text
stringlengths 1
40.9k
|
|---|
Thus, there are few published data for disease incidence in Togo, and the program is forced to rely on publications for neighboring Ghana. |
The reader is referred to the GIDEON website http:// www.GideonOnline.com for an extensive listing of data sources, published reviews, technical background and pricing information. |
Graph contrasting AIDS rates among user-selected countries Figure 9 Graph contrasting AIDS rates among user-selected countries. |
Publish with Bio Med Central and every scientist can read your work free of charge Globalization and Health This debut editorial of Globalization and Health introduces the journal, briefly delineating its goals and objectives and outlines its scope of subject matter. 'Open Access' publishing is expected to become an increasingly important format for peer reviewed academic journals and that Globalization and Health is 'Open Access' is appropriate. The rationale behind starting a journal dedicated to globalization and health is three fold: Firstly: Globalization is reshaping the social geography within which we might strive to create health or prevent disease. The determinants of health – be they a SARS virus or a predilection for fatty foods – have joined us in our global mobility. Driven by economic liberalization and changing technologies, the phenomenon of 'access' is likely to dominate to an increasing extent the unfolding experience of human disease and wellbeing. Secondly: Understanding globalization as a subject matter itself needs certain benchmarks and barometers of its successes and failings. Health is one such barometer. It is a marker of social infrastructure and social welfare and as such can be used to either sound an alarm or give a victory cheer as our interconnectedness hurts and heals the populations we serve. And lastly: In as much as globalization can have an effect on health, it is also true that health and disease has an effect on globalization as exemplified by the existence of quarantine laws and the devastating economic effects of the AIDS pandemic. A balanced view would propose that the effects of globalization on health (and health systems) are neither universally good nor bad, but rather context specific. If the dialogue pertaining to globalization is to be directed or biased in any direction, then it must be this: that we consider the poor first. Secondly: Understanding globalization as a subject matter itself needs certain benchmarks and barometers of its successes and failings. Health is one such barometer. It is a marker of social infrastructure and social welfare and as such can be used to either sound an alarm or give a victory cheer as our interconnectedness hurts and heals the populations we serve. |
And lastly: In as much as globalization can have an effect on health, it is also true that health and disease has an effect on globalization as exemplified by the existence of quarantine laws and the devastating economic effects of the AIDS pandemic. |
A balanced view would propose that the effects of globalization on health (and health systems) are neither universally good nor bad, but rather context specific. If the dialogue pertaining to globalization is to be directed or biased in any direction, then it must be this: that we consider the poor first. |
I am pleased to introduce 'Globalization and Health', a peer reviewed, open access (free to the end user) journal. In this, the début editorial, I will briefly outline the purpose and scope of this journal highlighting our intention to publish a balanced mixture of opinion on the subject. |
That the journal be 'Open Access' is entirely appropriate. Knowledge, at its best utility, is a 'public good' i.e. nonrival, non-excludable. While this journal will deal with the subject matter of creating 'global public goods for health', it will also by virtue of its very existence, contribute toward that process. Globalization and Health's 'Open Access' policy changes the way in which articles are pub-lished. First, all articles become freely and universally accessible online, and so an author's work can be read by anyone at no cost. Second, the authors hold copyright for their work and grant anyone the right to reproduce and disseminate the article, provided that it is correctly cited and no errors are introduced [1] . Third, a copy of the full text of each Open Access article is permanently archived in an online repository separate from the journal. Globalization and Health's articles are archived in PubMed Central [2], the US National Library of Medicine's full-text repository of life science literature, and also in repositories at the University of Potsdam [3] in Germany, at INIST [4] in France and in e-Depot [5], the National Library of the Netherlands' digital archive of all electronic publications. Importantly, the results of publicly funded research will be accessible to all taxpayers and not just those with access to a library with a subscription. As such, Open Access could help to increase public interest in, and support of, research. Note that this public accessibility may become a legal requirement in the USA if the proposed Public Access to Science Act is made law [6]. Added to this, a country's economy will not influence its scientists' ability to access articles because resource-poor countries (and institutions) will be able to read the same material as wealthier ones (although creating access to the internet is another matter [7] ). |
The rationale behind starting a journal dedicated to globalization and health is three fold: |
Firstly: Globalization is reshaping the social geography within which we might strive to create health or prevent disease. The determinants of health -be they a SARS virus or a predilection for fatty foods -have joined us in our global mobility. Driven by economic liberalization and changing technologies, the phenomenon of 'access' is likely to dominate to an increasing extent the unfolding experience of human disease and wellbeing. |
Secondly: Understanding globalization as a subject matter itself needs certain benchmarks and barometers of its successes and failings. Health is one such barometer. It is a marker of social infrastructure and social welfare and as such can be used to either sound an alarm or give a victory cheer as our interconnectedness hurts and heals the populations we serve. |
And lastly: In as much as globalization can have an effect on health, it is also true that health and disease has an effect on globalization as exemplified by the existence of quarantine laws and the devastating economic effects of the AIDS pandemic. |
A balanced view would propose that the effects of globalization on health (and health systems) are neither univer-sally good nor bad, but rather context specific. The extent to which individual states are able to engage the process of globalization on their own terms differs widely from one country to the next. Child mortality, for example, changes quickly in response to subtle changes in purchasing power in impoverished communities. In affluent communities however, a small change in income has little effect on utility in either direction. As we consider the effects of globalization on wellbeing it becomes apparent that we need to consider both the long term scenarios for populations as a whole, and the immediate effects for the more vulnerable within those populations who are dependent on fragile local economies. |
If the dialogue pertaining to globalization is to be directed or biased in any direction, then it must be this: that we consider the poor first. The 'polysemous' codon--a codon with multiple amino acid assignment caused by dual specificity of tRNA identity. In some Candida species, the universal CUG leucine codon is translated as serine. However, in most cases, the serine tRNAs responsible for this non-universal decoding (tRNA(Ser)CAG) accept in vitro not only serine, but also, to some extent, leucine. Nucleotide replacement experiments indicated that m1G37 is critical for leucylation activity. This finding was supported by the fact that the tRNA(Ser)CAGs possessing the leucylation activity always have m1G37, whereas that of Candida cylindracea, which possesses no leucylation activity, has A37. Quantification of defined aminoacetylated tRNAs in cells demonstrated that 3% of the tRNA(Ser)CAGs possessing m1G37 were, in fact, charged with leucine in vivo. A genetic approach using an auxotroph mutant of C.maltosa possessing this type of tRNA(Ser)CAG also suggested that the URA3 gene inactivated due to the translation of CUG as serine was rescued by a slight incorporation of leucine into the polypeptide, which demonstrated that the tRNA charged with multiple amino acids could participate in the translation. These findings provide the first evidence that two distinct amino acids are assigned by a single codon, which occurs naturally in the translation process of certain Candida species. We term this novel type of codon a 'polysemous codon'. (termed tRNA Ser CAG), and revealed its decoding mechan-Bioscience and Biotechnology, Tokyo Institute of Technology, ism by means of an in vitro translational assay system Nagatsuta, Midori-ku, Yokohama 227, Japan (Yokogawa et al., 1992; Suzuki et al., 1994) . Furthermore, 2 Corresponding authors when we investigated the distribution of this non-universal genetic code in fungi, as well as C.cylindracea, eight other In some Candida species, the universal CUG leucine |
Candida species-C.albicans, C.zeylanoides, C.lusitaniae, codon is translated as serine. However, in most cases, C.tropicalis, C.melbiosica, C.parapsilosis, C.guilliermonthe serine tRNAs responsible for this non-universal dii and C.rugosa-were found to utilize the codon CUG decoding (tRNA Ser CAG) accept in vitro not only serine, for serine instead of leucine, all having tRNA Ser CAG as but also, to some extent, leucine. Nucleotide replacethe mediator in the unusual decoding (Ohama et al., 1993 ; ment experiments indicated that m 1 G37 is critical for Ueda et al., 1994) . Several other investigators have also leucylation activity. This finding was supported by the shown that the codon CUG is actually translated as serine fact that the tRNA Ser CAGs possessing the leucylation in vivo in C.albicans and C.maltosa (Santos and Tuite, activity always have m 1 G37, whereas that of Candida 1995a; Sugiyama et al., 1995; Zimmer and Schunck, 1995) . |
One of the most remarkable structural features observed A37. Quantification of defined aminoacetylated tRNAs in most of these tRNA Ser CAGs is that the nucleotide 5Јin cells demonstrated that 3% of the tRNA Ser CAGs adjacent to the anticodon (position 33) is occupied not by possessing m 1 G37 were, in fact, charged with leucine the conserved U residue (U33) but by a G residue (G33). |
It has been speculated that U33 is necessary for forming of C.maltosa possessing this type of tRNA Ser CAG also the U-turn structure of the anticodon loop in all tRNAs suggested that the URA3 gene inactivated due to the reported so far (Quigley and Rich, 1976 ; Sprinzl et al., translation of CUG as serine was rescued by a slight 1996) . Moreover, the nucleotide at position 37, 3Ј-adjacent incorporation of leucine into the polypeptide, which to the anticodon CAG, is 1-methyl guanosine (m 1 G) in demonstrated that the tRNA charged with multiple almost all tRNA Ser CAGs except for that of C.cylindracea amino acids could participate in the translation. These (A37), while all the serine tRNAs in fungi corresponding findings provide the first evidence that two distinct Introduction Normanly and Abelson, 1989; Shimizu et al., 1992; McClain, 1993; Schimmel et al., 1993) . This line of study The universality of the genetic code was once considered began with the artificial conversion of leucine tRNA of to be one of the essential characteristics of life, which led Escherichia coli to serine tRNA by Abelson's group 10 to the conception of the 'frozen accident theory'. This years ago (Normanly et al., 1986) . Recently, tRNA identity theory proposes that all extant living organisms use the elements of Saccharomyces cerevisiae leucine tRNA were universal genetic code, which was born by accident and elucidated using unmodified variants synthesized by T7 'frozen', and that they originate from a single, closely RNA polymerase (Soma et al., 1996) , indicating that in interbreeding population (Crick, 1968) . However, in recent addition to the discriminator base, A73, the second letter years a number of non-universal genetic codes have been of the anticodon, A35, and the nucleotide 3Ј-adjacent to reported in various non-plant mitochondrial systems, as the anticodon, m 1 G37, are important for recognition by well as in several nuclear systems (reviewed in Osawa leucyl-tRNA synthetase (LeuRS). The majority of Candida et al., 1992; Osawa, 1995) , which contradict the frozen tRNA Ser CAGs have A35 and m 1 G37, while the discriminaccident theory. |
Among these deviations from the universal codes, ator is occupied by a nucleoside other than adenosine (mostly G73). In this respect, tRNA Ser CAG seems to be a potentially chimeric tRNA molecule capable of being recognized not only by seryl-but also by leucyl-tRNA synthetases. |
Previously, we showed that these tRNA Ser CAGs would have originated from the serine tRNA corresponding to codon UCG . This suggests an evolutionary pathway in which conversion from A to m 1 G would have taken place at position 37 just after the emergence of tRNA Ser CAG had brought about a change in the universal code. Since such a mutation at position 37 might potentially result in the leucylation of tRNA Ser CAG, we attempted to elucidate the charging properties of these tRNA Ser CAGs both in vitro and in vivo. Based on the results of in vitro aminoacylation reactions using tRNA variants constructed by the microsurgery method, the direct analysis of aminoacylated tRNAs in cells and a genetic approach, we demonstrate here that these serine tRNAs are actually leucylated both in vitro and in vivo. Furthermore, m 1 G at position 37 was found to be indispensable for the leucylation of tRNA Ser CAGs. In fact, the tRNA Ser CAG of C.cylindracea, which has A at position 37, exhibits no leucylation activity. C.cylindracea has a high GϩC content (63%) and utilizes CUG as a major serine codon. However, the other Candida species have no such high GϩC content and utilize the CUG as a minor serine codon (Kawaguchi et al., 1989; Lloyd and Sharp, 1992; our unpublished observation) . Considering the relationship between the usage of the codon CUG as serine and the leucylation properties of tRNA Ser CAG, it seems that only Candida species with a genome in which the incidence of the CUG serine codon is very low possess serine tRNA Ser CAG that can be leucylated. Furthermore, such tRNA Ser CAGs charged with heterogeneous amino acids should be utilized equally in the translation process. This is the first demonstration that a single tRNA species is assigned to two different amino acids in the cell. We propose designating this type of codon having multiple amino acid assignment as a 'polysemous codon'. The correlation between the dual-assignment state and the pathway of genetic code diversification is also discussed. |
