAc2-structure on the protein, but note that this has a different structure than the one made on LLO.
Next, a GlcNAc residue forms GlcNAc1Man5GlcNAc2, the substrate for a-mannosidase II (aManII).
aManII then removes two Man residues, creating the substrate for GlcNAc transferase II, which adds a GlcNAc to the second Man branch. This structure serves as substrate for additional galactosylation, fucosylation and sialylation reactions. Additionally, substitution with more GlcNAc residues can yield tri- and tetra-antennary molecules.Not all structures are fully modified, some remain as high-mannose structures, others as hybrids (one unmodified Man branch and one modified), but the majority become fully modified complex type oligosaccharides.In addition to glycosidase I, mutations have been found:
in MGAT2, in GlcNAc transferase II (CDG-IIa)
in SLC35C1, the GDP-Fuc transporter (CDG-IIc)
in B4GALT1, a galactosyltransferase (CDG-IId)
in COG7, the conserved oligomeric Golgi complex-7 (CDG-IIe)
in SLC35A1, the CMP-sialic acid (NeuAc) transporter (CDG-IIf)However, the use of >100 genes in this process, presumably means that many more defects are to be found.
Diagnosis
Classification
Historically, CDGs are classified as Types I and II (CDG-I and CDG-II), depending on the nature and location of the biochemical defect in the metabolic pathway relative to the action of oligosaccharyltransferase. The most commonly used screening method for CDG, analysis of transferrin glycosylation status by isoelectric focusing, ESI-MS, or other techniques, distinguish between these subtypes in so called Type I and Type II patterns.Currently, twenty-two CDG Type-I and fourteen Type-II subtypes of CDG have been described.Since 2009, most researchers use a different nomenclature based on the gene defect (e.g. CDG-Ia = PMM2-CDG, CDG-Ib = PMI-CDG, CDG-Ic = ALG6-CDG etc.). The reason for the new nomenclature was the fact that proteins not directly involved in glycan synthesis (such as members of the COG-family and vesicular H+-ATPase) were found to be causing the glycosylation defect in some CDG patients.
Also, defects disturbing other glycosylation pathways than the N-linked one are included in this classification. Examples are the α-dystroglycanopathies (e.g. POMT1/POMT2-CDG (Walker-Warburg syndrome and Muscle-Eye-Brain syndrome)) with deficiencies in O-mannosylation of proteins; O-xylosylglycan synthesis defects (EXT1/EXT2-CDG (hereditary multiple exostoses) and B4GALT7-CDG (Ehlers-Danlos syndrome, progeroid variant)); O-fucosylglycan synthesis (B3GALTL-CDG (Peters plus syndrome) and LFNG-CDG (spondylocostal dysostosis III)).
Type I
Type I disorders involve disrupted synthesis of the lipid-linked oligosaccharide precursor (LLO) or its transfer to the protein.Types include:
Type II
Type II disorders involve malfunctioning trimming/processing of the protein-bound oligosaccharide chain.Types include:
Disorders of O-mannosylation
Disorders with deficient α-dystroglycan O-mannosylation.Mutations in several genes have been associated with the traditional clinical syndromes, termed muscular dystrophy-dystroglycanopathies (MDDG). A new nomenclature based on clinical severity and genetic cause was recently proposed by OMIM. The severity classifications are A (severe), B (intermediate), and C (mild). The subtypes are numbered one to six according to the genetic cause, in the following order: (1) POMT1, (2) POMT2, (3) POMGNT1, (4) FKTN, (5) FKRP, and (6) LARGE.Most common severe types include:
Treatment
No treatment is available for most of these disorders. Mannose supplementation relieves the symptoms in MPI-CDG for the most part, even though the hepatic fibrosis may persist. Fucose supplementation has had a partial effect on some SLC35C1-CDG patients.
