diff
stringlengths
262
553k
is_single_chunk
bool
2 classes
is_single_function
bool
1 class
buggy_function
stringlengths
20
391k
fixed_function
stringlengths
0
392k
diff --git a/src/petrglad/javarpc/util/Sockets.java b/src/petrglad/javarpc/util/Sockets.java index 626e7a7..61d8932 100644 --- a/src/petrglad/javarpc/util/Sockets.java +++ b/src/petrglad/javarpc/util/Sockets.java @@ -1,53 +1,53 @@ package petrglad.javarpc.util; import java.io.IOException; import java.net.ServerSocket; import java.net.Socket; import java.net.UnknownHostException; import org.apache.log4j.Logger; public final class Sockets { static final Logger LOG = Logger.getLogger(Sockets.class); private Sockets() { } public static Socket openClientSocket(final String host, final int port) { try { return new Socket(host, port); } catch (UnknownHostException e) { - throw new RuntimeException("Host is not found " + host + ":" + port); + throw new RuntimeException("Host is not found " + host + ":" + port, e); } catch (IOException e) { - throw new RuntimeException("Could not open connection to " + host); + throw new RuntimeException("Could not open connection to " + host, e); } } /** * @return Stop condition for spoolers. */ public static Flag getIsSocketOpen(final Socket socket) { return new Flag() { @Override public Boolean get() { return !socket.isClosed(); } }; } public static void closeSocket(final ServerSocket socket) { try { socket.close(); } catch (IOException e) { LOG.error("Error closing server socket " + socket, e); } } public static void closeSocket(final Socket socket) { try { socket.close(); } catch (IOException e) { LOG.error("Error closing socket " + socket, e); } } }
false
true
public static Socket openClientSocket(final String host, final int port) { try { return new Socket(host, port); } catch (UnknownHostException e) { throw new RuntimeException("Host is not found " + host + ":" + port); } catch (IOException e) { throw new RuntimeException("Could not open connection to " + host); } }
public static Socket openClientSocket(final String host, final int port) { try { return new Socket(host, port); } catch (UnknownHostException e) { throw new RuntimeException("Host is not found " + host + ":" + port, e); } catch (IOException e) { throw new RuntimeException("Could not open connection to " + host, e); } }
diff --git a/HSRBuddy/src/ch/hsr/hsrbuddy/activity/map/MapActivity.java b/HSRBuddy/src/ch/hsr/hsrbuddy/activity/map/MapActivity.java index a70d51a..90917b3 100644 --- a/HSRBuddy/src/ch/hsr/hsrbuddy/activity/map/MapActivity.java +++ b/HSRBuddy/src/ch/hsr/hsrbuddy/activity/map/MapActivity.java @@ -1,72 +1,69 @@ package ch.hsr.hsrbuddy.activity.map; import android.app.Activity; import android.content.Intent; import android.graphics.drawable.Drawable; import android.os.Bundle; import android.view.Menu; import android.view.MenuItem; import ch.hsr.hsrbuddy.R; import ch.hsr.hsrbuddy.activity.SettingsActivity; import ch.hsr.hsrbuddy.view.ImageMap; import ch.hsr.hsrbuddy.view.ImageMap.OnImageMapClickedHandler; public class MapActivity extends Activity { ImageMap mImageMap; Drawable hsrmap; OnImageMapClickedHandler handler = new ImageMap.OnImageMapClickedHandler() { public void onImageMapClicked(int id) { changeMap(id); } public void onBubbleClicked(int id) { } }; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_map); mImageMap = (ImageMap) findViewById(R.id.map); mImageMap.addOnImageMapClickedHandler(handler); } private void changeMap(int id){ Intent intent = new Intent(this, MapActivityDetail.class); Integer buildingId = 0; switch (id) { case R.id.building1: - buildingId = R.drawable.schulgebaeude_og; - break; - case R.id.building2: - buildingId = R.drawable.laborgebaeude_eg; + buildingId = R.drawable.geb1; break; case R.id.building3: - buildingId = R.drawable.hoersaalgebaeude_eg; - break; - case R.id.building4: - buildingId = R.drawable.verwaltungsgebaeude_og; + buildingId = R.drawable.geb3; break; case R.id.building5: - buildingId = R.drawable.foyergebaeude_eg; + buildingId = R.drawable.geb5; break; + case R.id.building6: + buildingId = R.drawable.geb6; + break; } intent.putExtra("imageId", buildingId); startActivity(intent); } @Override public boolean onCreateOptionsMenu(Menu menu) { getMenuInflater().inflate(R.menu.activity_map, menu); return true; } @Override public boolean onOptionsItemSelected(MenuItem item) { switch (item.getItemId()) { case R.id.menu_settings: startActivity(new Intent(this, SettingsActivity.class)); return true; default: return super.onOptionsItemSelected(item); } } }
false
true
private void changeMap(int id){ Intent intent = new Intent(this, MapActivityDetail.class); Integer buildingId = 0; switch (id) { case R.id.building1: buildingId = R.drawable.schulgebaeude_og; break; case R.id.building2: buildingId = R.drawable.laborgebaeude_eg; break; case R.id.building3: buildingId = R.drawable.hoersaalgebaeude_eg; break; case R.id.building4: buildingId = R.drawable.verwaltungsgebaeude_og; break; case R.id.building5: buildingId = R.drawable.foyergebaeude_eg; break; } intent.putExtra("imageId", buildingId); startActivity(intent); }
private void changeMap(int id){ Intent intent = new Intent(this, MapActivityDetail.class); Integer buildingId = 0; switch (id) { case R.id.building1: buildingId = R.drawable.geb1; break; case R.id.building3: buildingId = R.drawable.geb3; break; case R.id.building5: buildingId = R.drawable.geb5; break; case R.id.building6: buildingId = R.drawable.geb6; break; } intent.putExtra("imageId", buildingId); startActivity(intent); }
diff --git a/bundles/org.eclipse.test.performance.ui/src/org/eclipse/test/performance/ui/ScenarioStatusTable.java b/bundles/org.eclipse.test.performance.ui/src/org/eclipse/test/performance/ui/ScenarioStatusTable.java index 327c93c..76ab08f 100644 --- a/bundles/org.eclipse.test.performance.ui/src/org/eclipse/test/performance/ui/ScenarioStatusTable.java +++ b/bundles/org.eclipse.test.performance.ui/src/org/eclipse/test/performance/ui/ScenarioStatusTable.java @@ -1,302 +1,302 @@ /******************************************************************************* * Copyright (c) 2005, 2007 IBM Corporation and others. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/epl-v10.html * * Contributors: * IBM Corporation - initial API and implementation *******************************************************************************/ package org.eclipse.test.performance.ui; import java.io.PrintStream; import java.util.ArrayList; import java.util.Hashtable; import java.util.StringTokenizer; import org.eclipse.test.internal.performance.PerformanceTestPlugin; import org.eclipse.test.internal.performance.data.Dim; import org.eclipse.test.internal.performance.db.DB; import org.eclipse.test.internal.performance.db.Scenario; import org.eclipse.test.internal.performance.db.SummaryEntry; import org.eclipse.test.internal.performance.db.TimeSeries; import org.eclipse.test.internal.performance.db.Variations; import org.eclipse.test.performance.Dimension; public class ScenarioStatusTable { private Hashtable configMaps=null; private Variations variations; private String scenarioPattern; private ArrayList configNames=new ArrayList(); private Hashtable scenarioComments; private SummaryEntry[] fingerprintEntries; private final String baseline; private class ScenarioStatus{ Hashtable statusMap; String name, shortName; Hashtable configStatus; Hashtable resultsMap; boolean hasSlowDownExplanation=false; boolean fingerprint = false; boolean hasBaseline = true; public ScenarioStatus(String scenarioName){ name = scenarioName; statusMap = new Hashtable(); configStatus = new Hashtable(); resultsMap = new Hashtable(); } } /** * Creates an HTML table of red x/green check for a scenario for each * configuration. * * @param variations * @param scenarioPattern * @param configDescriptors */ public ScenarioStatusTable(Variations variations,String scenarioPattern,Hashtable configDescriptors,Hashtable scenarioComments, SummaryEntry[] fpSummaries, String baseline){ configMaps=configDescriptors; this.variations=variations; this.scenarioPattern=scenarioPattern; this.scenarioComments=scenarioComments; this.baseline= baseline; this.fingerprintEntries = fpSummaries; } /** * Prints the HTML representation of scenario status table into the given stream. */ public void print(PrintStream stream, boolean filter) { String OS="config"; Scenario[] scenarios= DB.queryScenarios(variations, scenarioPattern, OS, null); if (scenarios != null && scenarios.length > 0) { ArrayList scenarioStatusList=new ArrayList(); for (int i= 0; i < scenarios.length; i++) { Scenario scenario= scenarios[i]; String scenarioName=scenario.getScenarioName(); if (filter && !Utils.matchPattern(scenarioName, scenarioPattern)) continue; // returns the config names. Making assumption that indices in // the configs array map to the indices of the failure messages. String[] configs=scenario.getTimeSeriesLabels(); String[] failureMessages= scenario.getFailureMessages(); ScenarioStatus scenarioStatus=new ScenarioStatus(scenarioName); scenarioStatus.fingerprint = Utils.hasSummary(this.fingerprintEntries, scenarioName); String scenarioComment= (String)scenarioComments.get(scenarioName); if (scenarioComment != null) scenarioStatus.hasSlowDownExplanation= true; int confsLength = configs.length; for (int j=0; j<confsLength; j++){ if (!configNames.contains(configs[j])) configNames.add(configs[j]); // Compute confidence level and store it in scenario status Variations v = (Variations) variations.clone(); v.put(PerformanceTestPlugin.CONFIG, configs[j]); // double[] resultStats = Utils.resultStats(v, scenarioName, baseline, configs[j]); String current = (String) v.get(PerformanceTestPlugin.BUILD); Dim significanceDimension = (Dim) Dimension.ELAPSED_PROCESS; Scenario newScenario= DB.getScenarioSeries(scenarioName, v, PerformanceTestPlugin.BUILD, baseline, current, new Dim[] { significanceDimension }); String[] timeSeriesLabels= newScenario.getTimeSeriesLabels(); TimeSeries timeSeries = newScenario.getTimeSeries(significanceDimension); boolean hasBaseline = timeSeriesLabels.length == 2 && timeSeriesLabels[0].equals(baseline); double[] resultStats = Utils.resultsStatistics(timeSeries); if (resultStats == null) continue; if (resultStats != null && resultStats[1] < 0 && scenarioStatus.hasBaseline) scenarioStatus.hasBaseline = false; - int confidenceLevel = Utils.confidenceLevel(resultStats); - scenarioStatus.configStatus.put(configs[j], new Integer(confidenceLevel)); // Store failure message in scenario status + int confidenceLevel = Utils.confidenceLevel(resultStats); boolean hasScenarioFailure = failureMessages[j] != null && failureMessages[j].indexOf(configs[j]) != -1; // ensure correct failure message relates to config StringBuffer buffer = new StringBuffer(); if (hasScenarioFailure) { buffer.append(failureMessages[j]); if (scenarioStatus.hasSlowDownExplanation) { buffer.append(" - Explanation comment: "); buffer.append(scenarioComment); } confidenceLevel |= Utils.DEV; } + scenarioStatus.configStatus.put(configs[j], new Integer(confidenceLevel)); scenarioStatus.statusMap.put(configs[j], buffer.toString()); // Store text for numbers in scenario status String text = Utils.failureMessage(resultStats, false); scenarioStatus.resultsMap.put(configs[j], text); // Store scenario short name in scenario status (for table column) if (scenarioStatus.shortName == null) { if (hasBaseline) { // baseline is OK scenarioStatus.shortName = Utils.getScenarioShortName(scenarioName, -1); } else { StringBuffer shortName = new StringBuffer("*"); shortName.append(Utils.getScenarioShortName(scenarioName, -1)); shortName.append(" <small>(vs.&nbsp;"); shortName.append(timeSeriesLabels[0]); shortName.append(")</small>"); scenarioStatus.shortName = shortName.toString(); } } // Store scenario status if (!scenarioStatusList.contains(scenarioStatus)) { scenarioStatusList.add(scenarioStatus); } } } String label=null; stream.println("<br><h4>Scenario Status</h4>"); stream.println("The following table gives a complete but compact view of performance results for the component.<br>"); stream.println("Each line of the table shows the results for one scenario on all machines.<br><br>"); stream.println("The name of the scenario is in <b>bold</b> when its results are also displayed in the fingerprints<br>"); stream.println("and starts with an '*' when the scenario has no results in the last baseline run.<br><br>"); stream.println("Here are information displayed for each test (ie. in each cell):"); stream.println("<ul>"); stream.println("<li>an icon showing whether the test fails or passes and whether it's reliable or not.<br>"); stream.println("The legend for this icon is:"); stream.println("<ul>"); stream.print("<li>Green (<img src=\""); stream.print(Utils.OK_IMAGE); stream.print("\">): mark a <b>successful result</b>, which means this test has neither significant performance regression nor significant standard error</li>"); stream.print("<li>Red (<img src=\""); stream.print(Utils.FAIL_IMAGE); stream.println("\">): mark a <b>failing result</b>, which means this test shows a significant performance regression (more than 10%)</li>"); stream.print("<li>Gray (<img src=\""); stream.print(Utils.FAIL_IMAGE_EXPLAINED); stream.println("\">): mark a <b>failing result</b> (see above) with a comment explaining this degradation.</li>"); stream.print("<li>Yellow (<img src=\""); stream.print(Utils.FAIL_IMAGE_WARN); stream.print("\"> or <img src=\""); stream.print(Utils.OK_IMAGE_WARN); stream.print("\">): mark a <b>failing or successful result</b> with a significant standard error (more than "); stream.print(Utils.STANDARD_ERROR_THRESHOLD_STRING); stream.println(")</li>"); stream.print("<li>Black (<img src=\""); stream.print(Utils.UNKNOWN_IMAGE); stream.print("\">): mark an <b>undefined result</b>, which means that deviation on this test is not a number (<code>NaN</code>) or is infinite (happens when the reference value is equals to 0!)</li>"); stream.println("<li>\"n/a\": mark a test for with <b>no</b> performance results</li>"); stream.println("</ul></li>"); stream.println("<li>the value of the deviation from the baseline as a percentage (ie. formula is: <code>(build_test_time - baseline_test_time) / baseline_test_time</code>)</li>"); stream.println("<li>the value of the standard error of this deviation as a percentage (ie. formula is: <code>sqrt(build_test_stddev^2 / N + baseline_test_stddev^2 / N) / baseline_test_time</code>)<br>"); stream.println("When test only has one measure, the standard error cannot be computed and is replaced with a '<font color=\"#CCCC00\">[n/a]</font>'.</li>"); stream.println("</ul>"); stream.println("<u>Hints</u>:<ul>"); stream.println("<li>fly over image of failing tests to see the complete error message</li>"); stream.println("<li>to look at the complete and detailed test results, click on its image</li>"); stream.println("</ul>"); stream.println(); stream.println("<table border=\"1\">"); stream.println("<tr>"); stream.print("<td><h4>All "); stream.print(scenarios.length); stream.println(" scenarios</h4></td>"); for (int i= 0; i < configNames.size(); i++){ label = configNames.get(i).toString(); String columnTitle = label; if (configMaps!=null) { Utils.ConfigDescriptor configDescriptor= (Utils.ConfigDescriptor)configMaps.get(label); if (configDescriptor != null) { int idx = configDescriptor.description.indexOf('('); if (idx < 0) { columnTitle = configDescriptor.description; } else { // first line StringTokenizer tokenizer = new StringTokenizer(configDescriptor.description.substring(0, idx).trim(), " "); StringBuffer buffer = new StringBuffer(tokenizer.nextToken()); while (tokenizer.hasMoreTokens()) { buffer.append("&nbsp;"); buffer.append(tokenizer.nextToken()); } buffer.append(' '); // second line tokenizer = new StringTokenizer(configDescriptor.description.substring(idx).trim(), " "); buffer.append(tokenizer.nextToken()); while (tokenizer.hasMoreTokens()) { buffer.append("&nbsp;"); buffer.append(tokenizer.nextToken()); } columnTitle = buffer.toString(); } } } stream.print("<td><h5>"); stream.print(columnTitle); stream.println("</h5>"); } // counter for js class Id's int jsIdCount=0; for (int j= 0; j < scenarioStatusList.size(); j++) { ScenarioStatus status=(ScenarioStatus)scenarioStatusList.get(j); stream.println("<tr>"); stream.print("<td>"); if (status.fingerprint) stream.print("<b>"); if (!status.hasBaseline) stream.print("*"); // stream.print(status.name.substring(status.name.indexOf(".",status.name.indexOf(".test")+1)+1)); stream.print(status.shortName); if (!status.hasBaseline) stream.print("</i>"); if (status.fingerprint) stream.print("</b>"); stream.println(); for (int i=0;i<configNames.size();i++){ String configName=configNames.get(i).toString(); String aUrl=configName; if (status.statusMap.containsKey(configName)){ String message = (String) status.statusMap.get(configName); int confidence = ((Integer) status.configStatus.get(configName)).intValue(); String image = Utils.getImage(confidence, status.hasSlowDownExplanation); stream.print("<td><a "); if ((confidence & Utils.DEV) == 0 || (confidence & Utils.NAN) != 0 || message.length() == 0){ // write deviation with error in table when test pass stream.print("href=\""); stream.print(aUrl); stream.print('/'); stream.print(status.name.replace('#', '.').replace(':', '_').replace('\\', '_')); stream.println(".html\">"); stream.print("<img hspace=\"10\" border=\"0\" src=\""); stream.print(image); stream.println("\"/></a>"); } else { // create message with tooltip text including deviation with error plus failure message jsIdCount+=1; stream.print("class=\"tooltipSource\" onMouseover=\"show_element('toolTip"); stream.print(jsIdCount); stream.print("')\" onMouseout=\"hide_element('toolTip"); stream.print(jsIdCount); stream.print("')\" \nhref=\""); stream.print(aUrl); stream.print('/'); stream.print(status.name.replace('#', '.').replace(':', '_').replace('\\', '_')); stream.println(".html\">"); stream.print("<img hspace=\"10\" border=\"0\" src=\""); stream.print(image); stream.println("\"/>"); stream.print("<span class=\"hidden_tooltip\" id=\"toolTip"); stream.print(jsIdCount); stream.print("\">"); stream.print(message); stream.println("</span></a>"); } String result = (String) status.resultsMap.get(configName); stream.println(result); }else{ stream.println("<td> n/a"); } } stream.flush(); } stream.println("</table>"); } } }
false
true
public void print(PrintStream stream, boolean filter) { String OS="config"; Scenario[] scenarios= DB.queryScenarios(variations, scenarioPattern, OS, null); if (scenarios != null && scenarios.length > 0) { ArrayList scenarioStatusList=new ArrayList(); for (int i= 0; i < scenarios.length; i++) { Scenario scenario= scenarios[i]; String scenarioName=scenario.getScenarioName(); if (filter && !Utils.matchPattern(scenarioName, scenarioPattern)) continue; // returns the config names. Making assumption that indices in // the configs array map to the indices of the failure messages. String[] configs=scenario.getTimeSeriesLabels(); String[] failureMessages= scenario.getFailureMessages(); ScenarioStatus scenarioStatus=new ScenarioStatus(scenarioName); scenarioStatus.fingerprint = Utils.hasSummary(this.fingerprintEntries, scenarioName); String scenarioComment= (String)scenarioComments.get(scenarioName); if (scenarioComment != null) scenarioStatus.hasSlowDownExplanation= true; int confsLength = configs.length; for (int j=0; j<confsLength; j++){ if (!configNames.contains(configs[j])) configNames.add(configs[j]); // Compute confidence level and store it in scenario status Variations v = (Variations) variations.clone(); v.put(PerformanceTestPlugin.CONFIG, configs[j]); // double[] resultStats = Utils.resultStats(v, scenarioName, baseline, configs[j]); String current = (String) v.get(PerformanceTestPlugin.BUILD); Dim significanceDimension = (Dim) Dimension.ELAPSED_PROCESS; Scenario newScenario= DB.getScenarioSeries(scenarioName, v, PerformanceTestPlugin.BUILD, baseline, current, new Dim[] { significanceDimension }); String[] timeSeriesLabels= newScenario.getTimeSeriesLabels(); TimeSeries timeSeries = newScenario.getTimeSeries(significanceDimension); boolean hasBaseline = timeSeriesLabels.length == 2 && timeSeriesLabels[0].equals(baseline); double[] resultStats = Utils.resultsStatistics(timeSeries); if (resultStats == null) continue; if (resultStats != null && resultStats[1] < 0 && scenarioStatus.hasBaseline) scenarioStatus.hasBaseline = false; int confidenceLevel = Utils.confidenceLevel(resultStats); scenarioStatus.configStatus.put(configs[j], new Integer(confidenceLevel)); // Store failure message in scenario status boolean hasScenarioFailure = failureMessages[j] != null && failureMessages[j].indexOf(configs[j]) != -1; // ensure correct failure message relates to config StringBuffer buffer = new StringBuffer(); if (hasScenarioFailure) { buffer.append(failureMessages[j]); if (scenarioStatus.hasSlowDownExplanation) { buffer.append(" - Explanation comment: "); buffer.append(scenarioComment); } confidenceLevel |= Utils.DEV; } scenarioStatus.statusMap.put(configs[j], buffer.toString()); // Store text for numbers in scenario status String text = Utils.failureMessage(resultStats, false); scenarioStatus.resultsMap.put(configs[j], text); // Store scenario short name in scenario status (for table column) if (scenarioStatus.shortName == null) { if (hasBaseline) { // baseline is OK scenarioStatus.shortName = Utils.getScenarioShortName(scenarioName, -1); } else { StringBuffer shortName = new StringBuffer("*"); shortName.append(Utils.getScenarioShortName(scenarioName, -1)); shortName.append(" <small>(vs.&nbsp;"); shortName.append(timeSeriesLabels[0]); shortName.append(")</small>"); scenarioStatus.shortName = shortName.toString(); } } // Store scenario status if (!scenarioStatusList.contains(scenarioStatus)) { scenarioStatusList.add(scenarioStatus); } } } String label=null; stream.println("<br><h4>Scenario Status</h4>"); stream.println("The following table gives a complete but compact view of performance results for the component.<br>"); stream.println("Each line of the table shows the results for one scenario on all machines.<br><br>"); stream.println("The name of the scenario is in <b>bold</b> when its results are also displayed in the fingerprints<br>"); stream.println("and starts with an '*' when the scenario has no results in the last baseline run.<br><br>"); stream.println("Here are information displayed for each test (ie. in each cell):"); stream.println("<ul>"); stream.println("<li>an icon showing whether the test fails or passes and whether it's reliable or not.<br>"); stream.println("The legend for this icon is:"); stream.println("<ul>"); stream.print("<li>Green (<img src=\""); stream.print(Utils.OK_IMAGE); stream.print("\">): mark a <b>successful result</b>, which means this test has neither significant performance regression nor significant standard error</li>"); stream.print("<li>Red (<img src=\""); stream.print(Utils.FAIL_IMAGE); stream.println("\">): mark a <b>failing result</b>, which means this test shows a significant performance regression (more than 10%)</li>"); stream.print("<li>Gray (<img src=\""); stream.print(Utils.FAIL_IMAGE_EXPLAINED); stream.println("\">): mark a <b>failing result</b> (see above) with a comment explaining this degradation.</li>"); stream.print("<li>Yellow (<img src=\""); stream.print(Utils.FAIL_IMAGE_WARN); stream.print("\"> or <img src=\""); stream.print(Utils.OK_IMAGE_WARN); stream.print("\">): mark a <b>failing or successful result</b> with a significant standard error (more than "); stream.print(Utils.STANDARD_ERROR_THRESHOLD_STRING); stream.println(")</li>"); stream.print("<li>Black (<img src=\""); stream.print(Utils.UNKNOWN_IMAGE); stream.print("\">): mark an <b>undefined result</b>, which means that deviation on this test is not a number (<code>NaN</code>) or is infinite (happens when the reference value is equals to 0!)</li>"); stream.println("<li>\"n/a\": mark a test for with <b>no</b> performance results</li>"); stream.println("</ul></li>"); stream.println("<li>the value of the deviation from the baseline as a percentage (ie. formula is: <code>(build_test_time - baseline_test_time) / baseline_test_time</code>)</li>"); stream.println("<li>the value of the standard error of this deviation as a percentage (ie. formula is: <code>sqrt(build_test_stddev^2 / N + baseline_test_stddev^2 / N) / baseline_test_time</code>)<br>"); stream.println("When test only has one measure, the standard error cannot be computed and is replaced with a '<font color=\"#CCCC00\">[n/a]</font>'.</li>"); stream.println("</ul>"); stream.println("<u>Hints</u>:<ul>"); stream.println("<li>fly over image of failing tests to see the complete error message</li>"); stream.println("<li>to look at the complete and detailed test results, click on its image</li>"); stream.println("</ul>"); stream.println(); stream.println("<table border=\"1\">"); stream.println("<tr>"); stream.print("<td><h4>All "); stream.print(scenarios.length); stream.println(" scenarios</h4></td>"); for (int i= 0; i < configNames.size(); i++){ label = configNames.get(i).toString(); String columnTitle = label; if (configMaps!=null) { Utils.ConfigDescriptor configDescriptor= (Utils.ConfigDescriptor)configMaps.get(label); if (configDescriptor != null) { int idx = configDescriptor.description.indexOf('('); if (idx < 0) { columnTitle = configDescriptor.description; } else { // first line StringTokenizer tokenizer = new StringTokenizer(configDescriptor.description.substring(0, idx).trim(), " "); StringBuffer buffer = new StringBuffer(tokenizer.nextToken()); while (tokenizer.hasMoreTokens()) { buffer.append("&nbsp;"); buffer.append(tokenizer.nextToken()); } buffer.append(' '); // second line tokenizer = new StringTokenizer(configDescriptor.description.substring(idx).trim(), " "); buffer.append(tokenizer.nextToken()); while (tokenizer.hasMoreTokens()) { buffer.append("&nbsp;"); buffer.append(tokenizer.nextToken()); } columnTitle = buffer.toString(); } } } stream.print("<td><h5>"); stream.print(columnTitle); stream.println("</h5>"); } // counter for js class Id's int jsIdCount=0; for (int j= 0; j < scenarioStatusList.size(); j++) { ScenarioStatus status=(ScenarioStatus)scenarioStatusList.get(j); stream.println("<tr>"); stream.print("<td>"); if (status.fingerprint) stream.print("<b>"); if (!status.hasBaseline) stream.print("*"); // stream.print(status.name.substring(status.name.indexOf(".",status.name.indexOf(".test")+1)+1)); stream.print(status.shortName); if (!status.hasBaseline) stream.print("</i>"); if (status.fingerprint) stream.print("</b>"); stream.println(); for (int i=0;i<configNames.size();i++){ String configName=configNames.get(i).toString(); String aUrl=configName; if (status.statusMap.containsKey(configName)){ String message = (String) status.statusMap.get(configName); int confidence = ((Integer) status.configStatus.get(configName)).intValue(); String image = Utils.getImage(confidence, status.hasSlowDownExplanation); stream.print("<td><a "); if ((confidence & Utils.DEV) == 0 || (confidence & Utils.NAN) != 0 || message.length() == 0){ // write deviation with error in table when test pass stream.print("href=\""); stream.print(aUrl); stream.print('/'); stream.print(status.name.replace('#', '.').replace(':', '_').replace('\\', '_')); stream.println(".html\">"); stream.print("<img hspace=\"10\" border=\"0\" src=\""); stream.print(image); stream.println("\"/></a>"); } else { // create message with tooltip text including deviation with error plus failure message jsIdCount+=1; stream.print("class=\"tooltipSource\" onMouseover=\"show_element('toolTip"); stream.print(jsIdCount); stream.print("')\" onMouseout=\"hide_element('toolTip"); stream.print(jsIdCount); stream.print("')\" \nhref=\""); stream.print(aUrl); stream.print('/'); stream.print(status.name.replace('#', '.').replace(':', '_').replace('\\', '_')); stream.println(".html\">"); stream.print("<img hspace=\"10\" border=\"0\" src=\""); stream.print(image); stream.println("\"/>"); stream.print("<span class=\"hidden_tooltip\" id=\"toolTip"); stream.print(jsIdCount); stream.print("\">"); stream.print(message); stream.println("</span></a>"); } String result = (String) status.resultsMap.get(configName); stream.println(result); }else{ stream.println("<td> n/a"); } } stream.flush(); } stream.println("</table>"); } }
public void print(PrintStream stream, boolean filter) { String OS="config"; Scenario[] scenarios= DB.queryScenarios(variations, scenarioPattern, OS, null); if (scenarios != null && scenarios.length > 0) { ArrayList scenarioStatusList=new ArrayList(); for (int i= 0; i < scenarios.length; i++) { Scenario scenario= scenarios[i]; String scenarioName=scenario.getScenarioName(); if (filter && !Utils.matchPattern(scenarioName, scenarioPattern)) continue; // returns the config names. Making assumption that indices in // the configs array map to the indices of the failure messages. String[] configs=scenario.getTimeSeriesLabels(); String[] failureMessages= scenario.getFailureMessages(); ScenarioStatus scenarioStatus=new ScenarioStatus(scenarioName); scenarioStatus.fingerprint = Utils.hasSummary(this.fingerprintEntries, scenarioName); String scenarioComment= (String)scenarioComments.get(scenarioName); if (scenarioComment != null) scenarioStatus.hasSlowDownExplanation= true; int confsLength = configs.length; for (int j=0; j<confsLength; j++){ if (!configNames.contains(configs[j])) configNames.add(configs[j]); // Compute confidence level and store it in scenario status Variations v = (Variations) variations.clone(); v.put(PerformanceTestPlugin.CONFIG, configs[j]); // double[] resultStats = Utils.resultStats(v, scenarioName, baseline, configs[j]); String current = (String) v.get(PerformanceTestPlugin.BUILD); Dim significanceDimension = (Dim) Dimension.ELAPSED_PROCESS; Scenario newScenario= DB.getScenarioSeries(scenarioName, v, PerformanceTestPlugin.BUILD, baseline, current, new Dim[] { significanceDimension }); String[] timeSeriesLabels= newScenario.getTimeSeriesLabels(); TimeSeries timeSeries = newScenario.getTimeSeries(significanceDimension); boolean hasBaseline = timeSeriesLabels.length == 2 && timeSeriesLabels[0].equals(baseline); double[] resultStats = Utils.resultsStatistics(timeSeries); if (resultStats == null) continue; if (resultStats != null && resultStats[1] < 0 && scenarioStatus.hasBaseline) scenarioStatus.hasBaseline = false; // Store failure message in scenario status int confidenceLevel = Utils.confidenceLevel(resultStats); boolean hasScenarioFailure = failureMessages[j] != null && failureMessages[j].indexOf(configs[j]) != -1; // ensure correct failure message relates to config StringBuffer buffer = new StringBuffer(); if (hasScenarioFailure) { buffer.append(failureMessages[j]); if (scenarioStatus.hasSlowDownExplanation) { buffer.append(" - Explanation comment: "); buffer.append(scenarioComment); } confidenceLevel |= Utils.DEV; } scenarioStatus.configStatus.put(configs[j], new Integer(confidenceLevel)); scenarioStatus.statusMap.put(configs[j], buffer.toString()); // Store text for numbers in scenario status String text = Utils.failureMessage(resultStats, false); scenarioStatus.resultsMap.put(configs[j], text); // Store scenario short name in scenario status (for table column) if (scenarioStatus.shortName == null) { if (hasBaseline) { // baseline is OK scenarioStatus.shortName = Utils.getScenarioShortName(scenarioName, -1); } else { StringBuffer shortName = new StringBuffer("*"); shortName.append(Utils.getScenarioShortName(scenarioName, -1)); shortName.append(" <small>(vs.&nbsp;"); shortName.append(timeSeriesLabels[0]); shortName.append(")</small>"); scenarioStatus.shortName = shortName.toString(); } } // Store scenario status if (!scenarioStatusList.contains(scenarioStatus)) { scenarioStatusList.add(scenarioStatus); } } } String label=null; stream.println("<br><h4>Scenario Status</h4>"); stream.println("The following table gives a complete but compact view of performance results for the component.<br>"); stream.println("Each line of the table shows the results for one scenario on all machines.<br><br>"); stream.println("The name of the scenario is in <b>bold</b> when its results are also displayed in the fingerprints<br>"); stream.println("and starts with an '*' when the scenario has no results in the last baseline run.<br><br>"); stream.println("Here are information displayed for each test (ie. in each cell):"); stream.println("<ul>"); stream.println("<li>an icon showing whether the test fails or passes and whether it's reliable or not.<br>"); stream.println("The legend for this icon is:"); stream.println("<ul>"); stream.print("<li>Green (<img src=\""); stream.print(Utils.OK_IMAGE); stream.print("\">): mark a <b>successful result</b>, which means this test has neither significant performance regression nor significant standard error</li>"); stream.print("<li>Red (<img src=\""); stream.print(Utils.FAIL_IMAGE); stream.println("\">): mark a <b>failing result</b>, which means this test shows a significant performance regression (more than 10%)</li>"); stream.print("<li>Gray (<img src=\""); stream.print(Utils.FAIL_IMAGE_EXPLAINED); stream.println("\">): mark a <b>failing result</b> (see above) with a comment explaining this degradation.</li>"); stream.print("<li>Yellow (<img src=\""); stream.print(Utils.FAIL_IMAGE_WARN); stream.print("\"> or <img src=\""); stream.print(Utils.OK_IMAGE_WARN); stream.print("\">): mark a <b>failing or successful result</b> with a significant standard error (more than "); stream.print(Utils.STANDARD_ERROR_THRESHOLD_STRING); stream.println(")</li>"); stream.print("<li>Black (<img src=\""); stream.print(Utils.UNKNOWN_IMAGE); stream.print("\">): mark an <b>undefined result</b>, which means that deviation on this test is not a number (<code>NaN</code>) or is infinite (happens when the reference value is equals to 0!)</li>"); stream.println("<li>\"n/a\": mark a test for with <b>no</b> performance results</li>"); stream.println("</ul></li>"); stream.println("<li>the value of the deviation from the baseline as a percentage (ie. formula is: <code>(build_test_time - baseline_test_time) / baseline_test_time</code>)</li>"); stream.println("<li>the value of the standard error of this deviation as a percentage (ie. formula is: <code>sqrt(build_test_stddev^2 / N + baseline_test_stddev^2 / N) / baseline_test_time</code>)<br>"); stream.println("When test only has one measure, the standard error cannot be computed and is replaced with a '<font color=\"#CCCC00\">[n/a]</font>'.</li>"); stream.println("</ul>"); stream.println("<u>Hints</u>:<ul>"); stream.println("<li>fly over image of failing tests to see the complete error message</li>"); stream.println("<li>to look at the complete and detailed test results, click on its image</li>"); stream.println("</ul>"); stream.println(); stream.println("<table border=\"1\">"); stream.println("<tr>"); stream.print("<td><h4>All "); stream.print(scenarios.length); stream.println(" scenarios</h4></td>"); for (int i= 0; i < configNames.size(); i++){ label = configNames.get(i).toString(); String columnTitle = label; if (configMaps!=null) { Utils.ConfigDescriptor configDescriptor= (Utils.ConfigDescriptor)configMaps.get(label); if (configDescriptor != null) { int idx = configDescriptor.description.indexOf('('); if (idx < 0) { columnTitle = configDescriptor.description; } else { // first line StringTokenizer tokenizer = new StringTokenizer(configDescriptor.description.substring(0, idx).trim(), " "); StringBuffer buffer = new StringBuffer(tokenizer.nextToken()); while (tokenizer.hasMoreTokens()) { buffer.append("&nbsp;"); buffer.append(tokenizer.nextToken()); } buffer.append(' '); // second line tokenizer = new StringTokenizer(configDescriptor.description.substring(idx).trim(), " "); buffer.append(tokenizer.nextToken()); while (tokenizer.hasMoreTokens()) { buffer.append("&nbsp;"); buffer.append(tokenizer.nextToken()); } columnTitle = buffer.toString(); } } } stream.print("<td><h5>"); stream.print(columnTitle); stream.println("</h5>"); } // counter for js class Id's int jsIdCount=0; for (int j= 0; j < scenarioStatusList.size(); j++) { ScenarioStatus status=(ScenarioStatus)scenarioStatusList.get(j); stream.println("<tr>"); stream.print("<td>"); if (status.fingerprint) stream.print("<b>"); if (!status.hasBaseline) stream.print("*"); // stream.print(status.name.substring(status.name.indexOf(".",status.name.indexOf(".test")+1)+1)); stream.print(status.shortName); if (!status.hasBaseline) stream.print("</i>"); if (status.fingerprint) stream.print("</b>"); stream.println(); for (int i=0;i<configNames.size();i++){ String configName=configNames.get(i).toString(); String aUrl=configName; if (status.statusMap.containsKey(configName)){ String message = (String) status.statusMap.get(configName); int confidence = ((Integer) status.configStatus.get(configName)).intValue(); String image = Utils.getImage(confidence, status.hasSlowDownExplanation); stream.print("<td><a "); if ((confidence & Utils.DEV) == 0 || (confidence & Utils.NAN) != 0 || message.length() == 0){ // write deviation with error in table when test pass stream.print("href=\""); stream.print(aUrl); stream.print('/'); stream.print(status.name.replace('#', '.').replace(':', '_').replace('\\', '_')); stream.println(".html\">"); stream.print("<img hspace=\"10\" border=\"0\" src=\""); stream.print(image); stream.println("\"/></a>"); } else { // create message with tooltip text including deviation with error plus failure message jsIdCount+=1; stream.print("class=\"tooltipSource\" onMouseover=\"show_element('toolTip"); stream.print(jsIdCount); stream.print("')\" onMouseout=\"hide_element('toolTip"); stream.print(jsIdCount); stream.print("')\" \nhref=\""); stream.print(aUrl); stream.print('/'); stream.print(status.name.replace('#', '.').replace(':', '_').replace('\\', '_')); stream.println(".html\">"); stream.print("<img hspace=\"10\" border=\"0\" src=\""); stream.print(image); stream.println("\"/>"); stream.print("<span class=\"hidden_tooltip\" id=\"toolTip"); stream.print(jsIdCount); stream.print("\">"); stream.print(message); stream.println("</span></a>"); } String result = (String) status.resultsMap.get(configName); stream.println(result); }else{ stream.println("<td> n/a"); } } stream.flush(); } stream.println("</table>"); } }
diff --git a/IGVC2013_Component_1/src/ClientSocket.java b/IGVC2013_Component_1/src/ClientSocket.java index f9353e1..a5aaf6f 100644 --- a/IGVC2013_Component_1/src/ClientSocket.java +++ b/IGVC2013_Component_1/src/ClientSocket.java @@ -1,232 +1,232 @@ package src; import java.net.*; import java.util.LinkedList; import java.io.*; import src.urn_jaus_jss_mobility_LocalWaypointListDriver_1_0.Messages.ReportLocalWaypoint; import src.urn_jaus_jss_mobility_LocalWaypointListDriver_1_0.Messages.SetElement.Body.SetElementSeq.ElementList.ElementRec; public class ClientSocket {//SocketClient //http://edn.embarcadero.com/article/31995 //Sockets allow you the programmer to treat the network connection as you would any other I/O. //(see your JBuilder help files or http://java.sun.com/j2se/1.5.0/docs/api/java/net/package-summary.html for more information). private ObjectOutputStream oos; private ObjectInputStream ois; private Socket connection; private LinkedList<Object> setLocalPoseList = new LinkedList<Object>(); private LinkedList<Object> setExecuteList = new LinkedList<Object>(); private LinkedList<Object> setExecuteSpeed = new LinkedList<Object>(); private Object[] RobData; private Object o;; ClientSocket(){} public void connect() //String host,int port { /**Define a host **/ - String host = "192.168.32.64"; + String host = "192.168.33.73"; /**Define a port**/ int port = 19998; StringBuffer instr = new StringBuffer(); System.out.println("SocketClient initialized"); try{//how to request a socket and establishing a connection /**obtain an address object of the server*/ InetAddress address = InetAddress.getByName(host); /**Establish a socket connection*/ connection = new Socket(address, port); this.oos = new ObjectOutputStream(connection.getOutputStream()); this.ois =new ObjectInputStream(connection.getInputStream()); System.out.println(instr); } catch (IOException f) { System.out.println("IOException: " + f); } catch (Exception g) { System.out.println("Exception: " + g); } } public void JausDataRequest() { System.out.println("Sending JausDataRequest..."); try { Object[] messageID = new Object[] {4}; oos.writeObject(messageID); oos.flush(); o = ois.readObject(); updateVariablesAndGUI(o); } catch (ClassNotFoundException e) { System.out.println(e); e.printStackTrace(); } catch (IOException e) { System.out.println(e); e.printStackTrace(); } System.out.println("Recieved JausData"); } public void SetLocalPoseRequest(Double x, Double y, Double yaw) { System.out.println("Sending SetLocalPose..."); try { Integer messageID = 0; setLocalPoseList.clear(); setLocalPoseList.add(messageID); setLocalPoseList.add(x); setLocalPoseList.add(y); setLocalPoseList.add(yaw); oos.writeObject(setLocalPoseList.toArray()); oos.flush(); o = ois.readObject(); } catch (ClassNotFoundException e) { System.out.println(e); e.printStackTrace(); } catch (IOException e) { System.out.println(e); e.printStackTrace(); } System.out.println("Sent SetLocalPose"); } public void ExecuteListRequest(LinkedList<ElementRec> waypointList, Double executeSpeed, Integer startElementPos) { System.out.println("Sending ExecuteListRequest..."); ReportLocalWaypoint decodedWaypoint = new ReportLocalWaypoint(); Integer messageID = 1; try { setExecuteList.clear(); setExecuteList.add(messageID); for(int j=startElementPos; j<waypointList.size(); j++){ decodedWaypoint.decode(waypointList.get(j).getElementData().getData(), 0); setExecuteList.add(new Object[] {waypointList.get(j).getElementUID(), decodedWaypoint.getBody().getLocalWaypointRec().getX(), decodedWaypoint.getBody().getLocalWaypointRec().getY()}); } oos.writeObject(setExecuteList.toArray()); oos.flush(); o = ois.readObject(); } catch (ClassNotFoundException e) { System.out.println(e); e.printStackTrace(); } catch (IOException e) { System.out.println(e); e.printStackTrace(); } System.out.println("Sent ExecuteListRequest"); } public void SetSpeedRequest(Double executeSpeed) { System.out.println("Sending SetSpeedRequest..."); Integer messageID = 2; try { setExecuteSpeed.clear(); setExecuteSpeed.add(messageID); setExecuteSpeed.add(executeSpeed); oos.writeObject(setExecuteSpeed.toArray()); oos.flush(); o = ois.readObject(); } catch (ClassNotFoundException e) { System.out.println(e); e.printStackTrace(); } catch (IOException e) { System.out.println(e); e.printStackTrace(); } System.out.println("Sent SetSpeedRequest"); } public void Shutdown() { Object[] messageID = new Object[] {3}; try { oos.writeObject(messageID); oos.flush(); o = ois.readObject(); } catch (ClassNotFoundException e) { System.out.println(e); e.printStackTrace(); } catch (IOException e) { System.out.println(e); e.printStackTrace(); } } public void close() { try { connection.close(); } catch (IOException e) { System.out.println(e); e.printStackTrace(); } } private void updateVariablesAndGUI(Object o){ RobData = (Object[]) o; JausGUI.robot_x_position = (Double) RobData[0]; JausGUI.robot_y_position = (Double) RobData[1]; JausGUI.robot_yaw_position = (Double) RobData[2]; JausGUI.robot_x_velocity = (Double) RobData[3]; JausGUI.robot_omega = (Double) RobData[4]; JausGUI.robot_desired_speed = (Double) RobData[5]; JausGUI.robot_Active_Element_UID = (Integer) RobData[6]; JausGUI.robot_LocalWaypoint_X = (Double) RobData[7]; JausGUI.robot_LocalWaypoint_Y = (Double) RobData[8]; JausGUI.updateRobotValues(); System.out.println("-------------------------------------------"); System.out.println("X Position: " + RobData[0]); System.out.println("Y Position: " + RobData[1]); System.out.println("YAW Position: " + RobData[2]); System.out.println("X Velocity: " + RobData[3]); System.out.println("Omega: " + RobData[4]); System.out.println("Desired Speed: " + RobData[5]); System.out.println("Active Element UID: " + RobData[6]); System.out.println("Local Waypoint X: " + RobData[7]); System.out.println("Local Waypoint Y: " + RobData[8]); } } //servers //client //have it send to itself
true
true
public void connect() //String host,int port { /**Define a host **/ String host = "192.168.32.64"; /**Define a port**/ int port = 19998; StringBuffer instr = new StringBuffer(); System.out.println("SocketClient initialized"); try{//how to request a socket and establishing a connection /**obtain an address object of the server*/ InetAddress address = InetAddress.getByName(host); /**Establish a socket connection*/ connection = new Socket(address, port); this.oos = new ObjectOutputStream(connection.getOutputStream()); this.ois =new ObjectInputStream(connection.getInputStream()); System.out.println(instr); } catch (IOException f) { System.out.println("IOException: " + f); } catch (Exception g) { System.out.println("Exception: " + g); } }
public void connect() //String host,int port { /**Define a host **/ String host = "192.168.33.73"; /**Define a port**/ int port = 19998; StringBuffer instr = new StringBuffer(); System.out.println("SocketClient initialized"); try{//how to request a socket and establishing a connection /**obtain an address object of the server*/ InetAddress address = InetAddress.getByName(host); /**Establish a socket connection*/ connection = new Socket(address, port); this.oos = new ObjectOutputStream(connection.getOutputStream()); this.ois =new ObjectInputStream(connection.getInputStream()); System.out.println(instr); } catch (IOException f) { System.out.println("IOException: " + f); } catch (Exception g) { System.out.println("Exception: " + g); } }
diff --git a/src/com/menny/android/anysoftkeyboard/keyboards/LatinKeyboard.java b/src/com/menny/android/anysoftkeyboard/keyboards/LatinKeyboard.java index 010e38d1..c63d0f9d 100644 --- a/src/com/menny/android/anysoftkeyboard/keyboards/LatinKeyboard.java +++ b/src/com/menny/android/anysoftkeyboard/keyboards/LatinKeyboard.java @@ -1,83 +1,83 @@ package com.menny.android.anysoftkeyboard.keyboards; import com.menny.android.anysoftkeyboard.AnyKeyboardContextProvider; public class LatinKeyboard extends AnyKeyboard { protected LatinKeyboard(AnyKeyboardContextProvider context, int keyboardLayoutId) { super(context, keyboardLayoutId); } protected void setPopupKeyChars(Key aKey) { if ((aKey.codes != null) && (aKey.codes.length > 0)) { switch((char)aKey.codes[0]) { case 'a': - aKey.popupCharacters = "\u00e0\u00e2\u00e1\u00e4\u00e3\u00e6\u00e5\u0105"; + aKey.popupCharacters = "\u00e0\u00e1\u00e2\u00e3\u00e4\u00e5\u00e6\u0105"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'c': - aKey.popupCharacters = "\u00e7\u010d\u0107\u0109"; + aKey.popupCharacters = "\u00e7\u0107\u0109\u010d"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'd': aKey.popupCharacters = "\u0111"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'e': - aKey.popupCharacters = "\u00e9\u00e8\u00ea\u00eb\u0119\u20ac"; + aKey.popupCharacters = "\u00e8\u00e9\u00ea\u00eb\u0119\u20ac"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'g': aKey.popupCharacters = "\u011d"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'h': aKey.popupCharacters = "\u0125"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'i': - aKey.popupCharacters = "\u00ee\u00ef\u00ed\u00ec\u0142"; + aKey.popupCharacters = "\u00ec\u00ed\u00ee\u00ef\u0142"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'j': aKey.popupCharacters = "\u0135"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'l': aKey.popupCharacters = "\u0142"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'o': - aKey.popupCharacters = "\u00f4\u00f6\u00f2\u00f3\u00f5\u0153\u00f8\u0151"; + aKey.popupCharacters = "\u00f2\u00f3\u00f4\u00f5\u00f6\u00f8\u0151\u0153"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 's': - aKey.popupCharacters = "\u00a7\u0161\u015b\u00df\u015d"; + aKey.popupCharacters = "\u00a7\u00df\u015b\u015d\u0161"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'u': - aKey.popupCharacters = "\u00f9\u00fb\u00fc\u00fa\u0171\u016d"; + aKey.popupCharacters = "\u00f9\u00fa\u00fb\u00fc\u016d\u0171"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'n': aKey.popupCharacters = "\u00f1"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'y': - aKey.popupCharacters = "\u00ff\u00fd"; + aKey.popupCharacters = "\u00fd\u00ff"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'z': - aKey.popupCharacters = "\u017e\u017c"; + aKey.popupCharacters = "\u017c\u017e"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; default: super.setPopupKeyChars(aKey); } } } }
false
true
protected void setPopupKeyChars(Key aKey) { if ((aKey.codes != null) && (aKey.codes.length > 0)) { switch((char)aKey.codes[0]) { case 'a': aKey.popupCharacters = "\u00e0\u00e2\u00e1\u00e4\u00e3\u00e6\u00e5\u0105"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'c': aKey.popupCharacters = "\u00e7\u010d\u0107\u0109"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'd': aKey.popupCharacters = "\u0111"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'e': aKey.popupCharacters = "\u00e9\u00e8\u00ea\u00eb\u0119\u20ac"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'g': aKey.popupCharacters = "\u011d"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'h': aKey.popupCharacters = "\u0125"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'i': aKey.popupCharacters = "\u00ee\u00ef\u00ed\u00ec\u0142"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'j': aKey.popupCharacters = "\u0135"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'l': aKey.popupCharacters = "\u0142"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'o': aKey.popupCharacters = "\u00f4\u00f6\u00f2\u00f3\u00f5\u0153\u00f8\u0151"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 's': aKey.popupCharacters = "\u00a7\u0161\u015b\u00df\u015d"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'u': aKey.popupCharacters = "\u00f9\u00fb\u00fc\u00fa\u0171\u016d"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'n': aKey.popupCharacters = "\u00f1"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'y': aKey.popupCharacters = "\u00ff\u00fd"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'z': aKey.popupCharacters = "\u017e\u017c"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; default: super.setPopupKeyChars(aKey); } } }
protected void setPopupKeyChars(Key aKey) { if ((aKey.codes != null) && (aKey.codes.length > 0)) { switch((char)aKey.codes[0]) { case 'a': aKey.popupCharacters = "\u00e0\u00e1\u00e2\u00e3\u00e4\u00e5\u00e6\u0105"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'c': aKey.popupCharacters = "\u00e7\u0107\u0109\u010d"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'd': aKey.popupCharacters = "\u0111"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'e': aKey.popupCharacters = "\u00e8\u00e9\u00ea\u00eb\u0119\u20ac"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'g': aKey.popupCharacters = "\u011d"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'h': aKey.popupCharacters = "\u0125"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'i': aKey.popupCharacters = "\u00ec\u00ed\u00ee\u00ef\u0142"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'j': aKey.popupCharacters = "\u0135"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'l': aKey.popupCharacters = "\u0142"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'o': aKey.popupCharacters = "\u00f2\u00f3\u00f4\u00f5\u00f6\u00f8\u0151\u0153"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 's': aKey.popupCharacters = "\u00a7\u00df\u015b\u015d\u0161"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'u': aKey.popupCharacters = "\u00f9\u00fa\u00fb\u00fc\u016d\u0171"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'n': aKey.popupCharacters = "\u00f1"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'y': aKey.popupCharacters = "\u00fd\u00ff"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; case 'z': aKey.popupCharacters = "\u017c\u017e"; aKey.popupResId = com.menny.android.anysoftkeyboard.R.xml.popup; break; default: super.setPopupKeyChars(aKey); } } }
diff --git a/rest/src/main/java/org/mayocat/shop/rest/resources/LoginResource.java b/rest/src/main/java/org/mayocat/shop/rest/resources/LoginResource.java index 5f833d3b..414cc670 100644 --- a/rest/src/main/java/org/mayocat/shop/rest/resources/LoginResource.java +++ b/rest/src/main/java/org/mayocat/shop/rest/resources/LoginResource.java @@ -1,80 +1,80 @@ package org.mayocat.shop.rest.resources; import javax.inject.Inject; import javax.ws.rs.Consumes; import javax.ws.rs.DefaultValue; import javax.ws.rs.FormParam; import javax.ws.rs.POST; import javax.ws.rs.Path; import javax.ws.rs.WebApplicationException; import javax.ws.rs.core.Context; import javax.ws.rs.core.MediaType; import javax.ws.rs.core.NewCookie; import javax.ws.rs.core.Response; import javax.ws.rs.core.Response.Status; import javax.ws.rs.core.UriInfo; import org.mayocat.shop.authorization.PasswordManager; import org.mayocat.shop.authorization.cookies.CookieCrypter; import org.mayocat.shop.authorization.cookies.EncryptionException; import org.mayocat.shop.model.User; import org.mayocat.shop.service.UserService; import org.mayocat.shop.store.StoreException; import org.xwiki.component.annotation.Component; @Component("LoginResource") @Path("/login/") public class LoginResource implements Resource { @Inject private UserService userService; @Inject private PasswordManager passwordManager; @Inject private CookieCrypter crypter; @POST @Consumes(MediaType.APPLICATION_FORM_URLENCODED) public Response login(@FormParam("username") String username, @FormParam("password") String password, @FormParam("remember") @DefaultValue("false") Boolean remember, @Context UriInfo uri) { try { User user = userService.findByEmailOrUserName(username); if (user == null) { // Don't give more information than this - return Response.status(Status.UNAUTHORIZED).build(); + return Response.noContent().status(Status.UNAUTHORIZED).build(); } if (!passwordManager.verifyPassword(password, user.getPassword())) { // Don't give more information than this - return Response.status(Status.UNAUTHORIZED).build(); + return Response.noContent().status(Status.UNAUTHORIZED).build(); } // Find out some cookie parameters we will need int ageWhenRemember = 60 * 60 * 24 * 15; // TODO make configurable // String domain = uri.geBaseUri().getHost(); // TODO set domain when at least two dots ? Or config ? // See http://curl.haxx.se/rfc/cookie_spec.html // Create the new cookies to be sent with the response NewCookie newUserCookie = new NewCookie("username", crypter.encrypt(username), "/", null, null, remember ? ageWhenRemember : -1, false); NewCookie newPassCookie = new NewCookie("password", crypter.encrypt(password), "/", null, null, remember ? ageWhenRemember : -1, false); return Response.ok().cookie(newUserCookie, newPassCookie).build(); } catch (StoreException e) { throw new WebApplicationException(e); } catch (EncryptionException e) { // Don't give more information than this throw new WebApplicationException(); } } }
false
true
public Response login(@FormParam("username") String username, @FormParam("password") String password, @FormParam("remember") @DefaultValue("false") Boolean remember, @Context UriInfo uri) { try { User user = userService.findByEmailOrUserName(username); if (user == null) { // Don't give more information than this return Response.status(Status.UNAUTHORIZED).build(); } if (!passwordManager.verifyPassword(password, user.getPassword())) { // Don't give more information than this return Response.status(Status.UNAUTHORIZED).build(); } // Find out some cookie parameters we will need int ageWhenRemember = 60 * 60 * 24 * 15; // TODO make configurable // String domain = uri.geBaseUri().getHost(); // TODO set domain when at least two dots ? Or config ? // See http://curl.haxx.se/rfc/cookie_spec.html // Create the new cookies to be sent with the response NewCookie newUserCookie = new NewCookie("username", crypter.encrypt(username), "/", null, null, remember ? ageWhenRemember : -1, false); NewCookie newPassCookie = new NewCookie("password", crypter.encrypt(password), "/", null, null, remember ? ageWhenRemember : -1, false); return Response.ok().cookie(newUserCookie, newPassCookie).build(); } catch (StoreException e) { throw new WebApplicationException(e); } catch (EncryptionException e) { // Don't give more information than this throw new WebApplicationException(); } }
public Response login(@FormParam("username") String username, @FormParam("password") String password, @FormParam("remember") @DefaultValue("false") Boolean remember, @Context UriInfo uri) { try { User user = userService.findByEmailOrUserName(username); if (user == null) { // Don't give more information than this return Response.noContent().status(Status.UNAUTHORIZED).build(); } if (!passwordManager.verifyPassword(password, user.getPassword())) { // Don't give more information than this return Response.noContent().status(Status.UNAUTHORIZED).build(); } // Find out some cookie parameters we will need int ageWhenRemember = 60 * 60 * 24 * 15; // TODO make configurable // String domain = uri.geBaseUri().getHost(); // TODO set domain when at least two dots ? Or config ? // See http://curl.haxx.se/rfc/cookie_spec.html // Create the new cookies to be sent with the response NewCookie newUserCookie = new NewCookie("username", crypter.encrypt(username), "/", null, null, remember ? ageWhenRemember : -1, false); NewCookie newPassCookie = new NewCookie("password", crypter.encrypt(password), "/", null, null, remember ? ageWhenRemember : -1, false); return Response.ok().cookie(newUserCookie, newPassCookie).build(); } catch (StoreException e) { throw new WebApplicationException(e); } catch (EncryptionException e) { // Don't give more information than this throw new WebApplicationException(); } }
diff --git a/src/uk/me/parabola/mkgmap/combiners/TdbBuilder.java b/src/uk/me/parabola/mkgmap/combiners/TdbBuilder.java index 161c00ba..2965d6c5 100644 --- a/src/uk/me/parabola/mkgmap/combiners/TdbBuilder.java +++ b/src/uk/me/parabola/mkgmap/combiners/TdbBuilder.java @@ -1,265 +1,265 @@ /* * Copyright (C) 2007 Steve Ratcliffe * * This program is free software; you can redistribute it and/or modify * it under the terms of the GNU General Public License version 2 as * published by the Free Software Foundation. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * * Author: Steve Ratcliffe * Create date: Dec 9, 2007 */ package uk.me.parabola.mkgmap.combiners; import java.io.IOException; import java.util.ArrayList; import java.util.List; import uk.me.parabola.imgfmt.ExitException; import uk.me.parabola.imgfmt.FileExistsException; import uk.me.parabola.imgfmt.FileNotWritableException; import uk.me.parabola.imgfmt.FileSystemParam; import uk.me.parabola.imgfmt.app.Area; import uk.me.parabola.imgfmt.app.Coord; import uk.me.parabola.imgfmt.app.map.Map; import uk.me.parabola.log.Logger; import uk.me.parabola.mkgmap.CommandArgs; import uk.me.parabola.mkgmap.build.MapBuilder; import uk.me.parabola.mkgmap.general.MapShape; import uk.me.parabola.tdbfmt.DetailMapBlock; import uk.me.parabola.tdbfmt.TdbFile; /** * Build the TDB file and the overview map. * * @author Steve Ratcliffe */ public class TdbBuilder implements Combiner { private static final Logger log = Logger.getLogger(TdbBuilder.class); private OverviewMap overviewSource; private TdbFile tdb; private int parent = 63240000; private String overviewMapname; private String overviewMapnumber; private String areaName; private int tdbVersion; /** * Initialise by saving all the information we require from the command line * args. * * @param args The command line arguments as they are at the end of the list. * In otherwords if the same argument appears more than once, then it will */ public void init(CommandArgs args) { overviewMapname = args.get("overview-mapname", "osmmap"); overviewMapnumber = args.get("overview-mapnumber", "63240000"); try { parent = Integer.parseInt(overviewMapnumber); } catch (NumberFormatException e) { log.debug("overview map number not an integer", overviewMapnumber); } areaName = args.get("area-name", "Overview Map"); int familyId = args.get("family-id", 0); int productId = args.get("product-id", 1); short productVersion = (short)args.get("product-version", 100); String seriesName = args.get("series-name", "OSM map"); String familyName = args.get("family-name", "OSM map"); // Versin 4 is the default. If you really want v3 then the tdb-v3 // option can be used. if (args.exists("tdb-v3")) { tdbVersion = TdbFile.TDB_V3; } else { tdbVersion = TdbFile.TDB_V407; } tdb = new TdbFile(tdbVersion); tdb.setProductInfo(familyId, productId, productVersion, seriesName, familyName, areaName); } /** * Called at the end of every map that is to be combined. We only deal * with IMG files and ignore everything else. * * @param finfo Information on the file. */ public void onMapEnd(FileInfo finfo) { if (!finfo.isImg()) return; addToTdb(finfo); addToOverviewMap(finfo); } /** * Add the information about the current map to the tdb file. * * @param finfo Information about the current .img file. */ private void addToTdb(FileInfo finfo) { DetailMapBlock detail = new DetailMapBlock(tdbVersion); detail.setArea(finfo.getBounds()); String mapname = finfo.getMapname(); String mapdesc = finfo.getDescription(); detail.setMapName(mapname, mapname); String desc = mapdesc + " (" + mapname + ')'; detail.setDescription(desc); detail.setLblDataSize(finfo.getLblsize()); detail.setTreDataSize(finfo.getTresize()); detail.setRgnDataSize(finfo.getRgnsize()); detail.setNetDataSize(finfo.getNetsize()); detail.setNodDataSize(finfo.getNodsize()); log.info("overview-mapname", overviewMapname); log.info("overview-mapnumber", parent); detail.setParentMapNumber(parent); tdb.addDetail(detail); String[] msgs = finfo.getCopyrights(); for (String m : msgs) tdb.addCopyright(m); } /** * Add an individual .img file to the overview map. * * @param finfo Information about an individual map. */ private void addToOverviewMap(FileInfo finfo) { Area bounds = finfo.getBounds(); //System.out.printf("overview shift %d\n", overviewSource.getShift()); int overviewMask = ((1 << overviewSource.getShift()) - 1); //System.out.printf("mask %x\n", overviewMask); //System.out.println("overviewSource.getShift() = " + overviewSource.getShift()); - int maxLon = roundUp(bounds.getMaxLong(), overviewMask); + int maxLon = roundDown(bounds.getMaxLong(), overviewMask); int maxLat = roundUp(bounds.getMaxLat(), overviewMask); - int minLat = roundDown(bounds.getMinLat(), overviewMask); + int minLat = roundUp(bounds.getMinLat(), overviewMask); int minLon = roundDown(bounds.getMinLong(), overviewMask); //System.out.printf("maxLat 0x%x, modified=0x%x\n", bounds.getMaxLat(), maxLat); //System.out.printf("maxLat %f, modified=%f\n", Utils.toDegrees(bounds.getMaxLat()), Utils.toDegrees(maxLat)); //System.out.printf("minLat 0x%x, modified=0x%x\n", bounds.getMinLat(), minLat); //System.out.printf("minLat %f, modified=%f\n", Utils.toDegrees(bounds.getMinLat()), Utils.toDegrees(minLat)); //System.out.printf("maxLon 0x%x, modified=0x%x\n", bounds.getMaxLong(), maxLon); //System.out.printf("maxLon %f, modified=%f\n", Utils.toDegrees(bounds.getMaxLong()), Utils.toDegrees(maxLon)); //System.out.printf("minLon 0x%x, modified=0x%x\n", bounds.getMinLong(), minLon); //System.out.printf("minLon %f, modified=%f\n", Utils.toDegrees(bounds.getMinLong()), Utils.toDegrees(minLon)); // Add a background polygon for this map. List<Coord> points = new ArrayList<Coord>(); Coord start = new Coord(minLat, minLon); points.add(start); overviewSource.addToBounds(start); Coord co = new Coord(maxLat, minLon); points.add(co); overviewSource.addToBounds(co); co = new Coord(maxLat, maxLon); points.add(co); overviewSource.addToBounds(co); co = new Coord(minLat, maxLon); points.add(co); overviewSource.addToBounds(co); points.add(start); // Create the background rectangle MapShape bg = new MapShape(); bg.setType(0x4a); bg.setPoints(points); bg.setMinResolution(10); bg.setName(finfo.getDescription() + '\u001d' + finfo.getMapname()); overviewSource.addShape(bg); } private int roundUp(int len, int overviewMask) { //System.out.printf("before up 0x%x\n", len); if (len > 0) return (len + overviewMask) & ~overviewMask; else return len & ~overviewMask; } private int roundDown(int len, int overviewMask) { //System.out.printf("before down 0x%x\n", len); if (len > 0) return len & ~overviewMask; else return -(-len +overviewMask & ~overviewMask); } /** * Called when all the .img files have been processed. We finish up and * create the TDB file and the overview map. */ public void onFinish() { log.debug("finishing overview"); // We can set the overall bounds easily as it was calcualted as part of // the overview map. tdb.setOverview(overviewMapname, overviewSource.getBounds(), overviewMapnumber); writeTdbFile(); writeOverviewMap(); } /** * Write out the overview map. */ private void writeOverviewMap() { MapBuilder mb = new MapBuilder(); mb.setEnableLineCleanFilters(false); FileSystemParam params = new FileSystemParam(); params.setBlockSize(512); params.setMapDescription(areaName); try { Map map = Map.createMap(overviewMapname, params, overviewMapnumber); mb.makeMap(map, overviewSource); map.close(); } catch (FileExistsException e) { throw new ExitException("Could not create overview map", e); } catch (FileNotWritableException e) { throw new ExitException("Could not write to overview map", e); } } /** * Write out the TDB file at the end of processing. */ private void writeTdbFile() { try { tdb.write(overviewMapname + ".tdb"); } catch (IOException e) { log.error("tdb write", e); throw new ExitException("Could not write the TDB file", e); } } public void setOverviewSource(OverviewMap overviewSource) { this.overviewSource = overviewSource; } }
false
true
private void addToOverviewMap(FileInfo finfo) { Area bounds = finfo.getBounds(); //System.out.printf("overview shift %d\n", overviewSource.getShift()); int overviewMask = ((1 << overviewSource.getShift()) - 1); //System.out.printf("mask %x\n", overviewMask); //System.out.println("overviewSource.getShift() = " + overviewSource.getShift()); int maxLon = roundUp(bounds.getMaxLong(), overviewMask); int maxLat = roundUp(bounds.getMaxLat(), overviewMask); int minLat = roundDown(bounds.getMinLat(), overviewMask); int minLon = roundDown(bounds.getMinLong(), overviewMask); //System.out.printf("maxLat 0x%x, modified=0x%x\n", bounds.getMaxLat(), maxLat); //System.out.printf("maxLat %f, modified=%f\n", Utils.toDegrees(bounds.getMaxLat()), Utils.toDegrees(maxLat)); //System.out.printf("minLat 0x%x, modified=0x%x\n", bounds.getMinLat(), minLat); //System.out.printf("minLat %f, modified=%f\n", Utils.toDegrees(bounds.getMinLat()), Utils.toDegrees(minLat)); //System.out.printf("maxLon 0x%x, modified=0x%x\n", bounds.getMaxLong(), maxLon); //System.out.printf("maxLon %f, modified=%f\n", Utils.toDegrees(bounds.getMaxLong()), Utils.toDegrees(maxLon)); //System.out.printf("minLon 0x%x, modified=0x%x\n", bounds.getMinLong(), minLon); //System.out.printf("minLon %f, modified=%f\n", Utils.toDegrees(bounds.getMinLong()), Utils.toDegrees(minLon)); // Add a background polygon for this map. List<Coord> points = new ArrayList<Coord>(); Coord start = new Coord(minLat, minLon); points.add(start); overviewSource.addToBounds(start); Coord co = new Coord(maxLat, minLon); points.add(co); overviewSource.addToBounds(co); co = new Coord(maxLat, maxLon); points.add(co); overviewSource.addToBounds(co); co = new Coord(minLat, maxLon); points.add(co); overviewSource.addToBounds(co); points.add(start); // Create the background rectangle MapShape bg = new MapShape(); bg.setType(0x4a); bg.setPoints(points); bg.setMinResolution(10); bg.setName(finfo.getDescription() + '\u001d' + finfo.getMapname()); overviewSource.addShape(bg); }
private void addToOverviewMap(FileInfo finfo) { Area bounds = finfo.getBounds(); //System.out.printf("overview shift %d\n", overviewSource.getShift()); int overviewMask = ((1 << overviewSource.getShift()) - 1); //System.out.printf("mask %x\n", overviewMask); //System.out.println("overviewSource.getShift() = " + overviewSource.getShift()); int maxLon = roundDown(bounds.getMaxLong(), overviewMask); int maxLat = roundUp(bounds.getMaxLat(), overviewMask); int minLat = roundUp(bounds.getMinLat(), overviewMask); int minLon = roundDown(bounds.getMinLong(), overviewMask); //System.out.printf("maxLat 0x%x, modified=0x%x\n", bounds.getMaxLat(), maxLat); //System.out.printf("maxLat %f, modified=%f\n", Utils.toDegrees(bounds.getMaxLat()), Utils.toDegrees(maxLat)); //System.out.printf("minLat 0x%x, modified=0x%x\n", bounds.getMinLat(), minLat); //System.out.printf("minLat %f, modified=%f\n", Utils.toDegrees(bounds.getMinLat()), Utils.toDegrees(minLat)); //System.out.printf("maxLon 0x%x, modified=0x%x\n", bounds.getMaxLong(), maxLon); //System.out.printf("maxLon %f, modified=%f\n", Utils.toDegrees(bounds.getMaxLong()), Utils.toDegrees(maxLon)); //System.out.printf("minLon 0x%x, modified=0x%x\n", bounds.getMinLong(), minLon); //System.out.printf("minLon %f, modified=%f\n", Utils.toDegrees(bounds.getMinLong()), Utils.toDegrees(minLon)); // Add a background polygon for this map. List<Coord> points = new ArrayList<Coord>(); Coord start = new Coord(minLat, minLon); points.add(start); overviewSource.addToBounds(start); Coord co = new Coord(maxLat, minLon); points.add(co); overviewSource.addToBounds(co); co = new Coord(maxLat, maxLon); points.add(co); overviewSource.addToBounds(co); co = new Coord(minLat, maxLon); points.add(co); overviewSource.addToBounds(co); points.add(start); // Create the background rectangle MapShape bg = new MapShape(); bg.setType(0x4a); bg.setPoints(points); bg.setMinResolution(10); bg.setName(finfo.getDescription() + '\u001d' + finfo.getMapname()); overviewSource.addShape(bg); }
diff --git a/orcid-persistence/src/main/java/org/orcid/persistence/jpa/entities/OrcidOauth2TokenDetail.java b/orcid-persistence/src/main/java/org/orcid/persistence/jpa/entities/OrcidOauth2TokenDetail.java index 7d187579a5..5c74b7eb9c 100644 --- a/orcid-persistence/src/main/java/org/orcid/persistence/jpa/entities/OrcidOauth2TokenDetail.java +++ b/orcid-persistence/src/main/java/org/orcid/persistence/jpa/entities/OrcidOauth2TokenDetail.java @@ -1,238 +1,239 @@ /** * ============================================================================= * * ORCID (R) Open Source * http://orcid.org * * Copyright (c) 2012-2013 ORCID, Inc. * Licensed under an MIT-Style License (MIT) * http://orcid.org/open-source-license * * This copyright and license information (including a link to the full license) * shall be included in its entirety in all copies or substantial portion of * the software. * * ============================================================================= */ package org.orcid.persistence.jpa.entities; import javax.persistence.Column; import javax.persistence.Entity; import javax.persistence.FetchType; import javax.persistence.GeneratedValue; import javax.persistence.GenerationType; import javax.persistence.Id; import javax.persistence.JoinColumn; import javax.persistence.ManyToOne; import javax.persistence.SequenceGenerator; import javax.persistence.Table; import java.util.Date; /** * 2011-2012 ORCID * * @author Declan Newman (declan) Date: 16/04/2012 */ @Entity @Table(name = "oauth2_token_detail") public class OrcidOauth2TokenDetail extends BaseEntity<Long> implements ProfileAware, Comparable<OrcidOauth2TokenDetail> { /** * */ private static final long serialVersionUID = 1L; private Long id; private String tokenValue; private ProfileEntity profile; private ClientDetailsEntity clientDetailsEntity; private boolean approved = false; private String resourceId; private String redirectUri; private String responseType; private String state; private String scope; private String tokenType; private Date tokenExpiration; private String refreshTokenValue; private Date refreshTokenExpiration; private String authenticationKey; private Boolean tokenDisabled; /** * This should be implemented by all entity classes to return the id of the * entity represented by the &lt;T&gt; generic argument * * @return the id of the entity */ @Id @GeneratedValue(strategy = GenerationType.AUTO, generator = "access_token_seq") @SequenceGenerator(name = "access_token_seq", sequenceName = "access_token_seq") @Column(name = "id") public Long getId() { return id; } public void setId(Long id) { this.id = id; } @Column(name = "token_value", length = 150, unique = true, nullable = true) public String getTokenValue() { return tokenValue; } public void setTokenValue(String tokenValue) { this.tokenValue = tokenValue; } @ManyToOne(fetch = FetchType.LAZY) @JoinColumn(name = "user_orcid") public ProfileEntity getProfile() { return profile; } public void setProfile(ProfileEntity profile) { this.profile = profile; } @ManyToOne(fetch = FetchType.LAZY) @JoinColumn(name = "client_details_id") public ClientDetailsEntity getClientDetailsEntity() { return clientDetailsEntity; } public void setClientDetailsEntity(ClientDetailsEntity clientDetailsEntity) { this.clientDetailsEntity = clientDetailsEntity; } @Column(name = "refresh_token_expiration") public Date getRefreshTokenExpiration() { return refreshTokenExpiration; } public void setRefreshTokenExpiration(Date refreshTokenExpiration) { this.refreshTokenExpiration = refreshTokenExpiration; } @Column(name = "refresh_token_value", length = 150, unique = true, nullable = true) public String getRefreshTokenValue() { return refreshTokenValue; } public void setRefreshTokenValue(String refreshTokenValue) { this.refreshTokenValue = refreshTokenValue; } @Column(name = "is_approved") public boolean isApproved() { return approved; } public void setApproved(boolean approved) { this.approved = approved; } @Column(name = "redirect_uri", length = 350) public String getRedirectUri() { return redirectUri; } public void setRedirectUri(String redirectUri) { this.redirectUri = redirectUri; } @Column(name = "response_type", length = 100) public String getResponseType() { return responseType; } public void setResponseType(String responseType) { this.responseType = responseType; } @Column(name = "state", length = 40) public String getState() { return state; } public void setState(String state) { this.state = state; } @Column(name = "scope_type", length = 50) public String getScope() { return scope; } public void setScope(String scope) { this.scope = scope; } @Column(name = "resource_id", length = 50) public String getResourceId() { return resourceId; } public void setResourceId(String resourceId) { this.resourceId = resourceId; } @Column(name = "token_type", length = 50) public String getTokenType() { return tokenType; } public void setTokenType(String tokenType) { this.tokenType = tokenType; } @Column(name = "token_expiration") public Date getTokenExpiration() { return tokenExpiration; } public void setTokenExpiration(Date tokenExpiration) { this.tokenExpiration = tokenExpiration; } @Column(name = "authentication_key", length = 150, unique = true) public String getAuthenticationKey() { return authenticationKey; } public void setAuthenticationKey(String authenticationKey) { this.authenticationKey = authenticationKey; } @Column(name = "token_disabled") public Boolean getTokenDisabled() { return tokenDisabled; } public void setTokenDisabled(Boolean tokenDisabled) { this.tokenDisabled = tokenDisabled; } @Override public int compareTo(OrcidOauth2TokenDetail other) { - ProfileEntity otherProfileEntity = other.getProfile(); - int compareName = profile.getCreditName().compareTo(otherProfileEntity.getCreditName()); + ProfileEntity clientProfileEntity = clientDetailsEntity.getProfile(); + ProfileEntity otherClientProfileEntity = other.getClientDetailsEntity().getProfile(); + int compareName = clientProfileEntity.getCreditName().compareTo(otherClientProfileEntity.getCreditName()); if (compareName != 0) { return compareName; } Date thisDateCreated = getDateCreated(); if (thisDateCreated != null) { Date otherDateCreated = other.getDateCreated(); if (otherDateCreated != null) { int compareDateCreated = thisDateCreated.compareTo(otherDateCreated); if (compareDateCreated != 0) { return compareDateCreated; } } } return tokenValue.compareTo(other.tokenValue); } }
true
true
public int compareTo(OrcidOauth2TokenDetail other) { ProfileEntity otherProfileEntity = other.getProfile(); int compareName = profile.getCreditName().compareTo(otherProfileEntity.getCreditName()); if (compareName != 0) { return compareName; } Date thisDateCreated = getDateCreated(); if (thisDateCreated != null) { Date otherDateCreated = other.getDateCreated(); if (otherDateCreated != null) { int compareDateCreated = thisDateCreated.compareTo(otherDateCreated); if (compareDateCreated != 0) { return compareDateCreated; } } } return tokenValue.compareTo(other.tokenValue); }
public int compareTo(OrcidOauth2TokenDetail other) { ProfileEntity clientProfileEntity = clientDetailsEntity.getProfile(); ProfileEntity otherClientProfileEntity = other.getClientDetailsEntity().getProfile(); int compareName = clientProfileEntity.getCreditName().compareTo(otherClientProfileEntity.getCreditName()); if (compareName != 0) { return compareName; } Date thisDateCreated = getDateCreated(); if (thisDateCreated != null) { Date otherDateCreated = other.getDateCreated(); if (otherDateCreated != null) { int compareDateCreated = thisDateCreated.compareTo(otherDateCreated); if (compareDateCreated != 0) { return compareDateCreated; } } } return tokenValue.compareTo(other.tokenValue); }
diff --git a/CBDT/src/cbdt/view/analysis/tree/treemodel/NodeLine.java b/CBDT/src/cbdt/view/analysis/tree/treemodel/NodeLine.java index 5b1117c..def807d 100644 --- a/CBDT/src/cbdt/view/analysis/tree/treemodel/NodeLine.java +++ b/CBDT/src/cbdt/view/analysis/tree/treemodel/NodeLine.java @@ -1,24 +1,24 @@ package cbdt.view.analysis.tree.treemodel; import cbdt.view.analysis.tree.TreePApplet; public class NodeLine { NodeCircle from; NodeCircle to; private TreePApplet pApplet; public NodeLine(TreePApplet pApplet, NodeCircle from, NodeCircle to) { this.pApplet = pApplet; this.from = from; this.to = to; } public void draw(){ int x1 = pApplet.getZoomConverter().convertToWindowCoordinatesX(from.getDocumentCoordinateX()); int y1 = pApplet.getZoomConverter().convertToWindowCoordinatesY(from.getDocumentCoordinateY()) + NodeCircle.radius; int x2 = pApplet.getZoomConverter().convertToWindowCoordinatesX(to.getDocumentCoordinateX()); - int y2 = pApplet.getZoomConverter().convertToWindowCoordinatesX(to.getDocumentCoordinateY()) - NodeCircle.radius; + int y2 = pApplet.getZoomConverter().convertToWindowCoordinatesY(to.getDocumentCoordinateY()) - NodeCircle.radius; pApplet.line(x1, y1, x2, y2); } }
true
true
public void draw(){ int x1 = pApplet.getZoomConverter().convertToWindowCoordinatesX(from.getDocumentCoordinateX()); int y1 = pApplet.getZoomConverter().convertToWindowCoordinatesY(from.getDocumentCoordinateY()) + NodeCircle.radius; int x2 = pApplet.getZoomConverter().convertToWindowCoordinatesX(to.getDocumentCoordinateX()); int y2 = pApplet.getZoomConverter().convertToWindowCoordinatesX(to.getDocumentCoordinateY()) - NodeCircle.radius; pApplet.line(x1, y1, x2, y2); }
public void draw(){ int x1 = pApplet.getZoomConverter().convertToWindowCoordinatesX(from.getDocumentCoordinateX()); int y1 = pApplet.getZoomConverter().convertToWindowCoordinatesY(from.getDocumentCoordinateY()) + NodeCircle.radius; int x2 = pApplet.getZoomConverter().convertToWindowCoordinatesX(to.getDocumentCoordinateX()); int y2 = pApplet.getZoomConverter().convertToWindowCoordinatesY(to.getDocumentCoordinateY()) - NodeCircle.radius; pApplet.line(x1, y1, x2, y2); }
diff --git a/test/tekai/test/ParserTest.java b/test/tekai/test/ParserTest.java index e007a1b..4f9b663 100644 --- a/test/tekai/test/ParserTest.java +++ b/test/tekai/test/ParserTest.java @@ -1,422 +1,422 @@ package tekai.test; import static org.junit.Assert.assertEquals; import static org.junit.Assert.fail; import java.util.regex.Pattern; import org.junit.Test; import tekai.Expression; import tekai.Parselet; import tekai.Parser; import tekai.standard.AtomParselet; import tekai.standard.InfixParselet; import tekai.standard.GroupingParselet; import tekai.standard.PrefixParselet; import tekai.standard.BeforeMiddleAfterParselet; public class ParserTest { @Test public void justAnAtom() { assertParsing("Just a number", "[1]:NUMBER", "1"); assertParsing("Just an identifier", "[abc]:IDENTIFIER", "abc"); } @Test public void simpleExpression() { assertParsing("Simple infix", "([+]:ARITHMETIC [1]:NUMBER [2]:NUMBER)", "1 + 2"); assertParsing("Double infix (left associativity)", "([+]:ARITHMETIC ([+]:ARITHMETIC [1]:NUMBER [2]:NUMBER) [3]:NUMBER)", "1 + 2 + 3"); assertParsing("Double infix with parenthesis", "([+]:ARITHMETIC [1]:NUMBER ([+]:ARITHMETIC [2]:NUMBER [3]:NUMBER))", "1 + (2 + 3)"); } @Test public void functions() { assertParsing("[abc]:FUNCTION", "abc()"); assertParsing("([abc]:FUNCTION [1]:NUMBER)", "abc(1)"); assertParsing("([abc]:FUNCTION [1]:NUMBER [2]:NUMBER)", "abc(1, 2)"); assertParsing("([abc]:FUNCTION [1]:NUMBER [2]:NUMBER [3]:NUMBER)", "abc(1, 2, 3)"); assertParsing("([+]:ARITHMETIC ([abc]:FUNCTION [4]:NUMBER) ([def]:FUNCTION [3]:NUMBER [2]:NUMBER))", "abc(4) + def(3, 2)"); assertParsing("([abc]:FUNCTION ([+]:ARITHMETIC ([+]:ARITHMETIC [2]:NUMBER [1]:NUMBER) [3]:NUMBER))", "abc((2 + 1) + 3)"); assertParsing("([+]:ARITHMETIC ([+]:ARITHMETIC ([+]:ARITHMETIC [1]:NUMBER ([abc]:FUNCTION ([+]:ARITHMETIC [2]:NUMBER [3]:NUMBER) [4]:NUMBER)) [5]:NUMBER) [6]:NUMBER)", "(1 + abc(2 + 3, 4) + 5) + 6"); assertParsing("([abc]:FUNCTION ([def]:FUNCTION [1]:NUMBER) ([ghi]:FUNCTION [2]:NUMBER))", "abc(def(1), ghi(2))"); } @Test public void selectFrom() { assertParsing("([SQL]:SQL ([SELECT]:SELECT [campo1]:IDENTIFIER [campo2]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER [tabela2]:IDENTIFIER))", "SELECT campo1, campo2 FROM tabela, tabela2"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT * FROM tabela"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER ([INNER JOIN]:JOIN [outra_tabela]:IDENTIFIER [xxx]:IDENTIFIER)))", "SELECT * FROM tabela INNER JOIN outra_tabela ON xxx"); } @Test public void selectWithWhere(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([+]:ARITHMETIC [campo]:IDENTIFIER [2]:NUMBER)))", "SELECT * FROM tabela WHERE campo + 2"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([=]:OPERATOR [tabela.campo1]:IDENTIFIER [tabela.campo2]:IDENTIFIER)))", "SELECT * FROM tabela WHERE tabela.campo1 = tabela.campo2"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([AND]:BOOLEAN ([=]:OPERATOR [campo]:IDENTIFIER [2]:NUMBER) ([=]:OPERATOR [id]:IDENTIFIER [3]:NUMBER))))", "SELECT * FROM tabela WHERE campo = 2 AND id = 3"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([OR]:BOOLEAN ([AND]:BOOLEAN ([=]:OPERATOR [campo]:IDENTIFIER [2]:NUMBER) ([=]:OPERATOR [id]:IDENTIFIER [3]:NUMBER)) ([=]:OPERATOR [campo]:IDENTIFIER [5.5]:NUMBER))))", "SELECT * FROM tabela WHERE campo = 2 AND id = 3 OR campo = 5.5"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([OR]:BOOLEAN ([AND]:BOOLEAN ([=]:OPERATOR [campo]:IDENTIFIER [2]:NUMBER) ([=]:OPERATOR [id]:IDENTIFIER [35.89]:NUMBER)) ([=]:OPERATOR [campo]:IDENTIFIER [5]:NUMBER))))", "SELECT * FROM tabela WHERE (campo = 2) AND id = 35.89 OR (campo = 5)"); } @Test public void selectWithAlias(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT [tb.campo1]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT tb.campo1 FROM tabela"); assertParsing("([SQL]:SQL ([SELECT]:SELECT ([AS]:ALIAS [campo]:IDENTIFIER [nome]:IDENTIFIER)) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT campo AS nome FROM tabela"); assertParsing("([SQL]:SQL ([SELECT]:SELECT ([AS]:ALIAS [tb.campo1]:IDENTIFIER [nome]:IDENTIFIER)) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT tb.campo1 AS nome FROM tabela"); } @Test public void selectWithConcat(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT ([||]:CONCAT [campo1]:IDENTIFIER [campo2]:IDENTIFIER)) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT campo1 || campo2 FROM tabela"); assertParsing("([SQL]:SQL ([SELECT]:SELECT ([||]:CONCAT [campo1]:IDENTIFIER [campo2]:IDENTIFIER [campo3]:IDENTIFIER)) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT campo1 || campo2 || campo3 FROM tabela"); assertParsing("([SQL]:SQL ([SELECT]:SELECT ([||]:CONCAT [campo1]:IDENTIFIER [campo2]:IDENTIFIER ([abc]:FUNCTION [campo3]:IDENTIFIER [campo4]:IDENTIFIER))) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT campo1 || campo2 || abc(campo3, campo4) FROM tabela"); assertParsing("([SQL]:SQL ([SELECT]:SELECT ([||]:CONCAT [campo1]:IDENTIFIER ['string']:STRING ([abc]:FUNCTION [campo3]:IDENTIFIER [campo4]:IDENTIFIER))) ([FROM]:FROM [tabela]:IDENTIFIER))", "SELECT campo1 || 'string' || abc(campo3, campo4) FROM tabela"); } @Test public void selectWithJoin(){ String expected = "([SQL]:SQL\n" + " ([SELECT]:SELECT\n" + " [C120.idcomercial]:IDENTIFIER\n" + " [C120.idnome]:IDENTIFIER\n" + " [X040.razsoc]:IDENTIFIER\n" + " ([as]:ALIAS [X040.docto1]:IDENTIFIER [cnpj]:IDENTIFIER)\n" + " ([AS]:ALIAS [X030.nomcid]:IDENTIFIER [municipio]:IDENTIFIER)\n" + " ([AS]:ALIAS [X030.uf]:IDENTIFIER [uf]:IDENTIFIER)\n" + " ([=]:ALIAS [chave_acesso]:IDENTIFIER [' ']:STRING)\n" + " ([=]:ALIAS [data_acesso]:IDENTIFIER ['00/00/0000 00:00:00']:STRING)\n" + " ([AS]:ALIAS [X040.docto2]:IDENTIFIER [inscricao]:IDENTIFIER))\n" + " ([FROM]:FROM\n" + " ([AS]:ALIAS [ACT12000]:IDENTIFIER [C120]:IDENTIFIER)\n" + " ([INNER JOIN]:JOIN\n" + " ([AS]:ALIAS [AXT04000]:IDENTIFIER [X040]:IDENTIFIER)\n" + " ([=]:OPERATOR [X040.idnome]:IDENTIFIER [C120.idnome]:IDENTIFIER))\n" + " ([INNER JOIN]:JOIN\n" + " ([AS]:ALIAS [AXT02000]:IDENTIFIER [X020A]:IDENTIFIER)\n" + " ([=]:OPERATOR [X020A.idparametro]:IDENTIFIER [C120.sitsis]:IDENTIFIER))\n" + " ([INNER JOIN]:JOIN\n" + " ([AS]:ALIAS [AXT02000]:IDENTIFIER [X020B]:IDENTIFIER)\n" + " ([=]:OPERATOR [X020B.idparametro]:IDENTIFIER [C120.sitcom]:IDENTIFIER))\n" + " ([INNER JOIN]:JOIN\n" + " ([AS]:ALIAS [AXT02000]:IDENTIFIER [X020C]:IDENTIFIER)\n" + " ([=]:OPERATOR [X020C.idparametro]:IDENTIFIER [C120.sitlas]:IDENTIFIER))\n" + " ([INNER JOIN]:JOIN\n" + " ([AS]:ALIAS [AXT03000]:IDENTIFIER [X030]:IDENTIFIER)\n" + " ([=]:OPERATOR [X030.idcidade]:IDENTIFIER [X040.idcidade]:IDENTIFIER))))"; Pattern spaces = Pattern.compile("\n\\s+", Pattern.MULTILINE); assertParsing(spaces.matcher(expected).replaceAll(" "), " SELECT C120.idcomercial, " + " C120.idnome, " + " X040.razsoc, " + " X040.docto1 as cnpj, " + " X030.nomcid AS municipio, " + " X030.uf AS uf, " + " chave_acesso = ' ', " + " data_acesso = '00/00/0000 00:00:00', " + " X040.docto2 AS inscricao " + " FROM ACT12000 AS C120 " + " INNER JOIN AXT04000 AS X040 ON X040.idnome = C120.idnome " + " INNER JOIN AXT02000 AS X020A ON X020A.idparametro = C120.sitsis " + " INNER JOIN AXT02000 AS X020B ON X020B.idparametro = C120.sitcom " + " INNER JOIN AXT02000 AS X020C ON X020C.idparametro = C120.sitlas " + " INNER JOIN AXT03000 AS X030 ON X030.idcidade = X040.idcidade "); } @Test public void selectOrder(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([=]:OPERATOR [campo]:IDENTIFIER [2]:NUMBER)) ([ORDER BY]:ORDER [campo2]:IDENTIFIER))", "SELECT * FROM tabela WHERE campo = 2 ORDER BY campo2"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([=]:OPERATOR [campo]:IDENTIFIER [2]:NUMBER)) ([ORDER BY]:ORDER [campo2]:IDENTIFIER [campo3]:IDENTIFIER [campo4]:IDENTIFIER))", "SELECT * FROM tabela WHERE campo = 2 ORDER BY campo2, campo3, campo4"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([ORDER BY]:ORDER [campo2]:IDENTIFIER [campo3]:IDENTIFIER [campo4]:IDENTIFIER [ASC]:ORDERING))", "SELECT * FROM tabela ORDER BY campo2, campo3, campo4 ASC"); } @Test public void selectLimit(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([=]:OPERATOR [campo]:IDENTIFIER [2]:NUMBER)) ([LIMIT]:LIMIT [10]:NUMBER))", "SELECT * FROM tabela WHERE campo = 2 LIMIT 10"); assertParsing("([SQL]:SQL ([SELECT]:SELECT [*]:IDENTIFIER) ([FROM]:FROM [tabela]:IDENTIFIER) ([WHERE]:WHERE ([=]:OPERATOR [campo]:IDENTIFIER [2]:NUMBER)) ([ORDER BY]:ORDER [campo2]:IDENTIFIER) ([LIMIT]:LIMIT [10]:NUMBER ([OFFSET]:OFFSET [0]:NUMBER)))", "SELECT * FROM tabela WHERE campo = 2 ORDER BY campo2 LIMIT 10 OFFSET 0"); } @Test public void TestCase(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT ([CASE]:CASE [campo]:IDENTIFIER ([WHEN]:WHEN [1]:NUMBER ([THEN]:THEN ['Aguarda Distribuição']:STRING)) ([WHEN]:WHEN [2]:NUMBER ([THEN]:THEN ['Em Análise']:STRING)) ([ELSE]:ELSE ['']:STRING))) ([FROM]:FROM ([as]:ALIAS [sat00100]:IDENTIFIER [sa001]:IDENTIFIER)))", " SELECT CASE campo" + " WHEN 1 THEN 'Aguarda Distribuição'" + " WHEN 2 THEN 'Em Análise'" + " ELSE '' END " + " FROM sat00100 as sa001"); assertParsing("([SQL]:SQL ([SELECT]:SELECT ([CASE]:CASE ([*]:ARITHMETIC [x]:IDENTIFIER [5]:NUMBER) ([WHEN]:WHEN [1]:NUMBER ([THEN]:THEN ([=]:OPERATOR [msg]:IDENTIFIER ['one or two']:STRING))) ([ELSE]:ELSE ([=]:OPERATOR [msg]:IDENTIFIER ['other value than one or two']:STRING)))) ([FROM]:FROM [TABELA]:IDENTIFIER))", "SELECT CASE x*5 " + "WHEN 1 THEN msg = 'one or two' " + "ELSE msg = 'other value than one or two'" + "END " + "FROM TABELA"); } @Test public void subSelect(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT [DISTINCT]:DISTINCT [ax050.idinterno]:IDENTIFIER [ax050.descricao]:IDENTIFIER ([||]:CONCAT ([=]:OPERATOR ['sistema']:STRING ([RTRIM]:FUNCTION [ax050.idinterno]:IDENTIFIER)) [' - ']:STRING ([RTRIM]:FUNCTION [ax050.descricao]:IDENTIFIER))) ([FROM]:FROM ([AS]:ALIAS [AXT05000]:IDENTIFIER [ax050]:IDENTIFIER)) ([WHERE]:WHERE ([like]:LIKE [ax050.Descricao]:IDENTIFIER ['SERVIÇOS DE TI%']:STRING)))", "SELECT DISTINCT ax050.idinterno, ax050.descricao, " + " 'sistema' = RTRIM(ax050.idinterno) || ' - ' || RTRIM(ax050.descricao) " + " FROM AXT05000 AS ax050 " + " WHERE ax050.Descricao like 'SERVIÇOS DE TI%' "); } @Test public void SelectGroup(){ assertParsing("([SQL]:SQL ([SELECT]:SELECT [DISTINCT]:DISTINCT [ax050.idinterno]:IDENTIFIER [ax050.descricao]:IDENTIFIER ([||]:CONCAT ([=]:OPERATOR ['sistema']:STRING ([RTRIM]:FUNCTION [ax050.idinterno]:IDENTIFIER)) [' - ']:STRING ([RTRIM]:FUNCTION [ax050.descricao]:IDENTIFIER))) ([FROM]:FROM ([AS]:ALIAS [AXT05000]:IDENTIFIER [ax050]:IDENTIFIER)) ([WHERE]:WHERE ([like]:LIKE [ax050.Descricao]:IDENTIFIER ['SERVIÇOS DE TI%']:STRING)) ([GROUP BY]:GROUP [campo1]:IDENTIFIER [campo2]:IDENTIFIER))", "SELECT DISTINCT ax050.idinterno, ax050.descricao, " + " 'sistema' = RTRIM(ax050.idinterno) || ' - ' || RTRIM(ax050.descricao) " + " FROM AXT05000 AS ax050 " + " WHERE ax050.Descricao like 'SERVIÇOS DE TI%' " + " GROUP BY campo1, campo2"); } @Test public void exceptions() { // TODO Launch specific exception to specific problems // TODO Add more and more contextual information to error messages try { parse("1 +"); fail("Expected not able to parse an incomplete expression \"1 +\""); } catch (Exception e) { // success } } // == Helpers == private void assertParsing(String expected, String source) { assertParsing(null, expected, source); } private void assertParsing(String message, String expected, String source) { Expression expression = parse(source); assertEquals(message, expected, expression.toString()); } private Expression parse(String source) { Parser parser = new Parser(source); configureParser(parser); Expression expression = parser.parse(); return expression; } private void configureParser(Parser parser) { // PRECEDENCE (What to parse first. Higher numbers means more precedence) int x = 1; final int ATOM = x++; final int OR = x++; final int AND = x++; final int NOT = x++; final int LIKE = x++; final int EQUALS = x++; final int MULTIPLY = x++; final int SUM = x++; final int GROUPING = x++; final int GROUP = x++; final int FUNCTION = x++; final int CASE = x++; final int ORDER = x++; final int SELECT = x++; // SQL parser.register(new Parselet(SELECT) { @Override public boolean isPrefixParselet() { return true; } @Override public String startingRegularExpression() { return "\\b((?i)SELECT)\\b"; } @Override public Expression parse() { Expression result = new Expression("SQL", "SQL"); Expression fields = new Expression("SELECT", lastMatchTrimmed()); if(canConsume("\\b((?i)DISTINCT)\\b")){ fields.addChildren(new Expression("DISTINCT", lastMatchTrimmed())); } do { Expression field = nextExpression(); if (field.isType("OPERATOR")) { Expression substitute = new Expression("ALIAS", field.getValue()); substitute.addChildren(field.getChildren()); field = substitute; } fields.addChildren(field); } while (canConsume("\\,")); consumeIf("\\b((?i)FROM)\\b"); Expression from = new Expression("FROM", "FROM"); do { from.addChildren(nextExpression()); } while(canConsume("\\,")); while (canConsume("\\b((?i)INNER(?: OUTER|RIGHT|LEFT)? JOIN)\\b")) { Expression join = new Expression("JOIN", lastMatchTrimmed()); join.addChildren(nextExpression()); consumeIf("ON"); join.addChildren(nextExpression()); from.addChildren(join); } result.addChildren(fields, from); if(canConsume("\\b((?i)WHERE)\\b")){ Expression where = new Expression("WHERE", "WHERE"); where.addChildren(nextExpression()); result.addChildren(where); } if(canConsume("\\b((?i)GROUP\\s+BY)\\b")){ Expression group = new Expression("GROUP", "GROUP BY"); do{ group.addChildren(nextExpression()); }while(canConsume("\\,")); result.addChildren(group); } // result.addChildren(nextExpression()); /* if(canConsume("\\b((?i)HAVING)\\b")){ Expression having = new Expression("HAVING", "HAVING"); do{ having.addChildren(nextExpression()); }while(canConsume("\\,")); result.addChildren(having); }*/ if(canConsume("\\b((?i)ORDER\\s+BY)\\b")){ Expression order = new Expression("ORDER", "ORDER BY"); do { order.addChildren(nextExpression()); } while(canConsume("\\,")); - if(canConsume("\\ASC|DESC")) + if(canConsume("\\b((?i)ASC|DESC)\\b")) order.addChildren(new Expression("ORDERING", lastMatchTrimmed())); result.addChildren(order); } if(canConsume("\\b((?i)LIMIT)\\b")){ Expression limit = new Expression("LIMIT", "LIMIT"); limit.addChildren(nextExpression()); if(canConsume("\\b((?i)OFFSET)\\b")){ Expression offset = new Expression("OFFSET", "OFFSET"); offset.addChildren(nextExpression()); limit.addChildren(offset); } result.addChildren(limit); } return result; } }); //CASE parser.register(new Parselet(CASE) { @Override public boolean isPrefixParselet() { return true; } @Override public String startingRegularExpression() { return "\\b((?i)CASE)\\b"; } @Override protected Expression parse() { Expression ecase = new Expression("CASE", lastMatchTrimmed()); do{ if(canConsume("\\b((?i)WHEN)\\b")){ Expression when = new Expression("WHEN", "WHEN"); when.addChildren(nextExpression()); consumeIf("\\b((?i)THEN)\\b"); Expression then = new Expression("THEN", "THEN"); then.addChildren(nextExpression()); when.addChildren(then); ecase.addChildren(when); }else if(canConsume("\\b((?i)ELSE)\\b")){ Expression eelse = new Expression("ELSE", "ELSE"); eelse.addChildren(nextExpression()); ecase.addChildren(eelse); }else ecase.addChildren(nextExpression()); }while(cannotConsume("\\b((?i)END)\\b")); return ecase; } }); // BOOLEAN parser.register(new InfixParselet(OR, "\\b((?i)OR)\\b", "BOOLEAN")); parser.register(new InfixParselet(AND, "\\b((?i)AND)\\b", "BOOLEAN")); parser.register(new PrefixParselet(NOT, "\\b((?i)NOT)\\b", "BOOLEAN")); //LIKE parser.register(new InfixParselet(LIKE, "\\b((?i)LIKE)\\b", "LIKE")); // ARITHMETIC parser.register(new InfixParselet(MULTIPLY, "(\\*|/|%)", "ARITHMETIC")); parser.register(new InfixParselet(SUM, "(\\+|-)", "ARITHMETIC")); //ALIAS parser.register(new InfixParselet(ATOM, "\\b((?i)AS)\\b", "ALIAS")); //EQUALS (OPERATOR) parser.register(new InfixParselet(EQUALS, "=", "OPERATOR")); //CONCAT parser.register(new BeforeMiddleAfterParselet(ATOM, null, "\\|\\|", null, "CONCAT")); //GROUP BY parser.register(new BeforeMiddleAfterParselet(GROUP, "\\b((?i)GROUP\\s+BY)\\b", "\\,", null, "GROUPBY")); //parser.register(new BeforeMiddleAfterParselet(ORDER, "\\b((?i)HAVING)\\b", "\\,", null, "HAVING")); // GROUPING (parenthesis) parser.register(new GroupingParselet(GROUPING, "\\(", "\\)")); // FUNCTION parser.register(new BeforeMiddleAfterParselet(FUNCTION, "(\\w+)\\s*\\(", ",", "\\)", "FUNCTION")); //ORDER BY //parser.register(new BeforeMiddleAfterParselet(ORDER, "\\b((?i)ORDER\\s+BY)\\b", ",", "(\\b((?i)ASC)\\b|\\b((?i)DESC)\\b)?", "ORDER BY")); //NUMBER parser.register(new AtomParselet(ATOM, "\\d+(?:\\.\\d+)?", "NUMBER")); //STRING parser.register(new AtomParselet(ATOM, "\\'[^\\']*?\\'", "STRING")); //IDENTIFIER parser.register(new AtomParselet(ATOM, "(\\w+\\.\\w+|\\w+|\\*)", "IDENTIFIER")); } }