and C.cylindracea (Yokogawa et al., 1992; Ohama et al., 1993 ). The numbering system and abbreviations for modified nucleotides conform Candida zeylanoides tRNA Ser CAG is leucylated to Sprinzl et al. (1996) and Crain and McCloskey (1996), respectively. in vitro (B) Time-dependent aminoacylation with SerRS or LeuRS from First the leucylation of tRNA Ser CAGs from C.zeylanoides C.zeylanoides cells. Aminoacylation reactions were carried out with and C.cylindracea was examined using LeuRS partially 0.7 µM tRNAs and with same amounts of enzyme activities calculated using cognate tRNAs. Serylation and leucylation are shown by dotted purified from C.zeylanoides, since it is known that leucine and solid lines, respectively. The right-hand frame shows the solid tRNAs of yeast have one of their identity determinants at curves from left-hand frame plotted with an enlarged ordinate. The position 37 (Soma et al., 1996) and tRNA Ser CAGs of aminoacylation of C.zeylanoides tRNA Ser CAG (s) and of C.zeylanoides and C.cylindracea have different nucleo-C.cylindracea tRNA Ser CAG (u) are compared; C.cylindracea tRNA Ser GCU (j), having no leucylation activity, is shown as a tides at this position (m 1 G and A, respectively) (Figure control. (C) TLC analysis of acetylleucyl-tRNA fragments derived 1A). Both tRNAs showed almost full serylation activity from leucylated tRNA Ser CAGs. After leucylation with [ 14 C]leucine, (~1200-1500 pmol/A 260 unit), as shown in Figure 1B . The leucyl-tRNAs were acetylated with acetic anhydride. Acetyl-tRNA Ser CAG of C.zeylanoides was evidently leucylated leucylated at all, as was the case when another species tRNA Ser CAG by gel-electrophoresis under acidic con- observed with LeuRSs from both C.cylindracea and S.cerevisiae (data not shown). of serine tRNA specific for codon AGY (Y: U or C) m 1 G37 is responsible for recognition by (tRNA Ser GCU) was employed as a control substrate leucyl-tRNA synthetase ( Figure 1B , right-hand graph). The K m value of C.zeylan-Among the tRNA Ser CAGs of several Candida species, oides LeuRS towards tRNA Ser CAG (5.0 µM) is only one that of C.cylindracea is unique because it alone possesses order of magnitude larger than that of the serylation of no leucylation capacity. A sequence comparison of these this tRNA (0.22 µM) as well as that of leucylation toward tRNAs ( Figure 1A ) prompts us to speculate that the the cognate leucine tRNAs of S.cerevisae (0.34 µM; Soma nucleotide at position 37 is strongly associated with et al., 1996) . |
leucylation, because all tRNA Ser CAGs possessing leucyl-In order to verify that the leucylation activity observed ation activity have m 1 G in common, while only the for the tRNA Ser CAG of C.zeylanoides actually came from tRNA Ser CAG of C.cylindracea, which possesses no leucylthe tRNA Ser CAG itself, and not from a trace amount ation activity, has A at this position. of leucine tRNA contaminating the tRNA sample, the To examine the validity of this speculation, a series of leucylated 3Ј-terminal RNA fragment derived from leucyl-tRNA Ser CAG variants was constructed by the in vitro tRNA Ser CAG was analyzed in the following manner. 14 Ctranscription method using T7 RNA polymerase, as well leucylated tRNA Ser CAG from C.zeylanoides was first as by the microsurgery method, and the leucylation activity acetylated with acetic anhydride to prevent deacylation, of each variant was measured. When the tRNA Ser CAG of and then digested with RNase T1. The resulting 3Ј-C.zeylanoides synthesized by in vitro transcription was terminal fragment with 14 C-labeled acetylleucine was employed as a substrate, no leucylation activity was analyzed by cellulose TLC. The results are shown in detected, not even for the tRNA transcript having G37 Figure 1C . If leucylated tRNA Ser CAG were digested ( Figure 3A ). On the other hand, as shown in Figure 3A , with RNase T1, 14 C-labeled acetylleucyl-CCA should be serylation activity exceeded 1000 pmol/A 260 unit. These released as a labeled fragment ( Figure 1C , lane 3), because results strongly suggested that some nucleoside modifica-G is located at position 73 of the tRNA Ser CAG (Figure tion is necessary in tRNA Ser CAG for recognition by 1A, left-hand structure). Any contaminated leucine tRNAs, LeuRS. We thus attempted to replace the m 1 G37 of if they exist, will give some 14 C-labeled fragments larger C.zeylanoides tRNA Ser CAG with G (the variant is symbolthan the tetramer ( Figure 1C , lane 4), because all the ized as m 1 G37G) or A (m 1 G37A), by the microsurgery leucine tRNAs of yeasts so far analyzed (Sprinzl et al., method (Figure 2A and B; for details, see Materials 1996) including those of C.zeylanoides (T. Suzuki, unpuband methods) to examine the contribution of m 1 G37 to lished result) are known to have A73 at their 3Ј-ends, leucylation and the contribution of A37 of C.cylindracea which are resistant to RNase T1. The mobility of the tRNA Ser CAG to the prevention of leucylation. acetylleucyl-oligonucleotide derived from tRNA Ser CAG When aminoacylation of m 1 G37A and m 1 G37G was from C.zeylanoides ( Figure 1C , lane 1) was identical to examined ( Figure 3A ), the results indicated that both that of acelylleucyl-CCA prepared from the RNase U2 substitutions lead to complete loss of leucylation (Figure digests of leucyl-tRNA Leu s from C.zeylanoides (lane 3). |
3A, right-hand graph), although no apparent influence was This observation clearly demonstrates that leucine is observed on serylation ( Figure 3A , left-hand graph). These definitely attached to the tRNA possessing G73; the tRNA findings strongly indicate that the methyl group of m 1 G37 therefore must be tRNA Ser CAG and not tRNA Leu . Thus, plays a crucial role in enhancing the leucylation activity it is concluded that the tRNA which incorporated leucine of tRNA Ser CAG. in vitro is in fact tRNA Ser CAG. This deduction is supported |
The slight reduction in leucylation activity observed in by the results of an additional experiment: incorporation the control variant z-G33G ( Figure 2A ) compared with of [ 14 C]leucine into the tRNA Ser CAG sample with LeuRS native tRNA ( Figure 3A , right-hand graph) was found to was reduced by the addition of SerRS and non-labeled have resulted from the partial deacetylation of 4-acetyl serine to the reaction mixture (data not shown), which cytidine (ac 4 C) due to acid treatment of the 5Ј-half clearly indicates that the same tRNA molecule is comfragment of tRNA Ser CAG (see Materials and methods). petitively aminoacylated by these two enzymes. This is considered further in the Discussion. To conclude that tRNA Ser CAG is aminoacylated with leucine, we carried out a further experiment. The G33 acts as a modulator of leucylation tRNA Ser CAG was charged with serine and serylated In addition to m 1 G37, another unique feature of the serine tRNA Ser CAGs in these Candida species is the presence tRNA Ser CAG was separated from non-aminoacylated The effect of mutation at position 33 in these two each variant was confirmed to have been replaced as expected (shown tRNAs was found to be quite different. In the case of the by arrows). |
C.cylindracea tRNA, none of the mutations at position 33 caused leucylation of the tRNA, as was observed with the native tRNA Ser CAG, and there was no reduction in of G at position 33, where a pyrimidine (mostly U) is completely conserved in usual tRNAs (Sprinzl et al., serylation activity ( Figure 3C ). In contrast, the replacement of G33 by pyrimidines in C.zeylanoides tRNA Ser CAG 1996). Since we considered it is possible that this notable feature may be in some way related to the unusual considerably enhanced the leucylation activity ( Figure 3B , right-hand graph), while no significant difference was aminoacylation characteristics described above and/or to the translation of non-universal genetic code, we examined observed in the serylation activity ( Figure 3B , left-hand graph). The kinetic parameters of leucylation for the the effect of residue 33 on the aminoacylation and transla- show the spots corresponding to acetylleucine and acetylserine as markers, respectively. (D) Analysis of acetylamino acids attached to tRNA fragments on a TLC plate. Lane 2 shows the spot corresponding to the acetylamino acids derived from the RNase T1 fragment of C.zeylanoides tRNA Ser CAG. Lanes 1 and 3 indicate the spots corresponding to acetylleucine and acetylserine, respectively. Ten micrograms of [ 14 C]acetylaminoacyl-tRNA Ser CAG from C.zeylanoides was digested with RNase T1 and developed on cellulose TLC plates under the same conditions as (C). CCA fragments with [ 14 C]acetylamino acids were scraped from the plate from which the fragments were eluted with H20 and desalted by Sep-pak C18 under the conditions described in the literature (Wang et al., 1990) . |
[ 14 C]acetylamino acids discharged from the fragments were developed on TLC and visualized by an imaging analyzer (BAS-1000, Fuji Photo Systems). variants of C.zeylanoides tRNA are shown in Table I . It |
Evidence for leucylation of C.zeylanoides tRNA Ser CAG in vivo is notable that the K m values of the two pyrimidine At this point, we had established that the tRNA Ser CAG mutants, z-G33U (1.4 µM) and z-G33C (1.3 µM), are of C.zeylanoides is actually able to accept leucine in vitro. clearly lower than those of the two purine mutants, z-G33A However, considering the facts that SerRS and LeuRS (6.7 µM) and z-G33G (5.6 µM). The V max value of z-G33U coexist in cells and, judging from their K m values, that (1.2 pmol/min) is 39% of that of z-G33C (3.1 pmol/min), the affinity of tRNA Ser CAG toward SerRS is one order of which could explain why z-G33U shows lower leucylation magnitude higher than that toward LeuRS, we needed to activity than z-G33C despite having nearly the same K m ascertain whether the tRNA Ser CAG of C.zeylanoides is in value ( Figure 3B , right-hand graph). Judging from the fact leucylated in vivo. For this purpose, we adopted a sequence analysis (data not shown), the slight reduction newly developed method for quantifying an individual in the leucylation of z-G33G (5.6 µM) compared with aminoacyl-tRNA in cells (Suzuki et al., 1996) . that of the native tRNA Ser CAG (5.0 µM) is probably due Aminoacyl-tRNAs separately prepared from cells of to the partial deacetylation of ac 4 C at position 12, as C.zeylanoides and C.cylindracea were immediately submentioned above. This was confirmed by the observation jected to acetylation using [1-14 C]acetic anhydride to label of a slight reduction in leucylation activity also in acidthe amino acids as well as to stabilize the aminoacylated treated native tRNA Ser CAG (data not shown). It is thus tRNAs. From each of the acetylated aminoacyl-tRNA concluded that replacement of a pyrimidine by a purine mixtures, tRNA Ser CAGs from C.zeylanoides and C.cylindat position 33 has a repressive effect on leucylation of the racea were fished out by a solid-phase-attached DNA tRNA Ser CAG of C.zeylanoides. |
probe as described previously (Tsurui et al., 1994 ; Wakita The translation efficiencies of the variants with a muta et al., 1994) . A single band for each of the aminoacyltion at position 33 were also examined in a cell-free tRNAs was detected by staining ( Figure 4A ) with which translation system of C.cylindracea (Yokogawa et al., the radioactivity coincided in each case ( Figure 4B ). 1992; Suzuki et al., 1994) , to evaluate the effect of G33. |
Acetylated amino acids attached to these tRNAs were A change from G to U at position 33 apparently enhanced deacylated by alkaline treatment and analyzed by TLC. the translation activity 2.5-fold, although their decoding As shown in Figure 4C , acetylserine was observed as a properties did not change at all (data not shown). We thus major amino acid derivative in both tRNA Ser CAGs, but consider that G33 serves as a modulator of leucylation of acetylleucine was detected only in the C.zeylanoides tRNA Ser CAG, despite a slight disadvantage in transla-tRNA Ser CAG; the acetylserine and acetylleucine spots were identified as described previously (Suzuki et al., tion activity. 1996) . The radioactivities remaining on the origins probably came from the direct acetylation of some nucleotides in the tRNAs, as discussed previously (Suzuki et al., 1996) . From comparison with the radioactivity of acetylserine, it was calculated that~3% of the tRNA Ser CAG was attached with acetylleucine. These results were reproducible. |
Digestion of purified acetyl-aminoacyl tRNA Ser CAG with RNase T1 also gave only a 14 C-labeled CCA fragment, as shown in Figure 1C . When the acetylated amino acid released from the fragment purified from the corresponding spot on TLC was analyzed by TLC, the ratio of acetylleucine to acetylserine was also found to be 3% ( Figure 4D ), indicating that acetylleucine is covalently attached to the tRNA Ser CAG fragment with G73. It thus became clear that the tRNA Ser CAG of C.zeylanoides was in fact charged with leucine by 3% of the amount of serylation of the same tRNA Ser CAG in C.zeylanoides cells. |
Aminoacylation has generally been considered to be the final stage determining translational accuracy (reviewed in Parker, 1989; Kurland, 1992; Farabaugh, 1993) . However, in the case of tRNA Gln charged with glutamate in the chloroplast, Glu-tRNA Gln is rejected by an elongation factor so that the chloroplast translation machinery does not employ the mischarged aminoacyl-tRNA (Stanzel et al., 1994) . It is likely that this is an exceptional case due to the lack of glutamyl-tRNA synthetase in the chloroplast. |