History
The first CDG patients (twin sisters) were described in 1980 by Jaeken et al. Their main features were psychomotor retardation, cerebral and cerebellar atrophy and fluctuating hormone levels (e.g.prolactin, FSH and GH). During the next 15 years the underlying defect remained unknown but since the plasmaprotein transferrin was underglycosylated (as shown by e.g. isoelectric focusing), the new syndrome was named carbohydrate-deficient glycoprotein syndrome (CDGS) Its "classical" phenotype included psychomotor retardation, ataxia, strabismus, anomalies (fat pads and inverted nipples) and coagulopathy.In 1994, a new phenotype was described and named CDGS-II. In 1995, Van Schaftingen and Jaeken showed that CDGS-I (now PMM2-CDG) was caused by the deficiency of the enzyme phosphomannomutase. This enzyme is responsible for the interconversion of mannose-6-phosphate and mannose-1-phosphate, and its deficiency leads to a shortage in GDP-mannose and dolichol (Dol)-mannose (Man), two donors required for the synthesis of the lipid-linked oligosaccharide precursor of N-linked glycosylation.In 1998, Niehues described a new CDG syndrome, MPI-CDG, which is caused by mutations in the enzyme metabolically upstream of PMM2, phosphomannose isomerase (PMI). A functional therapy for MPI-CDG, alimentary mannose was also described.
The characterization of new defects took increased and several new Type I and Type II defects were delineated.In 2012, Need described the first case of a congenital disorder of deglycosylation, NGLY1 deficiency. A 2014 study of NGLY1 deficient patients found similarities with traditional congenital disorders of glycosylation.
See also
Inborn error of metabolism
Leukocyte adhesion deficiency
PMM2 deficiency
References
External links
GeneReviews/NIH/NCBI/UW entry on PMM2-CDG (CDG-Ia)Carbohydrate-Deficient Glycoprotein Syndrome, Type 1a; Congenital Disorder of Glycosylation Type 1a; Jaeken Syndrome
OMIM entries on Carbohydrate-Deficient Glycoprotein Syndrome, Type 1a; Congenital Disorder of Glycosylation Type 1a; Jaeken Syndrome
GeneReviews/NIH/NCBI/UW entry on Congenital Disorders of Glycosylation Overview |
You function as a medical explainer. Your task is to convey the meanings of medical terms in a detailed, yet easy-to-understand manner. | I'm encountering the term 'Asplenia' in medical literature. What's its definition? | Asplenia refers to the absence of normal spleen function and is associated with some serious infection risks. Hyposplenism is used to describe reduced (hypo-) splenic functioning, but not as severely affected as with asplenism.
Functional asplenia occurs when splenic tissue is present but does not work well (e.g. sickle-cell disease, polysplenia) -such patients are managed as if asplenic-, while in anatomic asplenia, the spleen itself is absent.
Causes
Congenital
Congenital asplenia is rare. There are two distinct types of genetic disorders: heterotaxy syndrome and isolated congenital asplenia.
polysplenia
Acquired
Acquired asplenia occurs for several reasons:
Following splenectomy due to splenic rupture from trauma or because of tumor
After splenectomy with the goal of interfering with splenic function, as a treatment for diseases (e.g. idiopathic thrombocytopenic purpura, thalassemia, spherocytosis), in which the spleens usual activity exacerbates the disease
After splenectomy with the goal of arresting the progression of cancers (Chronic lymphocytic leukemia, Hodgkins disease (starting in the 1970s), non-Hodgkin lymphoma)
Due to underlying diseases that destroy the spleen (autosplenectomy), e.g. sickle-cell disease.
Celiac disease: unknown physiopathology. In a 1970 study, it was the second most common cause of abnormalities of red blood cells linked to hyposplenism, after surgical splenectomy.
Functional asplenia
Functional asplenia can occur when patients with metabolic or haematological disorders have their splenic tissue organisation altered. This can lead to results similar to those seen in patients who have undergone a splenectomy e.g. becoming infected with encapsulated bacteria such as Haemophilus influenzae, Streptococcus pneumoniae and Neisseria meningitidis. Patients who have some form of asplenia have an increased susceptibility to these encapsulated bacterial infections mainly because they lack IgM memory B cells and their non-adherence to polysaccharide vaccines. Furthermore, there is a deficiency of other splenic cells e.g. splenic macrophages. This combined with the lack of B cells can provide an environment favourable for the development of bacterial infections.