true
true
private void configureParser(Parser parser) { // PRECEDENCE (What to parse first. Higher numbers means more precedence) int x = 1; final int ATOM = x++; final int OR = x++; final int AND = x++; final int NOT = x++; final int LIKE = x++; final int EQUALS = x++; final int MULTIPLY = x++; final int SUM = x++; final int GROUPING = x++; final int GROUP = x++; final int FUNCTION = x++; final int CASE = x++; final int ORDER = x++; final int SELECT = x++; // SQL parser.register(new Parselet(SELECT) { @Override public boolean isPrefixParselet() { return true; } @Override public String startingRegularExpression() { return "\\b((?i)SELECT)\\b"; } @Override public Expression parse() { Expression result = new Expression("SQL", "SQL"); Expression fields = new Expression("SELECT", lastMatchTrimmed()); if(canConsume("\\b((?i)DISTINCT)\\b")){ fields.addChildren(new Expression("DISTINCT", lastMatchTrimmed())); } do { Expression field = nextExpression(); if (field.isType("OPERATOR")) { Expression substitute = new Expression("ALIAS", field.getValue()); substitute.addChildren(field.getChildren()); field = substitute; } fields.addChildren(field); } while (canConsume("\\,")); consumeIf("\\b((?i)FROM)\\b"); Expression from = new Expression("FROM", "FROM"); do { from.addChildren(nextExpression()); } while(canConsume("\\,")); while (canConsume("\\b((?i)INNER(?: OUTER|RIGHT|LEFT)? JOIN)\\b")) { Expression join = new Expression("JOIN", lastMatchTrimmed()); join.addChildren(nextExpression()); consumeIf("ON"); join.addChildren(nextExpression()); from.addChildren(join); } result.addChildren(fields, from); if(canConsume("\\b((?i)WHERE)\\b")){ Expression where = new Expression("WHERE", "WHERE"); where.addChildren(nextExpression()); result.addChildren(where); } if(canConsume("\\b((?i)GROUP\\s+BY)\\b")){ Expression group = new Expression("GROUP", "GROUP BY"); do{ group.addChildren(nextExpression()); }while(canConsume("\\,")); result.addChildren(group); } // result.addChildren(nextExpression()); /* if(canConsume("\\b((?i)HAVING)\\b")){ Expression having = new Expression("HAVING", "HAVING"); do{ having.addChildren(nextExpression()); }while(canConsume("\\,")); result.addChildren(having); }*/ if(canConsume("\\b((?i)ORDER\\s+BY)\\b")){ Expression order = new Expression("ORDER", "ORDER BY"); do { order.addChildren(nextExpression()); } while(canConsume("\\,")); if(canConsume("\\ASC|DESC")) order.addChildren(new Expression("ORDERING", lastMatchTrimmed())); result.addChildren(order); } if(canConsume("\\b((?i)LIMIT)\\b")){ Expression limit = new Expression("LIMIT", "LIMIT"); limit.addChildren(nextExpression()); if(canConsume("\\b((?i)OFFSET)\\b")){ Expression offset = new Expression("OFFSET", "OFFSET"); offset.addChildren(nextExpression()); limit.addChildren(offset); } result.addChildren(limit); } return result; } });
private void configureParser(Parser parser) { // PRECEDENCE (What to parse first. Higher numbers means more precedence) int x = 1; final int ATOM = x++; final int OR = x++; final int AND = x++; final int NOT = x++; final int LIKE = x++; final int EQUALS = x++; final int MULTIPLY = x++; final int SUM = x++; final int GROUPING = x++; final int GROUP = x++; final int FUNCTION = x++; final int CASE = x++; final int ORDER = x++; final int SELECT = x++; // SQL parser.register(new Parselet(SELECT) { @Override public boolean isPrefixParselet() { return true; } @Override public String startingRegularExpression() { return "\\b((?i)SELECT)\\b"; } @Override public Expression parse() { Expression result = new Expression("SQL", "SQL"); Expression fields = new Expression("SELECT", lastMatchTrimmed()); if(canConsume("\\b((?i)DISTINCT)\\b")){ fields.addChildren(new Expression("DISTINCT", lastMatchTrimmed())); } do { Expression field = nextExpression(); if (field.isType("OPERATOR")) { Expression substitute = new Expression("ALIAS", field.getValue()); substitute.addChildren(field.getChildren()); field = substitute; } fields.addChildren(field); } while (canConsume("\\,")); consumeIf("\\b((?i)FROM)\\b"); Expression from = new Expression("FROM", "FROM"); do { from.addChildren(nextExpression()); } while(canConsume("\\,")); while (canConsume("\\b((?i)INNER(?: OUTER|RIGHT|LEFT)? JOIN)\\b")) { Expression join = new Expression("JOIN", lastMatchTrimmed()); join.addChildren(nextExpression()); consumeIf("ON"); join.addChildren(nextExpression()); from.addChildren(join); } result.addChildren(fields, from); if(canConsume("\\b((?i)WHERE)\\b")){ Expression where = new Expression("WHERE", "WHERE"); where.addChildren(nextExpression()); result.addChildren(where); } if(canConsume("\\b((?i)GROUP\\s+BY)\\b")){ Expression group = new Expression("GROUP", "GROUP BY"); do{ group.addChildren(nextExpression()); }while(canConsume("\\,")); result.addChildren(group); } // result.addChildren(nextExpression()); /* if(canConsume("\\b((?i)HAVING)\\b")){ Expression having = new Expression("HAVING", "HAVING"); do{ having.addChildren(nextExpression()); }while(canConsume("\\,")); result.addChildren(having); }*/ if(canConsume("\\b((?i)ORDER\\s+BY)\\b")){ Expression order = new Expression("ORDER", "ORDER BY"); do { order.addChildren(nextExpression()); } while(canConsume("\\,")); if(canConsume("\\b((?i)ASC|DESC)\\b")) order.addChildren(new Expression("ORDERING", lastMatchTrimmed())); result.addChildren(order); } if(canConsume("\\b((?i)LIMIT)\\b")){ Expression limit = new Expression("LIMIT", "LIMIT"); limit.addChildren(nextExpression()); if(canConsume("\\b((?i)OFFSET)\\b")){ Expression offset = new Expression("OFFSET", "OFFSET"); offset.addChildren(nextExpression()); limit.addChildren(offset); } result.addChildren(limit); } return result; } });
diff --git a/src/main/java/org/apache/james/jspf/DNSServiceXBillImpl.java b/src/main/java/org/apache/james/jspf/DNSServiceXBillImpl.java index f72f27f..d1c113b 100644 --- a/src/main/java/org/apache/james/jspf/DNSServiceXBillImpl.java +++ b/src/main/java/org/apache/james/jspf/DNSServiceXBillImpl.java @@ -1,185 +1,187 @@ /**************************************************************** * Licensed to the Apache Software Foundation (ASF) under one * * or more contributor license agreements. See the NOTICE file * * distributed with this work for additional information * * regarding copyright ownership. The ASF licenses this file * * to you under the Apache License, Version 2.0 (the * * "License"); you may not use this file except in compliance * * with the License. You may obtain a copy of the License at * * * * http://www.apache.org/licenses/LICENSE-2.0 * * * * Unless required by applicable law or agreed to in writing, * * software distributed under the License is distributed on an * * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY * * KIND, either express or implied. See the License for the * * specific language governing permissions and limitations * * under the License. * ****************************************************************/ package org.apache.james.jspf; import java.net.InetAddress; import java.net.UnknownHostException; import java.util.ArrayList; import java.util.List; import org.apache.james.jspf.core.DNSService; import org.apache.james.jspf.core.IPAddr; import org.apache.james.jspf.core.Logger; import org.xbill.DNS.AAAARecord; import org.xbill.DNS.ARecord; import org.xbill.DNS.Lookup; import org.xbill.DNS.MXRecord; import org.xbill.DNS.PTRRecord; import org.xbill.DNS.Record; import org.xbill.DNS.TXTRecord; import org.xbill.DNS.TextParseException; import org.xbill.DNS.Type; /** * This class contains helper to get all neccassary DNS infos that are needed * for SPF */ public class DNSServiceXBillImpl implements DNSService { // Set seconds after which we return and TempError private static int timeOut = 20; // The logger private Logger log; // The record limit for lookups private int recordLimit; /** * Default Constructor */ public DNSServiceXBillImpl(Logger logger) { this.log = logger; // Default record limit is 10 this.recordLimit = 10; } /** * @see org.apache.james.jspf.core.DNSService#setTimeOut(int) */ public synchronized void setTimeOut(int timeOut) { DNSServiceXBillImpl.timeOut = timeOut; } /** * @see org.apache.james.jspf.core.DNSService#getLocalDomainNames(); */ public List getLocalDomainNames() { List names = new ArrayList(); log.debug("Start Local ipaddress lookup"); try { InetAddress ia[] = InetAddress.getAllByName(InetAddress .getLocalHost().getHostName()); for (int i = 0; i < ia.length; i++) { String host = ia[i].getHostName(); names.add(host); log.debug("Add hostname " + host + " to list"); } } catch (UnknownHostException e) { // just ignore this.. } return names; } /** * @return the current record limit */ public int getRecordLimit() { return recordLimit; } /** * Set a new limit for the number of records for MX and PTR lookups. * @param recordLimit */ public void setRecordLimit(int recordLimit) { this.recordLimit = recordLimit; } /** * @see org.apache.james.jspf.core.DNSService#getRecords(java.lang.String, int) */ public List getRecords(String hostname, int recordType) throws TimeoutException { String recordTypeDescription; int dnsJavaType; + int recordCount = 0; switch (recordType) { case A: recordTypeDescription = "A"; dnsJavaType = Type.A; break; case AAAA: recordTypeDescription = "AAAA"; dnsJavaType = Type.AAAA; break; case MX: recordTypeDescription = "MX"; dnsJavaType = Type.MX; break; case PTR: recordTypeDescription = "PTR"; dnsJavaType = Type.PTR; break; case TXT: recordTypeDescription = "TXT"; dnsJavaType = Type.TXT; break; // case SPF: recordTypeDescString = "SPF"; dnsJavaType = Type.SPF; break; default: // TODO fail! return null; } List records; try { log.debug("Start "+recordTypeDescription+"-Record lookup for : " + hostname); Lookup.getDefaultResolver().setTimeout(timeOut); Lookup query = new Lookup(hostname, dnsJavaType); Record[] rr = query.run(); int queryResult = query.getResult(); if (queryResult == Lookup.TRY_AGAIN) { throw new TimeoutException(); } if (rr != null && rr.length > 0) { records = new ArrayList(); for (int i = 0; i < rr.length; i++) { String res; switch (recordType) { case A: ARecord a = (ARecord) rr[i]; res = a.getAddress().getHostAddress(); break; case AAAA: AAAARecord aaaa = (AAAARecord) rr[i]; res = aaaa.getAddress().getHostAddress(); break; case MX: MXRecord mx = (MXRecord) rr[i]; res = mx.getTarget().toString(); break; case PTR: PTRRecord ptr = (PTRRecord) rr[i]; res = IPAddr.stripDot(ptr.getTarget().toString()); break; case TXT: TXTRecord txt = (TXTRecord) rr[i]; res = txt.rdataToString(); break; default: return null; } records.add(res); } + recordCount = rr.length; } else { records = null; } - log.debug("Found " + rr.length + " "+recordTypeDescription+"-Records"); + log.debug("Found " + recordCount + " "+recordTypeDescription+"-Records"); } catch (TextParseException e) { // i think this is the best we could do log.debug("No "+recordTypeDescription+" Record found for host: " + hostname); records = null; } return records; } }
false
true
public List getRecords(String hostname, int recordType) throws TimeoutException { String recordTypeDescription; int dnsJavaType; switch (recordType) { case A: recordTypeDescription = "A"; dnsJavaType = Type.A; break; case AAAA: recordTypeDescription = "AAAA"; dnsJavaType = Type.AAAA; break; case MX: recordTypeDescription = "MX"; dnsJavaType = Type.MX; break; case PTR: recordTypeDescription = "PTR"; dnsJavaType = Type.PTR; break; case TXT: recordTypeDescription = "TXT"; dnsJavaType = Type.TXT; break; // case SPF: recordTypeDescString = "SPF"; dnsJavaType = Type.SPF; break; default: // TODO fail! return null; } List records; try { log.debug("Start "+recordTypeDescription+"-Record lookup for : " + hostname); Lookup.getDefaultResolver().setTimeout(timeOut); Lookup query = new Lookup(hostname, dnsJavaType); Record[] rr = query.run(); int queryResult = query.getResult(); if (queryResult == Lookup.TRY_AGAIN) { throw new TimeoutException(); } if (rr != null && rr.length > 0) { records = new ArrayList(); for (int i = 0; i < rr.length; i++) { String res; switch (recordType) { case A: ARecord a = (ARecord) rr[i]; res = a.getAddress().getHostAddress(); break; case AAAA: AAAARecord aaaa = (AAAARecord) rr[i]; res = aaaa.getAddress().getHostAddress(); break; case MX: MXRecord mx = (MXRecord) rr[i]; res = mx.getTarget().toString(); break; case PTR: PTRRecord ptr = (PTRRecord) rr[i]; res = IPAddr.stripDot(ptr.getTarget().toString()); break; case TXT: TXTRecord txt = (TXTRecord) rr[i]; res = txt.rdataToString(); break; default: return null; } records.add(res); } } else { records = null; } log.debug("Found " + rr.length + " "+recordTypeDescription+"-Records"); } catch (TextParseException e) { // i think this is the best we could do log.debug("No "+recordTypeDescription+" Record found for host: " + hostname); records = null; } return records; }
public List getRecords(String hostname, int recordType) throws TimeoutException { String recordTypeDescription; int dnsJavaType; int recordCount = 0; switch (recordType) { case A: recordTypeDescription = "A"; dnsJavaType = Type.A; break; case AAAA: recordTypeDescription = "AAAA"; dnsJavaType = Type.AAAA; break; case MX: recordTypeDescription = "MX"; dnsJavaType = Type.MX; break; case PTR: recordTypeDescription = "PTR"; dnsJavaType = Type.PTR; break; case TXT: recordTypeDescription = "TXT"; dnsJavaType = Type.TXT; break; // case SPF: recordTypeDescString = "SPF"; dnsJavaType = Type.SPF; break; default: // TODO fail! return null; } List records; try { log.debug("Start "+recordTypeDescription+"-Record lookup for : " + hostname); Lookup.getDefaultResolver().setTimeout(timeOut); Lookup query = new Lookup(hostname, dnsJavaType); Record[] rr = query.run(); int queryResult = query.getResult(); if (queryResult == Lookup.TRY_AGAIN) { throw new TimeoutException(); } if (rr != null && rr.length > 0) { records = new ArrayList(); for (int i = 0; i < rr.length; i++) { String res; switch (recordType) { case A: ARecord a = (ARecord) rr[i]; res = a.getAddress().getHostAddress(); break; case AAAA: AAAARecord aaaa = (AAAARecord) rr[i]; res = aaaa.getAddress().getHostAddress(); break; case MX: MXRecord mx = (MXRecord) rr[i]; res = mx.getTarget().toString(); break; case PTR: PTRRecord ptr = (PTRRecord) rr[i]; res = IPAddr.stripDot(ptr.getTarget().toString()); break; case TXT: TXTRecord txt = (TXTRecord) rr[i]; res = txt.rdataToString(); break; default: return null; } records.add(res); } recordCount = rr.length; } else { records = null; } log.debug("Found " + recordCount + " "+recordTypeDescription+"-Records"); } catch (TextParseException e) { // i think this is the best we could do log.debug("No "+recordTypeDescription+" Record found for host: " + hostname); records = null; } return records; }
diff --git a/cvs/trunk/src/version1/src/com/rohanclan/cfml/views/snips/SnipVarParser.java b/cvs/trunk/src/version1/src/com/rohanclan/cfml/views/snips/SnipVarParser.java index 96b1e6ff..d89c63c7 100644 --- a/cvs/trunk/src/version1/src/com/rohanclan/cfml/views/snips/SnipVarParser.java +++ b/cvs/trunk/src/version1/src/com/rohanclan/cfml/views/snips/SnipVarParser.java @@ -1,168 +1,174 @@ /* * Created on May 6, 2004 * * TODO To change the template for this generated file go to * Window - Preferences - Java - Code Generation - Code and Comments */ package com.rohanclan.cfml.views.snips; import java.util.Date; import java.util.GregorianCalendar; import java.util.Calendar; import java.text.SimpleDateFormat; import org.eclipse.core.resources.IFile; import org.eclipse.jface.dialogs.InputDialog; import org.eclipse.swt.widgets.Shell; import java.io.File; /** * @author Stephen Milligan * * TODO To change the template for this generated type comment go to * Window - Preferences - Java - Code Generation - Code and Comments */ public class SnipVarParser { /** * */ public SnipVarParser() { super(); } public static String parse(String str, IFile activeFile, Shell shell ) { String currentFile = ""; String currentFolder = ""; String currentPath = ""; String currentProjectPath = ""; /* not sure why this next block is needed, but it causes the snippet * insert to fail on QA. Hope I am not misunderstanding something... * */ if (activeFile != null) { try { currentFile = activeFile.getName(); currentPath = activeFile.getRawLocation().toFile().getAbsolutePath(); File fullPath = new File(currentPath); currentFolder = fullPath.getParent(); currentProjectPath = activeFile.getParent().toString(); String[] path = currentProjectPath.split("/"); if (path.length > 0) { currentProjectPath = path[path.length-1]; } // Get your laughing gear round this little lot :) currentFile = currentFile.replaceAll("\\\\","\\\\\\\\"); currentPath = currentPath.replaceAll("\\\\","\\\\\\\\"); currentFolder = currentFolder.replaceAll("\\\\","\\\\\\\\"); currentProjectPath = currentProjectPath.replaceAll("\\\\","\\\\\\\\"); } catch (Exception e) { e.printStackTrace(System.err); } } /* * $${DATE} * $${MONTH} * $${TIME} * $${DATETIME} * $${DAYOFWEEK} * $${CURRENTFILE} - Current file name (just the file) * $${CURRENTFOLDER} - Current folder (The path to the containing folder) * $${CURRENTPATH} - Current path (full file name) * $${CURRENTPRJPATH} - Just the folder * $${USERNAME} - Current user * $${MONTHNUMBER} - Month as a number * $${DAYOFMONTH} - Day of month as a number * $${DAYOFWEEKNUMBER} - Day of week (the week starts on Sunday) * $${DATETIME24} - DateTime24 - a 24 hour clock version of datetime. * $${YEAR} - Current year. * $${YEAR2DIGIT} - Current two digit year. */ Calendar calendar = new GregorianCalendar(); Date currentTime = new Date(); calendar.setTime(currentTime); String newStr = str; newStr = newStr.replaceAll("\\$\\$\\{FULLDATE\\}",currentTime.toString()); SimpleDateFormat formatter = new SimpleDateFormat("M/d/yyyy"); String formattedDate = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATE\\}",formattedDate); formatter = new SimpleDateFormat("MMMM"); String formattedMonth = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{MONTH\\}",formattedMonth); formatter = new SimpleDateFormat("k:mm:ss a"); String formattedTime = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{TIME\\}",formattedTime); formatter = new SimpleDateFormat("M/d/yyyy K:mm:ss a"); String formattedDateTime = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATETIME\\}",formattedDateTime); formatter = new SimpleDateFormat("EEEE"); String formattedDayOfWeek = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DAYOFWEEK\\}",formattedDayOfWeek); newStr = newStr.replaceAll("\\$\\$\\{CURRENTFILE\\}",currentFile); newStr = newStr.replaceAll("\\$\\$\\{CURRENTFOLDER\\}",currentFolder); newStr = newStr.replaceAll("\\$\\$\\{CURRENTPATH\\}",currentPath); newStr = newStr.replaceAll("\\$\\$\\{CURRENTPRJPATH\\}",currentProjectPath); newStr = newStr.replaceAll("\\$\\$\\{USERNAME\\}",System.getProperty("user.name")); formatter = new SimpleDateFormat("MM"); String formattedMonthNumber = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{MONTHNUMBER\\}",formattedMonthNumber); formatter = new SimpleDateFormat("dd"); String formattedDayOfMonth = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DAYOFMONTH\\}",formattedDayOfMonth); newStr = newStr.replaceAll("\\$\\$\\{DAYOFWEEKNUMBER\\}",Integer.toString(calendar.get(Calendar.DAY_OF_WEEK))); formatter = new SimpleDateFormat("M/d/yyyy kk:mm:ss"); String formattedDateTime24 = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATETIME24\\}",formattedDateTime24); formatter = new SimpleDateFormat("yyyy"); String formattedYear = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{YEAR\\}",formattedYear); formatter = new SimpleDateFormat("yy"); String formattedYear2Digit = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{YEAR2DIGIT\\}",formattedYear2Digit); - while(newStr.indexOf("$${") > 0) { + while(newStr.indexOf("$${") >= 0) { int expressionStart = newStr.indexOf("$${")+3; int expressionEnd = newStr.indexOf("}",expressionStart); String expression = newStr.substring(expressionStart,expressionEnd); - InputDialog replacementDialog = new InputDialog(shell,"Replace variable",expression,"",null); + String stringArray[] = expression.split(":"); + String variable = stringArray[0]; + String defaultValue = ""; + if (stringArray.length > 1) { + defaultValue = stringArray[1]; + } + InputDialog replacementDialog = new InputDialog(shell,"Replace variable",variable,defaultValue,null); if (replacementDialog.open() == org.eclipse.jface.window.Window.OK) { String replacement = replacementDialog.getValue(); String pattern = "\\$\\$\\{"+expression+"\\}"; newStr = newStr.replaceAll(pattern,replacement); } else { return null; } } return newStr; } }
false
true
public static String parse(String str, IFile activeFile, Shell shell ) { String currentFile = ""; String currentFolder = ""; String currentPath = ""; String currentProjectPath = ""; /* not sure why this next block is needed, but it causes the snippet * insert to fail on QA. Hope I am not misunderstanding something... * */ if (activeFile != null) { try { currentFile = activeFile.getName(); currentPath = activeFile.getRawLocation().toFile().getAbsolutePath(); File fullPath = new File(currentPath); currentFolder = fullPath.getParent(); currentProjectPath = activeFile.getParent().toString(); String[] path = currentProjectPath.split("/"); if (path.length > 0) { currentProjectPath = path[path.length-1]; } // Get your laughing gear round this little lot :) currentFile = currentFile.replaceAll("\\\\","\\\\\\\\"); currentPath = currentPath.replaceAll("\\\\","\\\\\\\\"); currentFolder = currentFolder.replaceAll("\\\\","\\\\\\\\"); currentProjectPath = currentProjectPath.replaceAll("\\\\","\\\\\\\\"); } catch (Exception e) { e.printStackTrace(System.err); } } /* * $${DATE} * $${MONTH} * $${TIME} * $${DATETIME} * $${DAYOFWEEK} * $${CURRENTFILE} - Current file name (just the file) * $${CURRENTFOLDER} - Current folder (The path to the containing folder) * $${CURRENTPATH} - Current path (full file name) * $${CURRENTPRJPATH} - Just the folder * $${USERNAME} - Current user * $${MONTHNUMBER} - Month as a number * $${DAYOFMONTH} - Day of month as a number * $${DAYOFWEEKNUMBER} - Day of week (the week starts on Sunday) * $${DATETIME24} - DateTime24 - a 24 hour clock version of datetime. * $${YEAR} - Current year. * $${YEAR2DIGIT} - Current two digit year. */ Calendar calendar = new GregorianCalendar(); Date currentTime = new Date(); calendar.setTime(currentTime); String newStr = str; newStr = newStr.replaceAll("\\$\\$\\{FULLDATE\\}",currentTime.toString()); SimpleDateFormat formatter = new SimpleDateFormat("M/d/yyyy"); String formattedDate = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATE\\}",formattedDate); formatter = new SimpleDateFormat("MMMM"); String formattedMonth = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{MONTH\\}",formattedMonth); formatter = new SimpleDateFormat("k:mm:ss a"); String formattedTime = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{TIME\\}",formattedTime); formatter = new SimpleDateFormat("M/d/yyyy K:mm:ss a"); String formattedDateTime = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATETIME\\}",formattedDateTime); formatter = new SimpleDateFormat("EEEE"); String formattedDayOfWeek = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DAYOFWEEK\\}",formattedDayOfWeek); newStr = newStr.replaceAll("\\$\\$\\{CURRENTFILE\\}",currentFile); newStr = newStr.replaceAll("\\$\\$\\{CURRENTFOLDER\\}",currentFolder); newStr = newStr.replaceAll("\\$\\$\\{CURRENTPATH\\}",currentPath); newStr = newStr.replaceAll("\\$\\$\\{CURRENTPRJPATH\\}",currentProjectPath); newStr = newStr.replaceAll("\\$\\$\\{USERNAME\\}",System.getProperty("user.name")); formatter = new SimpleDateFormat("MM"); String formattedMonthNumber = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{MONTHNUMBER\\}",formattedMonthNumber); formatter = new SimpleDateFormat("dd"); String formattedDayOfMonth = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DAYOFMONTH\\}",formattedDayOfMonth); newStr = newStr.replaceAll("\\$\\$\\{DAYOFWEEKNUMBER\\}",Integer.toString(calendar.get(Calendar.DAY_OF_WEEK))); formatter = new SimpleDateFormat("M/d/yyyy kk:mm:ss"); String formattedDateTime24 = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATETIME24\\}",formattedDateTime24); formatter = new SimpleDateFormat("yyyy"); String formattedYear = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{YEAR\\}",formattedYear); formatter = new SimpleDateFormat("yy"); String formattedYear2Digit = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{YEAR2DIGIT\\}",formattedYear2Digit); while(newStr.indexOf("$${") > 0) { int expressionStart = newStr.indexOf("$${")+3; int expressionEnd = newStr.indexOf("}",expressionStart); String expression = newStr.substring(expressionStart,expressionEnd); InputDialog replacementDialog = new InputDialog(shell,"Replace variable",expression,"",null); if (replacementDialog.open() == org.eclipse.jface.window.Window.OK) { String replacement = replacementDialog.getValue(); String pattern = "\\$\\$\\{"+expression+"\\}"; newStr = newStr.replaceAll(pattern,replacement); } else { return null; } } return newStr; }
public static String parse(String str, IFile activeFile, Shell shell ) { String currentFile = ""; String currentFolder = ""; String currentPath = ""; String currentProjectPath = ""; /* not sure why this next block is needed, but it causes the snippet * insert to fail on QA. Hope I am not misunderstanding something... * */ if (activeFile != null) { try { currentFile = activeFile.getName(); currentPath = activeFile.getRawLocation().toFile().getAbsolutePath(); File fullPath = new File(currentPath); currentFolder = fullPath.getParent(); currentProjectPath = activeFile.getParent().toString(); String[] path = currentProjectPath.split("/"); if (path.length > 0) { currentProjectPath = path[path.length-1]; } // Get your laughing gear round this little lot :) currentFile = currentFile.replaceAll("\\\\","\\\\\\\\"); currentPath = currentPath.replaceAll("\\\\","\\\\\\\\"); currentFolder = currentFolder.replaceAll("\\\\","\\\\\\\\"); currentProjectPath = currentProjectPath.replaceAll("\\\\","\\\\\\\\"); } catch (Exception e) { e.printStackTrace(System.err); } } /* * $${DATE} * $${MONTH} * $${TIME} * $${DATETIME} * $${DAYOFWEEK} * $${CURRENTFILE} - Current file name (just the file) * $${CURRENTFOLDER} - Current folder (The path to the containing folder) * $${CURRENTPATH} - Current path (full file name) * $${CURRENTPRJPATH} - Just the folder * $${USERNAME} - Current user * $${MONTHNUMBER} - Month as a number * $${DAYOFMONTH} - Day of month as a number * $${DAYOFWEEKNUMBER} - Day of week (the week starts on Sunday) * $${DATETIME24} - DateTime24 - a 24 hour clock version of datetime. * $${YEAR} - Current year. * $${YEAR2DIGIT} - Current two digit year. */ Calendar calendar = new GregorianCalendar(); Date currentTime = new Date(); calendar.setTime(currentTime); String newStr = str; newStr = newStr.replaceAll("\\$\\$\\{FULLDATE\\}",currentTime.toString()); SimpleDateFormat formatter = new SimpleDateFormat("M/d/yyyy"); String formattedDate = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATE\\}",formattedDate); formatter = new SimpleDateFormat("MMMM"); String formattedMonth = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{MONTH\\}",formattedMonth); formatter = new SimpleDateFormat("k:mm:ss a"); String formattedTime = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{TIME\\}",formattedTime); formatter = new SimpleDateFormat("M/d/yyyy K:mm:ss a"); String formattedDateTime = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATETIME\\}",formattedDateTime); formatter = new SimpleDateFormat("EEEE"); String formattedDayOfWeek = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DAYOFWEEK\\}",formattedDayOfWeek); newStr = newStr.replaceAll("\\$\\$\\{CURRENTFILE\\}",currentFile); newStr = newStr.replaceAll("\\$\\$\\{CURRENTFOLDER\\}",currentFolder); newStr = newStr.replaceAll("\\$\\$\\{CURRENTPATH\\}",currentPath); newStr = newStr.replaceAll("\\$\\$\\{CURRENTPRJPATH\\}",currentProjectPath); newStr = newStr.replaceAll("\\$\\$\\{USERNAME\\}",System.getProperty("user.name")); formatter = new SimpleDateFormat("MM"); String formattedMonthNumber = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{MONTHNUMBER\\}",formattedMonthNumber); formatter = new SimpleDateFormat("dd"); String formattedDayOfMonth = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DAYOFMONTH\\}",formattedDayOfMonth); newStr = newStr.replaceAll("\\$\\$\\{DAYOFWEEKNUMBER\\}",Integer.toString(calendar.get(Calendar.DAY_OF_WEEK))); formatter = new SimpleDateFormat("M/d/yyyy kk:mm:ss"); String formattedDateTime24 = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{DATETIME24\\}",formattedDateTime24); formatter = new SimpleDateFormat("yyyy"); String formattedYear = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{YEAR\\}",formattedYear); formatter = new SimpleDateFormat("yy"); String formattedYear2Digit = formatter.format(currentTime); newStr = newStr.replaceAll("\\$\\$\\{YEAR2DIGIT\\}",formattedYear2Digit); while(newStr.indexOf("$${") >= 0) { int expressionStart = newStr.indexOf("$${")+3; int expressionEnd = newStr.indexOf("}",expressionStart); String expression = newStr.substring(expressionStart,expressionEnd); String stringArray[] = expression.split(":"); String variable = stringArray[0]; String defaultValue = ""; if (stringArray.length > 1) { defaultValue = stringArray[1]; } InputDialog replacementDialog = new InputDialog(shell,"Replace variable",variable,defaultValue,null); if (replacementDialog.open() == org.eclipse.jface.window.Window.OK) { String replacement = replacementDialog.getValue(); String pattern = "\\$\\$\\{"+expression+"\\}"; newStr = newStr.replaceAll(pattern,replacement); } else { return null; } } return newStr; }
diff --git a/src/org/nutz/ioc/loader/annotation/AnnotationIocLoader.java b/src/org/nutz/ioc/loader/annotation/AnnotationIocLoader.java index e4fe98d8b..bdd3f9f8e 100644 --- a/src/org/nutz/ioc/loader/annotation/AnnotationIocLoader.java +++ b/src/org/nutz/ioc/loader/annotation/AnnotationIocLoader.java @@ -1,253 +1,257 @@ package org.nutz.ioc.loader.annotation; import java.lang.reflect.Field; import java.lang.reflect.Method; import java.lang.reflect.Modifier; import java.util.ArrayList; import java.util.Arrays; import java.util.HashMap; import java.util.List; import org.nutz.castor.Castors; import org.nutz.ioc.IocException; import org.nutz.ioc.IocLoader; import org.nutz.ioc.IocLoading; import org.nutz.ioc.ObjectLoadException; import org.nutz.ioc.annotation.InjectName; import org.nutz.ioc.meta.IocEventSet; import org.nutz.ioc.meta.IocField; import org.nutz.ioc.meta.IocObject; import org.nutz.ioc.meta.IocValue; import org.nutz.json.Json; import org.nutz.lang.Lang; import org.nutz.lang.Mirror; import org.nutz.lang.Strings; import org.nutz.log.Log; import org.nutz.log.Logs; import org.nutz.resource.Scans; /** * 基于注解的Ioc配置 * * @author wendal([email protected]) * */ public class AnnotationIocLoader implements IocLoader { private static final Log log = Logs.get(); private HashMap<String, IocObject> map = new HashMap<String, IocObject>(); public AnnotationIocLoader(String... packages) { for (String packageZ : packages) for (Class<?> classZ : Scans.me().scanPackage(packageZ)) addClass(classZ); if (map.size() > 0) { if (log.isInfoEnabled()) log.infof("Scan complete ! Found %s classes in %s base-packages!\nbeans = %s", map.size(), packages.length, Castors.me().castToString(map.keySet())); } else { log.warn("NONE Annotation-Class found!! Check your configure or report a bug!! packages=" + Arrays.toString(packages)); } } private void addClass(Class<?> classZ) { if (classZ.isInterface() || classZ.isMemberClass() || classZ.isEnum() || classZ.isAnnotation() || classZ.isAnonymousClass()) return; int modify = classZ.getModifiers(); if (Modifier.isAbstract(modify) || (!Modifier.isPublic(modify))) return; IocBean iocBean = classZ.getAnnotation(IocBean.class); if (iocBean != null) { if (log.isDebugEnabled()) log.debugf("Found a Class with Ioc-Annotation : %s", classZ); // 采用 @IocBean->name String beanName = iocBean.name(); if (Strings.isBlank(beanName)) { // 否则采用 @InjectName InjectName innm = classZ.getAnnotation(InjectName.class); if (null != innm && !Strings.isBlank(innm.value())) { beanName = innm.value(); } // 大哥(姐),您都不设啊!? 那就用 simpleName 吧 else { beanName = Strings.lowerFirst(classZ.getSimpleName()); } } if (map.containsKey(beanName)) throw Lang.makeThrow(IocException.class, "Duplicate beanName=%s, by %s !! Have been define by %s !!", beanName, classZ, map.get(beanName).getClass()); IocObject iocObject = new IocObject(); iocObject.setType(classZ); map.put(beanName, iocObject); iocObject.setSingleton(iocBean.singleton()); if (!Strings.isBlank(iocBean.scope())) iocObject.setScope(iocBean.scope()); // 看看构造函数都需要什么函数 String[] args = iocBean.args(); // if (null == args || args.length == 0) // args = iocBean.param(); if (null != args && args.length > 0) for (String value : args) iocObject.addArg(convert(value)); // 设置Events IocEventSet eventSet = new IocEventSet(); iocObject.setEvents(eventSet); if (!Strings.isBlank(iocBean.create())) eventSet.setCreate(iocBean.create().trim().intern()); if (!Strings.isBlank(iocBean.depose())) eventSet.setDepose(iocBean.depose().trim().intern()); if (!Strings.isBlank(iocBean.fetch())) eventSet.setFetch(iocBean.fetch().trim().intern()); // 处理字段(以@Inject方式,位于字段) List<String> fieldList = new ArrayList<String>(); Mirror<?> mirror = Mirror.me(classZ); Field[] fields = mirror.getFields(Inject.class); for (Field field : fields) { Inject inject = field.getAnnotation(Inject.class); // 无需检查,因为字段名是唯一的 // if(fieldList.contains(field.getName())) // throw duplicateField(classZ,field.getName()); IocField iocField = new IocField(); iocField.setName(field.getName()); IocValue iocValue; if (Strings.isBlank(inject.value())) { iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(field.getName()); } else iocValue = convert(inject.value()); iocField.setValue(iocValue); iocObject.addField(iocField); fieldList.add(iocField.getName()); } // 处理字段(以@Inject方式,位于set方法) Method[] methods; try { methods = classZ.getMethods(); } catch (Exception e) { // 如果获取失败,就忽略之 - log.info("Fail to call getMethods(), miss class or Security Limit, ignore it", e); + log.infof("Fail to call getMethods() in Class=%s, miss class or Security Limit, ignore it", classZ, e); methods = new Method[0]; } + catch (NoClassDefFoundError e) { + log.infof("Fail to call getMethods() in Class=%s, miss class or Security Limit, ignore it", classZ, e); + methods = new Method[0]; + } for (Method method : methods) { Inject inject = method.getAnnotation(Inject.class); if (inject == null) continue; // 过滤特殊方法 int m = method.getModifiers(); if (Modifier.isAbstract(m) || (!Modifier.isPublic(m)) || Modifier.isStatic(m)) continue; String methodName = method.getName(); if (methodName.startsWith("set") && methodName.length() > 3 && method.getParameterTypes().length == 1) { IocField iocField = new IocField(); iocField.setName(Strings.lowerFirst(methodName.substring(3))); if (fieldList.contains(iocField.getName())) throw duplicateField(classZ, iocField.getName()); IocValue iocValue; if (Strings.isBlank(inject.value())) { iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(Strings.lowerFirst(methodName.substring(3))); } else iocValue = convert(inject.value()); iocField.setValue(iocValue); iocObject.addField(iocField); fieldList.add(iocField.getName()); } } // 处理字段(以@IocBean.field方式) String[] flds = iocBean.fields(); if (flds != null && flds.length > 0) { for (String fieldInfo : flds) { if (fieldList.contains(fieldInfo)) throw duplicateField(classZ, fieldInfo); IocField iocField = new IocField(); if (fieldInfo.contains(":")) { // dao:jndi:dataSource/jdbc形式 String[] datas = fieldInfo.split(":", 2); // 完整形式, 与@Inject完全一致了 iocField.setName(datas[0]); iocField.setValue(convert(datas[1])); iocObject.addField(iocField); } else { // 基本形式, 引用与自身同名的bean iocField.setName(fieldInfo); IocValue iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(fieldInfo); iocField.setValue(iocValue); iocObject.addField(iocField); } fieldList.add(iocField.getName()); } } } else { if (log.isWarnEnabled()) { Field[] fields = classZ.getDeclaredFields(); for (Field field : fields) if (field.getAnnotation(Inject.class) != null) { log.warnf("class(%s) don't has @IocBean, but field(%s) has @Inject! Miss @IocBean ??", classZ.getName(), field.getName()); break; } } } } protected IocValue convert(String value) { IocValue iocValue = new IocValue(); if (value.contains(":")) { iocValue.setType(value.substring(0, value.indexOf(':'))); iocValue.setValue(value.substring(value.indexOf(':') + 1)); } else { iocValue.setValue(value); // TODO 是否应该改为默认refer呢? } return iocValue; } public String[] getName() { return map.keySet().toArray(new String[map.size()]); } public boolean has(String name) { return map.containsKey(name); } public IocObject load(IocLoading loading, String name) throws ObjectLoadException { if (has(name)) return map.get(name); throw new ObjectLoadException("Object '" + name + "' without define!"); } private static final IocException duplicateField(Class<?> classZ, String name) { return Lang.makeThrow(IocException.class, "Duplicate filed defined! Class=%s,FileName=%s", classZ, name); } public String toString() { return "/*AnnotationIocLoader*/\n" + Json.toJson(map); } }
false
true
private void addClass(Class<?> classZ) { if (classZ.isInterface() || classZ.isMemberClass() || classZ.isEnum() || classZ.isAnnotation() || classZ.isAnonymousClass()) return; int modify = classZ.getModifiers(); if (Modifier.isAbstract(modify) || (!Modifier.isPublic(modify))) return; IocBean iocBean = classZ.getAnnotation(IocBean.class); if (iocBean != null) { if (log.isDebugEnabled()) log.debugf("Found a Class with Ioc-Annotation : %s", classZ); // 采用 @IocBean->name String beanName = iocBean.name(); if (Strings.isBlank(beanName)) { // 否则采用 @InjectName InjectName innm = classZ.getAnnotation(InjectName.class); if (null != innm && !Strings.isBlank(innm.value())) { beanName = innm.value(); } // 大哥(姐),您都不设啊!? 那就用 simpleName 吧 else { beanName = Strings.lowerFirst(classZ.getSimpleName()); } } if (map.containsKey(beanName)) throw Lang.makeThrow(IocException.class, "Duplicate beanName=%s, by %s !! Have been define by %s !!", beanName, classZ, map.get(beanName).getClass()); IocObject iocObject = new IocObject(); iocObject.setType(classZ); map.put(beanName, iocObject); iocObject.setSingleton(iocBean.singleton()); if (!Strings.isBlank(iocBean.scope())) iocObject.setScope(iocBean.scope()); // 看看构造函数都需要什么函数 String[] args = iocBean.args(); // if (null == args || args.length == 0) // args = iocBean.param(); if (null != args && args.length > 0) for (String value : args) iocObject.addArg(convert(value)); // 设置Events IocEventSet eventSet = new IocEventSet(); iocObject.setEvents(eventSet); if (!Strings.isBlank(iocBean.create())) eventSet.setCreate(iocBean.create().trim().intern()); if (!Strings.isBlank(iocBean.depose())) eventSet.setDepose(iocBean.depose().trim().intern()); if (!Strings.isBlank(iocBean.fetch())) eventSet.setFetch(iocBean.fetch().trim().intern()); // 处理字段(以@Inject方式,位于字段) List<String> fieldList = new ArrayList<String>(); Mirror<?> mirror = Mirror.me(classZ); Field[] fields = mirror.getFields(Inject.class); for (Field field : fields) { Inject inject = field.getAnnotation(Inject.class); // 无需检查,因为字段名是唯一的 // if(fieldList.contains(field.getName())) // throw duplicateField(classZ,field.getName()); IocField iocField = new IocField(); iocField.setName(field.getName()); IocValue iocValue; if (Strings.isBlank(inject.value())) { iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(field.getName()); } else iocValue = convert(inject.value()); iocField.setValue(iocValue); iocObject.addField(iocField); fieldList.add(iocField.getName()); } // 处理字段(以@Inject方式,位于set方法) Method[] methods; try { methods = classZ.getMethods(); } catch (Exception e) { // 如果获取失败,就忽略之 log.info("Fail to call getMethods(), miss class or Security Limit, ignore it", e); methods = new Method[0]; } for (Method method : methods) { Inject inject = method.getAnnotation(Inject.class); if (inject == null) continue; // 过滤特殊方法 int m = method.getModifiers(); if (Modifier.isAbstract(m) || (!Modifier.isPublic(m)) || Modifier.isStatic(m)) continue; String methodName = method.getName(); if (methodName.startsWith("set") && methodName.length() > 3 && method.getParameterTypes().length == 1) { IocField iocField = new IocField(); iocField.setName(Strings.lowerFirst(methodName.substring(3))); if (fieldList.contains(iocField.getName())) throw duplicateField(classZ, iocField.getName()); IocValue iocValue; if (Strings.isBlank(inject.value())) { iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(Strings.lowerFirst(methodName.substring(3))); } else iocValue = convert(inject.value()); iocField.setValue(iocValue); iocObject.addField(iocField); fieldList.add(iocField.getName()); } } // 处理字段(以@IocBean.field方式) String[] flds = iocBean.fields(); if (flds != null && flds.length > 0) { for (String fieldInfo : flds) { if (fieldList.contains(fieldInfo)) throw duplicateField(classZ, fieldInfo); IocField iocField = new IocField(); if (fieldInfo.contains(":")) { // dao:jndi:dataSource/jdbc形式 String[] datas = fieldInfo.split(":", 2); // 完整形式, 与@Inject完全一致了 iocField.setName(datas[0]); iocField.setValue(convert(datas[1])); iocObject.addField(iocField); } else { // 基本形式, 引用与自身同名的bean iocField.setName(fieldInfo); IocValue iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(fieldInfo); iocField.setValue(iocValue); iocObject.addField(iocField); } fieldList.add(iocField.getName()); } } } else { if (log.isWarnEnabled()) { Field[] fields = classZ.getDeclaredFields(); for (Field field : fields) if (field.getAnnotation(Inject.class) != null) { log.warnf("class(%s) don't has @IocBean, but field(%s) has @Inject! Miss @IocBean ??", classZ.getName(), field.getName()); break; } } } }
private void addClass(Class<?> classZ) { if (classZ.isInterface() || classZ.isMemberClass() || classZ.isEnum() || classZ.isAnnotation() || classZ.isAnonymousClass()) return; int modify = classZ.getModifiers(); if (Modifier.isAbstract(modify) || (!Modifier.isPublic(modify))) return; IocBean iocBean = classZ.getAnnotation(IocBean.class); if (iocBean != null) { if (log.isDebugEnabled()) log.debugf("Found a Class with Ioc-Annotation : %s", classZ); // 采用 @IocBean->name String beanName = iocBean.name(); if (Strings.isBlank(beanName)) { // 否则采用 @InjectName InjectName innm = classZ.getAnnotation(InjectName.class); if (null != innm && !Strings.isBlank(innm.value())) { beanName = innm.value(); } // 大哥(姐),您都不设啊!? 那就用 simpleName 吧 else { beanName = Strings.lowerFirst(classZ.getSimpleName()); } } if (map.containsKey(beanName)) throw Lang.makeThrow(IocException.class, "Duplicate beanName=%s, by %s !! Have been define by %s !!", beanName, classZ, map.get(beanName).getClass()); IocObject iocObject = new IocObject(); iocObject.setType(classZ); map.put(beanName, iocObject); iocObject.setSingleton(iocBean.singleton()); if (!Strings.isBlank(iocBean.scope())) iocObject.setScope(iocBean.scope()); // 看看构造函数都需要什么函数 String[] args = iocBean.args(); // if (null == args || args.length == 0) // args = iocBean.param(); if (null != args && args.length > 0) for (String value : args) iocObject.addArg(convert(value)); // 设置Events IocEventSet eventSet = new IocEventSet(); iocObject.setEvents(eventSet); if (!Strings.isBlank(iocBean.create())) eventSet.setCreate(iocBean.create().trim().intern()); if (!Strings.isBlank(iocBean.depose())) eventSet.setDepose(iocBean.depose().trim().intern()); if (!Strings.isBlank(iocBean.fetch())) eventSet.setFetch(iocBean.fetch().trim().intern()); // 处理字段(以@Inject方式,位于字段) List<String> fieldList = new ArrayList<String>(); Mirror<?> mirror = Mirror.me(classZ); Field[] fields = mirror.getFields(Inject.class); for (Field field : fields) { Inject inject = field.getAnnotation(Inject.class); // 无需检查,因为字段名是唯一的 // if(fieldList.contains(field.getName())) // throw duplicateField(classZ,field.getName()); IocField iocField = new IocField(); iocField.setName(field.getName()); IocValue iocValue; if (Strings.isBlank(inject.value())) { iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(field.getName()); } else iocValue = convert(inject.value()); iocField.setValue(iocValue); iocObject.addField(iocField); fieldList.add(iocField.getName()); } // 处理字段(以@Inject方式,位于set方法) Method[] methods; try { methods = classZ.getMethods(); } catch (Exception e) { // 如果获取失败,就忽略之 log.infof("Fail to call getMethods() in Class=%s, miss class or Security Limit, ignore it", classZ, e); methods = new Method[0]; } catch (NoClassDefFoundError e) { log.infof("Fail to call getMethods() in Class=%s, miss class or Security Limit, ignore it", classZ, e); methods = new Method[0]; } for (Method method : methods) { Inject inject = method.getAnnotation(Inject.class); if (inject == null) continue; // 过滤特殊方法 int m = method.getModifiers(); if (Modifier.isAbstract(m) || (!Modifier.isPublic(m)) || Modifier.isStatic(m)) continue; String methodName = method.getName(); if (methodName.startsWith("set") && methodName.length() > 3 && method.getParameterTypes().length == 1) { IocField iocField = new IocField(); iocField.setName(Strings.lowerFirst(methodName.substring(3))); if (fieldList.contains(iocField.getName())) throw duplicateField(classZ, iocField.getName()); IocValue iocValue; if (Strings.isBlank(inject.value())) { iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(Strings.lowerFirst(methodName.substring(3))); } else iocValue = convert(inject.value()); iocField.setValue(iocValue); iocObject.addField(iocField); fieldList.add(iocField.getName()); } } // 处理字段(以@IocBean.field方式) String[] flds = iocBean.fields(); if (flds != null && flds.length > 0) { for (String fieldInfo : flds) { if (fieldList.contains(fieldInfo)) throw duplicateField(classZ, fieldInfo); IocField iocField = new IocField(); if (fieldInfo.contains(":")) { // dao:jndi:dataSource/jdbc形式 String[] datas = fieldInfo.split(":", 2); // 完整形式, 与@Inject完全一致了 iocField.setName(datas[0]); iocField.setValue(convert(datas[1])); iocObject.addField(iocField); } else { // 基本形式, 引用与自身同名的bean iocField.setName(fieldInfo); IocValue iocValue = new IocValue(); iocValue.setType(IocValue.TYPE_REFER); iocValue.setValue(fieldInfo); iocField.setValue(iocValue); iocObject.addField(iocField); } fieldList.add(iocField.getName()); } } } else { if (log.isWarnEnabled()) { Field[] fields = classZ.getDeclaredFields(); for (Field field : fields) if (field.getAnnotation(Inject.class) != null) { log.warnf("class(%s) don't has @IocBean, but field(%s) has @Inject! Miss @IocBean ??", classZ.getName(), field.getName()); break; } } } }
diff --git a/src/edu/sc/seis/sod/database/DatabaseManager.java b/src/edu/sc/seis/sod/database/DatabaseManager.java index 7a95bfed1..d6294ffbb 100644 --- a/src/edu/sc/seis/sod/database/DatabaseManager.java +++ b/src/edu/sc/seis/sod/database/DatabaseManager.java @@ -1,52 +1,55 @@ package edu.sc.seis.sod.database; import java.lang.reflect.*; import java.sql.*; import java.util.*; /** * DatabaseManager.java * * * Created: Thu Oct 3 14:27:47 2002 * * @author <a href="mailto:">Srinivasa Telukutla</a> * @version */ public class DatabaseManager { private DatabaseManager() { } public static AbstractDatabaseManager getDatabaseManager(Properties props, String type) { + String className = null; try { if(databaseManager != null) return databaseManager; //use reflection to get the appropriate Database Manager. - String className = getDatabaseType(props); + className = getDatabaseType(props); Class[] constructorArgTypes = new Class[1]; constructorArgTypes[0] = Properties.class; Class externalClass = Class.forName(className); Constructor constructor = externalClass.getConstructor(constructorArgTypes); Object[] constructorArgs = new Object[1]; constructorArgs[0] = props; Object obj = constructor.newInstance(constructorArgs); databaseManager = (AbstractDatabaseManager)obj; return databaseManager; } catch(Exception e) { e.printStackTrace(); - return null; + System.out.println("Unable to load "+className); + System.exit(0); + return null; } } private static String getDatabaseType(Properties props) { if(props == null) return "edu.sc.seis.sod.database.HSqlDbManager"; String rtnValue = props.getProperty("edu.sc.seis.sod.databasetype"); if(rtnValue != null) return rtnValue; return "edu.sc.seis.sod.database.HSqlDbManager"; } private static AbstractDatabaseManager databaseManager; }// DatabaseManager
false
true
public static AbstractDatabaseManager getDatabaseManager(Properties props, String type) { try { if(databaseManager != null) return databaseManager; //use reflection to get the appropriate Database Manager. String className = getDatabaseType(props); Class[] constructorArgTypes = new Class[1]; constructorArgTypes[0] = Properties.class; Class externalClass = Class.forName(className); Constructor constructor = externalClass.getConstructor(constructorArgTypes); Object[] constructorArgs = new Object[1]; constructorArgs[0] = props; Object obj = constructor.newInstance(constructorArgs); databaseManager = (AbstractDatabaseManager)obj; return databaseManager; } catch(Exception e) { e.printStackTrace(); return null; } }
public static AbstractDatabaseManager getDatabaseManager(Properties props, String type) { String className = null; try { if(databaseManager != null) return databaseManager; //use reflection to get the appropriate Database Manager. className = getDatabaseType(props); Class[] constructorArgTypes = new Class[1]; constructorArgTypes[0] = Properties.class; Class externalClass = Class.forName(className); Constructor constructor = externalClass.getConstructor(constructorArgTypes); Object[] constructorArgs = new Object[1]; constructorArgs[0] = props; Object obj = constructor.newInstance(constructorArgs); databaseManager = (AbstractDatabaseManager)obj; return databaseManager; } catch(Exception e) { e.printStackTrace(); System.out.println("Unable to load "+className); System.exit(0); return null; } }
diff --git a/GUI.java b/GUI.java index e6a55abb..34d1f8bf 100644 --- a/GUI.java +++ b/GUI.java @@ -1,2690 +1,2690 @@ //////////////////////////////////////////////////////////////////////////////// // // RMG - Reaction Mechanism Generator // // Copyright (c) 2002-2009 Prof. William H. Green ([email protected]) and the // RMG Team ([email protected]) // // Permission is hereby granted, free of charge, to any person obtaining a // copy of this software and associated documentation files (the "Software"), // to deal in the Software without restriction, including without limitation // the rights to use, copy, modify, merge, publish, distribute, sublicense, // and/or sell copies of the Software, and to permit persons to whom the // Software is furnished to do so, subject to the following conditions: // // The above copyright notice and this permission notice shall be included in // all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR // IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, // FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE // AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER // LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING // FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER // DEALINGS IN THE SOFTWARE. // //////////////////////////////////////////////////////////////////////////////// /** * @author User1 * */ /* * GUI.java creates a Graphical User Interface (GUI) for Prof. * Green's Group's Reaction Mechanism Generator (RMG). More information * on RMG may be found at: http://www.sourceforge.net/projects/rmg * * Michael Harper Jr. * MIT Chemical Engineering * Green Group * * Last updated: March 3, 2009 * - Modified reactants & inert gas input table (Initial Conditions tab) * -- If user adds "Inert Gas", the entry must be "N2", "Ar", or "Ne"; otherwise, an error message is displayed to the user (but the GUI's entries remain untouched). * - Modified how RMG-GUI writes the "condition.txt" file * -- If user does not add all of the necessary information for the condition.txt file, an error message is displayed (the GUI's entries remain untouched) and no condition.txt file will be written. * -- If user does not add any "Comments" to be placed in the header of the condition.txt file, a warning if displayed * - Modified how RMG-GUI reads the "condition.txt" file * -- If condition.txt file is missing a field, GUI instructs user which field is missing (and where it should be located in file) * -- If condition.txt file contains unknown entries (e.g. units of Temperature not equal to K, F, or C), GUI informs user that entry is incorrect and gives user available options * Last updated: February 17, 2009 * - Adapted GUI to handle new condition.txt file format * -- Different location of SpectroscopicDataEstimator * -- PressureDependence replacing ModelEnlarger + PDepKineticsEstimator * -- No FinishController options * * Currently: * - creates & displays GUI * - creates .txt file related to running RMG * * condition.txt : file containing all inputs (species, tolerances, etc.) * * Improvements: * */ import jing.gui.*; import javax.swing.BorderFactory; import javax.swing.Box; import javax.swing.BoxLayout; import javax.swing.JButton; import javax.swing.JComboBox; import javax.swing.JComponent; import javax.swing.JFileChooser; import javax.swing.JFormattedTextField; import javax.swing.JLabel; import javax.swing.JOptionPane; import javax.swing.JPanel; import javax.swing.JScrollPane; import javax.swing.JTabbedPane; import javax.swing.JTable; import javax.swing.JTextArea; import javax.swing.JTextField; import javax.swing.ListCellRenderer; import javax.swing.table.TableCellRenderer; import javax.swing.table.TableColumn; import java.awt.Dimension; import java.awt.GridLayout; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.text.DecimalFormat; import java.text.SimpleDateFormat; import java.io.*; import java.util.*; import jing.chem.PrimaryThermoLibrary; import jing.chem.Species; import jing.chemParser.ChemParser; public class GUI extends JPanel implements ActionListener { public static void main(String[] args) { String workingDir = System.getenv("RMG"); System.setProperty("RMG.workingDirectory", workingDir); theApp = new GUI(); theApp.createAndShowGUI(); } private void createAndShowGUI() { GUIWindow frame = new GUIWindow("RMG", this); frame.setContentPane(theApp.mainPanel); Dimension wndSize = frame.getToolkit().getScreenSize(); frame.setBounds(wndSize.width*3/16, wndSize.height/16, wndSize.width*5/8, wndSize.height*7/8); frame.setVisible(true); } public GUI() { super(new GridLayout(1,1)); // Create main panel + individual tabs JTabbedPane tabbedPanel = new JTabbedPane(); JComponent tabInputs = createTabInputs(); JComponent tabInitialization = createTabInitialization(); JComponent tabTermination = createTabTermination(); JComponent tabSolver = createTabSolver(); JComponent tabOptions = createTabOptions(); JComponent tabSensitivity = createTabSensitivity(); // Add the individual tabs to the main panel tabbedPanel.addTab("Initial Conditions", null, tabInputs, "Specify Reactants, Inerts, & Temperature/Pressure Model"); tabbedPanel.addTab("Thermochemical Libraries", null, tabInitialization, "Specify Thermochemical Library"); tabbedPanel.addTab("Termination", null, tabTermination, "Specify Simulation Termination Conditions"); tabbedPanel.addTab("Dynamic Simulator", null, tabSolver, "Specify Solver Tolerances"); tabbedPanel.addTab("Additional Options", null, tabOptions, "Specify Other Options"); tabbedPanel.addTab("Sensitivity Analysis", null, tabSensitivity, "Specify Error/Sensitivity Analysis Criteria"); tabbedPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Create the main panel to contain the main tabbed panel mainPanel = new JPanel(); mainPanel.setLayout(new BoxLayout(mainPanel, BoxLayout.PAGE_AXIS)); mainPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Create & fill boxes to display panels Box Main1 = Box.createHorizontalBox(); Box Main2 = Box.createHorizontalBox(); Box Main3 = Box.createVerticalBox(); Main1.add(tabbedPanel); JPanel submitConditionFile = new JPanel(); Main2.add(submitConditionFile); Main3.add(Main1); Main3.add(Main2); mainPanel.add(Main3); // Change preferences on Submit button JPanel comments = new JPanel(); comments.add(new JLabel("Comments to add to file's header:")); headerComments = new JTextArea(3,20); JScrollPane headerScroll = new JScrollPane(headerComments); comments.add(headerScroll); comments.add(save = new JButton("Save")); save.addActionListener(this); save.setActionCommand("saveCondition"); save.setToolTipText("Press to save file"); comments.add(saveAndRun = new JButton("Save and Run")); saveAndRun.addActionListener(this); saveAndRun.setActionCommand("runCondition"); saveAndRun.setToolTipText("Press to save and run file"); submitConditionFile.add(comments); submitConditionFile.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder ("Create Initialization File: condition.txt"), BorderFactory.createEmptyBorder(5,5,5,5))); } public void initializeJCB(JComboBox[] all) { ListCellRenderer centerJComboBoxRenderer = new CenterJCBRenderer(); //TableCellRenderer centerTableRenderer = new CenterTRenderer(); for (int i=0; i<all.length; i++) { all[i].addActionListener(this); all[i].setRenderer(centerJComboBoxRenderer); all[i].setSelectedIndex(0); } } /* TabInputs: Initial Conditions This tab allows the user to input the initial conditions (species, temperature, & pressure) of the system The user must input the following information: - Each species * Identity * Concentration * Units - Temperature & Pressure * Model: Constant * Value(s) and Units(s) Additionally, the user is asked to specify the reactivity of each species: - Reactive: Normal species that RMG will react based on library - Unreactive: Species that RMG will only react based on IncludeSpecies.txt (see GJB work for more details) - Inert Gas: The user is asked to supply an adjacency list for the species if it is reactive. */ public JComponent createTabInputs() { // Create cell renderers for JComboBox/JTable - CENTER text ListCellRenderer centerJComboBoxRenderer = new CenterJCBRenderer(); TableCellRenderer centerRenderer = new CenterTRenderer(); /* Create the "Species" panel - This panel will allow the user to enter information about each species. - Each species must be given a name, concentration, units, and reactivity - If the reactivity is "Reactive," the user must supply an adjacency list for the molecule This may be done by giving the location of the species .mol file or InChI - If the reactivity is "Unreactive," the user must supply the location of the IncludeSpecies.txt file - All of this information is stored in a table which the user can add/remove data */ JPanel Species = new JPanel(); // Create the "speciesData" subpanel // This subpanel holds the data for each species JPanel speciesData = new JPanel(); // Create labels JLabel labelName = new JLabel("Name"); JLabel labelInChI = new JLabel("InChI"); JLabel labelConc = new JLabel("Concentration"); JLabel labelUnit = new JLabel("Units"); JLabel labelReact = new JLabel("Reactivity"); // Create boxes to store each of the pieces of data Box boxName = Box.createVerticalBox(); Box boxInchi = Box.createVerticalBox(); Box boxConc = Box.createVerticalBox(); Box boxUnit = Box.createVerticalBox(); Box boxReact = Box.createVerticalBox(); // Add labels and data fields to boxes boxName.add(labelName); boxName.add(NameInput = new JTextField()); NameInput.setPreferredSize(new Dimension (75,25)); NameInput.setHorizontalAlignment(JTextField.CENTER); NameInput.addActionListener(this); boxInchi.add(labelInChI); boxInchi.add(InChIInput = new JTextField()); InChIInput.setPreferredSize(new Dimension (150,25)); InChIInput.setHorizontalAlignment(JTextField.CENTER); InChIInput.addActionListener(this); boxConc.add(labelConc); boxConc.add(ConcInput = new JTextField()); ConcInput.setPreferredSize(new Dimension(30,25)); ConcInput.setHorizontalAlignment(JTextField.CENTER); ConcInput.addActionListener(this); boxUnit.add(labelUnit); boxUnit.add(UnitsInput = new JComboBox(concUnits)); UnitsInput.setSelectedIndex(0); UnitsInput.setRenderer(centerJComboBoxRenderer); UnitsInput.addActionListener(this); boxReact.add(labelReact); boxReact.add(ReactiveInput = new JComboBox(reactive)); ReactiveInput.setRenderer(centerJComboBoxRenderer); ReactiveInput.setSelectedIndex(0); ReactiveInput.addActionListener(this); // Add the boxes to the "speciesData" subpanel speciesData.add(boxName); speciesData.add(boxInchi); speciesData.add(boxConc); speciesData.add(boxUnit); speciesData.add(boxReact); // Create the "speciesButton" panel // This subpanel holds the add/remove buttons JPanel speciesButton = new JPanel(); // Create the buttons: "Add" and "Remove" JButton AddInput = new JButton("Add"); AddButtonListener addListenerInput = new AddButtonListener(); AddInput.addActionListener(addListenerInput); AddInput.setActionCommand("AddInput"); AddInput.setToolTipText("Press to submit data for molecule"); JButton DeleteInput = new JButton("Remove"); DeleteButtonListener deleteListenerInput = new DeleteButtonListener(); DeleteInput.addActionListener(deleteListenerInput); DeleteInput.setActionCommand("DeleteInput"); DeleteInput.setToolTipText("Press to delete molecule's data"); // Add the box to the "speciesButton" subpanel speciesButton.add(AddInput); speciesButton.add(DeleteInput); // Create the "speciesTable" subpanel JPanel speciesTable = new JPanel(); // Create table to hold the species data tableInput = new JTable(tmodelInput = new MyTableModelInput()); tableInput.setPreferredScrollableViewportSize(new Dimension(500,50)); tableInput.setAutoResizeMode(JTable.AUTO_RESIZE_OFF); tableInput.getColumnModel().getColumn(0).setPreferredWidth(75); tableInput.getColumnModel().getColumn(1).setPreferredWidth(100); tableInput.getColumnModel().getColumn(2).setPreferredWidth(75); tableInput.getColumnModel().getColumn(3).setPreferredWidth(100); tableInput.getColumnModel().getColumn(4).setPreferredWidth(150); // Create a scroll panel and add it to "speciesTable" subpanel JScrollPane scrollInput = new JScrollPane(tableInput); scrollInput.setBorder(BorderFactory.createLoweredBevelBorder()); for (int i=0; i<tableInput.getColumnCount(); i++) { TableColumn column = tableInput.getColumnModel().getColumn(i); column.setCellRenderer(centerRenderer); } speciesTable.add(scrollInput); // Create the "speciesAList" subpanel JPanel speciesAList = new JPanel(); // Create text field where the user can visualize the adjacency list speciesAdjList = new JTextArea(5,13); // Add text field to a scroll panel JScrollPane scrollAdjList = new JScrollPane(speciesAdjList); scrollAdjList.setBorder(BorderFactory.createLoweredBevelBorder()); Box adj = Box.createVerticalBox(); adj.add(new JLabel("Adjacency List")); adj.add(scrollAdjList); speciesAList.add(adj); // Create the "speciesIS" subpanel // If at least one of the species is "Unreactive," the user must specify the path of IncludeSpecies.txt JPanel speciesIS = new JPanel(); // Create the label for the speciesIS subpanel JLabel labelIS = new JLabel("Location of IncludeSpecies.txt: "); // Populate the speicesIS subpanel speciesIS.add(labelIS); speciesIS.add(isPath = new JTextField(20)); speciesIS.add(isButton = new JButton("Change")); ChangeButtonListener addListenerIS = new ChangeButtonListener(); isButton.addActionListener(addListenerIS); isButton.setActionCommand("isPath"); // Update the subpanel's properties isPath.addActionListener(this); isPath.setEditable(false); // Create boxes to store all of the species subpanels Box species1 = Box.createHorizontalBox(); Box species2 = Box.createHorizontalBox(); Box species3 = Box.createHorizontalBox(); Box species4 = Box.createHorizontalBox(); Box species5 = Box.createHorizontalBox(); Box speciesTotal = Box.createVerticalBox(); // Add the subpanels to the boxes species1.add(speciesData); species2.add(speciesButton); species2.setBorder(BorderFactory.createEmptyBorder(10,10,10,10)); species3.add(speciesTable); species4.add(speciesAList); species4.setBorder(BorderFactory.createEmptyBorder(10,10,10,10)); species5.add(speciesIS); speciesTotal.add(species1); speciesTotal.add(species4); speciesTotal.add(species2); speciesTotal.add(species3); speciesTotal.add(species5); // Add the boxes to the main panel "Species" Species.add(speciesTotal); Species.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Species"), BorderFactory.createEmptyBorder(5,5,5,5))); /* Create the "Temperature" panel The user must specify which temperature model to use. Note: As of 10-Feb-2009, the only option is "Constant" The user must also specify a list of temperatures to build the model */ JPanel Temperature = new JPanel(); // Create the "tempModel" subpanel JPanel tempModel = new JPanel(); tempModel.setBorder(BorderFactory.createEmptyBorder(0,0,10,0)); // Create the labels JLabel tempModelLabel = new JLabel("Select Model: "); // Add the labels to the panel tempModel.add(tempModelLabel); tempModel.add(tempModelCombo = new JComboBox(tpModel)); // Adjust the labels properties tempModelCombo.setSelectedIndex(0); tempModelCombo.addActionListener(this); tempModelCombo.setRenderer(centerJComboBoxRenderer); // Create the "tempValues" subpanel JPanel tempValues = new JPanel(); // Create the labels JLabel valueTLabel = new JLabel("List of Temperatures"); JLabel unitTLabel = new JLabel("Units"); // Create the data entries and edit their properties tempConstant = new JTextArea(3,10); tempConstantUnit = new JComboBox(tempUnits); tempConstantUnit.addActionListener(this); tempConstantUnit.setRenderer(centerJComboBoxRenderer); tempConstantUnit.setSelectedIndex(0); // Create scroll panel for list of temperatures JScrollPane tempScroll = new JScrollPane(tempConstant); tempScroll.setBorder(BorderFactory.createLoweredBevelBorder()); // Create boxes to store labels and data Box leftT = Box.createVerticalBox(); Box rightT = Box.createVerticalBox(); // Add labels and data to boxes leftT.add(valueTLabel); leftT.add(tempScroll); rightT.add(unitTLabel); rightT.add(tempConstantUnit); // Add boxes to "tempValues" subpanel tempValues.add(leftT); tempValues.add(rightT); // Create boxes for Temperature panel Box temp1 = Box.createHorizontalBox(); Box temp2 = Box.createHorizontalBox(); Box temp = Box.createVerticalBox(); // Populate boxes temp1.add(tempModel); temp2.add(tempValues); temp.add(temp1); temp.add(temp2); // Add box to "Temperature" panel Temperature.add(temp); Temperature.setBorder(BorderFactory.createTitledBorder("Temperature")); /* Create the "Pressure" panel The user must specify which pressure model to use. Note: As of 10-Feb-2009, the only option is "Constant" The user must also specify a list of pressures to build the model */ JPanel Pressure = new JPanel(); // Create the "pressModel" subpanel JPanel pressModel = new JPanel(); pressModel.setBorder(BorderFactory.createEmptyBorder(0,0,10,0)); // Create the labels JLabel pressModelLabel = new JLabel("Select Model: "); // Add the labels to the panel pressModel.add(pressModelLabel); pressModel.add(pressModelCombo = new JComboBox(tpModel)); // Adjust the labels properties pressModelCombo.setSelectedIndex(0); pressModelCombo.addActionListener(this); pressModelCombo.setRenderer(centerJComboBoxRenderer); // Create the "pressValues" subpanel JPanel pressValues = new JPanel(); // Create the labels JLabel valuePLabel = new JLabel("List of Pressures"); JLabel unitPLabel = new JLabel("Units"); // Create the data entries and edit their properties pressConstant = new JTextArea(3,10); pressConstantUnit = new JComboBox(pressUnits); pressConstantUnit.addActionListener(this); pressConstantUnit.setRenderer(centerJComboBoxRenderer); pressConstantUnit.setSelectedIndex(0); // Create scroll panel for list of pressures JScrollPane pressScroll = new JScrollPane(pressConstant); pressScroll.setBorder(BorderFactory.createLoweredBevelBorder()); // Create boxes to store labels and data Box leftP = Box.createVerticalBox(); Box rightP = Box.createVerticalBox(); // Add labels and data to boxes leftP.add(valuePLabel); leftP.add(pressScroll); rightP.add(unitPLabel); rightP.add(pressConstantUnit); // Add boxes to "pressValues" subpanel pressValues.add(leftP); pressValues.add(rightP); // Create boxes for Pressure panel Box press1 = Box.createHorizontalBox(); Box press2 = Box.createHorizontalBox(); Box press = Box.createVerticalBox(); // Populate boxes press1.add(pressModel); press2.add(pressValues); press.add(press1); press.add(press2); // Add box to "Pressure" panel Pressure.add(press); Pressure.setBorder(BorderFactory.createTitledBorder("Pressure")); // Create boxes for the PressAndTemp combined panel Box PressAndTemp = Box.createHorizontalBox(); PressAndTemp.add(Temperature); PressAndTemp.add(Pressure); // Create the PressAndTemp combined panel JPanel tempandpress = new JPanel(); tempandpress.add(PressAndTemp); tempandpress.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Temperature & Pressure"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create boxes for the entire Inputs tab Box TabTotal = Box.createVerticalBox(); TabTotal.add(Species); TabTotal.add(tempandpress); // Create the panel for the entire Input tab JPanel input = new JPanel(); input.add(TabTotal); input.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Initial Conditions"), BorderFactory.createEmptyBorder(5,5,5,5))); JScrollPane scrolltab2 = new JScrollPane(input); scrolltab2.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); return scrolltab2; } /* Tab0: Initialization This tab allows the user to input the initialization specifications of the simulation. The user must input the following information: - Whether to restart the prior simulation - The database - The primary thermodynamic library - The reaction model enlarger - The dynamic simulator * The time steps for integration * The absolute tolerance * The relative tolerance - The primary reaction library * Name * Location */ public JComponent createTabInitialization() { // Create cellrenderers for JComboBox/JTable - CENTER text TableCellRenderer centerTableRenderer = new CenterTRenderer(); // Create the "Database" panel JPanel Database = new JPanel(); Database.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Main database"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate the "Database" panel JLabel databaseLabel = new JLabel("Choose database"); Database.add(databaseLabel); databaseLabel.setToolTipText("Default = RMG/databases/RMG_database"); Database.add(databasePath = new JTextField(25)); databasePath.setText(System.getProperty("RMG.workingDirectory") + "/databases/RMG_database"); databasePath.setEditable(false); Database.add(databaseButton = new JButton("Select")); ChangeButtonListener addListenerDatabase = new ChangeButtonListener(); databaseButton.addActionListener(addListenerDatabase); databaseButton.setActionCommand("databasePath"); // Create the Primary Thermodynamic Library (PTL) panel JPanel PTL = new JPanel(); PTL.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Primary Thermo Library"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create PTL Name label JPanel ptlName = new JPanel(); ptlName.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the label JLabel ptlNameLabel = new JLabel("Name:"); ptlName.add(ptlNameLabel); ptlName.add(ptlLibName = new JTextField(20)); // Create PTL Location label JPanel ptlLoc = new JPanel(); ptlLoc.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the label JLabel ptlLocationLabel = new JLabel("Location:"); ptlLoc.add(ptlLocationLabel); ptlLocationLabel.setToolTipText("Default = " + "RMG/databases/RMG_database/thermo/primaryThermoLibrary"); ptlLoc.add(ptlPath = new JTextField(20)); ptlLoc.add(ptlButton = new JButton("Select")); ChangeButtonListener ptlAddListenerLib = new ChangeButtonListener(); ptlButton.addActionListener(ptlAddListenerLib); ptlButton.setActionCommand("ptlPath"); // Create table and scroll panel to store PTL(s) tablePTL = new JTable(tmodelPTL = new MyTableModelPRL()); tablePTL.setAutoResizeMode(JTable.AUTO_RESIZE_OFF); tablePTL.setPreferredScrollableViewportSize(new Dimension(600,50)); tablePTL.getColumnModel().getColumn(0).setPreferredWidth(100); tablePTL.getColumnModel().getColumn(1).setPreferredWidth(500); for (int i=0; i<tablePTL.getColumnCount(); i++) { TableColumn column = tablePTL.getColumnModel().getColumn(i); column.setCellRenderer(centerTableRenderer); } JScrollPane scrollPTL = new JScrollPane(tablePTL); scrollPTL.setBorder(BorderFactory.createLoweredBevelBorder()); // Create boxes to display the PTL table Box PTLtable1 = Box.createHorizontalBox(); Box PTLtable2 = Box.createHorizontalBox(); Box PTLtable3 = Box.createHorizontalBox(); Box PTLtable4 = Box.createHorizontalBox(); Box PTLtable5 = Box.createVerticalBox(); // Fill the boxes with the appropriate components of the table PTLtable1.add(AddPTL = new JButton("Add")); AddButtonListener addListenerPTL = new AddButtonListener(); AddPTL.addActionListener(addListenerPTL); AddPTL.setActionCommand("AddPTL"); AddPTL.setToolTipText("Press to submit PTL Name & Location"); PTLtable1.setBorder(BorderFactory.createEmptyBorder(10,10,10,10)); PTLtable2.add(DeletePTL = new JButton("Remove")); DeleteButtonListener deleteListenerPTL = new DeleteButtonListener(); DeletePTL.addActionListener(deleteListenerPTL); DeletePTL.setActionCommand("DeletePTL"); DeletePTL.setToolTipText("Press to remove PTL Name & Location"); PTLtable3.add(PTLtable1); PTLtable3.add(PTLtable2); PTLtable4.add(scrollPTL); PTLtable5.add(ptlName); PTLtable5.add(ptlLoc); PTLtable5.add(PTLtable3); PTLtable5.add(PTLtable4); PTL.add(PTLtable5); // Initialize the PTL with the RMG default library // This library contains H and H2, which cannot be estimated using Benson's group additivity scheme PRLVector initialPTL = new PRLVector(0, "Default_H_H2", databasePath.getText()+"/thermo/primaryThermoLibrary"); tmodelPTL.updatePRL(initialPTL); // Create the Primary Reaction Library (PRL) panel JPanel PRL = new JPanel(); PRL.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Primary Reaction Library"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create PRL Name label JPanel prlName = new JPanel(); prlName.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the label JLabel prlNameLabel = new JLabel("Name:"); prlName.add(prlNameLabel); prlName.add(prlLibName = new JTextField(20)); // Create PRL Location label JPanel prlLoc = new JPanel(); prlLoc.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the label JLabel prlLocationLabel = new JLabel("Location:"); prlLoc.add(prlLocationLabel); prlLocationLabel.setToolTipText("Default = " + "RMG/databases/RMG_database/primaryReactionLibrary/"); prlLoc.add(prlPath = new JTextField(20)); prlLoc.add(prlButton = new JButton("Select")); ChangeButtonListener prlAddListenerLib = new ChangeButtonListener(); prlButton.addActionListener(prlAddListenerLib); prlButton.setActionCommand("prlPath"); // Create table and scroll panel to store PRL(s) tablePRL = new JTable(tmodelPRL = new MyTableModelPRL()); tablePRL.setAutoResizeMode(JTable.AUTO_RESIZE_OFF); tablePRL.setPreferredScrollableViewportSize(new Dimension(600,50)); tablePRL.getColumnModel().getColumn(0).setPreferredWidth(100); tablePRL.getColumnModel().getColumn(1).setPreferredWidth(500); for (int i=0; i<tablePRL.getColumnCount(); i++) { TableColumn column = tablePRL.getColumnModel().getColumn(i); column.setCellRenderer(centerTableRenderer); } JScrollPane scrollPRL = new JScrollPane(tablePRL); scrollPRL.setBorder(BorderFactory.createLoweredBevelBorder()); // Create boxes to display the PRL table Box PRLtable1 = Box.createHorizontalBox(); Box PRLtable2 = Box.createHorizontalBox(); Box PRLtable3 = Box.createHorizontalBox(); Box PRLtable4 = Box.createHorizontalBox(); Box PRLtable5 = Box.createVerticalBox(); // Fill the boxes with the appropriate components of the table PRLtable1.add(AddPRL = new JButton("Add")); AddButtonListener addListenerPRL = new AddButtonListener(); AddPRL.addActionListener(addListenerPRL); AddPRL.setActionCommand("AddPRL"); AddPRL.setToolTipText("Press to submit PRL Name & Location"); PRLtable1.setBorder(BorderFactory.createEmptyBorder(10,10,10,10)); PRLtable2.add(DeletePRL = new JButton("Remove")); DeleteButtonListener deleteListenerPRL = new DeleteButtonListener(); DeletePRL.addActionListener(deleteListenerPRL); DeletePRL.setActionCommand("DeletePRL"); DeletePRL.setToolTipText("Press to remove PRL Name & Location"); PRLtable3.add(PRLtable1); PRLtable3.add(PRLtable2); PRLtable4.add(scrollPRL); PRLtable5.add(prlName); PRLtable5.add(prlLoc); PRLtable5.add(PRLtable3); PRLtable5.add(PRLtable4); PRL.add(PRLtable5); // Create the Seed Mechanism (SM) panel JPanel SM = new JPanel(); SM.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Seed Mechanism"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create SM Name label JPanel smName = new JPanel(); smName.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the label JLabel smNameLabel = new JLabel("Name:"); smName.add(smNameLabel); smName.add(smLibName = new JTextField(20)); // Create SM Location label JPanel smLoc = new JPanel(); smLoc.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the label JLabel smLocationLabel = new JLabel("Location:"); smLoc.add(smLocationLabel); smLocationLabel.setToolTipText("Default = " + "RMG/databases/RMG_database/SeedMechanism/combustion_core/version5"); smLoc.add(smPath = new JTextField(20)); smLoc.add(smButton = new JButton("Select")); ChangeButtonListener smAddListenerLib = new ChangeButtonListener(); smButton.addActionListener(smAddListenerLib); smButton.setActionCommand("smPath"); // Create table and scroll panel to store SM(s) tableSM = new JTable(tmodelSM = new MyTableModelPRL()); tableSM.setAutoResizeMode(JTable.AUTO_RESIZE_OFF); tableSM.setPreferredScrollableViewportSize(new Dimension(600,50)); tableSM.getColumnModel().getColumn(0).setPreferredWidth(100); tableSM.getColumnModel().getColumn(1).setPreferredWidth(500); for (int i=0; i<tableSM.getColumnCount(); i++) { TableColumn column = tableSM.getColumnModel().getColumn(i); column.setCellRenderer(centerTableRenderer); } JScrollPane scrollSM = new JScrollPane(tableSM); scrollSM.setBorder(BorderFactory.createLoweredBevelBorder()); // Create boxes to display the PRL table Box SMtable1 = Box.createHorizontalBox(); Box SMtable2 = Box.createHorizontalBox(); Box SMtable3 = Box.createHorizontalBox(); Box SMtable4 = Box.createHorizontalBox(); Box SMtable5 = Box.createVerticalBox(); // Fill the boxes with the appropriate components of the table SMtable1.add(AddSM = new JButton("Add")); AddButtonListener addListenerSM = new AddButtonListener(); AddSM.addActionListener(addListenerSM); AddSM.setActionCommand("AddSM"); AddSM.setToolTipText("Press to submit Seed Mechanism Name & Location"); SMtable1.setBorder(BorderFactory.createEmptyBorder(10,10,10,10)); SMtable2.add(DeleteSM = new JButton("Remove")); DeleteButtonListener deleteListenerSM = new DeleteButtonListener(); DeleteSM.addActionListener(deleteListenerSM); DeleteSM.setActionCommand("DeleteSM"); DeleteSM.setToolTipText("Press to remove Seed Mechanism Name & Location"); SMtable3.add(SMtable1); SMtable3.add(SMtable2); SMtable4.add(scrollSM); SMtable5.add(smName); SMtable5.add(smLoc); SMtable5.add(SMtable3); SMtable5.add(SMtable4); SM.add(SMtable5); // Create & fill box for Initialization tab Box TabTotal = Box.createVerticalBox(); TabTotal.add(Database); TabTotal.add(PTL); TabTotal.add(PRL); TabTotal.add(SM); // Create the thermochemLibrary panel JPanel thermochemLibrary = new JPanel(); thermochemLibrary.add(TabTotal); thermochemLibrary.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder( "Thermochemistry Libraries"), BorderFactory.createEmptyBorder(10,10,10,10))); // Embed the thermochemistry panel in a scroll panel JScrollPane scrolltab = new JScrollPane(thermochemLibrary); scrolltab.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); return scrolltab; } public JComponent createTabSolver() { // Create cellrenderers for JComboBox/JTable - CENTER text ListCellRenderer centerJComboBoxRenderer = new CenterJCBRenderer(); // Create the Dynamic Simulator (DS) panel JPanel DS = new JPanel(); DS.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Dynamic Simulator"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create the DS subpanel: Solver JPanel dsSolver = new JPanel(); dsSolver.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the Solver subpanel JLabel solverLabel = new JLabel("Select Dynamic Simulator"); dsSolver.add(solverLabel); solverLabel.setToolTipText("Default = DASSL"); dsSolver.add(simulatorCombo = new JComboBox(simOptions)); simulatorCombo.addActionListener(this); simulatorCombo.setRenderer(centerJComboBoxRenderer); simulatorCombo.setSelectedIndex(0); simulatorCombo.setActionCommand("saOnOff"); // Create the DS subpanel: aTolPanel JPanel aTolPanel = new JPanel(); aTolPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the aTolPanel subpanel JLabel aToleranceLabel = new JLabel("Select absolute tolerance"); aTolPanel.add(aToleranceLabel); aToleranceLabel.setToolTipText("Suggested value = 1E-12"); aTolPanel.add(aTolerance = new JTextField()); aTolerance.setPreferredSize(new Dimension(100,25)); aTolerance.addActionListener(this); aTolerance.setHorizontalAlignment(JTextField.CENTER); aTolerance.setText("1E-12"); // Create the DS subpanel: rTolPanel JPanel rTolPanel = new JPanel(); rTolPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the rTolPanel subpanel JLabel rToleranceLabel = new JLabel("Select relative tolerance"); rTolPanel.add(rToleranceLabel); rToleranceLabel.setToolTipText("Suggested value = 1E-3"); rTolPanel.add(rTolerance = new JTextField()); rTolerance.setPreferredSize(new Dimension(100,25)); rTolerance.addActionListener(this); rTolerance.setHorizontalAlignment(JTextField.CENTER); rTolerance.setText("1E-3"); // Create the DS subpanel: interConv JPanel interConv = new JPanel(); interConv.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the subpanel JLabel multiConvLabel = new JLabel("Intermediate Conversions"); interConv.add(multiConvLabel); multiConvLabel.setToolTipText("Default = AUTO"); interConv.add(multiConv = new JTextArea(2,15)); multiConv.setText("AUTO"); // Create the DS subpanel: interTS JPanel interTS = new JPanel(); interTS.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the subpanel JLabel multiTSLabel = new JLabel("Intermediate Time Steps"); interTS.add(multiTSLabel); multiTSLabel.setToolTipText("Default = AUTO"); interTS.add(multiTS = new JTextArea(2,15)); multiTS.setEnabled(false); multiTS.setText("AUTO"); // Create boxes for DS panel Box ds = Box.createVerticalBox(); // Populate the boxes ds.add(dsSolver); ds.add(aTolPanel); ds.add(rTolPanel); ds.add(interConv); ds.add(interTS); DS.add(ds); // Create the total pressure dependence panel JPanel totalPDep = new JPanel(); totalPDep.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Pressure dependence"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create the Pressure dependence (Pdep) model panel JPanel Pdep = new JPanel(); Pdep.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the ME panel JLabel modelLabel = new JLabel("Choose pressure dependence model"); Pdep.add(modelLabel); modelLabel.setToolTipText("Default = Off"); Pdep.add(pdepCombo = new JComboBox(pdepOptions)); pdepCombo.setActionCommand("pDep"); // Create the Spectroscopic Data Estimator (SDE) subpanel JPanel SDE = new JPanel(); SDE.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the subpanel JLabel sdeLabel = new JLabel("Spectroscopic Data Estimator"); SDE.add(sdeLabel); SDE.add(sdeCombo = new JComboBox(sdeOptions)); sdeCombo.setEnabled(false); // Create the PDep Kinetics Model (PDKM) subpanel JPanel PDKM = new JPanel(); PDKM.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Populate the subpanel JLabel pdkmLabel = new JLabel("PDep Kinetics Model"); PDKM.add(pdkmLabel); PDKM.add(pdkmCombo = new JComboBox(pdkmOptions)); pdkmCombo.setEnabled(false); pdkmCombo.setActionCommand("pdkm"); JPanel Cheby = new JPanel(); Cheby.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); // Create boxes to store each of the pieces of data Box boxTP = Box.createVerticalBox(); Box boxMin = Box.createVerticalBox(); Box boxMax = Box.createVerticalBox(); Box boxUnits = Box.createVerticalBox(); Box boxNumGenerate = Box.createVerticalBox(); Box boxNumReport = Box.createVerticalBox(); // Add labels and data fields to boxes boxTP.add(new JLabel(" ")); boxTP.add(new JLabel("Temperature")); boxTP.add(new JLabel(" ")); boxTP.add(new JLabel("Pressure")); boxMin.add(new JLabel("Min. Value")); boxMin.add(chebyTMin = new JTextField()); boxMin.add(new JLabel(" ")); boxMin.add(chebyPMin = new JTextField()); chebyTMin.setPreferredSize(new Dimension (25,25)); chebyTMin.setHorizontalAlignment(JTextField.CENTER); chebyTMin.addActionListener(this); chebyPMin.setPreferredSize(new Dimension (25,25)); chebyPMin.setHorizontalAlignment(JTextField.CENTER); chebyPMin.addActionListener(this); boxMax.add(new JLabel("Max. Value")); boxMax.add(chebyTMax = new JTextField()); boxMax.add(new JLabel(" ")); boxMax.add(chebyPMax = new JTextField()); chebyTMax.setPreferredSize(new Dimension (25,25)); chebyTMax.setHorizontalAlignment(JTextField.CENTER); chebyTMax.addActionListener(this); chebyPMax.setPreferredSize(new Dimension (25,25)); chebyPMax.setHorizontalAlignment(JTextField.CENTER); chebyPMax.addActionListener(this); boxUnits.add(new JLabel("Units")); boxUnits.add(chebyTUnits = new JComboBox(tempUnits)); boxUnits.add(new JLabel(" ")); boxUnits.add(chebyPUnits = new JComboBox(pressUnits)); boxNumGenerate.add(new JLabel("# to Generate")); boxNumGenerate.add(chebyTGen = new JTextField()); boxNumGenerate.add(new JLabel(" ")); boxNumGenerate.add(chebyPGen = new JTextField()); chebyTGen.setPreferredSize(new Dimension (25,25)); chebyTGen.setHorizontalAlignment(JTextField.CENTER); chebyTGen.addActionListener(this); chebyPGen.setPreferredSize(new Dimension (25,25)); chebyPGen.setHorizontalAlignment(JTextField.CENTER); chebyPGen.addActionListener(this); boxNumReport.add(new JLabel("# to Report")); boxNumReport.add(chebyTRep = new JTextField()); boxNumReport.add(new JLabel(" ")); boxNumReport.add(chebyPRep = new JTextField()); chebyTRep.setPreferredSize(new Dimension (25,25)); chebyTRep.setHorizontalAlignment(JTextField.CENTER); chebyTRep.addActionListener(this); chebyPRep.setPreferredSize(new Dimension (25,25)); chebyPRep.setHorizontalAlignment(JTextField.CENTER); chebyPRep.addActionListener(this); // Add the boxes to the "Cheby" subpanel Cheby.add(boxTP); Cheby.add(boxMin); Cheby.add(boxMax); Cheby.add(boxUnits); Cheby.add(boxNumGenerate); Cheby.add(boxNumReport); Box pDepBox = Box.createVerticalBox(); pDepBox.add(Pdep); pDepBox.add(SDE); pDepBox.add(PDKM); pDepBox.add(Cheby); totalPDep.add(pDepBox); JComboBox[] allTab = {pdepCombo, sdeCombo, pdkmCombo, chebyTUnits, chebyPUnits}; initializeJCB(allTab); JComponent[] pdkmComps = {chebyTMin, chebyTMax, chebyTUnits, chebyTGen, chebyTRep, chebyPMin, chebyPMax, chebyPUnits, chebyPGen, chebyPRep}; disableComponents(pdkmComps); Box TabTotal = Box.createVerticalBox(); TabTotal.add(DS); TabTotal.add(totalPDep); // Create the dynamicSimulator panel JPanel dynamicSimulator = new JPanel(); dynamicSimulator.add(TabTotal); dynamicSimulator.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder( "Solver Options"), BorderFactory.createEmptyBorder(10,10,10,10))); // Embed the dynamicSimulator panel in a scroll panel JScrollPane scrolltab = new JScrollPane(dynamicSimulator); scrolltab.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); return scrolltab; } /* Tab1: Termination Sequence This tab allows the user to input the terminating sequence of the simulation. The user must input the followig information: - The goal of the reaction * The limiting reactant & its associated conversion * The time of reaction - The error tolerance */ public JComponent createTabTermination() { // Create cellrenderers for JComboBox/JTable - CENTER text ListCellRenderer centerJComboBoxRenderer = new CenterJCBRenderer(); // Create "Goal" panel JPanel Goal = new JPanel(); Goal.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Termination Goal"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate the panel JLabel controllerLabel = new JLabel("Goal of reaction"); Goal.add(controllerLabel); Goal.add(controllerCombo = new JComboBox(goalOptions)); controllerCombo.setActionCommand("GoalofReaction"); controllerCombo.addActionListener(this); controllerCombo.setRenderer(centerJComboBoxRenderer); // "If Goal = Conversion" subpanel JPanel Conversion = new JPanel(); Conversion.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Conversion"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create conversionName subpanel JPanel conversionName = new JPanel(); JLabel nameCLabel = new JLabel("Species"); conversionName.add(nameCLabel); conversionName.add(SpeciesConvName = new JComboBox(species_blank)); // Create conversionValue subpanel JPanel conversionValue = new JPanel(); JLabel convCLabel = new JLabel("Fractional Conversion"); conversionValue.add(convCLabel); conversionValue.add(conversion = new JTextField()); conversion.setPreferredSize(new Dimension(50,25)); conversion.addActionListener(this); conversion.setHorizontalAlignment(JTextField.CENTER); Box convBox = Box.createVerticalBox(); convBox.add(conversionName); convBox.add(conversionValue); Conversion.add(convBox); // "If Goal = ReactionTime" subpanel JPanel ReactionTime = new JPanel(); ReactionTime.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Reaction Time"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate the subpanel ReactionTime.add(new JLabel("Input reaction time")); ReactionTime.add(time = new JTextField()); time.setPreferredSize(new Dimension(50,25)); time.setEnabled(false); time.addActionListener(this); time.setHorizontalAlignment(JTextField.CENTER); ReactionTime.add(timeCombo = new JComboBox(timeUnits)); timeCombo.setEnabled(false); timeCombo.addActionListener(this); timeCombo.setRenderer(centerJComboBoxRenderer); timeCombo.setSelectedIndex(1); // Error tolerance subpanel JPanel eTolPanel = new JPanel(); eTolPanel.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Error tolerance"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate subpanel JLabel eToleranceLabel = new JLabel("Select error tolerance"); eToleranceLabel.setToolTipText("Suggested value = 0.1"); eTolPanel.add(eToleranceLabel); eTolPanel.add(eTolerance = new JTextField()); eTolerance.setPreferredSize(new Dimension(100,25)); eTolerance.addActionListener(this); eTolerance.setHorizontalAlignment(JTextField.CENTER); eTolerance.setText("0.1"); // Create boxes to store subpanels Box term = Box.createVerticalBox(); Box goalTypes = Box.createHorizontalBox(); goalTypes.add(Conversion); goalTypes.add(ReactionTime); term.add(Goal); term.add(goalTypes); term.add(eTolPanel); JPanel terminationPanel = new JPanel(); terminationPanel.add(term); terminationPanel.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Finish Controller"), BorderFactory.createEmptyBorder(5,5,5,5))); JScrollPane scrolltab = new JScrollPane(terminationPanel); scrolltab.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); return scrolltab; } /* Tab3: Error Analysis This tab allows the user to choose whether error bars & sensitivity coefficients (and for which speices) are available in the output .txt files The user must input the following information: - Whether to display error bars - Whether to display sensitivity coefficients * Which species to analyze */ public JComponent createTabSensitivity() { // Create cellrenderers for JComboBox/JTable - CENTER text ListCellRenderer centerJComboBoxRenderer = new CenterJCBRenderer(); TableCellRenderer centerRenderer = new CenterTRenderer(); // Create errorbars (EB) subpanel JPanel EB = new JPanel(); EB.