In order to prove that leucylated tRNA Ser CAGs actually participate in the translation process in Candida cells without such a rejection mechanism, we utilized a URA3 gene expression system derived from S.cerevisiae in C.maltosa, which was developed by Sugiyama et al. (1995) . Candida maltosa utilizes the codon CUG as serine and possesses the relevant tRNA Ser CAG gene (Sugiyama et al., 1995; Zimmer and Schunck, 1995) . Since the et al., 1995) . In the present study, this URA3 gene, with the CTG codon replaced by various leucine or serine codons, was utilized as a marker gene ( Figure 5A ). First, ADE1/ura3::C-ADE1) (Ohkuma et al., 1993) , the growth of which was monitored on minimal medium SD plates a plasmid in which the S.cerevisiae URA3 gene was inserted downstream of a C.maltosa-specific promoter in the presence and absence of uracil. When uracil was supplied to the SD plate for the (C-p) was constructed and designated as pCSU-CTG (Sugiyama, 1995) . As controls, mutant plasmids of pCSU-positive control experiments, all the transformants grew normally ( Figure 5B , middle row). However, in the absence CTG, in which the codon CTG was replaced by either the serine codon TCT or the leucine codon CTC, were of uracil, cells harboring pCCU and pCSU-CTC showed normal growth, whereas no growth was observed in those constructed and named pCSU-TCT and pCSU-CTC, respectively. In addition, a plasmid (pCCU) consisting of harboring pCSU-TCT and pUTH18 that contained no URA3 gene insertion. Cells harboring pCSU-CTG showed the URA3 gene of C.maltosa having a CTT leucine codon at the corresponding site, combined with the C.maltosa-weak but significant growth ( Figure 5B, uppermost row) . These results demonstrate that if the codon at position 45 specific promoter, was also used as a positive control. These variant plasmids were introduced into a URA3-is translated as leucine, active ODCase will be produced and the cells will be able to grow, but translation of the defective C.maltosa strain CHU1 (his5, ade1, ura3::C-codon with serine will produce inactive ODCase and the We believe that tRNA Ser CAG is the only molecule responsible for the leucine insertion corresponding to cells will be unable to grow. The result with cells harboring pCSU-CTG clearly demonstrates that the URA3 mutation codon CUG in C.maltosa cells, based on the following obervations. We have purified and sequenced a number on the C.maltosa chromosome was in some way complemented by the introduced pCSU-CTG plasmid, suggesting of leucine and serine tRNAs from Candida species, in which codon CUG is translated as serine, and failed in that the CTG codon was read at least partially as leucine in C.maltosa cells possessing tRNA Ser CAG. |
finding tRNA with the anticodon sequence potentially complementary to codon CUG other than tRNA Ser CAG In order to quantify the growth rate of the cells harboring pCSU-CTG, the viability of the cells was examined in (Yokogawa et al., 1992; Ohama et al., 1993; Suzuki et al., 1994; Ueda et al., 1994; our unpublished observation) . liquid medium without uracil. As shown in Figure 5C , whereas translation of the CTG codon as serine completely Futhermore, tRNA genes for serine and leucine from these Candida species were sequenced following the blocked cell growth in the case of pCSU-TCT, and full complementation was observed in the case of pCSU-CTC amplification by cloning and/or PCR methods, and we found that only tRNA Ser CAG is able to translate codon in which the CTC codon was read as leucine, intermediate cell growth was observed in the case of pCSU-CTG, CUG (Yokogawa et al., 1992; Ohama et al., 1993; Suzuki et al., 1994; Ueda et al., 1994 ; our unpublished observ-indicating that ODCase was expressed in an active form, albeit at a low level, when there was a slight incorporation ation). Thus, it could be concluded that only the tRNA Ser CAG species inserts leucine into polypeptide of leucine at the CTG codon. The slow growth of the cells harboring pCSU-CTG was not due to the spontaneous corresponding to codon CUG. reversion of the CTG codon to another leucine codon or due to any other mutation, because the cells harvested Discussion from the colony on the SD-plate show the same growth phenotype. These results are unlikely to reflect the different The observations presented here clearly demonstrate that, in certain living organisms, a single codon can be simul-expression levels of the URA3 gene variants because the URA3 mRNA level is not altered by mutations at position taneously assigned to two distinct amino acids. Most codons in the genetic code degenerate, but our findings 45 (Ohkuma, 1993) . Furthermore, the possibility that the URA3 gene with CTG at position 45 is translated more show that some amino acids are also able to degenerate with respect to a particular codon. Such codon ambiguity efficiently than the gene with TCT at the same site due to codon preference (Ikemura, 1982) is excluded by the is governed by a tRNA acceptable to two amino acids simultaneously, as described above. We propose to desig-fact that the TCT codon is the most preferred of all the serine codons, including the CUG codon, in C.maltosa nate a codon corresponding to multiple amino acids a 'polysemous codon'. (Sugiyama et al., 1995) . |
ODCase activity resulting from the translation of the A high degree of accuracy in tRNA aminoacylation has been considered crucial for preserving fidelity in protein URA3 gene was examined in the presence of a pyrimidine analog, 5-fluoroorotic acid (5FOA), an inhibitor in synthesis. It has been established that aminoacyl-tRNA synthetase is able to discriminate precisely its cognate pyrimidine biosynthesis. Incorporation of 5FOA with ODCase results in the formation of 5-fluorouridylate, amino acid from other structurally related amino acids at the adenylation reaction step, and its cognate tRNAs from which is harmful to cell propagation (Boeke et al., 1984) . Thus, URA3-defective strains grow normally on a medium non-cognate ones (reviewed in Parker, 1989; Kurland, 1992) . The misacylation error in this process has been containing 5FOA, whereas cells possessing the active URA3 gene are unable to grow on this medium. Cells estimated to range between 10 -4 and 10 -5 (Lin et al., 1984; Okamoto et al., 1984) . Discrimination of cognate harboring the respective plasmids were cultivated in the presence of 5FOA in addition to uracil. tRNA from non-cognate tRNAs is mediated by positive and negative identity determinants localized on the tRNA As shown in the bottom row of Figure 5B , cells harboring pCSU-CTG exhibited similar growth on the molecule (Yarus, 1988; Normanly and Abelson, 1989) . The only exception reported so far is that tRNA Gln is agar plate to those with pCSU-TCT and pUTH18, although the transformants with pCSU-CTC and pCCU were unable aminoacylated with glutamate in Gram-positive bacteria and in some organelles (Lapointe et al., 1986 ; Schön to grow. These results indicate that the CTG codon at position 45 was mainly translated as serine in C. maltosa, et al., 1988) . However, this differs from misaminoacylation in that this process is indispensable to compensate for the so as to produce the inactive ODCase. However, when the liquid medium was supplied with 5FOA, a slight lack of glutamyl-tRNA synthetase in these organisms. In general, high fidelity in the aminoacylation process is reduction in the growth rate was observed in the case of pCSU-CTG, compared with pCSU-TCT ( Figure 5C ), considered to be indispensable for translating genes into functionally active proteins with a high degree of accuracy. while very slow growth was observed in the case of pCSU-CTC used as a control. In order to detect a low |
The discovery of a polysemous codon in a Candida species contradicts the established notion of aminoacyl-level of ODCase activity arising from a slight incorporation of leucine at the CUG codon in the 45th position, we ation with high fidelity. We have shown that a single tRNA is acceptable to two different amino acids, and adjusted the ratio of 5FOA and uracil as shown in Materials and methods. This growth rate reduction clearly suggests that it can therefore transfer two different amino acids corresponding to a particular codon. The expression that the slow growth observed in the SD medium was due to low expression of active ODCase. Thus it is concluded experiment using the ODCase-encoding URA3 gene containing codon CUG at the site essential for its activity that the CUG codon is partially translated as leucine in C.maltosa cells. |
(see also Sugiyama et al., 1995) suggested that leucine could be incorporated into the gene product corresponding on experiments using an artificial mutation, and it does not reflect experimental observation in an extant living to codon CUG in C.maltosa, as judged from the complementation tests with the URA3 mutation. Although the organism. |
On the basis of peptide sequences, several research amount of leucine incorporated per CUG codon was not quantitatively determined, it is clear that the incorporation groups have reported that codon CUG corresponds only to serine in C.maltosa (Sugiyama et al., 1995) and was mediated by the leucyl-tRNA Ser CAG. We thus concluded that codon CUG was simultaneously assigned to C.albicans (Santos and Tuite, 1995a; White et al., 1995) . No leucine-inserted peptide was detected in these studies. serine and leucine in the normal translation process in C.maltosa. A quantitative analysis of the amino acids However, we consider that any peptide with a leucine which was inserted for the codon CUG might have been attached to the tRNA indicated that 3% of tRNA Ser CAG is leucylated in C.zeylanoides cells. Such a high level of missed during purification or was undetectable in the peptide sequencing, because the amount of leucine-inserted leucylation is far beyond conventional misacylation, whose rate is estimated to be less than 10 -4 . Unless a proofreading peptide (~3%) would have been too low to be positively identified in sequencing experiments. mechanism exists on the ribosome, incorporation of leucine at CUG codon sites may reflect the relative ratio of |
We have shown that tRNA Ser CAG in Candida species is a chimera of tRNA Ser CAG and tRNALeuCAG in so far tRNA Ser CAG leucylation, which is two orders of magnitude higher than that of conventional mistranslation. |
as it is the substrate for both SerRS and LeuRS. The K m value for LeuRS is 5.0 µM, which is only one order of To date, artificial manipulations of molecules participating in the translation process, such as the overproduction magnitude larger than that for SerRS (0.22 µM). In an in vitro aminoacylation experiment Ͼ30% of tRNA Ser CAG of aminoacyl-tRNA synthetase (Swanson et al., 1988) , mutations of tRNAs etc. and/or control of growth condi-subjected to the reaction could be converted to leucyl-tRNA Ser CAG using an increased amount of LeuRS and a tions, such as deprivation of amino acids in the medium (Edelmann and Gallant, 1977; O'Farrell, 1978; Parker and longer incubation time (data not shown). We observed that while the presence of SerRS and non-radioactive Precup, 1986), have been found to increase the error rate in translation (reviewed in Parker, 1989) . However, our serine reduced leucylation, complete loss of leucylation could not be achieved (data not shown), indicating that the observation is based on experiments using wild-type cells grown in a rich medium suitable for high viability. In affinity of LeuRS toward tRNA Ser CAG is relatively high. In proliferating cells of C.zeylanoides, the leucyl-these respects, the polysemous codon is a phenomenon completely different from these artificial translational tRNA Ser CAG in the cells was estimated to be 3% of the seryl-tRNA Ser CAG, which is much lower than that errors. It is known that many examples exist for alternative decoding of universal codons-initiation codons other obtained in the in vitro experiments. We consider that such a reduction in leucylation is due to the competition than AUG (Gold, 1988; Kozak, 1983) , leaky stop codons caused by nonsense suppresser or native tRNAs (Murgola, for the tRNA Ser CAG between SerRS and LeuRS in the cells. Despite this competition, the distinct detection of 1985), the UGA codon used for incorporation of selenocysteine (Leinfelder et al., 1988) and so on. However, leucylated tRNA Ser CAG in vivo supports the existence of an ambiguous aminoacylation reaction toward the single because of strong dependence on the context effects or possible secondary structures of mRNAs, these recoding tRNA Ser CAG species. The polysemous codon results from the coexistence of events are those which are programed in the mRNAs (Gesteland et al., 1992) . We have sequenced several genes tRNA identity determinants for serine and leucine in a single tRNA molecule. Construction of tRNA Ser CAG in Candida genomes, but we could not find any secondary structure around the codon CUG in these genes. Con-variants by the microsurgery method led to the finding that a single methyl moiety of m 1 G at position 37 sidering that the polysemous codon is mediated by a single tRNA, it is unlikely that a polysemous codon occurs under is involved in the leucylation process. In contrast, the tRNA Ser CAG of C.cylindracea, which has A at the same the influences of the neighboring regions in mRNAs. Alternative decoding of a polysemous codon CUG is position, is deprived of such leucine-accepting activity. Himeno and his co-workers noted that three nucleotides possible, assuming that LeuRS is overexpressed under a certain physiological condition. Depending on the of leucine tRNAs were strongly recognized by S.cerevisiae LeuRS using unmodified variants transcribed by T7 RNA increased amount of the LeuRS in cells, incorporation of leucine corresponding to codon CUG may occur fre-polymerase (Soma et al., 1996) . Although the discriminator base, A73, is the strongest recognition site among them, quently, which causes the production of polypeptides with new functions. This possibility should be examined in A35 and G37 in the anticodon loop also play roles as determinants in tRNA. They were able to compare the further experiments. |
The idea of a polysemous codon also differs from the activities of variants mutated at position 37 with A or G using the variants with A at the discriminator position 'near-cognate' concept proposed by Schultz and Yarus (1994) . They claimed that ambiguous decoding may occur which effectively elevates leucylation activity. In our work, we utilized serine tRNA with a modified nucleoside as a consequence of an irregular codon-anticodon interaction induced by the 27-43 base pair at the anticodon and with G at the discriminator position as a substrate for LeuRS, because the T7 transcript of tRNA Ser CAG showed stem of the tRNA, resulting in a genetic code change transition state. The polysemous codon found in our study no activity for leucylation. Our experiments using microsurgery methods indicated that m 1 G is of great importance is caused by the tRNA aminoacylation process of tRNA with codon-anticodon interaction proceeding precisely in in leucylation, despite the fact that the presence of G at the discriminator position is unsuitable for the recognition the conventional manner . Furthermore, since the hypothesis of Schultz and Yarus is based of LeuRS. Some modified nucleotides in tRNA are known to be involved in recoginition of some synthetases (Muramatsu et al., 1988) . Pütz et al. (1994) showed that m 1 G at position 37 of yeast tRNA Asp is one of the negative determinants for arginyl-tRNA synthetase. |