Partial splenectomy and preservation of splenic function
In an effort to preserve some of the spleens protective roles, attempts are now often made to preserve a small part of the spleen when performing either surgical subtotal (partial) splenectomy, or partial splenic embolization.
This may be particularly important in poorer countries where protective measures for patients with asplenia are not available.
However, it has been advised that preoperative vaccination is advisable until the remnant splenic tissue can reestablish its function.
Risks
Asplenia is a form of immunodeficiency, increasing the risk of sepsis from polysaccharide encapsulated bacteria, and can result in overwhelming post splenectomy infection (OPSI), often fatal within a few hours. In particular, patients are at risk from Streptococcus pneumoniae, Haemophilus influenzae, and meningococcus. The risk is elevated as much as 350–fold.The increased risk of infection is due to inability to clear opsonised bacteria from circulating blood. There is also a deficiency of T-cell independent antibodies, such as those reactive to the polysaccharide capsule of Streptococcus pneumoniae.The risk to asplenic patients has been expressed as equivalent to an adult dying in a road traffic accident (in every 100 people without spleens, 1 to 5 would develop a severe infection per decade) (reference UK Splenectomy Trust Advice)—hence sensible precautions are advisable. Increased platelet counts can be seen in individuals without a functioning spleen.
Diagnosis
Diagnosis is confirmed by abdominal ultrasonography and detection of Howell-Jolly bodies in red blood cells.
Management
To minimise the risks associated with splenectomy, antibiotic and vaccination protocols have been established, but are often poorly adhered to by physicians and patients due to the complications resulting from antibiotic prophylaxis such as development of an overpopulation of Clostridium difficile in the intestinal tract.
Antibiotic prophylaxis
Because of the increased risk of infection, physicians administer oral antibiotics as prophylaxis after a surgical splenectomy, or starting at birth for congenital or functional asplenia.
Those with asplenia are also cautioned to start a full-dose course of antibiotics at the first onset of an upper or lower respiratory tract infection (for example, sore throat or cough), or at the onset of any fever. Even with a course of antibiotics and even with a history of relevant vaccination, persons without a functional spleen are at risk for Overwhelming post-splenectomy infection.In an emergency room or hospital setting, appropriate evaluation and treatment for an asplenic febrile patient should include a complete blood count with differential, blood culture with Gram stain, arterial blood gas analysis, chest x-ray, and consideration for lumbar puncture with CSF studies. None of these evaluations should delay the initiation of appropriate broad-spectrum intravenous antibiotics. The Surviving Sepsis Campaign guidelines state that antibiotics should be administered to a patient suspected of sepsis within 1 hour of presentation. Delay in starting antibiotics for any reason is associated with a poor outcome.
Vaccinations
It is suggested that splenectomized persons receive the following vaccinations, and ideally prior to planned splenectomy surgery:
Pneumococcal polysaccharide vaccine (not before 2 years of age). Children may first need one or more boosters of pneumococcal conjugate vaccine if they did not complete the full childhood series.
Haemophilus influenzae type b vaccine, especially if not received in childhood. For adults who have not been previously vaccinated, two doses given two months apart was advised in the new 2006 UK vaccination guidelines (in the UK may be given as a combined Hib/MenC vaccine).
Meningococcal conjugate vaccine, especially if not received in adolescence. Previously vaccinated adults require a single booster and non-immunised adults advised, in UK since 2006, to have two doses given two months apart. Children too young for the conjugate vaccine should receive meningococcal polysaccharide vaccine in the interim.
Influenza vaccine, every winter, to help prevent getting secondary bacterial infection.
Travel measures
In addition to the normal immunizations advised for the countries to be visited, Group A meningococcus should be included if visiting countries of particular risk (e.g. sub-saharan Africa). The non-conjugated Meningitis A and C vaccines usually used for this purpose give only 3 years coverage and provide less-effective long-term cover for Meningitis C than the conjugated form already mentioned.Those lacking a functional spleen are at higher risk of contracting malaria, and succumbing to its effects. Travel to malarial areas will carry greater risks and is best avoided. Travellers should take the most appropriate anti-malarial prophylaxis medication and be extra vigilant over measures to prevent mosquito bites.The pneumococcal vaccinations may not cover some of the other strains of pneumococcal bacteria present in other countries. Likewise, their antibiotic resistance may also vary, requiring a different choice of stand-by antibiotic.