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Error Bars"), BorderFactory.createEmptyBorder(10,10,10,10))); // Populate the subpanel EB.add(new JLabel("Display error bars")); EB.add(eBarsCombo = new JComboBox(yesnoOptions)); eBarsCombo.addActionListener(this); eBarsCombo.setRenderer(centerJComboBoxRenderer); eBarsCombo.setSelectedIndex(0); eBarsCombo.setEnabled(false); // Create Sensitivity Coefficients (SC) panel JPanel SC = new JPanel(); SC.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Sensitivity Coefficients"), BorderFactory.createEmptyBorder(10,10,10,10))); // Create SC on/off subpanel JPanel scOnOff = new JPanel(); scOnOff.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); scOnOff.add(new JLabel("Display sensitivity coefficients")); scOnOff.add(sensCoeffCombo = new JComboBox(yesnoOptions)); sensCoeffCombo.setSelectedIndex(0); sensCoeffCombo.setActionCommand("scOnOff"); sensCoeffCombo.addActionListener(this); sensCoeffCombo.setRenderer(centerJComboBoxRenderer); sensCoeffCombo.setEnabled(false); // Create SC list subpanel JPanel scList = new JPanel(); scList.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); scList.add(new JLabel("Species Name")); scList.add(scName = new JTextField()); scName.setEnabled(false); scName.setHorizontalAlignment(JTextField.CENTER); scName.setPreferredSize(new Dimension(60,25)); // Create sensitivity table, tablemodel, scroll panel tableSens = new JTable(tmodelSens = new MyTableModelSensitivity()); tableSens.setPreferredScrollableViewportSize(new Dimension(30,50)); tableSens.getColumnModel().getColumn(0).setPreferredWidth(30); tableSens.setEnabled(false); JScrollPane scrollSens = new JScrollPane(tableSens); scrollSens.setBorder(BorderFactory.createLoweredBevelBorder()); // * Set the alignment for all cells in the table to CENTER for (int i=0; i<tableSens.getColumnCount(); i++) { TableColumn column = tableSens.getColumnModel().getColumn(i); column.setCellRenderer(centerRenderer); } // Create boxes to display panels Box sens1 = Box.createHorizontalBox(); Box sens2 = Box.createHorizontalBox(); // Fill boxes sens1.add(AddSens = new JButton("Add")); sens1.setBorder(BorderFactory.createEmptyBorder(10,10,10,10)); AddButtonListener addListenerSens = new AddButtonListener(); AddSens.addActionListener(addListenerSens); AddSens.setActionCommand("AddSens"); AddSens.setToolTipText("Press to submit molecule"); AddSens.setEnabled(false); sens2.add(DeleteSens = new JButton("Remove")); DeleteButtonListener deleteListenerSens = new DeleteButtonListener(); DeleteSens.addActionListener(deleteListenerSens); DeleteSens.setActionCommand("DeleteSens"); DeleteSens.setToolTipText("Press to delete molecule"); DeleteSens.setEnabled(false); JPanel scButtons = new JPanel(); scButtons.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); scButtons.add(sens1); scButtons.add(sens2); Box scBox = Box.createVerticalBox(); scBox.add(scOnOff); scBox.add(scList); scBox.add(scButtons); scBox.add(scrollSens); SC.add(scBox); // Total tab Box Tab3Total = Box.createVerticalBox(); Tab3Total.add(EB); Tab3Total.add(SC); JPanel SA = new JPanel(); SA.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Sensitivity Analysis"), BorderFactory.createEmptyBorder(5,5,5,5))); SA.add(Tab3Total); JScrollPane scrolltab3 = new JScrollPane(SA); scrolltab3.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); return scrolltab3; } class DeleteButtonListener implements ActionListener { public void actionPerformed(ActionEvent e) { if ("DeletePRL".equals(e.getActionCommand())) { int highlightRow = tablePRL.getSelectedRow(); if (highlightRow == -1) { System.out.println("Please select a row to delete"); } else tmodelPRL.deleteRow(highlightRow); } else if ("DeleteInput".equals(e.getActionCommand())) { int highlightRow = tableInput.getSelectedRow(); if (highlightRow == -1) { System.out.println("Please select a row to delete"); } else { tmodelInput.deleteRow(highlightRow); limitingReactant(); } } else if ("DeleteSens".equals(e.getActionCommand())) { int highlightRow = tableSens.getSelectedRow(); if (highlightRow == -1) { System.out.println("Please select a row to delete"); } else tmodelSens.deleteRow(highlightRow); } else if ("DeletePTL".equals(e.getActionCommand())) { int highlightRow = tablePTL.getSelectedRow(); if (highlightRow == -1) { System.out.println("Please select a row to delete"); } else tmodelPTL.deleteRow(highlightRow); } else if ("DeleteSM".equals(e.getActionCommand())) { int highlightRow = tableSM.getSelectedRow(); if (highlightRow == -1) { System.out.println("Please select a row to delete"); } else tmodelSM.deleteRow(highlightRow); } } } class AddButtonListener implements ActionListener { public void actionPerformed(ActionEvent e) { // IF the user adds a primary reaction library ... if ("AddPRL".equals(e.getActionCommand())) { // Extract the information int prlInput0 = tmodelPRL.nextEmptyRow+1; String prlInput1 = prlLibName.getText(); String prlInput2 = prlPath.getText(); // Check that all information is present if (prlInput1.equals("") || prlInput2.equals("")) { System.out.println("Please input the Name and Location of a Primary Reaction Library"); } else { PRLVector prlEntry = new PRLVector(prlInput0, prlInput1, prlInput2); tmodelPRL.updatePRL(prlEntry); prlLibName.setText(""); prlPath.setText(""); } } else if ("AddPTL".equals(e.getActionCommand())) { // Extract the information int ptlInput0 = tmodelPTL.nextEmptyRow+1; String ptlInput1 = ptlLibName.getText(); String ptlInput2 = ptlPath.getText(); // Check that all information is present if (ptlInput1.equals("") || ptlInput2.equals("")) { System.out.println("Please input the Name and Location of a Primary Thermo Library"); } else { PRLVector ptlEntry = new PRLVector(ptlInput0, ptlInput1, ptlInput2); tmodelPTL.updatePRL(ptlEntry); ptlLibName.setText(""); ptlPath.setText(""); } } else if ("AddSM".equals(e.getActionCommand())) { // Extract the information int smInput0 = tmodelSM.nextEmptyRow+1; String smInput1 = smLibName.getText(); String smInput2 = smPath.getText(); // Check that all information is present if (smInput1.equals("") || smInput2.equals("")) { System.out.println("Please input the Name and Location of a Seed Mechanism"); } else { PRLVector smEntry = new PRLVector(smInput0, smInput1, smInput2); tmodelSM.updatePRL(smEntry); smLibName.setText(""); smPath.setText(""); } // ELSE IF the user adds a species ... } else if ("AddInput".equals(e.getActionCommand())) { // Extract the information int icInput0 = tmodelInput.nextEmptyRow+1; String icInput1 = NameInput.getText(); boolean renameName = false; try { int doesNameBeginWithNumber = Integer.parseInt(icInput1.substring(0,1)); renameName = true; } catch (NumberFormatException e1) { // We're good } String icInput2 = ConcInput.getText(); String icInput3 = (String)UnitsInput.getSelectedItem(); String icInput4 = (String)ReactiveInput.getSelectedItem(); String icInput5 = ""; // Ask user for adjacency list if species is marked "Reactive" if (!icInput4.equals("Inert")) { if (!speciesAdjList.getText().equals("")) { icInput5 = speciesAdjList.getText(); } else if (!InChIInput.getText().equals("")) { String inchi = InChIInput.getText(); icInput5 = Species.inchi2AdjList(inchi); } else { File molFile = null; molFile = askUserForInput("Select corresponding .mol file", false, null); if (molFile != null) icInput5 = Species.mol2AdjList(molFile.getAbsolutePath(), molFile.getAbsolutePath()); } } else { String[] inerts = {"N2", "Ar", "Ne", "He"}; boolean correctInertFormat = false; for (int i=0; i<inerts.length; i++) { if (icInput1.equals(inerts[i])) correctInertFormat = true; } if (!correctInertFormat) { System.out.println("ERROR: Adding Inert Gas species to model - RMG recognizes the following species as Inert Gas (case sensitive): N2, Ar, Ne, He"); return; } } // If a species is marked "Reactive-User", ask user for location of IncludeSpecies.txt file if (icInput4.equals("Reactive-User")) { // If the path is not known if (isPath.getText().equals("")) { File isFile = null; isFile = askUserForInput("Select IncludeSpecies.txt file", false, null); if (isFile != null) { isPath.setText(isFile.getPath()); isPath.setEnabled(true); } } } // Check that all information is present if (icInput1.equals("") || icInput2.equals("") || (icInput5.equals("") & !icInput4.equals("Inert"))) { System.out.println("Please input the molecule's Name, Concentration, and Adjacency List"); } else if (renameName) { System.out.println("\nA species name should not begin with a number." + " Please rename species: " + icInput1 + "\n"); } else { ICVector icEntry = new ICVector(icInput0, icInput1, icInput2, icInput3, icInput4, icInput5); tmodelInput.updateIC(icEntry); NameInput.setText(""); InChIInput.setText(""); ConcInput.setText(""); UnitsInput.setSelectedIndex(0); ReactiveInput.setSelectedIndex(0); speciesAdjList.setText(""); if (!icInput4.equals("Inert")) limitingReactant(); } // ELSE IF the user adds a species to sensitivity analysis } else if ("AddSens".equals(e.getActionCommand())) { // Extract the information int sensInput0 = tmodelSens.nextEmptyRow+1; String sensInput1 = scName.getText(); // Check if all information is present if (sensInput1.equals("")) { System.out.println("Please input the name of a Molecule"); } else { SensVector sensEntry = new SensVector(sensInput0, sensInput1); tmodelSens.updateSens(sensEntry); scName.setText(""); } } } } class ChangeButtonListener implements ActionListener { public void actionPerformed(ActionEvent e) { // IF the user selects to switch the IncludeSpecies.txt path if ("isPath".equals(e.getActionCommand())) { File path = null; path = askUserForInput("Select IncludeSpecies.txt file", false, null); if (path != null) isPath.setText(path.getPath()); // ELSE IF user selects to switch the database path } else if ("databasePath".equals(e.getActionCommand())) { File path = null; String workingDirectory = System.getProperty("RMG.workingDirectory"); path = askUserForInput("Select database folder", true, workingDirectory + "/databases"); if (path != null) databasePath.setText(path.getPath()); // If user selects to switch Primary Thermo Library path } else if ("ptlPath".equals(e.getActionCommand())) { File path = null; path = askUserForInput("Select PrimaryThermoLibrary folder", true, databasePath.getText()+"/thermo"); if (path != null) ptlPath.setText(path.getPath()); // If user selects to switch Primary Reaction Library path } else if ("prlPath".equals(e.getActionCommand())) { File path = null; path = askUserForInput("Select PrimaryReactionLibrary folder", true, databasePath.getText()+"/primaryReactionLibrary"); if (path != null) prlPath.setText(path.getPath()); } else if ("smPath".equals(e.getActionCommand())) { File path = null; path = askUserForInput("Select SeedMechanism folder", true, databasePath.getText()+"/SeedMechanisms"); if (path != null) smPath.setText(path.getPath()); } } } public File askUserForInput (String popupwindowTitle, boolean folder, String additionalPath) { String workingDirectory = System.getProperty("RMG.workingDirectory"); String completePath =""; if (additionalPath != null) completePath = additionalPath; else completePath = workingDirectory; JFileChooser chooser = new JFileChooser(completePath); chooser.setApproveButtonText("Select"); chooser.setDialogTitle(popupwindowTitle); chooser.rescanCurrentDirectory(); if (folder) chooser.setFileSelectionMode(JFileChooser.FILES_AND_DIRECTORIES); int result = chooser.showDialog(GUI.this, null); File file = null; if (result == chooser.APPROVE_OPTION) { file = chooser.getSelectedFile(); } else { chooser.cancelSelection(); } return file; } /* * This function updates the Limiting Reactant combobox on the Termination * tab of the GUI - for a termination criteria of expected conversion, only * an input to the simulation is acceptable */ public void limitingReactant() { int permanentNumber = SpeciesConvName.getItemCount(); for (int i=1; i<permanentNumber; i++) { SpeciesConvName.removeItemAt(1); } int nonInertCount = 0; for (int j=0; j<tmodelInput.nextEmptyRow; j++) { if (!tmodelInput.getValueAt(j,3).equals("Inert")) { ++nonInertCount; SpeciesConvName.insertItemAt(tmodelInput.getValueAt(j,0),nonInertCount); } } } public void createConditionFile(boolean saveAndRun) { // Let's create the condition.txt file! String conditionFile = ""; String[] tempString; // Add user supplied comments conditionFile += "// User supplied comments:\r"; if (headerComments.getText().equals("")) System.out.println("Warning: Writing condition.txt file: No comments being read in."); String[] header4Condition = headerComments.getText().split("[\n]"); for (int i=0; i<header4Condition.length; i++) { conditionFile += "// " + header4Condition[i] + "\r"; } // Add date and time to the file String DATE_FORMAT_NOW = "yyyy-MM-dd HH:mm:ss"; SimpleDateFormat sdf = new SimpleDateFormat(DATE_FORMAT_NOW); Calendar cal = Calendar.getInstance(); conditionFile += "//\r// File created at: " + sdf.format(cal.getTime()) + "\r\r"; // String storing the folder of the Main Database (w.r.t. $RMG/databases) String stringMainDatabase = ""; // Add the name of the database and primary thermo library if (databasePath.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read Main Database (Thermochemical Libraries tab)"); return; } else { tempString = databasePath.getText().split("[\\\\,/]"); stringMainDatabase = tempString[tempString.length-1]; conditionFile += "Database: " + stringMainDatabase + "\r\r"; } // Add the name(s)/location(s) of the primary thermo library String rmgEnvVar = System.getProperty("RMG.workingDirectory"); String ptlReferenceDirectory = rmgEnvVar + "/databases/" + stringMainDatabase + "/thermo/"; conditionFile += "PrimaryThermoLibrary:\r"; if (tablePTL.getRowCount()==0) { System.out.println("Warning: Writing condition.txt file: Could not read Primary Thermo Library (Thermochemical Libraries tab)"); } else { for (int k=0; k<tablePTL.getRowCount(); k++) { conditionFile += "Name: " + tablePTL.getValueAt(k,0) + "\r" + "Location: "; String ptlDir = (String)tablePTL.getValueAt(k,1); if (ptlDir.startsWith(rmgEnvVar)) { int startIndex = ptlReferenceDirectory.length(); conditionFile += ptlDir.substring(startIndex) + "\r"; } else { conditionFile += ptlDir + "\r"; } } } conditionFile += "END\r\r"; // Add the temperature model, list of temperatures, and units conditionFile += "TemperatureModel: " + tempModelCombo.getSelectedItem() + " (" + tempConstantUnit.getSelectedItem() + ")"; if (tempConstant.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read list of temperatures (Initial Conditions tab)"); return; } else { String[] tempLines = tempConstant.getText().split("[\n]"); StringTokenizer st = null; for (int i=0; i<tempLines.length; i++) { st = new StringTokenizer(tempLines[i]); while (st.hasMoreTokens()) { String line = st.nextToken(); if (line.endsWith(",")) line = line.substring(0,line.length()-1); conditionFile += " " + line; } } } conditionFile += "\r"; // Add the pressure model, list of pressures, and units conditionFile += "PressureModel: " + pressModelCombo.getSelectedItem() + " (" + pressConstantUnit.getSelectedItem() + ")"; if (pressConstant.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read list of pressures (Initial Conditions tab)"); return; } else { String[] pressLines = pressConstant.getText().split("[\n]"); StringTokenizer st = null; for (int i=0; i<pressLines.length; i++) { st = new StringTokenizer(pressLines[i]); while (st.hasMoreTokens()) { String line = st.nextToken(); if (line.endsWith(",")) line = line.substring(0,line.length()-1); conditionFile += " " + line; } } } conditionFile += "\r\r"; // Add the equation of state (if equal to liquid) if (eosCombo.getSelectedItem().equals("Liquid")) { conditionFile += "EquationOfState: Liquid\r"; } // Add the user-specified maximum number of carbons, oxygens, and radicals / species if (!maxCarbonNum.getText().equals("")) conditionFile += "MaxCarbonNumberPerSpecies: " + maxCarbonNum.getText() + "\r"; if (!maxOxygenNum.getText().equals("")) conditionFile += "MaxOxygenNumberPerSpecies: " + maxOxygenNum.getText() + "\r"; if (!maxRadicalNum.getText().equals("")) conditionFile += "MaxRadicalNumberPerSpecies: " + maxRadicalNum.getText() + "\r"; // Add whether to generate InChIs or not if (inchiCombo.getSelectedItem().equals("Yes")) conditionFile += "InChIGeneration: on\r"; // Add whether to turn solvation on or not // Add whether to run on-the-fly quantum jobs or not // Determine if each species is reactive, unreactive, or inert int nonInertCount = 0; boolean unreactiveStatus = false; String reactiveSpecies = ""; String inertSpecies = ""; if (tableInput.getRowCount()==0) { System.out.println("ERROR: Writing condition.txt file: Could not read table of reactants (Initial Conditions tab)"); return; } else { for (int i=0; i<tableInput.getRowCount(); i++) { if (tableInput.getValueAt(i,3).equals("Inert")) { inertSpecies += tableInput.getValueAt(i,0) + " " + tableInput.getValueAt(i,1) + " (" + tableInput.getValueAt(i,2) + ")\r"; } else if (tableInput.getValueAt(i,3).equals("Reactive-RMG")) { ++nonInertCount; reactiveSpecies += "(" + nonInertCount + ") " + tableInput.getValueAt(i,0) + " " + tableInput.getValueAt(i,1) + " (" + tableInput.getValueAt(i,2) + ")\r" + tableInput.getValueAt(i,4) + "\r\r"; } else if (tableInput.getValueAt(i,3).equals("Reactive-User")) { unreactiveStatus = true; ++nonInertCount; reactiveSpecies += "(" + nonInertCount + ") " + tableInput.getValueAt(i,0) + " " + tableInput.getValueAt(i,1) + " (" + tableInput.getValueAt(i,2) + ") unreactive\r" + tableInput.getValueAt(i,4) + "\r\r"; } } // Add the non-inert gas species conditionFile += "\rInitialStatus:\r\r" + reactiveSpecies + "END\r\r"; // Add the inert gas species conditionFile += "InertGas:\r" + inertSpecies + "END\r\r"; } // Add the spectroscopic data estimator conditionFile += "SpectroscopicDataEstimator: "; if (sdeCombo.getSelectedItem().equals("Frequency Groups")) { conditionFile += "FrequencyGroups\r"; // } else if (sdeCombo.getSelectedItem().equals("Three Frequency Model")) { // conditionFile += "ThreeFrequencyModel\r"; } else if (sdeCombo.getSelectedItem().equals("off")) { conditionFile += "off\r"; } // Add the pressure dependence model conditionFile += "PressureDependence: "; if (pdepCombo.getSelectedItem().equals("Modified Strong Collision")) { conditionFile += "modifiedstrongcollision\r"; } else if (pdepCombo.getSelectedItem().equals("Reservoir State")) { conditionFile += "reservoirstate\r"; } else if (pdepCombo.getSelectedItem().equals("off")) { conditionFile += "off\r"; } // Add the pdep kinetics model if (!pdepCombo.getSelectedItem().equals("off")) { conditionFile += "PDepKineticsModel: "; if (pdkmCombo.getSelectedItem().equals("CHEB")) { conditionFile += "Chebyshev\r"; if (!chebyTMin.getText().equals("")) { if (chebyTMax.getText().equals("") || chebyTGen.getText().equals("") || chebyTRep.getText().equals("") || chebyPMin.getText().equals("") || chebyPMax.getText().equals("") || chebyPGen.getText().equals("") || chebyPRep.getText().equals("")) System.out.println("ERROR: Writing condition.txt file: All Chebyshev entries must be filled in (Dynamic Simulator tab)"); conditionFile += "TRange: (" + chebyTUnits.getSelectedItem() + ") " + chebyTMin.getText() + " " + chebyTMax.getText() + " " + chebyTGen.getText() + " " + chebyTRep.getText() + "\r"; conditionFile += "PRange: (" + chebyPUnits.getSelectedItem() + ") " + chebyPMin.getText() + " " + chebyPMax.getText() + " " + chebyPGen.getText() + " " + chebyPRep.getText() + "\r"; } } else if (pdkmCombo.getSelectedItem().equals("PLOG")) conditionFile += "PDepArrhenius\r"; else if (pdkmCombo.getSelectedItem().equals("Rate")) conditionFile += "Rate\r"; } conditionFile += "\r"; // Add the path of the IncludeSpecies.txt file (if present) if (unreactiveStatus) { conditionFile += "IncludeSpecies: "; if (isPath.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read location of IncludeSpecies.txt (Initial Conditions tab)"); return; } else { if (isPath.getText().startsWith(rmgEnvVar)) { int startIndex = rmgEnvVar.length()+1; conditionFile += isPath.getText().substring(startIndex) + "\r\r"; } else { conditionFile += isPath.getText() + "\r\r"; } } } // Add the finish controller conditionFile += "FinishController:\r" + "(1) Goal "; // If goal is conversion boolean conversionGoal = true; if (controllerCombo.getSelectedItem().equals("Conversion")) { if (SpeciesConvName.getSelectedItem().equals(" ") || conversion.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read limiting reactant and/or fractional conversion (Termination tab)"); return; } else { conditionFile += controllerCombo.getSelectedItem() + " " + SpeciesConvName.getSelectedItem() + " " + conversion.getText() + "\r"; } } else if (controllerCombo.getSelectedItem().equals("ReactionTime")) { if (time.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read time of reaction (Termination tab)"); return; } else { conversionGoal = false; conditionFile += controllerCombo.getSelectedItem() + " " + time.getText() + " (" + timeCombo.getSelectedItem() + ")\r"; } } if (eTolerance.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read model's error tolerance (Termination tab)"); return; } else { conditionFile += "(2) Error Tolerance: " + eTolerance.getText() + "\r\r"; } // Add the dynamic simulator conditionFile += "DynamicSimulator: " + simulatorCombo.getSelectedItem() + "\r"; if (conversionGoal) { conditionFile += "Conversions:"; if (multiConv.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read list of intermediate conversions (Dynamic Simulator tab)"); return; } else { String[] convLines = multiConv.getText().split("[\n]"); for (int i=0; i<convLines.length; i++) { StringTokenizer st = null; st = new StringTokenizer(convLines[i]); while (st.hasMoreTokens()) { String line = st.nextToken(); if (line.endsWith(",")) line = line.substring(0,line.length()-1); conditionFile += " " + line; } } } } else { conditionFile += "TimeStep:"; if (multiTS.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read list of intermediate time steps (Dynamic Simulator tab)"); return; } else { String[] tsLines = multiTS.getText().split("[\n]"); for (int i=0; i<tsLines.length; i++) { StringTokenizer st = null; st = new StringTokenizer(tsLines[i]); while (st.hasMoreTokens()) { String line = st.nextToken(); if (line.endsWith(",")) line = line.substring(0,line.length()-1); conditionFile += " " + line; } } } } if (aTolerance.getText().equals("") || rTolerance.getText().equals("")) { System.out.println("ERROR: Writing condition.txt file: Could not read absolute and/or relative tolerance (Dynamic Simulator tab)"); return; } else { conditionFile += "\rAtol: " + aTolerance.getText() + "\r" + "Rtol: " + rTolerance.getText() + "\r\r"; } // Add error bars & sensitivity analysis information (if DASPK is selected) if (simulatorCombo.getSelectedItem().equals("DASPK")) { conditionFile += "Error bars: "; if (eBarsCombo.getSelectedItem().equals("Yes")) { conditionFile += "on\r"; } else if (eBarsCombo.getSelectedItem().equals("No")) { conditionFile += "off\r"; } conditionFile += "Display sensitivity coefficients: "; if (sensCoeffCombo.getSelectedItem().equals("Yes")) { conditionFile += "on\rDisplay sensitivity information for:\r"; if (tableSens.getRowCount()==0) { System.out.println("ERROR: Writing condition.txt file: Could not read table of species for which to perform sensitivity analysis (Sensitivity Analysis tab)"); return; } for (int j=0; j<tableSens.getRowCount(); j++) { conditionFile += tableSens.getValueAt(j,0) + "\r"; } conditionFile += "END\r\r"; } else if (sensCoeffCombo.getSelectedItem().equals("No")) { conditionFile += "off\r"; } } // Add the name(s)/location(s) of the primary reaction library String prlReferenceDirectory = rmgEnvVar + "/databases/"; conditionFile += "PrimaryReactionLibrary:\r"; if (tablePRL.getRowCount()==0) { System.out.println("Warning: Writing condition.txt file: Could not read Primary Reaction Library (Thermochemical Libraries tab)"); } else { for (int k=0; k<tablePRL.getRowCount(); k++) { conditionFile += "Name: " + tablePRL.getValueAt(k,0) + "\r" + "Location: "; String prlDir = (String)tablePRL.getValueAt(k,1); if (prlDir.startsWith(rmgEnvVar)) { int startIndex = prlReferenceDirectory.length(); conditionFile += prlDir.substring(startIndex) + "\r"; } else { conditionFile += prlDir + "\r"; } } } conditionFile += "END\r\r"; // Add the name(s)/location(s) of the primary reaction library conditionFile += "SeedMechanism:\r"; if (tableSM.getRowCount()==0) { System.out.println("Warning: Writing condition.txt file: Could not read Seed Mechanism (Thermochemical Libraries tab)"); } else { for (int k=0; k<tableSM.getRowCount(); k++) { conditionFile += "Name: " + tableSM.getValueAt(k,0) + "\r" + "Location: "; String smDir = (String)tableSM.getValueAt(k,1); if (smDir.startsWith(rmgEnvVar)) { int startIndex = prlReferenceDirectory.length(); conditionFile += smDir.substring(startIndex) + "\r"; } else { conditionFile += smDir + "\r"; } } } conditionFile += "END\r\r"; // Add the Chemkin chem.inp file options conditionFile += "ChemkinUnits:\r"; if (chemkinVerbosity.getSelectedItem().equals("Yes")) conditionFile += "Verbose: on\r"; conditionFile += "A: " + chemkinAUnits.getSelectedItem() + "\r"; conditionFile += "Ea: " + chemkinEaUnits.getSelectedItem() + "\r"; File conditionPath = null; FileWriter fw = null; // Write the conditionFile string to user-specified file try { conditionPath = askUserForInput("Save file", false, null); if (conditionPath != null) { fw = new FileWriter(conditionPath); fw.write(conditionFile); fw.close(); } } catch (IOException e) { String err = "Error writing condition file: "; err += e.toString(); System.out.println(err); } // Run RMG if "Save and Run" selected if (saveAndRun && conditionPath != null) { runConditionFile(conditionPath.getAbsolutePath()); } } public void openConditionFile(File filePath) { int numSpecies = 0; tmodelPTL.clear(); tmodelPRL.clear(); tmodelSM.clear(); tmodelInput.clear(); tmodelSens.clear(); System.out.println("GUI cannot read in file's header (comments)"); // Read in the .txt file FileReader in = null; try { in = new FileReader(filePath); } catch (FileNotFoundException e) { String err = "Error reading file: "; err += e.toString(); System.out.println(err); } BufferedReader reader = new BufferedReader(in); String line = ChemParser.readMeaningfulLine(reader); read: while (line != null) { // Populate the GUI with as much information as possible StringTokenizer st = null; String tempString = ""; String[] tempStringVector = null; if (line.startsWith("Database")) { // Path of Database st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Database:" databasePath.setText(st.nextToken()); } else if (line.startsWith("PrimaryThermoLibrary")) { // Name(s)/Path(s) of PrimaryThermoLibrary line = ChemParser.readMeaningfulLine(reader); int ptlCounter = 0; while (!line.equals("END")) { ++ptlCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector ptlEntry = new PRLVector(ptlCounter-1,name,path); tmodelPTL.updatePRL(ptlEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("TemperatureModel")) { // Temperature model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "TemperatureModel:" String modelTemp = st.nextToken(); if (!modelTemp.equals("Constant")) { System.out.println("ERROR: Reading in condition.txt file - Invalid TemperatureModel. RMG recognizes 'Constant' TemperatureModel, but not " + modelTemp + ". GUI does not contain all information present in condition.txt file."); } tempModelCombo.setSelectedItem(modelTemp); String unitTemp = st.nextToken().substring(1,2); if (unitTemp.equals("K") || unitTemp.equals("F") || unitTemp.equals("C")) { tempConstantUnit.setSelectedItem(unitTemp); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid temperature unit. RMG recognizes temperature units of 'K', 'C', or 'F', but not " + unitTemp + ". GUI does not contain all information present in condition.txt file."); } String temps = st.nextToken(); while (st.hasMoreTokens()) { temps += " " + st.nextToken(); } tempConstant.setText(temps); } else if (line.startsWith("PressureModel")) { // Pressure model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "PressureModel:" String modelPress = st.nextToken(); if (!modelPress.equals("Constant")) { System.out.println("ERROR: Reading in condition.txt file - Invalid PressureModel. RMG recognizes 'Constant' PressureModel, but not " + modelPress + ". GUI does not contain all information present in condition.txt file."); } else { pressModelCombo.setSelectedItem(modelPress); } String temp = st.nextToken(); String unitPress = temp.substring(1,temp.length()-1); if (unitPress.equals("atm") || unitPress.equals("Pa") || unitPress.equals("bar") || unitPress.equals("torr")) { pressConstantUnit.setSelectedItem(unitPress); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid pressure unit. RMG recognizes pressure units of 'atm', 'Pa', 'bar' or 'torr', but not " + unitPress + ". GUI does not contain all information present in condition.txt file."); } String presses = st.nextToken(); while (st.hasMoreTokens()) { presses += " " + st.nextToken(); } pressConstant.setText(presses); } // GUI only recognized Ideal Gas EOS (30Jul2009) // else if (line.startsWith("EquationOfState")) { // // Equation of state (if present) // st = new StringTokenizer(line); // tempString = st.nextToken(); // Skip over "EquationOfState" // tempString = st.nextToken(); // if (tempString.equals("Liquid")) { // eosCombo.setSelectedItem(tempString); // } else { // System.out.println("ERROR: Reading in condition.txt file - Invalid equation of state. RMG recognizes 'Liquid', but not " + tempString + ". GUI does not contain all information present in condition.txt file."); // } // } else if (line.startsWith("MaxCarbonNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxCarbonNumberPerSpecies"\ maxCarbonNum.setText(st.nextToken()); } else if (line.startsWith("MaxOxygenNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxOxygenNumberPerSpecies"\ maxOxygenNum.setText(st.nextToken()); } else if (line.startsWith("MaxRadicalNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxRadicalNumberPerSpecies"\ maxRadicalNum.setText(st.nextToken()); } else if (line.startsWith("InChIGeneration")) { // InChI generation st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "InChIGeneration:" String inchi = st.nextToken(); if (inchi.toLowerCase().equals("on")) { inchiCombo.setSelectedItem("Yes"); } else if (inchi.toLowerCase().equals("off")) { inchiCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for InChIGeneration. RMG recognizes an argument of 'On' or 'Off', but not " + inchi + ". GUI does not contain all information present in condition.txt file."); } } // GUI does not handle Solvation (30Jul2009) // else if (line.startsWith("Solvation")) { // // Solvation // st = new StringTokenizer(line); // tempString = st.nextToken(); // Skip over "Solvation:" // String solvation = st.nextToken(); // if (solvation.toLowerCase().equals("on")) { // solvationCombo.setSelectedItem("Yes"); // } else if (solvation.toLowerCase().equals("off")) { // solvationCombo.setSelectedItem("No"); // } else { // System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Solvation. RMG recognizes an argument of 'On' or 'Off', but not " + solvation + ". GUI does not contain all information present in condition.txt file."); // } // } else if (line.startsWith("InitialStatus")) { String adjList = ""; String name = ""; String conc = ""; String unit = ""; String reactivity = ""; line = ChemParser.readMeaningfulLine(reader); while (!line.startsWith("END")) { if (line.startsWith("(")) { ++numSpecies; st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over (#) name = st.nextToken(); conc = st.nextToken(); unit = st.nextToken(); - reactivity = "Reactive"; + reactivity = "Reactive-RMG"; if (st.hasMoreTokens()) { - reactivity = "Unreactive"; + reactivity = "Reactive-User"; } } else { adjList += line + "\r"; } line = ChemParser.readMeaningfulLine(reader); if (line.startsWith("(") || line.startsWith("END")) { ICVector icEntry = new ICVector(numSpecies-1,name,conc,unit.substring(1,unit.length()-1),reactivity,adjList); tmodelInput.updateIC(icEntry); adjList = ""; } } limitingReactant(); } else if (line.startsWith("InertGas")) { // Inert gases String name = ""; String conc = ""; String unit = ""; String reactivity = ""; String adjList = ""; line = ChemParser.readMeaningfulLine(reader); while (!line.startsWith("END")) { ++numSpecies; st = new StringTokenizer(line); name = st.nextToken(); conc = st.nextToken(); unit = st.nextToken(); reactivity = "Inert"; if (name.equals("Ar") || name.equals("Ne") || name.equals("N2") || name.equals("He")) { ICVector icEntry = new ICVector(numSpecies-1,name,conc,unit.substring(1,unit.length()-1),reactivity,adjList); tmodelInput.updateIC(icEntry); } else System.out.println("Warning: Could not read in one of the inert gas species: " + name + ". The Inert Gas options are 'N2', 'Ar', 'He', and 'Ne' (case sensitive)"); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("Spectroscopic")) { // Spectroscopic data estimator st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over SpectroscopicDataEstimator String sde = st.nextToken(); if (sde.toLowerCase().equals("frequencygroups")) { sdeCombo.setSelectedItem("Frequency Groups"); // } else if (sde.toLowerCase().equals("threefrequencymodel")) { // sdeCombo.setSelectedItem("Three Frequency Model"); } else if (sde.toLowerCase().equals("off")) { sdeCombo.setSelectedItem("off"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for SpectroscopicDataEstimator. RMG recognizes an argument of 'frequencygroups' or 'off' but not " + sde + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("PressureDep")) { // Pressure dependence model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PressureDependence String pdep = st.nextToken(); if (pdep.toLowerCase().equals("off")) { pdepCombo.setSelectedItem("off"); } else if (pdep.toLowerCase().equals("reservoirstate")) { pdepCombo.setSelectedItem("Reservoir State"); } else if (pdep.toLowerCase().equals("modifiedstrongcollision")) { pdepCombo.setSelectedItem("Modified Strong Collision"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for PressureDependence. RMG recognizes an argument of 'reservoirstate', 'modifiedstrongcollision', or 'off' but not " + pdep + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("PDepKinetics")) { // Pressure dependent kinetics model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PDepKineticsModel String pdkm = st.nextToken(); if (pdkm.toLowerCase().equals("chebyshev")) { pdkmCombo.setSelectedItem("CHEB"); } else if (pdkm.toLowerCase().equals("pdeparrhenius")) { pdkmCombo.setSelectedItem("PLOG"); } else if (pdkm.toLowerCase().equals("rate")) { pdkmCombo.setSelectedItem("Rate"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for PDepKineticsModel. RMG recognizes an argument of 'chebyshev' or 'pdeparrhenius' but not " + pdkm + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("TRange")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over TRange String units = st.nextToken(); String unit = units.substring(1,units.length()-1); if (unit.equals("K") || unit.equals("F") || unit.equals("C")) chebyTUnits.setSelectedItem(unit); else System.out.println("ERROR: Reading in condition.txt file - Invalid chebyshev temperature unit. RMG recognizes temperature units of 'K', 'C', or 'F', but not " + unit + ". GUI does not contain all information present in condition.txt file."); chebyTMin.setText(st.nextToken()); chebyTMax.setText(st.nextToken()); chebyTGen.setText(st.nextToken()); chebyTRep.setText(st.nextToken()); } else if (line.startsWith("PRange")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PRange String units = st.nextToken(); String unit = units.substring(1,units.length()-1); if (unit.equals("atm") || unit.equals("Pa") || unit.equals("bar") || unit.equals("torr")) chebyPUnits.setSelectedItem(unit); else System.out.println("ERROR: Reading in condition.txt file - Invalid chebyshev pressure unit. RMG recognizes pressure units of 'atm', 'bar', 'torr', or 'Pa', but not " + unit + ". GUI does not contain all information present in condition.txt file."); chebyPMin.setText(st.nextToken()); chebyPMax.setText(st.nextToken()); chebyPGen.setText(st.nextToken()); chebyPRep.setText(st.nextToken()); } else if (line.startsWith("IncludeSpecies")) { // IncludeSpecies.txt file (if present) st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over IncludeSpecies isPath.setText(st.nextToken()); } else if (line.startsWith("(1) Goal")) { // Goal st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "(1)" tempString = st.nextToken(); // Skip over "Goal" String goal = st.nextToken(); if (goal.startsWith("Conversion")) { controllerCombo.setSelectedItem("Conversion"); SpeciesConvName.setSelectedItem(st.nextToken()); conversion.setText(st.nextToken()); } else if (goal.startsWith("Reaction")) { controllerCombo.setSelectedItem("ReactionTime"); time.setText(st.nextToken()); String units = st.nextToken(); timeCombo.setSelectedItem(units.substring(1,units.length()-1)); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Goal. RMG recognizes an argument of 'Conversion' or 'ReactionTime' but not " + goal + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("(2) Error")) { // Error tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "(2)" tempString = st.nextToken(); // Skip over "Error" tempString = st.nextToken(); // Skip over "Tolerance:" eTolerance.setText(st.nextToken()); } else if (line.startsWith("DynamicSim")) { // Dynamic simulator st = new StringTokenizer(line); tempString = st.nextToken(); String sim = st.nextToken(); if (sim.equals("DASPK") || sim.equals("DASSL")) { simulatorCombo.setSelectedItem(sim); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for DynamicSimulator. RMG recognizes an argument of 'DASPK' or 'DASSL' but not " + sim + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Conversions")) { // Intermediate integration step st = new StringTokenizer(line); String stepName = st.nextToken(); // Skip over Conversions String steps = st.nextToken(); while (st.hasMoreTokens()) { steps += " " + st.nextToken(); } multiConv.setText(steps); } else if (line.startsWith("TimeStep")) { // Intermediate integration step st = new StringTokenizer(line); String stepName = st.nextToken(); // Skip over TimeStep String steps = st.nextToken(); while (st.hasMoreTokens()) { steps += " " + st.nextToken(); } multiTS.setText(steps); } else if (line.startsWith("Atol")) { // Absolute tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Atol aTolerance.setText(st.nextToken()); } else if (line.startsWith("Rtol")) { // Relative tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Rtol rTolerance.setText(st.nextToken()); } else if (line.startsWith("Error bars")) { // Error bars and Sensitivity analysis (if present) st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Error" tempString = st.nextToken(); // Skip over "bars:" String onoff = st.nextToken(); if (onoff.equals("on")) { eBarsCombo.setSelectedItem("Yes"); } else if (onoff.equals("off")) { eBarsCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Error bars. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Display sensitivity coefficients")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Display" tempString = st.nextToken(); // Skip over "sensitivity" tempString = st.nextToken(); // Skip over "coefficients:" String onoff = st.nextToken(); if (onoff.equals("on")) { sensCoeffCombo.setSelectedItem("Yes"); } else if (onoff.equals("off")) { sensCoeffCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Display sensitivity coefficients. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Display sensitivity information")) { // Sensitivity coefficients (if present) line = ChemParser.readMeaningfulLine(reader); numSpecies = 0; while (!line.startsWith("END")) { ++numSpecies; SensVector sensEntry = new SensVector(numSpecies-1,line); tmodelSens.updateSens(sensEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("PrimaryReactionLibrary")) { // Name(s)/Path(s) of PrimaryReactionLibrary line = ChemParser.readMeaningfulLine(reader); int prlCounter = 0; while (!line.equals("END")) { ++prlCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector prlEntry = new PRLVector(prlCounter-1,name,path); tmodelPRL.updatePRL(prlEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("SeedMechanism")) { // Name(s)/Path(s) of SeedMechanism line = ChemParser.readMeaningfulLine(reader); int smCounter = 0; while (!line.equals("END")) { ++smCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector smEntry = new PRLVector(smCounter-1,name,path); tmodelSM.updatePRL(smEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("Verbose")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Verbose String onoff = st.nextToken(); if (onoff.equals("on")) { chemkinVerbosity.setSelectedItem("Yes"); } else if (onoff.equals("off")) { chemkinVerbosity.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin Verbosity. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("A:")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over A String units = st.nextToken(); if (units.equals("moles") || units.equals("molecules")) chemkinAUnits.setSelectedItem(units); else System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin A units. RMG recognizes an argument of 'moles' or 'molecules' but not " + units + ". GUI does not contain all information present in condition.txt file."); } else if (line.startsWith("Ea:")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Ea String units = st.nextToken(); if (units.equals("cal/mol") || units.equals("kcal/mol") || units.equals("kJ/mol") || units.equals("J/mol") || units.equals("Kelvins")) chemkinEaUnits.setSelectedItem(units); else System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin Ea units. RMG recognizes an argument of 'kcal/mol', 'cal/mol', 'kJ/mol', 'J/mol', or 'Kelvins' but not " + units + ". GUI does not contain all information present in condition.txt file."); } else if (!line.startsWith("FinishController") & !line.startsWith("ChemkinUnits")) System.out.println("Warning: Reading in condition.txt file - Interpreter does not recognize the following line: " + line); line = ChemParser.readMeaningfulLine(reader); } } public JComponent createTabOptions() { // Create cellrenderers for JComboBox/JTable - CENTER text ListCellRenderer centerJComboBoxRenderer = new CenterJCBRenderer(); // Create "Options" panel JPanel Options = new JPanel(); Options.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Additional Options"), BorderFactory.createEmptyBorder(5,5,5,5))); // Create the InChI generation subpanel JPanel inchiPanel = new JPanel(); inchiPanel.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("InChI Generation"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate the subpanel JLabel inchiLabel = new JLabel("Generate InChIs"); inchiPanel.add(inchiLabel); inchiPanel.add(inchiCombo = new JComboBox(yesnoOptions)); // Create the Max carbon/oxygen/radical subpanel JPanel maxPanel = new JPanel(); maxPanel.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Species properties"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate the subpanel JPanel carbonPanel = new JPanel(); carbonPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); JLabel maxCarbonLabel = new JLabel("Maximum Carbon # per species"); carbonPanel.add(maxCarbonLabel); carbonPanel.add(maxCarbonNum = new JTextField()); maxCarbonNum.setPreferredSize(new Dimension(50,25)); maxCarbonNum.addActionListener(this); maxCarbonNum.setHorizontalAlignment(JTextField.CENTER); JPanel oxygenPanel = new JPanel(); oxygenPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); JLabel maxOxygenLabel = new JLabel("Maximum Oxygen # per species"); oxygenPanel.add(maxOxygenLabel); oxygenPanel.add(maxOxygenNum = new JTextField()); maxOxygenNum.setPreferredSize(new Dimension(50,25)); maxOxygenNum.addActionListener(this); maxOxygenNum.setHorizontalAlignment(JTextField.CENTER); JPanel radicalPanel = new JPanel(); radicalPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); JLabel maxRadicalLabel = new JLabel("Maximum Radical # per species"); radicalPanel.add(maxRadicalLabel); radicalPanel.add(maxRadicalNum = new JTextField()); maxRadicalNum.setPreferredSize(new Dimension(50,25)); maxRadicalNum.addActionListener(this); maxRadicalNum.setHorizontalAlignment(JTextField.CENTER); Box maxSpeciesProps = Box.createVerticalBox(); maxSpeciesProps.add(carbonPanel); maxSpeciesProps.add(oxygenPanel); maxSpeciesProps.add(radicalPanel); maxPanel.add(maxSpeciesProps); // Create the Max carbon/oxygen/radical subpanel JPanel chemkinPanel = new JPanel(); chemkinPanel.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("CHEMKIN chem.inp properties"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate the subpanel JPanel AUnitsPanel = new JPanel(); AUnitsPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); JLabel ALabel = new JLabel("Units of A in chem.inp file"); AUnitsPanel.add(ALabel); AUnitsPanel.add(chemkinAUnits = new JComboBox(AUnitsOptions)); JPanel EaUnitsPanel = new JPanel(); EaUnitsPanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); JLabel EaLabel = new JLabel("Units of Ea in chem.inp file"); EaUnitsPanel.add(EaLabel); EaUnitsPanel.add(chemkinEaUnits = new JComboBox(EaUnitsOptions)); JPanel verbosePanel = new JPanel(); verbosePanel.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); JLabel verboseLabel = new JLabel("Detailed kinetics comments"); verbosePanel.add(verboseLabel); verbosePanel.add(chemkinVerbosity = new JComboBox(yesnoOptions)); Box chemkinProps = Box.createVerticalBox(); chemkinProps.add(AUnitsPanel); chemkinProps.add(EaUnitsPanel); chemkinProps.add(verbosePanel); chemkinPanel.add(chemkinProps); // Create the Equation Of State (EOS) subpanel JPanel EOS = new JPanel(); EOS.setBorder(BorderFactory.createCompoundBorder(BorderFactory.createTitledBorder("Equation of State"), BorderFactory.createEmptyBorder(5,5,5,5))); // Populate the subpanel JLabel eosLabel = new JLabel("Equation of State"); EOS.add(eosLabel); EOS.add(eosCombo = new JComboBox(eosOptions)); Box totalOptionsBox = Box.createVerticalBox(); totalOptionsBox.add(maxPanel); totalOptionsBox.add(chemkinPanel); totalOptionsBox.add(inchiPanel); totalOptionsBox.add(EOS); Options.add(totalOptionsBox); JComboBox[] allTab = {eosCombo, inchiCombo, chemkinAUnits, chemkinEaUnits, chemkinVerbosity}; initializeJCB(allTab); JScrollPane scrolltab = new JScrollPane(Options); scrolltab.setBorder(BorderFactory.createEmptyBorder(5,5,5,5)); return scrolltab; } public void runConditionFile(String c_path) { String[] rmgArgs = {c_path}; RMG.main(rmgArgs); System.exit(0); } public void enableComponents (JComponent[] allComponents) { for (int i=0; i<allComponents.length; i++) allComponents[i].setEnabled(true); } public void disableComponents (JComponent[] allComponents) { for (int i=0; i<allComponents.length; i++) allComponents[i].setEnabled(false); } public void actionPerformed(ActionEvent event) { // - If Termination sequence is specified, highlight appropriate boxes if ("GoalofReaction".equals(event.getActionCommand())) { JComponent[] timeComps = {timeCombo, time, multiTS}; JComponent[] convComps = {SpeciesConvName, conversion, multiConv}; if (controllerCombo.getSelectedItem().equals("ReactionTime")) { enableComponents(timeComps); disableComponents(convComps); } else if (controllerCombo.getSelectedItem().equals("Conversion")) { enableComponents(convComps); disableComponents(timeComps); } } // - If Sensitivity analysis is turned on/off, highlight the appropriate boxes else if ("scOnOff".equals(event.getActionCommand())) { JComponent[] scComps = {AddSens, DeleteSens, tableSens, scName}; if (sensCoeffCombo.getSelectedItem().equals("Yes")) { enableComponents(scComps); } else if (sensCoeffCombo.getSelectedItem().equals("No")){ disableComponents(scComps); } } // If the user enables/disables DASPK else if ("saOnOff".equals(event.getActionCommand())) { JComponent[] saComps = {eBarsCombo, sensCoeffCombo}; JComponent[] otherComps = {AddSens, DeleteSens, tableSens, scName}; if (simulatorCombo.getSelectedItem().equals("DASPK")) { enableComponents(saComps); if (sensCoeffCombo.getSelectedItem().equals("Yes")) enableComponents(otherComps); else if (sensCoeffCombo.getSelectedItem().equals("No")) disableComponents(otherComps); } else if (simulatorCombo.getSelectedItem().equals("DASSL")) { disableComponents(saComps); disableComponents(otherComps); } } else if ("pDep".equals(event.getActionCommand())) { JComponent[] pDepComps = {sdeCombo, pdkmCombo}; JComponent[] pdkmComps = {chebyTMin, chebyTMax, chebyTUnits, chebyTGen, chebyTRep, chebyPMin, chebyPMax, chebyPUnits, chebyPGen, chebyPRep}; if (pdepCombo.getSelectedItem().equals("off")) { disableComponents(pDepComps); disableComponents(pdkmComps); } else { enableComponents(pDepComps); if (pdkmCombo.getSelectedItem().equals("CHEB")) { enableComponents(pdkmComps); } else disableComponents(pdkmComps); } } else if ("pdkm".equals(event.getActionCommand())) { JComponent[] pdkmComps = {chebyTMin, chebyTMax, chebyTUnits, chebyTGen, chebyTRep, chebyPMin, chebyPMax, chebyPUnits, chebyPGen, chebyPRep}; if (pdkmCombo.getSelectedItem().equals("CHEB")) { enableComponents(pdkmComps); } else disableComponents(pdkmComps); } // Save the condition.txt file else if ("saveCondition".equals(event.getActionCommand())) { createConditionFile(false); } // Save and run the condition.txt file else if ("runCondition".equals(event.getActionCommand())) { createConditionFile(true); } } // Main panel private static GUI theApp; // Tab0: Initialization String[] timeUnits = {"sec", "min", "hr", "day"}; // Tab1: Termination Sequence String[] species_blank = {" "}; String[] goalOptions = {"Conversion", "ReactionTime"}; // Tab2: Initial Condition String[] tpModel = {"Constant"}; String[] concUnits = {"mol/cm3", "mol/m3", "mol/liter"}; String[] tempUnits = {"K", "C", "F"}; String[] pressUnits = {"atm", "bar", "Pa", "torr"}; String[] reactive = {"Reactive-RMG", "Reactive-User", "Inert"}; // Tab3: Error Analysis String[] yesnoOptions = {"No", "Yes"}; // Tab4: Dynamic Simulator String[] pdepOptions = {"off", "Reservoir State", "Modified Strong Collision"}; String[] simOptions = {"DASSL", "DASPK"}; //"CHEMKIN" String[] sdeOptions = {"Frequency Groups"}; //"Three Frequency Model" String[] pdkmOptions = {"CHEB", "PLOG", "Rate"}; // Tab : Additional Options String[] AUnitsOptions = {"moles", "molecules"}; String[] EaUnitsOptions = {"kcal/mol", "cal/mol", "kJ/mol", "J/mol", "Kelvins"}; String[] eosOptions = {"Ideal Gas"}; // "Liquid" JPanel // Main Panel mainPanel; JComboBox // Tab0: Initialization simulatorCombo, timeStepCombo, libraryCombo, // Tab1: Termination Sequence SpeciesConvName, controllerCombo, timeCombo, // Tab2: Initial Condition UnitsInput, ReactiveInput, tempModelCombo, tempConstantUnit, pressModelCombo, pressConstantUnit, // Tab3: Error Analysis SpeciesSensName, eBarsCombo, sensCoeffCombo, // Tab4: Dynamic Simulator pdepCombo, sdeCombo, pdkmCombo, // Tab : Additional Options eosCombo, inchiCombo, chemkinAUnits, chemkinEaUnits, chemkinVerbosity, // chebyTUnits, chebyPUnits; JTextField // Tab0: Initialization nameFiller, locationFiller, databasePath, prlPath, ptlPath, timeStep, aTolerance, rTolerance, ptlLibName, prlLibName, smLibName, smPath, // Tab1: Termination Sequence conversion, time, eTolerance, // Tab2: Initial Condition NameInput, InChIInput, isPath, ConcInput, // Tab3: Error Analysis scName, // Tab : Additional Options maxCarbonNum, maxOxygenNum, maxRadicalNum, // chebyTMin, chebyTMax, chebyPMin, chebyPMax, chebyTGen, chebyTRep, chebyPGen, chebyPRep; JTextArea // Main Panel headerComments, // Tab2: Initial Condition speciesAdjList, tempConstant, pressConstant, // Tab4: Dynamic Simulator multiTS, multiConv; JButton // Main panel save, saveAndRun, // Tab0: Initialization AddPRL, DeletePRL, databaseButton, prlButton, ptlButton, AddPTL, DeletePTL, smButton, AddSM, DeleteSM, // Tab1: Termination // Tab2: Initial Condition AddInput, DeleteInput, isButton, // Tab3: Error Analysis AddSens, DeleteSens; JTable // Tab0: Initialization tablePRL, tablePTL, tableSM, // Tab1: Termination // Tab2: Initial Condition tableInput, // Tab3: Error Analysis tableSens; // Tab0: Initialization MyTableModelPRL tmodelPRL, tmodelPTL, tmodelSM; // Tab1: Termination // Tab2: Initial Condition MyTableModelInput tmodelInput; // Tab3: Error Analysis MyTableModelSensitivity tmodelSens; }
false
true
public void openConditionFile(File filePath) { int numSpecies = 0; tmodelPTL.clear(); tmodelPRL.clear(); tmodelSM.clear(); tmodelInput.clear(); tmodelSens.clear(); System.out.println("GUI cannot read in file's header (comments)"); // Read in the .txt file FileReader in = null; try { in = new FileReader(filePath); } catch (FileNotFoundException e) { String err = "Error reading file: "; err += e.toString(); System.out.println(err); } BufferedReader reader = new BufferedReader(in); String line = ChemParser.readMeaningfulLine(reader); read: while (line != null) { // Populate the GUI with as much information as possible StringTokenizer st = null; String tempString = ""; String[] tempStringVector = null; if (line.startsWith("Database")) { // Path of Database st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Database:" databasePath.setText(st.nextToken()); } else if (line.startsWith("PrimaryThermoLibrary")) { // Name(s)/Path(s) of PrimaryThermoLibrary line = ChemParser.readMeaningfulLine(reader); int ptlCounter = 0; while (!line.equals("END")) { ++ptlCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector ptlEntry = new PRLVector(ptlCounter-1,name,path); tmodelPTL.updatePRL(ptlEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("TemperatureModel")) { // Temperature model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "TemperatureModel:" String modelTemp = st.nextToken(); if (!modelTemp.equals("Constant")) { System.out.println("ERROR: Reading in condition.txt file - Invalid TemperatureModel. RMG recognizes 'Constant' TemperatureModel, but not " + modelTemp + ". GUI does not contain all information present in condition.txt file."); } tempModelCombo.setSelectedItem(modelTemp); String unitTemp = st.nextToken().substring(1,2); if (unitTemp.equals("K") || unitTemp.equals("F") || unitTemp.equals("C")) { tempConstantUnit.setSelectedItem(unitTemp); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid temperature unit. RMG recognizes temperature units of 'K', 'C', or 'F', but not " + unitTemp + ". GUI does not contain all information present in condition.txt file."); } String temps = st.nextToken(); while (st.hasMoreTokens()) { temps += " " + st.nextToken(); } tempConstant.setText(temps); } else if (line.startsWith("PressureModel")) { // Pressure model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "PressureModel:" String modelPress = st.nextToken(); if (!modelPress.equals("Constant")) { System.out.println("ERROR: Reading in condition.txt file - Invalid PressureModel. RMG recognizes 'Constant' PressureModel, but not " + modelPress + ". GUI does not contain all information present in condition.txt file."); } else { pressModelCombo.setSelectedItem(modelPress); } String temp = st.nextToken(); String unitPress = temp.substring(1,temp.length()-1); if (unitPress.equals("atm") || unitPress.equals("Pa") || unitPress.equals("bar") || unitPress.equals("torr")) { pressConstantUnit.setSelectedItem(unitPress); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid pressure unit. RMG recognizes pressure units of 'atm', 'Pa', 'bar' or 'torr', but not " + unitPress + ". GUI does not contain all information present in condition.txt file."); } String presses = st.nextToken(); while (st.hasMoreTokens()) { presses += " " + st.nextToken(); } pressConstant.setText(presses); } // GUI only recognized Ideal Gas EOS (30Jul2009) // else if (line.startsWith("EquationOfState")) { // // Equation of state (if present) // st = new StringTokenizer(line); // tempString = st.nextToken(); // Skip over "EquationOfState" // tempString = st.nextToken(); // if (tempString.equals("Liquid")) { // eosCombo.setSelectedItem(tempString); // } else { // System.out.println("ERROR: Reading in condition.txt file - Invalid equation of state. RMG recognizes 'Liquid', but not " + tempString + ". GUI does not contain all information present in condition.txt file."); // } // } else if (line.startsWith("MaxCarbonNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxCarbonNumberPerSpecies"\ maxCarbonNum.setText(st.nextToken()); } else if (line.startsWith("MaxOxygenNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxOxygenNumberPerSpecies"\ maxOxygenNum.setText(st.nextToken()); } else if (line.startsWith("MaxRadicalNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxRadicalNumberPerSpecies"\ maxRadicalNum.setText(st.nextToken()); } else if (line.startsWith("InChIGeneration")) { // InChI generation st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "InChIGeneration:" String inchi = st.nextToken(); if (inchi.toLowerCase().equals("on")) { inchiCombo.setSelectedItem("Yes"); } else if (inchi.toLowerCase().equals("off")) { inchiCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for InChIGeneration. RMG recognizes an argument of 'On' or 'Off', but not " + inchi + ". GUI does not contain all information present in condition.txt file."); } } // GUI does not handle Solvation (30Jul2009) // else if (line.startsWith("Solvation")) { // // Solvation // st = new StringTokenizer(line); // tempString = st.nextToken(); // Skip over "Solvation:" // String solvation = st.nextToken(); // if (solvation.toLowerCase().equals("on")) { // solvationCombo.setSelectedItem("Yes"); // } else if (solvation.toLowerCase().equals("off")) { // solvationCombo.setSelectedItem("No"); // } else { // System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Solvation. RMG recognizes an argument of 'On' or 'Off', but not " + solvation + ". GUI does not contain all information present in condition.txt file."); // } // } else if (line.startsWith("InitialStatus")) { String adjList = ""; String name = ""; String conc = ""; String unit = ""; String reactivity = ""; line = ChemParser.readMeaningfulLine(reader); while (!line.startsWith("END")) { if (line.startsWith("(")) { ++numSpecies; st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over (#) name = st.nextToken(); conc = st.nextToken(); unit = st.nextToken(); reactivity = "Reactive"; if (st.hasMoreTokens()) { reactivity = "Unreactive"; } } else { adjList += line + "\r"; } line = ChemParser.readMeaningfulLine(reader); if (line.startsWith("(") || line.startsWith("END")) { ICVector icEntry = new ICVector(numSpecies-1,name,conc,unit.substring(1,unit.length()-1),reactivity,adjList); tmodelInput.updateIC(icEntry); adjList = ""; } } limitingReactant(); } else if (line.startsWith("InertGas")) { // Inert gases String name = ""; String conc = ""; String unit = ""; String reactivity = ""; String adjList = ""; line = ChemParser.readMeaningfulLine(reader); while (!line.startsWith("END")) { ++numSpecies; st = new StringTokenizer(line); name = st.nextToken(); conc = st.nextToken(); unit = st.nextToken(); reactivity = "Inert"; if (name.equals("Ar") || name.equals("Ne") || name.equals("N2") || name.equals("He")) { ICVector icEntry = new ICVector(numSpecies-1,name,conc,unit.substring(1,unit.length()-1),reactivity,adjList); tmodelInput.updateIC(icEntry); } else System.out.println("Warning: Could not read in one of the inert gas species: " + name + ". The Inert Gas options are 'N2', 'Ar', 'He', and 'Ne' (case sensitive)"); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("Spectroscopic")) { // Spectroscopic data estimator st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over SpectroscopicDataEstimator String sde = st.nextToken(); if (sde.toLowerCase().equals("frequencygroups")) { sdeCombo.setSelectedItem("Frequency Groups"); // } else if (sde.toLowerCase().equals("threefrequencymodel")) { // sdeCombo.setSelectedItem("Three Frequency Model"); } else if (sde.toLowerCase().equals("off")) { sdeCombo.setSelectedItem("off"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for SpectroscopicDataEstimator. RMG recognizes an argument of 'frequencygroups' or 'off' but not " + sde + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("PressureDep")) { // Pressure dependence model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PressureDependence String pdep = st.nextToken(); if (pdep.toLowerCase().equals("off")) { pdepCombo.setSelectedItem("off"); } else if (pdep.toLowerCase().equals("reservoirstate")) { pdepCombo.setSelectedItem("Reservoir State"); } else if (pdep.toLowerCase().equals("modifiedstrongcollision")) { pdepCombo.setSelectedItem("Modified Strong Collision"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for PressureDependence. RMG recognizes an argument of 'reservoirstate', 'modifiedstrongcollision', or 'off' but not " + pdep + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("PDepKinetics")) { // Pressure dependent kinetics model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PDepKineticsModel String pdkm = st.nextToken(); if (pdkm.toLowerCase().equals("chebyshev")) { pdkmCombo.setSelectedItem("CHEB"); } else if (pdkm.toLowerCase().equals("pdeparrhenius")) { pdkmCombo.setSelectedItem("PLOG"); } else if (pdkm.toLowerCase().equals("rate")) { pdkmCombo.setSelectedItem("Rate"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for PDepKineticsModel. RMG recognizes an argument of 'chebyshev' or 'pdeparrhenius' but not " + pdkm + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("TRange")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over TRange String units = st.nextToken(); String unit = units.substring(1,units.length()-1); if (unit.equals("K") || unit.equals("F") || unit.equals("C")) chebyTUnits.setSelectedItem(unit); else System.out.println("ERROR: Reading in condition.txt file - Invalid chebyshev temperature unit. RMG recognizes temperature units of 'K', 'C', or 'F', but not " + unit + ". GUI does not contain all information present in condition.txt file."); chebyTMin.setText(st.nextToken()); chebyTMax.setText(st.nextToken()); chebyTGen.setText(st.nextToken()); chebyTRep.setText(st.nextToken()); } else if (line.startsWith("PRange")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PRange String units = st.nextToken(); String unit = units.substring(1,units.length()-1); if (unit.equals("atm") || unit.equals("Pa") || unit.equals("bar") || unit.equals("torr")) chebyPUnits.setSelectedItem(unit); else System.out.println("ERROR: Reading in condition.txt file - Invalid chebyshev pressure unit. RMG recognizes pressure units of 'atm', 'bar', 'torr', or 'Pa', but not " + unit + ". GUI does not contain all information present in condition.txt file."); chebyPMin.setText(st.nextToken()); chebyPMax.setText(st.nextToken()); chebyPGen.setText(st.nextToken()); chebyPRep.setText(st.nextToken()); } else if (line.startsWith("IncludeSpecies")) { // IncludeSpecies.txt file (if present) st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over IncludeSpecies isPath.setText(st.nextToken()); } else if (line.startsWith("(1) Goal")) { // Goal st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "(1)" tempString = st.nextToken(); // Skip over "Goal" String goal = st.nextToken(); if (goal.startsWith("Conversion")) { controllerCombo.setSelectedItem("Conversion"); SpeciesConvName.setSelectedItem(st.nextToken()); conversion.setText(st.nextToken()); } else if (goal.startsWith("Reaction")) { controllerCombo.setSelectedItem("ReactionTime"); time.setText(st.nextToken()); String units = st.nextToken(); timeCombo.setSelectedItem(units.substring(1,units.length()-1)); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Goal. RMG recognizes an argument of 'Conversion' or 'ReactionTime' but not " + goal + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("(2) Error")) { // Error tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "(2)" tempString = st.nextToken(); // Skip over "Error" tempString = st.nextToken(); // Skip over "Tolerance:" eTolerance.setText(st.nextToken()); } else if (line.startsWith("DynamicSim")) { // Dynamic simulator st = new StringTokenizer(line); tempString = st.nextToken(); String sim = st.nextToken(); if (sim.equals("DASPK") || sim.equals("DASSL")) { simulatorCombo.setSelectedItem(sim); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for DynamicSimulator. RMG recognizes an argument of 'DASPK' or 'DASSL' but not " + sim + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Conversions")) { // Intermediate integration step st = new StringTokenizer(line); String stepName = st.nextToken(); // Skip over Conversions String steps = st.nextToken(); while (st.hasMoreTokens()) { steps += " " + st.nextToken(); } multiConv.setText(steps); } else if (line.startsWith("TimeStep")) { // Intermediate integration step st = new StringTokenizer(line); String stepName = st.nextToken(); // Skip over TimeStep String steps = st.nextToken(); while (st.hasMoreTokens()) { steps += " " + st.nextToken(); } multiTS.setText(steps); } else if (line.startsWith("Atol")) { // Absolute tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Atol aTolerance.setText(st.nextToken()); } else if (line.startsWith("Rtol")) { // Relative tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Rtol rTolerance.setText(st.nextToken()); } else if (line.startsWith("Error bars")) { // Error bars and Sensitivity analysis (if present) st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Error" tempString = st.nextToken(); // Skip over "bars:" String onoff = st.nextToken(); if (onoff.equals("on")) { eBarsCombo.setSelectedItem("Yes"); } else if (onoff.equals("off")) { eBarsCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Error bars. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Display sensitivity coefficients")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Display" tempString = st.nextToken(); // Skip over "sensitivity" tempString = st.nextToken(); // Skip over "coefficients:" String onoff = st.nextToken(); if (onoff.equals("on")) { sensCoeffCombo.setSelectedItem("Yes"); } else if (onoff.equals("off")) { sensCoeffCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Display sensitivity coefficients. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Display sensitivity information")) { // Sensitivity coefficients (if present) line = ChemParser.readMeaningfulLine(reader); numSpecies = 0; while (!line.startsWith("END")) { ++numSpecies; SensVector sensEntry = new SensVector(numSpecies-1,line); tmodelSens.updateSens(sensEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("PrimaryReactionLibrary")) { // Name(s)/Path(s) of PrimaryReactionLibrary line = ChemParser.readMeaningfulLine(reader); int prlCounter = 0; while (!line.equals("END")) { ++prlCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector prlEntry = new PRLVector(prlCounter-1,name,path); tmodelPRL.updatePRL(prlEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("SeedMechanism")) { // Name(s)/Path(s) of SeedMechanism line = ChemParser.readMeaningfulLine(reader); int smCounter = 0; while (!line.equals("END")) { ++smCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector smEntry = new PRLVector(smCounter-1,name,path); tmodelSM.updatePRL(smEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("Verbose")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Verbose String onoff = st.nextToken(); if (onoff.equals("on")) { chemkinVerbosity.setSelectedItem("Yes"); } else if (onoff.equals("off")) { chemkinVerbosity.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin Verbosity. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("A:")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over A String units = st.nextToken(); if (units.equals("moles") || units.equals("molecules")) chemkinAUnits.setSelectedItem(units); else System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin A units. RMG recognizes an argument of 'moles' or 'molecules' but not " + units + ". GUI does not contain all information present in condition.txt file."); } else if (line.startsWith("Ea:")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Ea String units = st.nextToken(); if (units.equals("cal/mol") || units.equals("kcal/mol") || units.equals("kJ/mol") || units.equals("J/mol") || units.equals("Kelvins")) chemkinEaUnits.setSelectedItem(units); else System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin Ea units. RMG recognizes an argument of 'kcal/mol', 'cal/mol', 'kJ/mol', 'J/mol', or 'Kelvins' but not " + units + ". GUI does not contain all information present in condition.txt file."); } else if (!line.startsWith("FinishController") & !line.startsWith("ChemkinUnits")) System.out.println("Warning: Reading in condition.txt file - Interpreter does not recognize the following line: " + line); line = ChemParser.readMeaningfulLine(reader); } }
public void openConditionFile(File filePath) { int numSpecies = 0; tmodelPTL.clear(); tmodelPRL.clear(); tmodelSM.clear(); tmodelInput.clear(); tmodelSens.clear(); System.out.println("GUI cannot read in file's header (comments)"); // Read in the .txt file FileReader in = null; try { in = new FileReader(filePath); } catch (FileNotFoundException e) { String err = "Error reading file: "; err += e.toString(); System.out.println(err); } BufferedReader reader = new BufferedReader(in); String line = ChemParser.readMeaningfulLine(reader); read: while (line != null) { // Populate the GUI with as much information as possible StringTokenizer st = null; String tempString = ""; String[] tempStringVector = null; if (line.startsWith("Database")) { // Path of Database st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Database:" databasePath.setText(st.nextToken()); } else if (line.startsWith("PrimaryThermoLibrary")) { // Name(s)/Path(s) of PrimaryThermoLibrary line = ChemParser.readMeaningfulLine(reader); int ptlCounter = 0; while (!line.equals("END")) { ++ptlCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector ptlEntry = new PRLVector(ptlCounter-1,name,path); tmodelPTL.updatePRL(ptlEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("TemperatureModel")) { // Temperature model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "TemperatureModel:" String modelTemp = st.nextToken(); if (!modelTemp.equals("Constant")) { System.out.println("ERROR: Reading in condition.txt file - Invalid TemperatureModel. RMG recognizes 'Constant' TemperatureModel, but not " + modelTemp + ". GUI does not contain all information present in condition.txt file."); } tempModelCombo.setSelectedItem(modelTemp); String unitTemp = st.nextToken().substring(1,2); if (unitTemp.equals("K") || unitTemp.equals("F") || unitTemp.equals("C")) { tempConstantUnit.setSelectedItem(unitTemp); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid temperature unit. RMG recognizes temperature units of 'K', 'C', or 'F', but not " + unitTemp + ". GUI does not contain all information present in condition.txt file."); } String temps = st.nextToken(); while (st.hasMoreTokens()) { temps += " " + st.nextToken(); } tempConstant.setText(temps); } else if (line.startsWith("PressureModel")) { // Pressure model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "PressureModel:" String modelPress = st.nextToken(); if (!modelPress.equals("Constant")) { System.out.println("ERROR: Reading in condition.txt file - Invalid PressureModel. RMG recognizes 'Constant' PressureModel, but not " + modelPress + ". GUI does not contain all information present in condition.txt file."); } else { pressModelCombo.setSelectedItem(modelPress); } String temp = st.nextToken(); String unitPress = temp.substring(1,temp.length()-1); if (unitPress.equals("atm") || unitPress.equals("Pa") || unitPress.equals("bar") || unitPress.equals("torr")) { pressConstantUnit.setSelectedItem(unitPress); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid pressure unit. RMG recognizes pressure units of 'atm', 'Pa', 'bar' or 'torr', but not " + unitPress + ". GUI does not contain all information present in condition.txt file."); } String presses = st.nextToken(); while (st.hasMoreTokens()) { presses += " " + st.nextToken(); } pressConstant.setText(presses); } // GUI only recognized Ideal Gas EOS (30Jul2009) // else if (line.startsWith("EquationOfState")) { // // Equation of state (if present) // st = new StringTokenizer(line); // tempString = st.nextToken(); // Skip over "EquationOfState" // tempString = st.nextToken(); // if (tempString.equals("Liquid")) { // eosCombo.setSelectedItem(tempString); // } else { // System.out.println("ERROR: Reading in condition.txt file - Invalid equation of state. RMG recognizes 'Liquid', but not " + tempString + ". GUI does not contain all information present in condition.txt file."); // } // } else if (line.startsWith("MaxCarbonNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxCarbonNumberPerSpecies"\ maxCarbonNum.setText(st.nextToken()); } else if (line.startsWith("MaxOxygenNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxOxygenNumberPerSpecies"\ maxOxygenNum.setText(st.nextToken()); } else if (line.startsWith("MaxRadicalNumber")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "MaxRadicalNumberPerSpecies"\ maxRadicalNum.setText(st.nextToken()); } else if (line.startsWith("InChIGeneration")) { // InChI generation st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "InChIGeneration:" String inchi = st.nextToken(); if (inchi.toLowerCase().equals("on")) { inchiCombo.setSelectedItem("Yes"); } else if (inchi.toLowerCase().equals("off")) { inchiCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for InChIGeneration. RMG recognizes an argument of 'On' or 'Off', but not " + inchi + ". GUI does not contain all information present in condition.txt file."); } } // GUI does not handle Solvation (30Jul2009) // else if (line.startsWith("Solvation")) { // // Solvation // st = new StringTokenizer(line); // tempString = st.nextToken(); // Skip over "Solvation:" // String solvation = st.nextToken(); // if (solvation.toLowerCase().equals("on")) { // solvationCombo.setSelectedItem("Yes"); // } else if (solvation.toLowerCase().equals("off")) { // solvationCombo.setSelectedItem("No"); // } else { // System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Solvation. RMG recognizes an argument of 'On' or 'Off', but not " + solvation + ". GUI does not contain all information present in condition.txt file."); // } // } else if (line.startsWith("InitialStatus")) { String adjList = ""; String name = ""; String conc = ""; String unit = ""; String reactivity = ""; line = ChemParser.readMeaningfulLine(reader); while (!line.startsWith("END")) { if (line.startsWith("(")) { ++numSpecies; st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over (#) name = st.nextToken(); conc = st.nextToken(); unit = st.nextToken(); reactivity = "Reactive-RMG"; if (st.hasMoreTokens()) { reactivity = "Reactive-User"; } } else { adjList += line + "\r"; } line = ChemParser.readMeaningfulLine(reader); if (line.startsWith("(") || line.startsWith("END")) { ICVector icEntry = new ICVector(numSpecies-1,name,conc,unit.substring(1,unit.length()-1),reactivity,adjList); tmodelInput.updateIC(icEntry); adjList = ""; } } limitingReactant(); } else if (line.startsWith("InertGas")) { // Inert gases String name = ""; String conc = ""; String unit = ""; String reactivity = ""; String adjList = ""; line = ChemParser.readMeaningfulLine(reader); while (!line.startsWith("END")) { ++numSpecies; st = new StringTokenizer(line); name = st.nextToken(); conc = st.nextToken(); unit = st.nextToken(); reactivity = "Inert"; if (name.equals("Ar") || name.equals("Ne") || name.equals("N2") || name.equals("He")) { ICVector icEntry = new ICVector(numSpecies-1,name,conc,unit.substring(1,unit.length()-1),reactivity,adjList); tmodelInput.updateIC(icEntry); } else System.out.println("Warning: Could not read in one of the inert gas species: " + name + ". The Inert Gas options are 'N2', 'Ar', 'He', and 'Ne' (case sensitive)"); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("Spectroscopic")) { // Spectroscopic data estimator st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over SpectroscopicDataEstimator String sde = st.nextToken(); if (sde.toLowerCase().equals("frequencygroups")) { sdeCombo.setSelectedItem("Frequency Groups"); // } else if (sde.toLowerCase().equals("threefrequencymodel")) { // sdeCombo.setSelectedItem("Three Frequency Model"); } else if (sde.toLowerCase().equals("off")) { sdeCombo.setSelectedItem("off"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for SpectroscopicDataEstimator. RMG recognizes an argument of 'frequencygroups' or 'off' but not " + sde + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("PressureDep")) { // Pressure dependence model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PressureDependence String pdep = st.nextToken(); if (pdep.toLowerCase().equals("off")) { pdepCombo.setSelectedItem("off"); } else if (pdep.toLowerCase().equals("reservoirstate")) { pdepCombo.setSelectedItem("Reservoir State"); } else if (pdep.toLowerCase().equals("modifiedstrongcollision")) { pdepCombo.setSelectedItem("Modified Strong Collision"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for PressureDependence. RMG recognizes an argument of 'reservoirstate', 'modifiedstrongcollision', or 'off' but not " + pdep + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("PDepKinetics")) { // Pressure dependent kinetics model st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PDepKineticsModel String pdkm = st.nextToken(); if (pdkm.toLowerCase().equals("chebyshev")) { pdkmCombo.setSelectedItem("CHEB"); } else if (pdkm.toLowerCase().equals("pdeparrhenius")) { pdkmCombo.setSelectedItem("PLOG"); } else if (pdkm.toLowerCase().equals("rate")) { pdkmCombo.setSelectedItem("Rate"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for PDepKineticsModel. RMG recognizes an argument of 'chebyshev' or 'pdeparrhenius' but not " + pdkm + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("TRange")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over TRange String units = st.nextToken(); String unit = units.substring(1,units.length()-1); if (unit.equals("K") || unit.equals("F") || unit.equals("C")) chebyTUnits.setSelectedItem(unit); else System.out.println("ERROR: Reading in condition.txt file - Invalid chebyshev temperature unit. RMG recognizes temperature units of 'K', 'C', or 'F', but not " + unit + ". GUI does not contain all information present in condition.txt file."); chebyTMin.setText(st.nextToken()); chebyTMax.setText(st.nextToken()); chebyTGen.setText(st.nextToken()); chebyTRep.setText(st.nextToken()); } else if (line.startsWith("PRange")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over PRange String units = st.nextToken(); String unit = units.substring(1,units.length()-1); if (unit.equals("atm") || unit.equals("Pa") || unit.equals("bar") || unit.equals("torr")) chebyPUnits.setSelectedItem(unit); else System.out.println("ERROR: Reading in condition.txt file - Invalid chebyshev pressure unit. RMG recognizes pressure units of 'atm', 'bar', 'torr', or 'Pa', but not " + unit + ". GUI does not contain all information present in condition.txt file."); chebyPMin.setText(st.nextToken()); chebyPMax.setText(st.nextToken()); chebyPGen.setText(st.nextToken()); chebyPRep.setText(st.nextToken()); } else if (line.startsWith("IncludeSpecies")) { // IncludeSpecies.txt file (if present) st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over IncludeSpecies isPath.setText(st.nextToken()); } else if (line.startsWith("(1) Goal")) { // Goal st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "(1)" tempString = st.nextToken(); // Skip over "Goal" String goal = st.nextToken(); if (goal.startsWith("Conversion")) { controllerCombo.setSelectedItem("Conversion"); SpeciesConvName.setSelectedItem(st.nextToken()); conversion.setText(st.nextToken()); } else if (goal.startsWith("Reaction")) { controllerCombo.setSelectedItem("ReactionTime"); time.setText(st.nextToken()); String units = st.nextToken(); timeCombo.setSelectedItem(units.substring(1,units.length()-1)); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Goal. RMG recognizes an argument of 'Conversion' or 'ReactionTime' but not " + goal + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("(2) Error")) { // Error tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "(2)" tempString = st.nextToken(); // Skip over "Error" tempString = st.nextToken(); // Skip over "Tolerance:" eTolerance.setText(st.nextToken()); } else if (line.startsWith("DynamicSim")) { // Dynamic simulator st = new StringTokenizer(line); tempString = st.nextToken(); String sim = st.nextToken(); if (sim.equals("DASPK") || sim.equals("DASSL")) { simulatorCombo.setSelectedItem(sim); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for DynamicSimulator. RMG recognizes an argument of 'DASPK' or 'DASSL' but not " + sim + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Conversions")) { // Intermediate integration step st = new StringTokenizer(line); String stepName = st.nextToken(); // Skip over Conversions String steps = st.nextToken(); while (st.hasMoreTokens()) { steps += " " + st.nextToken(); } multiConv.setText(steps); } else if (line.startsWith("TimeStep")) { // Intermediate integration step st = new StringTokenizer(line); String stepName = st.nextToken(); // Skip over TimeStep String steps = st.nextToken(); while (st.hasMoreTokens()) { steps += " " + st.nextToken(); } multiTS.setText(steps); } else if (line.startsWith("Atol")) { // Absolute tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Atol aTolerance.setText(st.nextToken()); } else if (line.startsWith("Rtol")) { // Relative tolerance st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Rtol rTolerance.setText(st.nextToken()); } else if (line.startsWith("Error bars")) { // Error bars and Sensitivity analysis (if present) st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Error" tempString = st.nextToken(); // Skip over "bars:" String onoff = st.nextToken(); if (onoff.equals("on")) { eBarsCombo.setSelectedItem("Yes"); } else if (onoff.equals("off")) { eBarsCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Error bars. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Display sensitivity coefficients")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over "Display" tempString = st.nextToken(); // Skip over "sensitivity" tempString = st.nextToken(); // Skip over "coefficients:" String onoff = st.nextToken(); if (onoff.equals("on")) { sensCoeffCombo.setSelectedItem("Yes"); } else if (onoff.equals("off")) { sensCoeffCombo.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Display sensitivity coefficients. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("Display sensitivity information")) { // Sensitivity coefficients (if present) line = ChemParser.readMeaningfulLine(reader); numSpecies = 0; while (!line.startsWith("END")) { ++numSpecies; SensVector sensEntry = new SensVector(numSpecies-1,line); tmodelSens.updateSens(sensEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("PrimaryReactionLibrary")) { // Name(s)/Path(s) of PrimaryReactionLibrary line = ChemParser.readMeaningfulLine(reader); int prlCounter = 0; while (!line.equals("END")) { ++prlCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector prlEntry = new PRLVector(prlCounter-1,name,path); tmodelPRL.updatePRL(prlEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("SeedMechanism")) { // Name(s)/Path(s) of SeedMechanism line = ChemParser.readMeaningfulLine(reader); int smCounter = 0; while (!line.equals("END")) { ++smCounter; tempStringVector = line.split("Name: "); String name = tempStringVector[tempStringVector.length-1].trim(); line = ChemParser.readMeaningfulLine(reader); tempStringVector = line.split("Location: "); String path = tempStringVector[tempStringVector.length-1].trim(); PRLVector smEntry = new PRLVector(smCounter-1,name,path); tmodelSM.updatePRL(smEntry); line = ChemParser.readMeaningfulLine(reader); } } else if (line.startsWith("Verbose")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Verbose String onoff = st.nextToken(); if (onoff.equals("on")) { chemkinVerbosity.setSelectedItem("Yes"); } else if (onoff.equals("off")) { chemkinVerbosity.setSelectedItem("No"); } else { System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin Verbosity. RMG recognizes an argument of 'Off' or 'On' but not " + onoff + ". GUI does not contain all information present in condition.txt file."); } } else if (line.startsWith("A:")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over A String units = st.nextToken(); if (units.equals("moles") || units.equals("molecules")) chemkinAUnits.setSelectedItem(units); else System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin A units. RMG recognizes an argument of 'moles' or 'molecules' but not " + units + ". GUI does not contain all information present in condition.txt file."); } else if (line.startsWith("Ea:")) { st = new StringTokenizer(line); tempString = st.nextToken(); // Skip over Ea String units = st.nextToken(); if (units.equals("cal/mol") || units.equals("kcal/mol") || units.equals("kJ/mol") || units.equals("J/mol") || units.equals("Kelvins")) chemkinEaUnits.setSelectedItem(units); else System.out.println("ERROR: Reading in condition.txt file - Invalid argument for Chemkin Ea units. RMG recognizes an argument of 'kcal/mol', 'cal/mol', 'kJ/mol', 'J/mol', or 'Kelvins' but not " + units + ". GUI does not contain all information present in condition.txt file."); } else if (!line.startsWith("FinishController") & !line.startsWith("ChemkinUnits")) System.out.println("Warning: Reading in condition.txt file - Interpreter does not recognize the following line: " + line); line = ChemParser.readMeaningfulLine(reader); } }
diff --git a/freeplane/src/org/freeplane/features/common/attribute/AttributeBuilder.java b/freeplane/src/org/freeplane/features/common/attribute/AttributeBuilder.java index a568496c3..e26cb03f1 100644 --- a/freeplane/src/org/freeplane/features/common/attribute/AttributeBuilder.java +++ b/freeplane/src/org/freeplane/features/common/attribute/AttributeBuilder.java @@ -1,230 +1,233 @@ /* * Freeplane - mind map editor * Copyright (C) 2008 Dimitry Polivaev * * This file author is Dimitry Polivaev * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 2 of the License, or * (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ package org.freeplane.features.common.attribute; import java.io.IOException; import org.freeplane.core.extension.IExtension; import org.freeplane.core.io.IAttributeHandler; import org.freeplane.core.io.IElementDOMHandler; import org.freeplane.core.io.IElementHandler; import org.freeplane.core.io.IExtensionElementWriter; import org.freeplane.core.io.ITreeWriter; import org.freeplane.core.io.ReadManager; import org.freeplane.core.io.WriteManager; import org.freeplane.features.common.map.MapModel; import org.freeplane.features.common.map.MapReader; import org.freeplane.features.common.map.NodeModel; import org.freeplane.n3.nanoxml.XMLElement; class AttributeBuilder implements IElementDOMHandler { static class AttributeProperties { String attributeName; String attributeValue; } static class RegisteredAttributeProperties { String attributeName; boolean manual = false; boolean restricted = false; boolean visible = false; } public static final String XML_NODE_ATTRIBUTE = "attribute"; public static final String XML_NODE_ATTRIBUTE_LAYOUT = "attribute_layout"; public static final String XML_NODE_ATTRIBUTE_REGISTRY = "attribute_registry"; public static final String XML_NODE_REGISTERED_ATTRIBUTE_NAME = "attribute_name"; public static final String XML_NODE_REGISTERED_ATTRIBUTE_VALUE = "attribute_value"; final private AttributeController attributeController; // // final private Controller controller; final private MapReader mapReader; public AttributeBuilder(final AttributeController attributeController, final MapReader mapReader) { this.attributeController = attributeController; this.mapReader = mapReader; } public Object createElement(final Object parent, final String tag, final XMLElement attributes) { if (tag.equals(AttributeBuilder.XML_NODE_ATTRIBUTE)) { return new AttributeProperties(); } if (tag.equals(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME)) { return new RegisteredAttributeProperties(); } if (tag.equals(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_VALUE) || tag.equals(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY)) { return parent; } return null; } public void endElement(final Object parent, final String tag, final Object userObject, final XMLElement dom) { /* attributes */ if (tag.equals(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME)) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; if (rap.visible) { AttributeRegistry.getRegistry(getMap()).getElement(rap.attributeName).setVisibility(true); } if (rap.restricted) { AttributeRegistry.getRegistry(getMap()).getElement(rap.attributeName).setRestriction(true); } if (rap.manual) { AttributeRegistry.getRegistry(getMap()).getElement(rap.attributeName).setManual(true); } return; } if (parent instanceof NodeModel) { final NodeModel node = (NodeModel) parent; if (tag.equals(AttributeBuilder.XML_NODE_ATTRIBUTE)) { final AttributeProperties ap = (AttributeProperties) userObject; final Attribute attribute = new Attribute(ap.attributeName, ap.attributeValue); attributeController.createAttributeTableModel(node); final NodeAttributeTableModel model = NodeAttributeTableModel.getModel(node); model.addRowNoUndo(attribute); attributeController.setStateIcon(model); return; } return; } } private MapModel getMap() { return mapReader.getCurrentNodeTreeCreator().getCreatedMap(); } private void registerAttributeHandlers(final ReadManager reader) { reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "NAME", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.attributeName = value; AttributeRegistry.getRegistry(getMap()).registry(value); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "VISIBLE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.visible = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "RESTRICTED", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.restricted = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "MANUAL", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.manual = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_VALUE, "VALUE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; final Attribute attribute = new Attribute(rap.attributeName, value); final AttributeRegistry r = AttributeRegistry.getRegistry(getMap()); r.registry(attribute); } }); reader.addElementHandler(XML_NODE_ATTRIBUTE_LAYOUT, new IElementHandler() { public Object createElement(final Object parent, final String tag, final XMLElement attributes) { return parent; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_LAYOUT, "NAME_WIDTH", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final NodeModel node = (NodeModel) userObject; attributeController.createAttributeTableModel(node); final AttributeTableLayoutModel layout = NodeAttributeTableModel.getModel(node).getLayout(); layout.setColumnWidth(0, Integer.parseInt(value));; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_LAYOUT, "VALUE_WIDTH", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final NodeModel node = (NodeModel) userObject; attributeController.createAttributeTableModel(node); final AttributeTableLayoutModel layout = NodeAttributeTableModel.getModel(node).getLayout(); layout.setColumnWidth(1, Integer.parseInt(value));; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE, "NAME", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final AttributeProperties ap = (AttributeProperties) userObject; ap.attributeName = value.toString(); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE, "VALUE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final AttributeProperties ap = (AttributeProperties) userObject; ap.attributeValue = value.toString(); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "RESTRICTED", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { AttributeRegistry.getRegistry(getMap()).setRestricted(true); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "SHOW_ATTRIBUTES", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { + ModelessAttributeController.getController().setAttributeViewType(getMap(), + value.toString()); final AttributeRegistry attributes = AttributeRegistry.getRegistry(getMap()); - attributes.setAttributeViewType(value); + if(attributes != null) + attributes.setAttributeViewType(value); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "FONT_SIZE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final int size = Integer.parseInt(value.toString()); AttributeRegistry.getRegistry(getMap()).setFontSize(size); } }); } /** */ public void registerBy(final ReadManager reader, final WriteManager writer) { reader.addElementHandler("attribute_registry", this); reader.addElementHandler(AttributeBuilder.XML_NODE_ATTRIBUTE, this); reader.addElementHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, this); reader.addElementHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_VALUE, this); writer.addExtensionElementWriter(NodeAttributeTableModel.class, new IExtensionElementWriter() { public void writeContent(final ITreeWriter writer, final Object node, final IExtension extension) throws IOException { final NodeAttributeTableModel attributes = (NodeAttributeTableModel) extension; attributes.save(writer); } }); writer.addExtensionElementWriter(AttributeRegistry.class, new IExtensionElementWriter() { public void writeContent(final ITreeWriter writer, final Object node, final IExtension extension) throws IOException { final AttributeRegistry attributes = (AttributeRegistry) extension; attributes.write(writer); } }); registerAttributeHandlers(reader); } public void setAttributes(final String tag, final Object node, final XMLElement attributes) { } }
false
true