We have also demonstrated that the nucleotide at position 33, where only tRNA Ser CAG uniquely possesses G, modulates the leucine-accepting activity. G33 may prevent tRNA Ser CAG from excessive leucylation, which S.cerevisiae cells, but that the viability of the cells decreased substantially. This finding suggests the polysemous state may be tolerated only when the ambiguous recognizes its cognate leucine tRNA from the 3Ј-side of the anticodon loop, which is afforded by the uridine-turn translation is under a strict constraint. We consider that G33 functions as a negative modulator in the leucylation structure due to U33 ( Figure 6A ). The methyl moiety of m 1 G37 is directly recognized by LeuRS. In the case of tRNA Ser CAG, thereby controlling the relative seryl-to leucyl-tRNA Ser CAG ratio. |
of C.zeylanoides, the anticodon loop distorted by G33 decreases the affinity toward LeuRS, judging from the Several lines of experiment have suggested that U33 is involved in the tRNA function on ribosomes, such as in observation that G33 increased the K m value for leucylation approximately 4-to 5-fold in comparison with that with rigid codon-anticodon interaction, proper GTP hydrolysis of the ternary complex and the efficient translation of prymidine bases at the position ( Figure 6B ). In C.cylindracea, m 1 G is replaced by A, which means that the tRNA termination codons (Bare et al., 1983; Dix et al., 1986) . Indeed, the replacement of G33 by U in C.cylindracea has lost the two major determinants for LeuRS, m 1 G and the discriminator base ( Figure 6C ). Consequently, LeuRS tRNA Ser CAG increased the efficiency of in vitro translation by 2-to 3-fold (data not shown). The negative effect of is unable to recognize tRNA Ser CAG at all, and G33 concomitantly loses its function as a modulator. LeuRS G33 on translation may indicate involvement in some mechanism for decoding the polysemous codon. This is, of course, unable to recognize other serine isoacceptor tRNAs corresponding to universal codons, because they possibility needs to be clarified by further study. Nevertheless, we have shown here that one of the roles of G33 is have modified A at position 37. How did this interaction between LeuRS and the suppression of leucylation, and we consider that the nucleotide at position 33 is not directly involved in tRNA Ser CAG evolve? Candida species utilizing CUG as serine can be classified into two distinct groups: group 1 recognition by LeuRS. On the basis of our observation that no leucylation was detectable in the C.cylindracea contains the species that have tRNA Ser CAG with leucylation activity, and includes C.zeylanoides, C.maltosa and tRNA Ser CAG variants in which G33 was replaced by a pyrimidine base (c-G33U and c-G33C), we speculate that others (see Figure 6B ); group 2, which is represented solely by C.cylindracea, contains species that have tRNA Ser CAG G33 influences the location and/or conformation of m 1 G37, accompanied by the alteration of the anticodon loop without leucylation activity ( Figure 6C ). A plausible evolutionary process is that group 1 would have arisen structure, decreasing the affinity of LeuRS toward tRNA Ser CAG. |
prior to group 2 after the genetic code change, which is speculated on the basis of the following observations. It has been generally considered that reconstructed tRNA does not lose its activity during the several reaction First, the homology between tRNA Ser CAGs in group 1 and its isoacceptor tRNAs for codon UCG is higher than steps needed in the microsurgery method, such as cleavage of the tRNA strand and ligation of tRNA fragments that between the tRNA Ser CAG from C.cylindracea and its isoacceptor . Second, C.cylindracea (Ohyama et al., 1985) . However, a slight reduction of leucylation activity was observed in the control variant, (group 2) possesses high copy numbers of the tRNA Ser CAG genes (~20 copies) on the diploid genome (Suzuki z-G33G, compared with that of the native tRNA ( Figure 3A , right-hand graph), which turned out to result from et al., 1994) , while low copy numbers (two or four copies) are observed for group 1 tRNA Ser CAG genes (Santos the partial deacetylation of 4-acetyl cytidine (ac4C) due to acid treatment of the 5Ј-half fragment (see Materials et al., 1993; Sugiyama et al., 1995; T.Suzuki, personal observations) . Third, the codon CUG is utilized as a major and methods). Nevertheless, it is reasonable to deduce the effect of base replacement on the aminoacylation activity serine codon on several genes in C.cylindracea, such as lipase (Kawaguchi et al., 1989) and chitin synthase by comparing the activities of these reconstructed tRNAs, because the same 5Ј-half fragments were used for all the (unpublished results) , while CUG appears infrequently on the genomes of other species belonging to group 1 (Lloyd manipulated tRNA molecules of C.zeylanoides. |
A plausible mechanism by which LeuRS could recog-and Sharp, 1992; Sugiyama et al., 1995; T.Suzuki, personal observations) . During the course of the change in the nize cognate leucine and serine tRNAs specific for codon CUG is illustrated in Figure 6 . LeuRS contacts and genetic code, the genome should pass through a state group 2 (Ohama et al., 1993) . Fourth, the phylogenetic dextrose) and minimal medium SD [0.67% yeast nitrogen base without tree of these species and relatives constructed by using amino acids (Difco) and 2% dextrose] supplied with 24 mg/ml uracil were used for the cultivation of yeast cells. |
several genes also supports this evolutionary pathway SD-plates with or without uracil were prepared by adding agar at a (manuscript in preparation (Boeke et al., 1984) . |
for codon UCG Pesole et al., 1995) . Thus, the nucleotide at position 37 seems likely to have |
In order to introduce mutation at the 45th codon in the reading frame mutated in the direction modified A→m 1 G- Alternative splicing generates a multiple protein pUTH18 containing an autonomously replicating sequence of C.maltosa (Takagi et al., 1986) and C-HIS5 (Hikiji et al., 1989) were used as sequence from a single gene at the mRNA level. In when the codon appears infrequently, as observed in group was mutated from CTG to CTC, and pCCU (Sugiyama et al., 1995) synthesis caused by a polysemous codon. We speculate instruction manual. The electrified cells were spread on a SD-plate that such ambiguity could have given rise to proteins containing uracil and incubated at 30°C. |
with multiple amino acid sequences in non-house-keeping genes, which may have conferred multifunctionality on |
In vitro aminoacylation assay Seryl-or leucyl-tRNA synthetases were partially purified from C.zeylan-the proteins. Since the C.cylindracea strain was developed oides cells as described previously , both of the industrially for the production of lipase, such multifunc- Large-scale purification of tRNA Ser CAGs from C.zeylanoides and C.cylindracea mmol) and leucine (11.5 MBq/mmol) were from Amersham. 5-fluoroorotic acid monohydrate (5FOA) was from PCR inc. 3Ј-Biotinylated Candida cylindracea cells (3.1 kg) were treated with phenol, from which 150 000 A 260 units of unfractionated tRNA were extracted. Eighty DNA probes were synthesized by Sci. Media, Japan. Synthetic RNA oligomers and a chimeric oligonucleotide composed of DNA and 2Ј-O-thousand A 260 units of tRNA mixture were obtained by DEAE-cellulose chromatography with stepwise elution, which was then applied onto a methyl RNA were synthesized by Genset Co. Ltd. Most of the enzymes used for the microsurgery were from Takara Shuzo (Tokyo, Japan). |
DEAE-Sephadex A-50 column (6ϫ100 cm). Elution was performed with a linear gradient of NaCl from 0.375 to 0.525 M in a buffer Other chemicals were obtained from Wako Chemical Industries. |
consisting of 20 mM Tris-HCl (pH 7.5) and 8 mM MgCl 2 . The fraction as CZE-37 (5ЈGmCmCmCmAmAmUmGmGmAmAmdCdCdTdG-CmAmUmCmCmAmUm3Ј), possessing a cleavage site between posi-rich in tRNA Ser was applied onto a RPC-5 column (1ϫ80 cm) and eluted with a linear gradient of NaCl from 0.4 to 1 M NaCl in a buffer tions 37 and 38 of C.zeylanoides tRNA Ser CAG. Two hundred micrograms of purified tRNA Ser CAG from C.zeylanoides was incubated at 65°C for consisting of 10 mM Tris-HCl (pH 7.5) and 10 mM Mg(OAc) 2 . As a result of these chromatographies, 300 A 260 units of purified tRNA Ser CAG 10 min with 14.4 nmol CZE-37 in a buffer consisting of 40 mM Tris-HCl (pH 7.7), 0.5 mM NaCl, 0.1 mM DTT, 0.0003% BSA and 0.4% were finally obtained. |
One hundred and fifty thousand A 260 units of tRNA from C.zeylanoides glycerol (500 µl), and then annealed at room temperature. Magnesium chloride was added to the mixture up to a final concentration of 4 mM cells (3.7 kg) were fractionated on DEAE-Sepharose fast-flow column (3.5ϫ130 cm) with a linear gradient of NaCl from 0.25 to 0.4 M in a and the reaction was carried out at 30°C for 2 h by the addition of 600 units of RNase H (Takara Shuzo). About 60 µg of the cleaved 3Ј-half buffer consisting of 20 mM Tris-HCl (pH 7.5) and 8 mM MgCl 2 . About 300 A 260 units of C.zeylanoides tRNA Ser CAG were finally obtained by fragment was obtained by purification using 10% PAGE containing 7 M urea. Either of two synthetic oligo-RNAs, pCAGAp or pCAGGp, was further column chromatography with Sepharose 4B in a reverse gradient of ammonium sulfate from 1.7 to 0 M with a buffer consisting of ligated with the same 5Ј-half fragment digested by RNase T1 as the variants mutated at position 33 under the conditions described above. 10 mM NaOAc (pH 4.5), 10 mM MgCl 2 , 6 mM β-mercaptoethanol and 1 mM EDTA. |
The ligated and dephosphorylated 5Ј-half fragments were annealed and ligated with the 3Ј-half fragment digested by RNase H. About 50 µg of each of the two variants from C.zeylanoides mutated at position 37-Construction of tRNA variants with mutation at position 33 The microsurgery procedures were basically carried out according to the m 1 G37A and m 1 G37G-was obtained by the phosphorylation of the 5Јend and purification by 12% PAGE containing 7 M urea. literature (Ohyama et al., 1985 (Ohyama et al., , 1986 . Limited digestion of 4 mg purified tRNA Ser CAG from C.zeylanoides with RNase T1 was performed at 0°C for 30 min in a reaction mixture containing 50 mM Tris-HCl (pH 7.5), Identification of amino acids attached to tRNA Ser CAGs in 100 mM MgCl 2 , 0.5 mg/ml of the tRNA and 25 000 units/ml RNase the cells T1 (Sigma). After phenol extraction, the resulting fragments were treated Identification of aminoacyl-tRNA Ser CAG from Candida cells was carried with 0.1 N HCl at 0°C for 12 h in order to cleave the 2Ј, 3Ј cyclic out by a new method developed recently by us (Suzuki et al., 1996) . phosphate of the 3Ј-end of the fragments formed in the limited digestion, |
The experimental conditions were the same as those reported. To and then the 5Ј-and 3Ј-half fragments were separated by 10% PAGE fish out the aminoacyl-tRNAs, we designed two 3Ј-biotinylated DNA containing 7 M urea (10ϫ10 cm). Four hundred and thirty micrograms probes: 5ЈAGCAAGCTCAATGGATTCTGCGTCC3Ј for C.cylindracea of the 5Ј-half and 520 µg of the 3Ј-half fragments were recovered from tRNA Ser CAG and 5ЈGAAGCCCAATGGAACCTGCATCC3Ј for the gel. The purified 5Ј-half fragment was dephosphorylated with C.zeylanoides tRNA Ser CAG. These probes were immobilized with strepbacterial alkaline phosphatase (Takara Shuzo), and G33 at the 3Ј-end of tavidin agarose (Gibco BRL) as reported previously (Wakita et al., 1994) . the 5Ј-half fragment was removed by oxidation with sodium periodate as described in the literature (Keith and Gilham, 1974) . After dephos- A universal BMV-based RNA recombination system—how to search for general rules in RNA recombination At present, there is no doubt that RNA recombination is one of the major factors responsible for the generation of new RNA viruses and retroviruses. Numerous experimental systems have been created to investigate this complex phenomenon. Consequently, specific RNA structural motifs mediating recombination have been identified in several viruses. Unfortunately, up till now a unified model of genetic RNA recombination has not been formulated, mainly due to difficulties with the direct comparison of data obtained for different RNA-based viruses. To solve this problem, we have attempted to construct a universal system in which the recombination activity of various RNA sequences could be tested. To this end, we have used brome mosaic virus, a model (+)RNA virus of plants, for which the structural requirements of RNA recombination are well defined. The effectiveness of the new homomolecular system has been proven in an experiment involving two RNA sequences derived from the hepatitis C virus genome. In addition, comparison of the data obtained with the homomolecular system with those generated earlier using the heteromolecular one has provided new evidence that the mechanisms of homologous and non-homologous recombination are different and depend on the virus' mode of replication. RNA recombination is a very common phenomenon. It has been observed in all types of viruses using RNA as a carrier of genetic information: in positive-sense, single-stranded RNA viruses (1) (2) (3) (4) , in negative-sense, single-stranded RNA viruses (5, 6) , in double-stranded RNA viruses (7, 8) and in retroviruses (9) (10) (11) . Moreover, it has been shown that RNA recombination enables the exchange of genetic material not only between the same or similar viruses but also between distinctly different viruses (12) . Sometimes it also permits crossovers between viral and host RNA (13) (14) (15) (16) (17) . Taking into account the structure of viral genomic molecules and the location of crossover sites, three basic types of RNA recombination were distinguished: homologous, aberrant homologous and non-homologous (3, 4, 18) . The former two occur between two identical or similar RNAs (or between molecules displaying local homology), while the latter involves two different molecules. Most of the collected data suggest that RNA recombinants are formed according to a copy choice model (4, 18) . A viral replication complex starts nascent RNA strand synthesis on one template, called RNA donor and then switches to another template, called RNA acceptor. Accordingly, two main factors are thought to affect RNA recombination: the structure of recombining molecules and the ability of the viral replicase to switch templates. |