Additional measures
Surgical and dental procedures - Antibiotic prophylaxis may be required before certain surgical or dental procedures.
Animal bites - adequate antibiotic cover is required after even minor dog or other animal bites. Asplenic patients are particularly susceptible to infection by capnocytophaga canimorsus and should receive a five-day course of amoxicillin/clavulanate (erythromycin in patients allergic to penicillin).
Tick bites - Babesiosis is a rare tickborne infection. Patients should check themselves or have themselves inspected for tick bites if they are in an at-risk situation. Presentation with fever, fatigue, and haemolytic anaemia requires diagnostic confirmation by identifying the parasites within red blood cells on blood film and by specific serology. Quinine (with or without clindamycin) is usually an effective treatment.
Alert warning - People without a working spleen can carry a card, or wear a special bracelet or necklet which says that they do not have a working spleen. This would alert a healthcare professional to take rapid action if they become are seriously ill and cannot notify them of their condition.
References
== External links == |
You are a facilitator of medical knowledge. Provide thorough and accessible explanations of medical terms, catering to both specialists and non-specialists. | Could you offer a clear explanation of the term 'Noonan syndrome' as used in the medical field? | Noonan syndrome (NS) is a genetic disorder that may present with mildly unusual facial features, short height, congenital heart disease, bleeding problems, and skeletal malformations. Facial features include widely spaced eyes, light-colored eyes, low-set ears, a short neck, and a small lower jaw. Heart problems may include pulmonary valve stenosis. The breast bone may either protrude or be sunken, while the spine may be abnormally curved. Intelligence in the syndrome is often normal. Complications of NS can include leukemia.A number of genetic mutations can result in Noonan syndrome. The condition may be inherited from a persons parents as an autosomal dominant condition or occur as a new mutation. Noonan syndrome is a type of RASopathy, the underlying mechanism for which involves overactivation within the RAS/MAPK cell signaling pathway. The diagnosis may be suspected based on symptoms, medical imaging, and blood tests. Confirmation may be achieved with genetic testing.No cure for NS is known. Treatment is based on the symptoms and underlying problems, and extra support in school may be required. Growth hormone therapy during childhood can increase an affected persons final height. Long-term outcomes typically depend on the severity of heart problems.An estimated 1 in 1000 people are mildly affected by NS, while about 1 in 2,000 have a more severe form of the condition. Males appear to be affected more often than females. The condition was first described in 1883 and was named after American pediatric cardiologist Jacqueline Noonan, who described further cases in 1963.
Signs and symptoms
The most common signs leading to the diagnosis of Noonan syndrome are unique facial characteristics and musculoskeletal features. The facial characteristics are most prominent in infancy, becoming less apparent with age in many people with Noonan syndrome.
Head
Some of the characteristic features of Noonan syndrome include a large head with excess skin on the back of the neck, low hairline at the nape of the neck, high hairline at the front of the head, triangular face shape, broad forehead, and a short, webbed neck.
In the eyes, hypertelorism (widely set eyes) is a defining characteristic, present in 95% of people with Noonan syndrome. This may be accompanied by epicanthal folds (extra fold of skin at the inner corner of the eye), ptosis (drooping of the eyelids), proptosis (bulging eyes), strabismus (inward or outward turning of the eyes), nystagmus (jerking movement of the eyes) and refractive visual errors.
The nose may be small, wide, and upturned.
The development of the ears and auditory system may be affected in people with Noonans syndrome. This can result in low-set ears (in over 90%), backward-rotated ears (over 90%), thick helix (outer rim) of ear (over 90%), incomplete folding of ears, chronic otitis media (ear infections), and hearing loss.
Development of the mouth may also be affected in Noonan syndrome. This can result in deeply grooved philtrum (top lip line) (over 90%), micrognathia (undersized lower jaw), high arched palate, articulation difficulties (teeth dont line up) which can lead to dental problems. Similar to the muscular manifestations above, in the mouth, poor tongue control may be observed.