private void registerAttributeHandlers(final ReadManager reader) { reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "NAME", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.attributeName = value; AttributeRegistry.getRegistry(getMap()).registry(value); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "VISIBLE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.visible = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "RESTRICTED", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.restricted = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "MANUAL", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.manual = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_VALUE, "VALUE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; final Attribute attribute = new Attribute(rap.attributeName, value); final AttributeRegistry r = AttributeRegistry.getRegistry(getMap()); r.registry(attribute); } }); reader.addElementHandler(XML_NODE_ATTRIBUTE_LAYOUT, new IElementHandler() { public Object createElement(final Object parent, final String tag, final XMLElement attributes) { return parent; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_LAYOUT, "NAME_WIDTH", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final NodeModel node = (NodeModel) userObject; attributeController.createAttributeTableModel(node); final AttributeTableLayoutModel layout = NodeAttributeTableModel.getModel(node).getLayout(); layout.setColumnWidth(0, Integer.parseInt(value));; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_LAYOUT, "VALUE_WIDTH", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final NodeModel node = (NodeModel) userObject; attributeController.createAttributeTableModel(node); final AttributeTableLayoutModel layout = NodeAttributeTableModel.getModel(node).getLayout(); layout.setColumnWidth(1, Integer.parseInt(value));; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE, "NAME", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final AttributeProperties ap = (AttributeProperties) userObject; ap.attributeName = value.toString(); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE, "VALUE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final AttributeProperties ap = (AttributeProperties) userObject; ap.attributeValue = value.toString(); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "RESTRICTED", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { AttributeRegistry.getRegistry(getMap()).setRestricted(true); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "SHOW_ATTRIBUTES", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final AttributeRegistry attributes = AttributeRegistry.getRegistry(getMap()); attributes.setAttributeViewType(value); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "FONT_SIZE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final int size = Integer.parseInt(value.toString()); AttributeRegistry.getRegistry(getMap()).setFontSize(size); } }); }
private void registerAttributeHandlers(final ReadManager reader) { reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "NAME", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.attributeName = value; AttributeRegistry.getRegistry(getMap()).registry(value); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "VISIBLE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.visible = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "RESTRICTED", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.restricted = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_NAME, "MANUAL", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; rap.manual = true; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_REGISTERED_ATTRIBUTE_VALUE, "VALUE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final RegisteredAttributeProperties rap = (RegisteredAttributeProperties) userObject; final Attribute attribute = new Attribute(rap.attributeName, value); final AttributeRegistry r = AttributeRegistry.getRegistry(getMap()); r.registry(attribute); } }); reader.addElementHandler(XML_NODE_ATTRIBUTE_LAYOUT, new IElementHandler() { public Object createElement(final Object parent, final String tag, final XMLElement attributes) { return parent; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_LAYOUT, "NAME_WIDTH", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final NodeModel node = (NodeModel) userObject; attributeController.createAttributeTableModel(node); final AttributeTableLayoutModel layout = NodeAttributeTableModel.getModel(node).getLayout(); layout.setColumnWidth(0, Integer.parseInt(value));; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_LAYOUT, "VALUE_WIDTH", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final NodeModel node = (NodeModel) userObject; attributeController.createAttributeTableModel(node); final AttributeTableLayoutModel layout = NodeAttributeTableModel.getModel(node).getLayout(); layout.setColumnWidth(1, Integer.parseInt(value));; } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE, "NAME", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final AttributeProperties ap = (AttributeProperties) userObject; ap.attributeName = value.toString(); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE, "VALUE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final AttributeProperties ap = (AttributeProperties) userObject; ap.attributeValue = value.toString(); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "RESTRICTED", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { AttributeRegistry.getRegistry(getMap()).setRestricted(true); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "SHOW_ATTRIBUTES", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { ModelessAttributeController.getController().setAttributeViewType(getMap(), value.toString()); final AttributeRegistry attributes = AttributeRegistry.getRegistry(getMap()); if(attributes != null) attributes.setAttributeViewType(value); } }); reader.addAttributeHandler(AttributeBuilder.XML_NODE_ATTRIBUTE_REGISTRY, "FONT_SIZE", new IAttributeHandler() { public void setAttribute(final Object userObject, final String value) { final int size = Integer.parseInt(value.toString()); AttributeRegistry.getRegistry(getMap()).setFontSize(size); } }); }
diff --git a/fest-swing/src/test/java/org/fest/swing/core/ComponentIsFocusableQuery_isFocusable_Test.java b/fest-swing/src/test/java/org/fest/swing/core/ComponentIsFocusableQuery_isFocusable_Test.java index ecef9945..f736c9ba 100644 --- a/fest-swing/src/test/java/org/fest/swing/core/ComponentIsFocusableQuery_isFocusable_Test.java +++ b/fest-swing/src/test/java/org/fest/swing/core/ComponentIsFocusableQuery_isFocusable_Test.java @@ -1,74 +1,73 @@ /* * Created on Apr 21, 2010 * * Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except * in compliance with the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software distributed under the License * is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express * or implied. See the License for the specific language governing permissions and limitations under * the License. * * Copyright @2010 the original author or authors. */ package org.fest.swing.core; import java.awt.Component; import java.util.Collection; import org.junit.*; import org.junit.runner.RunWith; import org.junit.runners.Parameterized; import org.junit.runners.Parameterized.Parameters; import org.fest.mocks.EasyMockTemplate; import org.fest.swing.test.core.EDTSafeTestCase; import org.fest.swing.test.data.BooleanProvider; import static org.easymock.EasyMock.expect; import static org.easymock.classextension.EasyMock.createMock; import static org.fest.assertions.Assertions.assertThat; import static org.fest.util.Collections.list; /** * Tests for <code>{@link ComponentIsFocusableQuery#isFocusable(Component)}</code>. * * @author Yvonne Wang */ @RunWith(Parameterized.class) public class ComponentIsFocusableQuery_isFocusable_Test extends EDTSafeTestCase { private final boolean isFocusable; private Component component; @Parameters public static Collection<Object[]> isFocusable() { return list(BooleanProvider.booleans()); } public ComponentIsFocusableQuery_isFocusable_Test(boolean isFocusable) { this.isFocusable = isFocusable; } @Before public void setUp() { component = createMock(Component.class); } @Test public void should_return_Component_is_focusable() { new EasyMockTemplate(component) { protected void expectations() { expect(component.isFocusable()).andReturn(isFocusable); } protected void codeToTest() { - boolean b = ComponentIsFocusableQuery.isFocusable(component); - assertThat(b).isEqualTo(isFocusable); + assertThat(ComponentIsFocusableQuery.isFocusable(component)).isEqualTo(isFocusable); } }.run(); } }
true
true
public void should_return_Component_is_focusable() { new EasyMockTemplate(component) { protected void expectations() { expect(component.isFocusable()).andReturn(isFocusable); } protected void codeToTest() { boolean b = ComponentIsFocusableQuery.isFocusable(component); assertThat(b).isEqualTo(isFocusable); } }.run(); }
public void should_return_Component_is_focusable() { new EasyMockTemplate(component) { protected void expectations() { expect(component.isFocusable()).andReturn(isFocusable); } protected void codeToTest() { assertThat(ComponentIsFocusableQuery.isFocusable(component)).isEqualTo(isFocusable); } }.run(); }
diff --git a/plugins/org.eclipse.wst.common.modulecore/modulecore-src/org/eclipse/wst/common/componentcore/internal/util/WTPModulesTranslator.java b/plugins/org.eclipse.wst.common.modulecore/modulecore-src/org/eclipse/wst/common/componentcore/internal/util/WTPModulesTranslator.java index 89c03371..4f5f3831 100644 --- a/plugins/org.eclipse.wst.common.modulecore/modulecore-src/org/eclipse/wst/common/componentcore/internal/util/WTPModulesTranslator.java +++ b/plugins/org.eclipse.wst.common.modulecore/modulecore-src/org/eclipse/wst/common/componentcore/internal/util/WTPModulesTranslator.java @@ -1,120 +1,120 @@ /******************************************************************************* * Copyright (c) 2005 IBM Corporation and others. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/epl-v10.html * * Contributors: * IBM Corporation - initial API and implementation *******************************************************************************/ package org.eclipse.wst.common.componentcore.internal.util; import org.eclipse.emf.ecore.EStructuralFeature; import org.eclipse.wst.common.componentcore.internal.ComponentcorePackage; import org.eclipse.wst.common.internal.emf.resource.GenericTranslator; import org.eclipse.wst.common.internal.emf.resource.IDTranslator; import org.eclipse.wst.common.internal.emf.resource.RootTranslator; import org.eclipse.wst.common.internal.emf.resource.Translator; public class WTPModulesTranslator extends RootTranslator implements WTPModulesXmlMapperI{ public static WTPModulesTranslator INSTANCE = new WTPModulesTranslator(); private static Translator[] children; private static final ComponentcorePackage MODULE_CORE_PKG = ComponentcorePackage.eINSTANCE; /** * @param domNameAndPath * @param eClass */ public WTPModulesTranslator() { super(PROJECT_MODULES, ComponentcorePackage.eINSTANCE.getProjectComponents()); } // public void setMOFValue(Notifier owner, Object value, int newIndex) { // super.setMOFValue(owner, value, newIndex); // EObject target = ((EObject)value); // IProject project = ProjectUtilities.getProject(target); // if(project != null) // target.eSet(ComponentcorePackage.eINSTANCE.getProjectComponents_ProjectName(), project.getName()); // } /* (non-Javadoc) * @see org.eclipse.wst.common.internal.emf.resource.Translator#getChildren(java.lang.Object, int) */ public Translator[] getChildren(Object target, int versionID) { if(children == null) children = createWTPModulesTranslator(); return children; } private static Translator[] createWTPModulesTranslator() { return new Translator[] { IDTranslator.INSTANCE, createWBModuleTranslator(MODULE_CORE_PKG.getProjectComponents_Components()) }; } /** * @return */ private static Translator createWBModuleTranslator(EStructuralFeature afeature) { GenericTranslator result = new GenericTranslator(WORKBENCH_COMPONENT, afeature); result.setChildren(new Translator[] { IDTranslator.INSTANCE, //new Translator(HANDLE, MODULE_CORE_PKG.getWorkbenchComponent_Handle(), DOM_ATTRIBUTE), REMOVED SINCE HANDLE SHOULD NOW BE DERIVED -MDE new Translator(RUNTIME_NAME, MODULE_CORE_PKG.getWorkbenchComponent_Name(), DOM_ATTRIBUTE), createModuleTypeTranslator(MODULE_CORE_PKG.getWorkbenchComponent_ComponentType()), createWBResourceTranslator(MODULE_CORE_PKG.getWorkbenchComponent_Resources()), createDependentModuleTranslator(MODULE_CORE_PKG.getWorkbenchComponent_ReferencedComponents()), - new Translator(META_RESOURCES, MODULE_CORE_PKG.getWorkbenchComponent_MetadataResources()), + new IPathTranslator(META_RESOURCES, MODULE_CORE_PKG.getWorkbenchComponent_MetadataResources()), createPropertiesTranslator(MODULE_CORE_PKG.getWorkbenchComponent_Properties()) }); return result; } private static Translator createModuleTypeTranslator(EStructuralFeature afeature) { GenericTranslator result = new GenericTranslator(MODULE_TYPE, afeature); result.setChildren(new Translator[] { new Translator(COMPONENT_TYPE_ID, MODULE_CORE_PKG.getComponentType_ComponentTypeId(), DOM_ATTRIBUTE), new Translator(META_RESOURCES, MODULE_CORE_PKG.getComponentType_MetadataResources()), new Translator(COMPONENT_TYPE_VERSION, MODULE_CORE_PKG.getComponentType_Version()), createPropertiesTranslator(MODULE_CORE_PKG.getComponentType_Properties()) }); return result; } private static Translator createPropertiesTranslator(EStructuralFeature afeature){ GenericTranslator result = new GenericTranslator(PROPERTY, afeature); result.setChildren(new Translator[] { new Translator(PROPERTY_NAME, MODULE_CORE_PKG.getProperty_Name(), DOM_ATTRIBUTE ), new Translator(PROPERTY_VALUE, MODULE_CORE_PKG.getProperty_Value(), DOM_ATTRIBUTE ), }); return result; } private static Translator createDependentModuleTranslator(EStructuralFeature afeature) { GenericTranslator result = new GenericTranslator(REFERENCED_COMPONENT, afeature); result.setChildren(new Translator[] { new IPathTranslator(RUNTIME_PATH, MODULE_CORE_PKG.getReferencedComponent_RuntimePath(), DOM_ATTRIBUTE), new URITranslator(HANDLE, MODULE_CORE_PKG.getReferencedComponent_Handle(), DOM_ATTRIBUTE), new HRefTranslator(DEP_OBJECT,MODULE_CORE_PKG.getReferencedComponent_DependentObject()), new DependencyTypeTranslator() }); return result; } private static Translator createWBResourceTranslator(EStructuralFeature afeature) { GenericTranslator result = new GenericTranslator(COMPONENT_RESOURCE, afeature); result.setChildren(new Translator[] { IDTranslator.INSTANCE, new IPathTranslator(SOURCE_PATH, MODULE_CORE_PKG.getComponentResource_SourcePath(), DOM_ATTRIBUTE), new IPathTranslator(RUNTIME_PATH, MODULE_CORE_PKG.getComponentResource_RuntimePath(), DOM_ATTRIBUTE), new Translator(RESOURCE_TYPE, MODULE_CORE_PKG.getComponentResource_ResourceType(), DOM_ATTRIBUTE), new Translator(EXCLUSIONS, MODULE_CORE_PKG.getComponentResource_Exclusions()) }); return result; } }
true
true
private static Translator createWBModuleTranslator(EStructuralFeature afeature) { GenericTranslator result = new GenericTranslator(WORKBENCH_COMPONENT, afeature); result.setChildren(new Translator[] { IDTranslator.INSTANCE, //new Translator(HANDLE, MODULE_CORE_PKG.getWorkbenchComponent_Handle(), DOM_ATTRIBUTE), REMOVED SINCE HANDLE SHOULD NOW BE DERIVED -MDE new Translator(RUNTIME_NAME, MODULE_CORE_PKG.getWorkbenchComponent_Name(), DOM_ATTRIBUTE), createModuleTypeTranslator(MODULE_CORE_PKG.getWorkbenchComponent_ComponentType()), createWBResourceTranslator(MODULE_CORE_PKG.getWorkbenchComponent_Resources()), createDependentModuleTranslator(MODULE_CORE_PKG.getWorkbenchComponent_ReferencedComponents()), new Translator(META_RESOURCES, MODULE_CORE_PKG.getWorkbenchComponent_MetadataResources()), createPropertiesTranslator(MODULE_CORE_PKG.getWorkbenchComponent_Properties()) }); return result; }
private static Translator createWBModuleTranslator(EStructuralFeature afeature) { GenericTranslator result = new GenericTranslator(WORKBENCH_COMPONENT, afeature); result.setChildren(new Translator[] { IDTranslator.INSTANCE, //new Translator(HANDLE, MODULE_CORE_PKG.getWorkbenchComponent_Handle(), DOM_ATTRIBUTE), REMOVED SINCE HANDLE SHOULD NOW BE DERIVED -MDE new Translator(RUNTIME_NAME, MODULE_CORE_PKG.getWorkbenchComponent_Name(), DOM_ATTRIBUTE), createModuleTypeTranslator(MODULE_CORE_PKG.getWorkbenchComponent_ComponentType()), createWBResourceTranslator(MODULE_CORE_PKG.getWorkbenchComponent_Resources()), createDependentModuleTranslator(MODULE_CORE_PKG.getWorkbenchComponent_ReferencedComponents()), new IPathTranslator(META_RESOURCES, MODULE_CORE_PKG.getWorkbenchComponent_MetadataResources()), createPropertiesTranslator(MODULE_CORE_PKG.getWorkbenchComponent_Properties()) }); return result; }
diff --git a/src/minecraft/net/minecraft/src/GuiIngame.java b/src/minecraft/net/minecraft/src/GuiIngame.java index a8348c3e..0af2e44b 100644 --- a/src/minecraft/net/minecraft/src/GuiIngame.java +++ b/src/minecraft/net/minecraft/src/GuiIngame.java @@ -1,640 +1,640 @@ package net.minecraft.src; import java.util.ArrayList; import java.util.List; import java.util.Random; import net.minecraft.client.Minecraft; import org.lwjgl.opengl.GL11; import org.lwjgl.opengl.GL12; //Spout Start import org.spoutcraft.client.SpoutClient; import org.spoutcraft.client.config.ConfigReader; import org.spoutcraft.client.gui.minimap.ZanMinimap; import org.spoutcraft.spoutcraftapi.Spoutcraft; import org.spoutcraft.spoutcraftapi.gui.ChatTextBox; import org.spoutcraft.spoutcraftapi.gui.Color; import org.spoutcraft.spoutcraftapi.gui.InGameHUD; import org.spoutcraft.spoutcraftapi.gui.ServerPlayerList; //Spout End import org.spoutcraft.spoutcraftapi.player.ChatMessage; public class GuiIngame extends Gui { private static RenderItem itemRenderer = new RenderItem(); //Spout Start private final ZanMinimap map = new ZanMinimap(); //Spout End public static final Random rand = new Random(); //Spout private -> public static final private Minecraft mc; private int updateCounter; /** The string specifying which record music is playing */ private String recordPlaying; /** How many ticks the record playing message will be displayed */ private int recordPlayingUpFor; private boolean recordIsPlaying; /** Damage partial time (GUI) */ public float damageGuiPartialTime; /** Previous frame vignette brightness (slowly changes by 1% each frame) */ float prevVignetteBrightness; public GuiIngame(Minecraft par1Minecraft) { //rand = new Random(); //Spout removed updateCounter = 0; recordPlaying = ""; recordPlayingUpFor = 0; recordIsPlaying = false; prevVignetteBrightness = 1.0F; mc = par1Minecraft; } /** * Render the ingame overlay with quick icon bar, ... */ //Spout Start //TODO Rewrite again, it's in a horrible state, i'm surprised it works... //Most of function rewritten public void renderGameOverlay(float f, boolean flag, int i, int j) { SpoutClient.getInstance().onTick(); InGameHUD mainScreen = SpoutClient.getInstance().getActivePlayer().getMainScreen(); ScaledResolution scaledRes = new ScaledResolution(this.mc.gameSettings, this.mc.displayWidth, this.mc.displayHeight); int screenWidth = scaledRes.getScaledWidth(); int screenHeight = scaledRes.getScaledHeight(); FontRenderer font = this.mc.fontRenderer; this.mc.entityRenderer.setupOverlayRendering(); GL11.glEnable(3042 /*GL_BLEND*/); if(Minecraft.isFancyGraphicsEnabled()) { this.renderVignette(this.mc.thePlayer.getBrightness(f), screenWidth, screenHeight); } ItemStack helmet = this.mc.thePlayer.inventory.armorItemInSlot(3); if(this.mc.gameSettings.thirdPersonView == 0 && helmet != null && helmet.itemID == Block.pumpkin.blockID) { this.renderPumpkinBlur(screenWidth, screenHeight); } if(!this.mc.thePlayer.isPotionActive(Potion.confusion)) { float var10 = this.mc.thePlayer.prevTimeInPortal + (this.mc.thePlayer.timeInPortal - this.mc.thePlayer.prevTimeInPortal) * f; if(var10 > 0.0F) { this.renderPortalOverlay(var10, screenWidth, screenHeight); } } GL11.glBlendFunc(770, 771); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glBindTexture(3553 /* GL_TEXTURE_2D */, this.mc.renderEngine.getTexture("/gui/gui.png")); InventoryPlayer var11 = this.mc.thePlayer.inventory; this.zLevel = -90.0F; this.drawTexturedModalRect(screenWidth / 2 - 91, screenHeight - 22, 0, 0, 182, 22); this.drawTexturedModalRect(screenWidth / 2 - 91 - 1 + var11.currentItem * 20, screenHeight - 22 - 1, 0, 22, 24, 22); GL11.glBindTexture(3553 /* GL_TEXTURE_2D */, this.mc.renderEngine.getTexture("/gui/icons.png")); GL11.glEnable(3042 /* GL_BLEND */); GL11.glBlendFunc(775, 769); this.drawTexturedModalRect(screenWidth / 2 - 7, screenHeight / 2 - 7, 0, 0, 16, 16); GL11.glDisable(3042 /* GL_BLEND */); GuiIngame.rand.setSeed((long) (this.updateCounter * 312871)); int var15; int var17; this.renderBossHealth(); //better safe than sorry SpoutClient.enableSandbox(); //Toggle visibility if needed if(mainScreen.getHealthBar().isVisible() == mc.playerController.isInCreativeMode()) { mainScreen.toggleSurvivalHUD(!mc.playerController.isInCreativeMode()); } // Hunger Bar Begin mainScreen.getHungerBar().render(); // Hunger Bar End // Armor Bar Begin mainScreen.getArmorBar().render(); // Armor Bar End // Health Bar Begin mainScreen.getHealthBar().render(); // Health Bar End // Bubble Bar Begin mainScreen.getBubbleBar().render(); // Bubble Bar End // Exp Bar Begin mainScreen.getExpBar().render(); // Exp Bar End SpoutClient.disableSandbox(); map.onRenderTick(); GL11.glDisable(3042 /* GL_BLEND */); GL11.glEnable('\u803a'); GL11.glPushMatrix(); GL11.glRotatef(120.0F, 1.0F, 0.0F, 0.0F); RenderHelper.enableStandardItemLighting(); GL11.glPopMatrix(); for (var15 = 0; var15 < 9; ++var15) { int x = screenWidth / 2 - 90 + var15 * 20 + 2; var17 = screenHeight - 16 - 3; this.renderInventorySlot(var15, x, var17, f); } RenderHelper.disableStandardItemLighting(); GL11.glDisable('\u803a'); if (this.mc.thePlayer.getSleepTimer() > 0) { GL11.glDisable(2929 /*GL_DEPTH_TEST*/); GL11.glDisable(3008 /*GL_ALPHA_TEST*/); var15 = this.mc.thePlayer.getSleepTimer(); float var26 = (float)var15 / 100.0F; if(var26 > 1.0F) { var26 = 1.0F - (float)(var15 - 100) / 10.0F; } var17 = (int)(220.0F * var26) << 24 | 1052704; this.drawRect(0, 0, screenWidth, screenHeight, var17); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); GL11.glEnable(2929 /*GL_DEPTH_TEST*/); } SpoutClient.enableSandbox(); mainScreen.render(); SpoutClient.disableSandbox(); if (this.mc.gameSettings.showDebugInfo) { this.mc.mcProfiler.startSection("debug"); GL11.glPushMatrix(); font.drawStringWithShadow("Minecraft 1.3.2 (" + this.mc.debug + ")", 2, 2, 16777215); font.drawStringWithShadow(this.mc.debugInfoRenders(), 2, 12, 16777215); font.drawStringWithShadow(this.mc.getEntityDebug(), 2, 22, 16777215); font.drawStringWithShadow(this.mc.debugInfoEntities(), 2, 32, 16777215); font.drawStringWithShadow(this.mc.getWorldProviderName(), 2, 42, 16777215); long var41 = Runtime.getRuntime().maxMemory(); long var34 = Runtime.getRuntime().totalMemory(); long var42 = Runtime.getRuntime().freeMemory(); long var43 = var34 - var42; String var45 = "Used memory: " + var43 * 100L / var41 + "% (" + var43 / 1024L / 1024L + "MB) of " + var41 / 1024L / 1024L + "MB"; this.drawString(font, var45, screenWidth - font.getStringWidth(var45) - 2, 2, 14737632); var45 = "Allocated memory: " + var34 * 100L / var41 + "% (" + var34 / 1024L / 1024L + "MB)"; this.drawString(font, var45, screenWidth - font.getStringWidth(var45) - 2, 12, 14737632); - if(!(SpoutClient.getInstance().isCoordsCheat())) { + if(SpoutClient.getInstance().isCoordsCheat()) { this.drawString(font, String.format("x: %.5f", new Object[] {Double.valueOf(this.mc.thePlayer.posX)}), 2, 64, 14737632); this.drawString(font, String.format("y: %.3f (feet pos, %.3f eyes pos)", new Object[] {Double.valueOf(this.mc.thePlayer.boundingBox.minY), Double.valueOf(this.mc.thePlayer.posY)}), 2, 72, 14737632); this.drawString(font, String.format("z: %.5f", new Object[] {Double.valueOf(this.mc.thePlayer.posZ)}), 2, 80, 14737632); this.drawString(font, "f: " + (MathHelper.floor_double((double)(this.mc.thePlayer.rotationYaw * 4.0F / 360.0F) + 0.5D) & 3), 2, 88, 14737632); } int var47 = MathHelper.floor_double(this.mc.thePlayer.posX); int var22 = MathHelper.floor_double(this.mc.thePlayer.posY); int var233 = MathHelper.floor_double(this.mc.thePlayer.posZ); if (this.mc.theWorld != null && this.mc.theWorld.blockExists(var47, var22, var233)) { Chunk var48 = this.mc.theWorld.getChunkFromBlockCoords(var47, var233); this.drawString(font, "lc: " + (var48.getTopFilledSegment() + 15) + " b: " + var48.getBiomeGenForWorldCoords(var47 & 15, var233 & 15, this.mc.theWorld.getWorldChunkManager()).biomeName + " bl: " + var48.getSavedLightValue(EnumSkyBlock.Block, var47 & 15, var22, var233 & 15) + " sl: " + var48.getSavedLightValue(EnumSkyBlock.Sky, var47 & 15, var22, var233 & 15) + " rl: " + var48.getBlockLightValue(var47 & 15, var22, var233 & 15, 0), 2, 96, 14737632); } this.drawString(font, String.format("ws: %.3f, fs: %.3f, g: %b", new Object[] {Float.valueOf(this.mc.thePlayer.capabilities.getWalkSpeed()), Float.valueOf(this.mc.thePlayer.capabilities.getFlySpeed()), Boolean.valueOf(this.mc.thePlayer.onGround)}), 2, 104, 14737632); GL11.glPopMatrix(); this.mc.mcProfiler.endSection(); } if(this.recordPlayingUpFor > 0) { float var24 = (float)this.recordPlayingUpFor - f; int fontColor = (int)(var24 * 256.0F / 20.0F); if(fontColor > 255) { fontColor = 255; } if(fontColor > 0) { GL11.glPushMatrix(); GL11.glTranslatef((float)(screenWidth / 2), (float)(screenHeight - 48), 0.0F); GL11.glEnable(3042 /*GL_BLEND*/); GL11.glBlendFunc(770, 771); var17 = 16777215; if(this.recordIsPlaying) { var17 = java.awt.Color.HSBtoRGB(var24 / 50.0F, 0.7F, 0.6F) & 16777215; } font.drawString(this.recordPlaying, -font.getStringWidth(this.recordPlaying) / 2, -4, var17 + (fontColor << 24)); GL11.glDisable(3042 /*GL_BLEND*/); GL11.glPopMatrix(); } } SpoutClient.enableSandbox(); //boolean chatOpen = mainScreen.getChatBar().isVisible() && mc.currentScreen instanceof GuiChat; //int lines = chatOpen ? mainScreen.getChatTextBox().getNumVisibleChatLines() : mainScreen.getChatTextBox().getNumVisibleLines(); // GL11.glEnable(3042 /*GL_BLEND*/); // GL11.glBlendFunc(770, 771); // GL11.glDisable(3008 /*GL_ALPHA_TEST*/); ChatTextBox chatTextWidget = mainScreen.getChatTextBox(); GL11.glPushMatrix(); boolean chatOpen = mainScreen.getChatBar().isVisible() && mc.currentScreen instanceof GuiChat; if (chatTextWidget.isVisible() || chatOpen) { chatTextWidget.setChatOpen(chatOpen); chatTextWidget.render(); } GL11.glPopMatrix(); // if (chatTextWidget.isVisible()) { // int viewedLine = 0; // for (int line = SpoutClient.getInstance().getChatManager().chatScroll; line < Math.min(chatMessageList.size(), (lines + SpoutClient.getInstance().getChatManager().chatScroll)); line++) { // if (chatOpen || chatMessageList.get(line).updateCounter < chatTextWidget.getFadeoutTicks()) { // double opacity = 1.0D - chatMessageList.get(line).updateCounter / (double)chatTextWidget.getFadeoutTicks(); // opacity *= 10D; // if(opacity < 0.0D) { // opacity = 0.0D; // } // if(opacity > 1.0D) { // opacity = 1.0D; // } // opacity *= opacity; // int color = chatOpen ? 255 : (int)(255D * opacity); // if (color > 0) { // int x = 2 + chatTextWidget.getX(); // int y = chatTextWidget.getY() + (-viewedLine * 9); // String chat = chatMessageList.get(line).message; // chat = SpoutClient.getInstance().getChatManager().formatChatColors(chat); // // boolean mentioned = false; // if (ConfigReader.highlightMentions) { // String[] split = chat.toLowerCase().split(":"); // if (split.length == 1) { // split = chat.toLowerCase().split(">"); // } // if (split.length > 1) { // String name = this.mc.thePlayer.username.toLowerCase(); // if (!split[0].contains(name)) { // for (int part = 1; part < split.length; part++) { // if (split[part].contains(name)) { // mentioned = true; // break; // } // } // } // } // } // // if (mentioned) { // drawRect(x, y - 1, x + 320, y + 8, RED); // } // else { // drawRect(x, y - 1, x + 320, y + 8, color / 2 << 24); // } // GL11.glEnable(3042 /*GL_BLEND*/); // font.drawStringWithShadow(chat, x, y, 0xffffff + (color << 24)); // } // viewedLine++; // } // } // } SpoutClient.disableSandbox(); ServerPlayerList playerList = mainScreen.getServerPlayerList(); if(this.mc.thePlayer instanceof EntityClientPlayerMP && this.mc.gameSettings.keyBindPlayerList.pressed && playerList.isVisible()) { NetClientHandler var41 = ((EntityClientPlayerMP)this.mc.thePlayer).sendQueue; List var44 = var41.playerInfoList; int var40 = var41.currentServerMaxPlayers; int var38 = var40; int var16; for(var16 = 1; var38 > 20; var38 = (var40 + var16 - 1) / var16) { ++var16; } var17 = 300 / var16; if(var17 > 150) { var17 = 150; } int var18 = (screenWidth - var16 * var17) / 2; byte var46 = 10; this.drawRect(var18 - 1, var46 - 1, var18 + var17 * var16, var46 + 9 * var38, Integer.MIN_VALUE); for(int var20 = 0; var20 < var40; ++var20) { int var47 = var18 + var20 % var16 * var17; int var22 = var46 + var20 / var16 * 9; this.drawRect(var47, var22, var47 + var17 - 1, var22 + 8, 553648127); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); if(var20 < var44.size()) { GuiPlayerInfo var50 = (GuiPlayerInfo)var44.get(var20); font.drawStringWithShadow(var50.name, var47, var22, 16777215); this.mc.renderEngine.bindTexture(this.mc.renderEngine.getTexture("/gui/icons.png")); boolean var48 = false; boolean var53 = false; byte var49 = 0; var53 = false; byte var54; if(var50.responseTime < 0) { var54 = 5; } else if(var50.responseTime < 150) { var54 = 0; } else if(var50.responseTime < 300) { var54 = 1; } else if(var50.responseTime < 600) { var54 = 2; } else if(var50.responseTime < 1000) { var54 = 3; } else { var54 = 4; } this.zLevel += 100.0F; this.drawTexturedModalRect(var47 + var17 - 12, var22, 0 + var49 * 10, 176 + var54 * 8, 10, 8); this.zLevel -= 100.0F; } } } GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glDisable(2896 /*GL_LIGHTING*/); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); GL11.glDisable(3042 /*GL_BLEND*/); } /** * Renders dragon's (boss) health on the HUD */ private void renderBossHealth() { if (RenderDragon.entityDragon == null) { return; } EntityDragon entitydragon = RenderDragon.entityDragon; RenderDragon.entityDragon = null; FontRenderer fontrenderer = mc.fontRenderer; ScaledResolution scaledresolution = new ScaledResolution(mc.gameSettings, mc.displayWidth, mc.displayHeight); int i = scaledresolution.getScaledWidth(); char c = '\266'; int j = i / 2 - c / 2; int k = (int)(((float)entitydragon.getDragonHealth() / (float)entitydragon.getMaxHealth()) * (float)(c + 1)); byte byte0 = 12; drawTexturedModalRect(j, byte0, 0, 74, c, 5); drawTexturedModalRect(j, byte0, 0, 74, c, 5); if (k > 0) { drawTexturedModalRect(j, byte0, 0, 79, k, 5); } String s = "Boss health"; fontrenderer.drawStringWithShadow(s, i / 2 - fontrenderer.getStringWidth(s) / 2, byte0 - 10, 0xff00ff); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glBindTexture(GL11.GL_TEXTURE_2D, mc.renderEngine.getTexture("/gui/icons.png")); } private void renderPumpkinBlur(int par1, int par2) { GL11.glDisable(GL11.GL_DEPTH_TEST); GL11.glDepthMask(false); GL11.glBlendFunc(GL11.GL_SRC_ALPHA, GL11.GL_ONE_MINUS_SRC_ALPHA); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glDisable(GL11.GL_ALPHA_TEST); GL11.glBindTexture(GL11.GL_TEXTURE_2D, mc.renderEngine.getTexture("%blur%/misc/pumpkinblur.png")); Tessellator tessellator = Tessellator.instance; tessellator.startDrawingQuads(); tessellator.addVertexWithUV(0.0D, par2, -90D, 0.0D, 1.0D); tessellator.addVertexWithUV(par1, par2, -90D, 1.0D, 1.0D); tessellator.addVertexWithUV(par1, 0.0D, -90D, 1.0D, 0.0D); tessellator.addVertexWithUV(0.0D, 0.0D, -90D, 0.0D, 0.0D); tessellator.draw(); GL11.glDepthMask(true); GL11.glEnable(GL11.GL_DEPTH_TEST); GL11.glEnable(GL11.GL_ALPHA_TEST); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); } /** * Renders the vignette. Args: vignetteBrightness, width, height */ private void renderVignette(float par1, int par2, int par3) { par1 = 1.0F - par1; if (par1 < 0.0F) { par1 = 0.0F; } if (par1 > 1.0F) { par1 = 1.0F; } prevVignetteBrightness += (double)(par1 - prevVignetteBrightness) * 0.01D; GL11.glDisable(GL11.GL_DEPTH_TEST); GL11.glDepthMask(false); GL11.glBlendFunc(GL11.GL_ZERO, GL11.GL_ONE_MINUS_SRC_COLOR); GL11.glColor4f(prevVignetteBrightness, prevVignetteBrightness, prevVignetteBrightness, 1.0F); GL11.glBindTexture(GL11.GL_TEXTURE_2D, mc.renderEngine.getTexture("%blur%/misc/vignette.png")); Tessellator tessellator = Tessellator.instance; tessellator.startDrawingQuads(); tessellator.addVertexWithUV(0.0D, par3, -90D, 0.0D, 1.0D); tessellator.addVertexWithUV(par2, par3, -90D, 1.0D, 1.0D); tessellator.addVertexWithUV(par2, 0.0D, -90D, 1.0D, 0.0D); tessellator.addVertexWithUV(0.0D, 0.0D, -90D, 0.0D, 0.0D); tessellator.draw(); GL11.glDepthMask(true); GL11.glEnable(GL11.GL_DEPTH_TEST); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glBlendFunc(GL11.GL_SRC_ALPHA, GL11.GL_ONE_MINUS_SRC_ALPHA); } /** * Renders the portal overlay. Args: portalStrength, width, height */ private void renderPortalOverlay(float par1, int par2, int par3) { if (par1 < 1.0F) { par1 *= par1; par1 *= par1; par1 = par1 * 0.8F + 0.2F; } GL11.glDisable(GL11.GL_ALPHA_TEST); GL11.glDisable(GL11.GL_DEPTH_TEST); GL11.glDepthMask(false); GL11.glBlendFunc(GL11.GL_SRC_ALPHA, GL11.GL_ONE_MINUS_SRC_ALPHA); GL11.glColor4f(1.0F, 1.0F, 1.0F, par1); GL11.glBindTexture(GL11.GL_TEXTURE_2D, mc.renderEngine.getTexture("/terrain.png")); float f = (float)(Block.portal.blockIndexInTexture % 16) / 16F; float f1 = (float)(Block.portal.blockIndexInTexture / 16) / 16F; float f2 = (float)(Block.portal.blockIndexInTexture % 16 + 1) / 16F; float f3 = (float)(Block.portal.blockIndexInTexture / 16 + 1) / 16F; Tessellator tessellator = Tessellator.instance; tessellator.startDrawingQuads(); tessellator.addVertexWithUV(0.0D, par3, -90D, f, f3); tessellator.addVertexWithUV(par2, par3, -90D, f2, f3); tessellator.addVertexWithUV(par2, 0.0D, -90D, f2, f1); tessellator.addVertexWithUV(0.0D, 0.0D, -90D, f, f1); tessellator.draw(); GL11.glDepthMask(true); GL11.glEnable(GL11.GL_DEPTH_TEST); GL11.glEnable(GL11.GL_ALPHA_TEST); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); } /** * Renders the specified item of the inventory slot at the specified location. Args: slot, x, y, partialTick */ private void renderInventorySlot(int par1, int par2, int par3, float par4) { ItemStack itemstack = mc.thePlayer.inventory.mainInventory[par1]; if (itemstack == null) { return; } float f = (float)itemstack.animationsToGo - par4; if (f > 0.0F) { GL11.glPushMatrix(); float f1 = 1.0F + f / 5F; GL11.glTranslatef(par2 + 8, par3 + 12, 0.0F); GL11.glScalef(1.0F / f1, (f1 + 1.0F) / 2.0F, 1.0F); GL11.glTranslatef(-(par2 + 8), -(par3 + 12), 0.0F); } itemRenderer.renderItemIntoGUI(mc.fontRenderer, mc.renderEngine, itemstack, par2, par3); if (f > 0.0F) { GL11.glPopMatrix(); } itemRenderer.renderItemOverlayIntoGUI(mc.fontRenderer, mc.renderEngine, itemstack, par2, par3); } /** * The update tick for the ingame UI */ public void updateTick() { if(Spoutcraft.getActivePlayer() != null) { Spoutcraft.getActivePlayer().getMainScreen().getChatTextBox().increaseAge(); } if (recordPlayingUpFor > 0) { recordPlayingUpFor--; } updateCounter++; } /** * Clear all chat messages. */ public void clearChatMessages() { ChatTextBox.clearChat(); } /** * Adds a chat message to the list of chat messages. Args: msg */ public void addChatMessage(String message) { /* Spout start */ if (!ConfigReader.showJoinMessages && message.toLowerCase().contains("joined the game")) { return; } String mess[] = (mc.fontRenderer.func_50113_d(message, 320)).split("\n"); for(int i=0;i<mess.length;i++) { SpoutClient.enableSandbox(); if (Spoutcraft.getActivePlayer() != null) { ChatTextBox.addChatMessage(ChatMessage.parseMessage(mess[i])); } else { ChatTextBox.addChatMessage(new ChatMessage(mess[i], mess[i])); } SpoutClient.disableSandbox(); } /* Spout end */ } // public void addChatMessage(String message) { // /* Spout start */ // if (!ConfigReader.showJoinMessages && message.toLowerCase().contains("joined the game")) { // return; // } // SpoutClient.enableSandbox(); // if (Spoutcraft.getActivePlayer() != null) { // ChatTextBox.addChatMessage(ChatMessage.parseMessage(message)); // } // else { // ChatTextBox.addChatMessage(new ChatMessage(message, message)); // } // SpoutClient.disableSandbox(); // /* Spout end */ // int i; // for (; mc.fontRenderer.getStringWidth(message) > 320; message = message.substring(i)) { // for (i = 1; i < message.length() && mc.fontRenderer.getStringWidth(message.substring(0, i + 1)) <= 320; i++) { } // addChatMessage(message.substring(0, i)); // } // } public void setRecordPlayingMessage(String par1Str) { recordPlaying = (new StringBuilder()).append("Now playing: ").append(par1Str).toString(); recordPlayingUpFor = 60; recordIsPlaying = true; } /** * Adds the string to chat message after translate it with the language file. */ public void addChatMessageTranslate(String par1Str, Object ... par2ArrayOfObj) { StringTranslate stringtranslate = StringTranslate.getInstance(); String s = stringtranslate.translateKeyFormat(par1Str, par2ArrayOfObj); addChatMessage(s); } public boolean isChatOpen() { return this.mc.currentScreen instanceof GuiChat; } public ChatClickData func_50012_a(int par1, int par2) { if (!this.isChatOpen()) { return null; } else { ScaledResolution var3 = new ScaledResolution(this.mc.gameSettings, this.mc.displayWidth, this.mc.displayHeight); int chatScroll = SpoutClient.getInstance().getChatManager().chatScroll; //don't ask, it's much better than vanilla matching though par2 = par2 / var3.getScaleFactor() - 33 - ((20 - Math.min(20, chatScroll)) / 2); par1 = par1 / var3.getScaleFactor() - 3; if (par1 >= 0 && par2 >= 0) { int var4 = Math.min(20, ChatTextBox.getNumChatMessages()); if (par1 <= 320 && par2 < this.mc.fontRenderer.FONT_HEIGHT * var4 + var4) { int var5 = par2 / (this.mc.fontRenderer.FONT_HEIGHT + 1) + chatScroll; return new ChatClickData(this.mc.fontRenderer, new ChatLine(this.mc.ingameGUI.getUpdateCounter(), ChatTextBox.getChatMessageAt(var5), par2), par1, par2 - (var5 - chatScroll) * this.mc.fontRenderer.FONT_HEIGHT + var5); } else { return null; } } else { return null; } } } public int getUpdateCounter() { return this.updateCounter++; } }
true
true
public void renderGameOverlay(float f, boolean flag, int i, int j) { SpoutClient.getInstance().onTick(); InGameHUD mainScreen = SpoutClient.getInstance().getActivePlayer().getMainScreen(); ScaledResolution scaledRes = new ScaledResolution(this.mc.gameSettings, this.mc.displayWidth, this.mc.displayHeight); int screenWidth = scaledRes.getScaledWidth(); int screenHeight = scaledRes.getScaledHeight(); FontRenderer font = this.mc.fontRenderer; this.mc.entityRenderer.setupOverlayRendering(); GL11.glEnable(3042 /*GL_BLEND*/); if(Minecraft.isFancyGraphicsEnabled()) { this.renderVignette(this.mc.thePlayer.getBrightness(f), screenWidth, screenHeight); } ItemStack helmet = this.mc.thePlayer.inventory.armorItemInSlot(3); if(this.mc.gameSettings.thirdPersonView == 0 && helmet != null && helmet.itemID == Block.pumpkin.blockID) { this.renderPumpkinBlur(screenWidth, screenHeight); } if(!this.mc.thePlayer.isPotionActive(Potion.confusion)) { float var10 = this.mc.thePlayer.prevTimeInPortal + (this.mc.thePlayer.timeInPortal - this.mc.thePlayer.prevTimeInPortal) * f; if(var10 > 0.0F) { this.renderPortalOverlay(var10, screenWidth, screenHeight); } } GL11.glBlendFunc(770, 771); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glBindTexture(3553 /* GL_TEXTURE_2D */, this.mc.renderEngine.getTexture("/gui/gui.png")); InventoryPlayer var11 = this.mc.thePlayer.inventory; this.zLevel = -90.0F; this.drawTexturedModalRect(screenWidth / 2 - 91, screenHeight - 22, 0, 0, 182, 22); this.drawTexturedModalRect(screenWidth / 2 - 91 - 1 + var11.currentItem * 20, screenHeight - 22 - 1, 0, 22, 24, 22); GL11.glBindTexture(3553 /* GL_TEXTURE_2D */, this.mc.renderEngine.getTexture("/gui/icons.png")); GL11.glEnable(3042 /* GL_BLEND */); GL11.glBlendFunc(775, 769); this.drawTexturedModalRect(screenWidth / 2 - 7, screenHeight / 2 - 7, 0, 0, 16, 16); GL11.glDisable(3042 /* GL_BLEND */); GuiIngame.rand.setSeed((long) (this.updateCounter * 312871)); int var15; int var17; this.renderBossHealth(); //better safe than sorry SpoutClient.enableSandbox(); //Toggle visibility if needed if(mainScreen.getHealthBar().isVisible() == mc.playerController.isInCreativeMode()) { mainScreen.toggleSurvivalHUD(!mc.playerController.isInCreativeMode()); } // Hunger Bar Begin mainScreen.getHungerBar().render(); // Hunger Bar End // Armor Bar Begin mainScreen.getArmorBar().render(); // Armor Bar End // Health Bar Begin mainScreen.getHealthBar().render(); // Health Bar End // Bubble Bar Begin mainScreen.getBubbleBar().render(); // Bubble Bar End // Exp Bar Begin mainScreen.getExpBar().render(); // Exp Bar End SpoutClient.disableSandbox(); map.onRenderTick(); GL11.glDisable(3042 /* GL_BLEND */); GL11.glEnable('\u803a'); GL11.glPushMatrix(); GL11.glRotatef(120.0F, 1.0F, 0.0F, 0.0F); RenderHelper.enableStandardItemLighting(); GL11.glPopMatrix(); for (var15 = 0; var15 < 9; ++var15) { int x = screenWidth / 2 - 90 + var15 * 20 + 2; var17 = screenHeight - 16 - 3; this.renderInventorySlot(var15, x, var17, f); } RenderHelper.disableStandardItemLighting(); GL11.glDisable('\u803a'); if (this.mc.thePlayer.getSleepTimer() > 0) { GL11.glDisable(2929 /*GL_DEPTH_TEST*/); GL11.glDisable(3008 /*GL_ALPHA_TEST*/); var15 = this.mc.thePlayer.getSleepTimer(); float var26 = (float)var15 / 100.0F; if(var26 > 1.0F) { var26 = 1.0F - (float)(var15 - 100) / 10.0F; } var17 = (int)(220.0F * var26) << 24 | 1052704; this.drawRect(0, 0, screenWidth, screenHeight, var17); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); GL11.glEnable(2929 /*GL_DEPTH_TEST*/); } SpoutClient.enableSandbox(); mainScreen.render(); SpoutClient.disableSandbox(); if (this.mc.gameSettings.showDebugInfo) { this.mc.mcProfiler.startSection("debug"); GL11.glPushMatrix(); font.drawStringWithShadow("Minecraft 1.3.2 (" + this.mc.debug + ")", 2, 2, 16777215); font.drawStringWithShadow(this.mc.debugInfoRenders(), 2, 12, 16777215); font.drawStringWithShadow(this.mc.getEntityDebug(), 2, 22, 16777215); font.drawStringWithShadow(this.mc.debugInfoEntities(), 2, 32, 16777215); font.drawStringWithShadow(this.mc.getWorldProviderName(), 2, 42, 16777215); long var41 = Runtime.getRuntime().maxMemory(); long var34 = Runtime.getRuntime().totalMemory(); long var42 = Runtime.getRuntime().freeMemory(); long var43 = var34 - var42; String var45 = "Used memory: " + var43 * 100L / var41 + "% (" + var43 / 1024L / 1024L + "MB) of " + var41 / 1024L / 1024L + "MB"; this.drawString(font, var45, screenWidth - font.getStringWidth(var45) - 2, 2, 14737632); var45 = "Allocated memory: " + var34 * 100L / var41 + "% (" + var34 / 1024L / 1024L + "MB)"; this.drawString(font, var45, screenWidth - font.getStringWidth(var45) - 2, 12, 14737632); if(!(SpoutClient.getInstance().isCoordsCheat())) { this.drawString(font, String.format("x: %.5f", new Object[] {Double.valueOf(this.mc.thePlayer.posX)}), 2, 64, 14737632); this.drawString(font, String.format("y: %.3f (feet pos, %.3f eyes pos)", new Object[] {Double.valueOf(this.mc.thePlayer.boundingBox.minY), Double.valueOf(this.mc.thePlayer.posY)}), 2, 72, 14737632); this.drawString(font, String.format("z: %.5f", new Object[] {Double.valueOf(this.mc.thePlayer.posZ)}), 2, 80, 14737632); this.drawString(font, "f: " + (MathHelper.floor_double((double)(this.mc.thePlayer.rotationYaw * 4.0F / 360.0F) + 0.5D) & 3), 2, 88, 14737632); } int var47 = MathHelper.floor_double(this.mc.thePlayer.posX); int var22 = MathHelper.floor_double(this.mc.thePlayer.posY); int var233 = MathHelper.floor_double(this.mc.thePlayer.posZ); if (this.mc.theWorld != null && this.mc.theWorld.blockExists(var47, var22, var233)) { Chunk var48 = this.mc.theWorld.getChunkFromBlockCoords(var47, var233); this.drawString(font, "lc: " + (var48.getTopFilledSegment() + 15) + " b: " + var48.getBiomeGenForWorldCoords(var47 & 15, var233 & 15, this.mc.theWorld.getWorldChunkManager()).biomeName + " bl: " + var48.getSavedLightValue(EnumSkyBlock.Block, var47 & 15, var22, var233 & 15) + " sl: " + var48.getSavedLightValue(EnumSkyBlock.Sky, var47 & 15, var22, var233 & 15) + " rl: " + var48.getBlockLightValue(var47 & 15, var22, var233 & 15, 0), 2, 96, 14737632); } this.drawString(font, String.format("ws: %.3f, fs: %.3f, g: %b", new Object[] {Float.valueOf(this.mc.thePlayer.capabilities.getWalkSpeed()), Float.valueOf(this.mc.thePlayer.capabilities.getFlySpeed()), Boolean.valueOf(this.mc.thePlayer.onGround)}), 2, 104, 14737632); GL11.glPopMatrix(); this.mc.mcProfiler.endSection(); } if(this.recordPlayingUpFor > 0) { float var24 = (float)this.recordPlayingUpFor - f; int fontColor = (int)(var24 * 256.0F / 20.0F); if(fontColor > 255) { fontColor = 255; } if(fontColor > 0) { GL11.glPushMatrix(); GL11.glTranslatef((float)(screenWidth / 2), (float)(screenHeight - 48), 0.0F); GL11.glEnable(3042 /*GL_BLEND*/); GL11.glBlendFunc(770, 771); var17 = 16777215; if(this.recordIsPlaying) { var17 = java.awt.Color.HSBtoRGB(var24 / 50.0F, 0.7F, 0.6F) & 16777215; } font.drawString(this.recordPlaying, -font.getStringWidth(this.recordPlaying) / 2, -4, var17 + (fontColor << 24)); GL11.glDisable(3042 /*GL_BLEND*/); GL11.glPopMatrix(); } } SpoutClient.enableSandbox(); //boolean chatOpen = mainScreen.getChatBar().isVisible() && mc.currentScreen instanceof GuiChat; //int lines = chatOpen ? mainScreen.getChatTextBox().getNumVisibleChatLines() : mainScreen.getChatTextBox().getNumVisibleLines(); // GL11.glEnable(3042 /*GL_BLEND*/); // GL11.glBlendFunc(770, 771); // GL11.glDisable(3008 /*GL_ALPHA_TEST*/); ChatTextBox chatTextWidget = mainScreen.getChatTextBox(); GL11.glPushMatrix(); boolean chatOpen = mainScreen.getChatBar().isVisible() && mc.currentScreen instanceof GuiChat; if (chatTextWidget.isVisible() || chatOpen) { chatTextWidget.setChatOpen(chatOpen); chatTextWidget.render(); } GL11.glPopMatrix(); // if (chatTextWidget.isVisible()) { // int viewedLine = 0; // for (int line = SpoutClient.getInstance().getChatManager().chatScroll; line < Math.min(chatMessageList.size(), (lines + SpoutClient.getInstance().getChatManager().chatScroll)); line++) { // if (chatOpen || chatMessageList.get(line).updateCounter < chatTextWidget.getFadeoutTicks()) { // double opacity = 1.0D - chatMessageList.get(line).updateCounter / (double)chatTextWidget.getFadeoutTicks(); // opacity *= 10D; // if(opacity < 0.0D) { // opacity = 0.0D; // } // if(opacity > 1.0D) { // opacity = 1.0D; // } // opacity *= opacity; // int color = chatOpen ? 255 : (int)(255D * opacity); // if (color > 0) { // int x = 2 + chatTextWidget.getX(); // int y = chatTextWidget.getY() + (-viewedLine * 9); // String chat = chatMessageList.get(line).message; // chat = SpoutClient.getInstance().getChatManager().formatChatColors(chat); // // boolean mentioned = false; // if (ConfigReader.highlightMentions) { // String[] split = chat.toLowerCase().split(":"); // if (split.length == 1) { // split = chat.toLowerCase().split(">"); // } // if (split.length > 1) { // String name = this.mc.thePlayer.username.toLowerCase(); // if (!split[0].contains(name)) { // for (int part = 1; part < split.length; part++) { // if (split[part].contains(name)) { // mentioned = true; // break; // } // } // } // } // } // // if (mentioned) { // drawRect(x, y - 1, x + 320, y + 8, RED); // } // else { // drawRect(x, y - 1, x + 320, y + 8, color / 2 << 24); // } // GL11.glEnable(3042 /*GL_BLEND*/); // font.drawStringWithShadow(chat, x, y, 0xffffff + (color << 24)); // } // viewedLine++; // } // } // } SpoutClient.disableSandbox(); ServerPlayerList playerList = mainScreen.getServerPlayerList(); if(this.mc.thePlayer instanceof EntityClientPlayerMP && this.mc.gameSettings.keyBindPlayerList.pressed && playerList.isVisible()) { NetClientHandler var41 = ((EntityClientPlayerMP)this.mc.thePlayer).sendQueue; List var44 = var41.playerInfoList; int var40 = var41.currentServerMaxPlayers; int var38 = var40; int var16; for(var16 = 1; var38 > 20; var38 = (var40 + var16 - 1) / var16) { ++var16; } var17 = 300 / var16; if(var17 > 150) { var17 = 150; } int var18 = (screenWidth - var16 * var17) / 2; byte var46 = 10; this.drawRect(var18 - 1, var46 - 1, var18 + var17 * var16, var46 + 9 * var38, Integer.MIN_VALUE); for(int var20 = 0; var20 < var40; ++var20) { int var47 = var18 + var20 % var16 * var17; int var22 = var46 + var20 / var16 * 9; this.drawRect(var47, var22, var47 + var17 - 1, var22 + 8, 553648127); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); if(var20 < var44.size()) { GuiPlayerInfo var50 = (GuiPlayerInfo)var44.get(var20); font.drawStringWithShadow(var50.name, var47, var22, 16777215); this.mc.renderEngine.bindTexture(this.mc.renderEngine.getTexture("/gui/icons.png")); boolean var48 = false; boolean var53 = false; byte var49 = 0; var53 = false; byte var54; if(var50.responseTime < 0) { var54 = 5; } else if(var50.responseTime < 150) { var54 = 0; } else if(var50.responseTime < 300) { var54 = 1; } else if(var50.responseTime < 600) { var54 = 2; } else if(var50.responseTime < 1000) { var54 = 3; } else { var54 = 4; } this.zLevel += 100.0F; this.drawTexturedModalRect(var47 + var17 - 12, var22, 0 + var49 * 10, 176 + var54 * 8, 10, 8); this.zLevel -= 100.0F; } } } GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glDisable(2896 /*GL_LIGHTING*/); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); GL11.glDisable(3042 /*GL_BLEND*/); }
public void renderGameOverlay(float f, boolean flag, int i, int j) { SpoutClient.getInstance().onTick(); InGameHUD mainScreen = SpoutClient.getInstance().getActivePlayer().getMainScreen(); ScaledResolution scaledRes = new ScaledResolution(this.mc.gameSettings, this.mc.displayWidth, this.mc.displayHeight); int screenWidth = scaledRes.getScaledWidth(); int screenHeight = scaledRes.getScaledHeight(); FontRenderer font = this.mc.fontRenderer; this.mc.entityRenderer.setupOverlayRendering(); GL11.glEnable(3042 /*GL_BLEND*/); if(Minecraft.isFancyGraphicsEnabled()) { this.renderVignette(this.mc.thePlayer.getBrightness(f), screenWidth, screenHeight); } ItemStack helmet = this.mc.thePlayer.inventory.armorItemInSlot(3); if(this.mc.gameSettings.thirdPersonView == 0 && helmet != null && helmet.itemID == Block.pumpkin.blockID) { this.renderPumpkinBlur(screenWidth, screenHeight); } if(!this.mc.thePlayer.isPotionActive(Potion.confusion)) { float var10 = this.mc.thePlayer.prevTimeInPortal + (this.mc.thePlayer.timeInPortal - this.mc.thePlayer.prevTimeInPortal) * f; if(var10 > 0.0F) { this.renderPortalOverlay(var10, screenWidth, screenHeight); } } GL11.glBlendFunc(770, 771); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glBindTexture(3553 /* GL_TEXTURE_2D */, this.mc.renderEngine.getTexture("/gui/gui.png")); InventoryPlayer var11 = this.mc.thePlayer.inventory; this.zLevel = -90.0F; this.drawTexturedModalRect(screenWidth / 2 - 91, screenHeight - 22, 0, 0, 182, 22); this.drawTexturedModalRect(screenWidth / 2 - 91 - 1 + var11.currentItem * 20, screenHeight - 22 - 1, 0, 22, 24, 22); GL11.glBindTexture(3553 /* GL_TEXTURE_2D */, this.mc.renderEngine.getTexture("/gui/icons.png")); GL11.glEnable(3042 /* GL_BLEND */); GL11.glBlendFunc(775, 769); this.drawTexturedModalRect(screenWidth / 2 - 7, screenHeight / 2 - 7, 0, 0, 16, 16); GL11.glDisable(3042 /* GL_BLEND */); GuiIngame.rand.setSeed((long) (this.updateCounter * 312871)); int var15; int var17; this.renderBossHealth(); //better safe than sorry SpoutClient.enableSandbox(); //Toggle visibility if needed if(mainScreen.getHealthBar().isVisible() == mc.playerController.isInCreativeMode()) { mainScreen.toggleSurvivalHUD(!mc.playerController.isInCreativeMode()); } // Hunger Bar Begin mainScreen.getHungerBar().render(); // Hunger Bar End // Armor Bar Begin mainScreen.getArmorBar().render(); // Armor Bar End // Health Bar Begin mainScreen.getHealthBar().render(); // Health Bar End // Bubble Bar Begin mainScreen.getBubbleBar().render(); // Bubble Bar End // Exp Bar Begin mainScreen.getExpBar().render(); // Exp Bar End SpoutClient.disableSandbox(); map.onRenderTick(); GL11.glDisable(3042 /* GL_BLEND */); GL11.glEnable('\u803a'); GL11.glPushMatrix(); GL11.glRotatef(120.0F, 1.0F, 0.0F, 0.0F); RenderHelper.enableStandardItemLighting(); GL11.glPopMatrix(); for (var15 = 0; var15 < 9; ++var15) { int x = screenWidth / 2 - 90 + var15 * 20 + 2; var17 = screenHeight - 16 - 3; this.renderInventorySlot(var15, x, var17, f); } RenderHelper.disableStandardItemLighting(); GL11.glDisable('\u803a'); if (this.mc.thePlayer.getSleepTimer() > 0) { GL11.glDisable(2929 /*GL_DEPTH_TEST*/); GL11.glDisable(3008 /*GL_ALPHA_TEST*/); var15 = this.mc.thePlayer.getSleepTimer(); float var26 = (float)var15 / 100.0F; if(var26 > 1.0F) { var26 = 1.0F - (float)(var15 - 100) / 10.0F; } var17 = (int)(220.0F * var26) << 24 | 1052704; this.drawRect(0, 0, screenWidth, screenHeight, var17); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); GL11.glEnable(2929 /*GL_DEPTH_TEST*/); } SpoutClient.enableSandbox(); mainScreen.render(); SpoutClient.disableSandbox(); if (this.mc.gameSettings.showDebugInfo) { this.mc.mcProfiler.startSection("debug"); GL11.glPushMatrix(); font.drawStringWithShadow("Minecraft 1.3.2 (" + this.mc.debug + ")", 2, 2, 16777215); font.drawStringWithShadow(this.mc.debugInfoRenders(), 2, 12, 16777215); font.drawStringWithShadow(this.mc.getEntityDebug(), 2, 22, 16777215); font.drawStringWithShadow(this.mc.debugInfoEntities(), 2, 32, 16777215); font.drawStringWithShadow(this.mc.getWorldProviderName(), 2, 42, 16777215); long var41 = Runtime.getRuntime().maxMemory(); long var34 = Runtime.getRuntime().totalMemory(); long var42 = Runtime.getRuntime().freeMemory(); long var43 = var34 - var42; String var45 = "Used memory: " + var43 * 100L / var41 + "% (" + var43 / 1024L / 1024L + "MB) of " + var41 / 1024L / 1024L + "MB"; this.drawString(font, var45, screenWidth - font.getStringWidth(var45) - 2, 2, 14737632); var45 = "Allocated memory: " + var34 * 100L / var41 + "% (" + var34 / 1024L / 1024L + "MB)"; this.drawString(font, var45, screenWidth - font.getStringWidth(var45) - 2, 12, 14737632); if(SpoutClient.getInstance().isCoordsCheat()) { this.drawString(font, String.format("x: %.5f", new Object[] {Double.valueOf(this.mc.thePlayer.posX)}), 2, 64, 14737632); this.drawString(font, String.format("y: %.3f (feet pos, %.3f eyes pos)", new Object[] {Double.valueOf(this.mc.thePlayer.boundingBox.minY), Double.valueOf(this.mc.thePlayer.posY)}), 2, 72, 14737632); this.drawString(font, String.format("z: %.5f", new Object[] {Double.valueOf(this.mc.thePlayer.posZ)}), 2, 80, 14737632); this.drawString(font, "f: " + (MathHelper.floor_double((double)(this.mc.thePlayer.rotationYaw * 4.0F / 360.0F) + 0.5D) & 3), 2, 88, 14737632); } int var47 = MathHelper.floor_double(this.mc.thePlayer.posX); int var22 = MathHelper.floor_double(this.mc.thePlayer.posY); int var233 = MathHelper.floor_double(this.mc.thePlayer.posZ); if (this.mc.theWorld != null && this.mc.theWorld.blockExists(var47, var22, var233)) { Chunk var48 = this.mc.theWorld.getChunkFromBlockCoords(var47, var233); this.drawString(font, "lc: " + (var48.getTopFilledSegment() + 15) + " b: " + var48.getBiomeGenForWorldCoords(var47 & 15, var233 & 15, this.mc.theWorld.getWorldChunkManager()).biomeName + " bl: " + var48.getSavedLightValue(EnumSkyBlock.Block, var47 & 15, var22, var233 & 15) + " sl: " + var48.getSavedLightValue(EnumSkyBlock.Sky, var47 & 15, var22, var233 & 15) + " rl: " + var48.getBlockLightValue(var47 & 15, var22, var233 & 15, 0), 2, 96, 14737632); } this.drawString(font, String.format("ws: %.3f, fs: %.3f, g: %b", new Object[] {Float.valueOf(this.mc.thePlayer.capabilities.getWalkSpeed()), Float.valueOf(this.mc.thePlayer.capabilities.getFlySpeed()), Boolean.valueOf(this.mc.thePlayer.onGround)}), 2, 104, 14737632); GL11.glPopMatrix(); this.mc.mcProfiler.endSection(); } if(this.recordPlayingUpFor > 0) { float var24 = (float)this.recordPlayingUpFor - f; int fontColor = (int)(var24 * 256.0F / 20.0F); if(fontColor > 255) { fontColor = 255; } if(fontColor > 0) { GL11.glPushMatrix(); GL11.glTranslatef((float)(screenWidth / 2), (float)(screenHeight - 48), 0.0F); GL11.glEnable(3042 /*GL_BLEND*/); GL11.glBlendFunc(770, 771); var17 = 16777215; if(this.recordIsPlaying) { var17 = java.awt.Color.HSBtoRGB(var24 / 50.0F, 0.7F, 0.6F) & 16777215; } font.drawString(this.recordPlaying, -font.getStringWidth(this.recordPlaying) / 2, -4, var17 + (fontColor << 24)); GL11.glDisable(3042 /*GL_BLEND*/); GL11.glPopMatrix(); } } SpoutClient.enableSandbox(); //boolean chatOpen = mainScreen.getChatBar().isVisible() && mc.currentScreen instanceof GuiChat; //int lines = chatOpen ? mainScreen.getChatTextBox().getNumVisibleChatLines() : mainScreen.getChatTextBox().getNumVisibleLines(); // GL11.glEnable(3042 /*GL_BLEND*/); // GL11.glBlendFunc(770, 771); // GL11.glDisable(3008 /*GL_ALPHA_TEST*/); ChatTextBox chatTextWidget = mainScreen.getChatTextBox(); GL11.glPushMatrix(); boolean chatOpen = mainScreen.getChatBar().isVisible() && mc.currentScreen instanceof GuiChat; if (chatTextWidget.isVisible() || chatOpen) { chatTextWidget.setChatOpen(chatOpen); chatTextWidget.render(); } GL11.glPopMatrix(); // if (chatTextWidget.isVisible()) { // int viewedLine = 0; // for (int line = SpoutClient.getInstance().getChatManager().chatScroll; line < Math.min(chatMessageList.size(), (lines + SpoutClient.getInstance().getChatManager().chatScroll)); line++) { // if (chatOpen || chatMessageList.get(line).updateCounter < chatTextWidget.getFadeoutTicks()) { // double opacity = 1.0D - chatMessageList.get(line).updateCounter / (double)chatTextWidget.getFadeoutTicks(); // opacity *= 10D; // if(opacity < 0.0D) { // opacity = 0.0D; // } // if(opacity > 1.0D) { // opacity = 1.0D; // } // opacity *= opacity; // int color = chatOpen ? 255 : (int)(255D * opacity); // if (color > 0) { // int x = 2 + chatTextWidget.getX(); // int y = chatTextWidget.getY() + (-viewedLine * 9); // String chat = chatMessageList.get(line).message; // chat = SpoutClient.getInstance().getChatManager().formatChatColors(chat); // // boolean mentioned = false; // if (ConfigReader.highlightMentions) { // String[] split = chat.toLowerCase().split(":"); // if (split.length == 1) { // split = chat.toLowerCase().split(">"); // } // if (split.length > 1) { // String name = this.mc.thePlayer.username.toLowerCase(); // if (!split[0].contains(name)) { // for (int part = 1; part < split.length; part++) { // if (split[part].contains(name)) { // mentioned = true; // break; // } // } // } // } // } // // if (mentioned) { // drawRect(x, y - 1, x + 320, y + 8, RED); // } // else { // drawRect(x, y - 1, x + 320, y + 8, color / 2 << 24); // } // GL11.glEnable(3042 /*GL_BLEND*/); // font.drawStringWithShadow(chat, x, y, 0xffffff + (color << 24)); // } // viewedLine++; // } // } // } SpoutClient.disableSandbox(); ServerPlayerList playerList = mainScreen.getServerPlayerList(); if(this.mc.thePlayer instanceof EntityClientPlayerMP && this.mc.gameSettings.keyBindPlayerList.pressed && playerList.isVisible()) { NetClientHandler var41 = ((EntityClientPlayerMP)this.mc.thePlayer).sendQueue; List var44 = var41.playerInfoList; int var40 = var41.currentServerMaxPlayers; int var38 = var40; int var16; for(var16 = 1; var38 > 20; var38 = (var40 + var16 - 1) / var16) { ++var16; } var17 = 300 / var16; if(var17 > 150) { var17 = 150; } int var18 = (screenWidth - var16 * var17) / 2; byte var46 = 10; this.drawRect(var18 - 1, var46 - 1, var18 + var17 * var16, var46 + 9 * var38, Integer.MIN_VALUE); for(int var20 = 0; var20 < var40; ++var20) { int var47 = var18 + var20 % var16 * var17; int var22 = var46 + var20 / var16 * 9; this.drawRect(var47, var22, var47 + var17 - 1, var22 + 8, 553648127); GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); if(var20 < var44.size()) { GuiPlayerInfo var50 = (GuiPlayerInfo)var44.get(var20); font.drawStringWithShadow(var50.name, var47, var22, 16777215); this.mc.renderEngine.bindTexture(this.mc.renderEngine.getTexture("/gui/icons.png")); boolean var48 = false; boolean var53 = false; byte var49 = 0; var53 = false; byte var54; if(var50.responseTime < 0) { var54 = 5; } else if(var50.responseTime < 150) { var54 = 0; } else if(var50.responseTime < 300) { var54 = 1; } else if(var50.responseTime < 600) { var54 = 2; } else if(var50.responseTime < 1000) { var54 = 3; } else { var54 = 4; } this.zLevel += 100.0F; this.drawTexturedModalRect(var47 + var17 - 12, var22, 0 + var49 * 10, 176 + var54 * 8, 10, 8); this.zLevel -= 100.0F; } } } GL11.glColor4f(1.0F, 1.0F, 1.0F, 1.0F); GL11.glDisable(2896 /*GL_LIGHTING*/); GL11.glEnable(3008 /*GL_ALPHA_TEST*/); GL11.glDisable(3042 /*GL_BLEND*/); }
diff --git a/hazelcast/src/main/java/com/hazelcast/impl/ListenerManager.java b/hazelcast/src/main/java/com/hazelcast/impl/ListenerManager.java index 96cad276..07357450 100644 --- a/hazelcast/src/main/java/com/hazelcast/impl/ListenerManager.java +++ b/hazelcast/src/main/java/com/hazelcast/impl/ListenerManager.java @@ -1,400 +1,403 @@ /* * Copyright (c) 2008-2010, Hazel Ltd. All Rights Reserved. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. * */ package com.hazelcast.impl; import com.hazelcast.cluster.AbstractRemotelyProcessable; import com.hazelcast.core.*; import com.hazelcast.impl.base.PacketProcessor; import com.hazelcast.nio.Address; import com.hazelcast.nio.Data; import com.hazelcast.nio.DataSerializable; import com.hazelcast.nio.Packet; import java.io.DataInput; import java.io.DataOutput; import java.io.IOException; import java.util.Iterator; import java.util.List; import java.util.concurrent.CopyOnWriteArrayList; import java.util.logging.Level; import static com.hazelcast.impl.ClusterOperation.*; import static com.hazelcast.nio.IOUtil.toData; public class ListenerManager extends BaseManager { private List<ListenerItem> listeners = new CopyOnWriteArrayList<ListenerItem>(); ListenerManager(Node node) { super(node); registerPacketProcessor(ClusterOperation.EVENT, new PacketProcessor() { public void process(Packet packet) { handleEvent(packet); } }); registerPacketProcessor(ADD_LISTENER, new AddRemoveListenerOperationHandler()); registerPacketProcessor(REMOVE_LISTENER, new AddRemoveListenerOperationHandler()); registerPacketProcessor(ADD_LISTENER_NO_RESPONSE, new PacketProcessor() { public void process(Packet packet) { handleAddRemoveListener(true, packet); } }); } private void handleEvent(Packet packet) { int eventType = (int) packet.longValue; Data key = packet.key; Data value = packet.value; String name = packet.name; Address from = packet.conn.getEndPoint(); releasePacket(packet); enqueueEvent(eventType, name, key, value, from); } private void handleAddRemoveListener(boolean add, Packet packet) { Data key = (packet.key != null) ? packet.key : null; boolean returnValue = (packet.longValue == 1); String name = packet.name; Address address = packet.conn.getEndPoint(); releasePacket(packet); handleListenerRegistrations(add, name, key, address, returnValue); } public void syncForDead(Address deadAddress) { syncForAdd(); } public void syncForAdd() { for (ListenerItem listenerItem : listeners) { registerListenerWithNoResponse(listenerItem.name, listenerItem.key, listenerItem.includeValue); } } public void syncForAdd(Address newAddress) { for (ListenerItem listenerItem : listeners) { Data dataKey = null; if (listenerItem.key != null) { dataKey = ThreadContext.get().toData(listenerItem.key); } sendAddListener(newAddress, listenerItem.name, dataKey, listenerItem.includeValue); } } class AddRemoveListenerOperationHandler extends TargetAwareOperationHandler { boolean isRightRemoteTarget(Request request) { return (null == request.key) || thisAddress.equals(getKeyOwner(request.key)); } void doOperation(Request request) { Address from = request.caller; logger.log(Level.FINEST, "AddListenerOperation from " + from + ", local=" + request.local + " key:" + request.key + " op:" + request.operation); if (from == null) throw new RuntimeException("Listener origin is not known!"); boolean add = (request.operation == ADD_LISTENER); boolean includeValue = (request.longValue == 1); handleListenerRegistrations(add, request.name, request.key, request.caller, includeValue); request.response = Boolean.TRUE; } } public class AddRemoveListener extends MultiCall<Boolean> { final String name; final boolean add; final boolean includeValue; public AddRemoveListener(String name, boolean add, boolean includeValue) { this.name = name; this.add = add; this.includeValue = includeValue; } TargetAwareOp createNewTargetAwareOp(Address target) { return new AddListenerAtTarget(target); } boolean onResponse(Object response) { return true; } Object returnResult() { return Boolean.TRUE; } class AddListenerAtTarget extends TargetAwareOp { public AddListenerAtTarget(Address target) { request.reset(); this.target = target; ClusterOperation operation = (add) ? ADD_LISTENER : REMOVE_LISTENER; setLocal(operation, name, null, null, -1, -1); request.setBooleanRequest(); request.longValue = (includeValue) ? 1 : 0; } @Override public void setTarget() { } } } private void registerListener(String name, Object key, boolean add, boolean includeValue) { if (key == null) { AddRemoveListener addRemoveListener = new AddRemoveListener(name, add, includeValue); addRemoveListener.call(); } else { node.concurrentMapManager.new MAddKeyListener().addListener(name, add, key, includeValue); } } private void registerListenerWithNoResponse(String name, Object key, boolean includeValue) { Data dataKey = null; if (key != null) { dataKey = ThreadContext.get().toData(key); } enqueueAndReturn(new ListenerRegistrationProcess(name, dataKey, includeValue)); } final class ListenerRegistrationProcess implements Processable { final String name; final Data key; final boolean includeValue; public ListenerRegistrationProcess(String name, Data key, boolean includeValue) { super(); this.key = key; this.name = name; this.includeValue = includeValue; } public void process() { if (key != null) { processWithKey(); } else { processWithoutKey(); } } private void processWithKey() { Address owner = node.concurrentMapManager.getKeyOwner(key); if (owner.equals(thisAddress)) { handleListenerRegistrations(true, name, key, thisAddress, includeValue); } else { Packet packet = obtainPacket(); packet.set(name, ADD_LISTENER_NO_RESPONSE, key, null); packet.longValue = (includeValue) ? 1 : 0; boolean sent = send(packet, owner); if (!sent) { releasePacket(packet); } } } private void processWithoutKey() { for (MemberImpl member : lsMembers) { if (member.localMember()) { handleListenerRegistrations(true, name, null, thisAddress, includeValue); } else { sendAddListener(member.getAddress(), name, null, includeValue); } } } } public void collectInitialProcess(List<AbstractRemotelyProcessable> lsProcessables) { for (ListenerItem listenerItem : listeners) { lsProcessables.add(listenerItem); } } void sendAddListener(Address toAddress, String name, Data key, boolean includeValue) { Packet packet = obtainPacket(); packet.set(name, ClusterOperation.ADD_LISTENER_NO_RESPONSE, key, null); packet.longValue = (includeValue) ? 1 : 0; boolean sent = send(packet, toAddress); if (!sent) { releasePacket(packet); } } public void addListener(String name, Object listener, Object key, boolean includeValue, Instance.InstanceType instanceType) { /** * check if already registered send this lockAddress to the key owner as a * listener add this listener to the local listeners map */ boolean remotelyRegister = true; for (ListenerItem listenerItem : listeners) { if (remotelyRegister) { if (listenerItem.listener == listener) { if (listenerItem.name.equals(name)) { if (key == null) { if (listenerItem.key == null) { if (!includeValue || listenerItem.includeValue == includeValue) { remotelyRegister = false; } } } else { if (listenerItem.key != null) { if (listenerItem.key.equals(key)) { if (!includeValue || listenerItem.includeValue == includeValue) { remotelyRegister = false; } } } } } } } } if (remotelyRegister) { registerListener(name, key, true, includeValue); } ListenerItem listenerItem = new ListenerItem(name, key, listener, includeValue, instanceType); listeners.add(listenerItem); } public synchronized void removeListener(String name, Object listener, Object key) { /** * send this lockAddress to the key owner as a listener add this listener to * the local listeners map */ Iterator<ListenerItem> it = listeners.iterator(); for (; it.hasNext();) { ListenerItem listenerItem = it.next(); if (listener == listenerItem.listener) { if (key == null) { if (listenerItem.key == null) { registerListener(name, null, false, false); listeners.remove(listenerItem); } } else if (key.equals(listenerItem.key)) { registerListener(name, key, false, false); listeners.remove(listenerItem); } } } } void callListeners(EventTask event) { for (ListenerItem listenerItem : listeners) { if (listenerItem.listens(event)) { callListener(listenerItem, event); } } } private void callListener(ListenerItem listenerItem, EntryEvent event) { Object listener = listenerItem.listener; EntryEventType entryEventType = event.getEventType(); if (listenerItem.instanceType == Instance.InstanceType.MAP) { if (!listenerItem.name.startsWith("c:__hz_")) { - MProxy mProxy = (MProxy) node.factory.getOrCreateProxyByName(listenerItem.name); - mProxy.getMapOperationStats().incrementReceivedEvents(); + Object proxy = node.factory.getOrCreateProxyByName(listenerItem.name); + if (proxy instanceof MProxy) { + MProxy mProxy = (MProxy) proxy; + mProxy.getMapOperationStats().incrementReceivedEvents(); + } } } switch (listenerItem.instanceType) { case MAP: case MULTIMAP: EntryListener entryListener = (EntryListener) listener; switch (entryEventType) { case ADDED: entryListener.entryAdded(event); break; case REMOVED: entryListener.entryRemoved(event); break; case UPDATED: entryListener.entryUpdated(event); break; case EVICTED: entryListener.entryEvicted(event); break; } break; case SET: case LIST: ItemListener itemListener = (ItemListener) listener; switch (entryEventType) { case ADDED: itemListener.itemAdded(event.getKey()); break; case REMOVED: itemListener.itemRemoved(event.getKey()); break; } break; case TOPIC: MessageListener messageListener = (MessageListener) listener; messageListener.onMessage(event.getValue()); break; case QUEUE: ItemListener queueItemListener = (ItemListener) listener; switch (entryEventType) { case ADDED: queueItemListener.itemAdded(event.getValue()); break; case REMOVED: queueItemListener.itemRemoved(event.getValue()); break; } break; } } public static class ListenerItem extends AbstractRemotelyProcessable implements DataSerializable { public String name; public Object key; public Object listener; public boolean includeValue; public Instance.InstanceType instanceType; public ListenerItem() { } public ListenerItem(String name, Object key, Object listener, boolean includeValue, Instance.InstanceType instanceType) { super(); this.key = key; this.listener = listener; this.name = name; this.includeValue = includeValue; this.instanceType = instanceType; } public boolean listens(EventTask event) { String name = event.getName(); return this.name.equals(name) && (this.key == null || event.getKey().equals(this.key)); } public void writeData(DataOutput out) throws IOException { out.writeUTF(name); writeObject(out, key); out.writeBoolean(includeValue); } public void readData(DataInput in) throws IOException { name = in.readUTF(); key = readObject(in); includeValue = in.readBoolean(); } public void process() { getNode().listenerManager.handleListenerRegistrations(true, name, toData(key), getConnection().getEndPoint(), includeValue); } } }
true
true
private void callListener(ListenerItem listenerItem, EntryEvent event) { Object listener = listenerItem.listener; EntryEventType entryEventType = event.getEventType(); if (listenerItem.instanceType == Instance.InstanceType.MAP) { if (!listenerItem.name.startsWith("c:__hz_")) { MProxy mProxy = (MProxy) node.factory.getOrCreateProxyByName(listenerItem.name); mProxy.getMapOperationStats().incrementReceivedEvents(); } } switch (listenerItem.instanceType) { case MAP: case MULTIMAP: EntryListener entryListener = (EntryListener) listener; switch (entryEventType) { case ADDED: entryListener.entryAdded(event); break; case REMOVED: entryListener.entryRemoved(event); break; case UPDATED: entryListener.entryUpdated(event); break; case EVICTED: entryListener.entryEvicted(event); break; } break; case SET: case LIST: ItemListener itemListener = (ItemListener) listener; switch (entryEventType) { case ADDED: itemListener.itemAdded(event.getKey()); break; case REMOVED: itemListener.itemRemoved(event.getKey()); break; } break; case TOPIC: MessageListener messageListener = (MessageListener) listener; messageListener.onMessage(event.getValue()); break; case QUEUE: ItemListener queueItemListener = (ItemListener) listener; switch (entryEventType) { case ADDED: queueItemListener.itemAdded(event.getValue()); break; case REMOVED: queueItemListener.itemRemoved(event.getValue()); break; } break; } }
private void callListener(ListenerItem listenerItem, EntryEvent event) { Object listener = listenerItem.listener; EntryEventType entryEventType = event.getEventType(); if (listenerItem.instanceType == Instance.InstanceType.MAP) { if (!listenerItem.name.startsWith("c:__hz_")) { Object proxy = node.factory.getOrCreateProxyByName(listenerItem.name); if (proxy instanceof MProxy) { MProxy mProxy = (MProxy) proxy; mProxy.getMapOperationStats().incrementReceivedEvents(); } } } switch (listenerItem.instanceType) { case MAP: case MULTIMAP: EntryListener entryListener = (EntryListener) listener; switch (entryEventType) { case ADDED: entryListener.entryAdded(event); break; case REMOVED: entryListener.entryRemoved(event); break; case UPDATED: entryListener.entryUpdated(event); break; case EVICTED: entryListener.entryEvicted(event); break; } break; case SET: case LIST: ItemListener itemListener = (ItemListener) listener; switch (entryEventType) { case ADDED: itemListener.itemAdded(event.getKey()); break; case REMOVED: itemListener.itemRemoved(event.getKey()); break; } break; case TOPIC: MessageListener messageListener = (MessageListener) listener; messageListener.onMessage(event.getValue()); break; case QUEUE: ItemListener queueItemListener = (ItemListener) listener; switch (entryEventType) { case ADDED: queueItemListener.itemAdded(event.getValue()); break; case REMOVED: queueItemListener.itemRemoved(event.getValue()); break; } break; } }
diff --git a/impl/src/java/uk/ac/ox/oucs/oxam/logic/SakaiLocation.java b/impl/src/java/uk/ac/ox/oucs/oxam/logic/SakaiLocation.java index 00ec9c5..0960050 100644 --- a/impl/src/java/uk/ac/ox/oucs/oxam/logic/SakaiLocation.java +++ b/impl/src/java/uk/ac/ox/oucs/oxam/logic/SakaiLocation.java @@ -1,63 +1,66 @@ package uk.ac.ox.oucs.oxam.logic; import org.sakaiproject.component.api.ServerConfigurationService; import org.sakaiproject.content.api.ContentHostingService; import org.sakaiproject.exception.IdUnusedException; import org.sakaiproject.exception.PermissionException; import org.sakaiproject.exception.TypeException; import uk.ac.ox.oucs.oxam.utils.Utils; /** * This is a Sakai implementation for locating uploaded paper files. * @author buckett * */ public class SakaiLocation implements Location { private ServerConfigurationService serverConfigurationService; private ContentHostingService contentHostingService; private String sitePath; private String prefix; public void setServerConfigurationService( ServerConfigurationService serverConfigurationService) { this.serverConfigurationService = serverConfigurationService; } public void setContentHostingService(ContentHostingService contentHostingService) { this.contentHostingService = contentHostingService; } public void init() { String siteId = serverConfigurationService.getString(SakaiValueSource.OXAM_CONTENT_SITE_ID); if (siteId == null) { // Oh poo. } sitePath = contentHostingService.getSiteCollection(siteId); } public String getPrefix() { if (prefix == null) { try { - prefix = contentHostingService.getCollection(sitePath).getUrl(true); + // This is so that we can have a relative path, without the hostname. + String siteUrl = contentHostingService.getCollection(sitePath).getUrl(true); + String prefix = serverConfigurationService.getString("accessPath", "/access"); + this.prefix = Utils.joinPaths("/", prefix, siteUrl); // Ignore all the exceptions. } catch (PermissionException e) { // } catch (IdUnusedException e) { // } catch (TypeException e) { // } } return prefix; } public String getPath(String path) { String fullPath = Utils.joinPaths("/", sitePath, path); return fullPath; } }
true
true
public String getPrefix() { if (prefix == null) { try { prefix = contentHostingService.getCollection(sitePath).getUrl(true); // Ignore all the exceptions. } catch (PermissionException e) { // } catch (IdUnusedException e) { // } catch (TypeException e) { // } } return prefix; }
public String getPrefix() { if (prefix == null) { try { // This is so that we can have a relative path, without the hostname. String siteUrl = contentHostingService.getCollection(sitePath).getUrl(true); String prefix = serverConfigurationService.getString("accessPath", "/access"); this.prefix = Utils.joinPaths("/", prefix, siteUrl); // Ignore all the exceptions. } catch (PermissionException e) { // } catch (IdUnusedException e) { // } catch (TypeException e) { // } } return prefix; }
diff --git a/src/net/azib/ipscan/gui/PreferencesDialog.java b/src/net/azib/ipscan/gui/PreferencesDialog.java index a44213d..6467caf 100755 --- a/src/net/azib/ipscan/gui/PreferencesDialog.java +++ b/src/net/azib/ipscan/gui/PreferencesDialog.java @@ -1,511 +1,511 @@ /** * This file is a part of Angry IP Scanner source code, * see http://www.angryip.org/ for more information. * Licensed under GPLv2. */ package net.azib.ipscan.gui; import net.azib.ipscan.config.GUIConfig; import net.azib.ipscan.config.GUIConfig.DisplayMethod; import net.azib.ipscan.config.Labels; import net.azib.ipscan.config.ScannerConfig; import net.azib.ipscan.core.PortIterator; import net.azib.ipscan.core.net.PingerRegistry; import net.azib.ipscan.fetchers.FetcherException; import net.azib.ipscan.gui.util.LayoutHelper; import org.eclipse.swt.SWT; import org.eclipse.swt.events.KeyEvent; import org.eclipse.swt.events.KeyListener; import org.eclipse.swt.events.SelectionAdapter; import org.eclipse.swt.events.SelectionEvent; import org.eclipse.swt.layout.GridData; import org.eclipse.swt.layout.GridLayout; import org.eclipse.swt.layout.RowData; import org.eclipse.swt.layout.RowLayout; import org.eclipse.swt.widgets.*; /** * Preferences Dialog * * @author Anton Keks */ public class PreferencesDialog extends AbstractModalDialog { private PingerRegistry pingerRegistry; private ScannerConfig scannerConfig; private GUIConfig guiConfig; private ConfigDetectorDialog configDetectorDialog; private Button okButton; private Button cancelButton; private TabFolder tabFolder; private Composite scanningTab; private TabItem scanningTabItem; private Composite displayTab; private Text threadDelayText; private Text maxThreadsText; private Button deadHostsCheckbox; private Text pingingTimeoutText; private Text pingingCountText; private Combo pingersCombo; private Button skipBroadcastsCheckbox; // private Composite fetchersTab; private Composite portsTab; private TabItem portsTabItem; private Text portTimeoutText; private Button adaptTimeoutCheckbox; private Button addRequestedPortsCheckbox; private Text minPortTimeoutText; private Text portsText; private Text notAvailableText; private Text notScannedText; private Button[] displayMethod; private Button showInfoCheckbox; private Button askConfirmationCheckbox; public PreferencesDialog(PingerRegistry pingerRegistry, ScannerConfig scannerConfig, GUIConfig guiConfig, ConfigDetectorDialog configDetectorDialog) { this.pingerRegistry = pingerRegistry; this.scannerConfig = scannerConfig; this.guiConfig = guiConfig; this.configDetectorDialog = configDetectorDialog; } @Override public void open() { openTab(0); } /** * Opens the specified tab of preferences dialog * @param tabIndex */ public void openTab(int tabIndex) { // widgets are created on demand createShell(); loadPreferences(); tabFolder.setSelection(tabIndex); // select ports text by default if ports tab is opened // this is needed for PortsFetcher that uses this tab as its preferences if (tabFolder.getItem(tabIndex) == portsTabItem) { portsText.forceFocus(); } super.open(); } @Override protected void populateShell() { shell.setText(Labels.getLabel("title.preferences")); shell.setLayout(LayoutHelper.formLayout(10, 10, 4)); createTabFolder(); okButton = new Button(shell, SWT.NONE); okButton.setText(Labels.getLabel("button.OK")); cancelButton = new Button(shell, SWT.NONE); cancelButton.setText(Labels.getLabel("button.cancel")); positionButtonsInFormLayout(okButton, cancelButton, tabFolder); shell.pack(); okButton.setFocus(); okButton.addSelectionListener(new SelectionAdapter() { public void widgetSelected(SelectionEvent e) { savePreferences(); shell.close(); } }); cancelButton.addSelectionListener(new SelectionAdapter() { public void widgetSelected(SelectionEvent e) { shell.close(); } }); } /** * This method initializes tabFolder */ private void createTabFolder() { tabFolder = new TabFolder(shell, SWT.NONE); createScanningTab(); TabItem tabItem = new TabItem(tabFolder, SWT.NONE); tabItem.setText(Labels.getLabel("title.preferences.scanning")); tabItem.setControl(scanningTab); scanningTabItem = tabItem; createPortsTab(); tabItem = new TabItem(tabFolder, SWT.NONE); tabItem.setText(Labels.getLabel("title.preferences.ports")); tabItem.setControl(portsTab); portsTabItem = tabItem; createDisplayTab(); tabItem = new TabItem(tabFolder, SWT.NONE); tabItem.setText(Labels.getLabel("title.preferences.display")); tabItem.setControl(displayTab); // createFetchersTab(); // tabItem = new TabItem(tabFolder, SWT.NONE); // tabItem.setText(Labels.getLabel("title.preferences.fetchers")); // tabItem.setControl(fetchersTab); tabFolder.pack(); } /** * This method initializes scanningTab */ private void createScanningTab() { RowLayout rowLayout = createRowLayout(); scanningTab = new Composite(tabFolder, SWT.NONE); scanningTab.setLayout(rowLayout); GridLayout groupLayout = new GridLayout(); groupLayout.numColumns = 2; Group threadsGroup = new Group(scanningTab, SWT.NONE); threadsGroup.setText(Labels.getLabel("preferences.threads")); threadsGroup.setLayout(groupLayout); GridData gridData = new GridData(80, SWT.DEFAULT); Label label; label = new Label(threadsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.threads.delay")); threadDelayText = new Text(threadsGroup, SWT.BORDER); threadDelayText.setLayoutData(gridData); label = new Label(threadsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.threads.maxThreads")); maxThreadsText = new Text(threadsGroup, SWT.BORDER); maxThreadsText.setLayoutData(gridData); // new Label(threadsGroup, SWT.NONE); // Button checkButton = new Button(threadsGroup, SWT.NONE); // checkButton.setText(Labels.getLabel("button.check")); // checkButton.setLayoutData(gridData); // checkButton.addListener(SWT.Selection, new CheckButtonListener()); Group pingingGroup = new Group(scanningTab, SWT.NONE); pingingGroup.setLayout(groupLayout); pingingGroup.setText(Labels.getLabel("preferences.pinging")); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.type")); pingersCombo = new Combo(pingingGroup, SWT.DROP_DOWN | SWT.READ_ONLY); pingersCombo.setLayoutData(gridData); String[] pingerNames = pingerRegistry.getRegisteredNames(); for (int i = 0; i < pingerNames.length; i++) { pingersCombo.add(Labels.getLabel(pingerNames[i])); // this is used by savePreferences() pingersCombo.setData(Integer.toString(i), pingerNames[i]); } pingersCombo.select(0); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.count")); pingingCountText = new Text(pingingGroup, SWT.BORDER); pingingCountText.setLayoutData(gridData); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.timeout")); pingingTimeoutText = new Text(pingingGroup, SWT.BORDER); pingingTimeoutText.setLayoutData(gridData); GridData gridDataWithSpan = new GridData(); gridDataWithSpan.horizontalSpan = 2; deadHostsCheckbox = new Button(pingingGroup, SWT.CHECK); deadHostsCheckbox.setText(Labels.getLabel("preferences.pinging.deadHosts")); deadHostsCheckbox.setLayoutData(gridDataWithSpan); - Group broadcastGroup = new Group(scanningTab, SWT.NONE); - broadcastGroup.setLayout(groupLayout); - broadcastGroup.setText(Labels.getLabel("preferences.broadcast")); + Group skippingGroup = new Group(scanningTab, SWT.NONE); + skippingGroup.setLayout(groupLayout); + skippingGroup.setText(Labels.getLabel("preferences.skipping")); - skipBroadcastsCheckbox = new Button(broadcastGroup, SWT.CHECK); - skipBroadcastsCheckbox.setText(Labels.getLabel("preferences.broadcast.skip")); + skipBroadcastsCheckbox = new Button(skippingGroup, SWT.CHECK); + skipBroadcastsCheckbox.setText(Labels.getLabel("preferences.skipping.broadcast")); GridData gridDataWithSpan2 = new GridData(); gridDataWithSpan2.horizontalSpan = 2; skipBroadcastsCheckbox.setLayoutData(gridDataWithSpan2); } /** * This method initializes displayTab */ private void createDisplayTab() { RowLayout rowLayout = createRowLayout(); displayTab = new Composite(tabFolder, SWT.NONE); displayTab.setLayout(rowLayout); GridLayout groupLayout = new GridLayout(); groupLayout.numColumns = 1; Group listGroup = new Group(displayTab, SWT.NONE); listGroup.setText(Labels.getLabel("preferences.display.list")); listGroup.setLayout(groupLayout); listGroup.setLayoutData(new RowData(260, SWT.DEFAULT)); displayMethod = new Button[DisplayMethod.values().length]; Button allRadio = new Button(listGroup, SWT.RADIO); allRadio.setText(Labels.getLabel("preferences.display.list" + '.' + DisplayMethod.ALL)); displayMethod[DisplayMethod.ALL.ordinal()] = allRadio; Button aliveRadio = new Button(listGroup, SWT.RADIO); aliveRadio.setText(Labels.getLabel("preferences.display.list" + '.' + DisplayMethod.ALIVE)); displayMethod[DisplayMethod.ALIVE.ordinal()] = aliveRadio; Button portsRadio = new Button(listGroup, SWT.RADIO); portsRadio.setText(Labels.getLabel("preferences.display.list" + '.' + DisplayMethod.PORTS)); displayMethod[DisplayMethod.PORTS.ordinal()] = portsRadio; groupLayout = new GridLayout(); groupLayout.numColumns = 2; Group labelsGroup = new Group(displayTab, SWT.NONE); labelsGroup.setText(Labels.getLabel("preferences.display.labels")); labelsGroup.setLayout(groupLayout); GridData gridData = new GridData(); gridData.widthHint = 50; Label label = new Label(labelsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.display.labels.notAvailable")); notAvailableText = new Text(labelsGroup, SWT.BORDER); notAvailableText.setLayoutData(gridData); label = new Label(labelsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.display.labels.notScanned")); notScannedText = new Text(labelsGroup, SWT.BORDER); notScannedText.setLayoutData(gridData); groupLayout = new GridLayout(); groupLayout.numColumns = 1; Group showStatsGroup = new Group(displayTab, SWT.NONE); showStatsGroup.setLayout(groupLayout); showStatsGroup.setText(Labels.getLabel("preferences.display.confirmation")); askConfirmationCheckbox = new Button(showStatsGroup, SWT.CHECK); askConfirmationCheckbox.setText(Labels.getLabel("preferences.display.confirmation.newScan")); showInfoCheckbox = new Button(showStatsGroup, SWT.CHECK); showInfoCheckbox.setText(Labels.getLabel("preferences.display.confirmation.showInfo")); } /** * This method initializes portsTab */ private void createPortsTab() { RowLayout rowLayout = createRowLayout(); portsTab = new Composite(tabFolder, SWT.NONE); portsTab.setLayout(rowLayout); GridLayout groupLayout = new GridLayout(); groupLayout.numColumns = 2; Group timingGroup = new Group(portsTab, SWT.NONE); timingGroup.setText(Labels.getLabel("preferences.ports.timing")); timingGroup.setLayout(groupLayout); GridData gridData = new GridData(); gridData.widthHint = 50; Label label = new Label(timingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.ports.timing.timeout")); portTimeoutText = new Text(timingGroup, SWT.BORDER); portTimeoutText.setLayoutData(gridData); GridData gridData1 = new GridData(); gridData1.horizontalSpan = 2; adaptTimeoutCheckbox = new Button(timingGroup, SWT.CHECK); adaptTimeoutCheckbox.setText(Labels.getLabel("preferences.ports.timing.adaptTimeout")); adaptTimeoutCheckbox.setLayoutData(gridData1); adaptTimeoutCheckbox.addListener(SWT.Selection, new Listener() { public void handleEvent(Event event) { minPortTimeoutText.setEnabled(adaptTimeoutCheckbox.getSelection()); } }); label = new Label(timingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.ports.timing.minTimeout")); minPortTimeoutText = new Text(timingGroup, SWT.BORDER); minPortTimeoutText.setLayoutData(gridData); RowLayout portsLayout = new RowLayout(SWT.VERTICAL); portsLayout.fill = true; portsLayout.marginHeight = 2; portsLayout.marginWidth = 2; Group portsGroup = new Group(portsTab, SWT.NONE); portsGroup.setText(Labels.getLabel("preferences.ports.ports")); portsGroup.setLayout(portsLayout); label = new Label(portsGroup, SWT.WRAP); label.setText(Labels.getLabel("preferences.ports.portsDescription")); //label.setLayoutData(new RowData(300, SWT.DEFAULT)); portsText = new Text(portsGroup, SWT.MULTI | SWT.BORDER | SWT.V_SCROLL); portsText.setLayoutData(new RowData(SWT.DEFAULT, 60)); portsText.addKeyListener(new PortsTextValidationListener()); addRequestedPortsCheckbox = new Button(portsGroup, SWT.CHECK); addRequestedPortsCheckbox.setText(Labels.getLabel("preferences.ports.addRequested")); addRequestedPortsCheckbox.setToolTipText(Labels.getLabel("preferences.ports.addRequested.info")); } /** * This method initializes fetchersTab */ // private void createFetchersTab() { // GridLayout gridLayout = new GridLayout(); // gridLayout.numColumns = 1; // fetchersTab = new Composite(tabFolder, SWT.NONE); // fetchersTab.setLayout(gridLayout); // Label label = new Label(fetchersTab, SWT.NONE); // label.setText(Labels.getLabel("preferences.fetchers.info")); // } /** * @return a pre-initialized RowLayout suitable for option tabs. */ private RowLayout createRowLayout() { RowLayout rowLayout = new RowLayout(); rowLayout.type = org.eclipse.swt.SWT.VERTICAL; rowLayout.spacing = 9; rowLayout.marginHeight = 9; rowLayout.marginWidth = 11; rowLayout.fill = true; return rowLayout; } private void loadPreferences() { pingerRegistry.checkSelectedPinger(); maxThreadsText.setText(Integer.toString(scannerConfig.maxThreads)); threadDelayText.setText(Integer.toString(scannerConfig.threadDelay)); String[] pingerNames = pingerRegistry.getRegisteredNames(); for (int i = 0; i < pingerNames.length; i++) { if (scannerConfig.selectedPinger.equals(pingerNames[i])) { pingersCombo.select(i); } } pingingCountText.setText(Integer.toString(scannerConfig.pingCount)); pingingTimeoutText.setText(Integer.toString(scannerConfig.pingTimeout)); deadHostsCheckbox.setSelection(scannerConfig.scanDeadHosts); skipBroadcastsCheckbox.setSelection(scannerConfig.skipBroadcastAddresses); portTimeoutText.setText(Integer.toString(scannerConfig.portTimeout)); adaptTimeoutCheckbox.setSelection(scannerConfig.adaptPortTimeout); minPortTimeoutText.setText(Integer.toString(scannerConfig.minPortTimeout)); minPortTimeoutText.setEnabled(scannerConfig.adaptPortTimeout); portsText.setText(scannerConfig.portString); addRequestedPortsCheckbox.setSelection(scannerConfig.useRequestedPorts); notAvailableText.setText(scannerConfig.notAvailableText); notScannedText.setText(scannerConfig.notScannedText); displayMethod[guiConfig.displayMethod.ordinal()].setSelection(true); showInfoCheckbox.setSelection(guiConfig.showScanStats); askConfirmationCheckbox.setSelection(guiConfig.askScanConfirmation); } private void savePreferences() { // validate port string try { new PortIterator(portsText.getText()); } catch (Exception e) { tabFolder.setSelection(portsTabItem); portsText.forceFocus(); throw new FetcherException("unparseablePortString", e); } scannerConfig.selectedPinger = (String) pingersCombo.getData(Integer.toString(pingersCombo.getSelectionIndex())); if (!pingerRegistry.checkSelectedPinger()) { tabFolder.setSelection(scanningTabItem); pingersCombo.forceFocus(); throw new FetcherException("unsupportedPinger"); } scannerConfig.maxThreads = parseIntValue(maxThreadsText); scannerConfig.threadDelay = parseIntValue(threadDelayText); scannerConfig.pingCount = parseIntValue(pingingCountText); scannerConfig.pingTimeout = parseIntValue(pingingTimeoutText); scannerConfig.scanDeadHosts = deadHostsCheckbox.getSelection(); scannerConfig.skipBroadcastAddresses = skipBroadcastsCheckbox.getSelection(); scannerConfig.portTimeout = parseIntValue(portTimeoutText); scannerConfig.adaptPortTimeout = adaptTimeoutCheckbox.getSelection(); scannerConfig.minPortTimeout = parseIntValue(minPortTimeoutText); scannerConfig.portString = portsText.getText(); scannerConfig.useRequestedPorts = addRequestedPortsCheckbox.getSelection(); scannerConfig.notAvailableText = notAvailableText.getText(); scannerConfig.notScannedText = notScannedText.getText(); for (int i = 0; i < displayMethod.length; i++) { if (displayMethod[i].getSelection()) guiConfig.displayMethod = DisplayMethod.values()[i]; } guiConfig.showScanStats = showInfoCheckbox.getSelection(); guiConfig.askScanConfirmation = askConfirmationCheckbox.getSelection(); } /** * @return an int from the passed Text control. */ private static int parseIntValue(Text text) { try { return Integer.parseInt(text.getText()); } catch (NumberFormatException e) { text.forceFocus(); throw e; } } static class PortsTextValidationListener implements KeyListener { public void keyPressed(KeyEvent e) { Text portsText = (Text) e.getSource(); if (e.keyCode == SWT.TAB) { portsText.getShell().traverse(SWT.TRAVERSE_TAB_NEXT); e.doit = false; return; } else if (e.keyCode == SWT.CR) { if ((e.stateMask & SWT.MOD1) > 0) { // allow ctrl+enter to insert newlines e.stateMask = 0; } else { // single-enter will traverse portsText.getShell().traverse(SWT.TRAVERSE_RETURN); e.doit = false; return; } } else if (Character.isISOControl(e.character)) { return; } e.doit = validateChar(e.character, portsText.getText(), portsText.getCaretPosition()); } boolean validateChar(char c, String text, int caretPos) { // previous char pc = 0; for (int i = caretPos-1; i >= 0; i--) { pc = text.charAt(i); if (!Character.isWhitespace(pc)) break; } boolean isCurDigit = c >= '0' && c <= '9'; boolean isPrevDigit = pc >= '0' && pc <= '9'; return isPrevDigit && (isCurDigit || c == '-' || c == ',') || isCurDigit && (pc == '-' || pc == ',' || pc == 0) || Character.isWhitespace(c) && pc == ','; } public void keyReleased(KeyEvent e) { } } class CheckButtonListener implements Listener { public void handleEvent(Event event) { scannerConfig.maxThreads = Integer.parseInt(maxThreadsText.getText()); configDetectorDialog.open(); } } }