To gain more knowledge of the mechanism of RNA recombination, several model experimental systems have been created. They provided us with some specific data describing homologous and/or non-homologous recombination in particular viruses, e.g. in poliovirus, (19) mouse hepatitis virus (20, 21) , brome mosaic virus (BMV) (4, 22) , turnip crinkle virus (23, 24) or tomato bushy stunt virus (25) . As a result, the involvement of viral replicase proteins in recombination has been demonstrated (26, 27) and a wide spectrum of RNA motifs supporting recombination have been identified (4, 23, (28) (29) (30) . In general, the collected data suggest that there exist two major types of RNA structural elements that induce recombination events: (i) universal ones mediating template switching by different viral replicases, e.g. regions *To whom correspondence should be addressed. Tel: +48 61 8528503; Fax: +48 61 8520532; Email: [email protected] The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact [email protected] of local homology (28, 31) or complementarity (32) (33) (34) (35) and (ii) virus-specific ones, e.g. promoter-like structures (36, 37) . Unfortunately, up till now there has been no in vivo recombination system that could be used to test the recombination activity of any given RNA sequence and consequently to verify the above hypothesis and find some general laws governing the studied process. |
In our studies on genetic RNA recombination we have used the well-characterized in vivo system developed in BMV (30, 33) . BMV is a model (+)RNA virus of plants (38) . Its genome is composed of three segments called RNA1, RNA2 and RNA3. RNA1 and RNA2 encode BMV replicase proteins 1a and 2a, respectively. RNA3 encodes movement (3a) and coat proteins (CP) (38) . All three BMV RNAs possess an almost identical 3 0 -untranslated region (3 0 -UTR). The first BMV-based recombination system was created by Nagy and Bujarski (33) . They constructed a recombinationally active BMV mutant whose genome is composed of wtRNA1, wtRNA2 and modified RNA3 (PN0-RNA3 called the recombination vector, for details see Figure 1 ). Only 3 0 -UTR was modified in PN0-RNA3, while its 5 0 -UTR, intergenic and coding regions were unchanged. Despite the introduced changes, the recombination vector is stable and replicates when used together with wtRNA1 and wtRNA2 to infect plants. It starts to recombine if a recombinationally active sequence (RAS) is introduced just between the CP coding sequence and the modified 3 0 region (into the RAS-cloning site). Non-homologous recombination was observed when a 140-60 nt sequence complementary to RNA1 between positions 2856 and 2992 was inserted into PN0-RNA3 (a sequence from the 3 0 -portion of RNA1 was introduced in antisense orientation) (30, 33) . Interestingly, the same RNA1 fragment inserted in sense Figure 1 . The BMV-based recombination system. White, black and gray boxes represent coding, noncoding and recombinationally active sequences, respectively. The location of the primers (A and B) used for specific RT-PCR amplification of the 3 0 -portion of BMV RNA3 (parental or recombinant) is indicated by arrows. (A) BMV genome. The BMV genome consists of three RNA segments: RNA1, RNA2 and RNA3. All three BMV RNAs share an almost identical 3 0 -noncoding region with a tRNA-like structure at the very end. (B) Recombination vector. The PN0-RNA3 vector is a wtRNA3 derivative with a modified 3 0 -noncoding end [(for details see ref. (33) ]. The latter includes (i) the RAS cloning site, (ii) a 197 nt sequence derived from the 3 0 -noncoding region of cowpea chlorotic mottle virus RNA3 (marked as CCMV), (iii) the sequence of wtRNA3 between nt 7 and 200 (counting from the 3 0 end-marked as the region B) and (iv) the last 236 nt from the 3 0 end of BMV wtRNA1 (marked as A). (C) Non-homologous recombination. Non-homologous recombination was observed if an 140 nt sequence, called RAS1as (shown in A), complementary to wtRNA1 between positions 2856 and 2992 was inserted into the PN0-RNA3 vector. The presence of the RAS1as sequence in RNA3 derivative (called Mag1-RNA3) allows local RNA1-RNA3 hybridization that mediates frequent non-homologous crossovers. It is thought that polymerase starts nascent strand synthesis on the 3 0 end of RNA1 and then switches to RNA3 within a local double-stranded region. (D) Non-homologous recombinant. Non-homologous recombination repairs Mag1-RNA3 by replacing its modified 3 0 end with the 3 0 -noncoding fragment coming from RNA1. orientation did not support homologous crossovers (33) . Non-homologous recombination repaired the RNA3 vector by replacing its highly modified 3 0 end with 3 0 -UTR derived from RNA1. The resultant recombinants replicated and accumulated better than the parental RNA3 molecule, and so the latter was out competed from the infected cells. The above system is extremely efficient, since it employs selection pressure to support the accumulation of RNA3 recombinants. Because RAS is placed in two different segments of the BMV genome, we have proposed to name this system heteromolecular. |
Unfortunately, Nagy and Bujarski's BMV-based recombination system has one serious limitation. It was designed in such a manner that viable RNA3 recombinants can easily form only if a sequence derived from the 3 0 -portion of RNA1 or RNA2 is used as a RAS. Consequently, the heteromolecular system could not be applied for testing the recombination capacity of various RNA motifs. Olsthoorn et al. (39) attempted to solve that problem by inserting examined sequences into the 3 0 -noncoding region of BMV RNA2 and RNA3. This system was not further developed, since any changes in RNA2, which encodes BMV polymerase, could strongly affect the studied process. |
Here, we describe a new BMV-based recombination system. It has been constructed in such a way that both tested RASes are placed in the same segment of the BMV genome (in the modified RNA3 molecule); therefore, we have called this system homomolecular. To prove the usefulness of the homomolecular system, we have employed it to examine the recombination activity of sequences derived from the hepatitis C virus (HCV) genome. The examined sequences have been inserted into RNA3 as direct or inverted repeats. This demonstrated that the 101 nt hypervariable region of HCV efficiently supports both homologous and non-homologous crossovers, while the most conservative 98 nt portion of HCV's 3 0 -UTR induces only non-homologous recombination events. Moreover, a direct comparison of the hetero-and homomolecular systems revealed crucial differences between the mechanisms of homologous and non-homologous recombination. The former involves preferentially two different segments of the BMV genome and the latter occurs more easily between the same genomic RNAs. |
Plasmids pB1TP3, pB2TP5 and pPN0-RNA3 containing fulllength cDNA of BMV RNA1, RNA2 and modified RNA3 (recombination vector), respectively, were the generous gift from J. J. Bujarski (Northern Illinois University, DeKalb, IL). |
Restriction enzymes (EcoRI, SpeI and XbaI) T7 RNA polymerase, RNasine, RQ DNase RNase free, MMLV-reverse transcriptase, Taq polymerase and pUC19 cloning vector were from Promega. |
The following primers were used for the construction of pMatNH-pMatH-, pMatNH-HVR-, pMatH-HVR-, pMatNH-X-, pMatH-X-RNA3: |
Plasmids pMag1-and pMagH-RNA3 contain full-length cDNA of the RNA3 vector carrying the recombinationally active sequence RAS1 inserted in antisense or sense orientation, respectively. Both plasmids were constructed in the same way: pPN0-RNA3 was linearized with SpeI endonuclease and ligated with SpeI cut RAS1 cDNA. Then plasmids carrying RAS1 in antisense (pMag1-RNA3) and sense (pMagH-RNA3) orientation were identified (30) . |
To prepare pMatNH-RNA3 and pMatH-RNA3 plasmids (containing full-length cDNA of MatNH-RNA3 and MatH-RNA3), pMag1-RNA3 and pMagH-RNA3 were digested with KpnI and EcoRI endonucleases. Then, the deleted fragment was replaced with a KpnI-EcoRI cut 379 nt cDNA fragment corresponding to the BMV RNA1 3 0 end (containing the entire 3 0 -UTR and RAS1). The latter were obtained by PCR involving primers 1, 2 and pB1TP3 as a template. |
To construct pMat0-RNA3, i.e. a plasmid containing cDNA of the universal recombination vector Mat0-RNA3, the following modifications were introduced into pMatNH-RNA3. First, it was digested with SpeI endonuclease and religated. This way 5 0 RAS1as was removed and the 5 0 RAS cloning site (including only one restriction site SpeI) was created. Next, the plasmid was cut with KpnI and EcoRI to remove RNA1 3 0 -UTR and 3 0 RAS1s. Instead, a 295 nt fragment of RNA1 3 0 end (between positions 2940 and 3234) followed by the 3 0 RAS cloning site (including KpnI, MluI, BamHI and EcoRV restriction sites) was ligated into pMatNH-RNA3. The inserted sequence was obtained by PCR using primers 2, 3 and pB1TP3 as a template and digested with KpnI and EcoRI, prior to ligation. |
To test the recombination activity of HCV-derived sequences (hypervariable region 1, abbreviated HVR and sequence X, abbreviated X) cDNA of the corresponding fragments of the virus' genome was obtained by RT-PCR method (40, 41) and cloned into the pUC19 vector. Then, both tested sequences were amplified by PCR with primers introducing an SpeI restriction site. Primers 4, 5 and primers 6, 7 were used to obtain HVR and X cDNA, respectively. PCR products and pMat0-RNA3 were digested with SpeI and ligated. Then pMat0-RNA3 derivatives bearing HVR and X in sense and antisense orientation were identified. HVR and X were amplified again by PCR involving primers introducing MluI and EcoRV restriction sites (primers 8, 9 and 10, 11 to amplify HVR and X, respectively). PCR products were cut with MluI and EcoRV and ligated into the 5 0 RAS cloning site of previously identified pMat0-RNA3 derivatives (carrying HVR and X in sense and antisense orientation). As a result four plasmids were obtained: (i) pMatH-HVR-RNA3-containing cDNA of MatH-HVR-RNA3 in which two HVRs were inserted in sense orientation; (ii) pMatNH-HVR-RNA3-containing cDNA of MatNH-HVR-RNA3 possessing two HVRs, 5 0 HVR in antisense and 3 0 HVR in sense orientation; (iii) pMatH-X-RNA3containing cDNA of MatH-X-RNA3 in which two Xes are in sense orientation; (iv) pMatNH-X-RNA3-containing cDNA of MatNH-X-RNA3 carrying two Xes, 5 0 X in sense and 3 0 X in antisense orientation. Their structure was confirmed by sequencing. |
To test the recombination activity of the BMV mutants, the previously described procedure was applied (30, 33) . Infectious BMV genomic RNAs were obtained by in vitro transcription for which EcoRI linearized plasmids pB1TP3, pB2TP5, pMag1-RNA3, pMagH-RNA3, pMatNH-RNA3, pMatH-RNA3, pMat0-RNA3, pMatH-HVR-RNA3, pMatH-HVR-RNA3, pMatHN-X-RNA3 and pMatH-X-RNA3 were used. Five-leaf C.quinoa plants (local lesion host for BMV) were mechanically inoculated with mixtures containing BMV RNA1, RNA2 and one of the RNA3 derivatives. Two weeks post-inoculation, the number of lesions developed on each inoculated leaf was counted to establish the infectivity of the tested BMV mutant. Then, individual local lesions were excised and total RNA was extracted separately from every lesion. The isolated RNA was subjected to RT-PCR involving primer A (the first strand primer) and primer B (the second strand primer) specific for RNA3 3 0 fragment amplification (the region where recombination crossovers occur). As a control identical reactions involving either parental RNA3 transcript (positive control) or water (negative control) were carried out. RT-PCR products were analyzed by electrophoresis in a 1.5% agarose gel. The formation of 800 nt or shorter 500 nt products indicated that parental or recombinant RNA3 accumulated in the analyzed lesion, respectively. Next, RT-PCR products were cloned into the pUC19 vector and sequenced to determine the location of recombinant junction sites. Finally, the presence of recombinants in the selected local lesions was additionally confirmed by northern blot analysis. |
The main question that we had to answer during our studies was how to design a vector that could be used for examining the recombination activity of any RNA sequences in vivo. As a result, the idea arose to construct a BMV-based homomolecular recombination system. In such a system, both tested sequences are supposed to be present within the same segment of the BMV genome (either in RNA1, RNA2 or RNA3). Thus, a new vector should possess two separately located RAS cloning sites, be replicable and stable during infection. It has to be capable of generating viable recombinants, which have selective advantage over parental RNA molecules. Consequently, recombinants ought to be able to out compete the vector with inserted RASes. Assuming that RNA recombination occurs according to a copy choice mechanism, we decided that RNA3, being dispensable for BMV replication, is the best candidate for a new vector. Any changes in RNA1 and RNA2, which encode BMV replicase proteins, would strongly affect the studied process. The next important question was whether the location of RASes within the same (homomolecular system) or within two different segments of the BMV genome (heteromolecular system) influences the recombination activity of the examined RNA sequence. |
To address both issues, we decided to construct a so-called mixed system, homo-and heteromolecular at the same time. |
To this end two RNA3 molecules, prototypes of a new vector carrying two RASes, were prepared. To obtain them we used PN0-RNA3, described earlier, and a well-characterized recombinationally active sequence from BMV RNA1 (RAS1, see Figure 1 ). The 137 nt RAS1 corresponding to RNA1 between positions 2856 and 2992 was inserted into the PN0-RNA3 RAS cloning site, in antisense (RAS1as) and sense (RAS1s) orientations ( Figure 2 ). As a result, we obtained Mag1-and MagH-RNA3 derivatives (30) . Then the 356 nt portion of Mag1-and MagH-RNA3 3 0 end was replaced with a 379 nt sequence representing the wtRNA1 3 0 end (fragment encompassing the entire 3 0 -UTR and RAS1s sequence) ( Figure 2 ). In addition, a marker mutation (called DXho) was introduced within the RNA1-derived fragment to make it distinguishable from an analogous region present in wtRNA1. To this end, the XhoI restriction site (2988-2994) was disrupted by a 4 nt insertion (GATC) between C-2991 and G-2992. Resultant RNA3 derivatives, called MatNH-and MatH-RNA3, have unchanged 5 0 -UTR, intergenic and coding regions and a highly modified 3 0 -UTR. The latter includes 3 0 -UTR coming from wtRNA1 and two RAS1 sequences (3 0 RAS1 and 5 0 RAS1) separated by a 338 nt spacer (sequence CCMV and B1). In MatNH-RNA3, 3 0 RAS1 is located in sense and 5 0 RAS1 in antisense orientation, while in MatH-RNA3 both RAS1 sequences are in sense orientation ( Figure 2 ). |
Having these two RNA3 derivatives, we were able to construct two variants of the mixed system: one for homologous (MatH-BMV mutant) and the other for non-homologous (MatNH-BMV mutant) recombination studies. The MatH-BMV genome is composed of wtRNA1, wtRNA2 and MatH-RNA3 and the MatNH-BMV genome of wtRNA1, wtRNA2 and MatNH-RNA3 (Table 1 ). In genomes of both BMV mutants three copies of RAS1 are present: two in the RNA3 derivative (RAS1s-RAS1s or RAS1as-RAS1s in MatH-and MatNH-RNA3, respectively) and one in wtRNA1 (RAS1s). Thus, in the mixed systems two identical RASes or RAS and its complementary counterpart were capable of supporting, respectively, homologous or non-homologous (heteroduplex-mediated) recombination between the same or between different BMV genomic RNAs. As a result, we could directly compare homo-and heteromolecular recombination systems in one in vivo experiment and examine whether our presumptions concerning the new recombination vector are correct. |