Skin
Skin signs and symptoms in Noonan syndrome include lymphedema (lymph swelling of the extremities), keloid formation, excessive scar formation, hyperkeratosis (overdevelopment of outer skin layer), pigmented nevi (darkly pigmented skin spots), and connective tissue disease.
Musculoskeletal
Abnormalities in the limbs and extremities may occur in Noonan syndrome. This may manifest as bluntly ended fingers, extra padding on fingers and toes, edema of the back of hands and tops of feet, and cubitus valgus (wide carrying angle of the elbows).
For short stature, growth hormone is sometimes combined with IGF-1 (or as an alternative, IGF-1 as a stand-alone) can be used to achieve an increased height/final height quicker. The final adult height of individuals with Noonan syndrome is about 161–167 cm in males and 150–155 cm in females, which approaches the lower limit of normal.Spinal abnormalities may be present up to 30% of the time and this may require surgery to correct in over 60% of these cases. Other musculoskeletal manifestations in Noonan syndrome are associated with undifferentiated connective-tissue disorders which can be associated with joint contractures (tightness) or joint hypermobility (looseness). Additional factors may present in the form of winging of the scapula, scoliosis, breast bone prominence (pectus carinatum), breast bone depression (pectus excavatum). Muscle abnormalities may present as hypotonia (low muscle tone), which may lead to lordosis (increased hollow in the back) due to poor abdominal muscle tone.
Heart
Noonan syndrome is the second most common syndromic cause of congenital heart disease. This includes pulmonary valvular stenosis (50–60%), atrial septal defects (10–25%), ventricular septal defects (5–20%) and hypertrophic cardiomyopathy (12–35%).
Lungs
Restrictive lung function has been reported in some people.
Gastrointestinal
A number of diverse gastrointestinal (GI) symptoms have been associated with Noonan syndrome. These include swallowing difficulties, low gut motility, gastroparesis (delayed gastric emptying), intestinal malrotation, and frequent or forceful vomiting. These digestive issues may lead to decreased appetite, failure to thrive from infancy to puberty (75%), and occasionally the need for a feeding tube.
Genitourinary system
In some males with Noonan syndrome, testicles do not descend (cryptorchidism).
Circulation
Lymphatic anomalies including Posterior cervical hygroma (webbed neck) and Lymphedema may present in people with Noonan syndrome.
A number of bleeding disorders have been associated with Noonan syndrome, these include platelet dysfunction, Blood clotting disorders, partial deficiency of factor VIII:C, partial deficiency of factor XI:C, partial deficiency of factor XII:C, and an imbalance of plasminogen activator inhibitor type-1 (PAI-1) and tissue plasminogen activator (t-PA) activity. It has been associated with Von Willebrand disease, Amegakaryocytic thrombocytopenia (low platelet count), prolonged activated partial thromboplastin time, combined coagulation defects. When present, these Noonan-syndrome accompanying disorders can be associated with a predisposition to bruise easily, or hemorrhage.
Neurological
Occasionally, Chiari malformation (type 1), may occur, which can lead to hydrocephalus. Seizures have also been reported.
Causes
Recurrence in siblings and apparent transmission from parent to child has long suggested a genetic defect with autosomal dominant inheritance and variable expression. Mutations in the Ras/mitogen activated protein kinase signaling pathways are known to be responsible for about 70% of NS cases.Persons with NS have up to a 50% chance of transmitting it to their offspring. The fact that an affected parent is not always identified for children with NS suggests several possibilities:
Manifestations could be so subtle as to go unrecognized (variable expressivity)
NS is heterogeneous, comprising more than one similar condition of differing causes, and some of these may not be inherited.
A high proportion of cases may represent new, sporadic mutations.Heterozygous mutations in NRAS, HRAS, BRAF, SHOC2, MAP2K1, MAP2K2, and CBL have also been associated with a smaller percentage of NS and related phenotypes.A condition known as "neurofibromatosis–Noonan syndrome" is associated with neurofibromin.