false
true
private void createScanningTab() { RowLayout rowLayout = createRowLayout(); scanningTab = new Composite(tabFolder, SWT.NONE); scanningTab.setLayout(rowLayout); GridLayout groupLayout = new GridLayout(); groupLayout.numColumns = 2; Group threadsGroup = new Group(scanningTab, SWT.NONE); threadsGroup.setText(Labels.getLabel("preferences.threads")); threadsGroup.setLayout(groupLayout); GridData gridData = new GridData(80, SWT.DEFAULT); Label label; label = new Label(threadsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.threads.delay")); threadDelayText = new Text(threadsGroup, SWT.BORDER); threadDelayText.setLayoutData(gridData); label = new Label(threadsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.threads.maxThreads")); maxThreadsText = new Text(threadsGroup, SWT.BORDER); maxThreadsText.setLayoutData(gridData); // new Label(threadsGroup, SWT.NONE); // Button checkButton = new Button(threadsGroup, SWT.NONE); // checkButton.setText(Labels.getLabel("button.check")); // checkButton.setLayoutData(gridData); // checkButton.addListener(SWT.Selection, new CheckButtonListener()); Group pingingGroup = new Group(scanningTab, SWT.NONE); pingingGroup.setLayout(groupLayout); pingingGroup.setText(Labels.getLabel("preferences.pinging")); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.type")); pingersCombo = new Combo(pingingGroup, SWT.DROP_DOWN | SWT.READ_ONLY); pingersCombo.setLayoutData(gridData); String[] pingerNames = pingerRegistry.getRegisteredNames(); for (int i = 0; i < pingerNames.length; i++) { pingersCombo.add(Labels.getLabel(pingerNames[i])); // this is used by savePreferences() pingersCombo.setData(Integer.toString(i), pingerNames[i]); } pingersCombo.select(0); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.count")); pingingCountText = new Text(pingingGroup, SWT.BORDER); pingingCountText.setLayoutData(gridData); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.timeout")); pingingTimeoutText = new Text(pingingGroup, SWT.BORDER); pingingTimeoutText.setLayoutData(gridData); GridData gridDataWithSpan = new GridData(); gridDataWithSpan.horizontalSpan = 2; deadHostsCheckbox = new Button(pingingGroup, SWT.CHECK); deadHostsCheckbox.setText(Labels.getLabel("preferences.pinging.deadHosts")); deadHostsCheckbox.setLayoutData(gridDataWithSpan); Group broadcastGroup = new Group(scanningTab, SWT.NONE); broadcastGroup.setLayout(groupLayout); broadcastGroup.setText(Labels.getLabel("preferences.broadcast")); skipBroadcastsCheckbox = new Button(broadcastGroup, SWT.CHECK); skipBroadcastsCheckbox.setText(Labels.getLabel("preferences.broadcast.skip")); GridData gridDataWithSpan2 = new GridData(); gridDataWithSpan2.horizontalSpan = 2; skipBroadcastsCheckbox.setLayoutData(gridDataWithSpan2); }
private void createScanningTab() { RowLayout rowLayout = createRowLayout(); scanningTab = new Composite(tabFolder, SWT.NONE); scanningTab.setLayout(rowLayout); GridLayout groupLayout = new GridLayout(); groupLayout.numColumns = 2; Group threadsGroup = new Group(scanningTab, SWT.NONE); threadsGroup.setText(Labels.getLabel("preferences.threads")); threadsGroup.setLayout(groupLayout); GridData gridData = new GridData(80, SWT.DEFAULT); Label label; label = new Label(threadsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.threads.delay")); threadDelayText = new Text(threadsGroup, SWT.BORDER); threadDelayText.setLayoutData(gridData); label = new Label(threadsGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.threads.maxThreads")); maxThreadsText = new Text(threadsGroup, SWT.BORDER); maxThreadsText.setLayoutData(gridData); // new Label(threadsGroup, SWT.NONE); // Button checkButton = new Button(threadsGroup, SWT.NONE); // checkButton.setText(Labels.getLabel("button.check")); // checkButton.setLayoutData(gridData); // checkButton.addListener(SWT.Selection, new CheckButtonListener()); Group pingingGroup = new Group(scanningTab, SWT.NONE); pingingGroup.setLayout(groupLayout); pingingGroup.setText(Labels.getLabel("preferences.pinging")); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.type")); pingersCombo = new Combo(pingingGroup, SWT.DROP_DOWN | SWT.READ_ONLY); pingersCombo.setLayoutData(gridData); String[] pingerNames = pingerRegistry.getRegisteredNames(); for (int i = 0; i < pingerNames.length; i++) { pingersCombo.add(Labels.getLabel(pingerNames[i])); // this is used by savePreferences() pingersCombo.setData(Integer.toString(i), pingerNames[i]); } pingersCombo.select(0); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.count")); pingingCountText = new Text(pingingGroup, SWT.BORDER); pingingCountText.setLayoutData(gridData); label = new Label(pingingGroup, SWT.NONE); label.setText(Labels.getLabel("preferences.pinging.timeout")); pingingTimeoutText = new Text(pingingGroup, SWT.BORDER); pingingTimeoutText.setLayoutData(gridData); GridData gridDataWithSpan = new GridData(); gridDataWithSpan.horizontalSpan = 2; deadHostsCheckbox = new Button(pingingGroup, SWT.CHECK); deadHostsCheckbox.setText(Labels.getLabel("preferences.pinging.deadHosts")); deadHostsCheckbox.setLayoutData(gridDataWithSpan); Group skippingGroup = new Group(scanningTab, SWT.NONE); skippingGroup.setLayout(groupLayout); skippingGroup.setText(Labels.getLabel("preferences.skipping")); skipBroadcastsCheckbox = new Button(skippingGroup, SWT.CHECK); skipBroadcastsCheckbox.setText(Labels.getLabel("preferences.skipping.broadcast")); GridData gridDataWithSpan2 = new GridData(); gridDataWithSpan2.horizontalSpan = 2; skipBroadcastsCheckbox.setLayoutData(gridDataWithSpan2); }
diff --git a/apps/xgap/plugins/reportbuilder/Statistics.java b/apps/xgap/plugins/reportbuilder/Statistics.java index 5d18a4d93..fbf229e3b 100644 --- a/apps/xgap/plugins/reportbuilder/Statistics.java +++ b/apps/xgap/plugins/reportbuilder/Statistics.java @@ -1,170 +1,170 @@ package plugins.reportbuilder; import java.util.Comparator; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.TreeMap; import matrix.DataMatrixInstance; import org.apache.commons.math.stat.correlation.SpearmansCorrelation; public class Statistics { public static TreeMap<String, Double> getSpearManCorr(DataMatrixInstance i, String name, boolean isRow) throws Exception { HashMap<String, Double> map = new HashMap<String, Double>(); ValueComparator bvc = new ValueComparator(map); boolean decimals = i.getData().getValueType().equals("Decimal") ? true : false; // could do per row, but is slower? dont do on big sets anyway.. Object[][] elements = i.getElements(); List<String> dimNames; int self = -1; if (isRow) { dimNames = i.getRowNames(); - i.getRowIndexForName(name); + self = i.getRowIndexForName(name); } else { // reassign dimNames = i.getColNames(); self = i.getColIndexForName(name); // swap row and col, easier to iterate elements = transposeMatrix(elements); } double[] selfDoubles; if (decimals) { selfDoubles = getAsDoubles(elements[self]); } else { selfDoubles = getTextAsDoubles(elements[self]); } for (int index = 0; index < i.getNumberOfRows(); index++) { if (index != self) { double[] doubles; if (decimals) { doubles = getAsDoubles(elements[index]); } else { doubles = getTextAsDoubles(elements[index]); } double corr = new SpearmansCorrelation().correlation(doubles, selfDoubles); map.put(dimNames.get(index), corr); } } TreeMap<String, Double> sorted_map = new TreeMap(bvc); sorted_map.putAll(map); for (String key : sorted_map.keySet()) { System.out.println("k: " + key + ", v: " + sorted_map.get(key)); } return sorted_map; } public static Object[][] transposeMatrix(Object[][] m) { int r = m.length; int c = m[0].length; Object[][] t = new Object[c][r]; for (int i = 0; i < r; ++i) { for (int j = 0; j < c; ++j) { t[j][i] = m[i][j]; } } return t; } public static double[] getAsDoubles(Object[] e) { double[] res = new double[e.length]; for (int i = 0; i < e.length; i++) { if (e[i] == null) { res[i] = 0; } else { res[i] = Double.parseDouble(e[i].toString()); } } return res; } public static double[] getTextAsDoubles(Object[] e) { double[] res = new double[e.length]; for (int i = 0; i < e.length; i++) { if (e[i] == null) { res[i] = 0; } else { double r = 0; for (char c : e[i].toString().toCharArray()) { r += (byte) c; } res[i] = r; } } return res; } static class ValueComparator implements Comparator { Map base; public ValueComparator(Map base) { this.base = base; } public int compare(Object a, Object b) { if ((Double) base.get(a) < (Double) base.get(b)) { return 1; } else if ((Double) base.get(a) == (Double) base.get(b)) { return 0; } else { return -1; } } } }
true
true
public static TreeMap<String, Double> getSpearManCorr(DataMatrixInstance i, String name, boolean isRow) throws Exception { HashMap<String, Double> map = new HashMap<String, Double>(); ValueComparator bvc = new ValueComparator(map); boolean decimals = i.getData().getValueType().equals("Decimal") ? true : false; // could do per row, but is slower? dont do on big sets anyway.. Object[][] elements = i.getElements(); List<String> dimNames; int self = -1; if (isRow) { dimNames = i.getRowNames(); i.getRowIndexForName(name); } else { // reassign dimNames = i.getColNames(); self = i.getColIndexForName(name); // swap row and col, easier to iterate elements = transposeMatrix(elements); } double[] selfDoubles; if (decimals) { selfDoubles = getAsDoubles(elements[self]); } else { selfDoubles = getTextAsDoubles(elements[self]); } for (int index = 0; index < i.getNumberOfRows(); index++) { if (index != self) { double[] doubles; if (decimals) { doubles = getAsDoubles(elements[index]); } else { doubles = getTextAsDoubles(elements[index]); } double corr = new SpearmansCorrelation().correlation(doubles, selfDoubles); map.put(dimNames.get(index), corr); } } TreeMap<String, Double> sorted_map = new TreeMap(bvc); sorted_map.putAll(map); for (String key : sorted_map.keySet()) { System.out.println("k: " + key + ", v: " + sorted_map.get(key)); } return sorted_map; }
public static TreeMap<String, Double> getSpearManCorr(DataMatrixInstance i, String name, boolean isRow) throws Exception { HashMap<String, Double> map = new HashMap<String, Double>(); ValueComparator bvc = new ValueComparator(map); boolean decimals = i.getData().getValueType().equals("Decimal") ? true : false; // could do per row, but is slower? dont do on big sets anyway.. Object[][] elements = i.getElements(); List<String> dimNames; int self = -1; if (isRow) { dimNames = i.getRowNames(); self = i.getRowIndexForName(name); } else { // reassign dimNames = i.getColNames(); self = i.getColIndexForName(name); // swap row and col, easier to iterate elements = transposeMatrix(elements); } double[] selfDoubles; if (decimals) { selfDoubles = getAsDoubles(elements[self]); } else { selfDoubles = getTextAsDoubles(elements[self]); } for (int index = 0; index < i.getNumberOfRows(); index++) { if (index != self) { double[] doubles; if (decimals) { doubles = getAsDoubles(elements[index]); } else { doubles = getTextAsDoubles(elements[index]); } double corr = new SpearmansCorrelation().correlation(doubles, selfDoubles); map.put(dimNames.get(index), corr); } } TreeMap<String, Double> sorted_map = new TreeMap(bvc); sorted_map.putAll(map); for (String key : sorted_map.keySet()) { System.out.println("k: " + key + ", v: " + sorted_map.get(key)); } return sorted_map; }
diff --git a/src/jpcsp/HLE/modules150/sceSasCore.java b/src/jpcsp/HLE/modules150/sceSasCore.java index 20022646..a70dccda 100644 --- a/src/jpcsp/HLE/modules150/sceSasCore.java +++ b/src/jpcsp/HLE/modules150/sceSasCore.java @@ -1,1222 +1,1229 @@ /* This file is part of jpcsp. Jpcsp is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. Jpcsp is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with Jpcsp. If not, see <http://www.gnu.org/licenses/>. */ package jpcsp.HLE.modules150; import javax.sound.sampled.AudioFormat; import javax.sound.sampled.AudioSystem; import javax.sound.sampled.LineUnavailableException; import javax.sound.sampled.SourceDataLine; import jpcsp.HLE.Modules; import jpcsp.HLE.ThreadMan; import jpcsp.HLE.kernel.managers.SceUidManager; import jpcsp.HLE.modules.HLEModule; import jpcsp.HLE.modules.HLEModuleFunction; import jpcsp.HLE.modules.HLEModuleManager; import jpcsp.Memory; import jpcsp.Processor; import jpcsp.Allegrex.CpuState; public class sceSasCore implements HLEModule { @Override public String getName() { return "sceSasCore"; } @Override public void installModule(HLEModuleManager mm, int version) { if (version >= 150) { mm.addFunction(__sceSasSetADSRFunction, 0x019B25EB); mm.addFunction(__sceSasRevParamFunction, 0x267A6DD2); mm.addFunction(__sceSasGetPauseFlagFunction, 0x2C8E6AB3); mm.addFunction(__sceSasRevTypeFunction, 0x33D4AB37); mm.addFunction(__sceSasInitFunction, 0x42778A9F); mm.addFunction(__sceSasSetVolumeFunction, 0x440CA7D8); mm.addFunction(__sceSasCoreWithMixFunction, 0x50A14DFC); mm.addFunction(__sceSasSetSLFunction, 0x5F9529F6); mm.addFunction(__sceSasGetEndFlagFunction, 0x68A46B95); mm.addFunction(__sceSasGetEnvelopeHeightFunction, 0x74AE582A); mm.addFunction(__sceSasSetKeyOnFunction, 0x76F01ACA); mm.addFunction(__sceSasSetPauseFunction, 0x787D04D5); mm.addFunction(__sceSasSetVoiceFunction, 0x99944089); mm.addFunction(__sceSasSetADSRmodeFunction, 0x9EC3676A); mm.addFunction(__sceSasSetKeyOffFunction, 0xA0CF2FA4); mm.addFunction(__sceSasSetTrianglarWaveFunction, 0xA232CBE6); mm.addFunction(__sceSasCoreFunction, 0xA3589D81); mm.addFunction(__sceSasSetPitchFunction, 0xAD84D37F); mm.addFunction(__sceSasSetNoiseFunction, 0xB7660A23); mm.addFunction(__sceSasGetGrainFunction, 0xBD11B7C2); mm.addFunction(__sceSasSetSimpleADSRFunction, 0xCBCD4F79); mm.addFunction(__sceSasSetGrainFunction, 0xD1E0A01E); mm.addFunction(__sceSasRevEVOLFunction, 0xD5A229C9); mm.addFunction(__sceSasSetSteepWaveFunction, 0xD5EBBBCD); mm.addFunction(__sceSasGetOutputmodeFunction, 0xE175EF66); mm.addFunction(__sceSasSetOutputmodeFunction, 0xE855BF76); mm.addFunction(__sceSasRevVONFunction, 0xF983B186); } sasCoreUid = -1; sampleRate = 48000; voices = new pspVoice[32]; for (int i = 0; i < voices.length; i++) { voices[i] = new pspVoice(); } if (voicesCheckerThread == null) { voicesCheckerThread = new VoicesCheckerThread(500); voicesCheckerThread.setDaemon(true); voicesCheckerThread.setName("sceSasCore Voices Checker"); voicesCheckerThread.start(); } } @Override public void uninstallModule(HLEModuleManager mm, int version) { if (version >= 150) { mm.removeFunction(__sceSasSetADSRFunction); mm.removeFunction(__sceSasRevParamFunction); mm.removeFunction(__sceSasGetPauseFlagFunction); mm.removeFunction(__sceSasRevTypeFunction); mm.removeFunction(__sceSasInitFunction); mm.removeFunction(__sceSasSetVolumeFunction); mm.removeFunction(__sceSasCoreWithMixFunction); mm.removeFunction(__sceSasSetSLFunction); mm.removeFunction(__sceSasGetEndFlagFunction); mm.removeFunction(__sceSasGetEnvelopeHeightFunction); mm.removeFunction(__sceSasSetKeyOnFunction); mm.removeFunction(__sceSasSetPauseFunction); mm.removeFunction(__sceSasSetVoiceFunction); mm.removeFunction(__sceSasSetADSRmodeFunction); mm.removeFunction(__sceSasSetKeyOffFunction); mm.removeFunction(__sceSasSetTrianglarWaveFunction); mm.removeFunction(__sceSasCoreFunction); mm.removeFunction(__sceSasSetPitchFunction); mm.removeFunction(__sceSasSetNoiseFunction); mm.removeFunction(__sceSasGetGrainFunction); mm.removeFunction(__sceSasSetSimpleADSRFunction); mm.removeFunction(__sceSasSetGrainFunction); mm.removeFunction(__sceSasRevEVOLFunction); mm.removeFunction(__sceSasSetSteepWaveFunction); mm.removeFunction(__sceSasGetOutputmodeFunction); mm.removeFunction(__sceSasSetOutputmodeFunction); mm.removeFunction(__sceSasRevVONFunction); } } protected class pspVoice { public SourceDataLine outputDataLine; public float outputDataLineSampleRate; public int leftVolume; public int rightVolume; public short[] samples; public int loopMode; public int pitch; public final int NORMAL_PITCH = 0x1000; public byte[] buffer; public int bufferIndex; public pspVoice() { outputDataLine = null; leftVolume = 0x8000; rightVolume = 0x8000; samples = null; loopMode = 0; pitch = NORMAL_PITCH; buffer = null; bufferIndex = 0; } private float getSampleRate() { return (sampleRate * pitch) / (float) NORMAL_PITCH; } private void init() { float wantedSampleRate = getSampleRate(); int wantedBufferSize = 0; if (samples != null) { wantedBufferSize = samples.length * 4; } else { wantedBufferSize = outputDataLine.getBufferSize(); } if (outputDataLine == null || wantedSampleRate != outputDataLineSampleRate || wantedBufferSize > outputDataLine.getBufferSize()) { if (outputDataLine != null) { outputDataLine.close(); outputDataLine = null; } try { AudioFormat format = new AudioFormat(wantedSampleRate, 16, 2, true, false); outputDataLine = AudioSystem.getSourceDataLine(format); outputDataLineSampleRate = wantedSampleRate; if (!audioMuted) { if (wantedBufferSize > 0) { outputDataLine.open(format, wantedBufferSize); } else { outputDataLine.open(format); } } } catch (LineUnavailableException e) { Modules.log.error("sceSasCore.pspVoice.init: " + e.toString()); } } } public synchronized int on() { init(); if (samples != null) { outputDataLine.stop(); buffer = encodeSamples(); int length = Math.min(outputDataLine.available(), buffer.length); bufferIndex = length; outputDataLine.write(buffer, 0, length); outputDataLine.start(); } return 0; // TODO Check the return value } public synchronized int off() { if (outputDataLine != null) { outputDataLine.stop(); } return 0; // TODO Check the return value } public synchronized boolean IsEnded() { if (outputDataLine == null) { return true; } if (!outputDataLine.isRunning()) { return true; } if (buffer != null && bufferIndex < buffer.length) { return false; } if (outputDataLine.available() >= outputDataLine.getBufferSize()) { return true; } return false; } private byte[] encodeSamples() { int numSamples = samples.length; byte[] buffer = new byte[numSamples * 4]; for (int i = 0; i < numSamples; i++) { short sample = samples[i]; short lval = (short) ((sample * leftVolume ) >> 16); short rval = (short) ((sample * rightVolume) >> 16); buffer[i*4+0] = (byte) (lval); buffer[i*4+1] = (byte) (lval >> 8); buffer[i*4+2] = (byte) (rval); buffer[i*4+3] = (byte) (rval >> 8); } return buffer; } public synchronized void check() { if (outputDataLine == null || !outputDataLine.isActive() || buffer == null) { return; } if (bufferIndex < buffer.length) { int length = Math.min(outputDataLine.available(), buffer.length - bufferIndex); if (length > 0) { outputDataLine.write(buffer, bufferIndex, length); bufferIndex += length; } } else if (IsEnded()) { outputDataLine.stop(); } } } protected class VoicesCheckerThread extends Thread { private long delayMillis; public VoicesCheckerThread(long delayMillis) { this.delayMillis = delayMillis; } @Override public void run() { while (true) { for (int i = 0; i < voices.length; i++) { voices[i].check(); } try { sleep(delayMillis); } catch (InterruptedException e) { // Ignore the Exception } } } } private static VoicesCheckerThread voicesCheckerThread = null; protected int sasCoreUid; protected pspVoice[] voices; protected int sampleRate; protected boolean audioMuted; public void setAudioMuted(boolean muted) { audioMuted = muted; } protected String makeLogParams(CpuState cpu) { return String.format("%08x %08x %08x %08x", cpu.gpr[4], cpu.gpr[5], cpu.gpr[6], cpu.gpr[7]); } /** If sasCore isn't a valid handle this function will print a log message and set $v0 to -1. * @return true if sasCore is good. */ protected boolean isSasHandleGood(int sasCore, String functionName, CpuState cpu) { if (Processor.memory.isAddressGood(sasCore)) { if (Processor.memory.read32(sasCore) == sasCoreUid) { return true; } else { Modules.log.warn(functionName + " bad sasCoreUid 0x" + Integer.toHexString(Processor.memory.read32(sasCore))); } } else { Modules.log.warn(functionName + " bad sasCore Address 0x" + Integer.toHexString(sasCore)); } cpu.gpr[2] = -1; return false; } protected boolean isVoiceNumberGood(int voice, String functionName, CpuState cpu) { if (voice >= 0 && voice < voices.length) { return true; } Modules.log.warn(functionName + " bad voice number " + voice); cpu.gpr[2] = -1; return false; } public void __sceSasSetADSR(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; //int unk2 = cpu.gpr[6]; // 8, 0xf //int unk3 = cpu.gpr[7]; // 0, 0x40000000 //int unk4 = cpu.gpr[8]; // 0x64 //int unk5 = cpu.gpr[9]; // 0x64 //int unk6 = cpu.gpr[10]; // 0x10000000 Modules.log.warn("Unimplemented NID function __sceSasSetADSR [0x019B25EB] " + String.format("sasCore=%08x, voice=%d %08x %08x %08x %08x %08x", sasCore, voice, cpu.gpr[6], cpu.gpr[7], cpu.gpr[8], cpu.gpr[9], cpu.gpr[10])); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasRevParam(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ int sasCore = cpu.gpr[4]; int unk1 = cpu.gpr[5]; // 0, 64 int unk2 = cpu.gpr[6]; // 0, 64 // 99% sure there are no more parameters Modules.log.warn("IGNORING:__sceSasRevParam(" + String.format("sasCore=0x%08x,unk1=0x%x,unk2=0x%x)", sasCore, unk1, unk2)); cpu.gpr[2] = 0; } // we could do some trickery in here too // 2C8E6AB3 public void __sceSasGetPauseFlag(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; int sasCore = cpu.gpr[4]; //int unk1 = cpu.gpr[5]; // set to 1, if this matches __sceSasSetPause then it's a voice bitfield //int unk2 = cpu.gpr[6]; // looks like a heap address, but so far 0x10000 aligned // 99% sure there are no more parameters // probably matches __sceSasGetEndFlag Modules.log.debug("IGNORING:__sceSasGetPauseFlag(sasCore=0x" + Integer.toHexString(sasCore) + ") " + makeLogParams(cpu)); if (isSasHandleGood(sasCore, "__sceSasGetPauseFlag", cpu)) { // Fake all voices NOT paused cpu.gpr[2] = 0x0; } } public void __sceSasRevType(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ int sasCore = cpu.gpr[4]; // -1 = any? // 0 = ? // 1 = ? // 2 = ? // 3 = ? // 4 = ? // 5 = ? // 6 = ? int type = cpu.gpr[5]; //int unk2 = cpu.gpr[6]; // unused or 1 or the return code from some other function (0xdeadc0de) //int unk3 = cpu.gpr[7]; // unused or 0, 1, 0x1000 Modules.log.warn("IGNORING:__sceSasRevType(type=" + type + ") " + makeLogParams(cpu)); cpu.gpr[2] = 0; } public void __sceSasInit(Processor processor) { CpuState cpu = processor.cpu; Memory mem = Processor.memory; int sasCore = cpu.gpr[4]; // int unk1 = cpu.gpr[5]; // 0x00000100 // int unk2 = cpu.gpr[6]; // 0x00000020 // int unk3 = cpu.gpr[7]; // 0x00000000 int sampleRate = cpu.gpr[8]; // 0x0000AC44 (44100 Hz) // 100% sure there are no more parameters Modules.log.info("PARTIAL __sceSasInit: " + String.format("sasCore=0x%08x, unk1=0x%08x, unk2=0x%08x, unk3=0x%08x, sampleRate=%d", sasCore, cpu.gpr[5], cpu.gpr[6], cpu.gpr[7], sampleRate)); // we'll support only 1 sascore instance at a time, we can fix this later if needed if (sasCoreUid != -1) { Modules.log.warn("UNIMPLEMENTED:__sceSasInit multiple instances not yet supported"); cpu.gpr[2] = -1; } else { if (mem.isAddressGood(sasCore)) { sasCoreUid = SceUidManager.getNewUid("sceMpeg-Mpeg"); mem.write32(sasCore, sasCoreUid); } this.sampleRate = sampleRate; cpu.gpr[2] = 0; } } public void __sceSasSetVolume(Processor processor) { CpuState cpu = processor.cpu; int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; int leftVolume = cpu.gpr[6]; // left channel volume 0 - 0x1000 int rightVolume = cpu.gpr[7]; // right channel volume 0 - 0x1000 if (isSasHandleGood(sasCore, "__sceSasSetVolume", cpu) && isVoiceNumberGood(voice, "__sceSasSetVolume", cpu)) { voices[voice].leftVolume = leftVolume << 3; // 0 - 0x8000 voices[voice].rightVolume = rightVolume << 3; // 0 - 0x8000 cpu.gpr[2] = 0; } } // 50A14DFC public void __sceSasCoreWithMix(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; int sasCore = cpu.gpr[4]; //int unk1 = cpu.gpr[5]; // looks like a heap address //int unk2 = cpu.gpr[6]; // looks like a bitfield Modules.log.debug("IGNORING:__sceSasCoreWithMix " + makeLogParams(cpu)); if (isSasHandleGood(sasCore, "__sceSasCoreWithMix", cpu)) { // nothing to do ... ? cpu.gpr[2] = 0; } } public void __sceSasSetSL(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ // int a0 = cpu.gpr[4]; int a1 = cpu.gpr[5]; ... int t3 = cpu.gpr[11]; // float f12 = cpu.fpr[12]; float f13 = cpu.fpr[13]; ... float f19 = cpu.fpr[19]; Modules.log.warn("Unimplemented NID function __sceSasSetSL [0x5F9529F6] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } // 68A46B95 public void __sceSasGetEndFlag(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor int sasCore = cpu.gpr[4]; // 99% sure there are no more parameters if (isSasHandleGood(sasCore, "__sceSasGetEndFlag", cpu)) { // Returns a 32 bits bitfield (tested using "if (result & (1 << n))") int endFlag = 0; for (int i = 0; i < voices.length; i++) { if (voices[i].IsEnded()) { endFlag |= (1 << i); } } Modules.log.info("__sceSasGetEndFlag(sasCore=0x" + Integer.toHexString(sasCore) + "): 0x" + Integer.toHexString(endFlag)); cpu.gpr[2] = endFlag; } } public void __sceSasGetEnvelopeHeight(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; int unk1 = cpu.gpr[6]; // set to 1 // 99% sure there are no more parameters Modules.log.warn("IGNORING:__sceSasGetEnvelopeHeight(sasCore=0x" + Integer.toHexString(sasCore) + ",voice=" + voice + ",unk1=0x" + Integer.toHexString(unk1) + ")"); cpu.gpr[2] = 0xDEADC0DE; } // I think this means start playing this channel, key off would then mean stop or pause the playback (fiveofhearts) public void __sceSasSetKeyOn(Processor processor) { CpuState cpu = processor.cpu; int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; Modules.log.info("PARTIAL __sceSasSetKeyOn: " + String.format("sasCore=%08x, voice=%d", sasCore, voice)); if (isSasHandleGood(sasCore, "__sceSasSetKeyOn", cpu) && isVoiceNumberGood(voice, "__sceSasSetKeyOn", cpu)) { cpu.gpr[2] = voices[voice].on(); } } public void __sceSasSetPause(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ int sasCore = cpu.gpr[4]; int voice_bit = cpu.gpr[5]; // bitfield instead of index, example: 0x08 is voice 3 int pause = cpu.gpr[6]; // 0 Modules.log.warn("Unimplemented NID function __sceSasSetPause [0x787D04D5] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; } protected short[] decodeSamples(Processor processor, int vagAddr, int size) { Memory mem = Processor.memory; // Based on vgmstream short[] samples = new short[size / 16 * 28]; int numSamples = 0; int headerCheck = mem.read32(vagAddr); if ((headerCheck & 0x00FFFFFF) == 0x00474156) { // VAGx vagAddr += 0x30; // Skip the VAG header } int[] unpackedSamples = new int[28]; int hist1 = 0; int hist2 = 0; final double[][] VAG_f = { { 0.0 , 0.0 }, { 60.0 / 64.0, 0.0 }, { 115.0 / 64.0, -52.0 / 64.0 }, { 98.0 / 64.0, -55.0 / 64.0 }, { 122.0 / 64.0, -60.0 / 64.0 } }; for (int i = 0; i <= (size - 16); ) { int n = mem.read8(vagAddr + i); i++; int predict_nr = n >> 4; + if (predict_nr >= VAG_f.length) { + // predict_nr is supposed to be included in [0..4]. + // TODO The game "Tenchu: TOTA" is using a value "predict_nr = 7", I could not find out how this value should be interpreted... + Modules.log.warn("sceSasCore.decodeSamples: Unknown value for predict_nr: " + predict_nr); + // Avoid ArrayIndexOutOfBoundsException + predict_nr = 0; + } int shift_factor = n & 0x0F; int flag = mem.read8(vagAddr + i); i++; if (flag == 0x07) { break; // End of stream flag } for (int j = 0; j < 28; j += 2) { int d = mem.read8(vagAddr + i); i++; int s = (short) ((d & 0x0F) << 12); unpackedSamples[j] = s >> shift_factor; s = (short) ((d & 0xF0) << 8); unpackedSamples[j + 1] = s >> shift_factor; } for (int j = 0; j < 28; j++) { int sample = (int) (unpackedSamples[j] + hist1 * VAG_f[predict_nr][0] + hist2 * VAG_f[predict_nr][1]); hist2 = hist1; hist1 = sample; if (sample < -32768) { samples[numSamples] = -32768; } else if (sample > 0x7FFF) { samples[numSamples] = 0x7FFF; } else { samples[numSamples] = (short) sample; } numSamples++; } } if (samples.length != numSamples) { short[] resizedSamples = new short[numSamples]; for (int i = 0; i < numSamples; i++) { resizedSamples[i] = samples[i]; } samples = resizedSamples; } return samples; } public void __sceSasSetVoice(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor Memory mem = Processor.memory; int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; int vagAddr = cpu.gpr[6]; // may have uncached bit set int size = cpu.gpr[7]; int loopmode = cpu.gpr[8]; Modules.log.info("PARTIAL __sceSasSetVoice: " + String.format("sasCore=0x%08x, voice=%d, vagAddr=0x%08x, size=0x%08x, loopmode=%d", sasCore, voice, vagAddr, size, loopmode)); if (isSasHandleGood(sasCore, "__sceSasSetVoice", cpu) && isVoiceNumberGood(voice, "__sceSasSetVoice", cpu)) { voices[voice].samples = decodeSamples(processor, vagAddr, size); voices[voice].loopMode = loopmode; cpu.gpr[2] = 0; } } public void __sceSasSetADSRmode(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; //int unk2 = cpu.gpr[6]; // 8/0xf //int unk3 = cpu.gpr[7]; // 0 // may be more parameters Modules.log.warn("Unimplemented NID function __sceSasSetADSRmode [0x9EC3676A] " + String.format("%08x %08x %08x %08x %08x %08x", cpu.gpr[4], cpu.gpr[5], cpu.gpr[6], cpu.gpr[7], cpu.gpr[8], cpu.gpr[9])); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasSetKeyOff(Processor processor) { CpuState cpu = processor.cpu; int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; Modules.log.info("PARTIAL __sceSasSetKeyOff: " + String.format("sasCore=%08x, voice=%d", sasCore, voice)); if (isSasHandleGood(sasCore, "__sceSasSetKeyOff", cpu) && isVoiceNumberGood(voice, "__sceSasSetKeyOff", cpu)) { cpu.gpr[2] = voices[voice].off(); } } public void __sceSasSetTrianglarWave(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ // int a0 = cpu.gpr[4]; int a1 = cpu.gpr[5]; ... int t3 = cpu.gpr[11]; // float f12 = cpu.fpr[12]; float f13 = cpu.fpr[13]; ... float f19 = cpu.fpr[19]; Modules.log.warn("Unimplemented NID function __sceSasSetTrianglarWave [0xA232CBE6] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } // A3589D81 public void __sceSasCore(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor int sasCore = cpu.gpr[4]; //int unk1 = cpu.gpr[5]; // looks like a heap address, bss, 0x40 aligned // 99% sure there are no more parameters Modules.log.debug("IGNORING:__sceSasCore " + makeLogParams(cpu)); if (isSasHandleGood(sasCore, "__sceSasCore", cpu)) { // noxa/pspplayer blocks in __sceSasCore // some games protect __sceSasCore with locks, suggesting it may context switch. // Games seems to run better when delaying the thread instead of just yielding. cpu.gpr[2] = 0; ThreadMan.getInstance().hleKernelDelayThread(1000000, false); // ThreadMan.getInstance().yieldCurrentThread(); } } public void __sceSasSetPitch(Processor processor) { CpuState cpu = processor.cpu; int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; int pitch = cpu.gpr[6]; // 0x6e4/0x800/0x1000/0x2000 large values may be clamped Modules.log.info("PARTIAL __sceSasSetPitch: " + String.format("sasCore=%08x, voice=%d, pitch=0x%04x", sasCore, voice, pitch)); if (isSasHandleGood(sasCore, "__sceSasSetPitch", cpu) && isVoiceNumberGood(voice, "__sceSasSetPitch", cpu)) { voices[voice].pitch = pitch; cpu.gpr[2] = 0; } } public void __sceSasSetNoise(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ // int a0 = cpu.gpr[4]; int a1 = cpu.gpr[5]; ... int t3 = cpu.gpr[11]; // float f12 = cpu.fpr[12]; float f13 = cpu.fpr[13]; ... float f19 = cpu.fpr[19]; Modules.log.warn("Unimplemented NID function __sceSasSetNoise [0xB7660A23] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasGetGrain(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ // int a0 = cpu.gpr[4]; int a1 = cpu.gpr[5]; ... int t3 = cpu.gpr[11]; // float f12 = cpu.fpr[12]; float f13 = cpu.fpr[13]; ... float f19 = cpu.fpr[19]; Modules.log.warn("Unimplemented NID function __sceSasGetGrain [0xBD11B7C2] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasSetSimpleADSR(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ int sasCore = cpu.gpr[4]; int voice = cpu.gpr[5]; //int unk1 = cpu.gpr[6]; // 0xff //int unk2 = cpu.gpr[7]; // 0x1fc6 // doesn't look like any more parameters, they look like error codes Modules.log.warn("Unimplemented NID function __sceSasSetSimpleADSR [0xCBCD4F79] " + String.format("%08x %08x %08x %08x %08x %08x", cpu.gpr[4], cpu.gpr[5], cpu.gpr[6], cpu.gpr[7], cpu.gpr[8], cpu.gpr[9])); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasSetGrain(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; int sasCore = cpu.gpr[4]; int grain = cpu.gpr[5]; // 0x400 Modules.log.warn("Unimplemented NID function __sceSasSetGrain [0xD1E0A01E] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; } public void __sceSasRevEVOL(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor int sasCore = cpu.gpr[4]; int left = cpu.gpr[5]; // left channel volume 0 - 0x1000 int right = cpu.gpr[6]; // right channel volume 0 - 0x1000 Modules.log.debug("IGNORING:__sceSasRevEVOL(" + String.format("sasCore=0x%08x,left=0x%04x,right=0x%04x)", sasCore, left, right)); cpu.gpr[2] = 0; } public void __sceSasSetSteepWave(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ // int a0 = cpu.gpr[4]; int a1 = cpu.gpr[5]; ... int t3 = cpu.gpr[11]; // float f12 = cpu.fpr[12]; float f13 = cpu.fpr[13]; ... float f19 = cpu.fpr[19]; Modules.log.warn("Unimplemented NID function __sceSasSetSteepWave [0xD5EBBBCD] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasGetOutputmode(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; int sasCore = cpu.gpr[4]; //int unk1 = cpu.gpr[5]; // 0, 1 (most common), 0x1f // 99% sure there are no more parameters Modules.log.warn("Unimplemented NID function __sceSasGetOutputmode [0xE175EF66] " + makeLogParams(cpu)); // beq t0 (t0=1) cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasSetOutputmode(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor Memory mem = Processor.memory; /* put your own code here instead */ // int a0 = cpu.gpr[4]; int a1 = cpu.gpr[5]; ... int t3 = cpu.gpr[11]; // float f12 = cpu.fpr[12]; float f13 = cpu.fpr[13]; ... float f19 = cpu.fpr[19]; Modules.log.warn("Unimplemented NID function __sceSasSetOutputmode [0xE855BF76] " + makeLogParams(cpu)); cpu.gpr[2] = 0xDEADC0DE; // cpu.gpr[2] = (int)(result & 0xffffffff); cpu.gpr[3] = (int)(result >>> 32); cpu.fpr[0] = result; } public void __sceSasRevVON(Processor processor) { CpuState cpu = processor.cpu; // New-Style Processor // Processor cpu = processor; // Old-Style Processor int sasCore = cpu.gpr[4]; int unk1 = cpu.gpr[5]; // set to 1 int unk2 = cpu.gpr[6]; // 0 or 1 // 99% sure there are no more parameters Modules.log.debug("IGNORING:__sceSasRevVON(" + String.format("sasCore=0x%08x,unk1=0x%x,unk2=0x%x)", sasCore, unk1, unk2)); cpu.gpr[2] = 0; } public final HLEModuleFunction __sceSasSetADSRFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetADSR") { @Override public final void execute(Processor processor) { __sceSasSetADSR(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetADSR(processor);"; } }; public final HLEModuleFunction __sceSasRevParamFunction = new HLEModuleFunction("sceSasCore", "__sceSasRevParam") { @Override public final void execute(Processor processor) { __sceSasRevParam(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasRevParam(processor);"; } }; public final HLEModuleFunction __sceSasGetPauseFlagFunction = new HLEModuleFunction("sceSasCore", "__sceSasGetPauseFlag") { @Override public final void execute(Processor processor) { __sceSasGetPauseFlag(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasGetPauseFlag(processor);"; } }; public final HLEModuleFunction __sceSasRevTypeFunction = new HLEModuleFunction("sceSasCore", "__sceSasRevType") { @Override public final void execute(Processor processor) { __sceSasRevType(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasRevType(processor);"; } }; public final HLEModuleFunction __sceSasInitFunction = new HLEModuleFunction("sceSasCore", "__sceSasInit") { @Override public final void execute(Processor processor) { __sceSasInit(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasInit(processor);"; } }; public final HLEModuleFunction __sceSasSetVolumeFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetVolume") { @Override public final void execute(Processor processor) { __sceSasSetVolume(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetVolume(processor);"; } }; public final HLEModuleFunction __sceSasCoreWithMixFunction = new HLEModuleFunction("sceSasCore", "__sceSasCoreWithMix") { @Override public final void execute(Processor processor) { __sceSasCoreWithMix(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasCoreWithMix(processor);"; } }; public final HLEModuleFunction __sceSasSetSLFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetSL") { @Override public final void execute(Processor processor) { __sceSasSetSL(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetSL(processor);"; } }; public final HLEModuleFunction __sceSasGetEndFlagFunction = new HLEModuleFunction("sceSasCore", "__sceSasGetEndFlag") { @Override public final void execute(Processor processor) { __sceSasGetEndFlag(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasGetEndFlag(processor);"; } }; public final HLEModuleFunction __sceSasGetEnvelopeHeightFunction = new HLEModuleFunction("sceSasCore", "__sceSasGetEnvelopeHeight") { @Override public final void execute(Processor processor) { __sceSasGetEnvelopeHeight(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasGetEnvelopeHeight(processor);"; } }; public final HLEModuleFunction __sceSasSetKeyOnFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetKeyOn") { @Override public final void execute(Processor processor) { __sceSasSetKeyOn(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetKeyOn(processor);"; } }; public final HLEModuleFunction __sceSasSetPauseFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetPause") { @Override public final void execute(Processor processor) { __sceSasSetPause(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetPause(processor);"; } }; public final HLEModuleFunction __sceSasSetVoiceFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetVoice") { @Override public final void execute(Processor processor) { __sceSasSetVoice(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetVoice(processor);"; } }; public final HLEModuleFunction __sceSasSetADSRmodeFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetADSRmode") { @Override public final void execute(Processor processor) { __sceSasSetADSRmode(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetADSRmode(processor);"; } }; public final HLEModuleFunction __sceSasSetKeyOffFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetKeyOff") { @Override public final void execute(Processor processor) { __sceSasSetKeyOff(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetKeyOff(processor);"; } }; public final HLEModuleFunction __sceSasSetTrianglarWaveFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetTrianglarWave") { @Override public final void execute(Processor processor) { __sceSasSetTrianglarWave(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetTrianglarWave(processor);"; } }; public final HLEModuleFunction __sceSasCoreFunction = new HLEModuleFunction("sceSasCore", "__sceSasCore") { @Override public final void execute(Processor processor) { __sceSasCore(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasCore(processor);"; } }; public final HLEModuleFunction __sceSasSetPitchFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetPitch") { @Override public final void execute(Processor processor) { __sceSasSetPitch(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetPitch(processor);"; } }; public final HLEModuleFunction __sceSasSetNoiseFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetNoise") { @Override public final void execute(Processor processor) { __sceSasSetNoise(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetNoise(processor);"; } }; public final HLEModuleFunction __sceSasGetGrainFunction = new HLEModuleFunction("sceSasCore", "__sceSasGetGrain") { @Override public final void execute(Processor processor) { __sceSasGetGrain(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasGetGrain(processor);"; } }; public final HLEModuleFunction __sceSasSetSimpleADSRFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetSimpleADSR") { @Override public final void execute(Processor processor) { __sceSasSetSimpleADSR(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetSimpleADSR(processor);"; } }; public final HLEModuleFunction __sceSasSetGrainFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetGrain") { @Override public final void execute(Processor processor) { __sceSasSetGrain(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetGrain(processor);"; } }; public final HLEModuleFunction __sceSasRevEVOLFunction = new HLEModuleFunction("sceSasCore", "__sceSasRevEVOL") { @Override public final void execute(Processor processor) { __sceSasRevEVOL(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasRevEVOL(processor);"; } }; public final HLEModuleFunction __sceSasSetSteepWaveFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetSteepWave") { @Override public final void execute(Processor processor) { __sceSasSetSteepWave(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetSteepWave(processor);"; } }; public final HLEModuleFunction __sceSasGetOutputmodeFunction = new HLEModuleFunction("sceSasCore", "__sceSasGetOutputmode") { @Override public final void execute(Processor processor) { __sceSasGetOutputmode(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasGetOutputmode(processor);"; } }; public final HLEModuleFunction __sceSasSetOutputmodeFunction = new HLEModuleFunction("sceSasCore", "__sceSasSetOutputmode") { @Override public final void execute(Processor processor) { __sceSasSetOutputmode(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasSetOutputmode(processor);"; } }; public final HLEModuleFunction __sceSasRevVONFunction = new HLEModuleFunction("sceSasCore", "__sceSasRevVON") { @Override public final void execute(Processor processor) { __sceSasRevVON(processor); } @Override public final String compiledString() { return "jpcsp.HLE.Modules.sceSasCoreModule.__sceSasRevVON(processor);"; } }; };
true
true
protected short[] decodeSamples(Processor processor, int vagAddr, int size) { Memory mem = Processor.memory; // Based on vgmstream short[] samples = new short[size / 16 * 28]; int numSamples = 0; int headerCheck = mem.read32(vagAddr); if ((headerCheck & 0x00FFFFFF) == 0x00474156) { // VAGx vagAddr += 0x30; // Skip the VAG header } int[] unpackedSamples = new int[28]; int hist1 = 0; int hist2 = 0; final double[][] VAG_f = { { 0.0 , 0.0 }, { 60.0 / 64.0, 0.0 }, { 115.0 / 64.0, -52.0 / 64.0 }, { 98.0 / 64.0, -55.0 / 64.0 }, { 122.0 / 64.0, -60.0 / 64.0 } }; for (int i = 0; i <= (size - 16); ) { int n = mem.read8(vagAddr + i); i++; int predict_nr = n >> 4; int shift_factor = n & 0x0F; int flag = mem.read8(vagAddr + i); i++; if (flag == 0x07) { break; // End of stream flag } for (int j = 0; j < 28; j += 2) { int d = mem.read8(vagAddr + i); i++; int s = (short) ((d & 0x0F) << 12); unpackedSamples[j] = s >> shift_factor; s = (short) ((d & 0xF0) << 8); unpackedSamples[j + 1] = s >> shift_factor; } for (int j = 0; j < 28; j++) { int sample = (int) (unpackedSamples[j] + hist1 * VAG_f[predict_nr][0] + hist2 * VAG_f[predict_nr][1]); hist2 = hist1; hist1 = sample; if (sample < -32768) { samples[numSamples] = -32768; } else if (sample > 0x7FFF) { samples[numSamples] = 0x7FFF; } else { samples[numSamples] = (short) sample; } numSamples++; } } if (samples.length != numSamples) { short[] resizedSamples = new short[numSamples]; for (int i = 0; i < numSamples; i++) { resizedSamples[i] = samples[i]; } samples = resizedSamples; } return samples; }
protected short[] decodeSamples(Processor processor, int vagAddr, int size) { Memory mem = Processor.memory; // Based on vgmstream short[] samples = new short[size / 16 * 28]; int numSamples = 0; int headerCheck = mem.read32(vagAddr); if ((headerCheck & 0x00FFFFFF) == 0x00474156) { // VAGx vagAddr += 0x30; // Skip the VAG header } int[] unpackedSamples = new int[28]; int hist1 = 0; int hist2 = 0; final double[][] VAG_f = { { 0.0 , 0.0 }, { 60.0 / 64.0, 0.0 }, { 115.0 / 64.0, -52.0 / 64.0 }, { 98.0 / 64.0, -55.0 / 64.0 }, { 122.0 / 64.0, -60.0 / 64.0 } }; for (int i = 0; i <= (size - 16); ) { int n = mem.read8(vagAddr + i); i++; int predict_nr = n >> 4; if (predict_nr >= VAG_f.length) { // predict_nr is supposed to be included in [0..4]. // TODO The game "Tenchu: TOTA" is using a value "predict_nr = 7", I could not find out how this value should be interpreted... Modules.log.warn("sceSasCore.decodeSamples: Unknown value for predict_nr: " + predict_nr); // Avoid ArrayIndexOutOfBoundsException predict_nr = 0; } int shift_factor = n & 0x0F; int flag = mem.read8(vagAddr + i); i++; if (flag == 0x07) { break; // End of stream flag } for (int j = 0; j < 28; j += 2) { int d = mem.read8(vagAddr + i); i++; int s = (short) ((d & 0x0F) << 12); unpackedSamples[j] = s >> shift_factor; s = (short) ((d & 0xF0) << 8); unpackedSamples[j + 1] = s >> shift_factor; } for (int j = 0; j < 28; j++) { int sample = (int) (unpackedSamples[j] + hist1 * VAG_f[predict_nr][0] + hist2 * VAG_f[predict_nr][1]); hist2 = hist1; hist1 = sample; if (sample < -32768) { samples[numSamples] = -32768; } else if (sample > 0x7FFF) { samples[numSamples] = 0x7FFF; } else { samples[numSamples] = (short) sample; } numSamples++; } } if (samples.length != numSamples) { short[] resizedSamples = new short[numSamples]; for (int i = 0; i < numSamples; i++) { resizedSamples[i] = samples[i]; } samples = resizedSamples; } return samples; }
diff --git a/src/org/cchmc/bmi/snpomics/annotation/interactive/HgvsProtName.java b/src/org/cchmc/bmi/snpomics/annotation/interactive/HgvsProtName.java index 9f7b190..3bdae0b 100644 --- a/src/org/cchmc/bmi/snpomics/annotation/interactive/HgvsProtName.java +++ b/src/org/cchmc/bmi/snpomics/annotation/interactive/HgvsProtName.java @@ -1,269 +1,273 @@ package org.cchmc.bmi.snpomics.annotation.interactive; import java.util.ArrayList; import java.util.List; import org.cchmc.bmi.snpomics.annotation.reference.TranscriptAnnotation; import org.cchmc.bmi.snpomics.translation.AminoAcid; public class HgvsProtName { public HgvsProtName(TranscriptAnnotation tx) { this.tx = tx; name = null; startCoord = 0; ref = null; alt = null; extension = null; isFrameshift = false; } public String getName() { if (name == null) buildName(); return name; } /** * The coordinate of the first amino acid specified to setRef(). The initiating Met has coordinate * 1, and then you count up. This is much easier than cDNA :) * @param startCoord */ public void setStartCoord(int startCoord) { this.startCoord = startCoord; } /** * The reference allele (in amino acids), including the AA before and after the change. * Do not extend beyond the coding sequence - so if the variation affects Met1, don't include * the preceding AA. */ public void setRef(List<AminoAcid> ref) { this.ref = ref; } /** * The alternate allele corresponding to the same region as the ref allele. If the mutation * is a frameshift, the alt allele should include translated sequence as far as possible (ie, * to the end of transcription). The same is true if the mutation destroys a stop codon * @param alt */ public void setAlt(List<AminoAcid> alt) { this.alt = alt; } /** * The protein sequence (for the reference) starting just after the allele set in setRef(). If * setFrameshift(true) has been called, the allele specified in setAlt() should also include this * DNA sequence (though it will of course be a different protein sequence due to the frameshift) * @param ext */ public void setExtension(List<AminoAcid> ext) { this.extension = ext; } public void setFrameshift(boolean isFrameshift) { this.isFrameshift = isFrameshift; } private void buildName() { if (startCoord == 0) { name = ""; return; } /* * Challenging cases: * * gCATga => gga * A* => G * p.Ala#_*#delinsGlyext*# (need to catch the readthrough and calculate the ext) * * caacgatcg => caTTGacgatcg * QRS => H*RS * p.Gln#delinsH* * * atgcgg => atCATgcgg * MR => ?MR * p.= (The insertion extends the UTR, but doesn't change the protein product) */ StringBuilder sb = new StringBuilder(); String protein = tx.getProtID(); if (protein != null && !protein.isEmpty()) { sb.append(protein); sb.append(":"); } sb.append("p.("); if (ref.equals(alt)) //Synonymous sb.append("="); else { if (extension != null) { ref.addAll(extension); if (!isFrameshift) alt.addAll(extension); } //Find the region that actually changed int leftFlank = 0; int rightFlank = 0; boolean isPotentialDuplicate = false; while (leftFlank < ref.size() && leftFlank < alt.size() && ref.get(leftFlank) == alt.get(leftFlank)) { leftFlank++; } while (rightFlank < ref.size() && rightFlank < alt.size() && ref.get(ref.size()-rightFlank-1) == alt.get(alt.size()-rightFlank-1)) { rightFlank++; } //If a duplicating insertion is made (or a deletion from a rpt region), //both leftFlank and rightFlank will go through the repeat region //Ex: //ABXXCD => ABXXXCD //leftFlank and rightFlank will both be 4 if (leftFlank+rightFlank > ref.size() || leftFlank+rightFlank > alt.size()) { rightFlank = Math.min(ref.size(), alt.size())-leftFlank; if (alt.size() > ref.size()) isPotentialDuplicate = true; } //Now make a new list containing just the changes //All of these manipulations are necessary because we need to know the flanking //AAs for an insertion - otherwise, we could have just started with the change List<AminoAcid> refAllele = new ArrayList<AminoAcid>(ref.subList(leftFlank, ref.size()-rightFlank)); List<AminoAcid> altAllele = new ArrayList<AminoAcid>(alt.subList(leftFlank, alt.size()-rightFlank)); String extType = ""; int extension = -1; //Some of these special conditions can be caused by indels or substitutions, //and we're worried about effect here, not cause. //So identify some of the overarching conditions, and caress the extraneous data //accordingly if (!isFrameshift && refAllele.contains(AminoAcid.STOP)) { //readthrough - everything after the old stop is unimportant, except that //we need to find the new stop if (altAllele.size() > 1) { //We'll only report the first new amino acid (altAllele might be empty here, so the if is important!) altAllele.clear(); altAllele.add(alt.get(leftFlank)); } extType = "ext"; extension = alt.subList(leftFlank, alt.size()).indexOf(AminoAcid.STOP); if (extension > 0) extension++; //If we found it, make it one-based } else if (!altAllele.isEmpty() && altAllele.get(0) == AminoAcid.STOP) { //nonsense - this is reported simply as a substitution, so just make sure //that it looks like a subst when we get to it later. Importantly, if the first //AA modified by frameshift is a stop, don't report it as a fs if (refAllele.size() > 1) { //Analogous to the modification to altAllele in the readthrough case refAllele.clear(); refAllele.add(ref.get(leftFlank)); } + if (altAllele.size() > 1) { + altAllele.clear(); + altAllele.add(alt.get(leftFlank)); + } } else if (!refAllele.isEmpty() && refAllele.get(0) == AminoAcid.MET && startCoord+leftFlank == 1) { //start-loss altAllele.clear(); if (refAllele.size() > 1) refAllele.subList(1, refAllele.size()).clear(); } else if (isFrameshift) { if (refAllele.size() > 1) { refAllele.clear(); refAllele.add(ref.get(leftFlank)); } if (altAllele.size() > 1) { altAllele.clear(); altAllele.add(alt.get(leftFlank)); } extType = "fs"; extension = alt.subList(leftFlank, alt.size()).indexOf(AminoAcid.STOP); if (extension > 0) extension++; //If we found it, make it one-based } //Now that the messy conditions have been cleaned up, it's pretty easy to describe the changes if (refAllele.size() == 1 && altAllele.size() == 1) { //substitution sb.append(refAllele.get(0).abbrev()); sb.append(startCoord+leftFlank); sb.append(altAllele.get(0).abbrev()); } else if (refAllele.isEmpty()) { //straight insertion - special because the site is identified by flanks if (startCoord+leftFlank == 1) { //Special case: Insertions before the initial Met are not real name = ""; return; } else if (isPotentialDuplicate && ref.subList(leftFlank-altAllele.size(), leftFlank).equals(altAllele)) { int dupLen = altAllele.size(); if (leftFlank <= dupLen) sb.append("Unk"); else sb.append(ref.get(leftFlank-dupLen).abbrev()); sb.append(startCoord+leftFlank-dupLen); if (dupLen > 1) { sb.append("_"); if (leftFlank == 0) sb.append("Unk"); else sb.append(ref.get(leftFlank-1).abbrev()); sb.append(startCoord+leftFlank-1); } sb.append("dup"); } else { if (leftFlank == 0) sb.append("Unk"); else sb.append(ref.get(leftFlank-1).abbrev()); sb.append(startCoord+leftFlank-1); sb.append("_"); if (rightFlank == 0) sb.append("Unk"); else sb.append(ref.get(ref.size()-rightFlank).abbrev()); sb.append(startCoord+leftFlank); sb.append("ins"); for (AminoAcid aa : altAllele) sb.append(aa.abbrev()); } } else { //Straight deletion or indel if (startCoord+leftFlank == 1 && altAllele.isEmpty() && refAllele.get(0) == AminoAcid.MET) { //Special case: Start loss (normalized to this form above) sb.append("Met1?"); } else { sb.append(refAllele.get(0).abbrev()); sb.append(startCoord+leftFlank); if (refAllele.size() > 1) { sb.append("_"); sb.append(refAllele.get(refAllele.size()-1).abbrev()); sb.append(startCoord+leftFlank+refAllele.size()-1); } sb.append("del"); if (!altAllele.isEmpty()) { sb.append("ins"); for (AminoAcid aa : altAllele) sb.append(aa.abbrev()); } } } if (!extType.equals("")) { sb.append(extType); sb.append("*"); if (extension > 0) sb.append(extension); else sb.append("?"); } } sb.append(")"); name = sb.toString(); } private TranscriptAnnotation tx; private String name; private int startCoord; private List<AminoAcid> ref; private List<AminoAcid> alt; private List<AminoAcid> extension; private boolean isFrameshift; }
true
true
private void buildName() { if (startCoord == 0) { name = ""; return; } /* * Challenging cases: * * gCATga => gga * A* => G * p.Ala#_*#delinsGlyext*# (need to catch the readthrough and calculate the ext) * * caacgatcg => caTTGacgatcg * QRS => H*RS * p.Gln#delinsH* * * atgcgg => atCATgcgg * MR => ?MR * p.= (The insertion extends the UTR, but doesn't change the protein product) */ StringBuilder sb = new StringBuilder(); String protein = tx.getProtID(); if (protein != null && !protein.isEmpty()) { sb.append(protein); sb.append(":"); } sb.append("p.("); if (ref.equals(alt)) //Synonymous sb.append("="); else { if (extension != null) { ref.addAll(extension); if (!isFrameshift) alt.addAll(extension); } //Find the region that actually changed int leftFlank = 0; int rightFlank = 0; boolean isPotentialDuplicate = false; while (leftFlank < ref.size() && leftFlank < alt.size() && ref.get(leftFlank) == alt.get(leftFlank)) { leftFlank++; } while (rightFlank < ref.size() && rightFlank < alt.size() && ref.get(ref.size()-rightFlank-1) == alt.get(alt.size()-rightFlank-1)) { rightFlank++; } //If a duplicating insertion is made (or a deletion from a rpt region), //both leftFlank and rightFlank will go through the repeat region //Ex: //ABXXCD => ABXXXCD //leftFlank and rightFlank will both be 4 if (leftFlank+rightFlank > ref.size() || leftFlank+rightFlank > alt.size()) { rightFlank = Math.min(ref.size(), alt.size())-leftFlank; if (alt.size() > ref.size()) isPotentialDuplicate = true; } //Now make a new list containing just the changes //All of these manipulations are necessary because we need to know the flanking //AAs for an insertion - otherwise, we could have just started with the change List<AminoAcid> refAllele = new ArrayList<AminoAcid>(ref.subList(leftFlank, ref.size()-rightFlank)); List<AminoAcid> altAllele = new ArrayList<AminoAcid>(alt.subList(leftFlank, alt.size()-rightFlank)); String extType = ""; int extension = -1; //Some of these special conditions can be caused by indels or substitutions, //and we're worried about effect here, not cause. //So identify some of the overarching conditions, and caress the extraneous data //accordingly if (!isFrameshift && refAllele.contains(AminoAcid.STOP)) { //readthrough - everything after the old stop is unimportant, except that //we need to find the new stop if (altAllele.size() > 1) { //We'll only report the first new amino acid (altAllele might be empty here, so the if is important!) altAllele.clear(); altAllele.add(alt.get(leftFlank)); } extType = "ext"; extension = alt.subList(leftFlank, alt.size()).indexOf(AminoAcid.STOP); if (extension > 0) extension++; //If we found it, make it one-based } else if (!altAllele.isEmpty() && altAllele.get(0) == AminoAcid.STOP) { //nonsense - this is reported simply as a substitution, so just make sure //that it looks like a subst when we get to it later. Importantly, if the first //AA modified by frameshift is a stop, don't report it as a fs if (refAllele.size() > 1) { //Analogous to the modification to altAllele in the readthrough case refAllele.clear(); refAllele.add(ref.get(leftFlank)); } } else if (!refAllele.isEmpty() && refAllele.get(0) == AminoAcid.MET && startCoord+leftFlank == 1) { //start-loss altAllele.clear(); if (refAllele.size() > 1) refAllele.subList(1, refAllele.size()).clear(); } else if (isFrameshift) { if (refAllele.size() > 1) { refAllele.clear(); refAllele.add(ref.get(leftFlank)); } if (altAllele.size() > 1) { altAllele.clear(); altAllele.add(alt.get(leftFlank)); } extType = "fs"; extension = alt.subList(leftFlank, alt.size()).indexOf(AminoAcid.STOP); if (extension > 0) extension++; //If we found it, make it one-based } //Now that the messy conditions have been cleaned up, it's pretty easy to describe the changes if (refAllele.size() == 1 && altAllele.size() == 1) { //substitution sb.append(refAllele.get(0).abbrev()); sb.append(startCoord+leftFlank); sb.append(altAllele.get(0).abbrev()); } else if (refAllele.isEmpty()) { //straight insertion - special because the site is identified by flanks if (startCoord+leftFlank == 1) { //Special case: Insertions before the initial Met are not real name = ""; return; } else if (isPotentialDuplicate && ref.subList(leftFlank-altAllele.size(), leftFlank).equals(altAllele)) { int dupLen = altAllele.size(); if (leftFlank <= dupLen) sb.append("Unk"); else sb.append(ref.get(leftFlank-dupLen).abbrev()); sb.append(startCoord+leftFlank-dupLen); if (dupLen > 1) { sb.append("_"); if (leftFlank == 0) sb.append("Unk"); else sb.append(ref.get(leftFlank-1).abbrev()); sb.append(startCoord+leftFlank-1); } sb.append("dup"); } else { if (leftFlank == 0) sb.append("Unk"); else sb.append(ref.get(leftFlank-1).abbrev()); sb.append(startCoord+leftFlank-1); sb.append("_"); if (rightFlank == 0) sb.append("Unk"); else sb.append(ref.get(ref.size()-rightFlank).abbrev()); sb.append(startCoord+leftFlank); sb.append("ins"); for (AminoAcid aa : altAllele) sb.append(aa.abbrev()); } } else { //Straight deletion or indel if (startCoord+leftFlank == 1 && altAllele.isEmpty() && refAllele.get(0) == AminoAcid.MET) { //Special case: Start loss (normalized to this form above) sb.append("Met1?"); } else { sb.append(refAllele.get(0).abbrev()); sb.append(startCoord+leftFlank); if (refAllele.size() > 1) { sb.append("_"); sb.append(refAllele.get(refAllele.size()-1).abbrev()); sb.append(startCoord+leftFlank+refAllele.size()-1); } sb.append("del"); if (!altAllele.isEmpty()) { sb.append("ins"); for (AminoAcid aa : altAllele) sb.append(aa.abbrev()); } } } if (!extType.equals("")) { sb.append(extType); sb.append("*"); if (extension > 0) sb.append(extension); else sb.append("?"); } } sb.append(")"); name = sb.toString(); }
private void buildName() { if (startCoord == 0) { name = ""; return; } /* * Challenging cases: * * gCATga => gga * A* => G * p.Ala#_*#delinsGlyext*# (need to catch the readthrough and calculate the ext) * * caacgatcg => caTTGacgatcg * QRS => H*RS * p.Gln#delinsH* * * atgcgg => atCATgcgg * MR => ?MR * p.= (The insertion extends the UTR, but doesn't change the protein product) */ StringBuilder sb = new StringBuilder(); String protein = tx.getProtID(); if (protein != null && !protein.isEmpty()) { sb.append(protein); sb.append(":"); } sb.append("p.("); if (ref.equals(alt)) //Synonymous sb.append("="); else { if (extension != null) { ref.addAll(extension); if (!isFrameshift) alt.addAll(extension); } //Find the region that actually changed int leftFlank = 0; int rightFlank = 0; boolean isPotentialDuplicate = false; while (leftFlank < ref.size() && leftFlank < alt.size() && ref.get(leftFlank) == alt.get(leftFlank)) { leftFlank++; } while (rightFlank < ref.size() && rightFlank < alt.size() && ref.get(ref.size()-rightFlank-1) == alt.get(alt.size()-rightFlank-1)) { rightFlank++; } //If a duplicating insertion is made (or a deletion from a rpt region), //both leftFlank and rightFlank will go through the repeat region //Ex: //ABXXCD => ABXXXCD //leftFlank and rightFlank will both be 4 if (leftFlank+rightFlank > ref.size() || leftFlank+rightFlank > alt.size()) { rightFlank = Math.min(ref.size(), alt.size())-leftFlank; if (alt.size() > ref.size()) isPotentialDuplicate = true; } //Now make a new list containing just the changes //All of these manipulations are necessary because we need to know the flanking //AAs for an insertion - otherwise, we could have just started with the change List<AminoAcid> refAllele = new ArrayList<AminoAcid>(ref.subList(leftFlank, ref.size()-rightFlank)); List<AminoAcid> altAllele = new ArrayList<AminoAcid>(alt.subList(leftFlank, alt.size()-rightFlank)); String extType = ""; int extension = -1; //Some of these special conditions can be caused by indels or substitutions, //and we're worried about effect here, not cause. //So identify some of the overarching conditions, and caress the extraneous data //accordingly if (!isFrameshift && refAllele.contains(AminoAcid.STOP)) { //readthrough - everything after the old stop is unimportant, except that //we need to find the new stop if (altAllele.size() > 1) { //We'll only report the first new amino acid (altAllele might be empty here, so the if is important!) altAllele.clear(); altAllele.add(alt.get(leftFlank)); } extType = "ext"; extension = alt.subList(leftFlank, alt.size()).indexOf(AminoAcid.STOP); if (extension > 0) extension++; //If we found it, make it one-based } else if (!altAllele.isEmpty() && altAllele.get(0) == AminoAcid.STOP) { //nonsense - this is reported simply as a substitution, so just make sure //that it looks like a subst when we get to it later. Importantly, if the first //AA modified by frameshift is a stop, don't report it as a fs if (refAllele.size() > 1) { //Analogous to the modification to altAllele in the readthrough case refAllele.clear(); refAllele.add(ref.get(leftFlank)); } if (altAllele.size() > 1) { altAllele.clear(); altAllele.add(alt.get(leftFlank)); } } else if (!refAllele.isEmpty() && refAllele.get(0) == AminoAcid.MET && startCoord+leftFlank == 1) { //start-loss altAllele.clear(); if (refAllele.size() > 1) refAllele.subList(1, refAllele.size()).clear(); } else if (isFrameshift) { if (refAllele.size() > 1) { refAllele.clear(); refAllele.add(ref.get(leftFlank)); } if (altAllele.size() > 1) { altAllele.clear(); altAllele.add(alt.get(leftFlank)); } extType = "fs"; extension = alt.subList(leftFlank, alt.size()).indexOf(AminoAcid.STOP); if (extension > 0) extension++; //If we found it, make it one-based } //Now that the messy conditions have been cleaned up, it's pretty easy to describe the changes if (refAllele.size() == 1 && altAllele.size() == 1) { //substitution sb.append(refAllele.get(0).abbrev()); sb.append(startCoord+leftFlank); sb.append(altAllele.get(0).abbrev()); } else if (refAllele.isEmpty()) { //straight insertion - special because the site is identified by flanks if (startCoord+leftFlank == 1) { //Special case: Insertions before the initial Met are not real name = ""; return; } else if (isPotentialDuplicate && ref.subList(leftFlank-altAllele.size(), leftFlank).equals(altAllele)) { int dupLen = altAllele.size(); if (leftFlank <= dupLen) sb.append("Unk"); else sb.append(ref.get(leftFlank-dupLen).abbrev()); sb.append(startCoord+leftFlank-dupLen); if (dupLen > 1) { sb.append("_"); if (leftFlank == 0) sb.append("Unk"); else sb.append(ref.get(leftFlank-1).abbrev()); sb.append(startCoord+leftFlank-1); } sb.append("dup"); } else { if (leftFlank == 0) sb.append("Unk"); else sb.append(ref.get(leftFlank-1).abbrev()); sb.append(startCoord+leftFlank-1); sb.append("_"); if (rightFlank == 0) sb.append("Unk"); else sb.append(ref.get(ref.size()-rightFlank).abbrev()); sb.append(startCoord+leftFlank); sb.append("ins"); for (AminoAcid aa : altAllele) sb.append(aa.abbrev()); } } else { //Straight deletion or indel if (startCoord+leftFlank == 1 && altAllele.isEmpty() && refAllele.get(0) == AminoAcid.MET) { //Special case: Start loss (normalized to this form above) sb.append("Met1?"); } else { sb.append(refAllele.get(0).abbrev()); sb.append(startCoord+leftFlank); if (refAllele.size() > 1) { sb.append("_"); sb.append(refAllele.get(refAllele.size()-1).abbrev()); sb.append(startCoord+leftFlank+refAllele.size()-1); } sb.append("del"); if (!altAllele.isEmpty()) { sb.append("ins"); for (AminoAcid aa : altAllele) sb.append(aa.abbrev()); } } } if (!extType.equals("")) { sb.append(extType); sb.append("*"); if (extension > 0) sb.append(extension); else sb.append("?"); } } sb.append(")"); name = sb.toString(); }
diff --git a/plugins/org.eclipse.mylyn.docs.intent.client.ui/src/org/eclipse/mylyn/docs/intent/client/ui/editor/quickfix/IntentSynchronizationCompletionProposal.java b/plugins/org.eclipse.mylyn.docs.intent.client.ui/src/org/eclipse/mylyn/docs/intent/client/ui/editor/quickfix/IntentSynchronizationCompletionProposal.java index a46083fd..d5719de0 100644 --- a/plugins/org.eclipse.mylyn.docs.intent.client.ui/src/org/eclipse/mylyn/docs/intent/client/ui/editor/quickfix/IntentSynchronizationCompletionProposal.java +++ b/plugins/org.eclipse.mylyn.docs.intent.client.ui/src/org/eclipse/mylyn/docs/intent/client/ui/editor/quickfix/IntentSynchronizationCompletionProposal.java @@ -1,442 +1,442 @@ /******************************************************************************* * Copyright (c) 2010, 2011 Obeo. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/epl-v10.html * * Contributors: * Obeo - initial API and implementation *******************************************************************************/ package org.eclipse.mylyn.docs.intent.client.ui.editor.quickfix; import java.util.Collection; import org.eclipse.compare.CompareConfiguration; import org.eclipse.compare.CompareUI; import org.eclipse.core.commands.Command; import org.eclipse.core.commands.ExecutionEvent; import org.eclipse.core.commands.ExecutionException; import org.eclipse.core.commands.IHandler; import org.eclipse.core.commands.NotEnabledException; import org.eclipse.core.commands.NotHandledException; import org.eclipse.core.commands.ParameterizedCommand; import org.eclipse.core.commands.common.NotDefinedException; import org.eclipse.core.expressions.Expression; import org.eclipse.core.expressions.IEvaluationContext; import org.eclipse.emf.common.util.URI; import org.eclipse.emf.compare.diff.metamodel.ComparisonResourceSnapshot; import org.eclipse.emf.compare.diff.metamodel.ComparisonSnapshot; import org.eclipse.emf.compare.diff.metamodel.DiffFactory; import org.eclipse.emf.compare.diff.metamodel.DiffModel; import org.eclipse.emf.compare.diff.service.DiffService; import org.eclipse.emf.compare.match.metamodel.MatchModel; import org.eclipse.emf.compare.match.service.MatchService; import org.eclipse.emf.compare.ui.editor.ModelCompareEditorInput; import org.eclipse.emf.ecore.resource.Resource; import org.eclipse.emf.ecore.resource.impl.ResourceSetImpl; import org.eclipse.jface.text.IDocument; import org.eclipse.jface.text.contentassist.ICompletionProposal; import org.eclipse.jface.text.contentassist.IContextInformation; import org.eclipse.jface.text.source.Annotation; import org.eclipse.mylyn.docs.intent.client.ui.IntentEditorActivator; import org.eclipse.mylyn.docs.intent.client.ui.editor.annotation.IntentAnnotation; import org.eclipse.swt.graphics.Image; import org.eclipse.swt.graphics.Point; import org.eclipse.swt.widgets.Event; import org.eclipse.ui.ISourceProvider; import org.eclipse.ui.IWorkbenchPart; import org.eclipse.ui.PlatformUI; import org.eclipse.ui.handlers.IHandlerActivation; import org.eclipse.ui.handlers.IHandlerService; import org.eclipse.ui.services.IServiceLocator; /** * {@link ICompletionProposal} used to fix a Synchronization issue by opening the compare Editor. * * @author <a href="mailto:[email protected]">Alex Lagarde</a> */ public class IntentSynchronizationCompletionProposal implements ICompletionProposal { private static final String COMPARE_EDITOR_TITLE = "Comparing Intent Document and Working Copy"; private IntentAnnotation syncAnnotation; /** * Default constructor. * * @param annotation * the {@link IntentAnnotation} describing the synchronization issue. */ public IntentSynchronizationCompletionProposal(Annotation annotation) { this.syncAnnotation = (IntentAnnotation)annotation; } /** * {@inheritDoc} * * @see org.eclipse.jface.text.contentassist.ICompletionProposal#apply(org.eclipse.jface.text.IDocument) */ public void apply(IDocument document) { // Step 1 : getting the resources to compare URI - String generatedResourceURI = syncAnnotation.getAdditionalInformations().iterator().next() + String workingCopyResourceURI = syncAnnotation.getAdditionalInformations().iterator().next() .replace("\"", ""); - String workingCopyResourceURI = ((String)syncAnnotation.getAdditionalInformations().toArray()[1]) + String generatedResourceURI = ((String)syncAnnotation.getAdditionalInformations().toArray()[1]) .replace("\"", ""); // Step 2 : loading the resources ResourceSetImpl rs = new ResourceSetImpl(); Resource generatedResource = rs.getResource(URI.createURI(generatedResourceURI), true); Resource workingCopyResource = rs.getResource(URI.createURI(workingCopyResourceURI), true); // Step 3 : opening a new Compare Editor on these two resources try { // Step 3.1 : making match and diff MatchModel match = MatchService.doResourceMatch(generatedResource, workingCopyResource, null); DiffModel diff = DiffService.doDiff(match, false); // Step 3.2 : creating a comparaison snapshot from this diff ComparisonResourceSnapshot snapshot = DiffFactory.eINSTANCE.createComparisonResourceSnapshot(); snapshot.setDiff(diff); snapshot.setMatch(match); // Step 3.3 : open a compare dialog final CompareConfiguration compareConfig = new IntentCompareConfiguration(generatedResource, workingCopyResource); ModelCompareEditorInput input = new IntentCompareEditorInput(snapshot, compareConfig); compareConfig.setContainer(input); input.setTitle(COMPARE_EDITOR_TITLE + " (" + workingCopyResourceURI + ")"); CompareUI.openCompareDialog(input); } catch (InterruptedException e) { // Editor will not be opened } } /** * {@inheritDoc} * * @see org.eclipse.jface.text.contentassist.ICompletionProposal#getSelection(org.eclipse.jface.text.IDocument) */ public Point getSelection(IDocument document) { return null; } /** * {@inheritDoc} * * @see org.eclipse.jface.text.contentassist.ICompletionProposal#getAdditionalProposalInfo() */ public String getAdditionalProposalInfo() { return ""; } /** * {@inheritDoc} * * @see org.eclipse.jface.text.contentassist.ICompletionProposal#getDisplayString() */ public String getDisplayString() { return "See differences in Compare Editor"; } /** * {@inheritDoc} * * @see org.eclipse.jface.text.contentassist.ICompletionProposal#getImage() */ public Image getImage() { return IntentEditorActivator.getDefault().getImage("icon/annotation/sync-warning.gif"); } /** * {@inheritDoc} * * @see org.eclipse.jface.text.contentassist.ICompletionProposal#getContextInformation() */ public IContextInformation getContextInformation() { return null; } /** * A custom CompareEditorInput for Intent. * * @author alagarde */ private class IntentCompareEditorInput extends ModelCompareEditorInput { private CompareConfiguration compareConfig; /** * This constructor takes a {@link ComparisonSnapshot} as input. * * @param snapshot * The ComparisonSnapshot loaded from an emfdiff. * @param compareConfig * the compare config */ public IntentCompareEditorInput(ComparisonSnapshot snapshot, CompareConfiguration compareConfig) { super(snapshot); this.compareConfig = compareConfig; } /** * {@inheritDoc} * * @see org.eclipse.compare.CompareEditorInput#getCompareConfiguration() */ @Override public CompareConfiguration getCompareConfiguration() { return compareConfig; } /** * {@inheritDoc} * * @see org.eclipse.compare.CompareEditorInput#getWorkbenchPart() */ @Override public IWorkbenchPart getWorkbenchPart() { return PlatformUI.getWorkbench().getActiveWorkbenchWindow().getActivePage().getActiveEditor(); } /** * {@inheritDoc} * * @see org.eclipse.compare.CompareEditorInput#getServiceLocator() */ @Override public IServiceLocator getServiceLocator() { return new IServiceLocator() { public boolean hasService(Class api) { if (api.equals(IHandlerService.class)) { return true; } return false; } public Object getService(Class api) { if (api.equals(IHandlerService.class)) { return new IntentCompareHandlerService(); } return null; } }; } } /** * A IHandlerService for Intent. * * @author alagarde */ private class IntentCompareHandlerService implements IHandlerService { /** * {@inheritDoc} * * @see org.eclipse.ui.services.IDisposable#dispose() */ public void dispose() { } /** * {@inheritDoc} * * @see org.eclipse.ui.services.IServiceWithSources#removeSourceProvider(org.eclipse.ui.ISourceProvider) */ public void removeSourceProvider(ISourceProvider provider) { } /** * {@inheritDoc} * * @see org.eclipse.ui.services.IServiceWithSources#addSourceProvider(org.eclipse.ui.ISourceProvider) */ public void addSourceProvider(ISourceProvider provider) { } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#setHelpContextId(org.eclipse.core.commands.IHandler, * java.lang.String) */ public void setHelpContextId(IHandler handler, String helpContextId) { } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#readRegistry() */ public void readRegistry() { } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#getCurrentState() */ public IEvaluationContext getCurrentState() { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#executeCommandInContext(org.eclipse.core.commands.ParameterizedCommand, * org.eclipse.swt.widgets.Event, org.eclipse.core.expressions.IEvaluationContext) */ // CHECKSTYLE:OFF public Object executeCommandInContext(ParameterizedCommand command, Event event, IEvaluationContext context) throws ExecutionException, NotDefinedException, NotEnabledException, NotHandledException { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#executeCommand(org.eclipse.core.commands.ParameterizedCommand, * org.eclipse.swt.widgets.Event) */ public Object executeCommand(ParameterizedCommand command, Event event) throws ExecutionException, NotDefinedException, NotEnabledException, NotHandledException { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#executeCommand(java.lang.String, * org.eclipse.swt.widgets.Event) */ public Object executeCommand(String commandId, Event event) throws ExecutionException, NotDefinedException, NotEnabledException, NotHandledException { return null; } // CHECKSTYLE:ON /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#deactivateHandlers(java.util.Collection) */ public void deactivateHandlers(Collection activations) { } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#deactivateHandler(org.eclipse.ui.handlers.IHandlerActivation) */ public void deactivateHandler(IHandlerActivation activation) { } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#createExecutionEvent(org.eclipse.core.commands.ParameterizedCommand, * org.eclipse.swt.widgets.Event) */ public ExecutionEvent createExecutionEvent(ParameterizedCommand command, Event event) { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#createExecutionEvent(org.eclipse.core.commands.Command, * org.eclipse.swt.widgets.Event) */ public ExecutionEvent createExecutionEvent(Command command, Event event) { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#createContextSnapshot(boolean) */ public IEvaluationContext createContextSnapshot(boolean includeSelection) { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#activateHandler(java.lang.String, * org.eclipse.core.commands.IHandler, org.eclipse.core.expressions.Expression, int) */ public IHandlerActivation activateHandler(String commandId, IHandler handler, Expression expression, int sourcePriorities) { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#activateHandler(java.lang.String, * org.eclipse.core.commands.IHandler, org.eclipse.core.expressions.Expression, boolean) */ public IHandlerActivation activateHandler(String commandId, IHandler handler, Expression expression, boolean global) { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#activateHandler(java.lang.String, * org.eclipse.core.commands.IHandler, org.eclipse.core.expressions.Expression) */ public IHandlerActivation activateHandler(String commandId, IHandler handler, Expression expression) { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#activateHandler(java.lang.String, * org.eclipse.core.commands.IHandler) */ public IHandlerActivation activateHandler(String commandId, IHandler handler) { return null; } /** * {@inheritDoc} * * @see org.eclipse.ui.handlers.IHandlerService#activateHandler(org.eclipse.ui.handlers.IHandlerActivation) */ public IHandlerActivation activateHandler(IHandlerActivation activation) { return null; } } }
false
true
public void apply(IDocument document) { // Step 1 : getting the resources to compare URI String generatedResourceURI = syncAnnotation.getAdditionalInformations().iterator().next() .replace("\"", ""); String workingCopyResourceURI = ((String)syncAnnotation.getAdditionalInformations().toArray()[1]) .replace("\"", ""); // Step 2 : loading the resources ResourceSetImpl rs = new ResourceSetImpl(); Resource generatedResource = rs.getResource(URI.createURI(generatedResourceURI), true); Resource workingCopyResource = rs.getResource(URI.createURI(workingCopyResourceURI), true); // Step 3 : opening a new Compare Editor on these two resources try { // Step 3.1 : making match and diff MatchModel match = MatchService.doResourceMatch(generatedResource, workingCopyResource, null); DiffModel diff = DiffService.doDiff(match, false); // Step 3.2 : creating a comparaison snapshot from this diff ComparisonResourceSnapshot snapshot = DiffFactory.eINSTANCE.createComparisonResourceSnapshot(); snapshot.setDiff(diff); snapshot.setMatch(match); // Step 3.3 : open a compare dialog final CompareConfiguration compareConfig = new IntentCompareConfiguration(generatedResource, workingCopyResource); ModelCompareEditorInput input = new IntentCompareEditorInput(snapshot, compareConfig); compareConfig.setContainer(input); input.setTitle(COMPARE_EDITOR_TITLE + " (" + workingCopyResourceURI + ")"); CompareUI.openCompareDialog(input); } catch (InterruptedException e) { // Editor will not be opened } }
public void apply(IDocument document) { // Step 1 : getting the resources to compare URI String workingCopyResourceURI = syncAnnotation.getAdditionalInformations().iterator().next() .replace("\"", ""); String generatedResourceURI = ((String)syncAnnotation.getAdditionalInformations().toArray()[1]) .replace("\"", ""); // Step 2 : loading the resources ResourceSetImpl rs = new ResourceSetImpl(); Resource generatedResource = rs.getResource(URI.createURI(generatedResourceURI), true); Resource workingCopyResource = rs.getResource(URI.createURI(workingCopyResourceURI), true); // Step 3 : opening a new Compare Editor on these two resources try { // Step 3.1 : making match and diff MatchModel match = MatchService.doResourceMatch(generatedResource, workingCopyResource, null); DiffModel diff = DiffService.doDiff(match, false); // Step 3.2 : creating a comparaison snapshot from this diff ComparisonResourceSnapshot snapshot = DiffFactory.eINSTANCE.createComparisonResourceSnapshot(); snapshot.setDiff(diff); snapshot.setMatch(match); // Step 3.3 : open a compare dialog final CompareConfiguration compareConfig = new IntentCompareConfiguration(generatedResource, workingCopyResource); ModelCompareEditorInput input = new IntentCompareEditorInput(snapshot, compareConfig); compareConfig.setContainer(input); input.setTitle(COMPARE_EDITOR_TITLE + " (" + workingCopyResourceURI + ")"); CompareUI.openCompareDialog(input); } catch (InterruptedException e) { // Editor will not be opened } }
diff --git a/src/net/sf/drftpd/master/command/plugins/Dir.java b/src/net/sf/drftpd/master/command/plugins/Dir.java index 557f3118..0ed748cc 100644 --- a/src/net/sf/drftpd/master/command/plugins/Dir.java +++ b/src/net/sf/drftpd/master/command/plugins/Dir.java @@ -1,970 +1,969 @@ /* * This file is part of DrFTPD, Distributed FTP Daemon. * * DrFTPD is free software; you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation; either version 2 of the License, or * (at your option) any later version. * * DrFTPD is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with DrFTPD; if not, write to the Free Software * Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */ package net.sf.drftpd.master.command.plugins; import net.sf.drftpd.Checksum; import net.sf.drftpd.FileExistsException; import net.sf.drftpd.NoAvailableSlaveException; import net.sf.drftpd.event.DirectoryFtpEvent; import net.sf.drftpd.master.BaseFtpConnection; import net.sf.drftpd.master.FtpRequest; import net.sf.drftpd.master.GroupPosition; import net.sf.drftpd.master.UploaderPosition; import net.sf.drftpd.master.command.CommandManager; import net.sf.drftpd.master.command.CommandManagerFactory; import net.sf.drftpd.util.ListUtils; import net.sf.drftpd.util.ReplacerUtils; import org.apache.log4j.Level; import org.apache.log4j.Logger; import org.drftpd.Bytes; import org.drftpd.SFVFile; import org.drftpd.commands.CommandHandler; import org.drftpd.commands.CommandHandlerFactory; import org.drftpd.commands.Reply; import org.drftpd.commands.UnhandledCommandException; import org.drftpd.commands.UserManagment; import org.drftpd.id3.ID3Tag; import org.drftpd.plugins.SiteBot; import org.drftpd.remotefile.LinkedRemoteFile; import org.drftpd.remotefile.LinkedRemoteFileInterface; import org.drftpd.remotefile.StaticRemoteFile; import org.drftpd.remotefile.LinkedRemoteFile.NonExistingFile; import org.drftpd.usermanager.NoSuchUserException; import org.drftpd.usermanager.User; import org.drftpd.usermanager.UserFileException; import org.tanesha.replacer.FormatterException; import org.tanesha.replacer.ReplacerEnvironment; import org.tanesha.replacer.ReplacerFormat; import org.tanesha.replacer.SimplePrintf; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.IOException; import java.text.SimpleDateFormat; import java.util.Collection; import java.util.Date; import java.util.Iterator; import java.util.Properties; import java.util.StringTokenizer; /** * @author mog * @version $Id$ */ public class Dir implements CommandHandlerFactory, CommandHandler, Cloneable { private final static SimpleDateFormat DATE_FMT = new SimpleDateFormat( "yyyyMMddHHmmss.SSS"); private static final Logger logger = Logger.getLogger(Dir.class); protected LinkedRemoteFileInterface _renameFrom = null; public Dir() { super(); } /** * <code>CDUP &lt;CRLF&gt;</code><br> * * This command is a special case of CWD, and is included to * simplify the implementation of programs for transferring * directory trees between operating systems having different * syntaxes for naming the parent directory. The reply codes * shall be identical to the reply codes of CWD. */ private Reply doCDUP(BaseFtpConnection conn) { // change directory try { conn.setCurrentDirectory(conn.getCurrentDirectory().getParentFile()); } catch (FileNotFoundException ex) { } return new Reply(200, "Directory changed to " + conn.getCurrentDirectory().getPath()); } /** * <code>CWD &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * This command allows the user to work with a different * directory for file storage or retrieval without * altering his login or accounting information. Transfer * parameters are similarly unchanged. The argument is a * pathname specifying a directory. */ private Reply doCWD(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } LinkedRemoteFile newCurrentDirectory; try { newCurrentDirectory = conn.getCurrentDirectory().lookupFile(request.getArgument()); } catch (FileNotFoundException ex) { return new Reply(550, ex.getMessage()); } if (!conn.getGlobalContext().getConfig().checkPrivPath(conn.getUserNull(), newCurrentDirectory)) { return new Reply(550, request.getArgument() + ": Not found"); // reply identical to FileNotFoundException.getMessage() above } if (!newCurrentDirectory.isDirectory()) { return new Reply(550, request.getArgument() + ": Not a directory"); } conn.setCurrentDirectory(newCurrentDirectory); Reply response = new Reply(250, "Directory changed to " + newCurrentDirectory.getPath()); conn.getGlobalContext().getConfig().directoryMessage(response, conn.getUserNull(), newCurrentDirectory); Properties zsCfg = new Properties(); try { FileInputStream zsFile = new FileInputStream("conf/zipscript.conf"); zsCfg.load(zsFile); zsFile.close(); } catch (FileNotFoundException e4) { response.setMessage("Missing file conf/zipscript.conf"); response.addComment(e4); } catch (IOException e4) { response.setMessage("IOException opening conf/zipscript.conf"); response.addComment(e4); } // show cwd_mp3.txt if this is an mp3 release boolean id3Enabled = zsCfg.getProperty("cwd.id3info.enabled").equalsIgnoreCase("true");; if (id3Enabled) { try { ID3Tag id3tag = newCurrentDirectory.lookupFile(newCurrentDirectory.lookupMP3File()) .getID3v1Tag(); String mp3text = zsCfg.getProperty("cwd.id3info.text"); ReplacerEnvironment env = BaseFtpConnection.getReplacerEnvironment(null, conn.getUserNull()); ReplacerFormat id3format = null; try { id3format = ReplacerFormat.createFormat(mp3text); } catch (FormatterException e1) { logger.warn(e1); } env.add("artist", id3tag.getArtist().trim()); env.add("album", id3tag.getAlbum().trim()); env.add("genre", id3tag.getGenre()); env.add("year", id3tag.getYear()); try { if (id3format == null) { response.addComment("broken 1"); } else { response.addComment(SimplePrintf.jprintf(id3format, env)); } } catch (FormatterException e) { response.addComment("broken 2"); logger.warn("", e); } } catch (FileNotFoundException e) { // no mp3 found //logger.warn("",e); } catch (IOException e) { logger.warn("", e); } catch (NoAvailableSlaveException e) { logger.warn("", e); } } //show race stats boolean racestatsEnabled = zsCfg.getProperty("cwd.racestats.enabled").equalsIgnoreCase("true"); if (racestatsEnabled) { try { SFVFile sfvfile = newCurrentDirectory.lookupSFVFile(); Collection racers = SiteBot.userSort(sfvfile.getFiles(), "bytes", "high"); Collection groups = SiteBot.topFileGroup(sfvfile.getFiles()); String racerline = zsCfg.getProperty("cwd.racers.body"); String groupline = zsCfg.getProperty("cwd.groups.body"); ReplacerEnvironment env = BaseFtpConnection.getReplacerEnvironment(null, conn.getUserNull()); //Start building race message String racetext = zsCfg.getProperty("cwd.racestats.header") + "\n"; racetext += zsCfg.getProperty("cwd.racers.header") + "\n"; ReplacerFormat raceformat = null; //Add racer stats int position = 1; for (Iterator iter = racers.iterator(); iter.hasNext();) { UploaderPosition stat = (UploaderPosition) iter.next(); User raceuser; try { raceuser = conn.getGlobalContext().getUserManager() .getUserByName(stat.getUsername()); } catch (NoSuchUserException e2) { continue; } catch (UserFileException e2) { logger.log(Level.FATAL, "Error reading userfile", e2); continue; } ReplacerEnvironment raceenv = new ReplacerEnvironment(); raceenv.add("speed", Bytes.formatBytes(stat.getXferspeed()) + "/s"); raceenv.add("user", stat.getUsername()); raceenv.add("group", raceuser.getGroup()); raceenv.add("files", "" + stat.getFiles()); raceenv.add("bytes", Bytes.formatBytes(stat.getBytes())); raceenv.add("position", String.valueOf(position)); raceenv.add("percent", Integer.toString( (stat.getFiles() * 100) / sfvfile.size()) + "%"); try { racetext += (SimplePrintf.jprintf(racerline, raceenv) + "\n"); position++; } catch (FormatterException e) { logger.warn(e); } } racetext += (zsCfg.getProperty("cwd.racers.footer") + "\n"); racetext += (zsCfg.getProperty("cwd.groups.header") + "\n"); //add groups stats position = 1; for (Iterator iter = groups.iterator(); iter.hasNext();) { GroupPosition stat = (GroupPosition) iter.next(); ReplacerEnvironment raceenv = new ReplacerEnvironment(); raceenv.add("group", stat.getGroupname()); raceenv.add("position", new Integer(position++)); raceenv.add("bytes", Bytes.formatBytes(stat.getBytes())); raceenv.add("files", Integer.toString(stat.getFiles())); raceenv.add("percent", Integer.toString( (stat.getFiles() * 100) / sfvfile.size()) + "%"); raceenv.add("speed", Bytes.formatBytes(stat.getXferspeed()) + "/s"); try { racetext += (SimplePrintf.jprintf(groupline, raceenv) + "\n"); position++; } catch (FormatterException e) { logger.warn(e); } } - racetext += (ReplacerUtils.jprintf("cwd.groups.footer", env, - Dir.class) + "\n"); + racetext += (zsCfg.getProperty("cwd.groups.footer") + "\n"); env.add("totalfiles", Integer.toString(sfvfile.size())); env.add("totalbytes", Bytes.formatBytes(sfvfile.getTotalBytes())); env.add("totalspeed", Bytes.formatBytes(sfvfile.getXferspeed()) + "/s"); env.add("totalpercent", Integer.toString( (sfvfile.getStatus().getPresent() * 100) / sfvfile.size()) + "%"); racetext += (zsCfg.getProperty("cwd.totals.body") + "\n"); racetext += (zsCfg.getProperty("cwd.racestats.footer") + "\n"); try { raceformat = ReplacerFormat.createFormat(racetext); } catch (FormatterException e1) { logger.warn(e1); } try { if (raceformat == null) { response.addComment("cwd.uploaders"); } else { response.addComment(SimplePrintf.jprintf(raceformat, env)); } } catch (FormatterException e) { response.addComment("cwd.uploaders"); logger.warn("", e); } } catch (RuntimeException ex) { logger.error("", ex); } catch (IOException e) { //Error fetching SFV, ignore } catch (NoAvailableSlaveException e) { //Error fetching SFV, ignore } } return response; } /** * <code>DELE &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * This command causes the file specified in the pathname to be * deleted at the server site. */ private Reply doDELE(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); // argument check if (!request.hasArgument()) { //out.print(FtpResponse.RESPONSE_501_SYNTAX_ERROR); return Reply.RESPONSE_501_SYNTAX_ERROR; } // get filenames String fileName = request.getArgument(); LinkedRemoteFile requestedFile; try { //requestedFile = getVirtualDirectory().lookupFile(fileName); requestedFile = conn.getCurrentDirectory().lookupFile(fileName); } catch (FileNotFoundException ex) { return new Reply(550, "File not found: " + ex.getMessage()); } // check permission if (requestedFile.getUsername().equals(conn.getUserNull().getName())) { if (!conn.getGlobalContext().getConfig().checkDeleteOwn(conn.getUserNull(), requestedFile)) { return Reply.RESPONSE_530_ACCESS_DENIED; } } else if (!conn.getGlobalContext().getConfig().checkDelete(conn.getUserNull(), requestedFile)) { return Reply.RESPONSE_530_ACCESS_DENIED; } Reply reply = (Reply) Reply.RESPONSE_250_ACTION_OKAY.clone(); User uploader; try { uploader = conn.getGlobalContext().getUserManager().getUserByName(requestedFile.getUsername()); uploader.updateCredits((long) -(requestedFile.length() * uploader.getKeyedMap().getObjectFloat(UserManagment.RATIO))); uploader.updateUploadedBytes(-requestedFile.length()); } catch (UserFileException e) { reply.addComment("Error removing credits & stats: " + e.getMessage()); } catch (NoSuchUserException e) { reply.addComment("Error removing credits & stats: " + e.getMessage()); } conn.getGlobalContext().getConnectionManager().dispatchFtpEvent(new DirectoryFtpEvent( conn, "DELE", requestedFile)); requestedFile.delete(); return reply; } /** * <code>MDTM &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * Returns the date and time of when a file was modified. */ private Reply doMDTM(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); // argument check if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } // get filenames String fileName = request.getArgument(); LinkedRemoteFile reqFile; try { reqFile = conn.getCurrentDirectory().lookupFile(fileName); } catch (FileNotFoundException ex) { return Reply.RESPONSE_550_REQUESTED_ACTION_NOT_TAKEN; } //fileName = user.getVirtualDirectory().getAbsoluteName(fileName); //String physicalName = // user.getVirtualDirectory().getPhysicalName(fileName); //File reqFile = new File(physicalName); // now print date //if (reqFile.exists()) { return new Reply(213, DATE_FMT.format(new Date(reqFile.lastModified()))); //out.print(ftpStatus.getResponse(213, request, user, args)); //} else { // out.write(ftpStatus.getResponse(550, request, user, null)); //} } /** * <code>MKD &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * This command causes the directory specified in the pathname * to be created as a directory (if the pathname is absolute) * or as a subdirectory of the current working directory (if * the pathname is relative). * * * MKD * 257 * 500, 501, 502, 421, 530, 550 */ private Reply doMKD(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); // argument check if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } if (!conn.getGlobalContext().getSlaveManager().hasAvailableSlaves()) { return Reply.RESPONSE_450_SLAVE_UNAVAILABLE; } LinkedRemoteFile.NonExistingFile ret = conn.getCurrentDirectory() .lookupNonExistingFile(request.getArgument()); LinkedRemoteFile dir = ret.getFile(); if (ret.exists()) { return new Reply(550, "Requested action not taken. " + request.getArgument() + " already exists"); } String createdDirName = conn.getGlobalContext().getConfig().getDirName(ret.getPath()); if (!ListUtils.isLegalFileName(createdDirName)) { return Reply.RESPONSE_553_REQUESTED_ACTION_NOT_TAKEN; } if (!conn.getGlobalContext().getConfig().checkMakeDir(conn.getUserNull(), dir)) { return Reply.RESPONSE_530_ACCESS_DENIED; } try { LinkedRemoteFile createdDir = dir.createDirectory(conn.getUserNull() .getName(), conn.getUserNull().getGroup(), createdDirName); conn.getGlobalContext().getConnectionManager().dispatchFtpEvent(new DirectoryFtpEvent( conn, "MKD", createdDir)); return new Reply(257, "\"" + createdDir.getPath() + "\" created."); } catch (FileExistsException ex) { return new Reply(550, "directory " + createdDirName + " already exists"); } } /** * <code>PWD &lt;CRLF&gt;</code><br> * * This command causes the name of the current working * directory to be returned in the reply. */ private Reply doPWD(BaseFtpConnection conn) { return new Reply(257, "\"" + conn.getCurrentDirectory().getPath() + "\" is current directory"); } /** * <code>RMD &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * This command causes the directory specified in the pathname * to be removed as a directory (if the pathname is absolute) * or as a subdirectory of the current working directory (if * the pathname is relative). */ private Reply doRMD(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); // argument check if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } // get file names String fileName = request.getArgument(); LinkedRemoteFile requestedFile; try { requestedFile = conn.getCurrentDirectory().lookupFile(fileName); } catch (FileNotFoundException e) { return new Reply(550, fileName + ": " + e.getMessage()); } if (requestedFile.getUsername().equals(conn.getUserNull().getName())) { if (!conn.getGlobalContext().getConfig().checkDeleteOwn(conn.getUserNull(), requestedFile)) { return Reply.RESPONSE_530_ACCESS_DENIED; } } else if (!conn.getGlobalContext().getConfig().checkDelete(conn.getUserNull(), requestedFile)) { return Reply.RESPONSE_530_ACCESS_DENIED; } if (!requestedFile.isDirectory()) { return new Reply(550, fileName + ": Not a directory"); } if (requestedFile.dirSize() != 0) { return new Reply(550, fileName + ": Directory not empty"); } // now delete //if (conn.getConfig().checkDirLog(conn.getUserNull(), requestedFile)) { conn.getGlobalContext().getConnectionManager().dispatchFtpEvent(new DirectoryFtpEvent( conn, "RMD", requestedFile)); //} requestedFile.delete(); return Reply.RESPONSE_250_ACTION_OKAY; } /** * <code>RNFR &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * This command specifies the old pathname of the file which is * to be renamed. This command must be immediately followed by * a "rename to" command specifying the new file pathname. * * RNFR 450, 550 500, 501, 502, 421, 530 350 */ private Reply doRNFR(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); // argument check if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } // set state variable // get filenames //String fileName = request.getArgument(); //fileName = user.getVirtualDirectory().getAbsoluteName(fileName); //mstRenFr = user.getVirtualDirectory().getPhysicalName(fileName); try { _renameFrom = conn.getCurrentDirectory().lookupFile(request.getArgument()); } catch (FileNotFoundException e) { return Reply.RESPONSE_550_REQUESTED_ACTION_NOT_TAKEN; } //check permission if (_renameFrom.getUsername().equals(conn.getUserNull().getName())) { if (!conn.getGlobalContext().getConfig().checkRenameOwn(conn.getUserNull(), _renameFrom)) { return Reply.RESPONSE_530_ACCESS_DENIED; } } else if (!conn.getGlobalContext().getConfig().checkRename(conn.getUserNull(), _renameFrom)) { return Reply.RESPONSE_530_ACCESS_DENIED; } return new Reply(350, "File exists, ready for destination name"); } /** * <code>RNTO &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * This command specifies the new pathname of the file * specified in the immediately preceding "rename from" * command. Together the two commands cause a file to be * renamed. */ private Reply doRNTO(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); // argument check if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } // set state variables if (_renameFrom == null) { return Reply.RESPONSE_503_BAD_SEQUENCE_OF_COMMANDS; } NonExistingFile ret = conn.getCurrentDirectory().lookupNonExistingFile(request.getArgument()); LinkedRemoteFileInterface toDir = ret.getFile(); String name = ret.getPath(); LinkedRemoteFileInterface fromFile = _renameFrom; if (name == null) { name = fromFile.getName(); } // check permission if (_renameFrom.getUsername().equals(conn.getUserNull().getName())) { if (!conn.getGlobalContext().getConfig().checkRenameOwn(conn.getUserNull(), toDir)) { return Reply.RESPONSE_530_ACCESS_DENIED; } } else if (!conn.getGlobalContext().getConfig().checkRename(conn.getUserNull(), toDir)) { return Reply.RESPONSE_530_ACCESS_DENIED; } try { fromFile.renameTo(toDir.getPath(), name); } catch (FileNotFoundException e) { logger.info("FileNotFoundException on renameTo()", e); return new Reply(500, "FileNotFound - " + e.getMessage()); } catch (IOException e) { logger.info("IOException on renameTo()", e); return new Reply(500, "IOException - " + e.getMessage()); } //out.write(FtpResponse.RESPONSE_250_ACTION_OKAY.toString()); return new Reply(250, request.getCommand() + " command successful."); } private Reply doSITE_CHOWN(BaseFtpConnection conn) throws UnhandledCommandException { FtpRequest req = conn.getRequest(); StringTokenizer st = new StringTokenizer(conn.getRequest().getArgument()); String owner = st.nextToken(); String group = null; int pos = owner.indexOf('.'); if (pos != -1) { group = owner.substring(pos + 1); owner = owner.substring(0, pos); } else if ("SITE CHGRP".equals(req.getCommand())) { group = owner; owner = null; } else if (!"SITE CHOWN".equals(req.getCommand())) { throw UnhandledCommandException.create(Dir.class, req); } Reply reply = new Reply(200); while (st.hasMoreTokens()) { try { LinkedRemoteFileInterface file = conn.getCurrentDirectory() .lookupFile(st.nextToken()); if (owner != null) { file.setOwner(owner); } if (group != null) { file.setGroup(group); } } catch (FileNotFoundException e) { reply.addComment(e.getMessage()); } } return Reply.RESPONSE_200_COMMAND_OK; } private Reply doSITE_LINK(BaseFtpConnection conn) { if (!conn.getUserNull().isAdmin()) { return Reply.RESPONSE_530_ACCESS_DENIED; } if (!conn.getRequest().hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } StringTokenizer st = new StringTokenizer(conn.getRequest().getArgument(), " "); if (st.countTokens() != 2) { return Reply.RESPONSE_501_SYNTAX_ERROR; } String targetName = st.nextToken(); String linkName = st.nextToken(); LinkedRemoteFile target; try { target = conn.getCurrentDirectory().lookupFile(targetName); } catch (FileNotFoundException e) { return Reply.RESPONSE_550_REQUESTED_ACTION_NOT_TAKEN; } if (!target.isDirectory()) { return new Reply(501, "Only link to directories for now."); } StaticRemoteFile link = new StaticRemoteFile(linkName, null, targetName); conn.getCurrentDirectory().addFile(link); return Reply.RESPONSE_200_COMMAND_OK; } /** * USAGE: site wipe [-r] <file/directory> * * This is similar to the UNIX rm command. * In glftpd, if you just delete a file, the uploader loses credits and * upload stats for it. There are many people who didn't like that and * were unable/too lazy to write a shell script to do it for them, so I * wrote this command to get them off my back. * * If the argument is a file, it will simply be deleted. If it's a * directory, it and the files it contains will be deleted. If the * directory contains other directories, the deletion will be aborted. * * To remove a directory containing subdirectories, you need to use * "site wipe -r dirname". BE CAREFUL WHO YOU GIVE ACCESS TO THIS COMMAND. * Glftpd will check if the parent directory of the file/directory you're * trying to delete is writable by its owner. If not, wipe will not * execute, so to protect directories from being wiped, make their parent * 555. * * Also, wipe will only work where you have the right to delete (in * glftpd.conf). Delete right and parent directory's mode of 755/777/etc * will cause glftpd to SWITCH TO ROOT UID and wipe the file/directory. * "site wipe -r /" will not work, but "site wipe -r /incoming" WILL, SO * BE CAREFUL. * * This command will remove the deleted files/directories from the dirlog * and dupefile databases. * * To give access to this command, add "-wipe -user flag =group" to the * config file (similar to other site commands). * * @param request * @param out */ private Reply doSITE_WIPE(BaseFtpConnection conn) { if (!conn.getUserNull().isAdmin()) { return Reply.RESPONSE_530_ACCESS_DENIED; } if (!conn.getRequest().hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } String arg = conn.getRequest().getArgument(); boolean recursive; if (arg.startsWith("-r ")) { arg = arg.substring(3); recursive = true; } else { recursive = false; } LinkedRemoteFile wipeFile; try { wipeFile = conn.getCurrentDirectory().lookupFile(arg); } catch (FileNotFoundException e) { return new Reply(200, "Can't wipe: " + arg + " does not exist or it's not a plain file/directory"); } if (wipeFile.isDirectory() && (wipeFile.dirSize() != 0) && !recursive) { return new Reply(200, "Can't wipe, directory not empty"); } //if (conn.getConfig().checkDirLog(conn.getUserNull(), wipeFile)) { conn.getGlobalContext().getConnectionManager().dispatchFtpEvent(new DirectoryFtpEvent( conn, "WIPE", wipeFile)); //} wipeFile.delete(); return Reply.RESPONSE_200_COMMAND_OK; } /** * <code>SIZE &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * Returns the size of the file in bytes. */ private Reply doSIZE(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } LinkedRemoteFile file; try { file = conn.getCurrentDirectory().lookupFile(request.getArgument()); } catch (FileNotFoundException ex) { return Reply.RESPONSE_550_REQUESTED_ACTION_NOT_TAKEN; } return new Reply(213, Long.toString(file.length())); } /** * http://www.southrivertech.com/support/titanftp/webhelp/xcrc.htm * * Originally implemented by CuteFTP Pro and Globalscape FTP Server */ private Reply doXCRC(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } StringTokenizer st = new StringTokenizer(request.getArgument()); LinkedRemoteFile myFile; try { myFile = conn.getCurrentDirectory().lookupFile(st.nextToken()); } catch (FileNotFoundException e) { return Reply.RESPONSE_550_REQUESTED_ACTION_NOT_TAKEN; } if (st.hasMoreTokens()) { if (!st.nextToken().equals("0") || !st.nextToken().equals(Long.toString(myFile.length()))) { return Reply.RESPONSE_504_COMMAND_NOT_IMPLEMENTED_FOR_PARM; } } try { return new Reply(250, "XCRC Successful. " + Checksum.formatChecksum(myFile.getCheckSum())); } catch (NoAvailableSlaveException e1) { logger.warn("", e1); return new Reply(550, "NoAvailableSlaveException: " + e1.getMessage()); } } public Reply execute(BaseFtpConnection conn) throws UnhandledCommandException { FtpRequest request = conn.getRequest(); String cmd = request.getCommand(); if ("CDUP".equals(cmd)) { return doCDUP(conn); } if ("CWD".equals(cmd)) { return doCWD(conn); } if ("MKD".equals(cmd)) { return doMKD(conn); } if ("PWD".equals(cmd)) { return doPWD(conn); } if ("RMD".equals(cmd)) { return doRMD(conn); } if ("RNFR".equals(cmd)) { return doRNFR(conn); } if ("RNTO".equals(cmd)) { return doRNTO(conn); } if ("SITE LINK".equals(cmd)) { return doSITE_LINK(conn); } if ("SITE WIPE".equals(cmd)) { return doSITE_WIPE(conn); } if ("XCRC".equals(cmd)) { return doXCRC(conn); } if ("MDTM".equals(cmd)) { return doMDTM(conn); } if ("SIZE".equals(cmd)) { return doSIZE(conn); } if ("DELE".equals(cmd)) { return doDELE(conn); } if ("SITE CHOWN".equals(cmd) || "SITE CHGRP".equals(cmd)) { return doSITE_CHOWN(conn); } throw UnhandledCommandException.create(Dir.class, request); } public String[] getFeatReplies() { return null; } public CommandHandler initialize(BaseFtpConnection conn, CommandManager initializer) { try { return (Dir) clone(); } catch (CloneNotSupportedException e) { throw new RuntimeException(e); } } public void load(CommandManagerFactory initializer) { } public void unload() { } }