Homologous recombination in the mixed homo-heteromolecular system Earlier, Nagy and Bujarski (33) demonstrated that the 66 nt portion of RAS1 did not support homologous recombination in heteromolecular system. We repeated this experiment using MH-BMV mutants. Recombinants also did not form although the entire RAS1 sequence was present in wtRNA1 and MagH-RNA3 molecules (Table 1 and Figure 3 ). To test RAS1 activity Figure 1 , white, black and gray boxes represent coding, noncoding and recombinationally active sequences, respectively, in sense (RAS1s) or antisense (RAS1as) orientation, dashed line squares encompass replaced parts of wtRNA1 and modified RNA3 molecules. Mag1-and MagH-RNA3 were created by inserting the RAS1 sequence from wtRNA1 into the RAS cloning site of PN0-RNA3 in antisense (Mag1-RNA3) or sense (MagH-RNA3) orientation. To construct MatNH-RNA3 and MatH-RNA3, the 356 nt very 3 0 end of Mag1-RNA3 or MagH-RNA3 (between KpnI and EcoRI sites) was replaced with a 379 nt portion of the wtRNA1 3 0 end (fragment containing the entire 3 0 -UTR and RAS1). Thus, both constructs contain two copies of RAS1 sequence-MatNH-RNA3 includes 5 0 RAS1as and 3 0 RAS1s, while MatH-RNA3 comprises 5 0 RAS1s and 3 0 RAS1s. Furthermore, a marker mutation DXho (marked as a white dot), removing the XhoI restriction site, was introduced into the 3 0 end of MatNH-and MatH-RNA3, to make it distinguishable from an analogous region present in wtRNA1. in the mixed homologous recombination system, a previously used, well-established procedure was applied (30, 33) . C.quinoa plants (local lesion host for BMV) were inoculated with a mixture containing in vitro transcribed wtRNA1, wtRNA2 and MatH-RNA3. After 2 weeks, when infection symptoms were well developed, the number of lesions formed on every inoculated leaf was counted to determine the infectivity of the MatH-BMV mutant. Individual local lesions were excised and total RNA was extracted separately from each of them. Then, the 3 0 -portion of RNA3 progeny accumulating in examined lesions was selectively amplified by RT-PCR involving RNA3 specific primers A and B (for their location see Figure 1 ). Reaction products were separated in a 1.5% agarose gel and their length was determined. The formation of an 800 or 400-500 nt DNA fragment indicated that the lesion contained parental or recombinant RNA3, respectively. In this way, we were able to determine the number of lesions in which a viable RNA3 recombinant was generated. The presence of recombinants in analyzed lesions was confirmed by standard northern blot hybridization. DNA fragments obtained during selective RT-PCR amplification of RNA3 were cloned and sequenced. Finally, the results obtained with our new mixed homologous recombination system were compared with analogous data previously got using the heteromolecular system (33) (see Table 1 and Figure 3 ). The data presented in Table 1 indicate that the exchange of MagH-RNA3 (carrying a single RAS1) into MatH-RNA3 (bearing two RAS1 sequences) did not affect the infectivity of the BMV mutants. The average numbers of lesions appearing on the leaves inoculated with MH-and MatH-BMV were similar: 18 and 17, respectively. Interestingly, although RAS1 did not support homologous crossovers in the heteromolecular system represented by MH-BMV, it was very active in the mixed system. About 85% of the local lesions developed during MatH-BMV infection accumulated the RNA3 recombinant instead of parental MatH-RNA3. In all of them, one RAS1 and a spacer were deleted. This indicates that crossovers occurred either within 3 0 end 5 0 RAS1 present in MatH-RNA3 (inter-or intramolecular crossovers) or within RAS1 and 5 0 RAS1 located in wtRNA1 and MatH-RNA3, respectively. Recombinant junction sites were placed in identical regions; therefore, their location could not be precisely established. |
The data presented till now also could not answer which molecules, exclusively MatH-RNA3 or wtRNA1 and MatH-RNA3, participated in recombination. In the heteromolecular system, only RAS1-mediated crossovers between wtRNA1 and MagH-RNA3 were permitted. The situation seems to be more complicated in the mixed homologous system where three copies of RAS1 are present, all in sense orientation: two of them in MatH-RNA3 (3 0 RAS1 and 5 0 RAS1) and one in wtRNA1. Consequently, RAS1-mediated homologous recombination may happen according to four different scenarios ( Figure 3 ). It can engage MatH-RNA3 only and occur as intra-or intermolecular process or it can involve wtRNA1 and MatH-RNA3. In the latter case, recombination can be mediated by RAS1 present in wtRNA1 and either 5 0 -or 3 0 RAS1 located in MatH-RNA3. |
To learn according to which scenario homologous recombination occurred, we checked whether mutation DXho introduced into MatH-RNA3 (just behind 3 0 RAS1) is still present in RNA3 recombinants. In this way, we were able to determine if their 3 0 -UTR was derived from MatH-RNA3 or wtRNA1 molecules. The undertaken analysis revealed that the mutation was present in 20% of recombinants. This result suggested that homologous crossovers preferentially occur between wtRNA1 and MatH-RNA3. |
However, there are other explanations why DXho was absent in a large fraction of recombinants. It is possible that the mutation was removed either from MatH-RNA3, due to homologous recombination between its 3 0 RAS1 and wtRNA1, or from the RNA3 recombinant (carrying a single copy of RAS1) because it could also have recombined with wtRNA1. To examine the first possibility, progeny RNA3 extracted from the local lesions accumulating MatH-RNA3 (lesions in which recombinant was not generated) was analyzed. About 800 nt RT-PCR products obtained during selective amplification of RNA3's 3 0 -portion were cloned and sequenced. In all of 20 analyzed clones DXho was present. To test the second possibility, a full-length cDNA clone of RNA3 recombinant containing DXho (RNA3-DXhoR) was obtained. It was inserted into the pUC19 vector under the T7 polymerase promoter. The resultant plasmid named pRNA3-DXhoR was used after linearization to produce an infectious RNA3-DXhoR molecule by in vitro transcription. Then, RNA3-DXhoR was used together with wtRNA1 and wtRNA2 to inoculate C.quinoa plants. After 2 weeks, total RNA was extracted from individual lesions and a 3 0 -portion of the progeny RNA3 was amplified by RT-PCR. Obtained products were cloned and sequenced. As described previously, DXho was present in all of the analyzed 20 clones. These two experiments proved that homologous recombination between either 3 0 RAS1 of MatH-RNA3 or RAS1 present in RNA3 recombinant and wtRNA1 does not occur frequently enough to explain why most recombinants lack DXho. Altogether, these results supported our initial thesis that DXho was removed from 80% of homologous recombinants, since most of the crossovers occurred within 5 0 RAS1 from MatH-RNA3 and RAS1 from wtRNA1. |
Earlier we showed that RAS1 can effectively support nonhomologous recombination if inserted into PN0-RNA3 in antisense orientation (30, 33) . The heteromolecular system used in our experiment was composed of wtRNA1, wtRNA2 and Mag1-RNA3 (M1-BMV mutant). Crossovers occurred within the local double-stranded region (local heteroduplex), which wtRNA1 and Mag1-RNA3 were capable of forming. In order to test RAS1 activity in the mixed non-homologous recombination system, C.quinoa plants were inoculated with the MatNH-BMV mutant (its genome is composed of wtRNA1, wtRNA2 and MatNH-RNA3). Two weeks later progeny RNA3 were analyzed as described above. The number of lesions developed on each leaf was counted and total RNA was extracted from individual local lesions. After RT-PCR amplification, the 3 0 -portion of BMV RNA3 accumulating in each lesion was analyzed in an agarose gel, cloned and sequenced. The presence of recombinants was confirmed by a standard Northern blot. The results obtained were compared with analogous data we had got using the heteromolecular system (30) (Table 1 and Figure 4) . |
As described previously, we observed that the exchange of Mag1-RNA3 (with a single RAS1as sequence) for MatNH-RNA3 (with two sequences: RAS1as and RAS1s) did not influence the infectivity of the BMV mutants. The average numbers of lesions developed on each leaf during infection with M1-BMV and MatNH-BMV were 19 and 18, respectively. There was also no difference between the recombination activity of M1-BMV and MatNH-BMV. RAS-1 (in fact RAS1s and RAS1as) supported non-homologous recombination . Non-homologous recombination in the heteromolecular and mixed homo-heteromolecular systems. As in Figure 3 , light and thicker lines represent viral genomic RNAs and nascent recombinant RNA, respectively. WtRNA1 is red (the recombinationally active sequence RAS1s which it contains is additionally boxed), wtRNA2 is black and modified RNA3 is blue. When inserted into RNA3 the wtRNA1-derived RAS1s sequence is also shown as a red box, whereas the complementary RAS1as sequence is shown as a green box. The portion of the RNA3 recombinant synthesized on wtRNA1 is red, the portion synthesized on the RAS1as sequence is green and the fragment synthesized on RNA3 is blue. The black dot symbolizes the DXho mutation present in MatNH-RNA3. RF, recombination frequency. Dashed line squares encompass the region identical in both systems [the region where crossovers occur, shown in detail in (E)]. (A) Heteromolecular system (M1-BMV). A detailed description of the M1-BMV genome is presented in Figure 1 . All nascent RNA3 molecules accumulating in M1-BMV infected plants were recombinants (RF = 100%). (B) Mixed system (MatNH-BMV). Three copies of RAS1 are located in the MatNH-BMV genome, two in MatNH-RNA3 (3 0 RAS1s and 5 0 RAS1as) and one in wtRNA1 (RAS1s). The recombination frequency observed during infection with MatNH-BMV was 95%. Of the identified recombinants, 10% were without the DXho marker, and 90% with the DXho marker. (C) Putative scenario of RAS1s/RAS1as-mediated non-homologous recombination in the heteromolecular system. Owing to the presence of RAS1s and RAS1as sequences in wtRNA1 and Mag1-RNA3, respectively, they are capable of forming a local double-stranded structure supporting non-homologous crossovers (for details see Figure 1 ). (D) Putative scenarios of RAS1s/RAS1as-mediated non-homologous recombination in the mixed system. The presence of 3 0 RAS1s and 5 0 RAS1as sequences in MatH-RNA3 and RAS1s in wtRNA1 creates several opportunities of heteroduplex formation: between wtRNA1 RAS1s and MatNH-RNA3 5 0 RAS1as (intermolecular), between two pairs of RAS1s/RAS1as sequences of two different MatNH-RNA3 molecules (intermolecular) and between 5 0 RAS1as and 3 0 RAS1s of the same MatNH-RNA3 molecule (intramolecular). Recombinants are generated if BMV replicase initiates nascent strand synthesis at the 3 0 end of wtRNA1 or MatNH-RNA3 and then switches to MatNH-RNA3 within the local double-stranded region. (E) Recombinants identified during M1-and MatNH-BMV infection. Boxed fragments of recombining wtRNA1/Mag1-RNA3, wtRNA1/MatNH-RNA3 and MatNH-RNA3/MatNH-RNA3 molecules are practically identical in both systems (except for the DXho mutation present in MatNH-RNA3). The locations of the junction sites are marked with arrows and letters. The numbers indicate how many recombinants of the same type were isolated. Upper case letters refer to M1-BMV, lower case letters refer to MatNH-BMV. equally in both systems. Recombination events occurred with a similar frequency (100 and 95% for M1-and MatNH-BMV, respectively) and recombinant junction sites were located within the same region of the heteroduplexes, which recombining molecules were capable of forming. |
In the heteromolecular system, only one type of heteroduplex supporting non-homologous crossovers could possibly form: between wtRNA1 and Mag1-RNA3. In the mixed system, recombining molecules were capable of forming three types of heteroduplexes: (i) intermolecular, between 5 0 RAS1as from MatNH-RNA3 and RAS1s from wtRNA1, (ii) intermolecular, between 5 0 RAS1as and 3 0 RAS1s located in two MatHN-RNA3 molecules and (iii) intramolecular, between 5 0 RAS1as and 3 0 RAS1s located in the same MatNH-RNA3 molecule (Figure 4) . To determine the molecules that participated in non-homologous recombination, the RT-PCR amplified 3 0 -portions of RNA3 were checked for DXho. It was present in 90% of recombinants. This result clearly showed that non-homologous crossovers almost always involve one (intramolecular recombination) or two (intermolecular recombination) MatNH-RNA3 molecules. |
The results presented above indicated that the homomolecular system can provide new interesting data concerning the mechanism of RNA recombination, especially if it could be used for testing the recombination activity of RNA sequences derived from other RNA-based viruses. Consequently, we attempted to construct a universal BMV RNA3-based recombination vector called Mat0-RNA3 (for details see Materials and Methods and Figure 5A ). In Mat0-RNA3, as in the former PN0-RNA3 vector, only 3 0 -UTR was modified. It is composed of the 295 nt very 3 0 end of RNA1 followed by the 3 0 RAS cloning site, a 338 nt spacer and the 5 0 RAS cloning site. |
To determine the infectivity and stability of the new vector, C.quinoa plants were inoculated with a mixture containing wtRNA1, wtRNA2 and Mat0-RNA3 (Mat0-BMV mutant). After 2 weeks, the number of lesions developed on inoculated leaves was counted and then standard analysis of progeny RNA was carried out. Twenty separate lesions were excised, the total RNA was isolated and used for the selective RT-PCR amplification of the 3 0 -portion of progeny RNA3. The length of RT-PCR products was established by electrophoresis in a 1.5% agarose gel. In addition, reaction products were cloned and sequenced. This demonstrated that the Mat0-BMV mutant is infectious (usually 20 lesions were developed on each leaf, see Table 2 ) and Mat0-RNA3 is stable during the whole period of infection and thus it can be used as a recombination vector. |