Diagnosis
NS can be confirmed genetically by the presence of any of the known mutations listed above. However, despite identification of 14 causative genes, the absence of a known mutation will not exclude the diagnosis, as more, as-yet-undiscovered genes can cause NS. Thus, the diagnosis of NS is still based on clinical features. In other words, it is made when a physician feels that a person has enough of the features to warrant the label. The principal values of making a genetic diagnosis are that it guides additional medical and developmental evaluations, it excludes other possible explanations for the features, and it allows more accurate recurrence risk estimates. With more genotype-phenotype correlation studies being performed, a positive genetic diagnosis will help the clinician to be aware of possible anomalies specific to that certain gene mutation. For example, an increase in hypertrophic cardiomyopathy is seen in people with a mutation of KRAS and an increased risk of juvenile myelomonocytic leukemia exists for a mutation of PTPN11. In the future, studies may lead to a targeted management of NS symptoms that depends on what genetic mutation a person has.
Before birth
Prenatal features that might lead physicians to consider a diagnosis of Noonan syndrome include cystic hygroma, increased nuchal translucency, pleural effusion, and edema.
Differential diagnosis
While Turner syndrome has similarities with renal anomalies and developmental delay, Turner syndrome is only found in females and often expresses differently. In Turner syndrome, there is a lower incidence of developmental delays, left-sided heart defects are constant and the occurrence of renal abnormalities is much lower.Other RASopathies
Watson syndrome - Watson Syndrome has a number of similar characteristics with Noonans Syndrome such as short stature, pulmonary valve stenosis, variable intellectual development, and skin pigment changes.
Cardiofaciocutaneous (CFC) syndrome - CFC syndrome is very similar to Noonans Syndrome due to similar cardiac and lymphatic features. However, In CFC syndrome intellectual disability and gastrointestinal problems are often more severe and pronounced.
Costello syndrome - Like CFC syndrome, Costello syndrome has overlapping features with Noonans Syndrome. However, the conditions can be distinguished by their genetic cause.
Neurofibromatosis 1 (NF1)
Williams syndrome
Management
The treatment varies depending on complications but tend to be quite standard, reflecting the treatment of the general population. Management guidelines, divided by systems, including general, developmental, dental, growth and feeding, cardiovascular, audiological, haematological, renal and skeletal, that account for actions to be taken at diagnosis, after diagnosis and if symptomatic, have been published by an American consortium.Specifically, treatment of cardiovascular complications resemble that of the general population and treatment of bleeding diathesis is guided by the specific factor deficiency or platelet aggregation.
Neuropsychological testing is recommended to find strengths and challenges to tailor support needed for school and career.
Educational customization such as an individualized education program plan is sometimes needed for school-aged children.
Speech therapy if speech and articulation issues present
Physical therapy and occupational therapy for gross- and fine-motor delays
Hypotonia and motor difficulties often impact handwriting. Accommodations for lessening handwriting demands will improve performance and save long-term hand function.
Periodic follow up and lifelong monitoring of abnormalities found in any system, especially the cardiovascular system, is recommended.
Anesthesia risk
Although a few people with Noonan syndrome have been reported to develop malignant hyperthermia, the gene mutation of diseases known to be associated with malignant hyperthermia is different from that of Noonan syndrome.
Prognosis
The lifespan of people with Noonans syndrome can be similar to the general population, however, Noonan syndrome can be associated with several health conditions that can contribute to mortality. The greatest contributor to mortality in individuals with Noonan syndrome is complications of cardiovascular disease. Prognosis is therefore largely dependent on the presence or absence of cardiac disease, as well as the type and severity of the disease (if disease is present). Most notably, Noonan syndrome with hypertrophic cardiomyopathy is associated with increased mortality.
History
Jacqueline Noonan was practicing as a pediatric cardiologist at the University of Iowa when she noticed that children with a rare type of heart defect, valvular pulmonary stenosis, often had a characteristic physical appearance, with short stature, webbed neck, wide spaced eyes, and low-set ears. Both boys and girls were affected. These characteristics were sometimes seen running in families but were not associated with gross chromosomal abnormalities. She studied 833 people with Noonan syndrome at the congenital heart disease clinic, looking for other congenital abnormalities, and, in 1963, presented a paper: "Associated non-cardiac malformations in children with congenital heart disease". This described 9 children who in addition to congenital heart disease had characteristic facial features, chest deformities and short stature.