true
true
private Reply doCWD(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } LinkedRemoteFile newCurrentDirectory; try { newCurrentDirectory = conn.getCurrentDirectory().lookupFile(request.getArgument()); } catch (FileNotFoundException ex) { return new Reply(550, ex.getMessage()); } if (!conn.getGlobalContext().getConfig().checkPrivPath(conn.getUserNull(), newCurrentDirectory)) { return new Reply(550, request.getArgument() + ": Not found"); // reply identical to FileNotFoundException.getMessage() above } if (!newCurrentDirectory.isDirectory()) { return new Reply(550, request.getArgument() + ": Not a directory"); } conn.setCurrentDirectory(newCurrentDirectory); Reply response = new Reply(250, "Directory changed to " + newCurrentDirectory.getPath()); conn.getGlobalContext().getConfig().directoryMessage(response, conn.getUserNull(), newCurrentDirectory); Properties zsCfg = new Properties(); try { FileInputStream zsFile = new FileInputStream("conf/zipscript.conf"); zsCfg.load(zsFile); zsFile.close(); } catch (FileNotFoundException e4) { response.setMessage("Missing file conf/zipscript.conf"); response.addComment(e4); } catch (IOException e4) { response.setMessage("IOException opening conf/zipscript.conf"); response.addComment(e4); } // show cwd_mp3.txt if this is an mp3 release boolean id3Enabled = zsCfg.getProperty("cwd.id3info.enabled").equalsIgnoreCase("true");; if (id3Enabled) { try { ID3Tag id3tag = newCurrentDirectory.lookupFile(newCurrentDirectory.lookupMP3File()) .getID3v1Tag(); String mp3text = zsCfg.getProperty("cwd.id3info.text"); ReplacerEnvironment env = BaseFtpConnection.getReplacerEnvironment(null, conn.getUserNull()); ReplacerFormat id3format = null; try { id3format = ReplacerFormat.createFormat(mp3text); } catch (FormatterException e1) { logger.warn(e1); } env.add("artist", id3tag.getArtist().trim()); env.add("album", id3tag.getAlbum().trim()); env.add("genre", id3tag.getGenre()); env.add("year", id3tag.getYear()); try { if (id3format == null) { response.addComment("broken 1"); } else { response.addComment(SimplePrintf.jprintf(id3format, env)); } } catch (FormatterException e) { response.addComment("broken 2"); logger.warn("", e); } } catch (FileNotFoundException e) { // no mp3 found //logger.warn("",e); } catch (IOException e) { logger.warn("", e); } catch (NoAvailableSlaveException e) { logger.warn("", e); } } //show race stats boolean racestatsEnabled = zsCfg.getProperty("cwd.racestats.enabled").equalsIgnoreCase("true"); if (racestatsEnabled) { try { SFVFile sfvfile = newCurrentDirectory.lookupSFVFile(); Collection racers = SiteBot.userSort(sfvfile.getFiles(), "bytes", "high"); Collection groups = SiteBot.topFileGroup(sfvfile.getFiles()); String racerline = zsCfg.getProperty("cwd.racers.body"); String groupline = zsCfg.getProperty("cwd.groups.body"); ReplacerEnvironment env = BaseFtpConnection.getReplacerEnvironment(null, conn.getUserNull()); //Start building race message String racetext = zsCfg.getProperty("cwd.racestats.header") + "\n"; racetext += zsCfg.getProperty("cwd.racers.header") + "\n"; ReplacerFormat raceformat = null; //Add racer stats int position = 1; for (Iterator iter = racers.iterator(); iter.hasNext();) { UploaderPosition stat = (UploaderPosition) iter.next(); User raceuser; try { raceuser = conn.getGlobalContext().getUserManager() .getUserByName(stat.getUsername()); } catch (NoSuchUserException e2) { continue; } catch (UserFileException e2) { logger.log(Level.FATAL, "Error reading userfile", e2); continue; } ReplacerEnvironment raceenv = new ReplacerEnvironment(); raceenv.add("speed", Bytes.formatBytes(stat.getXferspeed()) + "/s"); raceenv.add("user", stat.getUsername()); raceenv.add("group", raceuser.getGroup()); raceenv.add("files", "" + stat.getFiles()); raceenv.add("bytes", Bytes.formatBytes(stat.getBytes())); raceenv.add("position", String.valueOf(position)); raceenv.add("percent", Integer.toString( (stat.getFiles() * 100) / sfvfile.size()) + "%"); try { racetext += (SimplePrintf.jprintf(racerline, raceenv) + "\n"); position++; } catch (FormatterException e) { logger.warn(e); } } racetext += (zsCfg.getProperty("cwd.racers.footer") + "\n"); racetext += (zsCfg.getProperty("cwd.groups.header") + "\n"); //add groups stats position = 1; for (Iterator iter = groups.iterator(); iter.hasNext();) { GroupPosition stat = (GroupPosition) iter.next(); ReplacerEnvironment raceenv = new ReplacerEnvironment(); raceenv.add("group", stat.getGroupname()); raceenv.add("position", new Integer(position++)); raceenv.add("bytes", Bytes.formatBytes(stat.getBytes())); raceenv.add("files", Integer.toString(stat.getFiles())); raceenv.add("percent", Integer.toString( (stat.getFiles() * 100) / sfvfile.size()) + "%"); raceenv.add("speed", Bytes.formatBytes(stat.getXferspeed()) + "/s"); try { racetext += (SimplePrintf.jprintf(groupline, raceenv) + "\n"); position++; } catch (FormatterException e) { logger.warn(e); } } racetext += (ReplacerUtils.jprintf("cwd.groups.footer", env, Dir.class) + "\n"); env.add("totalfiles", Integer.toString(sfvfile.size())); env.add("totalbytes", Bytes.formatBytes(sfvfile.getTotalBytes())); env.add("totalspeed", Bytes.formatBytes(sfvfile.getXferspeed()) + "/s"); env.add("totalpercent", Integer.toString( (sfvfile.getStatus().getPresent() * 100) / sfvfile.size()) + "%"); racetext += (zsCfg.getProperty("cwd.totals.body") + "\n"); racetext += (zsCfg.getProperty("cwd.racestats.footer") + "\n"); try { raceformat = ReplacerFormat.createFormat(racetext); } catch (FormatterException e1) { logger.warn(e1); } try { if (raceformat == null) { response.addComment("cwd.uploaders"); } else { response.addComment(SimplePrintf.jprintf(raceformat, env)); } } catch (FormatterException e) { response.addComment("cwd.uploaders"); logger.warn("", e); } } catch (RuntimeException ex) { logger.error("", ex); } catch (IOException e) { //Error fetching SFV, ignore } catch (NoAvailableSlaveException e) { //Error fetching SFV, ignore } } return response; }
private Reply doCWD(BaseFtpConnection conn) { FtpRequest request = conn.getRequest(); if (!request.hasArgument()) { return Reply.RESPONSE_501_SYNTAX_ERROR; } LinkedRemoteFile newCurrentDirectory; try { newCurrentDirectory = conn.getCurrentDirectory().lookupFile(request.getArgument()); } catch (FileNotFoundException ex) { return new Reply(550, ex.getMessage()); } if (!conn.getGlobalContext().getConfig().checkPrivPath(conn.getUserNull(), newCurrentDirectory)) { return new Reply(550, request.getArgument() + ": Not found"); // reply identical to FileNotFoundException.getMessage() above } if (!newCurrentDirectory.isDirectory()) { return new Reply(550, request.getArgument() + ": Not a directory"); } conn.setCurrentDirectory(newCurrentDirectory); Reply response = new Reply(250, "Directory changed to " + newCurrentDirectory.getPath()); conn.getGlobalContext().getConfig().directoryMessage(response, conn.getUserNull(), newCurrentDirectory); Properties zsCfg = new Properties(); try { FileInputStream zsFile = new FileInputStream("conf/zipscript.conf"); zsCfg.load(zsFile); zsFile.close(); } catch (FileNotFoundException e4) { response.setMessage("Missing file conf/zipscript.conf"); response.addComment(e4); } catch (IOException e4) { response.setMessage("IOException opening conf/zipscript.conf"); response.addComment(e4); } // show cwd_mp3.txt if this is an mp3 release boolean id3Enabled = zsCfg.getProperty("cwd.id3info.enabled").equalsIgnoreCase("true");; if (id3Enabled) { try { ID3Tag id3tag = newCurrentDirectory.lookupFile(newCurrentDirectory.lookupMP3File()) .getID3v1Tag(); String mp3text = zsCfg.getProperty("cwd.id3info.text"); ReplacerEnvironment env = BaseFtpConnection.getReplacerEnvironment(null, conn.getUserNull()); ReplacerFormat id3format = null; try { id3format = ReplacerFormat.createFormat(mp3text); } catch (FormatterException e1) { logger.warn(e1); } env.add("artist", id3tag.getArtist().trim()); env.add("album", id3tag.getAlbum().trim()); env.add("genre", id3tag.getGenre()); env.add("year", id3tag.getYear()); try { if (id3format == null) { response.addComment("broken 1"); } else { response.addComment(SimplePrintf.jprintf(id3format, env)); } } catch (FormatterException e) { response.addComment("broken 2"); logger.warn("", e); } } catch (FileNotFoundException e) { // no mp3 found //logger.warn("",e); } catch (IOException e) { logger.warn("", e); } catch (NoAvailableSlaveException e) { logger.warn("", e); } } //show race stats boolean racestatsEnabled = zsCfg.getProperty("cwd.racestats.enabled").equalsIgnoreCase("true"); if (racestatsEnabled) { try { SFVFile sfvfile = newCurrentDirectory.lookupSFVFile(); Collection racers = SiteBot.userSort(sfvfile.getFiles(), "bytes", "high"); Collection groups = SiteBot.topFileGroup(sfvfile.getFiles()); String racerline = zsCfg.getProperty("cwd.racers.body"); String groupline = zsCfg.getProperty("cwd.groups.body"); ReplacerEnvironment env = BaseFtpConnection.getReplacerEnvironment(null, conn.getUserNull()); //Start building race message String racetext = zsCfg.getProperty("cwd.racestats.header") + "\n"; racetext += zsCfg.getProperty("cwd.racers.header") + "\n"; ReplacerFormat raceformat = null; //Add racer stats int position = 1; for (Iterator iter = racers.iterator(); iter.hasNext();) { UploaderPosition stat = (UploaderPosition) iter.next(); User raceuser; try { raceuser = conn.getGlobalContext().getUserManager() .getUserByName(stat.getUsername()); } catch (NoSuchUserException e2) { continue; } catch (UserFileException e2) { logger.log(Level.FATAL, "Error reading userfile", e2); continue; } ReplacerEnvironment raceenv = new ReplacerEnvironment(); raceenv.add("speed", Bytes.formatBytes(stat.getXferspeed()) + "/s"); raceenv.add("user", stat.getUsername()); raceenv.add("group", raceuser.getGroup()); raceenv.add("files", "" + stat.getFiles()); raceenv.add("bytes", Bytes.formatBytes(stat.getBytes())); raceenv.add("position", String.valueOf(position)); raceenv.add("percent", Integer.toString( (stat.getFiles() * 100) / sfvfile.size()) + "%"); try { racetext += (SimplePrintf.jprintf(racerline, raceenv) + "\n"); position++; } catch (FormatterException e) { logger.warn(e); } } racetext += (zsCfg.getProperty("cwd.racers.footer") + "\n"); racetext += (zsCfg.getProperty("cwd.groups.header") + "\n"); //add groups stats position = 1; for (Iterator iter = groups.iterator(); iter.hasNext();) { GroupPosition stat = (GroupPosition) iter.next(); ReplacerEnvironment raceenv = new ReplacerEnvironment(); raceenv.add("group", stat.getGroupname()); raceenv.add("position", new Integer(position++)); raceenv.add("bytes", Bytes.formatBytes(stat.getBytes())); raceenv.add("files", Integer.toString(stat.getFiles())); raceenv.add("percent", Integer.toString( (stat.getFiles() * 100) / sfvfile.size()) + "%"); raceenv.add("speed", Bytes.formatBytes(stat.getXferspeed()) + "/s"); try { racetext += (SimplePrintf.jprintf(groupline, raceenv) + "\n"); position++; } catch (FormatterException e) { logger.warn(e); } } racetext += (zsCfg.getProperty("cwd.groups.footer") + "\n"); env.add("totalfiles", Integer.toString(sfvfile.size())); env.add("totalbytes", Bytes.formatBytes(sfvfile.getTotalBytes())); env.add("totalspeed", Bytes.formatBytes(sfvfile.getXferspeed()) + "/s"); env.add("totalpercent", Integer.toString( (sfvfile.getStatus().getPresent() * 100) / sfvfile.size()) + "%"); racetext += (zsCfg.getProperty("cwd.totals.body") + "\n"); racetext += (zsCfg.getProperty("cwd.racestats.footer") + "\n"); try { raceformat = ReplacerFormat.createFormat(racetext); } catch (FormatterException e1) { logger.warn(e1); } try { if (raceformat == null) { response.addComment("cwd.uploaders"); } else { response.addComment(SimplePrintf.jprintf(raceformat, env)); } } catch (FormatterException e) { response.addComment("cwd.uploaders"); logger.warn("", e); } } catch (RuntimeException ex) { logger.error("", ex); } catch (IOException e) { //Error fetching SFV, ignore } catch (NoAvailableSlaveException e) { //Error fetching SFV, ignore } } return response; }
diff --git a/src/org/apache/xerces/impl/XMLVersionDetector.java b/src/org/apache/xerces/impl/XMLVersionDetector.java index ad16a1ea..9fa44308 100644 --- a/src/org/apache/xerces/impl/XMLVersionDetector.java +++ b/src/org/apache/xerces/impl/XMLVersionDetector.java @@ -1,266 +1,268 @@ /* * The Apache Software License, Version 1.1 * * * Copyright (c) 1999-2003 The Apache Software Foundation. * All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions * are met: * * 1. Redistributions of source code must retain the above copyright * notice, this list of conditions and the following disclaimer. * * 2. Redistributions in binary form must reproduce the above copyright * notice, this list of conditions and the following disclaimer in * the documentation and/or other materials provided with the * distribution. * * 3. The end-user documentation included with the redistribution, * if any, must include the following acknowledgment: * "This product includes software developed by the * Apache Software Foundation (http://www.apache.org/)." * Alternately, this acknowledgment may appear in the software itself, * if and wherever such third-party acknowledgments normally appear. * * 4. The names "Xerces" and "Apache Software Foundation" must * not be used to endorse or promote products derived from this * software without prior written permission. For written * permission, please contact [email protected]. * * 5. Products derived from this software may not be called "Apache", * nor may "Apache" appear in their name, without prior written * permission of the Apache Software Foundation. * * THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESSED OR IMPLIED * WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES * OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE * DISCLAIMED. IN NO EVENT SHALL THE APACHE SOFTWARE FOUNDATION OR * ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, * SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT * LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF * USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND * ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, * OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT * OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF * SUCH DAMAGE. * ==================================================================== * * This software consists of voluntary contributions made by many * individuals on behalf of the Apache Software Foundation and was * originally based on software copyright (c) 2003, International * Business Machines, Inc., http://www.apache.org. For more * information on the Apache Software Foundation, please see * <http://www.apache.org/>. */ package org.apache.xerces.impl; import java.io.EOFException; import java.io.IOException; import org.apache.xerces.impl.msg.XMLMessageFormatter; import org.apache.xerces.util.SymbolTable; import org.apache.xerces.xni.XMLString; import org.apache.xerces.xni.parser.XMLComponentManager; import org.apache.xerces.xni.parser.XMLConfigurationException; import org.apache.xerces.xni.parser.XMLInputSource; /** * This class scans the version of the document to determine * which scanner to use: XML 1.1 or XML 1.0. * The version is scanned using XML 1.1. scanner. * * @author Neil Graham, IBM * @author Elena Litani, IBM * @version $Id$ */ public class XMLVersionDetector { // // Constants // private final static char[] XML11_VERSION = new char[]{'1', '.', '1'}; // property identifiers /** Property identifier: symbol table. */ protected static final String SYMBOL_TABLE = Constants.XERCES_PROPERTY_PREFIX + Constants.SYMBOL_TABLE_PROPERTY; /** Property identifier: error reporter. */ protected static final String ERROR_REPORTER = Constants.XERCES_PROPERTY_PREFIX + Constants.ERROR_REPORTER_PROPERTY; /** Property identifier: entity manager. */ protected static final String ENTITY_MANAGER = Constants.XERCES_PROPERTY_PREFIX + Constants.ENTITY_MANAGER_PROPERTY; // // Data // /** Symbol: "version". */ protected final static String fVersionSymbol = "version".intern(); // symbol: [xml]: protected static final String fXMLSymbol = "[xml]".intern(); /** Symbol table. */ protected SymbolTable fSymbolTable; /** Error reporter. */ protected XMLErrorReporter fErrorReporter; /** Entity manager. */ protected XMLEntityManager fEntityManager; protected String fEncoding = null; private XMLString fVersionNum = new XMLString(); private final char [] fExpectedVersionString = {'<', '?', 'x', 'm', 'l', ' ', 'v', 'e', 'r', 's', 'i', 'o', 'n', '=', ' ', ' ', ' ', ' ', ' '}; /** * * * @param componentManager The component manager. * * @throws SAXException Throws exception if required features and * properties cannot be found. */ public void reset(XMLComponentManager componentManager) throws XMLConfigurationException { // Xerces properties fSymbolTable = (SymbolTable)componentManager.getProperty(SYMBOL_TABLE); fErrorReporter = (XMLErrorReporter)componentManager.getProperty(ERROR_REPORTER); fEntityManager = (XMLEntityManager)componentManager.getProperty(ENTITY_MANAGER); for(int i=14; i<fExpectedVersionString.length; i++ ) fExpectedVersionString[i] = ' '; } // reset(XMLComponentManager) /** * Reset the reference to the appropriate scanner given the version of the * document and start document scanning. * @param scanner - the scanner to use * @param version - the version of the document (XML 1.1 or XML 1.0). */ public void startDocumentParsing(XMLEntityHandler scanner, short version){ if (version == Constants.XML_VERSION_1_0){ fEntityManager.setScannerVersion(Constants.XML_VERSION_1_0); } else { fEntityManager.setScannerVersion(Constants.XML_VERSION_1_1); } // Make sure the locator used by the error reporter is the current entity scanner. fErrorReporter.setDocumentLocator(fEntityManager.getEntityScanner()); // Note: above we reset fEntityScanner in the entity manager, thus in startEntity // in each scanner fEntityScanner field must be reset to reflect the change. // fEntityManager.setEntityHandler(scanner); scanner.startEntity(fXMLSymbol, fEntityManager.getCurrentResourceIdentifier(), fEncoding); } /** * This methods scans the XML declaration to find out the version * (and provisional encoding) of the document. * The scanning is doing using XML 1.1 scanner. * @param inputSource * @return short - Constants.XML_VERSION_1_1 if document version 1.1, * otherwise Constants.XML_VERSION_1_0 * @throws IOException */ public short determineDocVersion(XMLInputSource inputSource) throws IOException { fEncoding = fEntityManager.setupCurrentEntity(fXMLSymbol, inputSource, false, true); // must assume 1.1 at this stage so that whitespace // handling is correct in the XML decl... fEntityManager.setScannerVersion(Constants.XML_VERSION_1_1); XMLEntityScanner scanner = fEntityManager.getEntityScanner(); try { if (!scanner.skipString("<?xml")) { // definitely not a well-formed 1.1 doc! return Constants.XML_VERSION_1_0; } if (!scanner.skipSpaces()) { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 5); return Constants.XML_VERSION_1_0; } if (!scanner.skipString("version")) { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 6); return Constants.XML_VERSION_1_0; } scanner.skipSpaces(); - if (scanner.scanChar() != '=') { + // Check if the next character is '='. If it is then consume it. + if (scanner.peekChar() != '=') { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 13); return Constants.XML_VERSION_1_0; } + scanner.scanChar(); scanner.skipSpaces(); int quoteChar = scanner.scanChar(); fExpectedVersionString[14] = (char) quoteChar; for (int versionPos = 0; versionPos < XML11_VERSION.length; versionPos++) { fExpectedVersionString[15 + versionPos] = (char) scanner.scanChar(); } // REVISIT: should we check whether this equals quoteChar? fExpectedVersionString[18] = (char) scanner.scanChar(); fixupCurrentEntity(fEntityManager, fExpectedVersionString, 19); int matched = 0; for (; matched < XML11_VERSION.length; matched++) { if (fExpectedVersionString[15 + matched] != XML11_VERSION[matched]) break; } if (matched == XML11_VERSION.length) return Constants.XML_VERSION_1_1; return Constants.XML_VERSION_1_0; // premature end of file } catch (EOFException e) { fErrorReporter.reportError( XMLMessageFormatter.XML_DOMAIN, "PrematureEOF", null, XMLErrorReporter.SEVERITY_FATAL_ERROR); return Constants.XML_VERSION_1_0; } } // This method prepends "length" chars from the char array, // from offset 0, to the manager's fCurrentEntity.ch. private void fixupCurrentEntity(XMLEntityManager manager, char [] scannedChars, int length) { XMLEntityManager.ScannedEntity currentEntity = manager.getCurrentEntity(); if(currentEntity.count-currentEntity.position+length > currentEntity.ch.length) { //resize array; this case is hard to imagine... char[] tempCh = currentEntity.ch; currentEntity.ch = new char[length+currentEntity.count-currentEntity.position+1]; System.arraycopy(tempCh, 0, currentEntity.ch, 0, tempCh.length); } if(currentEntity.position < length) { // have to move sensitive stuff out of the way... System.arraycopy(currentEntity.ch, currentEntity.position, currentEntity.ch, length, currentEntity.count-currentEntity.position); currentEntity.count += length-currentEntity.position; } else { // have to reintroduce some whitespace so this parses: for(int i=length; i<currentEntity.position; i++) currentEntity.ch[i]=' '; } // prepend contents... System.arraycopy(scannedChars, 0, currentEntity.ch, 0, length); currentEntity.position = 0; currentEntity.columnNumber = currentEntity.lineNumber = 1; } } // class XMLVersionDetector
false
true
public short determineDocVersion(XMLInputSource inputSource) throws IOException { fEncoding = fEntityManager.setupCurrentEntity(fXMLSymbol, inputSource, false, true); // must assume 1.1 at this stage so that whitespace // handling is correct in the XML decl... fEntityManager.setScannerVersion(Constants.XML_VERSION_1_1); XMLEntityScanner scanner = fEntityManager.getEntityScanner(); try { if (!scanner.skipString("<?xml")) { // definitely not a well-formed 1.1 doc! return Constants.XML_VERSION_1_0; } if (!scanner.skipSpaces()) { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 5); return Constants.XML_VERSION_1_0; } if (!scanner.skipString("version")) { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 6); return Constants.XML_VERSION_1_0; } scanner.skipSpaces(); if (scanner.scanChar() != '=') { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 13); return Constants.XML_VERSION_1_0; } scanner.skipSpaces(); int quoteChar = scanner.scanChar(); fExpectedVersionString[14] = (char) quoteChar; for (int versionPos = 0; versionPos < XML11_VERSION.length; versionPos++) { fExpectedVersionString[15 + versionPos] = (char) scanner.scanChar(); } // REVISIT: should we check whether this equals quoteChar? fExpectedVersionString[18] = (char) scanner.scanChar(); fixupCurrentEntity(fEntityManager, fExpectedVersionString, 19); int matched = 0; for (; matched < XML11_VERSION.length; matched++) { if (fExpectedVersionString[15 + matched] != XML11_VERSION[matched]) break; } if (matched == XML11_VERSION.length) return Constants.XML_VERSION_1_1; return Constants.XML_VERSION_1_0; // premature end of file } catch (EOFException e) { fErrorReporter.reportError( XMLMessageFormatter.XML_DOMAIN, "PrematureEOF", null, XMLErrorReporter.SEVERITY_FATAL_ERROR); return Constants.XML_VERSION_1_0; } }
public short determineDocVersion(XMLInputSource inputSource) throws IOException { fEncoding = fEntityManager.setupCurrentEntity(fXMLSymbol, inputSource, false, true); // must assume 1.1 at this stage so that whitespace // handling is correct in the XML decl... fEntityManager.setScannerVersion(Constants.XML_VERSION_1_1); XMLEntityScanner scanner = fEntityManager.getEntityScanner(); try { if (!scanner.skipString("<?xml")) { // definitely not a well-formed 1.1 doc! return Constants.XML_VERSION_1_0; } if (!scanner.skipSpaces()) { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 5); return Constants.XML_VERSION_1_0; } if (!scanner.skipString("version")) { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 6); return Constants.XML_VERSION_1_0; } scanner.skipSpaces(); // Check if the next character is '='. If it is then consume it. if (scanner.peekChar() != '=') { fixupCurrentEntity(fEntityManager, fExpectedVersionString, 13); return Constants.XML_VERSION_1_0; } scanner.scanChar(); scanner.skipSpaces(); int quoteChar = scanner.scanChar(); fExpectedVersionString[14] = (char) quoteChar; for (int versionPos = 0; versionPos < XML11_VERSION.length; versionPos++) { fExpectedVersionString[15 + versionPos] = (char) scanner.scanChar(); } // REVISIT: should we check whether this equals quoteChar? fExpectedVersionString[18] = (char) scanner.scanChar(); fixupCurrentEntity(fEntityManager, fExpectedVersionString, 19); int matched = 0; for (; matched < XML11_VERSION.length; matched++) { if (fExpectedVersionString[15 + matched] != XML11_VERSION[matched]) break; } if (matched == XML11_VERSION.length) return Constants.XML_VERSION_1_1; return Constants.XML_VERSION_1_0; // premature end of file } catch (EOFException e) { fErrorReporter.reportError( XMLMessageFormatter.XML_DOMAIN, "PrematureEOF", null, XMLErrorReporter.SEVERITY_FATAL_ERROR); return Constants.XML_VERSION_1_0; } }
diff --git a/code/server/app/Import.java b/code/server/app/Import.java index 852dfe5..f769ed7 100644 --- a/code/server/app/Import.java +++ b/code/server/app/Import.java @@ -1,86 +1,87 @@ import models.Transaction; import models.User; import org.apache.commons.io.IOUtils; import org.apache.log4j.Level; import org.apache.log4j.Logger; import play.jobs.Job; import play.jobs.OnApplicationStart; import play.test.Fixtures; import play.vfs.VirtualFile; import utils.FmtUtil; import utils.ModelHelper; import java.io.*; import java.text.ParseException; import java.text.SimpleDateFormat; import java.util.Date; @OnApplicationStart public class Import extends Job { private static final Logger logger = Logger.getLogger( Import.class.getName()); private final SimpleDateFormat dateFormat = new SimpleDateFormat( "dd.MM.yyyy"); public void doJob() { loadUsersFromFixture(); loadTransactionsFromCsv(); } private void loadUsersFromFixture() { if (User.count() == 0) { Fixtures.load("fixtures-local.yml"); } } private void loadTransactionsFromCsv() { if (Transaction.count() == 0) { File f = VirtualFile.fromRelativePath( "/conf/fixture-transactions-full.csv").getRealFile(); User user = User.all().first(); BufferedReader reader = null; try { reader = new BufferedReader(new InputStreamReader(new FileInputStream(f))); String line; while ((line = reader.readLine()) != null) { Transaction t = parseTransaction(line); if (t != null) { t.user = user; t.save(); } } } catch (IOException e) { logger.log(Level.ERROR, e); } finally { IOUtils.closeQuietly(reader); } } } private Transaction parseTransaction(String line) { String[] s = line.split("_"); try { Date accountingDate = dateFormat.parse(s[0]); String text = s[4]; Double out = Double.parseDouble(s[5]); Double in = Double.parseDouble(s[6]); Transaction t = new Transaction(); t.accountingDate = accountingDate; t.type = ModelHelper.insertIgnoreType(s[3]); t.text = text; t.trimmedText = FmtUtil.trimTransactionText(text).trim(); t.amountOut = out; t.amountIn = in; t.tag = ModelHelper.insertIgnoreTag(s[7]); t.tag.imageId = Integer.parseInt(s[8], 16); + t.tag.save(); t.internal = false; t.dirty = false; t.timestamp = t.accountingDate.getTime(); return t; } catch (ParseException e) { logger.log(Level.ERROR, e); } return null; } }
true
true
private Transaction parseTransaction(String line) { String[] s = line.split("_"); try { Date accountingDate = dateFormat.parse(s[0]); String text = s[4]; Double out = Double.parseDouble(s[5]); Double in = Double.parseDouble(s[6]); Transaction t = new Transaction(); t.accountingDate = accountingDate; t.type = ModelHelper.insertIgnoreType(s[3]); t.text = text; t.trimmedText = FmtUtil.trimTransactionText(text).trim(); t.amountOut = out; t.amountIn = in; t.tag = ModelHelper.insertIgnoreTag(s[7]); t.tag.imageId = Integer.parseInt(s[8], 16); t.internal = false; t.dirty = false; t.timestamp = t.accountingDate.getTime(); return t; } catch (ParseException e) { logger.log(Level.ERROR, e); } return null; }
private Transaction parseTransaction(String line) { String[] s = line.split("_"); try { Date accountingDate = dateFormat.parse(s[0]); String text = s[4]; Double out = Double.parseDouble(s[5]); Double in = Double.parseDouble(s[6]); Transaction t = new Transaction(); t.accountingDate = accountingDate; t.type = ModelHelper.insertIgnoreType(s[3]); t.text = text; t.trimmedText = FmtUtil.trimTransactionText(text).trim(); t.amountOut = out; t.amountIn = in; t.tag = ModelHelper.insertIgnoreTag(s[7]); t.tag.imageId = Integer.parseInt(s[8], 16); t.tag.save(); t.internal = false; t.dirty = false; t.timestamp = t.accountingDate.getTime(); return t; } catch (ParseException e) { logger.log(Level.ERROR, e); } return null; }
diff --git a/examples/fixengine/examples/console/commands/Config.java b/examples/fixengine/examples/console/commands/Config.java index 1f4d4d01..6abacb3d 100644 --- a/examples/fixengine/examples/console/commands/Config.java +++ b/examples/fixengine/examples/console/commands/Config.java @@ -1,73 +1,73 @@ /* * Copyright 2010 the original author or authors. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package fixengine.examples.console.commands; import java.util.Scanner; import fixengine.Version; import fixengine.examples.console.ConsoleClient; public class Config implements Command { public void execute(ConsoleClient client, Scanner scanner) throws CommandArgException { client.setConfig(config(scanner)); } private fixengine.Config config(Scanner scanner) throws CommandArgException { fixengine.Config config = new fixengine.Config(); config.setVersion(version(scanner)); config.setSenderCompId(senderCompID(scanner)); config.setTargetCompId(targetCompID(scanner)); config.setSenderSubID(senderSubID(scanner)); config.setTargetSubID(targetSubID(scanner)); return config; } private Version version(Scanner scanner) throws CommandArgException { if (!scanner.hasNext()) throw new CommandArgException("version must be specified"); String value = scanner.next(); for (Version version : Version.values()) { if (version.value().equals(value.toUpperCase())) { return version; } } - throw new CommandArgException("unknown version: '%s'".format(value)); + throw new CommandArgException("unknown version: '" + value + "'"); } private String senderCompID(Scanner scanner) throws CommandArgException { if (!scanner.hasNext()) throw new CommandArgException("senderCompID must be specified"); return scanner.next(); } private String targetCompID(Scanner scanner) throws CommandArgException { if (!scanner.hasNext()) throw new CommandArgException("targetCompID must be specified"); return scanner.next(); } private String senderSubID(Scanner scanner) throws CommandArgException { if (!scanner.hasNext()) return null; return scanner.next(); } private String targetSubID(Scanner scanner) throws CommandArgException { if (!scanner.hasNext()) return null; return scanner.next(); } }
true
true
private Version version(Scanner scanner) throws CommandArgException { if (!scanner.hasNext()) throw new CommandArgException("version must be specified"); String value = scanner.next(); for (Version version : Version.values()) { if (version.value().equals(value.toUpperCase())) { return version; } } throw new CommandArgException("unknown version: '%s'".format(value)); }
private Version version(Scanner scanner) throws CommandArgException { if (!scanner.hasNext()) throw new CommandArgException("version must be specified"); String value = scanner.next(); for (Version version : Version.values()) { if (version.value().equals(value.toUpperCase())) { return version; } } throw new CommandArgException("unknown version: '" + value + "'"); }
diff --git a/src/com/strategy/havannah/logic/PathsIter.java b/src/com/strategy/havannah/logic/PathsIter.java index b1d294a..b373e2b 100644 --- a/src/com/strategy/havannah/logic/PathsIter.java +++ b/src/com/strategy/havannah/logic/PathsIter.java @@ -1,178 +1,183 @@ package com.strategy.havannah.logic; import net.sf.javabdd.BDD; import net.sf.javabdd.BDDFactory; import com.strategy.api.board.Board; import com.strategy.api.logic.PathCalculator; import com.strategy.api.logic.Position; import com.strategy.util.Debug; import com.strategy.util.StoneColor; import com.strategy.util.operation.Logging; import com.strategy.util.preferences.Preferences; /** * TODO matrices are symmetrical - can be exploited to save memory * * @author Ralph Dürig */ public class PathsIter implements PathCalculator { private BDDFactory fac; private Board board; private Logging logPandQ = Logging.create("iterative: p and q"); private Logging logNPandNQ = Logging.create("iterative: not p and not q"); private Logging logPMandMQ = Logging.create("iterative: pm and mq"); private Logging logPQorPMMQ = Logging .create("iterative: pq or (pm and mq)"); private BDD[] reachWhite; private BDD[] reachBlack; private int rec; /** * */ public PathsIter(BDDFactory fac, Board board) { this.fac = fac; this.board = board; this.rec = 0; Debug initlog = Debug.create("iteratively creating reachability"); initReachability(); initlog.log(); } public BDD getPath(Position p, Position q, StoneColor color) { Integer indexP = board.getField(p.getRow(), p.getCol()).getIndex(); Integer indexQ = board.getField(q.getRow(), q.getCol()).getIndex(); int V = board.getRows() * board.getColumns(); BDD path; if (color.equals(StoneColor.WHITE)) { path = reachWhite[V * indexP + indexQ].id(); } else { path = reachBlack[V * indexP + indexQ].id(); } return path; } public void log() { if (null != Preferences.getInstance().getOut()) { Preferences.getInstance().getOut() .println("all iterations: " + rec); } logPandQ.log(); logNPandNQ.log(); logPMandMQ.log(); logPQorPMMQ.log(); } public void done() { freeMatrix(reachWhite); freeMatrix(reachBlack); } // ************************************************************************ private void initReachability() { // number of vertices int V = board.getColumns() * board.getRows(); // adjacency matrix with bdd style reachWhite = new BDD[V * V]; reachBlack = new BDD[V * V]; for (int p = 0; p < V; p++) { if (!board.isValidField(p)) { continue; } for (int q = 0; q < V; q++) { if (!board.isValidField(q)) { continue; } Position posP = board.getField(p).getPosition(); Position posQ = board.getField(q).getPosition(); if (posP.isNeighbour(posQ)) { reachWhite[V * p + q] = logPandQ.andLog(fac.ithVar(p), fac.ithVar(q)); reachBlack[V * p + q] = logNPandNQ.andLog(fac.nithVar(p), fac.nithVar(q)); } else { - reachWhite[V * p + q] = fac.zero(); - reachBlack[V * p + q] = fac.zero(); + if (posP.equals(posQ)) { + reachWhite[V * p + q] = fac.one(); + reachBlack[V * p + q] = fac.one(); + } else { + reachWhite[V * p + q] = fac.zero(); + reachBlack[V * p + q] = fac.zero(); + } } } } // printMatrix(reachWhite); // reachability matrix with floyd-warshall-algorithm and bdd style also for (int k = 0; k < V; k++) { if (!board.isValidField(k)) { continue; } // Pick all vertices as source one by one for (int i = 0; i < V; i++) { if (!board.isValidField(i) || i == k) { continue; } // Pick all vertices as destination for the // above picked source for (int j = 0; j < V; j++) { if (!board.isValidField(j) || j == k || j == i) { continue; } rec++; // If vertex k is on a path from i to j, // then make sure that the value of reach[i][j] is 1 doReach(reachWhite, k, i, j, board); doReach(reachBlack, k, i, j, board); } } } } private void doReach(BDD[] todo, int m, int p, int q, Board b) { int V = board.getRows() * board.getColumns(); BDD reachpq = todo[V * p + q]; BDD reachpm = todo[V * p + m]; BDD reachmq = todo[V * m + q]; // todo[p][q] = reachpq.or(reachpm.and(reachmq)); // System.out.println("p=" + p + ", q=" + q + ", m=" + m); todo[V * p + q] = logPQorPMMQ.orLog(reachpq, logPMandMQ.andLog(reachpm.id(), reachmq.id())); } private void freeMatrix(BDD[] reach) { for (int i = 0; i < reach.length; i++) { if (null != reach[i]) { reach[i].free(); } } } private void printMatrix(BDD[] reach) { System.out .println("Following matrix is transitive closure of the given graph"); int limit = board.getRows() * board.getColumns(); for (int i = 0; i < reach.length; i++) { if (i % limit == 0) { System.out.println(); } if (null != reach[i]) { System.out.print(i / limit + "x" + i % limit + " O "); } else { System.out.print(" null "); } } System.out.println(); } }
true
true
private void initReachability() { // number of vertices int V = board.getColumns() * board.getRows(); // adjacency matrix with bdd style reachWhite = new BDD[V * V]; reachBlack = new BDD[V * V]; for (int p = 0; p < V; p++) { if (!board.isValidField(p)) { continue; } for (int q = 0; q < V; q++) { if (!board.isValidField(q)) { continue; } Position posP = board.getField(p).getPosition(); Position posQ = board.getField(q).getPosition(); if (posP.isNeighbour(posQ)) { reachWhite[V * p + q] = logPandQ.andLog(fac.ithVar(p), fac.ithVar(q)); reachBlack[V * p + q] = logNPandNQ.andLog(fac.nithVar(p), fac.nithVar(q)); } else { reachWhite[V * p + q] = fac.zero(); reachBlack[V * p + q] = fac.zero(); } } } // printMatrix(reachWhite); // reachability matrix with floyd-warshall-algorithm and bdd style also for (int k = 0; k < V; k++) { if (!board.isValidField(k)) { continue; } // Pick all vertices as source one by one for (int i = 0; i < V; i++) { if (!board.isValidField(i) || i == k) { continue; } // Pick all vertices as destination for the // above picked source for (int j = 0; j < V; j++) { if (!board.isValidField(j) || j == k || j == i) { continue; } rec++; // If vertex k is on a path from i to j, // then make sure that the value of reach[i][j] is 1 doReach(reachWhite, k, i, j, board); doReach(reachBlack, k, i, j, board); } } } }
private void initReachability() { // number of vertices int V = board.getColumns() * board.getRows(); // adjacency matrix with bdd style reachWhite = new BDD[V * V]; reachBlack = new BDD[V * V]; for (int p = 0; p < V; p++) { if (!board.isValidField(p)) { continue; } for (int q = 0; q < V; q++) { if (!board.isValidField(q)) { continue; } Position posP = board.getField(p).getPosition(); Position posQ = board.getField(q).getPosition(); if (posP.isNeighbour(posQ)) { reachWhite[V * p + q] = logPandQ.andLog(fac.ithVar(p), fac.ithVar(q)); reachBlack[V * p + q] = logNPandNQ.andLog(fac.nithVar(p), fac.nithVar(q)); } else { if (posP.equals(posQ)) { reachWhite[V * p + q] = fac.one(); reachBlack[V * p + q] = fac.one(); } else { reachWhite[V * p + q] = fac.zero(); reachBlack[V * p + q] = fac.zero(); } } } } // printMatrix(reachWhite); // reachability matrix with floyd-warshall-algorithm and bdd style also for (int k = 0; k < V; k++) { if (!board.isValidField(k)) { continue; } // Pick all vertices as source one by one for (int i = 0; i < V; i++) { if (!board.isValidField(i) || i == k) { continue; } // Pick all vertices as destination for the // above picked source for (int j = 0; j < V; j++) { if (!board.isValidField(j) || j == k || j == i) { continue; } rec++; // If vertex k is on a path from i to j, // then make sure that the value of reach[i][j] is 1 doReach(reachWhite, k, i, j, board); doReach(reachBlack, k, i, j, board); } } } }
diff --git a/src/net/java/sip/communicator/plugin/updatechecker/UpdateCheckActivator.java b/src/net/java/sip/communicator/plugin/updatechecker/UpdateCheckActivator.java index ee8c36574..07772109b 100644 --- a/src/net/java/sip/communicator/plugin/updatechecker/UpdateCheckActivator.java +++ b/src/net/java/sip/communicator/plugin/updatechecker/UpdateCheckActivator.java @@ -1,751 +1,750 @@ /* * SIP Communicator, the OpenSource Java VoIP and Instant Messaging client. * * Distributable under LGPL license. * See terms of license at gnu.org. */ package net.java.sip.communicator.plugin.updatechecker; import java.awt.BorderLayout; import java.awt.Dimension; import java.awt.FlowLayout; import java.awt.Toolkit; import java.awt.event.*; import java.io.*; import java.net.*; import java.security.cert.*; import java.util.*; import javax.net.ssl.*; import javax.swing.*; import net.java.sip.communicator.service.browserlauncher.*; import net.java.sip.communicator.service.configuration.*; import net.java.sip.communicator.service.contactlist.*; import net.java.sip.communicator.service.gui.*; import net.java.sip.communicator.service.protocol.*; import net.java.sip.communicator.service.resources.*; import net.java.sip.communicator.service.version.*; import net.java.sip.communicator.util.*; import net.java.sip.communicator.util.swing.*; import org.osgi.framework.*; /** * Activates the UpdateCheck plugin * * @author Damian Minkov */ public class UpdateCheckActivator implements BundleActivator { private static final Logger logger = Logger.getLogger(UpdateCheckActivator.class); private static BundleContext bundleContext = null; private static BrowserLauncherService browserLauncherService; private static ResourceManagementService resourcesService; private static ConfigurationService configService; private static UIService uiService = null; private String downloadLink = null; private String lastVersion = null; private String changesLink = null; private static UserCredentials userCredentials = null; private static final String UPDATE_USERNAME_CONFIG = "net.java.sip.communicator.plugin.updatechecker.UPDATE_SITE_USERNAME"; private static final String UPDATE_PASSWORD_CONFIG = "net.java.sip.communicator.plugin.updatechecker.UPDATE_SITE_PASSWORD"; static { removeDownloadRestrictions(); } /** * Starts this bundle * * @param bundleContext BundleContext * @throws Exception */ public void start(BundleContext bundleContext) throws Exception { try { logger.logEntry(); UpdateCheckActivator.bundleContext = bundleContext; } finally { logger.logExit(); } String osName = System.getProperty("os.name"); if (osName.startsWith("Windows")) { // register update button Hashtable<String, String> toolsMenuFilter = new Hashtable<String, String>(); toolsMenuFilter.put( Container.CONTAINER_ID, Container.CONTAINER_HELP_MENU.getID()); bundleContext.registerService( PluginComponent.class.getName(), new UpdateMenuButtonComponent( Container.CONTAINER_HELP_MENU), toolsMenuFilter); } if(isNewestVersion()) return; if (osName.startsWith("Windows")) { windowsUpdaterShow(); return; } final JDialog dialog = new SIPCommDialog() { protected void close(boolean isEscaped) { } }; dialog.setTitle( getResources().getI18NString("plugin.updatechecker.DIALOG_TITLE")); JEditorPane contentMessage = new JEditorPane(); contentMessage.setContentType("text/html"); contentMessage.setOpaque(false); contentMessage.setEditable(false); String dialogMsg = getResources().getI18NString("plugin.updatechecker.DIALOG_MESSAGE", new String[]{getResources() .getSettingsString("service.gui.APPLICATION_NAME")}); if(lastVersion != null) dialogMsg += getResources().getI18NString( "plugin.updatechecker.DIALOG_MESSAGE_2", new String[]{ getResources().getSettingsString( "service.gui.APPLICATION_NAME"), lastVersion}); contentMessage.setText(dialogMsg); JPanel contentPane = new TransparentPanel(new BorderLayout(5,5)); contentPane.setBorder(BorderFactory.createEmptyBorder(10, 10, 10, 10)); contentPane.add(contentMessage, BorderLayout.CENTER); JPanel buttonPanel = new TransparentPanel(new FlowLayout(FlowLayout.CENTER, 10, 10)); JButton closeButton = new JButton( getResources().getI18NString("plugin.updatechecker.BUTTON_CLOSE")); closeButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { dialog.setVisible(false); } }); if(downloadLink != null) { JButton downloadButton = new JButton(getResources().getI18NString( "plugin.updatechecker.BUTTON_DOWNLOAD")); downloadButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { getBrowserLauncher().openURL(downloadLink); dialog.dispose(); } }); buttonPanel.add(downloadButton); } buttonPanel.add(closeButton); contentPane.add(buttonPanel, BorderLayout.SOUTH); dialog.setContentPane(contentPane); dialog.pack(); Dimension screenSize = Toolkit.getDefaultToolkit().getScreenSize(); dialog.setLocation( screenSize.width/2 - dialog.getWidth()/2, screenSize.height/2 - dialog.getHeight()/2 ); dialog.setVisible(true); } /** * stop the bundle */ public void stop(BundleContext bundleContext) throws Exception { } /** * Returns the <tt>BrowserLauncherService</tt> obtained from the bundle * context. * @return the <tt>BrowserLauncherService</tt> obtained from the bundle * context */ public static BrowserLauncherService getBrowserLauncher() { if (browserLauncherService == null) { ServiceReference serviceReference = bundleContext .getServiceReference(BrowserLauncherService.class.getName()); browserLauncherService = (BrowserLauncherService) bundleContext .getService(serviceReference); } return browserLauncherService; } /** * Returns the <tt>ConfigurationService</tt> obtained from the bundle * context. * * @return the <tt>ConfigurationService</tt> obtained from the bundle * context */ public static ConfigurationService getConfigurationService() { if (configService == null) { ServiceReference configReference = bundleContext.getServiceReference(ConfigurationService.class .getName()); configService = (ConfigurationService) bundleContext .getService(configReference); } return configService; } /** * Returns a reference to the UIService implementation currently registered * in the bundle context or null if no such implementation was found. * * @return a reference to a UIService implementation currently registered * in the bundle context or null if no such implementation was found. */ public static UIService getUIService() { if(uiService == null) { ServiceReference uiServiceReference = bundleContext.getServiceReference( UIService.class.getName()); uiService = (UIService)bundleContext .getService(uiServiceReference); } return uiService; } public static ResourceManagementService getResources() { if (resourcesService == null) { ServiceReference serviceReference = bundleContext .getServiceReference(ResourceManagementService.class.getName()); if(serviceReference == null) return null; resourcesService = (ResourceManagementService) bundleContext .getService(serviceReference); } return resourcesService; } /** * Check the first link as files on the web are sorted by date * @param currentVersionStr * @return */ private boolean isNewestVersion() { try { ServiceReference serviceReference = bundleContext .getServiceReference( net.java.sip.communicator.service.version. VersionService.class.getName()); VersionService verService = (VersionService) bundleContext .getService(serviceReference); net.java.sip.communicator.service.version.Version ver = verService.getCurrentVersion(); String configString = Resources.getConfigString("update_link"); if(configString == null) { logger.debug("Updates are disabled. Faking latest version."); return true; } URL url = new URL(configString); Properties props = new Properties(); props.load(url.openStream()); lastVersion = props.getProperty("last_version"); downloadLink = props.getProperty("download_link"); changesLink = configString.substring(0, configString.lastIndexOf("/") + 1) + props.getProperty("changes_html"); return lastVersion.compareTo(ver.toString()) <= 0; } catch (Exception e) { logger.warn("Cannot get and compare versions!"); logger.debug("Error was: ", e); // if we get an exception this mean we were unable to compare versions // will return that current is newest to prevent opening info dialog // about new version return true; } } /** * Shows dialog informing about new version with button Install * which trigers the update process. */ private void windowsUpdaterShow() { final JDialog dialog = new SIPCommDialog() { protected void close(boolean isEscaped) { } }; dialog.setTitle( getResources().getI18NString("plugin.updatechecker.DIALOG_TITLE")); JEditorPane contentMessage = new JEditorPane(); contentMessage.setContentType("text/html"); contentMessage.setOpaque(false); contentMessage.setEditable(false); String dialogMsg = getResources().getI18NString("plugin.updatechecker.DIALOG_MESSAGE", new String[]{getResources() .getSettingsString("service.gui.APPLICATION_NAME")}); if(lastVersion != null) dialogMsg += getResources().getI18NString( "plugin.updatechecker.DIALOG_MESSAGE_2", new String[]{ getResources().getSettingsString( "service.gui.APPLICATION_NAME"), lastVersion}); contentMessage.setText(dialogMsg); JPanel contentPane = new SIPCommFrame.MainContentPane(); contentMessage.setBorder(BorderFactory.createEmptyBorder(10, 0, 20, 0)); contentPane.setBorder(BorderFactory.createEmptyBorder(0, 10, 0, 10)); contentPane.add(contentMessage, BorderLayout.NORTH); JScrollPane scrollChanges = new JScrollPane(); scrollChanges.setPreferredSize(new Dimension(400, 200)); JEditorPane changesHtml = new JEditorPane(); changesHtml.setContentType("text/html"); changesHtml.setEditable(false); changesHtml.setBorder(BorderFactory.createLoweredBevelBorder()); scrollChanges.setViewportView(changesHtml); contentPane.add(scrollChanges, BorderLayout.CENTER); try { changesHtml.setPage(new URL(changesLink)); } catch (Exception e) { logger.error("Cannot set changes Page", e); } JPanel buttonPanel = new TransparentPanel(new FlowLayout(FlowLayout.CENTER, 10, 10)); JButton closeButton = new JButton( getResources().getI18NString("plugin.updatechecker.BUTTON_CLOSE")); closeButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { dialog.setVisible(false); } }); if(downloadLink != null) { JButton installButton = new JButton(getResources().getI18NString( "plugin.updatechecker.BUTTON_INSTALL")); installButton.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { dialog.dispose(); windowsUpdate(); } }); buttonPanel.add(installButton); } buttonPanel.add(closeButton); contentPane.add(buttonPanel, BorderLayout.SOUTH); dialog.setContentPane(contentPane); dialog.pack(); dialog.setLocation( Toolkit.getDefaultToolkit().getScreenSize().width/2 - dialog.getWidth()/2, Toolkit.getDefaultToolkit().getScreenSize().height/2 - dialog.getHeight()/2 ); dialog.setVisible(true); } /** * The update process itself. * - Downloads the installer in a temp directory. * - Warns that update will shutdown. * - Triggers update (installer) in separate process with the help * of update.exe and shutdowns. */ private void windowsUpdate() { File tempF = null; try { final File temp = File.createTempFile("sc-install", ".exe"); tempF = temp; URL u = new URL(downloadLink); URLConnection uc = u.openConnection(); if (uc instanceof HttpURLConnection) { int responseCode = ((HttpURLConnection) uc).getResponseCode(); if(responseCode == HttpURLConnection.HTTP_UNAUTHORIZED) { new Thread(new Runnable() { public void run() { ExportedWindow authWindow = getUIService().getExportedWindow( ExportedWindow.AUTHENTICATION_WINDOW); UserCredentials cred = new UserCredentials(); authWindow.setParams(new Object[]{cred}); authWindow.setVisible(true); userCredentials = cred; if(cred.getUserName() == null) { userCredentials = null; } else windowsUpdate(); } }).start(); } else if(responseCode == HttpURLConnection.HTTP_OK && userCredentials != null && userCredentials.getUserName() != null && userCredentials.isPasswordPersistent()) { // if save password is checked save the pass getConfigurationService().setProperty( UPDATE_USERNAME_CONFIG, userCredentials.getUserName()); getConfigurationService().setProperty( UPDATE_PASSWORD_CONFIG, new String(Base64.encode( userCredentials.getPasswordAsString().getBytes()))); } } InputStream in = uc.getInputStream(); // Chain a ProgressMonitorInputStream to the // URLConnection's InputStream final ProgressMonitorInputStream pin = new ProgressMonitorInputStream(null, u.toString(), in); // Set the maximum value of the ProgressMonitor ProgressMonitor pm = pin.getProgressMonitor(); pm.setMaximum(uc.getContentLength()); final BufferedOutputStream out = new BufferedOutputStream(new FileOutputStream(temp)); new Thread(new Runnable() { public void run() { try { int read = -1; byte[] buff = new byte[1024]; while((read = pin.read(buff)) != -1) { out.write(buff, 0, read); } pin.close(); out.flush(); out.close(); if(getUIService().getPopupDialog().showConfirmPopupDialog( getResources().getI18NString( "plugin.updatechecker.DIALOG_WARN"), getResources().getI18NString( "plugin.updatechecker.DIALOG_TITLE"), PopupDialog.YES_NO_OPTION, PopupDialog.QUESTION_MESSAGE ) != PopupDialog.YES_OPTION) { return; } // file saved. Now start updater and shutdown. String workingDir = System.getProperty("user.dir"); ProcessBuilder processBuilder = new ProcessBuilder( new String[] { - workingDir + File.separator + "updater.exe", - temp.getCanonicalPath() + workingDir + File.separator + "up2date.exe", + "--allow-elevation", + temp.getCanonicalPath(), + workingDir }); - processBuilder.environment().put( - "SIP_COMMUNICATOR_AUTOUPDATE_INSTALLDIR", - workingDir); processBuilder.start(); getUIService().beginShutdown(); } catch (Exception e) { logger.error("Error saving", e); try { pin.close(); out.close(); } catch (Exception e1) {} } } }).start(); } catch(FileNotFoundException e) { getUIService().getPopupDialog().showMessagePopupDialog( getResources().getI18NString("plugin.updatechecker.DIALOG_MISSING_UPDATE"), getResources().getI18NString("plugin.updatechecker.DIALOG_NOUPDATE_TITLE"), PopupDialog.INFORMATION_MESSAGE); tempF.delete(); } catch (Exception e) { logger.info("Error starting update process!", e); tempF.delete(); } } /** * Invokes action for checking for updates. */ private void checkForUpdate() { if(isNewestVersion()) { getUIService().getPopupDialog().showMessagePopupDialog( getResources().getI18NString("plugin.updatechecker.DIALOG_NOUPDATE"), getResources().getI18NString("plugin.updatechecker.DIALOG_NOUPDATE_TITLE"), PopupDialog.INFORMATION_MESSAGE); } else windowsUpdaterShow(); } /** * Installs Dummy TrustManager will not try to validate self-signed certs. * Fix some problems with not proper use of certs. */ private static void removeDownloadRestrictions() { try { SSLContext sc = SSLContext.getInstance("SSLv3"); TrustManager[] tma = {new DummyTrustManager()}; sc.init(null, tma, null); HttpsURLConnection.setDefaultSSLSocketFactory(sc.getSocketFactory()); } catch (Exception e) { logger.warn("Failed to init dummy trust magaer", e); } HostnameVerifier hv = new HostnameVerifier() { public boolean verify(String urlHostName, SSLSession session) { logger.warn("Warning: URL Host: " + urlHostName + " vs. " + session.getPeerHost()); return true; } }; HttpsURLConnection.setDefaultHostnameVerifier(hv); Authenticator.setDefault(new Authenticator() { protected PasswordAuthentication getPasswordAuthentication() { // if there is something save return it String uName = (String)getConfigurationService(). getProperty(UPDATE_USERNAME_CONFIG); if(uName != null) { String pass = (String)getConfigurationService(). getProperty(UPDATE_PASSWORD_CONFIG); if(pass != null) return new PasswordAuthentication(uName, new String(Base64.decode(pass)).toCharArray()); } if(userCredentials != null) { return new PasswordAuthentication( userCredentials.getUserName(), userCredentials.getPassword()); } else { return null; } } }); } /** * The menu entry under tools menu. */ private class UpdateMenuButtonComponent implements PluginComponent { private final Container container; private final JMenuItem updateMenuItem = new JMenuItem(getResources(). getI18NString("plugin.updatechecker.UPDATE_MENU_ENTRY")); UpdateMenuButtonComponent(Container c) { this.container = c; updateMenuItem.addActionListener(new ActionListener() { public void actionPerformed(ActionEvent e) { checkForUpdate(); } }); } public String getName() { return getResources().getI18NString( "plugin.updatechecker.UPDATE_MENU_ENTRY"); } public Container getContainer() { return this.container; } public String getConstraints() { return null; } public int getPositionIndex() { return -1; } public Object getComponent() { return updateMenuItem; } public void setCurrentContact(MetaContact metaContact) { } public void setCurrentContactGroup(MetaContactGroup metaGroup) { } public boolean isNativeComponent() { return false; } } /** * Dummy trust manager, trusts everything. */ private static class DummyTrustManager implements X509TrustManager { public void checkClientTrusted(X509Certificate[] arg0, String arg1) throws CertificateException { } public void checkServerTrusted(X509Certificate[] arg0, String arg1) throws CertificateException { } public X509Certificate[] getAcceptedIssuers() { return null; } } }
false
true
private void windowsUpdate() { File tempF = null; try { final File temp = File.createTempFile("sc-install", ".exe"); tempF = temp; URL u = new URL(downloadLink); URLConnection uc = u.openConnection(); if (uc instanceof HttpURLConnection) { int responseCode = ((HttpURLConnection) uc).getResponseCode(); if(responseCode == HttpURLConnection.HTTP_UNAUTHORIZED) { new Thread(new Runnable() { public void run() { ExportedWindow authWindow = getUIService().getExportedWindow( ExportedWindow.AUTHENTICATION_WINDOW); UserCredentials cred = new UserCredentials(); authWindow.setParams(new Object[]{cred}); authWindow.setVisible(true); userCredentials = cred; if(cred.getUserName() == null) { userCredentials = null; } else windowsUpdate(); } }).start(); } else if(responseCode == HttpURLConnection.HTTP_OK && userCredentials != null && userCredentials.getUserName() != null && userCredentials.isPasswordPersistent()) { // if save password is checked save the pass getConfigurationService().setProperty( UPDATE_USERNAME_CONFIG, userCredentials.getUserName()); getConfigurationService().setProperty( UPDATE_PASSWORD_CONFIG, new String(Base64.encode( userCredentials.getPasswordAsString().getBytes()))); } } InputStream in = uc.getInputStream(); // Chain a ProgressMonitorInputStream to the // URLConnection's InputStream final ProgressMonitorInputStream pin = new ProgressMonitorInputStream(null, u.toString(), in); // Set the maximum value of the ProgressMonitor ProgressMonitor pm = pin.getProgressMonitor(); pm.setMaximum(uc.getContentLength()); final BufferedOutputStream out = new BufferedOutputStream(new FileOutputStream(temp)); new Thread(new Runnable() { public void run() { try { int read = -1; byte[] buff = new byte[1024]; while((read = pin.read(buff)) != -1) { out.write(buff, 0, read); } pin.close(); out.flush(); out.close(); if(getUIService().getPopupDialog().showConfirmPopupDialog( getResources().getI18NString( "plugin.updatechecker.DIALOG_WARN"), getResources().getI18NString( "plugin.updatechecker.DIALOG_TITLE"), PopupDialog.YES_NO_OPTION, PopupDialog.QUESTION_MESSAGE ) != PopupDialog.YES_OPTION) { return; } // file saved. Now start updater and shutdown. String workingDir = System.getProperty("user.dir"); ProcessBuilder processBuilder = new ProcessBuilder( new String[] { workingDir + File.separator + "updater.exe", temp.getCanonicalPath() }); processBuilder.environment().put( "SIP_COMMUNICATOR_AUTOUPDATE_INSTALLDIR", workingDir); processBuilder.start(); getUIService().beginShutdown(); } catch (Exception e) { logger.error("Error saving", e); try { pin.close(); out.close(); } catch (Exception e1) {} } } }).start(); } catch(FileNotFoundException e) { getUIService().getPopupDialog().showMessagePopupDialog( getResources().getI18NString("plugin.updatechecker.DIALOG_MISSING_UPDATE"), getResources().getI18NString("plugin.updatechecker.DIALOG_NOUPDATE_TITLE"), PopupDialog.INFORMATION_MESSAGE); tempF.delete(); } catch (Exception e) { logger.info("Error starting update process!", e); tempF.delete(); } }
private void windowsUpdate() { File tempF = null; try { final File temp = File.createTempFile("sc-install", ".exe"); tempF = temp; URL u = new URL(downloadLink); URLConnection uc = u.openConnection(); if (uc instanceof HttpURLConnection) { int responseCode = ((HttpURLConnection) uc).getResponseCode(); if(responseCode == HttpURLConnection.HTTP_UNAUTHORIZED) { new Thread(new Runnable() { public void run() { ExportedWindow authWindow = getUIService().getExportedWindow( ExportedWindow.AUTHENTICATION_WINDOW); UserCredentials cred = new UserCredentials(); authWindow.setParams(new Object[]{cred}); authWindow.setVisible(true); userCredentials = cred; if(cred.getUserName() == null) { userCredentials = null; } else windowsUpdate(); } }).start(); } else if(responseCode == HttpURLConnection.HTTP_OK && userCredentials != null && userCredentials.getUserName() != null && userCredentials.isPasswordPersistent()) { // if save password is checked save the pass getConfigurationService().setProperty( UPDATE_USERNAME_CONFIG, userCredentials.getUserName()); getConfigurationService().setProperty( UPDATE_PASSWORD_CONFIG, new String(Base64.encode( userCredentials.getPasswordAsString().getBytes()))); } } InputStream in = uc.getInputStream(); // Chain a ProgressMonitorInputStream to the // URLConnection's InputStream final ProgressMonitorInputStream pin = new ProgressMonitorInputStream(null, u.toString(), in); // Set the maximum value of the ProgressMonitor ProgressMonitor pm = pin.getProgressMonitor(); pm.setMaximum(uc.getContentLength()); final BufferedOutputStream out = new BufferedOutputStream(new FileOutputStream(temp)); new Thread(new Runnable() { public void run() { try { int read = -1; byte[] buff = new byte[1024]; while((read = pin.read(buff)) != -1) { out.write(buff, 0, read); } pin.close(); out.flush(); out.close(); if(getUIService().getPopupDialog().showConfirmPopupDialog( getResources().getI18NString( "plugin.updatechecker.DIALOG_WARN"), getResources().getI18NString( "plugin.updatechecker.DIALOG_TITLE"), PopupDialog.YES_NO_OPTION, PopupDialog.QUESTION_MESSAGE ) != PopupDialog.YES_OPTION) { return; } // file saved. Now start updater and shutdown. String workingDir = System.getProperty("user.dir"); ProcessBuilder processBuilder = new ProcessBuilder( new String[] { workingDir + File.separator + "up2date.exe", "--allow-elevation", temp.getCanonicalPath(), workingDir }); processBuilder.start(); getUIService().beginShutdown(); } catch (Exception e) { logger.error("Error saving", e); try { pin.close(); out.close(); } catch (Exception e1) {} } } }).start(); } catch(FileNotFoundException e) { getUIService().getPopupDialog().showMessagePopupDialog( getResources().getI18NString("plugin.updatechecker.DIALOG_MISSING_UPDATE"), getResources().getI18NString("plugin.updatechecker.DIALOG_NOUPDATE_TITLE"), PopupDialog.INFORMATION_MESSAGE); tempF.delete(); } catch (Exception e) { logger.info("Error starting update process!", e); tempF.delete(); } }
diff --git a/src/org/jruby/debug/DebugEventHook.java b/src/org/jruby/debug/DebugEventHook.java index 40157ae..6d7e5e6 100644 --- a/src/org/jruby/debug/DebugEventHook.java +++ b/src/org/jruby/debug/DebugEventHook.java @@ -1,625 +1,625 @@ /* * header & license * Copyright (c) 2007-2008 Martin Krauskopf * Copyright (c) 2007 Peter Brant * * Permission is hereby granted, free of charge, to any person obtaining * a copy of this software and associated documentation files (the * "Software"), to deal in the Software without restriction, including * without limitation the rights to use, copy, modify, merge, publish, * distribute, sublicense, and/or sell copies of the Software, and to * permit persons to whom the Software is furnished to do so, subject to * the following conditions: * * The above copyright notice and this permission notice shall be * included in all copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF * MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE * LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION * OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION * WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.jruby.debug; import java.io.File; import org.jruby.MetaClass; import org.jruby.Ruby; import org.jruby.RubyArray; import org.jruby.RubyBinding; import org.jruby.RubyBoolean; import org.jruby.RubyFile; import org.jruby.RubyFixnum; import org.jruby.RubyFloat; import org.jruby.RubyKernel; import org.jruby.RubyModule; import org.jruby.RubyNil; import org.jruby.RubyObject; import org.jruby.RubyString; import org.jruby.RubySymbol; import org.jruby.RubyThread; import org.jruby.debug.DebugContext.StopReason; import org.jruby.debug.DebugFrame.Info; import org.jruby.debug.Debugger.DebugContextPair; import org.jruby.exceptions.RaiseException; import org.jruby.runtime.Block; import org.jruby.runtime.EventHook; import org.jruby.runtime.ThreadContext; import org.jruby.runtime.builtin.IRubyObject; final class DebugEventHook implements EventHook { private final Debugger debugger; private final Ruby runtime; private int hookCount; private int lastDebuggedThnum; private int lastCheck; private boolean inDebugger; public DebugEventHook(final Debugger debugger, final Ruby runtime) { this.debugger = debugger; lastDebuggedThnum = -1; this.runtime = runtime; } public void event(final ThreadContext tCtx, final int event, final String file, final int line0, final String methodName, final IRubyObject klass) { boolean needsSuspend = false; RubyThread currThread = tCtx.getThread(); DebugContextPair contexts = debugger.threadContextLookup(currThread, true); // return if thread is marked as 'ignored'. debugger's threads are marked this way if (contexts.debugContext.isIgnored()) { return; } /* ignore a skipped section of code */ if (contexts.debugContext.isSkipped()) { cleanUp(contexts.debugContext); return; } /** Ignore JRuby core classes by default. Consider option for enabling it. */ if (Util.isJRubyCore(file)) { return; } needsSuspend = contexts.debugContext.isSuspended(); if (needsSuspend) { RubyThread.stop(currThread); } synchronized (this) { if (isInDebugger()) { return; } setInDebugger(true); try { processEvent(tCtx, event, Util.relativizeToPWD(file), line0, methodName, klass, contexts); } finally { setInDebugger(false); } } } @SuppressWarnings("fallthrough") private void processEvent(final ThreadContext tCtx, final int event, final String file, final int line0, final String methodName, final IRubyObject klass, DebugContextPair contexts) { if (debugger.isDebug()) { Util.logEvent(event, file, line0, methodName, klass); } // one-based; jruby by default passes zero-based int line = line0 + 1; hookCount++; Ruby runtime = tCtx.getRuntime(); IRubyObject breakpoint = getNil(); IRubyObject binding = getNil(); IRubyObject context = contexts.context; DebugContext debugContext = contexts.debugContext; // debug("jrubydebug> %s:%d [%s] %s\n", file, line, EVENT_NAMES[event], methodName); boolean moved = false; if (debugContext.getLastLine() != line || debugContext.getLastFile() == null || !Util.areSameFiles(debugContext.getLastFile(), file)) { debugContext.setEnableBreakpoint(true); moved = true; } // else if(event != RUBY_EVENT_RETURN && event != RUBY_EVENT_C_RETURN) { // if(debug == Qtrue) // fprintf(stderr, "nodeless [%s] %s\n", get_event_name(event), rb_id2name(methodName)); // goto cleanup; // } else { // if(debug == Qtrue) // fprintf(stderr, "nodeless [%s] %s\n", get_event_name(event), rb_id2name(methodName)); // } if (event != RUBY_EVENT_LINE) { debugContext.setStepped(true); } switch (event) { case RUBY_EVENT_LINE: if (debugContext.getStackSize() == 0) { saveCallFrame(event, tCtx, file, line, methodName, debugContext); } else { updateTopFrame(event, debugContext, tCtx, file, line, methodName); } if (debugger.isTracing() || debugContext.isTracing()) { IRubyObject[] args = new IRubyObject[]{ runtime.newString(file), runtime.newFixnum(line) }; context.callMethod(tCtx, DebugContext.AT_TRACING, args); } if (debugContext.getDestFrame() == -1 || debugContext.getStackSize() == debugContext.getDestFrame()) { if (moved || !debugContext.isForceMove()) { debugContext.setStopNext(debugContext.getStopNext() - 1); } if (debugContext.getStopNext() < 0) { debugContext.setStopNext(-1); } if (moved || (debugContext.isStepped() && !debugContext.isForceMove())) { debugContext.setStopLine(debugContext.getStopLine() - 1); debugContext.setStepped(false); } } else if (debugContext.getStackSize() < debugContext.getDestFrame()) { debugContext.setStopNext(0); } if (debugContext.getStopNext() == 0 || debugContext.getStopLine() == 0 || !(breakpoint = checkBreakpointsByPos(debugContext, file, line)).isNil()) { binding = (tCtx != null ? RubyBinding.newBinding(runtime) : getNil()); saveTopBinding(debugContext, binding); debugContext.setStopReason(DebugContext.StopReason.STEP); /* Check breakpoint expression. */ if (!breakpoint.isNil()) { if (!checkBreakpointExpression(tCtx, breakpoint, binding)) { break; } if (!checkBreakpointHitCondition(breakpoint)) { break; } if (breakpoint != debugContext.getBreakpoint()) { debugContext.setStopReason(DebugContext.StopReason.BREAKPOINT); context.callMethod(tCtx, DebugContext.AT_BREAKPOINT, breakpoint); } else { debugContext.setBreakpoint(getNil()); } } /* reset all pointers */ debugContext.setDestFrame(-1); debugContext.setStopLine(-1); debugContext.setStopNext(-1); callAtLine(tCtx, context, debugContext, runtime, file, line); } break; case RUBY_EVENT_CALL: saveCallFrame(event, tCtx, file, line, methodName, debugContext); breakpoint = checkBreakpointsByMethod(debugContext, klass, methodName); if (!breakpoint.isNil()) { DebugFrame debugFrame = getTopFrame(debugContext); if (debugFrame != null) { binding = debugFrame.getBinding(); } if (tCtx != null && binding.isNil()) { binding = RubyBinding.newBinding(runtime); } saveTopBinding(debugContext, binding); if(!checkBreakpointExpression(tCtx, breakpoint, binding)) { break; } if(!checkBreakpointHitCondition(breakpoint)) { break; } if (breakpoint != debugContext.getBreakpoint()) { debugContext.setStopReason(DebugContext.StopReason.BREAKPOINT); context.callMethod(tCtx, DebugContext.AT_BREAKPOINT, breakpoint); } else { debugContext.setBreakpoint(getNil()); } callAtLine(tCtx, context, debugContext, runtime, file, line); } break; case RUBY_EVENT_C_CALL: if(cCallNewFrameP(klass)) { saveCallFrame(event, tCtx, file, line, methodName, debugContext); } else { updateTopFrame(event, debugContext, tCtx, file, line, methodName); } break; case RUBY_EVENT_C_RETURN: /* note if a block is given we fall through! */ if (!cCallNewFrameP(klass)) { break; } case RUBY_EVENT_RETURN: case RUBY_EVENT_END: if (debugContext.getStackSize() == debugContext.getStopFrame()) { debugContext.setStopNext(1); debugContext.setStopFrame(0); } while (debugContext.getStackSize() > 0) { DebugFrame topFrame = debugContext.popFrame(); String origMethodName = topFrame.getOrigMethodName(); if ((origMethodName == null && methodName == null) || (origMethodName != null && origMethodName.equals(methodName))) { break; } } debugContext.setEnableBreakpoint(true); break; case RUBY_EVENT_CLASS: resetTopFrameMethodName(debugContext); saveCallFrame(event, tCtx, file, line, methodName, debugContext); break; case RUBY_EVENT_RAISE: updateTopFrame(event, debugContext, tCtx, file, line, methodName); // XXX Implement post mortem debugging IRubyObject exception = runtime.getGlobalVariables().get("$!"); // Might happen if the current ThreadContext is within 'defined?' if (exception.isNil()) { assert tCtx.isWithinDefined() : "$! should be nil only when within defined?"; break; } if (runtime.getClass("SystemExit").isInstance(exception)) { // Can't do this because this unhooks the event hook causing // a ConcurrentModificationException because the runtime // is still iterating over event hooks. Shouldn't really // matter. We're on our way out regardless. // debugger.stop(runtime); break; } if (debugger.getCatchpoints().isNil() || debugger.getCatchpoints().isEmpty()) { break; } RubyArray ancestors = exception.getType().ancestors(); int l = ancestors.getLength(); for (int i = 0; i < l; i++) { RubyModule module = (RubyModule)ancestors.get(i); IRubyObject modName = module.name(); IRubyObject hitCount = debugger.getCatchpoints().op_aref(tCtx, modName); if (!hitCount.isNil()) { hitCount = runtime.newFixnum(RubyFixnum.fix2int(hitCount) + 1); debugger.getCatchpoints().op_aset(tCtx, modName, hitCount); debugContext.setStopReason(DebugContext.StopReason.CATCHPOINT); - context.callMethod(tCtx, DebugContext.AT_CATCHPOINT, breakpoint); + context.callMethod(tCtx, DebugContext.AT_CATCHPOINT, exception); DebugFrame debugFrame = getTopFrame(debugContext); if (debugFrame != null) { binding = debugFrame.getBinding(); } if (tCtx != null && binding.isNil()) { binding = RubyBinding.newBinding(runtime); } saveTopBinding(debugContext, binding); callAtLine(tCtx, context, debugContext, runtime, file, line); break; } } break; } cleanUp(debugContext); } private IRubyObject getNil() { return runtime.getNil(); } private IRubyObject getBreakpoints() { return debugger.getBreakpoints(); } private void cleanUp(DebugContext debugContext) { debugContext.setStopReason(StopReason.NONE); /* check that all contexts point to alive threads */ if(hookCount - lastCheck > 3000) { debugger.checkThreadContexts(runtime); lastCheck = hookCount; } } public boolean isInterestedInEvent(int event) { return true; } private void saveCallFrame(final int event, final ThreadContext tCtx, final String file, final int line, final String methodName, final DebugContext debugContext) { IRubyObject binding = (debugger.isKeepFrameBinding()) ? RubyBinding.newBinding(tCtx.getRuntime()) : tCtx.getRuntime().getNil(); DebugFrame debugFrame = new DebugFrame(); debugFrame.setFile(file); debugFrame.setLine(line); debugFrame.setBinding(binding); debugFrame.setMethodName(methodName); debugFrame.setOrigMethodName(methodName); debugFrame.setDead(false); debugFrame.setSelf(tCtx.getFrameSelf()); Info info = debugFrame.getInfo(); info.setFrame(tCtx.getCurrentFrame()); info.setScope(tCtx.getCurrentScope().getStaticScope()); info.setDynaVars(event == RUBY_EVENT_LINE ? tCtx.getCurrentScope() : null); debugContext.addFrame(debugFrame); if (debugger.isTrackFrameArgs()) { copyScalarArgs(tCtx, debugFrame); } else { debugFrame.setArgValues(runtime.getNil()); } } private boolean isArgValueSmall(IRubyObject value) { return value == RubyObject.UNDEF || value instanceof RubyFixnum || value instanceof RubyFloat || value instanceof RubyNil || value instanceof RubyModule || value instanceof RubyFile || value instanceof RubyBoolean || value instanceof RubySymbol; } /** Save scalar arguments or a class name. */ private void copyScalarArgs(ThreadContext tCtx, DebugFrame debugFrame) { RubyArray args = runtime.newArray(tCtx.getCurrentScope().getArgValues()); int len = args.getLength(); for (int i = 0; i < len; i++) { IRubyObject obj = args.entry(i); if (! isArgValueSmall(obj)) { args.store(i, runtime.newString(obj.getType().getName())); } } debugFrame.setArgValues(args); } private void updateTopFrame(int event, DebugContext debug_context, ThreadContext tCtx, String file, int line, String methodName) { DebugFrame topFrame = getTopFrame(debug_context); if (topFrame != null) { topFrame.setSelf(tCtx.getFrameSelf()); topFrame.setFile(file); topFrame.setLine(line); topFrame.setMethodName(methodName); topFrame.getInfo().setDynaVars(event == RUBY_EVENT_C_CALL ? null : tCtx.getCurrentScope()); } } private DebugFrame getTopFrame(final DebugContext debugContext) { if (debugContext.getStackSize() == 0) { return null; } else { return debugContext.getTopFrame(); } } private IRubyObject checkBreakpointsByPos(DebugContext debugContext, String file, int line) { if (!debugContext.isEnableBreakpoint()) { return getNil(); } if (checkBreakpointByPos(debugContext.getBreakpoint(), file, line)) { return debugContext.getBreakpoint(); } RubyArray arr = getBreakpoints().convertToArray(); if (arr.isEmpty()) { return getNil(); } for (int i = 0; i < arr.size(); i++) { IRubyObject breakpoint = arr.entry(i); if (checkBreakpointByPos(breakpoint, file, line)) { return breakpoint; } } return getNil(); } private boolean checkBreakpointByPos(IRubyObject breakpoint, String file, int line) { if (breakpoint.isNil()) { return false; } DebugBreakpoint debugBreakpoint = (DebugBreakpoint) breakpoint.dataGetStruct(); if (!debugBreakpoint.isEnabled()) { return false; } if (debugBreakpoint.getType() != DebugBreakpoint.Type.POS) { return false; } if (debugBreakpoint.getPos().getLine() != line) { return false; } String source = ((RubyString) debugBreakpoint.getSource()).toString(); String sourceName = new File(source).getName(); String fileName = new File(file).getName(); if (sourceName.equals(fileName)) { return true; } return false; } private IRubyObject checkBreakpointsByMethod(DebugContext debugContext, IRubyObject klass, String methodName) { if (!debugContext.isEnableBreakpoint()) { return getNil(); } if (checkBreakpointByMethod(debugContext.getBreakpoint(), klass, methodName)) { return debugContext.getBreakpoint(); } RubyArray arr = getBreakpoints().convertToArray(); if (arr.isEmpty()) { return getNil(); } for (int i = 0; i < arr.size(); i++) { IRubyObject breakpoint = arr.entry(i); if (checkBreakpointByMethod(breakpoint, klass, methodName)) { return breakpoint; } } return getNil(); } private boolean checkBreakpointByMethod(IRubyObject breakpoint, IRubyObject klass, String methodName) { if (breakpoint.isNil()) { return false; } DebugBreakpoint debugBreakpoint = (DebugBreakpoint) breakpoint.dataGetStruct(); if (!debugBreakpoint.isEnabled()) { return false; } if (debugBreakpoint.getType() != DebugBreakpoint.Type.METHOD) { return false; } if (! debugBreakpoint.getPos().getMethodName().equals(methodName)) { return false; } if (debugBreakpoint.getSource().asString().eql(klass.asString())) { return true; } return false; } private boolean checkBreakpointExpression(ThreadContext tCtx, IRubyObject breakpoint, IRubyObject binding) { DebugBreakpoint debugBreakpoint = (DebugBreakpoint) breakpoint.dataGetStruct(); if (debugBreakpoint.getExpr().isNil()) { return true; } try { IRubyObject result = RubyKernel.eval( tCtx, breakpoint, new IRubyObject[] { debugBreakpoint.getExpr(), binding }, Block.NULL_BLOCK); return result.isTrue(); } catch (RaiseException e) { // XXX Seems like we should tell the user about this, but this how // ruby-debug behaves return false; } } private boolean checkBreakpointHitCondition(IRubyObject breakpoint) { DebugBreakpoint debugBreakpoint = (DebugBreakpoint) breakpoint.dataGetStruct(); debugBreakpoint.setHitCount(debugBreakpoint.getHitCount()+1); if (debugBreakpoint.getHitCondition() == null) { return true; } switch (debugBreakpoint.getHitCondition()) { case NONE: return true; case GE: if (debugBreakpoint.getHitCount() >= debugBreakpoint.getHitValue()) { return true; } break; case EQ: if (debugBreakpoint.getHitCount() == debugBreakpoint.getHitValue()) { return true; } break; case MOD: if (debugBreakpoint.getHitCount() % debugBreakpoint.getHitValue() == 0) { return true; } break; } return false; } private void saveTopBinding(DebugContext context, IRubyObject binding) { DebugFrame debugFrame = getTopFrame(context); if (debugFrame != null) { debugFrame.setBinding(binding); } } private IRubyObject callAtLine(ThreadContext tCtx, IRubyObject context, DebugContext debugContext, Ruby runtime, String file, int line) { return callAtLine(tCtx, context, debugContext, runtime.newString(file), runtime.newFixnum(line)); } private IRubyObject callAtLine(ThreadContext tCtx, IRubyObject context, DebugContext debugContext, IRubyObject file, IRubyObject line) { lastDebuggedThnum = debugContext.getThnum(); saveCurrentPosition(debugContext); IRubyObject[] args = new IRubyObject[]{ file, line }; return context.callMethod(tCtx, DebugContext.AT_LINE, args); } private void saveCurrentPosition(final DebugContext debugContext) { DebugFrame debugFrame = getTopFrame(debugContext); if (debugFrame == null) { return; } debugContext.setLastFile(debugFrame.getFile()); debugContext.setLastLine(debugFrame.getLine()); debugContext.setEnableBreakpoint(false); debugContext.setStepped(false); debugContext.setForceMove(false); } private boolean cCallNewFrameP(IRubyObject klass) { klass = realClass(klass); // TODO - block_given? // if(rb_block_given_p()) return true; String cName = klass.getType().getName(); return "Proc".equals(cName) || "RubyKernel".equals(cName) || "Module".equals(cName); } private IRubyObject realClass(IRubyObject klass) { if (klass instanceof MetaClass) { return ((MetaClass)klass).getRealClass(); } return klass; } private void resetTopFrameMethodName(DebugContext debugContext) { DebugFrame topFrame = getTopFrame(debugContext); if (topFrame != null) { topFrame.setMethodName(""); } } private boolean isInDebugger() { return inDebugger; } private void setInDebugger(boolean inDebugger) { this.inDebugger = inDebugger; } int getLastDebuggedThnum() { return lastDebuggedThnum; } }
true
true