In order to demonstrate that Mat0-RNA3 can be used as an effective tool in recombination studies, we applied it to examine the recombination activity of two specific sequences derived from the HCV genome. The first, 101 nt sequence is placed within the 5 0 -portion of the HCV genome (within the fragment encoding E2 protein) and is named HVR (40, 42) . The second, called the sequence X (X) constitutes a 98 nt 3 0 end of HCV genomic RNA. It has been shown that X represents the most conservative fragment of HCV genome (43) . Both sequences were obtained by a standard RT-PCR method involving viral RNA isolated from the blood of infected patients as a template (40, 41) . Amplified fragments were inserted into the 5 0 -cloning site of Mat0-RNA3 in two different orientations (sense and antisense), then only in sense orientation into the 3 0 -cloning site (for details see Materials and Methods). As a result, four different Mat0-RNA3 derivatives were generated: (i) MatH-HVR-RNA3, possessing two copies of HVR in sense orientation (3 0 and 5 0 HVRs); (ii) MatH-X-RNA3, with two copies of X in sense orientation (3 0 and 5 0 Xs); (iii) MatNH-HVR-RNA3, with two copies of HVR, the 3 0 -copy in sense and the 5 0 in antisense orientation (3 0 HVRs and 5 0 HVRas); (iv) MatNH-X-RNA3, with two copies of X located in different orientation (3 0 Xs and 5 0 Xas) ( Figure 5B ). The former two were applied to test HVR's and X's ability to support homologous crossovers while the latter two to examine Xs/Xas' and HVRs/HVRas' capacity to induce nonhomologous, heteroduplex-mediated recombination. Unlike previously tested mutants (MatNH-and MatH-BMV), in MatH-HVR-, MatNH-HVR-, MatH-X-and MatNH-X-BMV, the examined sequences were present only in the recombination vector. They were absent in the two other genomic RNAs, so that recombination crossovers could involve only RNA3 molecules. |
To determine the recombination activity of HCV-derived sequences, C.quinoa plants were inoculated with four BMV mutants: MatH-HVR-BMV, MatNH-HVR-BMV, MatH-X-BMV and MatNH-X-BMV. Their genomes were composed of wtRNA1, wtRNA2 and one of the newly generated Mat0-RNA3 derivatives (either MatH-HVR-, MatNH-HVR-, MatH-X-or MatNH-X-RNA3) ( Table 2) . After 2 weeks, the standard procedure of BMV RNA3 progeny analysis was applied. The number of lesions developed during each infection was counted. The 3 0 -portion of progeny RNA3 was amplified by the RT-PCR method. The length of RT-PCR products was established (by electrophoresis in a 1.5% agarose gel), then they were cloned and sequenced. |
We found that BMV mutants carrying HVRs/HVRs and HVRs/HVRas sequences are as infectious as Mat0-BMV; usually they developed 14-18 lesions on each inoculated leaf. The two others, MatH-X-and MatNH-X-BMV mutants, are visibly less infectious and developed 3-5 and 4-8 lesions/leaf, respectively. Despite differences in their infectivity, BMV mutants carrying 3 0 HVRs and 5 0 HVRas as well as 3 0 Xs and 5 0 Xas supported non-homologous, heteroduplex-mediated crossovers very efficiently. An RNA3 recombinant was generated in 100 and 90% of lesions developed during infection with MatNH-HVR-and MatNH-X-BMV, respectively. Recombinant junction sites were located within the left portion of the local double-stranded region that could potentially be formed either by HVRs and HVRas or by Xs and Xas. As a result, both sequences supporting non-homologous crossovers were almost entirely deleted, together with the whole spacer ( Figure 5D and E) . |
Interestingly, homologous recombinants were generated only during infection involving MatH-HVR-BMV. Fiftyfive percent of analyzed lesions contained the RNA3 recombinant. In all sequenced recombinants, one HVR and the spacer were deleted ( Figure 5C ). Their 3 0 -UTR was composed of a 295 nt RNA1-derived sequence and HVRs followed by To test the recombination activity of HCV-derived sequences X and HVR the following Mat0-RNA3 derivatives were prepared: MatH-X-RNA3-with two copies of X in sense orientation (3 0 and 5 0 Xs), MatNH-X-RNA3-with two copies of X located in different orientation (3 0 Xs and 5 0 Xas), MatH-HVR-RNA3-containing two copies of HVR in sense orientation (3 0 and 5 0 HVRs) and MatNH-HVR-RNA3-with two copies of HVR, 3 0 -copy in sense and 5 0 in antisense orientation (3 0 HVRs and 5 0 HVRas). MatH-X-and MatH-HVR-RNA3 were applied to test X's and HVR's ability to support homologous crossovers while MatNH-X-and MatNH-HVR-RNA3 were applied to examine X's and HVR's competence to induce non-homologous, heteroduplex-mediated recombination. RF, recombination frequency observed during infection involving each RNA3 derivative. (C). Homologous recombinants generated during infection involving MatH-HVR-BMV. RNA3 recombinants were only formed during MatH-HVR-BMV infection. In all of them, one recombinationally active sequence HVRs and a spacer were deleted and their 3 0 -UTR was composed of RNA1 derived sequence and HVRs followed by the CP coding region. Because crossovers occurred within identical regions, the location of recombinant junction sites could not be precisely The presence of homologous and non-homologous recombinants in the examined lesions was always confirmed not only by RT-PCR but also by northern blot analysis ( Figure 6 ). This revealed the same tendency as that observed earlier using the heteromolecular system (30, 33) . BMV accumulated to a very low level in lesions containing parental RNA3 (original molecules with duplicated sequences- Figure 6A , lane 5 and Figure 6B , lane 2). However, this changed in lesions where a recombinant was generated ( Figure 6A , lanes 1-4 and Figure 6B, lanes 1 and 3) . |
Earlier it was shown that the BMV-based heteromolecular system can be used as an effective tool for investigating the mechanism of homologous and non-homologous recombination, although it is only suitable for testing the recombination activity of the sequences derived from the 3 0 -portion of BMV RNA1 or RNA2 (30, 33) . To overcome this problem, we attempted to create a new universal recombination in vivo system. The collected data suggested that a BMV RNA3-based homomolecular system would best fulfill our expectations. To confirm the correctness of the above presumption, to determine the efficacy of the homomolecular system and to compare it with the heteromolecular one, two mixed homoheteromolecular systems were constructed-one to study homologous (MatH-BMV) and the other non-homologous (MatNH-BMV) recombination. |
The mixed systems were prepared in such a way that two identical or two complementary sequences were capable of supporting homologous or non-homologous crossovers, respectively, either between molecules representing the same segment of the BMV genome (modified RNA3) or between molecules representing two different segments of the BMV genome (wtRNA1 and modified RNA3). Experiments involving MatH-and MatNH-BMV showed that recombination can occur both in homo-and heteromolecular systems and proved that the former should be at least as effective as the previously utilized heteromolecular one. Interestingly, the RAS1s sequence did not support homologous recombination during infection with MH-BMV (heteromolecular system) and it was Infectivity was defined as the average number of lesions per leaf. b Recombination frequency was defined as the ratio between the number of lesions that developed recombinants and the total number of analyzed lesions. quite active in the mixed system. This clearly demonstrates that not only primary and secondary structure but also the location of RAS within the viral genome affects its ability to mediate homologous crossovers. The undertaken experiments also revealed that homologous recombination occurs more often between two different RNAs (RNA1 and RNA3), while non-homologous recombination usually involves molecules representing the same segment of the BMV genome (RNA3). The obtained results constitute yet another piece of evidence that the mechanisms of homologous and nonhomologous recombination are different. The same conclusion was reached by us earlier while studying the influence of specific mutations in BMV-encoded protein 2a (26, 27) . We identified among other the mutation in the 2a protein, which inhibits non-homologous crossovers without affecting the frequency of homologous ones. At present, it is difficult to judge at which stage of the recombination process the observed differences occur. One can only suppose that the structural requirements of transfer of the replicase-nascent strand complex from the donor to the acceptor molecule must be different in homologous and nonhomologous recombination. In the case of the former, a basic factor facilitating this process is complementarity between the acceptor and the nascent strand. Consequently, there is no necessity for the replication complex to be stable during homologous crossovers (22) . Replicase can leave the donor template alone or together with a nascent strand. Then, the 3 0 end of the newly synthesized RNA molecule can function as a guide; it can find a complementary sequence in the acceptor RNA, hybridize and serve as a primer allowing viral replicase to reinitiate RNA synthesis. In non-homologous heteroduplexmediated recombination, a factor enhancing crossover seems to be the interaction between the donor and the acceptor (the formation of a local double-stranded region) (30, 33) . Considering that BMV genomic RNAs are copied within spherules (44) , intramolecular hybridization between RAS1s and RAS1as, located in MatNH-RNA3, is much more likely. Thus, the results presented here indicate that the way the virus replicates can strongly affect the recombination process. However, further detailed studies are necessary in order to explain this phenomenon. |
Based on results obtained using the heteromolecular (30, 33) and mixed systems, we constructed a new homomolecular one. Its most crucial element is the Mat0-RNA3 vector, into which both tested sequences can be introduced. In order to show the usefulness of this system, we employed it to test the recombination activity of two distinctly different sequences deriving from the genome of an RNA virus not related to BMV. Our choice was the 98 nt sequence X and an HVR both from HCV genome. There are many reasons as to why the two sequences can be deemed drastically different. The most important of them are (i) sequence X is placed in a noncoding region, while HVR in a coding one, (ii) sequence X is the least variable and HVR the most variable fragment of the HCV genome (42, 43, 45) , (iii) unlike to HVR, sequence X possesses a very stable and well-defined secondary and tertiary structure (42, 45) . |
We ascertained that the introduction of HVR into the Mat0-RNA3 vector (in sense/sense and antisense/sense orientation) does not influence BMV infectivity. The latter was, however, reduced if HVR was replaced with sequence X. We found that HVR supports homologous recombination and HVRs and its complementary counterpart HVRas mediate non-homologous crossovers. The frequency of homologous recombination amounted to 55% and of non-homologous to 100%. Sequence Xs did not support homologous crossovers but Xs and complementary sequence Xas were capable of inducing non-homologous ones (their frequency reaching 90%). |
The obtained results testify that the local double-stranded structures induce non-homologous recombination crossovers very efficiently. This may reflect the capacity of RNA viruses to remove inverted repeats from their genomes. Viruses lacking such ability would be an easy target for double-stranded RNA-induced RNA silencing, which is known as the plant antiviral mechanism (46) . Moreover, the data presented suggest that sequence X, which adopts a very compact and stable structure (45), is not able to mediate homologous recombination. It occurs efficiently within AU-rich HVR sequences whose structure is more labile and dynamic (42) . Earlier research on homologous recombination in BMV led to similar conclusions. It was shown that homologous recombination occurs effectively in AU-rich regions (47) and is not observed within highly structured 3 0 -and 5 0 -UTR (48) . These observations concur with the proposed mechanism of homologous RNA recombination (22) . It assumes that AU-rich regions facilitate the detachment of the polymerase-nascent strand complex from donor RNA. On the other hand, it is thought that the stability of RNA structure makes the hybridization of the nascent strand and/or replicase to the acceptor difficult. |
Currently, it is becoming increasingly clear that RNA recombination plays a very complex role in a virus' life cycle. Not only does it permit the exchange of genetic material between viruses (3, 4, 22) , frequent homologous crossovers between molecules representing the same segment of the virus genome also stabilize genetic information (48) . Moreover, here we showed that homologous and non-homologous recombination might control the organization of the virus genome by removing direct or inverted repeats, which affect the virus' ability to replicate or accumulate in the infected cells. Interestingly, we observed that complementary sequences are more effectively deleted than homologous ones. It seems that some of the latter can prevail in the viral genome probably due to their compact stable structure that prevents recombination events. |