Dr. John Opitz, a former student of Dr. Noonans, first began to call the condition "Noonan syndrome" when he saw children who looked like those whom Dr. Noonan had described. Dr. Noonan produced a paper titled "Hypertelorism with Turner Phenotype" in 1968 where she studied 19 patients who displayed symptoms indicative of Noonans Syndrome. In 1971, at the Symposium of Cardiovascular defects, the name Noonan syndrome became officially recognized.
References
== External links == |
You act as a medical communicator. Your goal is to translate medical terms into comprehensive, yet straightforward language for all readers. | Please help me grasp the concept behind the medical term 'Microvillous inclusion disease.' | Microvillus inclusion disease, previously known as Davidsons disease, congenital microvillus atrophy and, less specifically, microvillus atrophy (note: microvillus is often misspelled as microvillous), is a rare genetic disorder of the small intestine that is inherited in an autosomal recessive pattern.
Presentation
It is characterized by chronic, intractable diarrhea in new-born infants, starting in the first few days of life.
This results in metabolic acidosis and severe dehydration. Pregnancy and birth are usually normal.
Pathophysiology
It is caused by a congenital villus atrophy, atrophy of apical microvilli and intracellular accumulation of apical enzymes and transporters in the epithelial cells of the small intestine. MVID is in ost cases caused by mutations in the MYO5B gene. A minority of cases involves mutations in the STX3 gene.
Diagnosis
Prenatal screening in utero is currently offered by several medical centers since the gene(s) involved in the disease were recently discovered to be MYO5B; Diagnosis is typically made by biopsy of the small intestine.
Biopsy
The appearance of microvillous inclusion disease on light microscopy is similar to celiac sprue; however, it usually lacks the intraepithelial lymphocytic infiltration characteristic of celiac sprue and stains positive for carcinoembryonic antigen (CEA). The definitive diagnosis is dependent on electron microscopy.
Differential diagnosis
The differential diagnosis of chronic and intractable diarrhea is:
Intestinal epithelial dysplasia
Syndromatic diarrhea
Immunoinflammatory enteropathy
Prognosis
It is nearly always fatal unless, like short bowel syndrome patients, treated with parenteral nutrition or an intestinal transplant. The patient is often classified as being in "intestinal failure" and treated with the cohort of patients known as "short bowel syndrome" patients.One patient from the UK was documented as achieving nutritional independence at age 3. On 26 June 2009, a six-year-old girl with microvillus inclusion disease became the third person in the UK to die of swine flu. This was attributed to her weakened immune system.
Prevalence
Microvillus inclusion disease is extremely rare, however, no prevalence data have been published. An estimate of a few hundred children with the disease in Europe has been made but no time frame to which this count applies is given. Countries with a higher degrees of consanguinity experience higher prevalence rates due to its autosomal recessive transmission.
History
Microvillus inclusion disease was first described in 1978 by Davidson et al. It was originally described as familial enteropathy.
References
== External links == |
You function as a medical informant. Please provide in-depth yet accessible descriptions of medical terms, suitable for a broad audience. | I'm encountering the term 'Birth trauma' in medical literature. What's its definition? | Birth trauma may refer to:
Childbirth-related posttraumatic stress disorder, psychological trauma to the mother following childbirth
Birth trauma (physical), physical trauma to the infant following childbirth, as described at ICD-10 codes P10-P15
Birth trauma (psychoanalysis), a concept in Freudian psychoanalysis described by Otto Rank |
You are an expert in medical terminology. Explain medical terms in a way that is both precise and easy to understand for non-medical audiences. | What does the medical term 'Congenital erosive and vesicular dermatosis' encompass? | Congenital erosive and vesicular dermatosis is a cutaneous condition characterized by generalized erosions, vesicles, crusting and ‘scalded skin-like’ erythematous areas affecting up to 75% of the body surface area.
See also
Melanotic neuroectodermal tumor of infancy
List of cutaneous conditions
== References == |
Subsets and Splits