private void processEvent(final ThreadContext tCtx, final int event, final String file, final int line0, final String methodName, final IRubyObject klass, DebugContextPair contexts) { if (debugger.isDebug()) { Util.logEvent(event, file, line0, methodName, klass); } // one-based; jruby by default passes zero-based int line = line0 + 1; hookCount++; Ruby runtime = tCtx.getRuntime(); IRubyObject breakpoint = getNil(); IRubyObject binding = getNil(); IRubyObject context = contexts.context; DebugContext debugContext = contexts.debugContext; // debug("jrubydebug> %s:%d [%s] %s\n", file, line, EVENT_NAMES[event], methodName); boolean moved = false; if (debugContext.getLastLine() != line || debugContext.getLastFile() == null || !Util.areSameFiles(debugContext.getLastFile(), file)) { debugContext.setEnableBreakpoint(true); moved = true; } // else if(event != RUBY_EVENT_RETURN && event != RUBY_EVENT_C_RETURN) { // if(debug == Qtrue) // fprintf(stderr, "nodeless [%s] %s\n", get_event_name(event), rb_id2name(methodName)); // goto cleanup; // } else { // if(debug == Qtrue) // fprintf(stderr, "nodeless [%s] %s\n", get_event_name(event), rb_id2name(methodName)); // } if (event != RUBY_EVENT_LINE) { debugContext.setStepped(true); } switch (event) { case RUBY_EVENT_LINE: if (debugContext.getStackSize() == 0) { saveCallFrame(event, tCtx, file, line, methodName, debugContext); } else { updateTopFrame(event, debugContext, tCtx, file, line, methodName); } if (debugger.isTracing() || debugContext.isTracing()) { IRubyObject[] args = new IRubyObject[]{ runtime.newString(file), runtime.newFixnum(line) }; context.callMethod(tCtx, DebugContext.AT_TRACING, args); } if (debugContext.getDestFrame() == -1 || debugContext.getStackSize() == debugContext.getDestFrame()) { if (moved || !debugContext.isForceMove()) { debugContext.setStopNext(debugContext.getStopNext() - 1); } if (debugContext.getStopNext() < 0) { debugContext.setStopNext(-1); } if (moved || (debugContext.isStepped() && !debugContext.isForceMove())) { debugContext.setStopLine(debugContext.getStopLine() - 1); debugContext.setStepped(false); } } else if (debugContext.getStackSize() < debugContext.getDestFrame()) { debugContext.setStopNext(0); } if (debugContext.getStopNext() == 0 || debugContext.getStopLine() == 0 || !(breakpoint = checkBreakpointsByPos(debugContext, file, line)).isNil()) { binding = (tCtx != null ? RubyBinding.newBinding(runtime) : getNil()); saveTopBinding(debugContext, binding); debugContext.setStopReason(DebugContext.StopReason.STEP); /* Check breakpoint expression. */ if (!breakpoint.isNil()) { if (!checkBreakpointExpression(tCtx, breakpoint, binding)) { break; } if (!checkBreakpointHitCondition(breakpoint)) { break; } if (breakpoint != debugContext.getBreakpoint()) { debugContext.setStopReason(DebugContext.StopReason.BREAKPOINT); context.callMethod(tCtx, DebugContext.AT_BREAKPOINT, breakpoint); } else { debugContext.setBreakpoint(getNil()); } } /* reset all pointers */ debugContext.setDestFrame(-1); debugContext.setStopLine(-1); debugContext.setStopNext(-1); callAtLine(tCtx, context, debugContext, runtime, file, line); } break; case RUBY_EVENT_CALL: saveCallFrame(event, tCtx, file, line, methodName, debugContext); breakpoint = checkBreakpointsByMethod(debugContext, klass, methodName); if (!breakpoint.isNil()) { DebugFrame debugFrame = getTopFrame(debugContext); if (debugFrame != null) { binding = debugFrame.getBinding(); } if (tCtx != null && binding.isNil()) { binding = RubyBinding.newBinding(runtime); } saveTopBinding(debugContext, binding); if(!checkBreakpointExpression(tCtx, breakpoint, binding)) { break; } if(!checkBreakpointHitCondition(breakpoint)) { break; } if (breakpoint != debugContext.getBreakpoint()) { debugContext.setStopReason(DebugContext.StopReason.BREAKPOINT); context.callMethod(tCtx, DebugContext.AT_BREAKPOINT, breakpoint); } else { debugContext.setBreakpoint(getNil()); } callAtLine(tCtx, context, debugContext, runtime, file, line); } break; case RUBY_EVENT_C_CALL: if(cCallNewFrameP(klass)) { saveCallFrame(event, tCtx, file, line, methodName, debugContext); } else { updateTopFrame(event, debugContext, tCtx, file, line, methodName); } break; case RUBY_EVENT_C_RETURN: /* note if a block is given we fall through! */ if (!cCallNewFrameP(klass)) { break; } case RUBY_EVENT_RETURN: case RUBY_EVENT_END: if (debugContext.getStackSize() == debugContext.getStopFrame()) { debugContext.setStopNext(1); debugContext.setStopFrame(0); } while (debugContext.getStackSize() > 0) { DebugFrame topFrame = debugContext.popFrame(); String origMethodName = topFrame.getOrigMethodName(); if ((origMethodName == null && methodName == null) || (origMethodName != null && origMethodName.equals(methodName))) { break; } } debugContext.setEnableBreakpoint(true); break; case RUBY_EVENT_CLASS: resetTopFrameMethodName(debugContext); saveCallFrame(event, tCtx, file, line, methodName, debugContext); break; case RUBY_EVENT_RAISE: updateTopFrame(event, debugContext, tCtx, file, line, methodName); // XXX Implement post mortem debugging IRubyObject exception = runtime.getGlobalVariables().get("$!"); // Might happen if the current ThreadContext is within 'defined?' if (exception.isNil()) { assert tCtx.isWithinDefined() : "$! should be nil only when within defined?"; break; } if (runtime.getClass("SystemExit").isInstance(exception)) { // Can't do this because this unhooks the event hook causing // a ConcurrentModificationException because the runtime // is still iterating over event hooks. Shouldn't really // matter. We're on our way out regardless. // debugger.stop(runtime); break; } if (debugger.getCatchpoints().isNil() || debugger.getCatchpoints().isEmpty()) { break; } RubyArray ancestors = exception.getType().ancestors(); int l = ancestors.getLength(); for (int i = 0; i < l; i++) { RubyModule module = (RubyModule)ancestors.get(i); IRubyObject modName = module.name(); IRubyObject hitCount = debugger.getCatchpoints().op_aref(tCtx, modName); if (!hitCount.isNil()) { hitCount = runtime.newFixnum(RubyFixnum.fix2int(hitCount) + 1); debugger.getCatchpoints().op_aset(tCtx, modName, hitCount); debugContext.setStopReason(DebugContext.StopReason.CATCHPOINT); context.callMethod(tCtx, DebugContext.AT_CATCHPOINT, breakpoint); DebugFrame debugFrame = getTopFrame(debugContext); if (debugFrame != null) { binding = debugFrame.getBinding(); } if (tCtx != null && binding.isNil()) { binding = RubyBinding.newBinding(runtime); } saveTopBinding(debugContext, binding); callAtLine(tCtx, context, debugContext, runtime, file, line); break; } } break; } cleanUp(debugContext); }
private void processEvent(final ThreadContext tCtx, final int event, final String file, final int line0, final String methodName, final IRubyObject klass, DebugContextPair contexts) { if (debugger.isDebug()) { Util.logEvent(event, file, line0, methodName, klass); } // one-based; jruby by default passes zero-based int line = line0 + 1; hookCount++; Ruby runtime = tCtx.getRuntime(); IRubyObject breakpoint = getNil(); IRubyObject binding = getNil(); IRubyObject context = contexts.context; DebugContext debugContext = contexts.debugContext; // debug("jrubydebug> %s:%d [%s] %s\n", file, line, EVENT_NAMES[event], methodName); boolean moved = false; if (debugContext.getLastLine() != line || debugContext.getLastFile() == null || !Util.areSameFiles(debugContext.getLastFile(), file)) { debugContext.setEnableBreakpoint(true); moved = true; } // else if(event != RUBY_EVENT_RETURN && event != RUBY_EVENT_C_RETURN) { // if(debug == Qtrue) // fprintf(stderr, "nodeless [%s] %s\n", get_event_name(event), rb_id2name(methodName)); // goto cleanup; // } else { // if(debug == Qtrue) // fprintf(stderr, "nodeless [%s] %s\n", get_event_name(event), rb_id2name(methodName)); // } if (event != RUBY_EVENT_LINE) { debugContext.setStepped(true); } switch (event) { case RUBY_EVENT_LINE: if (debugContext.getStackSize() == 0) { saveCallFrame(event, tCtx, file, line, methodName, debugContext); } else { updateTopFrame(event, debugContext, tCtx, file, line, methodName); } if (debugger.isTracing() || debugContext.isTracing()) { IRubyObject[] args = new IRubyObject[]{ runtime.newString(file), runtime.newFixnum(line) }; context.callMethod(tCtx, DebugContext.AT_TRACING, args); } if (debugContext.getDestFrame() == -1 || debugContext.getStackSize() == debugContext.getDestFrame()) { if (moved || !debugContext.isForceMove()) { debugContext.setStopNext(debugContext.getStopNext() - 1); } if (debugContext.getStopNext() < 0) { debugContext.setStopNext(-1); } if (moved || (debugContext.isStepped() && !debugContext.isForceMove())) { debugContext.setStopLine(debugContext.getStopLine() - 1); debugContext.setStepped(false); } } else if (debugContext.getStackSize() < debugContext.getDestFrame()) { debugContext.setStopNext(0); } if (debugContext.getStopNext() == 0 || debugContext.getStopLine() == 0 || !(breakpoint = checkBreakpointsByPos(debugContext, file, line)).isNil()) { binding = (tCtx != null ? RubyBinding.newBinding(runtime) : getNil()); saveTopBinding(debugContext, binding); debugContext.setStopReason(DebugContext.StopReason.STEP); /* Check breakpoint expression. */ if (!breakpoint.isNil()) { if (!checkBreakpointExpression(tCtx, breakpoint, binding)) { break; } if (!checkBreakpointHitCondition(breakpoint)) { break; } if (breakpoint != debugContext.getBreakpoint()) { debugContext.setStopReason(DebugContext.StopReason.BREAKPOINT); context.callMethod(tCtx, DebugContext.AT_BREAKPOINT, breakpoint); } else { debugContext.setBreakpoint(getNil()); } } /* reset all pointers */ debugContext.setDestFrame(-1); debugContext.setStopLine(-1); debugContext.setStopNext(-1); callAtLine(tCtx, context, debugContext, runtime, file, line); } break; case RUBY_EVENT_CALL: saveCallFrame(event, tCtx, file, line, methodName, debugContext); breakpoint = checkBreakpointsByMethod(debugContext, klass, methodName); if (!breakpoint.isNil()) { DebugFrame debugFrame = getTopFrame(debugContext); if (debugFrame != null) { binding = debugFrame.getBinding(); } if (tCtx != null && binding.isNil()) { binding = RubyBinding.newBinding(runtime); } saveTopBinding(debugContext, binding); if(!checkBreakpointExpression(tCtx, breakpoint, binding)) { break; } if(!checkBreakpointHitCondition(breakpoint)) { break; } if (breakpoint != debugContext.getBreakpoint()) { debugContext.setStopReason(DebugContext.StopReason.BREAKPOINT); context.callMethod(tCtx, DebugContext.AT_BREAKPOINT, breakpoint); } else { debugContext.setBreakpoint(getNil()); } callAtLine(tCtx, context, debugContext, runtime, file, line); } break; case RUBY_EVENT_C_CALL: if(cCallNewFrameP(klass)) { saveCallFrame(event, tCtx, file, line, methodName, debugContext); } else { updateTopFrame(event, debugContext, tCtx, file, line, methodName); } break; case RUBY_EVENT_C_RETURN: /* note if a block is given we fall through! */ if (!cCallNewFrameP(klass)) { break; } case RUBY_EVENT_RETURN: case RUBY_EVENT_END: if (debugContext.getStackSize() == debugContext.getStopFrame()) { debugContext.setStopNext(1); debugContext.setStopFrame(0); } while (debugContext.getStackSize() > 0) { DebugFrame topFrame = debugContext.popFrame(); String origMethodName = topFrame.getOrigMethodName(); if ((origMethodName == null && methodName == null) || (origMethodName != null && origMethodName.equals(methodName))) { break; } } debugContext.setEnableBreakpoint(true); break; case RUBY_EVENT_CLASS: resetTopFrameMethodName(debugContext); saveCallFrame(event, tCtx, file, line, methodName, debugContext); break; case RUBY_EVENT_RAISE: updateTopFrame(event, debugContext, tCtx, file, line, methodName); // XXX Implement post mortem debugging IRubyObject exception = runtime.getGlobalVariables().get("$!"); // Might happen if the current ThreadContext is within 'defined?' if (exception.isNil()) { assert tCtx.isWithinDefined() : "$! should be nil only when within defined?"; break; } if (runtime.getClass("SystemExit").isInstance(exception)) { // Can't do this because this unhooks the event hook causing // a ConcurrentModificationException because the runtime // is still iterating over event hooks. Shouldn't really // matter. We're on our way out regardless. // debugger.stop(runtime); break; } if (debugger.getCatchpoints().isNil() || debugger.getCatchpoints().isEmpty()) { break; } RubyArray ancestors = exception.getType().ancestors(); int l = ancestors.getLength(); for (int i = 0; i < l; i++) { RubyModule module = (RubyModule)ancestors.get(i); IRubyObject modName = module.name(); IRubyObject hitCount = debugger.getCatchpoints().op_aref(tCtx, modName); if (!hitCount.isNil()) { hitCount = runtime.newFixnum(RubyFixnum.fix2int(hitCount) + 1); debugger.getCatchpoints().op_aset(tCtx, modName, hitCount); debugContext.setStopReason(DebugContext.StopReason.CATCHPOINT); context.callMethod(tCtx, DebugContext.AT_CATCHPOINT, exception); DebugFrame debugFrame = getTopFrame(debugContext); if (debugFrame != null) { binding = debugFrame.getBinding(); } if (tCtx != null && binding.isNil()) { binding = RubyBinding.newBinding(runtime); } saveTopBinding(debugContext, binding); callAtLine(tCtx, context, debugContext, runtime, file, line); break; } } break; } cleanUp(debugContext); }
diff --git a/java/modules/core/src/main/java/org/apache/synapse/core/axis2/SynapseCallbackReceiver.java b/java/modules/core/src/main/java/org/apache/synapse/core/axis2/SynapseCallbackReceiver.java index 6de7af8f3..02621fdec 100644 --- a/java/modules/core/src/main/java/org/apache/synapse/core/axis2/SynapseCallbackReceiver.java +++ b/java/modules/core/src/main/java/org/apache/synapse/core/axis2/SynapseCallbackReceiver.java @@ -1,198 +1,200 @@ /* * Licensed to the Apache Software Foundation (ASF) under one * or more contributor license agreements. See the NOTICE file * distributed with this work for additional information * regarding copyright ownership. The ASF licenses this file * to you under the Apache License, Version 2.0 (the * "License"); you may not use this file except in compliance * with the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, * software distributed under the License is distributed on an * * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY * KIND, either express or implied. See the License for the * specific language governing permissions and limitations * under the License. */ package org.apache.synapse.core.axis2; import org.apache.axis2.engine.MessageReceiver; import org.apache.axis2.client.async.Callback; import org.apache.axis2.context.MessageContext; import org.apache.axis2.AxisFault; import org.apache.axis2.addressing.RelatesTo; import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; import org.apache.synapse.Constants; import org.apache.synapse.FaultHandler; import org.apache.synapse.endpoints.Endpoint; import org.apache.axiom.soap.SOAPFault; import java.util.*; public class SynapseCallbackReceiver implements MessageReceiver { private static final Log log = LogFactory.getLog(SynapseCallbackReceiver.class); private Map callbackStore; // this will be made thread safe within the constructor public SynapseCallbackReceiver() { callbackStore = Collections.synchronizedMap(new HashMap()); } public void addCallback(String MsgID, Callback callback) { callbackStore.put(MsgID, callback); } public void receive(MessageContext messageCtx) throws AxisFault { if (messageCtx.getOptions() != null && messageCtx.getOptions().getRelatesTo() != null) { String messageID = messageCtx.getOptions().getRelatesTo().getValue(); Callback callback = (Callback) callbackStore.remove(messageID); RelatesTo[] relates = messageCtx.getRelationships(); if (relates.length > 1) { // we set a relates to to the response message so that if WSA is not used, we // could still link back to the original message. But if WSA was used, this // gets duplicated, and we should remove it removeDuplicateRelatesTo(messageCtx, relates); } if (callback != null) { handleMessage(messageCtx, ((AsyncCallback) callback).getSynapseOutMsgCtx()); } else { // TODO invoke a generic synapse error handler for this message log.warn("Synapse received a response for the request with message Id : " + messageID + " But a callback has not been registered to process this response"); } } else { // TODO invoke a generic synapse error handler for this message log.warn("Synapse received a response message without a message Id"); } } /** * Handle the response or error (during a failed send) message received for an outgoing request * * @param response the Axis2 MessageContext that has been received and has to be handled * @param synapseOutMsgCtx the corresponding (outgoing) Synapse MessageContext for the above * Axis2 MC, that holds Synapse specific information such as the error handler stack and * local properties etc. */ private void handleMessage(MessageContext response, org.apache.synapse.MessageContext synapseOutMsgCtx) { Object o = response.getProperty("sending_fault"); if (o != null && Boolean.TRUE.equals(o)) { // there is a sending fault. propagate the fault to fault handlers. Stack faultStack = synapseOutMsgCtx.getFaultStack(); if (faultStack != null && !faultStack.isEmpty()) { SOAPFault fault = response.getEnvelope().getBody().getFault(); Exception e = fault.getException(); if (e == null) { e = new Exception(fault.toString()); } ((FaultHandler) faultStack.pop()).handleFault(synapseOutMsgCtx,e); } } else { // there can always be only one instance of an Endpoint in the faultStack of a message // if the send was successful, so remove it before we proceed any further Stack faultStack = synapseOutMsgCtx.getFaultStack(); if (!faultStack.isEmpty() && faultStack.peek() instanceof Endpoint) { faultStack.pop(); } if (log.isDebugEnabled()) { log.debug("Synapse received an asynchronous response message"); log.debug("Received To: " + (response.getTo() != null ? response.getTo().getAddress() : "null")); log.debug("SOAPAction: " + (response.getSoapAction() != null ? response.getSoapAction() : "null")); log.debug("Body : \n" + response.getEnvelope()); } MessageContext axisOutMsgCtx = ((Axis2MessageContext)synapseOutMsgCtx).getAxis2MessageContext(); response.setOperationContext(axisOutMsgCtx.getOperationContext()); + response.getAxisMessage().setParent( + axisOutMsgCtx.getOperationContext().getAxisOperation()); response.setAxisService(axisOutMsgCtx.getAxisService()); // set properties on response response.setServerSide(true); response.setProperty(Constants.ISRESPONSE_PROPERTY, Boolean.TRUE); response.setProperty(MessageContext.TRANSPORT_OUT, axisOutMsgCtx.getProperty(MessageContext.TRANSPORT_OUT)); response.setProperty(org.apache.axis2.Constants.OUT_TRANSPORT_INFO, axisOutMsgCtx.getProperty(org.apache.axis2.Constants.OUT_TRANSPORT_INFO)); response.setTransportIn(axisOutMsgCtx.getTransportIn()); response.setTransportOut(axisOutMsgCtx.getTransportOut()); // If request is REST assume that the response is REST too response.setDoingREST(axisOutMsgCtx.isDoingREST()); if (axisOutMsgCtx.getMessageID() != null) { response.setRelationships( new RelatesTo[] {new RelatesTo(axisOutMsgCtx.getMessageID())}); } // create the synapse message context for the response Axis2MessageContext synapseInMessageContext = new Axis2MessageContext( response, synapseOutMsgCtx.getConfiguration(), synapseOutMsgCtx.getEnvironment()); synapseInMessageContext.setResponse(true); synapseInMessageContext.setTo(null); // set the properties of the original MC to the new MC Iterator iter = synapseOutMsgCtx.getPropertyKeySet().iterator(); while (iter.hasNext()) { Object key = iter.next(); synapseInMessageContext.setProperty( (String) key, synapseOutMsgCtx.getProperty((String) key)); } // send the response message through the synapse mediation flow synapseOutMsgCtx.getEnvironment(). injectMessage(synapseInMessageContext); } } private void removeDuplicateRelatesTo(MessageContext mc, RelatesTo[] relates) { int insertPos = 0; RelatesTo[] newRelates = new RelatesTo[relates.length]; for (int i=0; i<relates.length; i++) { RelatesTo current = relates[i]; boolean found = false; for (int j=0; j<newRelates.length && j<insertPos; j++) { if (newRelates[j].equals(current) || newRelates[j].getValue().equals(current.getValue())) { found = true; break; } } if (!found) { newRelates[insertPos++] = current; } } RelatesTo[] trimmedRelates = new RelatesTo[insertPos]; System.arraycopy(newRelates, 0, trimmedRelates, 0, insertPos); mc.setRelationships(trimmedRelates); } }
true
true
private void handleMessage(MessageContext response, org.apache.synapse.MessageContext synapseOutMsgCtx) { Object o = response.getProperty("sending_fault"); if (o != null && Boolean.TRUE.equals(o)) { // there is a sending fault. propagate the fault to fault handlers. Stack faultStack = synapseOutMsgCtx.getFaultStack(); if (faultStack != null && !faultStack.isEmpty()) { SOAPFault fault = response.getEnvelope().getBody().getFault(); Exception e = fault.getException(); if (e == null) { e = new Exception(fault.toString()); } ((FaultHandler) faultStack.pop()).handleFault(synapseOutMsgCtx,e); } } else { // there can always be only one instance of an Endpoint in the faultStack of a message // if the send was successful, so remove it before we proceed any further Stack faultStack = synapseOutMsgCtx.getFaultStack(); if (!faultStack.isEmpty() && faultStack.peek() instanceof Endpoint) { faultStack.pop(); } if (log.isDebugEnabled()) { log.debug("Synapse received an asynchronous response message"); log.debug("Received To: " + (response.getTo() != null ? response.getTo().getAddress() : "null")); log.debug("SOAPAction: " + (response.getSoapAction() != null ? response.getSoapAction() : "null")); log.debug("Body : \n" + response.getEnvelope()); } MessageContext axisOutMsgCtx = ((Axis2MessageContext)synapseOutMsgCtx).getAxis2MessageContext(); response.setOperationContext(axisOutMsgCtx.getOperationContext()); response.setAxisService(axisOutMsgCtx.getAxisService()); // set properties on response response.setServerSide(true); response.setProperty(Constants.ISRESPONSE_PROPERTY, Boolean.TRUE); response.setProperty(MessageContext.TRANSPORT_OUT, axisOutMsgCtx.getProperty(MessageContext.TRANSPORT_OUT)); response.setProperty(org.apache.axis2.Constants.OUT_TRANSPORT_INFO, axisOutMsgCtx.getProperty(org.apache.axis2.Constants.OUT_TRANSPORT_INFO)); response.setTransportIn(axisOutMsgCtx.getTransportIn()); response.setTransportOut(axisOutMsgCtx.getTransportOut()); // If request is REST assume that the response is REST too response.setDoingREST(axisOutMsgCtx.isDoingREST()); if (axisOutMsgCtx.getMessageID() != null) { response.setRelationships( new RelatesTo[] {new RelatesTo(axisOutMsgCtx.getMessageID())}); } // create the synapse message context for the response Axis2MessageContext synapseInMessageContext = new Axis2MessageContext( response, synapseOutMsgCtx.getConfiguration(), synapseOutMsgCtx.getEnvironment()); synapseInMessageContext.setResponse(true); synapseInMessageContext.setTo(null); // set the properties of the original MC to the new MC Iterator iter = synapseOutMsgCtx.getPropertyKeySet().iterator(); while (iter.hasNext()) { Object key = iter.next(); synapseInMessageContext.setProperty( (String) key, synapseOutMsgCtx.getProperty((String) key)); } // send the response message through the synapse mediation flow synapseOutMsgCtx.getEnvironment(). injectMessage(synapseInMessageContext); } }
private void handleMessage(MessageContext response, org.apache.synapse.MessageContext synapseOutMsgCtx) { Object o = response.getProperty("sending_fault"); if (o != null && Boolean.TRUE.equals(o)) { // there is a sending fault. propagate the fault to fault handlers. Stack faultStack = synapseOutMsgCtx.getFaultStack(); if (faultStack != null && !faultStack.isEmpty()) { SOAPFault fault = response.getEnvelope().getBody().getFault(); Exception e = fault.getException(); if (e == null) { e = new Exception(fault.toString()); } ((FaultHandler) faultStack.pop()).handleFault(synapseOutMsgCtx,e); } } else { // there can always be only one instance of an Endpoint in the faultStack of a message // if the send was successful, so remove it before we proceed any further Stack faultStack = synapseOutMsgCtx.getFaultStack(); if (!faultStack.isEmpty() && faultStack.peek() instanceof Endpoint) { faultStack.pop(); } if (log.isDebugEnabled()) { log.debug("Synapse received an asynchronous response message"); log.debug("Received To: " + (response.getTo() != null ? response.getTo().getAddress() : "null")); log.debug("SOAPAction: " + (response.getSoapAction() != null ? response.getSoapAction() : "null")); log.debug("Body : \n" + response.getEnvelope()); } MessageContext axisOutMsgCtx = ((Axis2MessageContext)synapseOutMsgCtx).getAxis2MessageContext(); response.setOperationContext(axisOutMsgCtx.getOperationContext()); response.getAxisMessage().setParent( axisOutMsgCtx.getOperationContext().getAxisOperation()); response.setAxisService(axisOutMsgCtx.getAxisService()); // set properties on response response.setServerSide(true); response.setProperty(Constants.ISRESPONSE_PROPERTY, Boolean.TRUE); response.setProperty(MessageContext.TRANSPORT_OUT, axisOutMsgCtx.getProperty(MessageContext.TRANSPORT_OUT)); response.setProperty(org.apache.axis2.Constants.OUT_TRANSPORT_INFO, axisOutMsgCtx.getProperty(org.apache.axis2.Constants.OUT_TRANSPORT_INFO)); response.setTransportIn(axisOutMsgCtx.getTransportIn()); response.setTransportOut(axisOutMsgCtx.getTransportOut()); // If request is REST assume that the response is REST too response.setDoingREST(axisOutMsgCtx.isDoingREST()); if (axisOutMsgCtx.getMessageID() != null) { response.setRelationships( new RelatesTo[] {new RelatesTo(axisOutMsgCtx.getMessageID())}); } // create the synapse message context for the response Axis2MessageContext synapseInMessageContext = new Axis2MessageContext( response, synapseOutMsgCtx.getConfiguration(), synapseOutMsgCtx.getEnvironment()); synapseInMessageContext.setResponse(true); synapseInMessageContext.setTo(null); // set the properties of the original MC to the new MC Iterator iter = synapseOutMsgCtx.getPropertyKeySet().iterator(); while (iter.hasNext()) { Object key = iter.next(); synapseInMessageContext.setProperty( (String) key, synapseOutMsgCtx.getProperty((String) key)); } // send the response message through the synapse mediation flow synapseOutMsgCtx.getEnvironment(). injectMessage(synapseInMessageContext); } }
diff --git a/src/main/java/org/jboss/loom/migrators/_ext/ExternalMigratorsLoader.java b/src/main/java/org/jboss/loom/migrators/_ext/ExternalMigratorsLoader.java index 4bdb538..45bec12 100644 --- a/src/main/java/org/jboss/loom/migrators/_ext/ExternalMigratorsLoader.java +++ b/src/main/java/org/jboss/loom/migrators/_ext/ExternalMigratorsLoader.java @@ -1,222 +1,223 @@ package org.jboss.loom.migrators._ext; import groovy.lang.GroovyClassLoader; import groovy.lang.GroovyCodeSource; import java.io.File; import java.io.IOException; import java.util.HashMap; import java.util.Iterator; import java.util.LinkedList; import java.util.List; import java.util.Map; import org.apache.commons.io.FileUtils; import org.apache.commons.lang.StringUtils; import org.codehaus.groovy.control.CompilationFailedException; import org.jboss.loom.conf.GlobalConfiguration; import org.jboss.loom.ex.MigrationException; import org.jboss.loom.ex.MigrationExceptions; import org.jboss.loom.migrators.IMigratorFilter; import org.jboss.loom.migrators._ext.MigratorDefinition.JaxbClassDef; import org.jboss.loom.spi.IConfigFragment; import org.jboss.loom.utils.Utils; import org.jboss.loom.utils.XmlUtils; import org.slf4j.Logger; import org.slf4j.LoggerFactory; /** * Loads migrators externalized to *.mig.xml descriptors and *.groovy JAXB beans. * * @author Ondrej Zizka, ozizka at redhat.com */ public class ExternalMigratorsLoader { private static final Logger log = LoggerFactory.getLogger( ExternalMigratorsLoader.class ); // Migrator descriptors. private List<MigratorDefinition> descriptors; // Map of JAXB class name -> class - not to lead them multiple times. private Map<String, Class<? extends IConfigFragment>> fragmentJaxbClasses = new HashMap(); // Map of migragor class name -> class private Map<String, Class<? extends DefinitionBasedMigrator>> migratorsClasses = new HashMap(); /** * Reads migrator descriptors from *.mig.xml in the given dir and returns them. * * 1) Reads the definitions from the XML files. * 2) Loads the Groovy classes referenced in these definitions. * 3) Creates the classes of the Migrators. * 4) Instantiates the classes and returns the list of instances. */ public Map<Class<? extends DefinitionBasedMigrator>, DefinitionBasedMigrator> loadMigrators( File dir, IMigratorFilter filter, GlobalConfiguration globConf ) throws MigrationException { // Read the definitions from the XML files. this.descriptors = loadMigratorDefinitions( dir, globConf ); // Filter out those which we don't want. for( Iterator<MigratorDefinition> it = descriptors.iterator(); it.hasNext(); ) { if( ! filter.filterDefinition( it.next() ) ) it.remove(); } // Load the Groovy classes referenced in these definitions. //this.fragmentJaxbClasses = loadJaxbClasses( this.descriptors ); // Create the classes of the Migrators. //this.migratorsClasses = createMigratorsClasses(); // Instantiates the classes and returns the list of instances. Map<Class<? extends DefinitionBasedMigrator>, DefinitionBasedMigrator> migs = instantiateMigratorsFromDefinitions( this.descriptors, this.fragmentJaxbClasses, globConf ); return migs; } /** * Reads migrator descriptors from *.mig.xml in the given dir and returns them. */ public static List<MigratorDefinition> loadMigratorDefinitions( File dir, GlobalConfiguration gc ) throws MigrationException { List<MigratorDefinition> retDefs = new LinkedList(); List<Exception> problems = new LinkedList(); // For each *.mig.xml file... for( File xmlFile : FileUtils.listFiles( dir, new String[]{"mig.xml"}, true ) ){ try{ List<MigratorDefinition> defs = XmlUtils.unmarshallBeans( xmlFile, "/migration/migrator", MigratorDefinition.class ); retDefs.addAll( defs ); // Validate for( MigratorDefinition def : defs ) { try { Utils.validate( def ); } catch( MigrationException ex ){ problems.add( ex ); } } } catch( Exception ex ){ problems.add(ex); } } String msg = "Errors occured when reading migrator descriptors from " + dir + ":\n "; MigrationExceptions.wrapExceptions( problems, msg ); return retDefs; } /** * Loads the Groovy classes referenced in these definitions. */ private static Map<String, Class<? extends IConfigFragment>> loadJaxbClasses( MigratorDefinition desc ) throws MigrationException { Map<String, Class<? extends IConfigFragment>> jaxbClasses = new HashMap(); List<Exception> problems = new LinkedList(); // JAXB class... + if( desc.jaxbBeansClasses != null ) for( JaxbClassDef jaxbClsBean : desc.jaxbBeansClasses ) { try { // Look up in the map: "TestJaxbBean" -> class String className = StringUtils.removeEnd( jaxbClsBean.getFile().getName(), ".groovy" ); Class cls = jaxbClasses.get( className ); if( cls == null ){ // Use the directory where the definition XML file is from. log.debug(" Loading JAXB class from dir " + desc.getOrigin() ); //File dir = new File( desc.getLocation().getSystemId() ).getParentFile(); File dir = desc.getOrigin().getFile().getParentFile(); final File groovyFile = new File( dir, jaxbClsBean.getFile().getPath() ); log.debug(" Loading JAXB class from " + groovyFile ); cls = loadGroovyClass( groovyFile ); if( ! IConfigFragment.class.isAssignableFrom( cls ) ){ problems.add( new MigrationException("Groovy class from '"+groovyFile.getPath()+ "' doesn't implement " + IConfigFragment.class.getSimpleName() + ": " + cls.getName())); continue; } jaxbClasses.put( className, cls ); } //mig.addJaxbClass( cls ); } catch( Exception ex ){ problems.add(ex); } } MigrationExceptions.wrapExceptions( problems, "Failed loading JAXB classes. "); return jaxbClasses; }// loadJaxbClasses() /** * Processes the definitions - loads the used classes and creates the migrator objects. */ public static Map<Class<? extends DefinitionBasedMigrator>, DefinitionBasedMigrator> instantiateMigratorsFromDefinitions ( List<MigratorDefinition> defs, Map<String, Class<? extends IConfigFragment>> fragClasses, GlobalConfiguration globConf ) throws MigrationException { //List<Class<? extends DefinitionBasedMigrator>> migClasses = new LinkedList(); Map<Class<? extends DefinitionBasedMigrator>, DefinitionBasedMigrator> migrators = new HashMap(); List<Exception> problems = new LinkedList(); // For each <migrator ...> definition... for( MigratorDefinition migDef : defs ) { log.debug("Instantiating " + migDef); try { // JAXB classes. Map<String, Class<? extends IConfigFragment>> jaxbClasses = loadJaxbClasses( migDef ); // Migrator class. Class<? extends DefinitionBasedMigrator> migClass = MigratorSubclassMaker.createClass( migDef.name ); //migClasses.add( migClass ); // Instance. DefinitionBasedMigrator mig = MigratorSubclassMaker.instantiate( migClass, migDef, globConf ); mig.setJaxbClasses( jaxbClasses ); migrators.put( migClass, mig ); } catch( Exception ex ) { problems.add( ex ); } } MigrationExceptions.wrapExceptions( problems, "Failed processing migrator definitions. "); return migrators; } /** * Loads a groovy class from given file. */ private static Class loadGroovyClass( File file ) throws MigrationException { try { GroovyClassLoader gcl = new GroovyClassLoader( ExternalMigratorsLoader.class.getClassLoader() ); // Try to add this class' directory on classpath. For the purposes of test runs. Should be conditional? /*File clsFile = ClassUtils.findClassOriginFile( ExternalMigratorsLoader.class ); log.debug("This class' file: " + clsFile); if( clsFile != null && clsFile.isFile() && clsFile.getName().endsWith(".class") ){ log.info("Adding to GroovyClassLoader's classpath: " + clsFile.getParent() ); gcl.addClasspath( clsFile.getParent() ); }/* final String cpRoot = ClassUtils.findClassPathRootFor( ExternalMigratorsLoader.class ); if( cpRoot != null ){ log.info("Adding to GroovyClassLoader's classpath: " + clsFile.getParent() ); gcl.addClasspath( cpRoot ); }/**/ //InputStream groovyClassIS = new FileInputStream( file ); //Class clazz = gcl.parseClass( groovyClassIS, StringUtils.substringBefore(file.getName(),".")); //FileReader fr = new FileReader( file ); GroovyCodeSource src = new GroovyCodeSource( file ); Class clazz = gcl.parseClass( src ); return clazz; } catch( CompilationFailedException | IOException ex ){ throw new MigrationException("Failed creating class from " + file.getPath() + ":\n " + ex.getMessage(), ex); } } }// class
true
true
private static Map<String, Class<? extends IConfigFragment>> loadJaxbClasses( MigratorDefinition desc ) throws MigrationException { Map<String, Class<? extends IConfigFragment>> jaxbClasses = new HashMap(); List<Exception> problems = new LinkedList(); // JAXB class... for( JaxbClassDef jaxbClsBean : desc.jaxbBeansClasses ) { try { // Look up in the map: "TestJaxbBean" -> class String className = StringUtils.removeEnd( jaxbClsBean.getFile().getName(), ".groovy" ); Class cls = jaxbClasses.get( className ); if( cls == null ){ // Use the directory where the definition XML file is from. log.debug(" Loading JAXB class from dir " + desc.getOrigin() ); //File dir = new File( desc.getLocation().getSystemId() ).getParentFile(); File dir = desc.getOrigin().getFile().getParentFile(); final File groovyFile = new File( dir, jaxbClsBean.getFile().getPath() ); log.debug(" Loading JAXB class from " + groovyFile ); cls = loadGroovyClass( groovyFile ); if( ! IConfigFragment.class.isAssignableFrom( cls ) ){ problems.add( new MigrationException("Groovy class from '"+groovyFile.getPath()+ "' doesn't implement " + IConfigFragment.class.getSimpleName() + ": " + cls.getName())); continue; } jaxbClasses.put( className, cls ); } //mig.addJaxbClass( cls ); } catch( Exception ex ){ problems.add(ex); } } MigrationExceptions.wrapExceptions( problems, "Failed loading JAXB classes. "); return jaxbClasses; }// loadJaxbClasses()
private static Map<String, Class<? extends IConfigFragment>> loadJaxbClasses( MigratorDefinition desc ) throws MigrationException { Map<String, Class<? extends IConfigFragment>> jaxbClasses = new HashMap(); List<Exception> problems = new LinkedList(); // JAXB class... if( desc.jaxbBeansClasses != null ) for( JaxbClassDef jaxbClsBean : desc.jaxbBeansClasses ) { try { // Look up in the map: "TestJaxbBean" -> class String className = StringUtils.removeEnd( jaxbClsBean.getFile().getName(), ".groovy" ); Class cls = jaxbClasses.get( className ); if( cls == null ){ // Use the directory where the definition XML file is from. log.debug(" Loading JAXB class from dir " + desc.getOrigin() ); //File dir = new File( desc.getLocation().getSystemId() ).getParentFile(); File dir = desc.getOrigin().getFile().getParentFile(); final File groovyFile = new File( dir, jaxbClsBean.getFile().getPath() ); log.debug(" Loading JAXB class from " + groovyFile ); cls = loadGroovyClass( groovyFile ); if( ! IConfigFragment.class.isAssignableFrom( cls ) ){ problems.add( new MigrationException("Groovy class from '"+groovyFile.getPath()+ "' doesn't implement " + IConfigFragment.class.getSimpleName() + ": " + cls.getName())); continue; } jaxbClasses.put( className, cls ); } //mig.addJaxbClass( cls ); } catch( Exception ex ){ problems.add(ex); } } MigrationExceptions.wrapExceptions( problems, "Failed loading JAXB classes. "); return jaxbClasses; }// loadJaxbClasses()
diff --git a/src/main/java/com/treasure_data/td_import/reader/NonFixnumColumnsFileReader.java b/src/main/java/com/treasure_data/td_import/reader/NonFixnumColumnsFileReader.java index 913e7ed..c3ee31a 100644 --- a/src/main/java/com/treasure_data/td_import/reader/NonFixnumColumnsFileReader.java +++ b/src/main/java/com/treasure_data/td_import/reader/NonFixnumColumnsFileReader.java @@ -1,167 +1,169 @@ // // Treasure Data Bulk-Import Tool in Java // // Copyright (C) 2012 - 2013 Muga Nishizawa // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. // package com.treasure_data.td_import.reader; import java.io.IOException; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.logging.Level; import java.util.logging.Logger; import com.treasure_data.td_import.Configuration; import com.treasure_data.td_import.model.AliasTimeColumnValue; import com.treasure_data.td_import.model.ColumnType; import com.treasure_data.td_import.model.TimeColumnValue; import com.treasure_data.td_import.model.TimeValueTimeColumnValue; import com.treasure_data.td_import.prepare.PrepareConfiguration; import com.treasure_data.td_import.prepare.PreparePartsException; import com.treasure_data.td_import.prepare.Task; import com.treasure_data.td_import.writer.FileWriter; public abstract class NonFixnumColumnsFileReader<T extends PrepareConfiguration> extends FileReader<T> { private static final Logger LOG = Logger.getLogger(NonFixnumColumnsFileReader.class.getName()); protected String aliasTimeColumnName = null; public NonFixnumColumnsFileReader(T conf, FileWriter writer) { super(conf, writer); } @Override public void configure(Task task) throws PreparePartsException { super.configure(task); if (conf.getAliasTimeColumn() != null && !conf.getAliasTimeColumn().equals(Configuration.BI_PREPARE_PARTS_TIMECOLUMN_DEFAULTVALUE)) { aliasTimeColumnName = conf.getAliasTimeColumn(); } columnNames = new String[0]; columnTypes = new ColumnType[0]; skipColumns = new HashSet<String>(); timeColumnValue = new TimeColumnValue(-1, null); } public void setColumnNames() { throw new UnsupportedOperationException(); } public void setColumnTypes() { throw new UnsupportedOperationException(); } public ColumnType toColumnType(Object value) { if (value instanceof Integer) { return ColumnType.INT; } else if (value instanceof Double) { return ColumnType.DOUBLE; } else if (value instanceof String) { return ColumnType.STRING; } else if (value instanceof Long) { return ColumnType.LONG; } else if (value instanceof List) { return ColumnType.ARRAY; } else if (value instanceof Map) { return ColumnType.MAP; } else { throw new UnsupportedOperationException("During toColumnType() execution"); } } @Override public void setSkipColumns() { skipColumns.clear(); super.setSkipColumns(); } public void setTimeColumnValue() throws PreparePartsException { int timeColumnIndex = -1; int aliasTimeColumnIndex = -1; for (int i = 0; i < columnNames.length; i++) { if (columnNames[i].equals(Configuration.BI_PREPARE_PARTS_TIMECOLUMN_DEFAULTVALUE)) { timeColumnIndex = i; break; } if (aliasTimeColumnName != null && columnNames[i].equals(aliasTimeColumnName)) { aliasTimeColumnIndex = i; } } if (timeColumnIndex >= 0) { timeColumnValue = new TimeColumnValue(timeColumnIndex, conf.getTimeFormat()); } else if (aliasTimeColumnIndex >= 0) { timeColumnValue = new AliasTimeColumnValue(aliasTimeColumnIndex, conf.getTimeFormat()); } else if (conf.getTimeValue() >= 0) { timeColumnValue = new TimeValueTimeColumnValue(conf.getTimeValue()); } else { // TODO should change message more user-friendly throw new PreparePartsException("the row doesn't have time column"); } } @Override public boolean next() throws PreparePartsException { try { if (!readRow()) { return false; } setColumnNames(); writer.setColumnNames(getColumnNames()); setColumnTypes(); writer.setColumnTypes(getColumnTypes()); setSkipColumns(); writer.setColumnTypes(getColumnTypes()); setTimeColumnValue(); writer.setTimeColumnValue(getTimeColumnValue()); // convert each column in row convertTypesOfColumns(); // write each column value writer.next(convertedRow); writer.incrementRowNum(); } catch (IOException e) { // if reader throw I/O error, parseRow throws PreparePartsException. String msg = String.format("Cannot read raw data: line %d in %s", lineNum, source); LOG.log(Level.WARNING, msg, e); throw new PreparePartsException(e); } catch (PreparePartsException e) { writer.incrementErrorRowNum(); + // the untokenized raw row is written to error rows file + writeErrorRecord(getCurrentRow()); // the row data should be written to error rows file String msg = String.format("line %d in %s: %s", lineNum, source, getCurrentRow()); LOG.log(Level.WARNING, msg, e); handleError(e); } return true; } @Override public boolean readRow() throws IOException { throw new UnsupportedOperationException(); } @Override public void convertTypesOfColumns() throws PreparePartsException { throw new UnsupportedOperationException(); } }
true
true
public boolean next() throws PreparePartsException { try { if (!readRow()) { return false; } setColumnNames(); writer.setColumnNames(getColumnNames()); setColumnTypes(); writer.setColumnTypes(getColumnTypes()); setSkipColumns(); writer.setColumnTypes(getColumnTypes()); setTimeColumnValue(); writer.setTimeColumnValue(getTimeColumnValue()); // convert each column in row convertTypesOfColumns(); // write each column value writer.next(convertedRow); writer.incrementRowNum(); } catch (IOException e) { // if reader throw I/O error, parseRow throws PreparePartsException. String msg = String.format("Cannot read raw data: line %d in %s", lineNum, source); LOG.log(Level.WARNING, msg, e); throw new PreparePartsException(e); } catch (PreparePartsException e) { writer.incrementErrorRowNum(); // the row data should be written to error rows file String msg = String.format("line %d in %s: %s", lineNum, source, getCurrentRow()); LOG.log(Level.WARNING, msg, e); handleError(e); } return true; }
public boolean next() throws PreparePartsException { try { if (!readRow()) { return false; } setColumnNames(); writer.setColumnNames(getColumnNames()); setColumnTypes(); writer.setColumnTypes(getColumnTypes()); setSkipColumns(); writer.setColumnTypes(getColumnTypes()); setTimeColumnValue(); writer.setTimeColumnValue(getTimeColumnValue()); // convert each column in row convertTypesOfColumns(); // write each column value writer.next(convertedRow); writer.incrementRowNum(); } catch (IOException e) { // if reader throw I/O error, parseRow throws PreparePartsException. String msg = String.format("Cannot read raw data: line %d in %s", lineNum, source); LOG.log(Level.WARNING, msg, e); throw new PreparePartsException(e); } catch (PreparePartsException e) { writer.incrementErrorRowNum(); // the untokenized raw row is written to error rows file writeErrorRecord(getCurrentRow()); // the row data should be written to error rows file String msg = String.format("line %d in %s: %s", lineNum, source, getCurrentRow()); LOG.log(Level.WARNING, msg, e); handleError(e); } return true; }
diff --git a/src/uk/ac/ebi/age/log/Log2JSON.java b/src/uk/ac/ebi/age/log/Log2JSON.java index 4323fea..ca551e8 100644 --- a/src/uk/ac/ebi/age/log/Log2JSON.java +++ b/src/uk/ac/ebi/age/log/Log2JSON.java @@ -1,67 +1,67 @@ package uk.ac.ebi.age.log; import uk.ac.ebi.age.log.LogNode.Level; import com.pri.util.StringUtils; public class Log2JSON { public static String convert( LogNode nd ) { StringBuilder sb = new StringBuilder(); setLevels( nd ); convertNode(nd, sb, 0); return sb.toString(); } private static void convertNode( LogNode ln, StringBuilder sb, int lyr ) { sb.append("{\n"); sb.append(" level: \"").append(ln.getLevel().name()).append("\",\n"); if( ln.getMessage() != null ) { sb.append(" message: \""); - StringUtils.appendSlashed(sb, ln.getMessage()); + StringUtils.appendBackslashed(sb, ln.getMessage(),'"'); sb.append("\",\n"); } if( ln.getSubNodes() != null ) { sb.append(" subnodes: ["); for( LogNode snd : ln.getSubNodes() ) { convertNode(snd,sb,lyr+1); sb.append(",\n"); } sb.append("]\n"); } sb.append("}"); } private static void setLevels( LogNode ln ) { if( ln.getSubNodes() == null ) return; LogNode.Level maxLevel = Level.getMinLevel(); for( LogNode snd : ln.getSubNodes() ) { setLevels(snd); if( snd.getLevel().getPriority() > maxLevel.getPriority() ) maxLevel = snd.getLevel(); } ln.setLevel(maxLevel); } }
true
true
private static void convertNode( LogNode ln, StringBuilder sb, int lyr ) { sb.append("{\n"); sb.append(" level: \"").append(ln.getLevel().name()).append("\",\n"); if( ln.getMessage() != null ) { sb.append(" message: \""); StringUtils.appendSlashed(sb, ln.getMessage()); sb.append("\",\n"); } if( ln.getSubNodes() != null ) { sb.append(" subnodes: ["); for( LogNode snd : ln.getSubNodes() ) { convertNode(snd,sb,lyr+1); sb.append(",\n"); } sb.append("]\n"); } sb.append("}"); }
private static void convertNode( LogNode ln, StringBuilder sb, int lyr ) { sb.append("{\n"); sb.append(" level: \"").append(ln.getLevel().name()).append("\",\n"); if( ln.getMessage() != null ) { sb.append(" message: \""); StringUtils.appendBackslashed(sb, ln.getMessage(),'"'); sb.append("\",\n"); } if( ln.getSubNodes() != null ) { sb.append(" subnodes: ["); for( LogNode snd : ln.getSubNodes() ) { convertNode(snd,sb,lyr+1); sb.append(",\n"); } sb.append("]\n"); } sb.append("}"); }
diff --git a/src/com/androzic/Splash.java b/src/com/androzic/Splash.java index 62ec7d0..d6e5e19 100644 --- a/src/com/androzic/Splash.java +++ b/src/com/androzic/Splash.java @@ -1,618 +1,619 @@ /* * Androzic - android navigation client that uses OziExplorer maps (ozf2, ozfx3). * Copyright (C) 2010-2012 Andrey Novikov <http://andreynovikov.info/> * * This file is part of Androzic application. * * Androzic is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * Androzic is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * You should have received a copy of the GNU General Public License * along with Androzic. If not, see <http://www.gnu.org/licenses/>. */ package com.androzic; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.io.InputStream; import java.net.HttpURLConnection; import java.net.URL; import java.util.List; import android.app.Activity; import android.app.AlertDialog; import android.app.Dialog; import android.content.DialogInterface; import android.content.DialogInterface.OnKeyListener; import android.content.SharedPreferences.Editor; import android.content.Intent; import android.content.SharedPreferences; import android.content.res.Resources; import android.os.Bundle; import android.os.Environment; import android.os.Handler; import android.os.Message; import android.preference.PreferenceManager; import android.text.Html; import android.text.SpannableString; import android.text.method.LinkMovementMethod; import android.text.util.Linkify; import android.view.KeyEvent; import android.view.View; import android.view.View.OnClickListener; import android.view.Window; import android.widget.Button; import android.widget.ProgressBar; import android.widget.TextView; import com.androzic.data.Route; import com.androzic.overlay.CurrentTrackOverlay; import com.androzic.util.FileList; import com.androzic.util.GpxFiles; import com.androzic.util.KmlFiles; import com.androzic.util.OziExplorerFiles; import com.androzic.util.RouteFilenameFilter; public class Splash extends Activity implements OnClickListener { private static final int MSG_FINISH = 1; private static final int MSG_ERROR = 2; private static final int MSG_STATUS = 3; private static final int MSG_PROGRESS = 4; private static final int MSG_ASK = 5; private static final int MSG_SAY = 6; private static final int RES_YES = 1; private static final int RES_NO = 2; private static final int DOWNLOAD_SIZE = 207216; private static final int PROGRESS_STEP = 10000; private int result; private boolean wait; protected String savedMessage; private ProgressBar progress; private TextView message; private Button gotit; private Button yes; private Button no; private Button quit; protected Androzic application; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); requestWindowFeature(Window.FEATURE_NO_TITLE); application = (Androzic) getApplication(); PreferenceManager.setDefaultValues(this, R.xml.pref_behavior, true); PreferenceManager.setDefaultValues(this, R.xml.pref_folder, true); PreferenceManager.setDefaultValues(this, R.xml.pref_location, true); PreferenceManager.setDefaultValues(this, R.xml.pref_display, true); PreferenceManager.setDefaultValues(this, R.xml.pref_unit, true); PreferenceManager.setDefaultValues(this, R.xml.pref_grid, true); PreferenceManager.setDefaultValues(this, R.xml.pref_tracking, true); PreferenceManager.setDefaultValues(this, R.xml.pref_waypoint, true); PreferenceManager.setDefaultValues(this, R.xml.pref_route, true); PreferenceManager.setDefaultValues(this, R.xml.pref_navigation, true); PreferenceManager.setDefaultValues(this, R.xml.pref_general, true); setContentView(R.layout.act_splash); if (application.isPaid) { findViewById(R.id.paid).setVisibility(View.VISIBLE); } progress = (ProgressBar) findViewById(R.id.progress); message = (TextView) findViewById(R.id.message); message.setText(getString(R.string.msg_connectingtoserver)); progress.setMax(DOWNLOAD_SIZE + PROGRESS_STEP * 4); yes = (Button) findViewById(R.id.yes); yes.setOnClickListener(this); no = (Button) findViewById(R.id.no); no.setOnClickListener(this); gotit = (Button) findViewById(R.id.gotit); gotit.setOnClickListener(this); quit = (Button) findViewById(R.id.quit); quit.setOnClickListener(this); wait = true; showEula(); if (! application.mapsInited) { new InitializationThread(progressHandler).start(); } else { progressHandler.sendEmptyMessage(MSG_FINISH); } } private void showEula() { final SharedPreferences prefs = PreferenceManager.getDefaultSharedPreferences(this); boolean hasBeenShown = prefs.getBoolean(getString(R.string.app_eulaaccepted), false); if (hasBeenShown == false) { final SpannableString message = new SpannableString(Html.fromHtml(getString(R.string.app_eula).replace("/n", "<br/>"))); Linkify.addLinks(message, Linkify.WEB_URLS); AlertDialog.Builder builder = new AlertDialog.Builder(this) .setTitle(getString(R.string.app_name)) .setIcon(R.drawable.icon) .setMessage(message) .setPositiveButton(android.R.string.ok, new Dialog.OnClickListener() { @Override public void onClick(DialogInterface dialogInterface, int i) { prefs.edit().putBoolean(getString(R.string.app_eulaaccepted), true).commit(); wait = false; dialogInterface.dismiss(); }}) .setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(DialogInterface dialoginterface, int keyCode, KeyEvent event) { return ! (keyCode == KeyEvent.KEYCODE_HOME); }}) .setCancelable(false); AlertDialog d = builder.create(); d.show(); // Make the textview clickable. Must be called after show() ((TextView) d.findViewById(android.R.id.message)).setMovementMethod(LinkMovementMethod.getInstance()); } else { wait = false; } } final Handler progressHandler = new Handler() { public void handleMessage(Message msg) { switch (msg.what) { case MSG_STATUS: message.setText(msg.getData().getString("message")); break; case MSG_PROGRESS: int total = msg.getData().getInt("total"); progress.setProgress(total); break; case MSG_ASK: progress.setVisibility(View.GONE); savedMessage = message.getText().toString(); message.setText(msg.getData().getString("message")); result = 0; yes.setVisibility(View.VISIBLE); no.setVisibility(View.VISIBLE); break; case MSG_SAY: progress.setVisibility(View.GONE); savedMessage = message.getText().toString(); message.setText(msg.getData().getString("message")); result = 0; gotit.setVisibility(View.VISIBLE); break; case MSG_FINISH: startActivity(new Intent(Splash.this, MapActivity.class).addFlags(Intent.FLAG_ACTIVITY_CLEAR_TOP | Intent.FLAG_ACTIVITY_NEW_TASK).putExtras(getIntent())); finish(); break; case MSG_ERROR: progress.setVisibility(View.INVISIBLE); message.setText(msg.getData().getString("message")); quit.setVisibility(View.VISIBLE); break; } } }; private class InitializationThread extends Thread { Handler mHandler; int total; InitializationThread(Handler h) { mHandler = h; } public void run() { while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } total = 0; Message msg = mHandler.obtainMessage(MSG_STATUS); Bundle b = new Bundle(); b.putString("message", getString(R.string.msg_initializingdata)); msg.setData(b); mHandler.sendMessage(msg); Resources resources = getResources(); SharedPreferences settings = PreferenceManager.getDefaultSharedPreferences(Splash.this); application.enableLocating(settings.getBoolean(getString(R.string.lc_locate), true)); application.enableTracking(settings.getBoolean(getString(R.string.lc_track), true)); // set root folder and check if it has to be created String rootPath = settings.getString(getString(R.string.pref_folder_root), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_prefix)); File root = new File(rootPath); if (!root.exists()) { try { root.mkdirs(); File nomedia = new File(root, ".nomedia"); nomedia.createNewFile(); } catch (IOException e) { msg = mHandler.obtainMessage(MSG_ERROR); b = new Bundle(); b.putString("message", getString(R.string.err_nosdcard)); msg.setData(b); mHandler.sendMessage(msg); return; } } // check maps folder existence File mapdir = new File(settings.getString(getString(R.string.pref_folder_map), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_map))); String oldmap = settings.getString(getString(R.string.pref_folder_map_old), null); if (oldmap != null) { File oldmapdir = new File(root, oldmap); if (! oldmapdir.equals(mapdir)) { mapdir = oldmapdir; Editor editor = settings.edit(); editor.putString(getString(R.string.pref_folder_map), mapdir.getAbsolutePath()); + editor.putString(getString(R.string.pref_folder_map_old), null); editor.commit(); } } if (!mapdir.exists()) { mapdir.mkdirs(); } // check data folder existence File datadir = new File(settings.getString(getString(R.string.pref_folder_data), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_data))); if (!datadir.exists()) { // check if there was an old data structure String wptdir = settings.getString(getString(R.string.pref_folder_waypoint), null); System.err.println("wpt: " + wptdir); if (wptdir != null) { wait = true; msg = mHandler.obtainMessage(MSG_SAY); b = new Bundle(); b.putString("message", getString(R.string.msg_newdatafolder, datadir.getAbsolutePath())); msg.setData(b); mHandler.sendMessage(msg); while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } } datadir.mkdirs(); } // initialize paths application.setRootPath(root.getAbsolutePath()); application.setMapPath(mapdir.getAbsolutePath()); application.setDataPath(Androzic.PATH_DATA, datadir.getAbsolutePath()); application.setDataPath(Androzic.PATH_ICONS, settings.getString(getString(R.string.pref_folder_icon), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_icon))); // initialize data application.installData(); // read default waypoints File wptFile = new File(application.dataPath, "myWaypoints.wpt"); if (wptFile.exists() && wptFile.canRead()) { try { application.addWaypoints(OziExplorerFiles.loadWaypointsFromFile(wptFile)); } catch (IOException e) { e.printStackTrace(); } } // read track tail if (settings.getBoolean(getString(R.string.pref_showcurrenttrack), true)) { application.currentTrackOverlay = new CurrentTrackOverlay(Splash.this); if (settings.getBoolean(getString(R.string.pref_tracking_currentload), resources.getBoolean(R.bool.def_tracking_currentload))) { String name = settings.getString(getString(R.string.trk_current), "myTrack.plt"); File trkFile = new File(application.dataPath, name); if (trkFile.exists() && trkFile.canRead()) { try { application.currentTrackOverlay.setTrack(OziExplorerFiles.loadTrackFromFile(trkFile, Integer.parseInt(settings.getString(getString(R.string.pref_tracking_currentlength), getString(R.string.def_tracking_currentlength))))); } catch (IllegalArgumentException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } } } } // load routes if (settings.getBoolean(getString(R.string.pref_route_preload), resources.getBoolean(R.bool.def_route_preload))) { List<File> files = FileList.getFileListing(new File(application.dataPath), new RouteFilenameFilter()); for (File file : files) { List<Route> routes = null; try { String lc = file.getName().toLowerCase(); if (lc.endsWith(".rt2") || lc.endsWith(".rte")) { routes = OziExplorerFiles.loadRoutesFromFile(file); } else if (lc.endsWith(".kml")) { routes = KmlFiles.loadRoutesFromFile(file); } else if (lc.endsWith(".gpx")) { routes = GpxFiles.loadRoutesFromFile(file); } application.addRoutes(routes); } catch (Exception e) { e.printStackTrace(); } } } total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); // load maps if no any found if (mapdir.list().length == 0) { wait = true; msg = mHandler.obtainMessage(MSG_ASK); b = new Bundle(); b.putString("message", getString(R.string.nomaps_explained, application.getMapPath())); msg.setData(b); mHandler.sendMessage(msg); while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } if (result == RES_YES) { try { // URL u = new URL("http://androzic.googlecode.com/files/world.ozfx3"); URL u = new URL("https://docs.google.com/uc?export=download&id=0Bxnm5oGXU2cja2lQMzVvWFNpZjQ"); HttpURLConnection c = (HttpURLConnection) u.openConnection(); c.setRequestMethod("GET"); c.setDoOutput(true); c.connect(); FileOutputStream f = new FileOutputStream(new File(application.getMapPath(), "world.ozf2")); InputStream in = c.getInputStream(); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_loadingimagefile)); msg.setData(b); mHandler.sendMessage(msg); byte[] buffer = new byte[1024]; int len = 0; while ((len = in.read(buffer)) > 0) { f.write(buffer, 0, len); total += len; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } f.close(); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_loadingmapfile)); msg.setData(b); mHandler.sendMessage(msg); //u = new URL("http://androzic.googlecode.com/files/world.map"); u = new URL("https://docs.google.com/uc?export=download&id=0Bxnm5oGXU2cjWllteG4tSDBxekU"); c = (HttpURLConnection) u.openConnection(); c.setRequestMethod("GET"); c.setDoOutput(true); c.connect(); f = new FileOutputStream(new File(application.getMapPath(), "world.map")); in = c.getInputStream(); buffer = new byte[1024]; len = 0; while ((len = in.read(buffer)) > 0) { f.write(buffer, 0, len); total += len; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } f.close(); } catch (IOException e) { e.printStackTrace(); msg = mHandler.obtainMessage(MSG_ERROR); b = new Bundle(); b.putString("message", getString(R.string.err_noconnection)); msg.setData(b); mHandler.sendMessage(msg); File dir = new File(application.getMapPath()); File[] files = dir.listFiles(); if (files != null) { for (int i = 0; i < files.length; i++) { files[i].delete(); } } return; } } } else { total += DOWNLOAD_SIZE; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingmaps)); msg.setData(b); mHandler.sendMessage(msg); // initialize maps application.initializeMaps(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingplugins)); msg.setData(b); mHandler.sendMessage(msg); // initialize plugins application.initializePlugins(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingview)); msg.setData(b); mHandler.sendMessage(msg); // initialize current map application.initializeMapCenter(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); mHandler.sendEmptyMessage(MSG_FINISH); } } @Override public void onClick(View v) { switch (v.getId()) { case R.id.yes: result = RES_YES; break; case R.id.no: result = RES_NO; break; case R.id.quit: finish(); break; } gotit.setVisibility(View.GONE); yes.setVisibility(View.GONE); no.setVisibility(View.GONE); progress.setVisibility(View.VISIBLE); message.setText(savedMessage); wait = false; } }
true
true
public void run() { while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } total = 0; Message msg = mHandler.obtainMessage(MSG_STATUS); Bundle b = new Bundle(); b.putString("message", getString(R.string.msg_initializingdata)); msg.setData(b); mHandler.sendMessage(msg); Resources resources = getResources(); SharedPreferences settings = PreferenceManager.getDefaultSharedPreferences(Splash.this); application.enableLocating(settings.getBoolean(getString(R.string.lc_locate), true)); application.enableTracking(settings.getBoolean(getString(R.string.lc_track), true)); // set root folder and check if it has to be created String rootPath = settings.getString(getString(R.string.pref_folder_root), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_prefix)); File root = new File(rootPath); if (!root.exists()) { try { root.mkdirs(); File nomedia = new File(root, ".nomedia"); nomedia.createNewFile(); } catch (IOException e) { msg = mHandler.obtainMessage(MSG_ERROR); b = new Bundle(); b.putString("message", getString(R.string.err_nosdcard)); msg.setData(b); mHandler.sendMessage(msg); return; } } // check maps folder existence File mapdir = new File(settings.getString(getString(R.string.pref_folder_map), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_map))); String oldmap = settings.getString(getString(R.string.pref_folder_map_old), null); if (oldmap != null) { File oldmapdir = new File(root, oldmap); if (! oldmapdir.equals(mapdir)) { mapdir = oldmapdir; Editor editor = settings.edit(); editor.putString(getString(R.string.pref_folder_map), mapdir.getAbsolutePath()); editor.commit(); } } if (!mapdir.exists()) { mapdir.mkdirs(); } // check data folder existence File datadir = new File(settings.getString(getString(R.string.pref_folder_data), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_data))); if (!datadir.exists()) { // check if there was an old data structure String wptdir = settings.getString(getString(R.string.pref_folder_waypoint), null); System.err.println("wpt: " + wptdir); if (wptdir != null) { wait = true; msg = mHandler.obtainMessage(MSG_SAY); b = new Bundle(); b.putString("message", getString(R.string.msg_newdatafolder, datadir.getAbsolutePath())); msg.setData(b); mHandler.sendMessage(msg); while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } } datadir.mkdirs(); } // initialize paths application.setRootPath(root.getAbsolutePath()); application.setMapPath(mapdir.getAbsolutePath()); application.setDataPath(Androzic.PATH_DATA, datadir.getAbsolutePath()); application.setDataPath(Androzic.PATH_ICONS, settings.getString(getString(R.string.pref_folder_icon), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_icon))); // initialize data application.installData(); // read default waypoints File wptFile = new File(application.dataPath, "myWaypoints.wpt"); if (wptFile.exists() && wptFile.canRead()) { try { application.addWaypoints(OziExplorerFiles.loadWaypointsFromFile(wptFile)); } catch (IOException e) { e.printStackTrace(); } } // read track tail if (settings.getBoolean(getString(R.string.pref_showcurrenttrack), true)) { application.currentTrackOverlay = new CurrentTrackOverlay(Splash.this); if (settings.getBoolean(getString(R.string.pref_tracking_currentload), resources.getBoolean(R.bool.def_tracking_currentload))) { String name = settings.getString(getString(R.string.trk_current), "myTrack.plt"); File trkFile = new File(application.dataPath, name); if (trkFile.exists() && trkFile.canRead()) { try { application.currentTrackOverlay.setTrack(OziExplorerFiles.loadTrackFromFile(trkFile, Integer.parseInt(settings.getString(getString(R.string.pref_tracking_currentlength), getString(R.string.def_tracking_currentlength))))); } catch (IllegalArgumentException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } } } } // load routes if (settings.getBoolean(getString(R.string.pref_route_preload), resources.getBoolean(R.bool.def_route_preload))) { List<File> files = FileList.getFileListing(new File(application.dataPath), new RouteFilenameFilter()); for (File file : files) { List<Route> routes = null; try { String lc = file.getName().toLowerCase(); if (lc.endsWith(".rt2") || lc.endsWith(".rte")) { routes = OziExplorerFiles.loadRoutesFromFile(file); } else if (lc.endsWith(".kml")) { routes = KmlFiles.loadRoutesFromFile(file); } else if (lc.endsWith(".gpx")) { routes = GpxFiles.loadRoutesFromFile(file); } application.addRoutes(routes); } catch (Exception e) { e.printStackTrace(); } } } total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); // load maps if no any found if (mapdir.list().length == 0) { wait = true; msg = mHandler.obtainMessage(MSG_ASK); b = new Bundle(); b.putString("message", getString(R.string.nomaps_explained, application.getMapPath())); msg.setData(b); mHandler.sendMessage(msg); while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } if (result == RES_YES) { try { // URL u = new URL("http://androzic.googlecode.com/files/world.ozfx3"); URL u = new URL("https://docs.google.com/uc?export=download&id=0Bxnm5oGXU2cja2lQMzVvWFNpZjQ"); HttpURLConnection c = (HttpURLConnection) u.openConnection(); c.setRequestMethod("GET"); c.setDoOutput(true); c.connect(); FileOutputStream f = new FileOutputStream(new File(application.getMapPath(), "world.ozf2")); InputStream in = c.getInputStream(); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_loadingimagefile)); msg.setData(b); mHandler.sendMessage(msg); byte[] buffer = new byte[1024]; int len = 0; while ((len = in.read(buffer)) > 0) { f.write(buffer, 0, len); total += len; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } f.close(); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_loadingmapfile)); msg.setData(b); mHandler.sendMessage(msg); //u = new URL("http://androzic.googlecode.com/files/world.map"); u = new URL("https://docs.google.com/uc?export=download&id=0Bxnm5oGXU2cjWllteG4tSDBxekU"); c = (HttpURLConnection) u.openConnection(); c.setRequestMethod("GET"); c.setDoOutput(true); c.connect(); f = new FileOutputStream(new File(application.getMapPath(), "world.map")); in = c.getInputStream(); buffer = new byte[1024]; len = 0; while ((len = in.read(buffer)) > 0) { f.write(buffer, 0, len); total += len; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } f.close(); } catch (IOException e) { e.printStackTrace(); msg = mHandler.obtainMessage(MSG_ERROR); b = new Bundle(); b.putString("message", getString(R.string.err_noconnection)); msg.setData(b); mHandler.sendMessage(msg); File dir = new File(application.getMapPath()); File[] files = dir.listFiles(); if (files != null) { for (int i = 0; i < files.length; i++) { files[i].delete(); } } return; } } } else { total += DOWNLOAD_SIZE; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingmaps)); msg.setData(b); mHandler.sendMessage(msg); // initialize maps application.initializeMaps(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingplugins)); msg.setData(b); mHandler.sendMessage(msg); // initialize plugins application.initializePlugins(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingview)); msg.setData(b); mHandler.sendMessage(msg); // initialize current map application.initializeMapCenter(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); mHandler.sendEmptyMessage(MSG_FINISH); }
public void run() { while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } total = 0; Message msg = mHandler.obtainMessage(MSG_STATUS); Bundle b = new Bundle(); b.putString("message", getString(R.string.msg_initializingdata)); msg.setData(b); mHandler.sendMessage(msg); Resources resources = getResources(); SharedPreferences settings = PreferenceManager.getDefaultSharedPreferences(Splash.this); application.enableLocating(settings.getBoolean(getString(R.string.lc_locate), true)); application.enableTracking(settings.getBoolean(getString(R.string.lc_track), true)); // set root folder and check if it has to be created String rootPath = settings.getString(getString(R.string.pref_folder_root), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_prefix)); File root = new File(rootPath); if (!root.exists()) { try { root.mkdirs(); File nomedia = new File(root, ".nomedia"); nomedia.createNewFile(); } catch (IOException e) { msg = mHandler.obtainMessage(MSG_ERROR); b = new Bundle(); b.putString("message", getString(R.string.err_nosdcard)); msg.setData(b); mHandler.sendMessage(msg); return; } } // check maps folder existence File mapdir = new File(settings.getString(getString(R.string.pref_folder_map), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_map))); String oldmap = settings.getString(getString(R.string.pref_folder_map_old), null); if (oldmap != null) { File oldmapdir = new File(root, oldmap); if (! oldmapdir.equals(mapdir)) { mapdir = oldmapdir; Editor editor = settings.edit(); editor.putString(getString(R.string.pref_folder_map), mapdir.getAbsolutePath()); editor.putString(getString(R.string.pref_folder_map_old), null); editor.commit(); } } if (!mapdir.exists()) { mapdir.mkdirs(); } // check data folder existence File datadir = new File(settings.getString(getString(R.string.pref_folder_data), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_data))); if (!datadir.exists()) { // check if there was an old data structure String wptdir = settings.getString(getString(R.string.pref_folder_waypoint), null); System.err.println("wpt: " + wptdir); if (wptdir != null) { wait = true; msg = mHandler.obtainMessage(MSG_SAY); b = new Bundle(); b.putString("message", getString(R.string.msg_newdatafolder, datadir.getAbsolutePath())); msg.setData(b); mHandler.sendMessage(msg); while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } } datadir.mkdirs(); } // initialize paths application.setRootPath(root.getAbsolutePath()); application.setMapPath(mapdir.getAbsolutePath()); application.setDataPath(Androzic.PATH_DATA, datadir.getAbsolutePath()); application.setDataPath(Androzic.PATH_ICONS, settings.getString(getString(R.string.pref_folder_icon), Environment.getExternalStorageDirectory() + File.separator + resources.getString(R.string.def_folder_icon))); // initialize data application.installData(); // read default waypoints File wptFile = new File(application.dataPath, "myWaypoints.wpt"); if (wptFile.exists() && wptFile.canRead()) { try { application.addWaypoints(OziExplorerFiles.loadWaypointsFromFile(wptFile)); } catch (IOException e) { e.printStackTrace(); } } // read track tail if (settings.getBoolean(getString(R.string.pref_showcurrenttrack), true)) { application.currentTrackOverlay = new CurrentTrackOverlay(Splash.this); if (settings.getBoolean(getString(R.string.pref_tracking_currentload), resources.getBoolean(R.bool.def_tracking_currentload))) { String name = settings.getString(getString(R.string.trk_current), "myTrack.plt"); File trkFile = new File(application.dataPath, name); if (trkFile.exists() && trkFile.canRead()) { try { application.currentTrackOverlay.setTrack(OziExplorerFiles.loadTrackFromFile(trkFile, Integer.parseInt(settings.getString(getString(R.string.pref_tracking_currentlength), getString(R.string.def_tracking_currentlength))))); } catch (IllegalArgumentException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } } } } // load routes if (settings.getBoolean(getString(R.string.pref_route_preload), resources.getBoolean(R.bool.def_route_preload))) { List<File> files = FileList.getFileListing(new File(application.dataPath), new RouteFilenameFilter()); for (File file : files) { List<Route> routes = null; try { String lc = file.getName().toLowerCase(); if (lc.endsWith(".rt2") || lc.endsWith(".rte")) { routes = OziExplorerFiles.loadRoutesFromFile(file); } else if (lc.endsWith(".kml")) { routes = KmlFiles.loadRoutesFromFile(file); } else if (lc.endsWith(".gpx")) { routes = GpxFiles.loadRoutesFromFile(file); } application.addRoutes(routes); } catch (Exception e) { e.printStackTrace(); } } } total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); // load maps if no any found if (mapdir.list().length == 0) { wait = true; msg = mHandler.obtainMessage(MSG_ASK); b = new Bundle(); b.putString("message", getString(R.string.nomaps_explained, application.getMapPath())); msg.setData(b); mHandler.sendMessage(msg); while (wait) { try { sleep(100); } catch (InterruptedException e) { e.printStackTrace(); } } if (result == RES_YES) { try { // URL u = new URL("http://androzic.googlecode.com/files/world.ozfx3"); URL u = new URL("https://docs.google.com/uc?export=download&id=0Bxnm5oGXU2cja2lQMzVvWFNpZjQ"); HttpURLConnection c = (HttpURLConnection) u.openConnection(); c.setRequestMethod("GET"); c.setDoOutput(true); c.connect(); FileOutputStream f = new FileOutputStream(new File(application.getMapPath(), "world.ozf2")); InputStream in = c.getInputStream(); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_loadingimagefile)); msg.setData(b); mHandler.sendMessage(msg); byte[] buffer = new byte[1024]; int len = 0; while ((len = in.read(buffer)) > 0) { f.write(buffer, 0, len); total += len; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } f.close(); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_loadingmapfile)); msg.setData(b); mHandler.sendMessage(msg); //u = new URL("http://androzic.googlecode.com/files/world.map"); u = new URL("https://docs.google.com/uc?export=download&id=0Bxnm5oGXU2cjWllteG4tSDBxekU"); c = (HttpURLConnection) u.openConnection(); c.setRequestMethod("GET"); c.setDoOutput(true); c.connect(); f = new FileOutputStream(new File(application.getMapPath(), "world.map")); in = c.getInputStream(); buffer = new byte[1024]; len = 0; while ((len = in.read(buffer)) > 0) { f.write(buffer, 0, len); total += len; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } f.close(); } catch (IOException e) { e.printStackTrace(); msg = mHandler.obtainMessage(MSG_ERROR); b = new Bundle(); b.putString("message", getString(R.string.err_noconnection)); msg.setData(b); mHandler.sendMessage(msg); File dir = new File(application.getMapPath()); File[] files = dir.listFiles(); if (files != null) { for (int i = 0; i < files.length; i++) { files[i].delete(); } } return; } } } else { total += DOWNLOAD_SIZE; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); } msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingmaps)); msg.setData(b); mHandler.sendMessage(msg); // initialize maps application.initializeMaps(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingplugins)); msg.setData(b); mHandler.sendMessage(msg); // initialize plugins application.initializePlugins(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); msg = mHandler.obtainMessage(MSG_STATUS); b = new Bundle(); b.putString("message", getString(R.string.msg_initializingview)); msg.setData(b); mHandler.sendMessage(msg); // initialize current map application.initializeMapCenter(); total += PROGRESS_STEP; msg = mHandler.obtainMessage(MSG_PROGRESS); b = new Bundle(); b.putInt("total", total); msg.setData(b); mHandler.sendMessage(msg); mHandler.sendEmptyMessage(MSG_FINISH); }
diff --git a/server/src/main/java/imagej/omero/server/DefaultOMEROService.java b/server/src/main/java/imagej/omero/server/DefaultOMEROService.java index b320804..6c3ebee 100644 --- a/server/src/main/java/imagej/omero/server/DefaultOMEROService.java +++ b/server/src/main/java/imagej/omero/server/DefaultOMEROService.java @@ -1,325 +1,325 @@ /* * #%L * Call ImageJ commands from OMERO on the server side. * %% * Copyright (C) 2013 Board of Regents of the University of * Wisconsin-Madison. * %% * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as * published by the Free Software Foundation, either version 2 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public * License along with this program. If not, see * <http://www.gnu.org/licenses/gpl-2.0.html>. * #L% */ package imagej.omero.server; import imagej.data.Dataset; import imagej.data.display.DatasetView; import imagej.data.display.ImageDisplay; import imagej.data.display.ImageDisplayService; import imagej.display.DisplayService; import imagej.module.ModuleItem; import java.lang.reflect.Array; import java.lang.reflect.InvocationTargetException; import java.lang.reflect.Method; import java.util.ArrayList; import java.util.Collection; import java.util.HashMap; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import org.scijava.log.LogService; import org.scijava.plugin.Parameter; import org.scijava.plugin.Plugin; import org.scijava.service.AbstractService; import org.scijava.service.Service; import org.scijava.util.ClassUtils; /** * Default ImageJ service for managing OMERO data conversion. * * @author Curtis Rueden */ @Plugin(type = Service.class) public class DefaultOMEROService extends AbstractService implements OMEROService { // -- Parameters -- @Parameter private LogService log; @Parameter private DisplayService displayService; @Parameter private ImageDisplayService imageDisplayService; // -- OMEROService methods -- @Override public omero.grid.Param getJobParam(final ModuleItem<?> item) { final omero.grid.Param param = new omero.grid.Param(); param.optional = !item.isRequired(); param.prototype = prototype(item.getType()); param.description = item.getDescription(); return param; } @Override public omero.RType prototype(final Class<?> type) { // image types if (Dataset.class.isAssignableFrom(type) || DatasetView.class.isAssignableFrom(type) || ImageDisplay.class.isAssignableFrom(type)) { // use a pixels ID return omero.rtypes.rlong(0); } // primitive types final Class<?> saneType = ClassUtils.getNonprimitiveType(type); if (Boolean.class.isAssignableFrom(saneType)) { return omero.rtypes.rbool(false); } if (Double.class.isAssignableFrom(saneType)) { return omero.rtypes.rdouble(Double.NaN); } if (Float.class.isAssignableFrom(saneType)) { return omero.rtypes.rfloat(Float.NaN); } if (Integer.class.isAssignableFrom(saneType)) { return omero.rtypes.rint(0); } if (Long.class.isAssignableFrom(saneType)) { return omero.rtypes.rlong(0L); } // data structure types if (type.isArray()) { return omero.rtypes.rarray(); } if (List.class.isAssignableFrom(type)) { return omero.rtypes.rlist(); } if (Map.class.isAssignableFrom(type)) { return omero.rtypes.rmap(); } if (Set.class.isAssignableFrom(type)) { return omero.rtypes.rset(); } // default case: convert to string // works for many types, including but not limited to: // - char // - imagej.util.ColorRGB // - java.io.File // - java.lang.Character // - java.lang.String // - java.math.BigDecimal // - java.math.BigInteger return omero.rtypes.rstring(""); } @Override public omero.RType toOMERO(final omero.client client, final Object value) { if (value instanceof Dataset) { // upload pixels to OMERO, returning the resultant pixels ID final long id = uploadPixels(client, (Dataset) value); return toOMERO(client, id); } else if (value instanceof DatasetView) { final DatasetView datasetView = (DatasetView) value; // TODO: Verify whether any view-specific metadata can be preserved. return toOMERO(client, datasetView.getData()); } else if (value instanceof ImageDisplay) { final ImageDisplay imageDisplay = (ImageDisplay) value; // TODO: Support more aspects of image displays; e.g., multiple datasets. return toOMERO(client, imageDisplayService.getActiveDataset(imageDisplay)); } else { // try generic conversion method try { return omero.rtypes.rtype(value); } catch (final omero.ClientError err) { // default case: convert to string return omero.rtypes.rstring(value.toString()); } } } @Override public Object toImageJ(final omero.client client, final omero.RType value, final Class<?> type) { if (value instanceof omero.RCollection) { // collection of objects final Collection<omero.RType> omeroCollection = ((omero.RCollection) value).getValue(); final Collection<Object> collection; if (value instanceof omero.RArray || value instanceof omero.RList) { // NB: See special handling for omero.RArray below. collection = new ArrayList<Object>(); } else if (value instanceof omero.RSet) { collection = new HashSet<Object>(); } else { log.error("Unsupported collection: " + value.getClass().getName()); return null; } // convert elements recursively Object element = null; // NB: Save 1st non-null element for later use. for (final omero.RType rType : omeroCollection) { final Object converted = toImageJ(client, rType, null); if (element != null) element = converted; collection.add(converted); } if (value instanceof omero.RArray) { // convert from Collection to array of the appropriate type if (element == null) { // unknown type return collection.toArray(); } // typed on 1st element return toArray(collection, element.getClass()); } // not an array, but a bona fide collection return collection; } if (value instanceof omero.RMap) { // map of objects final Map<String, omero.RType> omeroMap = ((omero.RMap) value).getValue(); final Map<String, Object> map = new HashMap<String, Object>(); for (final String key : omeroMap.keySet()) { map.put(key, toImageJ(client, omeroMap.get(key), null)); } return map; } // Use getValue() method if one exists for this type. // Reflection is necessary because there is no common interface // with the getValue() method implemented by each subclass. try { final Method method = value.getClass().getMethod("getValue"); final Object result = method.invoke(value); return convert(client, result, type); } catch (final NoSuchMethodException exc) { log.debug(exc); } catch (final IllegalArgumentException exc) { - log.warn(exc); + log.error(exc); } catch (final IllegalAccessException exc) { - log.warn(exc); + log.error(exc); } catch (final InvocationTargetException exc) { - log.warn(exc); + log.error(exc); } log.error("Unsupported type: " + value.getClass().getName()); return null; } @Override public Dataset downloadPixels(final omero.client client, final long id) { // FIXME: Implement this. return null; } @Override public long uploadPixels(final omero.client client, final Dataset dataset) { // FIXME: Implement this. return 0; } // -- Helper methods -- /** * Converts the given POJO to the specified type (if given). * <p> * This method handles coersion of POJOs unwrapped from OMERO into the * relevant type needed by ImageJ. Examples: * </p> * <ol> * <li>Many ImageJ types (such as {@link imagej.util.ColorRGB}) are mapped to * {@link String} for use with OMERO. We lean on the SciJava Common * {@link ClassUtils#convert(Object, Class)} method to handle conversion of * such types back to ImageJ's expected type for the parameter.</li> * <li>ImageJ's image types (i.e., {@link Dataset}, {@link DatasetView} and * {@link ImageDisplay}) are mapped to {@code long} since OMERO communicates * about images using pixel IDs. Work must be done to download pixels from a * specified ID and converting the result to the appropriate ImageJ image type * such as {@link Dataset}.</li> * </ol> */ private <T> T convert(final omero.client client, final Object result, final Class<T> type) { if (result == null) return null; if (type == null) { // no type given; try a simple cast @SuppressWarnings("unchecked") final T typedResult = (T) result; return typedResult; } // special case for converting an OMERO pixels ID to an ImageJ image type if (ClassUtils.isNumber(result.getClass())) { if (Dataset.class.isAssignableFrom(type)) { final long id = ((Number) result).longValue(); // TODO: Consider consequences of this cast more carefully. @SuppressWarnings("unchecked") final T dataset = (T) downloadPixels(client, id); return dataset; } if (DatasetView.class.isAssignableFrom(type)) { final Dataset dataset = convert(client, result, Dataset.class); @SuppressWarnings("unchecked") final T dataView = (T) imageDisplayService.createDataView(dataset); return dataView; } if (ImageDisplay.class.isAssignableFrom(type)) { final Dataset dataset = convert(client, result, Dataset.class); @SuppressWarnings("unchecked") final T display = (T) displayService.createDisplay(dataset); return display; } } // use SciJava Common's automagical conversion routine final T converted = ClassUtils.convert(result, type); if (converted == null) { log.error("Cannot convert: " + result.getClass().getName() + " to " + type.getName()); } return converted; } /** Converts a {@link Collection} to an array of the given type. */ private <T> T[] toArray(final Collection<Object> collection, final Class<T> type) { final Object array = Array.newInstance(type, 0); @SuppressWarnings("unchecked") final T[] typedArray = (T[]) array; return collection.toArray(typedArray); } }
false
true
public Object toImageJ(final omero.client client, final omero.RType value, final Class<?> type) { if (value instanceof omero.RCollection) { // collection of objects final Collection<omero.RType> omeroCollection = ((omero.RCollection) value).getValue(); final Collection<Object> collection; if (value instanceof omero.RArray || value instanceof omero.RList) { // NB: See special handling for omero.RArray below. collection = new ArrayList<Object>(); } else if (value instanceof omero.RSet) { collection = new HashSet<Object>(); } else { log.error("Unsupported collection: " + value.getClass().getName()); return null; } // convert elements recursively Object element = null; // NB: Save 1st non-null element for later use. for (final omero.RType rType : omeroCollection) { final Object converted = toImageJ(client, rType, null); if (element != null) element = converted; collection.add(converted); } if (value instanceof omero.RArray) { // convert from Collection to array of the appropriate type if (element == null) { // unknown type return collection.toArray(); } // typed on 1st element return toArray(collection, element.getClass()); } // not an array, but a bona fide collection return collection; } if (value instanceof omero.RMap) { // map of objects final Map<String, omero.RType> omeroMap = ((omero.RMap) value).getValue(); final Map<String, Object> map = new HashMap<String, Object>(); for (final String key : omeroMap.keySet()) { map.put(key, toImageJ(client, omeroMap.get(key), null)); } return map; } // Use getValue() method if one exists for this type. // Reflection is necessary because there is no common interface // with the getValue() method implemented by each subclass. try { final Method method = value.getClass().getMethod("getValue"); final Object result = method.invoke(value); return convert(client, result, type); } catch (final NoSuchMethodException exc) { log.debug(exc); } catch (final IllegalArgumentException exc) { log.warn(exc); } catch (final IllegalAccessException exc) { log.warn(exc); } catch (final InvocationTargetException exc) { log.warn(exc); } log.error("Unsupported type: " + value.getClass().getName()); return null; }
public Object toImageJ(final omero.client client, final omero.RType value, final Class<?> type) { if (value instanceof omero.RCollection) { // collection of objects final Collection<omero.RType> omeroCollection = ((omero.RCollection) value).getValue(); final Collection<Object> collection; if (value instanceof omero.RArray || value instanceof omero.RList) { // NB: See special handling for omero.RArray below. collection = new ArrayList<Object>(); } else if (value instanceof omero.RSet) { collection = new HashSet<Object>(); } else { log.error("Unsupported collection: " + value.getClass().getName()); return null; } // convert elements recursively Object element = null; // NB: Save 1st non-null element for later use. for (final omero.RType rType : omeroCollection) { final Object converted = toImageJ(client, rType, null); if (element != null) element = converted; collection.add(converted); } if (value instanceof omero.RArray) { // convert from Collection to array of the appropriate type if (element == null) { // unknown type return collection.toArray(); } // typed on 1st element return toArray(collection, element.getClass()); } // not an array, but a bona fide collection return collection; } if (value instanceof omero.RMap) { // map of objects final Map<String, omero.RType> omeroMap = ((omero.RMap) value).getValue(); final Map<String, Object> map = new HashMap<String, Object>(); for (final String key : omeroMap.keySet()) { map.put(key, toImageJ(client, omeroMap.get(key), null)); } return map; } // Use getValue() method if one exists for this type. // Reflection is necessary because there is no common interface // with the getValue() method implemented by each subclass. try { final Method method = value.getClass().getMethod("getValue"); final Object result = method.invoke(value); return convert(client, result, type); } catch (final NoSuchMethodException exc) { log.debug(exc); } catch (final IllegalArgumentException exc) { log.error(exc); } catch (final IllegalAccessException exc) { log.error(exc); } catch (final InvocationTargetException exc) { log.error(exc); } log.error("Unsupported type: " + value.getClass().getName()); return null; }
diff --git a/teo/teo/isgci/drawing/GraphEvent.java b/teo/teo/isgci/drawing/GraphEvent.java index 87bec2a..a60e840 100644 --- a/teo/teo/isgci/drawing/GraphEvent.java +++ b/teo/teo/isgci/drawing/GraphEvent.java @@ -1,29 +1,30 @@ package teo.isgci.drawing; import java.awt.event.MouseAdapter; import com.mxgraph.swing.mxGraphComponent; /** * Dumbed down version of the original, WIP GraphEvent * TODO: replace this with the final one */ class GraphEvent implements GraphEventInterface { private mxGraphComponent graphComponent; protected GraphEvent(mxGraphComponent graphComponent) { this.graphComponent = graphComponent; } /** * Register a MouseAdapter to receive events from the graph panel. * * @param adapter MouseAdapter */ @Override public void registerMouseAdapter(MouseAdapter adapter) { graphComponent.addMouseListener(adapter); + graphComponent.getGraphControl().addMouseListener(adapter); graphComponent.addMouseWheelListener(adapter); } }
true
true
public void registerMouseAdapter(MouseAdapter adapter) { graphComponent.addMouseListener(adapter); graphComponent.addMouseWheelListener(adapter); }
public void registerMouseAdapter(MouseAdapter adapter) { graphComponent.addMouseListener(adapter); graphComponent.getGraphControl().addMouseListener(adapter); graphComponent.addMouseWheelListener(adapter); }