Altogether, the data presented here prove that the newly created BMV-based homomolecular recombination system can be used to examine in vivo recombination activity of various RNA sequences derived from the genomes of related or unrelated viruses. However, there are other factors which, in addition to RNA structure, can affect the course of the studied process. Specific properties of the viral replicase and the host proteins that are necessary for recombination events can be of equally great importance. Therefore, there is a need to create similar universal recombination systems in other viruses. We believe that these systems will be very helpful in finding some general rules in RNA recombination and will provide us with knowledge which is indispensable to understand how new RNA viruses or retroviruses are generated. Neutrophil elastase, an acid-independent serine protease, facilitates reovirus uncoating and infection in U937 promonocyte cells BACKGROUND: Mammalian reoviruses naturally infect their hosts through the enteric and respiratory tracts. During enteric infections, proteolysis of the reovirus outer capsid protein σ3 is mediated by pancreatic serine proteases. In contrast, the proteases critical for reovirus replication in the lung are unknown. Neutrophil elastase (NE) is an acid-independent, inflammatory serine protease predominantly expressed by neutrophils. In addition to its normal role in microbial defense, aberrant expression of NE has been implicated in the pathology of acute respiratory distress syndrome (ARDS). Because reovirus replication in rodent lungs causes ARDS-like symptoms and induces an infiltration of neutrophils, we investigated the capacity of NE to promote reovirus virion uncoating. RESULTS: The human promonocyte cell line U937 expresses NE. Treatment of U937 cells with the broad-spectrum cysteine-protease inhibitor E64 [trans-epoxysuccinyl-L-leucylamido-(4-guanidino)butane] and with agents that increase vesicular pH did not inhibit reovirus replication. Even when these inhibitors were used in combination, reovirus replicated to significant yields, indicating that an acid-independent non-cysteine protease was capable of mediating reovirus uncoating in U937 cell cultures. To identify the protease(s) responsible, U937 cells were treated with phorbol 12-myristate 13-acetate (PMA), an agent that induces cellular differentiation and results in decreased expression of acid-independent serine proteases, including NE and cathepsin (Cat) G. In the presence of E64, reovirus did not replicate efficiently in PMA-treated cells. To directly assess the role of NE in reovirus infection of U937 cells, we examined viral growth in the presence of N-Ala-Ala-Pro-Val chloromethylketone, a NE-specific inhibitor. Reovirus replication in the presence of E64 was significantly reduced by treatment of cells with the NE inhibitor. Incubation of virions with purified NE resulted in the generation of infectious subviron particles that did not require additional intracellular proteolysis. CONCLUSION: Our findings reveal that NE can facilitate reovirus infection. The fact that it does so in the presence of agents that raise vesicular pH supports a model in which the requirement for acidic pH during infection reflects the conditions required for optimal protease activity. The capacity of reovirus to exploit NE may impact viral replication in the lung and other tissues during natural infections. Mammalian reoviruses are the prototypic members of the Reoviridae family, which also includes the pathogenic rotaviruses, coltiviruses, seadornaviruses and orbiviruses. These viruses share elements of their replication cycle as well as structural features, including a non-enveloped multi-layered capsid that surrounds a segmented dsRNA genome. In humans, mammalian reoviruses are typically associated with mild and self-limiting enteric and respiratory infections. However, studies in neonatal mice reveal that reoviruses can spread to distant tissue sites in immunocompromised hosts (reviewed in [1] ). The factors that determine reovirus cellular host range are poorly understood. Because reovirus attaches to cells through interactions with broadly expressed receptors, one or more subsequent steps in the viral life cycle must help to regulate host range and pathogenesis. Our recent studies suggest that one such step is proteolysis of the capsid protein σ3 [2, 3] . |
In cell culture, the first step in infection is attachment to cellular receptors through interactions with the viral protein σ1 [4, 5] . σ1 interacts with two known receptors: sialic acid and junctional adhesion molecule 1 [6] [7] [8] . Following binding, virions are internalized by receptor-mediated endocytosis [9] . Endocytosis is an essential step in the viral life cycle under standard infection conditions [10] . Within the endosomal and/or lysosomal compartment, proteases convert virions into particles that resemble in vitro-generated intermediate subvirion particles (ISVPs) [10] [11] [12] [13] [14] . These uncoating intermediates, typically prepared using chymotrypsin or trypsin, lack σ3 and have a cleaved form of µ1. Studies using ISVPs and ISVPs recoated with recombinant outer capsid proteins reveal that σ3 plays a key role in regulating reovirus cell entry by interacting with, protecting, and controlling the conformational status of the underlying penetration protein µ1 [15] [16] [17] [18] . In cells that cannot efficiently mediate σ3 degradation during uncoating, reovirus infection is slow or blocked; these cells can be productively infected by particles that lack σ3 [2] . In vitro, ISVP-like particles can be generated by a variety of proteases in addition to chymotrypsin and trypsin, including proteinase K, thermolysin, endoproteinase lys-C, Cat L, Cat B and Cat S [3, [19] [20] [21] . |
Recent work has provided insight into the cellular determinants of reovirus uncoating. In murine fibroblasts, where reovirus entry has been best studied, the cysteine proteases Cat L, and to a lesser extent Cat B, are required for σ3 removal, whereas the aspartyl protease Cat D is not [14, [21] [22] [23] [24] [25] . Virion disassembly in murine fibroblasts also requires acidic pH [10, 26, 27] . Recently, we demonstrated that reovirus uncoating in the macrophage-like cell line P388D is mediated by the acid-independent lysosomal cysteine protease Cat S [3] . This finding revealed that in different cell types, distinct proteases can facilitate reovirus uncoating. Our results suggested a model in which infection in some cells is acid-dependent because the proteases that mediate σ3 removal in those cells require acidic pH for maximal activity. Thus, in fibroblasts or other cells in which the acid-dependent proteases Cat L and Cat B mediate σ3 removal, infection is acid-dependent [21, 23, 28] , whereas in Cat S-expressing cells it is not [3] , because Cat S maintains its activity at neutral pH [29] . Insight from the analysis of reovirus cell entry facilitated the recent discovery that activation of the Ebola virus glycoprotein also depends on the activity of the acid-dependent endosomal proteases Cat B and Cat L [30] . |
The role that specific intracellular and extracellular proteases play in regulating reovirus tropism, spread, and disease in animals is largely unknown, except in the murine intestinal tract where pancreatic serine proteases have been shown to mediate σ3 removal [31, 32] . Reovirus also naturally infects hosts via the respiratory tract [33] [34] [35] . One protease with well-described effects in the respiratory tract is elastase 2 (GenBank NM_001972), an inflammatory serine protease of the chymotrypsin family, which is predominantly expressed by neutrophils [36] . NE plays a prominent role in wound repair [37] [38] [39] and in controlling microbial infections [38] [39] [40] . NE expression can also promote pathogenesis; it has been implicated in smokeinduced emphysema [41] , respiratory syncytial viral bronchiolitis [42] and in the respiratory syndrome ARDS [4] . The fact that reovirus replication in the rodent lung causes an influx of neutrophils [35, 43] and that reovirus infection can recapitulate ARDS [44] , led us to ask whether NE could mediate productive reovirus uncoating. We investigated reovirus infection in the monocyte-like cell line U937, because it is known to express NE [45] . Experiments described in this report demonstrate that reovirus infection in U937 cells does not require cysteine protease activity and is not blocked in the presence of agents that raise vesicular pH. Studies using protease inhibitors suggest that, in the absence of cysteine protease activity, NE is largely responsible for productive infection of U937 cells. NE can directly mediate σ3 removal from reovirus virions; the resultant particles are infectious and do not require additional intracellular proteolysis. Our data raise the possibility that NE is involved in reovirus replication in the respiratory tract. |
Analysis of viral replication in L929 and U937 cells treated with E64 Figure 1 Analysis of viral replication in L929 and U937 cells treated with E64. A. 3 × 10 6 L929 and U937 cells were untreated (-; black) or treated (+; grey) with 300 µM E64 for 3 h or 3 d. Cysteine protease activity was assessed using the fluorogenic substrate Z-Phe-Arg-MCA (Sigma) and plotted in arbitrary units. Activity levels in treated cells were so low (in L939 cells, 254 units at 3 h and 231 units at 3 d; in U937 cells, 200 units at 3 h and 115 units at 3 days) that they cannot be visualized on this graph. B. L929 (L; black bars) and U937 (U; grey bars) cells were treated with 300 µM E64 for 3 h prior to infection. Cells were then infected with reovirus strain Lang virions or ISVPs at an MOI of 3. Infectious virus present at 3 d p.i. was determined by plaque assay on L929 cell monolayers. Each time point represents the mean (+/-SD) derived from three independent samples. |
Virion ISVP we first established conditions under which lysosomal cysteine protease activity was inhibited. Cells were treated with 300 µM E64, a broad-spectrum cysteine protease inhibitor [46] , and protease activity was assessed using the Cat L and Cat B-specific fluorogenic substrate Z-Phe-Arg-MCA. We analyzed enzyme activity at two time points: first after 3 h of treatment, because we typically pre-treat cells with inhibitors for 3 h prior to infection, and second at 3 d, the time point at which viral yield would be quantified. As shown in Fig. 1A , treatment with 300 µM E64 completely abolished cysteine protease activity in U937 cells. Consistent with our previous findings [3] , E64 also completely blocked cysteine protease activity in L929 cells. Raw values are provided, to illustrate the relative difference in Cat L/B enzyme activity levels between U937 cells and L929 fibroblasts. In the absence of inhibitor, Cat L and B activity was significantly lower in U937 cells than in L929 cells. This may be a consequence of high expression in U937 cells of cystatin F, an intracellular cysteine protease inhibitor with specificity for Cat L and papain [47] . |
Next, we compared reovirus replication in E64-treated U937 and L929 cells. Cells were pre-treated for 3 h and infected with Lang virions or ISVPs at a multiplicity of infection (MOI) of 3. The results of a representative experiment are shown in Fig. 1B . In the absence of E64, both L929 and U937 cells supported reovirus replication, consistent with the fact that these cells express Cat L. As expected, E64 blocked virion infection of L929 cells; however, viral yields in E64-treated U937 cells were only slightly reduced relative to untreated cells. ISVPs, which lack capsid protein σ3, replicated efficiently in treated cells, indicating that 300 µM E64 was not toxic to either cell type. These results demonstrate that productive infection of U937 cells by Lang virions does not require the activity of E64-sensitive, papain-like cysteine proteases. |
Acidic pH is required for productive reovirus infection of murine L929 fibroblasts [10, 27] , in which the aciddependent proteases Cat L and Cat B mediate uncoating [21, 23] . Serine proteases, including NE, and metalloproteases function over a broader pH range. Therefore, to gain insight into the nature of the protease(s) that can promote reovirus uncoating in U937 cells, we investigated the requirements for acidic pH. L929 and U937 cells were left untreated or pre-treated with E64 in the presence or absence of bafilomycin A1 (Baf) or NH 4 Cl. These latter agents raise vesicular pH by blocking the vacuolar H + -ATPase pump or by acting as a weak base, respectively [48] [49] [50] . After pre-treatment, cells were infected with Lang virions at an MOI of 3 and viral yields were determined at 3 days post infection (d p.i.). A representative experiment is shown in Fig. 2 . Treatment with either Baf or NH 4 Cl did not inhibit viral replication in U937 cells; yields reached 2.9 and 2.7 logs, respectively. Furthermore, these agents had little effect on viral replication in U937 cells even when the cells were also treated with E64 to inhibit cysteine protease activity. In contrast, Baf or NH 4 Cl alone completely blocked reovirus replication in L929 cells, consistent with the requirement for Cat L/B-mediated σ3 removal in these cells. Given that reovirus uncoating is an essential step in the viral life cycle [10] , these findings revealed that a non-cysteine protease that functions at neutral pH can facilitate this step in U937 cells. |
Treatment of the promonocytic U937 cells with phorbol ester derivatives results in their differentiation into macrophage-like cells [51, 52] . This differentiation is characterized by several major phenotypic changes, including increases in expression of urokinase plasminogen activator receptors, upregulation of collagenase activity and a significant decrease in the expression of NE and Cat G [51, 52] . We predicted, therefore, that PMA treatment might decrease the capacity of reovirus virions to replicate in U937 cells when cysteine proteases were inhibited. To confirm that there was a significant decrease in NE expression in U937 cells differentiated with PMA, U937 cells were treated with 150 nM PMA for 72 h and expression of NE was analyzed by immunoblotting. As shown in Fig. 3A , NE was expressed in untreated U937 cells, but its expression was dramatically reduced following PMAinduced differentiation. |
To examine the effect of U937 cell differentiation on reovirus infection, PMA-treated and untreated U937 cells were left untreated or were treated with E64 for 3 h and infected with Lang virions or ISVPs at an MOI of 3. Yields were measured at 3 d p.i. and the results of a typical experiment are shown in Fig. 3B . In the absence of E64, PMAtreated U937 cells were permissive to infection by virions. PMA treatment only decreased yields by ~0.5 log relative to untreated cells. In contrast, when PMA-differentiated U937 cells were treated with E64 to inhibit cysteine protease activity, they no longer supported productive infection by Lang virions. Because these results could be explained if E64 was toxic to PMA-treated U937 cells, we examined the replication of ISVPs. In the presence of E64, ISVPs replicated to high yields in both undifferentiated and differentiated U937 cells. Since PMA-induced differentiation of U937 cells caused a substantial decrease in NE expression, these results are consistent with the hypothesis that NE or another similarly regulated neutral protease facilitates productive reovirus infection in promonocytic (pre-differentiated) U937 cells. |
Effects of agents that raise vesicular pH on reovirus replication in U937 and L929 cells A. |
Analysis of reovirus replication in U937 cells differentiated with PMA Figure 3 Analysis of reovirus replication in U937 cells differentiated with PMA. A. Lysates generated from 10 5 U937 cells that were untreated (-) or treated with 150 nM PMA for 72 h were resolved on SDS-12% polyacrylamide gels and electrophoretically transferred to a nitrocellulose filter. The filter was subsequently incubated with a polyclonal goat antibody against human NE (1:400) (Santa Cruz Biotechnology). The filter was washed and incubated with a secondary anti-goat antibody conjugated to horseradish peroxidase (1:5000) (Santa Cruz Biotechnology). Protein bands were detected using reagents that generate a chemiluminescent signal (Amersham). B. U937 cells that were undifferentiated (-; black bars) or differentiated (PMA; grey bars) with 150 nM of PMA for 72 h were left untreated (-) or were treated with 300 µM E64. Following pre-treatment with the protease inhibitor, cells were infected with Lang virions or ISVPs at an MOI of 3. Viral yield was quantified at 3 d p.i. as described in the legend to Fig. 1B. A. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.