diff --git a/src/main/java/ch/o2it/weblounge/contentrepository/impl/endpoint/FilesEndpointDocs.java b/src/main/java/ch/o2it/weblounge/contentrepository/impl/endpoint/FilesEndpointDocs.java index ce63d42b1..515151e94 100644 --- a/src/main/java/ch/o2it/weblounge/contentrepository/impl/endpoint/FilesEndpointDocs.java +++ b/src/main/java/ch/o2it/weblounge/contentrepository/impl/endpoint/FilesEndpointDocs.java @@ -1,171 +1,171 @@ /* * Weblounge: Web Content Management System * Copyright (c) 2010 The Weblounge Team * http://weblounge.o2it.ch * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public License * as published by the Free Software Foundation; either version 2 * of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public License * along with this program; if not, write to the Free Software Foundation * Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. */ package ch.o2it.weblounge.contentrepository.impl.endpoint; import static ch.o2it.weblounge.common.impl.util.doc.Status.conflict; import static ch.o2it.weblounge.common.impl.util.doc.Status.methodNotAllowed; import static ch.o2it.weblounge.common.impl.util.doc.Status.preconditionFailed; import static ch.o2it.weblounge.common.impl.util.doc.Status.badRequest; import static ch.o2it.weblounge.common.impl.util.doc.Status.notFound; import static ch.o2it.weblounge.common.impl.util.doc.Status.ok; import static ch.o2it.weblounge.common.impl.util.doc.Status.serviceUnavailable; import ch.o2it.weblounge.common.impl.util.doc.Endpoint; import ch.o2it.weblounge.common.impl.util.doc.EndpointDocumentation; import ch.o2it.weblounge.common.impl.util.doc.EndpointDocumentationGenerator; import ch.o2it.weblounge.common.impl.util.doc.Format; import ch.o2it.weblounge.common.impl.util.doc.Parameter; import ch.o2it.weblounge.common.impl.util.doc.TestForm; import ch.o2it.weblounge.common.impl.util.doc.Endpoint.Method; /** * File endpoint documentation generator. */ public final class FilesEndpointDocs { /** * Creates the documentation. * * @param endpointUrl * the endpoint address * @return the endpoint documentation */ public static String createDocumentation(String endpointUrl) { EndpointDocumentation docs = new EndpointDocumentation(endpointUrl, "files"); docs.setTitle("Weblounge Files"); // GET /?path= - Endpoint getFileByPathEndpoint = new Endpoint("/{resource}", Method.GET, "getfile"); + Endpoint getFileByPathEndpoint = new Endpoint("/", Method.GET, "getfile"); getFileByPathEndpoint.setDescription("Returns the file that is located at the given path"); getFileByPathEndpoint.addFormat(Format.xml()); getFileByPathEndpoint.addStatus(ok("the file was found and is returned as part of the response")); getFileByPathEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileByPathEndpoint.addStatus(badRequest("an invalid path was received")); getFileByPathEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileByPathEndpoint.addRequiredParameter(new Parameter("path", Parameter.Type.String, "The resource path")); getFileByPathEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileByPathEndpoint); // GET /{resource} Endpoint getFileByURIEndpoint = new Endpoint("/{resource}", Method.GET, "getfile"); getFileByURIEndpoint.setDescription("Returns the file with the given id"); getFileByURIEndpoint.addFormat(Format.xml()); getFileByURIEndpoint.addStatus(ok("the file was found and is returned as part of the response")); getFileByURIEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileByURIEndpoint.addStatus(badRequest("an invalid file identifier was received")); getFileByURIEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileByURIEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The resource identifier")); getFileByURIEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileByURIEndpoint); // GET /{resource}/content/{language} Endpoint getFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.GET, "getfilecontent"); getFileContentEndpoint.setDescription("Returns the localized file contents with the given id"); getFileContentEndpoint.addFormat(Format.xml()); getFileContentEndpoint.addStatus(ok("the file content was found and is returned as part of the response")); getFileContentEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileContentEndpoint.addStatus(notFound("the file content don't exist in the specified language")); getFileContentEndpoint.addStatus(badRequest("an invalid file identifier was received")); getFileContentEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); getFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language identifier")); getFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileContentEndpoint); // POST /{resource} Endpoint createFileEndpoint = new Endpoint("/", Method.POST, "createfile"); createFileEndpoint.setDescription("Creates a new file, either at the given path or at a random location and returns the REST url of the created resource."); createFileEndpoint.addFormat(Format.xml()); createFileEndpoint.addStatus(ok("the file was created and the response body contains it's resource url")); createFileEndpoint.addStatus(badRequest("the path was not specified")); createFileEndpoint.addStatus(badRequest("the file content is malformed")); createFileEndpoint.addStatus(conflict("a file already exists at the specified path")); createFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); createFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); createFileEndpoint.addOptionalParameter(new Parameter("path", Parameter.Type.String, "The target path")); createFileEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.Text, "The resource data")); createFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, createFileEndpoint); // PUT /{resource} Endpoint updateFileEndpoint = new Endpoint("/{resource}", Method.PUT, "updatefile"); updateFileEndpoint.setDescription("Updates the specified file. If the client supplies an If-Match header, the update is processed only if the header value matches the file's ETag"); updateFileEndpoint.addFormat(Format.xml()); updateFileEndpoint.addStatus(ok("the file was updated")); updateFileEndpoint.addStatus(badRequest("the file content was not specified")); updateFileEndpoint.addStatus(badRequest("the file content is malformed")); updateFileEndpoint.addStatus(preconditionFailed("the file's etag does not match the value specified in the If-Match header")); updateFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); updateFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); updateFileEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); updateFileEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.Text, "The resource data")); updateFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, updateFileEndpoint); // DELETE /{resource} Endpoint deleteFileEndpoint = new Endpoint("/{resource}", Method.DELETE, "deletefile"); deleteFileEndpoint.setDescription("Deletes the specified file."); deleteFileEndpoint.addFormat(Format.xml()); deleteFileEndpoint.addStatus(ok("the file was deleted")); deleteFileEndpoint.addStatus(badRequest("the file was not specified")); deleteFileEndpoint.addStatus(notFound("the file was not found")); deleteFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); deleteFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); deleteFileEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); deleteFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, deleteFileEndpoint); // PUT /{resource}/content/{language} Endpoint updateFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.PUT, "updatefilecontent"); updateFileContentEndpoint.setDescription("Updates the specified file contents. If the client supplies an If-Match header, the update is processed only if the header value matches the file's ETag"); updateFileContentEndpoint.addFormat(Format.xml()); updateFileContentEndpoint.addStatus(ok("the file content was updated")); updateFileContentEndpoint.addStatus(badRequest("the file content was not specified")); updateFileContentEndpoint.addStatus(badRequest("the language does not exist")); updateFileContentEndpoint.addStatus(badRequest("the file content is malformed")); updateFileContentEndpoint.addStatus(preconditionFailed("the file's etag does not match the value specified in the If-Match header")); updateFileContentEndpoint.addStatus(methodNotAllowed("the site or it's content repository is read-only")); updateFileContentEndpoint.addStatus(serviceUnavailable("the site or it's content repository is temporarily offline")); updateFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); updateFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language")); updateFileContentEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.File, "The resource content")); updateFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, updateFileContentEndpoint); // DELETE /{resource}/content/{language} Endpoint deleteFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.DELETE, "deletefilecontent"); deleteFileContentEndpoint.setDescription("Deletes the specified file content."); deleteFileContentEndpoint.addFormat(Format.xml()); deleteFileContentEndpoint.addStatus(ok("the file content was deleted")); deleteFileContentEndpoint.addStatus(badRequest("the file content was not specified")); deleteFileContentEndpoint.addStatus(notFound("the file was not found")); deleteFileContentEndpoint.addStatus(notFound("the file content was not found")); deleteFileContentEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); deleteFileContentEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); deleteFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); deleteFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language identifier")); deleteFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, deleteFileContentEndpoint); return EndpointDocumentationGenerator.generate(docs); } }
true
true
public static String createDocumentation(String endpointUrl) { EndpointDocumentation docs = new EndpointDocumentation(endpointUrl, "files"); docs.setTitle("Weblounge Files"); // GET /?path= Endpoint getFileByPathEndpoint = new Endpoint("/{resource}", Method.GET, "getfile"); getFileByPathEndpoint.setDescription("Returns the file that is located at the given path"); getFileByPathEndpoint.addFormat(Format.xml()); getFileByPathEndpoint.addStatus(ok("the file was found and is returned as part of the response")); getFileByPathEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileByPathEndpoint.addStatus(badRequest("an invalid path was received")); getFileByPathEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileByPathEndpoint.addRequiredParameter(new Parameter("path", Parameter.Type.String, "The resource path")); getFileByPathEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileByPathEndpoint); // GET /{resource} Endpoint getFileByURIEndpoint = new Endpoint("/{resource}", Method.GET, "getfile"); getFileByURIEndpoint.setDescription("Returns the file with the given id"); getFileByURIEndpoint.addFormat(Format.xml()); getFileByURIEndpoint.addStatus(ok("the file was found and is returned as part of the response")); getFileByURIEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileByURIEndpoint.addStatus(badRequest("an invalid file identifier was received")); getFileByURIEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileByURIEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The resource identifier")); getFileByURIEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileByURIEndpoint); // GET /{resource}/content/{language} Endpoint getFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.GET, "getfilecontent"); getFileContentEndpoint.setDescription("Returns the localized file contents with the given id"); getFileContentEndpoint.addFormat(Format.xml()); getFileContentEndpoint.addStatus(ok("the file content was found and is returned as part of the response")); getFileContentEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileContentEndpoint.addStatus(notFound("the file content don't exist in the specified language")); getFileContentEndpoint.addStatus(badRequest("an invalid file identifier was received")); getFileContentEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); getFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language identifier")); getFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileContentEndpoint); // POST /{resource} Endpoint createFileEndpoint = new Endpoint("/", Method.POST, "createfile"); createFileEndpoint.setDescription("Creates a new file, either at the given path or at a random location and returns the REST url of the created resource."); createFileEndpoint.addFormat(Format.xml()); createFileEndpoint.addStatus(ok("the file was created and the response body contains it's resource url")); createFileEndpoint.addStatus(badRequest("the path was not specified")); createFileEndpoint.addStatus(badRequest("the file content is malformed")); createFileEndpoint.addStatus(conflict("a file already exists at the specified path")); createFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); createFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); createFileEndpoint.addOptionalParameter(new Parameter("path", Parameter.Type.String, "The target path")); createFileEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.Text, "The resource data")); createFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, createFileEndpoint); // PUT /{resource} Endpoint updateFileEndpoint = new Endpoint("/{resource}", Method.PUT, "updatefile"); updateFileEndpoint.setDescription("Updates the specified file. If the client supplies an If-Match header, the update is processed only if the header value matches the file's ETag"); updateFileEndpoint.addFormat(Format.xml()); updateFileEndpoint.addStatus(ok("the file was updated")); updateFileEndpoint.addStatus(badRequest("the file content was not specified")); updateFileEndpoint.addStatus(badRequest("the file content is malformed")); updateFileEndpoint.addStatus(preconditionFailed("the file's etag does not match the value specified in the If-Match header")); updateFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); updateFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); updateFileEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); updateFileEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.Text, "The resource data")); updateFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, updateFileEndpoint); // DELETE /{resource} Endpoint deleteFileEndpoint = new Endpoint("/{resource}", Method.DELETE, "deletefile"); deleteFileEndpoint.setDescription("Deletes the specified file."); deleteFileEndpoint.addFormat(Format.xml()); deleteFileEndpoint.addStatus(ok("the file was deleted")); deleteFileEndpoint.addStatus(badRequest("the file was not specified")); deleteFileEndpoint.addStatus(notFound("the file was not found")); deleteFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); deleteFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); deleteFileEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); deleteFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, deleteFileEndpoint); // PUT /{resource}/content/{language} Endpoint updateFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.PUT, "updatefilecontent"); updateFileContentEndpoint.setDescription("Updates the specified file contents. If the client supplies an If-Match header, the update is processed only if the header value matches the file's ETag"); updateFileContentEndpoint.addFormat(Format.xml()); updateFileContentEndpoint.addStatus(ok("the file content was updated")); updateFileContentEndpoint.addStatus(badRequest("the file content was not specified")); updateFileContentEndpoint.addStatus(badRequest("the language does not exist")); updateFileContentEndpoint.addStatus(badRequest("the file content is malformed")); updateFileContentEndpoint.addStatus(preconditionFailed("the file's etag does not match the value specified in the If-Match header")); updateFileContentEndpoint.addStatus(methodNotAllowed("the site or it's content repository is read-only")); updateFileContentEndpoint.addStatus(serviceUnavailable("the site or it's content repository is temporarily offline")); updateFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); updateFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language")); updateFileContentEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.File, "The resource content")); updateFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, updateFileContentEndpoint); // DELETE /{resource}/content/{language} Endpoint deleteFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.DELETE, "deletefilecontent"); deleteFileContentEndpoint.setDescription("Deletes the specified file content."); deleteFileContentEndpoint.addFormat(Format.xml()); deleteFileContentEndpoint.addStatus(ok("the file content was deleted")); deleteFileContentEndpoint.addStatus(badRequest("the file content was not specified")); deleteFileContentEndpoint.addStatus(notFound("the file was not found")); deleteFileContentEndpoint.addStatus(notFound("the file content was not found")); deleteFileContentEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); deleteFileContentEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); deleteFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); deleteFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language identifier")); deleteFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, deleteFileContentEndpoint); return EndpointDocumentationGenerator.generate(docs); }
public static String createDocumentation(String endpointUrl) { EndpointDocumentation docs = new EndpointDocumentation(endpointUrl, "files"); docs.setTitle("Weblounge Files"); // GET /?path= Endpoint getFileByPathEndpoint = new Endpoint("/", Method.GET, "getfile"); getFileByPathEndpoint.setDescription("Returns the file that is located at the given path"); getFileByPathEndpoint.addFormat(Format.xml()); getFileByPathEndpoint.addStatus(ok("the file was found and is returned as part of the response")); getFileByPathEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileByPathEndpoint.addStatus(badRequest("an invalid path was received")); getFileByPathEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileByPathEndpoint.addRequiredParameter(new Parameter("path", Parameter.Type.String, "The resource path")); getFileByPathEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileByPathEndpoint); // GET /{resource} Endpoint getFileByURIEndpoint = new Endpoint("/{resource}", Method.GET, "getfile"); getFileByURIEndpoint.setDescription("Returns the file with the given id"); getFileByURIEndpoint.addFormat(Format.xml()); getFileByURIEndpoint.addStatus(ok("the file was found and is returned as part of the response")); getFileByURIEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileByURIEndpoint.addStatus(badRequest("an invalid file identifier was received")); getFileByURIEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileByURIEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The resource identifier")); getFileByURIEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileByURIEndpoint); // GET /{resource}/content/{language} Endpoint getFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.GET, "getfilecontent"); getFileContentEndpoint.setDescription("Returns the localized file contents with the given id"); getFileContentEndpoint.addFormat(Format.xml()); getFileContentEndpoint.addStatus(ok("the file content was found and is returned as part of the response")); getFileContentEndpoint.addStatus(notFound("the file was not found or could not be loaded")); getFileContentEndpoint.addStatus(notFound("the file content don't exist in the specified language")); getFileContentEndpoint.addStatus(badRequest("an invalid file identifier was received")); getFileContentEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); getFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); getFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language identifier")); getFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.READ, getFileContentEndpoint); // POST /{resource} Endpoint createFileEndpoint = new Endpoint("/", Method.POST, "createfile"); createFileEndpoint.setDescription("Creates a new file, either at the given path or at a random location and returns the REST url of the created resource."); createFileEndpoint.addFormat(Format.xml()); createFileEndpoint.addStatus(ok("the file was created and the response body contains it's resource url")); createFileEndpoint.addStatus(badRequest("the path was not specified")); createFileEndpoint.addStatus(badRequest("the file content is malformed")); createFileEndpoint.addStatus(conflict("a file already exists at the specified path")); createFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); createFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); createFileEndpoint.addOptionalParameter(new Parameter("path", Parameter.Type.String, "The target path")); createFileEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.Text, "The resource data")); createFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, createFileEndpoint); // PUT /{resource} Endpoint updateFileEndpoint = new Endpoint("/{resource}", Method.PUT, "updatefile"); updateFileEndpoint.setDescription("Updates the specified file. If the client supplies an If-Match header, the update is processed only if the header value matches the file's ETag"); updateFileEndpoint.addFormat(Format.xml()); updateFileEndpoint.addStatus(ok("the file was updated")); updateFileEndpoint.addStatus(badRequest("the file content was not specified")); updateFileEndpoint.addStatus(badRequest("the file content is malformed")); updateFileEndpoint.addStatus(preconditionFailed("the file's etag does not match the value specified in the If-Match header")); updateFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); updateFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); updateFileEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); updateFileEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.Text, "The resource data")); updateFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, updateFileEndpoint); // DELETE /{resource} Endpoint deleteFileEndpoint = new Endpoint("/{resource}", Method.DELETE, "deletefile"); deleteFileEndpoint.setDescription("Deletes the specified file."); deleteFileEndpoint.addFormat(Format.xml()); deleteFileEndpoint.addStatus(ok("the file was deleted")); deleteFileEndpoint.addStatus(badRequest("the file was not specified")); deleteFileEndpoint.addStatus(notFound("the file was not found")); deleteFileEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); deleteFileEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); deleteFileEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); deleteFileEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, deleteFileEndpoint); // PUT /{resource}/content/{language} Endpoint updateFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.PUT, "updatefilecontent"); updateFileContentEndpoint.setDescription("Updates the specified file contents. If the client supplies an If-Match header, the update is processed only if the header value matches the file's ETag"); updateFileContentEndpoint.addFormat(Format.xml()); updateFileContentEndpoint.addStatus(ok("the file content was updated")); updateFileContentEndpoint.addStatus(badRequest("the file content was not specified")); updateFileContentEndpoint.addStatus(badRequest("the language does not exist")); updateFileContentEndpoint.addStatus(badRequest("the file content is malformed")); updateFileContentEndpoint.addStatus(preconditionFailed("the file's etag does not match the value specified in the If-Match header")); updateFileContentEndpoint.addStatus(methodNotAllowed("the site or it's content repository is read-only")); updateFileContentEndpoint.addStatus(serviceUnavailable("the site or it's content repository is temporarily offline")); updateFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); updateFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language")); updateFileContentEndpoint.addOptionalParameter(new Parameter("content", Parameter.Type.File, "The resource content")); updateFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, updateFileContentEndpoint); // DELETE /{resource}/content/{language} Endpoint deleteFileContentEndpoint = new Endpoint("/{resource}/content/{language}", Method.DELETE, "deletefilecontent"); deleteFileContentEndpoint.setDescription("Deletes the specified file content."); deleteFileContentEndpoint.addFormat(Format.xml()); deleteFileContentEndpoint.addStatus(ok("the file content was deleted")); deleteFileContentEndpoint.addStatus(badRequest("the file content was not specified")); deleteFileContentEndpoint.addStatus(notFound("the file was not found")); deleteFileContentEndpoint.addStatus(notFound("the file content was not found")); deleteFileContentEndpoint.addStatus(methodNotAllowed("the site or its content repository is read-only")); deleteFileContentEndpoint.addStatus(serviceUnavailable("the site or its content repository is temporarily offline")); deleteFileContentEndpoint.addPathParameter(new Parameter("resource", Parameter.Type.String, "The file identifier")); deleteFileContentEndpoint.addPathParameter(new Parameter("language", Parameter.Type.String, "The language identifier")); deleteFileContentEndpoint.setTestForm(new TestForm()); docs.addEndpoint(Endpoint.Type.WRITE, deleteFileContentEndpoint); return EndpointDocumentationGenerator.generate(docs); }
diff --git a/src/org/sparvnastet/rnf/GameThread.java b/src/org/sparvnastet/rnf/GameThread.java index 6d3ca40..34664af 100644 --- a/src/org/sparvnastet/rnf/GameThread.java +++ b/src/org/sparvnastet/rnf/GameThread.java @@ -1,103 +1,104 @@ /** * Copyright (c) 2012 Anders Sundman <[email protected]> * * This file is part of 'Rise and Fall' (RnF). * * RnF is free software: you can redistribute it and/or modify it * under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * RnF is distributed in the hope that it will be useful, but * WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * You should have received a copy of the GNU General Public License * along with RnF. If not, see <http://www.gnu.org/licenses/>. */ package org.sparvnastet.rnf; import java.util.concurrent.atomic.AtomicBoolean; import android.view.MotionEvent; /** * An IGameThread represents an asynchronous path of execution that runs the * game. It should handle inputs, advance and then render the game state. */ interface IGameThread extends Runnable { public void doStart(); public void doStop(); } /** * A concrete game thread that handles input, advances the game state through a * physics simulation and renders the state to a renderer. * * Once started and stopped, the same instance can not be started again. A new * instance is required to continue. */ class GameThread extends Thread implements IGameThread { private AtomicBoolean running_ = new AtomicBoolean(false); private IRenderer renderer_; private IInputBroker inputBroker_; private IPhysicsSimulator physicsSimulator_; private GameState gameState_; private long lastTime_; public GameThread(IPhysicsSimulator physicsSimulator, IRenderer renderer, IInputBroker inputBroker, GameState gameState) { physicsSimulator_ = physicsSimulator; renderer_ = renderer; inputBroker_ = inputBroker; gameState_ = gameState; } /** * Start the game thread. */ @Override public void doStart() { running_.set(true); lastTime_ = System.currentTimeMillis(); start(); } /** * Stop the game thread as soon as possible. The method returns directly and * doesn't wait for the thread to stop. */ @Override public void doStop() { running_.set(false); } /** * Run the game loop. 1. Get input, 2. Do physics, 3. Render. * * While this method is public, it should not be called directly. Use the * doStart/doStop to control execution. */ @Override public void run() { while (running_.get()) { MotionEvent[] motionEvents = inputBroker_.takeBundle(); // Check how much to advance the simulation long now = System.currentTimeMillis(); float elapsed = (float) ((now - lastTime_) / 1000.0); + lastTime_ = now; gameState_ = physicsSimulator_.run(elapsed, gameState_, motionEvents); renderer_.render(gameState_); } } }
true
true
public void run() { while (running_.get()) { MotionEvent[] motionEvents = inputBroker_.takeBundle(); // Check how much to advance the simulation long now = System.currentTimeMillis(); float elapsed = (float) ((now - lastTime_) / 1000.0); gameState_ = physicsSimulator_.run(elapsed, gameState_, motionEvents); renderer_.render(gameState_); } }
public void run() { while (running_.get()) { MotionEvent[] motionEvents = inputBroker_.takeBundle(); // Check how much to advance the simulation long now = System.currentTimeMillis(); float elapsed = (float) ((now - lastTime_) / 1000.0); lastTime_ = now; gameState_ = physicsSimulator_.run(elapsed, gameState_, motionEvents); renderer_.render(gameState_); } }
diff --git a/src/org/ohmage/controls/ActionBarControl.java b/src/org/ohmage/controls/ActionBarControl.java index 35cca76..189e1e6 100644 --- a/src/org/ohmage/controls/ActionBarControl.java +++ b/src/org/ohmage/controls/ActionBarControl.java @@ -1,222 +1,223 @@ package org.ohmage.controls; import org.ohmage.R; import org.ohmage.activity.DashboardActivity; import android.app.Activity; import android.content.Context; import android.content.Intent; import android.content.res.TypedArray; import android.util.AttributeSet; import android.view.LayoutInflater; import android.view.View; import android.widget.ImageButton; import android.widget.ImageView; import android.widget.LinearLayout; import android.widget.ProgressBar; import android.widget.TextView; import java.util.ArrayList; import java.util.List; public class ActionBarControl extends LinearLayout { private final Activity mActivity; // view references private final TextView mTitleText; private final ImageButton mHomeButton; private final ProgressBar mProgressSpinner; private ImageView mHomeSeparator; // functionality private final List<ImageButton> mActionButtons; private final List<ImageView> mSeparators; private ActionListener mActionBarClickedListener; private final OnClickListener mActionButtonClickListener; // style flags private boolean mShowLogo; private boolean mShowHome; public ActionBarControl(Context context, AttributeSet attrs) { super(context, attrs); mActivity = (Activity)context; // load up the elements of the actionbar from controls_actionbar.xml LayoutInflater inflater = (LayoutInflater)context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); inflater.inflate(R.layout.controls_actionbar, this, true); // set up some basic layout parameters, like width x height and background this.setBackgroundResource(R.drawable.title_bkgnd); // gather member references mTitleText = (TextView) findViewById(R.id.controls_actionbar_title); mHomeButton = (ImageButton) findViewById(R.id.controls_actionbar_home); mProgressSpinner = (ProgressBar) findViewById(R.id.controls_actionbar_progress); // hook up buttons mHomeButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { mActivity.startActivity(new Intent(mActivity, DashboardActivity.class).addFlags(Intent.FLAG_ACTIVITY_CLEAR_TOP)); + mActivity.finish(); } }); // serves as a single handler for routing all action button presses to a user-supplied callback mActionButtonClickListener = new OnClickListener() { @Override public void onClick(View v) { // route clicks on the action bar to the user-supplied action handler, if present if (mActionBarClickedListener != null) mActionBarClickedListener.onActionClicked(v.getId()); } }; // holds a list of buttons that we manage mActionButtons = new ArrayList<ImageButton>(); mSeparators = new ArrayList<ImageView>(); // apply the xml-specified attributes, too initStyles(attrs); } public ActionBarControl(Context context) { this(context, null); } /** * Initializes the appearance of the control based on the attributes passed from the xml. * @param attrs the collection of attributes, usually provided in the control's constructor */ protected void initStyles(AttributeSet attrs) { TypedArray a = getContext().obtainStyledAttributes(attrs, R.styleable.ActivityBarControl); mShowLogo = a.getBoolean(R.styleable.ActivityBarControl_showlogo, false); String titleText = a.getString(R.styleable.ActivityBarControl_title); mHomeSeparator = (ImageView) findViewById(R.id.controls_actionbar_homebutton_separator); mTitleText.setText(titleText); setShowLogo(mShowLogo); // and set whether or not the home button appears setHomeVisibility(a.getBoolean(R.styleable.ActivityBarControl_showhome, true)); } public void setShowLogo(boolean showLogo) { ImageView logo = (ImageView) findViewById(R.id.controls_actionbar_logo); if (showLogo) { logo.setVisibility(VISIBLE); mHomeSeparator.setVisibility(GONE); mHomeButton.setVisibility(GONE); mTitleText.setVisibility(INVISIBLE); } else { logo.setVisibility(GONE); mHomeSeparator.setVisibility(VISIBLE); mHomeButton.setVisibility(VISIBLE); mTitleText.setVisibility(VISIBLE); } } /** * Set the visibility of the home button. Note that this is overridden by "showlogo"; * if the logo is visible, the home button will never appear. * * @param isVisible if true, home button is shown; if false, home button is hidden */ public void setHomeVisibility(boolean isVisible) { if (!isVisible || mShowLogo) { mHomeSeparator.setVisibility(GONE); mHomeButton.setVisibility(GONE); mShowHome = false; } else { mHomeSeparator.setVisibility(VISIBLE); mHomeButton.setVisibility(VISIBLE); mShowHome = true; } } /** * Sets the title for the action bar, which is displayed when showlogo is false. * * @param text the text to display in the action bar */ public void setTitle(CharSequence text) { mTitleText.setText(text); } /** * Shows or hides a progress bar "spinner" depending on the value of isVisible. Generally shown * to indicate that a lengthy background operation is in progress and hidden once it's done. * * @param isVisible shows spinner if true, hides it if false */ public void setProgressVisible(boolean isVisible) { mProgressSpinner.setVisibility(isVisible?VISIBLE:GONE); } /** * Adds a command to the action bar, identified in callbacks by buttonID. Note that buttonID will be used * as the ID of the ImageButton that this method creates. * * @param buttonID an id which should uniquely identify this command, up to the caller to create * @param description a string which defines this command, used for accessibility * @param resid a drawable to render as the icon. should be the same size as the action bar (i.e. 40x40px hdpi) */ public void addActionBarCommand(int buttonID, String description, int resID) { // inflate a new separator and button from the dashboard templates // we're doing this mostly to add a predefined style to the view/button, which is currently impossible without xml ImageView newSeparator = (ImageView) mActivity.getLayoutInflater().inflate(R.layout.controls_actionbar_separator, null); ImageButton newButton = (ImageButton) mActivity.getLayoutInflater().inflate(R.layout.controls_actionbar_button, null); newButton.setId(buttonID); newButton.setContentDescription(description); newButton.setImageResource(resID); // attach to our existing listener for routing clicks through the callback newButton.setOnClickListener(mActionButtonClickListener); mSeparators.add(newSeparator); mActionButtons.add(newButton); // add to the parent layout now this.addView(newSeparator, new LayoutParams(1, LayoutParams.FILL_PARENT)); this.addView(newButton, new LayoutParams(dpToPixels(45), LayoutParams.FILL_PARENT)); } /** * Removes all the action bar commands. This is somewhat useful if you want to recompose the action bar from scratch. */ public void clearActionBarCommands() { for (ImageButton button : mActionButtons) removeView(button); for (ImageView sep : mSeparators) removeView(sep); } /** * Set a callback to be invoked when the user presses any button in the action bar. * * @param listener a listener whose {@link ActionListener#onActionClicked(int)} method will be called when a click occurs. */ public void setOnActionListener(ActionListener listener) { mActionBarClickedListener = listener; } /** * Callback that receives action bar button presses when registered with {@link ActionBarControl#setOnActionListener(ActionListener)} * @author faisal * */ public interface ActionListener { void onActionClicked(int commandID); } // utility method for converting dp to pixels, since the setters only take pixel values :\ private int dpToPixels(int dp) { final float scale = getResources().getDisplayMetrics().density; return (int) (dp * scale + 0.5f); } }
true
true
public ActionBarControl(Context context, AttributeSet attrs) { super(context, attrs); mActivity = (Activity)context; // load up the elements of the actionbar from controls_actionbar.xml LayoutInflater inflater = (LayoutInflater)context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); inflater.inflate(R.layout.controls_actionbar, this, true); // set up some basic layout parameters, like width x height and background this.setBackgroundResource(R.drawable.title_bkgnd); // gather member references mTitleText = (TextView) findViewById(R.id.controls_actionbar_title); mHomeButton = (ImageButton) findViewById(R.id.controls_actionbar_home); mProgressSpinner = (ProgressBar) findViewById(R.id.controls_actionbar_progress); // hook up buttons mHomeButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { mActivity.startActivity(new Intent(mActivity, DashboardActivity.class).addFlags(Intent.FLAG_ACTIVITY_CLEAR_TOP)); } }); // serves as a single handler for routing all action button presses to a user-supplied callback mActionButtonClickListener = new OnClickListener() { @Override public void onClick(View v) { // route clicks on the action bar to the user-supplied action handler, if present if (mActionBarClickedListener != null) mActionBarClickedListener.onActionClicked(v.getId()); } }; // holds a list of buttons that we manage mActionButtons = new ArrayList<ImageButton>(); mSeparators = new ArrayList<ImageView>(); // apply the xml-specified attributes, too initStyles(attrs); }
public ActionBarControl(Context context, AttributeSet attrs) { super(context, attrs); mActivity = (Activity)context; // load up the elements of the actionbar from controls_actionbar.xml LayoutInflater inflater = (LayoutInflater)context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); inflater.inflate(R.layout.controls_actionbar, this, true); // set up some basic layout parameters, like width x height and background this.setBackgroundResource(R.drawable.title_bkgnd); // gather member references mTitleText = (TextView) findViewById(R.id.controls_actionbar_title); mHomeButton = (ImageButton) findViewById(R.id.controls_actionbar_home); mProgressSpinner = (ProgressBar) findViewById(R.id.controls_actionbar_progress); // hook up buttons mHomeButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { mActivity.startActivity(new Intent(mActivity, DashboardActivity.class).addFlags(Intent.FLAG_ACTIVITY_CLEAR_TOP)); mActivity.finish(); } }); // serves as a single handler for routing all action button presses to a user-supplied callback mActionButtonClickListener = new OnClickListener() { @Override public void onClick(View v) { // route clicks on the action bar to the user-supplied action handler, if present if (mActionBarClickedListener != null) mActionBarClickedListener.onActionClicked(v.getId()); } }; // holds a list of buttons that we manage mActionButtons = new ArrayList<ImageButton>(); mSeparators = new ArrayList<ImageView>(); // apply the xml-specified attributes, too initStyles(attrs); }
diff --git a/tests/DumpRenderTree/src/com/android/dumprendertree/LayoutTestsAutoRunner.java b/tests/DumpRenderTree/src/com/android/dumprendertree/LayoutTestsAutoRunner.java index 8f968b4397..ebdc9c7230 100755 --- a/tests/DumpRenderTree/src/com/android/dumprendertree/LayoutTestsAutoRunner.java +++ b/tests/DumpRenderTree/src/com/android/dumprendertree/LayoutTestsAutoRunner.java @@ -1,73 +1,73 @@ /* * Copyright (C) 2008 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.android.dumprendertree; import junit.framework.TestSuite; import com.android.dumprendertree.LayoutTestsAutoTest; import android.test.InstrumentationTestRunner; import android.test.InstrumentationTestSuite; import android.util.Log; import android.content.Intent; import android.os.Bundle; /** * Instrumentation Test Runner for all DumpRenderTree tests. * * Running all tests: * * adb shell am instrument \ * -w com.android.dumprendertree.LayoutTestsAutoRunner */ public class LayoutTestsAutoRunner extends InstrumentationTestRunner { @Override public TestSuite getAllTests() { TestSuite suite = new InstrumentationTestSuite(this); suite.addTestSuite(LayoutTestsAutoTest.class); suite.addTestSuite(LoadTestsAutoTest.class); return suite; } @Override public ClassLoader getLoader() { return LayoutTestsAutoRunner.class.getClassLoader(); } @Override public void onCreate(Bundle icicle) { - super.onCreate(icicle); this.mTestPath = (String) icicle.get("path"); String timeout_str = (String) icicle.get("timeout"); if (timeout_str != null) { try { this.mTimeoutInMillis = Integer.parseInt(timeout_str); } catch (Exception e) { e.printStackTrace(); } } String r = (String)icicle.get("rebaseline"); this.mRebaseline = (r != null && r.toLowerCase().equals("true")); + super.onCreate(icicle); } public String mTestPath = null; public int mTimeoutInMillis = 0; public boolean mRebaseline = false; }
false
true
public void onCreate(Bundle icicle) { super.onCreate(icicle); this.mTestPath = (String) icicle.get("path"); String timeout_str = (String) icicle.get("timeout"); if (timeout_str != null) { try { this.mTimeoutInMillis = Integer.parseInt(timeout_str); } catch (Exception e) { e.printStackTrace(); } } String r = (String)icicle.get("rebaseline"); this.mRebaseline = (r != null && r.toLowerCase().equals("true")); }
public void onCreate(Bundle icicle) { this.mTestPath = (String) icicle.get("path"); String timeout_str = (String) icicle.get("timeout"); if (timeout_str != null) { try { this.mTimeoutInMillis = Integer.parseInt(timeout_str); } catch (Exception e) { e.printStackTrace(); } } String r = (String)icicle.get("rebaseline"); this.mRebaseline = (r != null && r.toLowerCase().equals("true")); super.onCreate(icicle); }
diff --git a/cyklotron-ui/src/main/java/net/cyklotron/cms/modules/actions/structure/UpdateProposedDocument.java b/cyklotron-ui/src/main/java/net/cyklotron/cms/modules/actions/structure/UpdateProposedDocument.java index 1f5ddcaaa..31f79af9c 100644 --- a/cyklotron-ui/src/main/java/net/cyklotron/cms/modules/actions/structure/UpdateProposedDocument.java +++ b/cyklotron-ui/src/main/java/net/cyklotron/cms/modules/actions/structure/UpdateProposedDocument.java @@ -1,175 +1,174 @@ package net.cyklotron.cms.modules.actions.structure; import java.util.Arrays; import java.util.HashSet; import java.util.Set; import org.jcontainer.dna.Logger; import org.objectledge.context.Context; import org.objectledge.coral.security.Permission; import org.objectledge.coral.security.Subject; import org.objectledge.coral.session.CoralSession; import org.objectledge.coral.store.Resource; import org.objectledge.html.HTMLService; import org.objectledge.parameters.Parameters; import org.objectledge.parameters.RequestParameters; import org.objectledge.pipeline.ProcessingException; import org.objectledge.templating.TemplatingContext; import org.objectledge.upload.FileUpload; import org.objectledge.utils.StackTrace; import org.objectledge.web.HttpContext; import org.objectledge.web.mvc.MVCContext; import net.cyklotron.cms.CmsData; import net.cyklotron.cms.CmsDataFactory; import net.cyklotron.cms.documents.DocumentNodeResource; import net.cyklotron.cms.documents.DocumentNodeResourceImpl; import net.cyklotron.cms.documents.DocumentService; import net.cyklotron.cms.files.DirectoryResource; import net.cyklotron.cms.files.FileResource; import net.cyklotron.cms.files.FilesService; import net.cyklotron.cms.related.RelatedService; import net.cyklotron.cms.structure.NavigationNodeResourceImpl; import net.cyklotron.cms.structure.StructureService; import net.cyklotron.cms.structure.internal.ProposedDocumentData; import net.cyklotron.cms.style.StyleService; public class UpdateProposedDocument extends BaseProposeDocumentAction { private final RelatedService relatedService; private final HTMLService htmlService; private final DocumentService documentService; public UpdateProposedDocument(Logger logger, StructureService structureService, CmsDataFactory cmsDataFactory, StyleService styleService, FileUpload fileUpload, FilesService filesService, RelatedService relatedService, HTMLService htmlService, DocumentService documentService) { super(logger, structureService, cmsDataFactory, styleService, filesService, fileUpload); this.relatedService = relatedService; this.htmlService = htmlService; this.documentService = documentService; } @Override public void execute(Context context, Parameters parameters, MVCContext mvcContext, TemplatingContext templatingContext, HttpContext httpContext, CoralSession coralSession) throws ProcessingException { boolean valid = true; try { long docId = parameters.getLong("doc_id"); DocumentNodeResource node = DocumentNodeResourceImpl.getDocumentNodeResource( coralSession, docId); CmsData cmsData = cmsDataFactory.getCmsData(context); Parameters screenConfig = cmsData.getEmbeddedScreenConfig(); ProposedDocumentData data = new ProposedDocumentData(screenConfig, documentService.getPreferredImageSizes(), logger); data.fromParameters(parameters, coralSession); data.setOrigin(cmsData.getNode()); // check required parameters if(!data.isValid(htmlService)) { valid = false; templatingContext.put("result", data.getValidationFailure()); } // file upload - checking if(valid && !data.isFileUploadValid(coralSession, uploadService, filesService)) { valid = false; templatingContext.put("result", data.getValidationFailure()); } if(valid && data.isAttachmentsEnabled()) { DirectoryResource dir = data.getAttachmenDirectory(coralSession); - for(int i = 0; i < data.getNewAttachmentsCount() - && data.getCurrentAttachments().size() + i < data.getAttachmentsMaxCount(); i++) + for(int i = data.getCurrentAttachments().size(); i < data.getNewAttachmentsCount() + && i < data.getAttachmentsMaxCount(); i++) { - FileResource attachment = createAttachment(data, data.getCurrentAttachments() - .size() + i, dir, coralSession); + FileResource attachment = createAttachment(data, i, dir, coralSession); data.addAttachment(attachment); } Set<Resource> publishedAttachments = new HashSet<Resource>(Arrays .asList(relatedService.getRelatedTo(coralSession, node, node .getRelatedResourcesSequence(), null))); for(long id : parameters.getLongs("remove_attachment")) { FileResource file = data.removeAttachment(id, coralSession); if(!publishedAttachments.contains(file) && !node.getThumbnail().equals(file)) { filesService.deleteFile(coralSession, file); } } } if(valid) { data.toProposal(node); node.update(); } } catch(Exception e) { logger.error("excception", e); templatingContext.put("result", "exception"); templatingContext.put("trace", new StackTrace(e)); valid = false; } if(valid) { templatingContext.put("result", "update_request_submitted"); } else { parameters.set("state", "EditDocument"); } } @Override public boolean requiresAuthenticatedUser(Context context) throws Exception { return true; } @Override public boolean checkAccessRights(Context context) throws Exception { Parameters requestParameters = context.getAttribute(RequestParameters.class); CoralSession coralSession = context.getAttribute(CoralSession.class); Subject userSubject = coralSession.getUserSubject(); long id = requestParameters.getLong("doc_id", -1); Resource node = NavigationNodeResourceImpl.getNavigationNodeResource(coralSession, id); Permission modifyPermission = coralSession.getSecurity().getUniquePermission( "cms.structure.modify"); Permission modifyOwnPermission = coralSession.getSecurity().getUniquePermission( "cms.structure.modify_own"); if(userSubject.hasPermission(node, modifyPermission)) { return true; } if(node.getOwner().equals(userSubject) && userSubject.hasPermission(node, modifyOwnPermission)) { return true; } if(node.getCreatedBy().equals(userSubject) && userSubject.hasPermission(node, modifyOwnPermission)) { return true; } return false; } }
false
true
public void execute(Context context, Parameters parameters, MVCContext mvcContext, TemplatingContext templatingContext, HttpContext httpContext, CoralSession coralSession) throws ProcessingException { boolean valid = true; try { long docId = parameters.getLong("doc_id"); DocumentNodeResource node = DocumentNodeResourceImpl.getDocumentNodeResource( coralSession, docId); CmsData cmsData = cmsDataFactory.getCmsData(context); Parameters screenConfig = cmsData.getEmbeddedScreenConfig(); ProposedDocumentData data = new ProposedDocumentData(screenConfig, documentService.getPreferredImageSizes(), logger); data.fromParameters(parameters, coralSession); data.setOrigin(cmsData.getNode()); // check required parameters if(!data.isValid(htmlService)) { valid = false; templatingContext.put("result", data.getValidationFailure()); } // file upload - checking if(valid && !data.isFileUploadValid(coralSession, uploadService, filesService)) { valid = false; templatingContext.put("result", data.getValidationFailure()); } if(valid && data.isAttachmentsEnabled()) { DirectoryResource dir = data.getAttachmenDirectory(coralSession); for(int i = 0; i < data.getNewAttachmentsCount() && data.getCurrentAttachments().size() + i < data.getAttachmentsMaxCount(); i++) { FileResource attachment = createAttachment(data, data.getCurrentAttachments() .size() + i, dir, coralSession); data.addAttachment(attachment); } Set<Resource> publishedAttachments = new HashSet<Resource>(Arrays .asList(relatedService.getRelatedTo(coralSession, node, node .getRelatedResourcesSequence(), null))); for(long id : parameters.getLongs("remove_attachment")) { FileResource file = data.removeAttachment(id, coralSession); if(!publishedAttachments.contains(file) && !node.getThumbnail().equals(file)) { filesService.deleteFile(coralSession, file); } } } if(valid) { data.toProposal(node); node.update(); } } catch(Exception e) { logger.error("excception", e); templatingContext.put("result", "exception"); templatingContext.put("trace", new StackTrace(e)); valid = false; } if(valid) { templatingContext.put("result", "update_request_submitted"); } else { parameters.set("state", "EditDocument"); } }
public void execute(Context context, Parameters parameters, MVCContext mvcContext, TemplatingContext templatingContext, HttpContext httpContext, CoralSession coralSession) throws ProcessingException { boolean valid = true; try { long docId = parameters.getLong("doc_id"); DocumentNodeResource node = DocumentNodeResourceImpl.getDocumentNodeResource( coralSession, docId); CmsData cmsData = cmsDataFactory.getCmsData(context); Parameters screenConfig = cmsData.getEmbeddedScreenConfig(); ProposedDocumentData data = new ProposedDocumentData(screenConfig, documentService.getPreferredImageSizes(), logger); data.fromParameters(parameters, coralSession); data.setOrigin(cmsData.getNode()); // check required parameters if(!data.isValid(htmlService)) { valid = false; templatingContext.put("result", data.getValidationFailure()); } // file upload - checking if(valid && !data.isFileUploadValid(coralSession, uploadService, filesService)) { valid = false; templatingContext.put("result", data.getValidationFailure()); } if(valid && data.isAttachmentsEnabled()) { DirectoryResource dir = data.getAttachmenDirectory(coralSession); for(int i = data.getCurrentAttachments().size(); i < data.getNewAttachmentsCount() && i < data.getAttachmentsMaxCount(); i++) { FileResource attachment = createAttachment(data, i, dir, coralSession); data.addAttachment(attachment); } Set<Resource> publishedAttachments = new HashSet<Resource>(Arrays .asList(relatedService.getRelatedTo(coralSession, node, node .getRelatedResourcesSequence(), null))); for(long id : parameters.getLongs("remove_attachment")) { FileResource file = data.removeAttachment(id, coralSession); if(!publishedAttachments.contains(file) && !node.getThumbnail().equals(file)) { filesService.deleteFile(coralSession, file); } } } if(valid) { data.toProposal(node); node.update(); } } catch(Exception e) { logger.error("excception", e); templatingContext.put("result", "exception"); templatingContext.put("trace", new StackTrace(e)); valid = false; } if(valid) { templatingContext.put("result", "update_request_submitted"); } else { parameters.set("state", "EditDocument"); } }
diff --git a/pace-base/src/main/java/com/pace/base/project/utils/PafExcelUtil.java b/pace-base/src/main/java/com/pace/base/project/utils/PafExcelUtil.java index b96cdf67..866f5ea0 100644 --- a/pace-base/src/main/java/com/pace/base/project/utils/PafExcelUtil.java +++ b/pace-base/src/main/java/com/pace/base/project/utils/PafExcelUtil.java @@ -1,1477 +1,1478 @@ /** * */ package com.pace.base.project.utils; import java.io.File; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import java.io.InputStream; import java.util.ArrayList; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.regex.Matcher; import java.util.regex.Pattern; import org.apache.log4j.Logger; import org.apache.poi.openxml4j.exceptions.InvalidFormatException; import org.apache.poi.ss.usermodel.Cell; import org.apache.poi.ss.usermodel.CellStyle; import org.apache.poi.ss.usermodel.Font; import org.apache.poi.ss.usermodel.FormulaEvaluator; import org.apache.poi.ss.usermodel.Row; import org.apache.poi.ss.usermodel.Sheet; import org.apache.poi.ss.usermodel.Workbook; import org.apache.poi.ss.usermodel.WorkbookFactory; import org.apache.poi.xssf.usermodel.XSSFWorkbook; import com.pace.base.PafErrSeverity; import com.pace.base.PafException; import com.pace.base.project.ExcelPaceProjectConstants; import com.pace.base.project.ExcelProjectDataErrorException; import com.pace.base.project.ProjectDataError; import com.pace.base.project.ProjectElementId; import com.pace.base.project.excel.PafExcelInput; import com.pace.base.project.excel.PafExcelRow; import com.pace.base.project.excel.PafExcelValueObject; import com.pace.base.utility.CollectionsUtil; import com.pace.base.utility.StringUtils; /** * @author jmilliron * */ public class PafExcelUtil { private static final Logger logger = Logger.getLogger(PafExcelUtil.class); /** * * A user can read from an existing workbook via the input, or pass have this method create a new * workbook reference and read from that. The main objective of this method is to read in a sheet from * an existing workbook and to convert the data from that sheet into a model pace can use. * * If input doesn't have a column limit, a default of 100 columns will be read. * * @param input input meta data used by method to read in sheet * @return a list of paf row's. * @throws PafException */ public static List<PafExcelRow> readExcelSheet(PafExcelInput input) throws PafException { validateReadInput(input); Workbook wb = null; if ( input.getWorkbook() != null ) { wb = input.getWorkbook(); } else { wb = readWorkbook(input.getFullWorkbookName()); } List<PafExcelRow> pafRowList = new ArrayList<PafExcelRow>(); if (wb ==null) logger.info("Workbook(WB) is null"); if ( wb != null ) { logger.info("Workbook(WB) exists"); Sheet sheet = wb.getSheet(input.getSheetId()); if (sheet ==null) logger.info("Sheet is null"); if ( sheet != null ) { logger.info("Sheet is not null"); int sheetLastRowNumber = sheet.getLastRowNum(); //if row limit is less than max row number on sheet, reset last row number to row limit. if ( input.getRowLimit() > 0 && input.getRowLimit() < sheetLastRowNumber ) { sheetLastRowNumber = input.getRowLimit(); //subtract one to aline with 0 based indexes sheetLastRowNumber--; } int startColumnIndex = 0; if ( input.getStartDataReadColumnIndex() != null && input.getStartDataReadColumnIndex() < input.getColumnLimit()) { startColumnIndex = input.getStartDataReadColumnIndex(); } PafExcelRow pafRow = null; OUTTER_LOOP: for (int i = 0; i <= sheetLastRowNumber; i++) { Row row = sheet.getRow(i); //if entire row is blank if ( row == null ) { //by default, include empty row if ( ! input.isExcludeEmptyRows() ) { logger.info("Adding PafExcelRow"); pafRowList.add(new PafExcelRow()); } continue; } int endColumnIndex = input.getColumnLimit(); //Add pace row items to pace row for (int t = startColumnIndex; t < endColumnIndex; t++) { Cell cell = row.getCell(t); //if cell is null, have row create blank cell if ( cell == null ) { logger.debug("Null Blank: " + i + ", " + t); //since cell is null, have row create cell cell = row.createCell(t, Cell.CELL_TYPE_BLANK); } PafExcelValueObject pafExcelValueObject = PafExcelValueObject.createFromCell(wb, cell); //if 1st column item if ( t == startColumnIndex ) { //if user flagged end of sheet data with a string and string matches here, stop reading data if ( pafExcelValueObject.isString() && input.getEndOfSheetIdnt() != null && pafExcelValueObject.getString().equalsIgnoreCase(input.getEndOfSheetIdnt())) { break OUTTER_LOOP; } //if not multi data row or it is but 1st item isn't a blank, create a new row if ( ! input.isMultiDataRow() || (input.isMultiDataRow() && ! pafExcelValueObject.isBlank()) ) { pafRow = new PafExcelRow(); } } pafRow.addRowItem(t, pafExcelValueObject); } //if the list already contains the row, remove. if (pafRowList.contains(pafRow) && pafRowList.indexOf(pafRow) == (pafRowList.size() - 1)) { pafRowList.remove(pafRow); } pafRowList.add(pafRow); //header row if ( isHeaderRow(input, pafRow) ) { //if exclude header, then remove from list of pace rows if ( input.isExcludeHeaderRows() ) { pafRowList.remove(pafRow); sheetLastRowNumber++; //else set the header attribute } else { pafRow.setHeader(true); } //blank row } else if ( isBlankRow(input, pafRow)) { if ( input.isExcludeEmptyRows() ) { pafRowList.remove(pafRow); sheetLastRowNumber++; } else { pafRow.setBlank(true); } //data row } else { //exclude data rows? if yes, remove if ( input.isExcludeDataRows()) { pafRowList.remove(pafRow); } } } } } return pafRowList; } private static void validateReadInput(PafExcelInput input) throws PafException { if ( input == null ) { String error = "Paf Excel Input cannot be null"; logger.error(error); throw new NullPointerException(error); } else if ( input.getFullWorkbookName() == null && input.getWorkbook() == null ) { String error = "Paf excel input has not been configured property."; logger.error(error); throw new NullPointerException(error); } Workbook wb = null; if ( input.getWorkbook() != null ) { wb = input.getWorkbook(); } else { wb = readWorkbook(input.getFullWorkbookName()); } if ( wb == null ) { String error = "Workbook " + input.getFullWorkbookName() + " could not be read."; logger.error(error); throw new PafException(error, PafErrSeverity.Error); } else { Sheet sheet = wb.getSheet(input.getSheetId()); if ( sheet == null && input.isSheetRequired() ) { String error = "Sheet " + input.getSheetId() + " does not exist."; logger.error(error); throw new PafException(error, PafErrSeverity.Error); } } } public static List<String> getWorkbookSheetNames(Workbook workbook) throws PafException { List<String> sheetNameList = new ArrayList<String>(); if ( workbook != null ) { for (int i = 0; i < workbook.getNumberOfSheets(); i++) { sheetNameList.add(workbook.getSheetName(i)); } } if ( logger.isDebugEnabled() ) { logger.debug("Sheets: " + sheetNameList); } return sheetNameList; } public static List<String> getWorkbookSheetNames(String workbookLocation) throws PafException { Workbook wb = readWorkbook(workbookLocation); return getWorkbookSheetNames(wb); } private static boolean isBlankRow(PafExcelInput input, PafExcelRow pafRow) { if ( pafRow != null ) { for (Integer index : pafRow.getPafExcelValueObjectListMap().keySet()) { for (PafExcelValueObject valueObject : pafRow.getPafExcelValueObjectListMap().get(index) ) { if ( ! valueObject.isBlank() ) { return false; } } } } return true; } protected static boolean isHeaderRow(PafExcelInput input, PafExcelRow pafRow) { boolean isHeader = false; logger.debug("Checking if row is header row."); if ( input != null && pafRow != null ) { int startIndex = 0; if ( input.getStartDataReadColumnIndex() != null && input.getStartDataReadColumnIndex() > 0 ) { startIndex = input.getStartDataReadColumnIndex(); } int endIndex = input.getColumnLimit(); //continue if start index is less than end index if ( startIndex < endIndex ) { List<Integer> rowColumnIndexList = pafRow.getRowItemOrderedIndexes(); //loop through header list and see if the row matches any of the header list OUTTER_LOOP: for (String headerKey : input.getHeaderListMap().keySet()) { List<String> headerList = input.getHeaderListMap().get(headerKey); //see if header row or not if ( headerList != null && headerList.size() > 0 ) { try { headerList = headerList.subList(startIndex, endIndex); } catch (IndexOutOfBoundsException e) { continue; } List<Integer> updateRowColumnIndexList = new ArrayList<Integer>(); try { updateRowColumnIndexList.addAll(rowColumnIndexList.subList(0, endIndex-startIndex)); } catch (IndexOutOfBoundsException e) { continue; } //if header list size does not equal the number of row item indexes, continue to next header; if ( updateRowColumnIndexList.size() != headerList.size()) { continue; } isHeader = true; //loop through all pace row items for (Integer rowItemIndex : updateRowColumnIndexList ) { List<PafExcelValueObject> paceRowItemList = pafRow.getRowItem(rowItemIndex); logger.debug("\tProcessing Row Item List (element 0): " + paceRowItemList.get(0).getValueAsString()); int headerIndex = updateRowColumnIndexList.indexOf(rowItemIndex); //items to compare String headerItem = headerList.get(headerIndex); String paceRowItem = paceRowItemList.get(0).getValueAsString(); //if pace row item is a header ignore field, set as blank if ( headerItem.equals(ExcelPaceProjectConstants.HEADER_IGNORE_IDENT)) { paceRowItem = ExcelPaceProjectConstants.HEADER_IGNORE_IDENT; } //if string returns something and the header list does not match if ( paceRowItemList.size() > 1 || (paceRowItemList.size() == 1 && ! headerItem.equalsIgnoreCase(paceRowItem))) { isHeader = false; continue OUTTER_LOOP; } } //if header, break look and don't check next header if ( isHeader ) { pafRow.setHeaderIdent(headerKey); break OUTTER_LOOP; } } } } } logger.debug("Row is header: " + isHeader); return isHeader; } public static void writeExcelSheet(PafExcelInput input, List<PafExcelRow> paceRowList) throws PafException { if ( input == null ) { throw new IllegalArgumentException("Pace Excel Input cannot be null"); } else if ( input.getFullWorkbookName() == null && input.getWorkbook() == null ) { throw new IllegalArgumentException("A Full workbook name and a workbook haven't not been provided. One is required."); } Workbook wb = null; if ( input.getWorkbook() != null ) { wb = input.getWorkbook(); } else { wb = readWorkbook(input.getFullWorkbookName()); } if ( wb == null ) { throw new PafException("Couldn't get a reference to the workbook " + input.getFullWorkbookName() , PafErrSeverity.Error); } Sheet sheet = wb.getSheet(input.getSheetId()); if ( sheet == null ) { sheet = wb.createSheet(input.getSheetId()); } else { sheet = clearSheetValues(sheet); } if ( paceRowList != null ) { FormulaEvaluator evaluator = wb.getCreationHelper().createFormulaEvaluator(); int rowNdx = 0; int maxNumberOfColumns = 0; CellStyle boldCellStyle = null; boolean isFirstHeader = true; for (PafExcelRow paceRow : paceRowList ) { if ( paceRow != null ) { //if row is header and need to exclude, continue to next row if ( paceRow.isHeader() && input.isExcludeHeaderRows()) { continue; } if ( paceRow.numberOfColumns() > maxNumberOfColumns) { maxNumberOfColumns = paceRow.numberOfColumns(); } for (int i = 0; i < paceRow.numberOfCompressedRows(); i++ ) { Row row = sheet.createRow(rowNdx++); if ( isFirstHeader && paceRow.isHeader() ) { //freeze 1st header row sheet.createFreezePane(0, 1); isFirstHeader = false; } for ( Integer index : paceRow.getRowItemOrderedIndexes() ) { List<PafExcelValueObject> rowItemList = paceRow.getPafExcelValueObjectListMap().get(index); //Cell cell = row.createCell(rowItemNdx++);; Cell cell = row.createCell(index); if ( i < rowItemList.size()) { PafExcelValueObject rowItem = rowItemList.get(i); if ( rowItem == null ) { cell.setCellType(Cell.CELL_TYPE_BLANK); } else { //if header, bold item if ( paceRow.isHeader() || rowItem.isBoldItem() ) { if ( boldCellStyle == null ) { boldCellStyle = getBoldCellStyle(wb); //turn word wrap on boldCellStyle.setWrapText(true); } cell.setCellStyle(boldCellStyle); } switch ( rowItem.getType() ) { case Blank: cell.setCellType(Cell.CELL_TYPE_BLANK); break; case Boolean: if ( rowItem.getBoolean() != null ) { Boolean boolValue = rowItem.getBoolean(); if ( input.isExcludeDefaultValuesOnWrite()) { //if default, clear value if ( boolValue.equals(Boolean.FALSE)) { boolValue = null; } } //true or false if ( boolValue != null ) { cell.setCellType(Cell.CELL_TYPE_BOOLEAN); cell.setCellValue(boolValue); } } break; case Double: if ( rowItem.getDouble() != null ) { Double doubleVal = rowItem.getDouble(); if ( doubleVal != null && input.isExcludeDefaultValuesOnWrite()) { if ( doubleVal == 0 ) { doubleVal = null; } } if ( doubleVal != null ) { cell.setCellType(Cell.CELL_TYPE_NUMERIC); cell.setCellValue(doubleVal); } } break; case Integer: if ( rowItem.getInteger() != null ) { Integer intValue = rowItem.getInteger(); if ( intValue != null && input.isExcludeDefaultValuesOnWrite()) { if ( intValue == 0 ) { intValue = null; } } if ( intValue != null ) { cell.setCellType(Cell.CELL_TYPE_NUMERIC); cell.setCellValue(intValue); } } break; case Formula: cell.setCellType(Cell.CELL_TYPE_FORMULA); String formula = rowItem.getFormula(); String formulas[] = formula.split(" & \" \\| \" & "); if( formulas.length >= 1 ) { //there is only 1 formula + formula = formulas[0]; String tokens[] = formula.split("!"); String sheetName = tokens[0]; if( ! sheetName.matches("[a-zA-Z0123456789]*") ) { formula = "'" + sheetName + "'!" + tokens[1]; } } if ( formulas.length > 1 ) { // more than 1 formula concatenated String tmp = ""; for( int j=1;j<formulas.length;j++ ) { tmp = formulas[j]; String tokens[] = formulas[j].split("!"); String sheetName = tokens[0]; if( ! sheetName.matches("[a-zA-Z0123456789]*") ) { tmp = "'" + sheetName + "'!" + tokens[1]; } formula = formula + " & \" | \" & " + tmp; } } cell.setCellFormula(formula); evaluator.evaluateFormulaCell(cell); break; case String: cell.setCellType(Cell.CELL_TYPE_STRING); cell.setCellValue(rowItem.getString()); break; } } } else { cell.setCellType(Cell.CELL_TYPE_BLANK); } } } } } //add end of sheet ident if ( input.getEndOfSheetIdnt() != null ) { int lastSheetRowNumber = sheet.getLastRowNum() + 1; Row lastRow = sheet.createRow(lastSheetRowNumber); Cell eosCell = lastRow.createCell(0, Cell.CELL_TYPE_STRING); eosCell.setCellValue(input.getEndOfSheetIdnt()); //set bold style eosCell.setCellStyle(getBoldCellStyle(wb)); } //auto size columns? if ( input.isAutoSizeColumns() ) { for (int i = 0; i <= maxNumberOfColumns; i++) { sheet.autoSizeColumn((short) i); } } } logger.info("\tSaving sheet: " + input.getSheetId() ); wb.setActiveSheet(wb.getSheetIndex(sheet.getSheetName())); //if write to filesystem, close workbook if ( input.isAutoWriteToFileSystem() ) { writeWorkbook(wb, input.getFullWorkbookName()); } } private static CellStyle getBoldCellStyle(Workbook workbook) { CellStyle cellStyle = null; if ( workbook != null ) { cellStyle = workbook.createCellStyle(); Font font = workbook.createFont(); font.setBoldweight(Font.BOLDWEIGHT_BOLD); cellStyle.setFont(font); } return cellStyle; } private static Sheet clearSheetValues(Sheet sheet) { if ( sheet != null ) { Workbook wb = sheet.getWorkbook(); String sheetName = sheet.getSheetName(); int sheetNdx = wb.getSheetIndex(sheetName); wb.removeSheetAt(sheetNdx); sheet = wb.createSheet(sheetName); wb.setSheetOrder(sheetName, sheetNdx); } return sheet; } public static String createExcelReference(String sheetId, String address) { String excelReference = null; if ( sheetId != null && address != null ) { if ( sheetId.contains(" ") ) { sheetId = "'" + sheetId.trim() + "'"; } excelReference = sheetId + "!" + address; } return excelReference; } /** * * Replaces all blanks with null * * @param list list of paf excel value objects * @return a list of excel value objects will all blank's converted into null items in list */ public static List<PafExcelValueObject> convertBlanksToNullInList(List<PafExcelValueObject> list) { List<PafExcelValueObject> updatedList = new ArrayList<PafExcelValueObject>(); if ( list != null ) { for (PafExcelValueObject listValueObject : list ) { if ( listValueObject.isBlank() ) { updatedList.add(null); } else { updatedList.add(listValueObject); } } } return updatedList; } public static String getString(ProjectElementId projectElementId, PafExcelValueObject valueObject, boolean isRequired) throws ExcelProjectDataErrorException { return getString(projectElementId, valueObject, isRequired, null); } public static String getString(ProjectElementId projectElementId, PafExcelValueObject valueObject, List<String> validValueList) throws ExcelProjectDataErrorException { return getString(projectElementId, valueObject, false, validValueList); } public static String getString(ProjectElementId projectElementId, PafExcelValueObject valueObject, boolean isRequired, List<String> validValueList) throws ExcelProjectDataErrorException { String str = null; //if null or blank if ( valueObject == null || valueObject.isBlank() ) { if ( isRequired ) { throw new ExcelProjectDataErrorException(ProjectDataError.createRequiredProjectDataError(projectElementId, valueObject)); } } else if ( valueObject.isString() || valueObject.isFormula() || valueObject.isNumeric() ) { if ( validValueList == null ) { str = valueObject.getValueAsString(); } else if (validValueList != null && CollectionsUtil.containsIgnoreCase(validValueList, valueObject.getValueAsString())) { for (String validValue : validValueList ) { if ( valueObject.getValueAsString().equalsIgnoreCase(validValue)) { str = validValue; break; } } } else { throw new ExcelProjectDataErrorException(ProjectDataError.createInvalidValueProjectDataError(projectElementId, valueObject, validValueList)); } } else { throw new ExcelProjectDataErrorException(ProjectDataError.createInvalidValueProjectDataError(projectElementId, valueObject, validValueList)); } return str; } public static Integer getInteger(ProjectElementId projectElementId, PafExcelValueObject valueObject) throws ExcelProjectDataErrorException { return getInteger(projectElementId, valueObject, false); } public static Integer getInteger(ProjectElementId projectElementId, PafExcelValueObject valueObject, boolean isRequired) throws ExcelProjectDataErrorException { Integer intValue = null; //if not blank if ( valueObject != null && ! valueObject.isBlank() ) { //if numeric, get int value if ( valueObject.isNumeric() ) { intValue = valueObject.getInteger(); //throw invalid exception } else { throw new ExcelProjectDataErrorException(ProjectDataError.createInvalidNumberProjectDataError(projectElementId, valueObject)); } //if blank } else { //if required and blank if ( isRequired ) { throw new ExcelProjectDataErrorException(ProjectDataError.createRequiredProjectDataError(projectElementId, valueObject)); } } return intValue; } public static Boolean getBoolean(ProjectElementId projectElementId, PafExcelValueObject valueObject) throws ExcelProjectDataErrorException { return getBoolean(projectElementId, valueObject, false); } public static Boolean getBoolean(ProjectElementId projectElementId, PafExcelValueObject valueObject, boolean returnDefaultIfNull) throws ExcelProjectDataErrorException { Boolean boolValue = null; if ( ! valueObject.isBlank() ) { if ( valueObject.isBoolean() ) { boolValue = valueObject.getBoolean(); } else { throw new ExcelProjectDataErrorException(ProjectDataError.createBooleanProjectDataError(projectElementId, valueObject)); } } if ( returnDefaultIfNull && boolValue == null) { boolValue = Boolean.FALSE; } return boolValue; } public static String[] getStringAr(ProjectElementId projectElementId, List<PafExcelValueObject> valueObjectList) throws ExcelProjectDataErrorException { return getStringAr(projectElementId, valueObjectList, false); } public static String[] getStringAr(ProjectElementId projectElementId, List<PafExcelValueObject> valueObjectList, boolean isRequired ) throws ExcelProjectDataErrorException { String[] stringAr = null; List<String> stringList = new ArrayList<String>(); if ( valueObjectList != null ) { for (PafExcelValueObject excelValueObject : valueObjectList ) { stringList.add(getString(projectElementId, excelValueObject)); } } //if list has elements, convert into a string array if ( stringList.size() > 0 ) { stringAr = stringList.toArray(new String[0]); } //if required if ( isRequired ) { //if required and null or array converted to list with nulls pruned and size of 0, then throw project data error. if ( stringAr == null || CollectionsUtil.arrayToListPruneNulls(stringAr).size() == 0 ) { //throw new exception using 1st excel value object in list, should be blank throw new ExcelProjectDataErrorException(ProjectDataError.createRequiredProjectDataError(projectElementId, valueObjectList.get(0))); } } return stringAr; } public static String[] getStringArFromDelimValueObject(ProjectElementId projectElementId, PafExcelValueObject valueObject) throws ExcelProjectDataErrorException { return getStringArFromDelimValueObject(projectElementId, valueObject, false); } public static String[] getStringArFromDelimValueObject(ProjectElementId projectElementId, PafExcelValueObject valueObject, boolean isRequired) throws ExcelProjectDataErrorException { String[] strAr = null; //if null or blank if ( valueObject == null || valueObject.isBlank() ) { //if required, throw error if null or blank if ( isRequired ) { throw new ExcelProjectDataErrorException(ProjectDataError.createRequiredProjectDataError(projectElementId, valueObject)); } } else if ( valueObject.isString() || valueObject.isFormula() || valueObject.isNumeric() ) { List<String> listFromString = StringUtils.stringToList(PafExcelUtil.getString(projectElementId, valueObject), ExcelPaceProjectConstants.EXCEL_STRING_FIELD_DELIM); if ( listFromString.size() > 0 ) { strAr = listFromString.toArray(new String[0]); } } return strAr; } public static String getString(ProjectElementId projectElementId, PafExcelValueObject valueObject) throws ExcelProjectDataErrorException { return getString(projectElementId, valueObject, false, null); } public static String getHexNumber(ProjectElementId projectElementId, PafExcelValueObject valueObject) throws ExcelProjectDataErrorException { if ( valueObject != null ) { if ( ! valueObject.isBlank() ) { String hexNumber = null; if ( valueObject.isNumeric()) { hexNumber = valueObject.getInteger().toString(); } else { hexNumber = valueObject.getValueAsString(); } //hex values are length of 6 if ( hexNumber.length() != 6 ) { throw new ExcelProjectDataErrorException(ProjectDataError.createInvalidValueProjectDataError(projectElementId, valueObject)); } else { Pattern p = Pattern.compile(ExcelPaceProjectConstants.HEX_FONT_PATTERN); Matcher m = p.matcher(hexNumber); if ( m.matches() ) { return hexNumber.toUpperCase(); } else { throw new ExcelProjectDataErrorException(ProjectDataError.createInvalidValueProjectDataError(projectElementId, valueObject)); } } } } return null; } public static Workbook readWorkbook(String workbookLocation) throws PafException { if ( workbookLocation == null ) { throw new IllegalArgumentException("Workbook location can not be null."); } Workbook wb = null; File fullFileWorkbookLocation = new File(workbookLocation); if ( fullFileWorkbookLocation.isFile() ) { InputStream inp = null; try { inp = new FileInputStream(workbookLocation); wb = WorkbookFactory.create(inp); } catch (FileNotFoundException e) { throw new PafException(e.getMessage(), PafErrSeverity.Error); } catch (InvalidFormatException e) { throw new PafException(e.getMessage(), PafErrSeverity.Error); } catch (IOException e) { throw new PafException(e.getMessage(), PafErrSeverity.Error); } } else { wb = new XSSFWorkbook(); } if ( wb == null ) { logger.error("Couldn't get a refernece to workbook " + workbookLocation); throw new PafException("Workbook reference " + workbookLocation + " is null.", PafErrSeverity.Error); } return wb; } public static void writeWorkbook(Workbook wb, String fullWorkbookName) throws PafException { // Write the output to a file FileOutputStream fileOut = null; try { fileOut = new FileOutputStream(fullWorkbookName); wb.write(fileOut); } catch (FileNotFoundException e) { logger.error(e.getMessage()); throw new PafException(e.getMessage(), PafErrSeverity.Fatal); } catch (IOException e) { logger.error(e.getMessage()); throw new PafException(e.getMessage(), PafErrSeverity.Error); } finally { if ( fileOut != null ) { try { fileOut.close(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } } } } /** * * Creats a cell reference map, key is actual value, value is sheet/cell reference * * @param input * @return * @throws PafException */ public static Map<String, String> createCellReferenceMap ( PafExcelInput input ) throws PafException { validateReadInput(input); Map<String, String> cellReferenceMap = new HashMap<String, String>(); List<PafExcelRow> excelRowList = readExcelSheet(input); int startColumnIndex = 0; if ( input.getStartDataReadColumnIndex() != null ) { startColumnIndex = input.getStartDataReadColumnIndex(); } if ( excelRowList != null ) { for ( PafExcelRow excelRow : excelRowList ) { if ( excelRow.getRowItemOrderedIndexes().contains(startColumnIndex)) { List<PafExcelValueObject> valueObjectList = excelRow.getRowItem(startColumnIndex); if ( valueObjectList != null && valueObjectList.size() > 0 ) { //get 1st element PafExcelValueObject valueObject = valueObjectList.get(0); if ( valueObject.getCellAddress() != null ) { cellReferenceMap.put(valueObject.getString(), createExcelReference(input.getSheetId(), valueObject.getCellAddress(true))); } } } } } return cellReferenceMap; } public static PafExcelRow createHeaderRow(List<String> headerList) { PafExcelRow row = new PafExcelRow(); if ( headerList != null) { row.setHeader(true); int headerNdx = 0; for ( String header : headerList ) { row.addRowItem(headerNdx++, PafExcelValueObject.createFromString(header)); } } return row; } public static void orderSheets(String fullWorkbookName, List<ProjectElementId> sheetOrderList) throws PafException { try { Workbook wb = readWorkbook(fullWorkbookName); if ( wb != null ) { Map<ProjectElementId, Integer> sheetOrderMap = new HashMap<ProjectElementId, Integer>(); for ( ProjectElementId projectElementId : sheetOrderList ) { int sheetIndex = wb.getSheetIndex(projectElementId.toString()); logger.info(projectElementId.toString() + " : sheet index = " + sheetIndex); } } } catch (PafException e) { throw e; } } public static PafExcelValueObject getDelimValueObjectFromStringAr(String[] stringAr) { PafExcelValueObject valueObject = null; if ( stringAr != null && stringAr.length > 0 ) { List<PafExcelValueObject> list = new ArrayList<PafExcelValueObject>(); for ( String string : stringAr ) { list.add(PafExcelValueObject.createFromString(string)); } valueObject = PafExcelUtil.getDelimValueObjectFromList(list); } else { valueObject = PafExcelValueObject.createBlank(); } return valueObject; } /** * * Converts a list of PafExcelValueObjects into a single PafExcelValueObject that is delimited * by |'s between the values. If all items are string, then the PafExcelValueObject will be a * string with the |'s between the string values, but if formula, the entire list is parsed * into formula segements like this: =RuleSet_ContribPct!$A$2 & "|" & "StoreSales" * * @param list list of paf excel value objects * @return */ public static PafExcelValueObject getDelimValueObjectFromList(List<PafExcelValueObject> list) { PafExcelValueObject valueObject = null; if ( list != null && list.size() > 0 ) { boolean allStringValueObjects = true; for (PafExcelValueObject stringValueObject : list ) { if ( ! stringValueObject.isString() ) { allStringValueObjects = false; break; } } StringBuilder sb = new StringBuilder(); int strNdx = 0; for (PafExcelValueObject buildValueObject : list ) { if ( allStringValueObjects ) { sb.append(buildValueObject.getString()); } else { if ( buildValueObject.isFormula()) { sb.append(buildValueObject.getFormula()); } else { sb.append("\"" + buildValueObject.getString() + "\""); } } if ( ++strNdx != list.size() ) { if ( allStringValueObjects ) { sb.append(" " + ExcelPaceProjectConstants.EXCEL_STRING_FIELD_DELIM + " "); } else { sb.append(" & \" " + ExcelPaceProjectConstants.EXCEL_STRING_FIELD_DELIM + " \" & "); } } } if ( allStringValueObjects ) { valueObject = PafExcelValueObject.createFromString(sb.toString()); } else { valueObject = PafExcelValueObject.createFromFormula(sb.toString()); } } else { valueObject = PafExcelValueObject.createBlank(); } return valueObject; } /** * * Deletes a sheet from a workbook * * @param workbook workbook to delete sheet from * @param sheetName name of sheet to delete */ public static void deleteSheet(Workbook workbook, String sheetName) { if ( workbook != null && sheetName != null ) { int sheetIndex = workbook.getSheetIndex(sheetName); if ( sheetIndex >= 0 ) { logger.info("Deleting sheet: " + sheetName); workbook.removeSheetAt(sheetIndex); } } } }
true
true
public static void writeExcelSheet(PafExcelInput input, List<PafExcelRow> paceRowList) throws PafException { if ( input == null ) { throw new IllegalArgumentException("Pace Excel Input cannot be null"); } else if ( input.getFullWorkbookName() == null && input.getWorkbook() == null ) { throw new IllegalArgumentException("A Full workbook name and a workbook haven't not been provided. One is required."); } Workbook wb = null; if ( input.getWorkbook() != null ) { wb = input.getWorkbook(); } else { wb = readWorkbook(input.getFullWorkbookName()); } if ( wb == null ) { throw new PafException("Couldn't get a reference to the workbook " + input.getFullWorkbookName() , PafErrSeverity.Error); } Sheet sheet = wb.getSheet(input.getSheetId()); if ( sheet == null ) { sheet = wb.createSheet(input.getSheetId()); } else { sheet = clearSheetValues(sheet); } if ( paceRowList != null ) { FormulaEvaluator evaluator = wb.getCreationHelper().createFormulaEvaluator(); int rowNdx = 0; int maxNumberOfColumns = 0; CellStyle boldCellStyle = null; boolean isFirstHeader = true; for (PafExcelRow paceRow : paceRowList ) { if ( paceRow != null ) { //if row is header and need to exclude, continue to next row if ( paceRow.isHeader() && input.isExcludeHeaderRows()) { continue; } if ( paceRow.numberOfColumns() > maxNumberOfColumns) { maxNumberOfColumns = paceRow.numberOfColumns(); } for (int i = 0; i < paceRow.numberOfCompressedRows(); i++ ) { Row row = sheet.createRow(rowNdx++); if ( isFirstHeader && paceRow.isHeader() ) { //freeze 1st header row sheet.createFreezePane(0, 1); isFirstHeader = false; } for ( Integer index : paceRow.getRowItemOrderedIndexes() ) { List<PafExcelValueObject> rowItemList = paceRow.getPafExcelValueObjectListMap().get(index); //Cell cell = row.createCell(rowItemNdx++);; Cell cell = row.createCell(index); if ( i < rowItemList.size()) { PafExcelValueObject rowItem = rowItemList.get(i); if ( rowItem == null ) { cell.setCellType(Cell.CELL_TYPE_BLANK); } else { //if header, bold item if ( paceRow.isHeader() || rowItem.isBoldItem() ) { if ( boldCellStyle == null ) { boldCellStyle = getBoldCellStyle(wb); //turn word wrap on boldCellStyle.setWrapText(true); } cell.setCellStyle(boldCellStyle); } switch ( rowItem.getType() ) { case Blank: cell.setCellType(Cell.CELL_TYPE_BLANK); break; case Boolean: if ( rowItem.getBoolean() != null ) { Boolean boolValue = rowItem.getBoolean(); if ( input.isExcludeDefaultValuesOnWrite()) { //if default, clear value if ( boolValue.equals(Boolean.FALSE)) { boolValue = null; } } //true or false if ( boolValue != null ) { cell.setCellType(Cell.CELL_TYPE_BOOLEAN); cell.setCellValue(boolValue); } } break; case Double: if ( rowItem.getDouble() != null ) { Double doubleVal = rowItem.getDouble(); if ( doubleVal != null && input.isExcludeDefaultValuesOnWrite()) { if ( doubleVal == 0 ) { doubleVal = null; } } if ( doubleVal != null ) { cell.setCellType(Cell.CELL_TYPE_NUMERIC); cell.setCellValue(doubleVal); } } break; case Integer: if ( rowItem.getInteger() != null ) { Integer intValue = rowItem.getInteger(); if ( intValue != null && input.isExcludeDefaultValuesOnWrite()) { if ( intValue == 0 ) { intValue = null; } } if ( intValue != null ) { cell.setCellType(Cell.CELL_TYPE_NUMERIC); cell.setCellValue(intValue); } } break; case Formula: cell.setCellType(Cell.CELL_TYPE_FORMULA); String formula = rowItem.getFormula(); String formulas[] = formula.split(" & \" \\| \" & "); if( formulas.length >= 1 ) { //there is only 1 formula String tokens[] = formula.split("!"); String sheetName = tokens[0]; if( ! sheetName.matches("[a-zA-Z0123456789]*") ) { formula = "'" + sheetName + "'!" + tokens[1]; } } if ( formulas.length > 1 ) { // more than 1 formula concatenated String tmp = ""; for( int j=1;j<formulas.length;j++ ) { tmp = formulas[j]; String tokens[] = formulas[j].split("!"); String sheetName = tokens[0]; if( ! sheetName.matches("[a-zA-Z0123456789]*") ) { tmp = "'" + sheetName + "'!" + tokens[1]; } formula = formula + " & \" | \" & " + tmp; } } cell.setCellFormula(formula); evaluator.evaluateFormulaCell(cell); break; case String: cell.setCellType(Cell.CELL_TYPE_STRING); cell.setCellValue(rowItem.getString()); break; } } } else { cell.setCellType(Cell.CELL_TYPE_BLANK); } } } } } //add end of sheet ident if ( input.getEndOfSheetIdnt() != null ) { int lastSheetRowNumber = sheet.getLastRowNum() + 1; Row lastRow = sheet.createRow(lastSheetRowNumber); Cell eosCell = lastRow.createCell(0, Cell.CELL_TYPE_STRING); eosCell.setCellValue(input.getEndOfSheetIdnt()); //set bold style eosCell.setCellStyle(getBoldCellStyle(wb)); } //auto size columns? if ( input.isAutoSizeColumns() ) { for (int i = 0; i <= maxNumberOfColumns; i++) { sheet.autoSizeColumn((short) i); } } } logger.info("\tSaving sheet: " + input.getSheetId() ); wb.setActiveSheet(wb.getSheetIndex(sheet.getSheetName())); //if write to filesystem, close workbook if ( input.isAutoWriteToFileSystem() ) { writeWorkbook(wb, input.getFullWorkbookName()); } }
public static void writeExcelSheet(PafExcelInput input, List<PafExcelRow> paceRowList) throws PafException { if ( input == null ) { throw new IllegalArgumentException("Pace Excel Input cannot be null"); } else if ( input.getFullWorkbookName() == null && input.getWorkbook() == null ) { throw new IllegalArgumentException("A Full workbook name and a workbook haven't not been provided. One is required."); } Workbook wb = null; if ( input.getWorkbook() != null ) { wb = input.getWorkbook(); } else { wb = readWorkbook(input.getFullWorkbookName()); } if ( wb == null ) { throw new PafException("Couldn't get a reference to the workbook " + input.getFullWorkbookName() , PafErrSeverity.Error); } Sheet sheet = wb.getSheet(input.getSheetId()); if ( sheet == null ) { sheet = wb.createSheet(input.getSheetId()); } else { sheet = clearSheetValues(sheet); } if ( paceRowList != null ) { FormulaEvaluator evaluator = wb.getCreationHelper().createFormulaEvaluator(); int rowNdx = 0; int maxNumberOfColumns = 0; CellStyle boldCellStyle = null; boolean isFirstHeader = true; for (PafExcelRow paceRow : paceRowList ) { if ( paceRow != null ) { //if row is header and need to exclude, continue to next row if ( paceRow.isHeader() && input.isExcludeHeaderRows()) { continue; } if ( paceRow.numberOfColumns() > maxNumberOfColumns) { maxNumberOfColumns = paceRow.numberOfColumns(); } for (int i = 0; i < paceRow.numberOfCompressedRows(); i++ ) { Row row = sheet.createRow(rowNdx++); if ( isFirstHeader && paceRow.isHeader() ) { //freeze 1st header row sheet.createFreezePane(0, 1); isFirstHeader = false; } for ( Integer index : paceRow.getRowItemOrderedIndexes() ) { List<PafExcelValueObject> rowItemList = paceRow.getPafExcelValueObjectListMap().get(index); //Cell cell = row.createCell(rowItemNdx++);; Cell cell = row.createCell(index); if ( i < rowItemList.size()) { PafExcelValueObject rowItem = rowItemList.get(i); if ( rowItem == null ) { cell.setCellType(Cell.CELL_TYPE_BLANK); } else { //if header, bold item if ( paceRow.isHeader() || rowItem.isBoldItem() ) { if ( boldCellStyle == null ) { boldCellStyle = getBoldCellStyle(wb); //turn word wrap on boldCellStyle.setWrapText(true); } cell.setCellStyle(boldCellStyle); } switch ( rowItem.getType() ) { case Blank: cell.setCellType(Cell.CELL_TYPE_BLANK); break; case Boolean: if ( rowItem.getBoolean() != null ) { Boolean boolValue = rowItem.getBoolean(); if ( input.isExcludeDefaultValuesOnWrite()) { //if default, clear value if ( boolValue.equals(Boolean.FALSE)) { boolValue = null; } } //true or false if ( boolValue != null ) { cell.setCellType(Cell.CELL_TYPE_BOOLEAN); cell.setCellValue(boolValue); } } break; case Double: if ( rowItem.getDouble() != null ) { Double doubleVal = rowItem.getDouble(); if ( doubleVal != null && input.isExcludeDefaultValuesOnWrite()) { if ( doubleVal == 0 ) { doubleVal = null; } } if ( doubleVal != null ) { cell.setCellType(Cell.CELL_TYPE_NUMERIC); cell.setCellValue(doubleVal); } } break; case Integer: if ( rowItem.getInteger() != null ) { Integer intValue = rowItem.getInteger(); if ( intValue != null && input.isExcludeDefaultValuesOnWrite()) { if ( intValue == 0 ) { intValue = null; } } if ( intValue != null ) { cell.setCellType(Cell.CELL_TYPE_NUMERIC); cell.setCellValue(intValue); } } break; case Formula: cell.setCellType(Cell.CELL_TYPE_FORMULA); String formula = rowItem.getFormula(); String formulas[] = formula.split(" & \" \\| \" & "); if( formulas.length >= 1 ) { //there is only 1 formula formula = formulas[0]; String tokens[] = formula.split("!"); String sheetName = tokens[0]; if( ! sheetName.matches("[a-zA-Z0123456789]*") ) { formula = "'" + sheetName + "'!" + tokens[1]; } } if ( formulas.length > 1 ) { // more than 1 formula concatenated String tmp = ""; for( int j=1;j<formulas.length;j++ ) { tmp = formulas[j]; String tokens[] = formulas[j].split("!"); String sheetName = tokens[0]; if( ! sheetName.matches("[a-zA-Z0123456789]*") ) { tmp = "'" + sheetName + "'!" + tokens[1]; } formula = formula + " & \" | \" & " + tmp; } } cell.setCellFormula(formula); evaluator.evaluateFormulaCell(cell); break; case String: cell.setCellType(Cell.CELL_TYPE_STRING); cell.setCellValue(rowItem.getString()); break; } } } else { cell.setCellType(Cell.CELL_TYPE_BLANK); } } } } } //add end of sheet ident if ( input.getEndOfSheetIdnt() != null ) { int lastSheetRowNumber = sheet.getLastRowNum() + 1; Row lastRow = sheet.createRow(lastSheetRowNumber); Cell eosCell = lastRow.createCell(0, Cell.CELL_TYPE_STRING); eosCell.setCellValue(input.getEndOfSheetIdnt()); //set bold style eosCell.setCellStyle(getBoldCellStyle(wb)); } //auto size columns? if ( input.isAutoSizeColumns() ) { for (int i = 0; i <= maxNumberOfColumns; i++) { sheet.autoSizeColumn((short) i); } } } logger.info("\tSaving sheet: " + input.getSheetId() ); wb.setActiveSheet(wb.getSheetIndex(sheet.getSheetName())); //if write to filesystem, close workbook if ( input.isAutoWriteToFileSystem() ) { writeWorkbook(wb, input.getFullWorkbookName()); } }
diff --git a/SampleWebApplication/src/edu/gac/mcs270/ui/client/SampleWebApplication.java b/SampleWebApplication/src/edu/gac/mcs270/ui/client/SampleWebApplication.java index 880b20c..809fac0 100644 --- a/SampleWebApplication/src/edu/gac/mcs270/ui/client/SampleWebApplication.java +++ b/SampleWebApplication/src/edu/gac/mcs270/ui/client/SampleWebApplication.java @@ -1,152 +1,152 @@ package edu.gac.mcs270.ui.client; import edu.gac.mcs270.ui.shared.FieldVerifier; import com.google.gwt.core.client.EntryPoint; import com.google.gwt.core.client.GWT; import com.google.gwt.event.dom.client.ClickEvent; import com.google.gwt.event.dom.client.ClickHandler; import com.google.gwt.event.dom.client.KeyCodes; import com.google.gwt.event.dom.client.KeyUpEvent; import com.google.gwt.event.dom.client.KeyUpHandler; import com.google.gwt.user.client.rpc.AsyncCallback; import com.google.gwt.user.client.ui.Button; import com.google.gwt.user.client.ui.DialogBox; import com.google.gwt.user.client.ui.HTML; import com.google.gwt.user.client.ui.Label; import com.google.gwt.user.client.ui.RootPanel; import com.google.gwt.user.client.ui.TextBox; import com.google.gwt.user.client.ui.VerticalPanel; /** * Entry point classes define <code>onModuleLoad()</code>. */ public class SampleWebApplication implements EntryPoint { /** * The message displayed to the user when the server cannot be reached or * returns an error. */ private static final String SERVER_ERROR = "An error occurred while " + "attempting to contact the server. Please check your network " + "connection and try again."; /** * Create a remote service proxy to talk to the server-side Greeting service. */ private final GreetingServiceAsync greetingService = GWT .create(GreetingService.class); /** * This is the entry point method. */ public void onModuleLoad() { final Button sendButton = new Button("Send"); final TextBox nameField = new TextBox(); nameField.setText("GWT User"); final Label errorLabel = new Label(); // We can add style names to widgets sendButton.addStyleName("sendButton"); // Add the nameField and sendButton to the RootPanel // Use RootPanel.get() to get the entire body element RootPanel.get("nameFieldContainer").add(nameField); RootPanel.get("sendButtonContainer").add(sendButton); RootPanel.get("errorLabelContainer").add(errorLabel); // Focus the cursor on the name field when the app loads nameField.setFocus(true); nameField.selectAll(); // Create the popup dialog box final DialogBox dialogBox = new DialogBox(); dialogBox.setText("Remote Procedure Call"); dialogBox.setAnimationEnabled(true); final Button closeButton = new Button("Close"); // We can set the id of a widget by accessing its Element closeButton.getElement().setId("closeButton"); final Label textToServerLabel = new Label(); final HTML serverResponseLabel = new HTML(); VerticalPanel dialogVPanel = new VerticalPanel(); dialogVPanel.addStyleName("dialogVPanel"); dialogVPanel.add(new HTML("<b>Sending name to the server:</b>")); dialogVPanel.add(textToServerLabel); dialogVPanel.add(new HTML("<br><b>Server replies:</b>")); dialogVPanel.add(serverResponseLabel); dialogVPanel.setHorizontalAlignment(VerticalPanel.ALIGN_RIGHT); dialogVPanel.add(closeButton); dialogBox.setWidget(dialogVPanel); // Add a handler to close the DialogBox closeButton.addClickHandler(new ClickHandler() { public void onClick(ClickEvent event) { dialogBox.hide(); sendButton.setEnabled(true); sendButton.setFocus(true); } }); // Create a handler for the sendButton and nameField class MyHandler implements ClickHandler, KeyUpHandler { /** * Fired when the user clicks on the sendButton. */ public void onClick(ClickEvent event) { sendNameToServer(); } /** * Fired when the user types in the nameField. */ public void onKeyUp(KeyUpEvent event) { if (event.getNativeKeyCode() == KeyCodes.KEY_ENTER) { sendNameToServer(); } } /** * Send the name from the nameField to the server and wait for a response. */ private void sendNameToServer() { // First, we validate the input. errorLabel.setText(""); String textToServer = nameField.getText(); if (!FieldVerifier.isValidName(textToServer)) { errorLabel.setText("Please enter at least four characters"); return; } // Then, we send the input to the server. sendButton.setEnabled(false); textToServerLabel.setText(textToServer); serverResponseLabel.setText(""); greetingService.greetServer(textToServer, new AsyncCallback<String>() { public void onFailure(Throwable caught) { // Show the RPC error message to the user dialogBox .setText("Remote Procedure Call - Failure"); serverResponseLabel - .addStyleName("serverResponseLabelError"); + .addStyleName("error"); serverResponseLabel.setHTML(SERVER_ERROR); dialogBox.center(); closeButton.setFocus(true); } public void onSuccess(String result) { dialogBox.setText("Remote Procedure Call"); serverResponseLabel - .removeStyleName("serverResponseLabelError"); + .removeStyleName("error"); serverResponseLabel.setHTML(result); dialogBox.center(); closeButton.setFocus(true); } }); } } // Add a handler to send the name to the server MyHandler handler = new MyHandler(); sendButton.addClickHandler(handler); nameField.addKeyUpHandler(handler); } }
false
true
public void onModuleLoad() { final Button sendButton = new Button("Send"); final TextBox nameField = new TextBox(); nameField.setText("GWT User"); final Label errorLabel = new Label(); // We can add style names to widgets sendButton.addStyleName("sendButton"); // Add the nameField and sendButton to the RootPanel // Use RootPanel.get() to get the entire body element RootPanel.get("nameFieldContainer").add(nameField); RootPanel.get("sendButtonContainer").add(sendButton); RootPanel.get("errorLabelContainer").add(errorLabel); // Focus the cursor on the name field when the app loads nameField.setFocus(true); nameField.selectAll(); // Create the popup dialog box final DialogBox dialogBox = new DialogBox(); dialogBox.setText("Remote Procedure Call"); dialogBox.setAnimationEnabled(true); final Button closeButton = new Button("Close"); // We can set the id of a widget by accessing its Element closeButton.getElement().setId("closeButton"); final Label textToServerLabel = new Label(); final HTML serverResponseLabel = new HTML(); VerticalPanel dialogVPanel = new VerticalPanel(); dialogVPanel.addStyleName("dialogVPanel"); dialogVPanel.add(new HTML("<b>Sending name to the server:</b>")); dialogVPanel.add(textToServerLabel); dialogVPanel.add(new HTML("<br><b>Server replies:</b>")); dialogVPanel.add(serverResponseLabel); dialogVPanel.setHorizontalAlignment(VerticalPanel.ALIGN_RIGHT); dialogVPanel.add(closeButton); dialogBox.setWidget(dialogVPanel); // Add a handler to close the DialogBox closeButton.addClickHandler(new ClickHandler() { public void onClick(ClickEvent event) { dialogBox.hide(); sendButton.setEnabled(true); sendButton.setFocus(true); } }); // Create a handler for the sendButton and nameField class MyHandler implements ClickHandler, KeyUpHandler { /** * Fired when the user clicks on the sendButton. */ public void onClick(ClickEvent event) { sendNameToServer(); } /** * Fired when the user types in the nameField. */ public void onKeyUp(KeyUpEvent event) { if (event.getNativeKeyCode() == KeyCodes.KEY_ENTER) { sendNameToServer(); } } /** * Send the name from the nameField to the server and wait for a response. */ private void sendNameToServer() { // First, we validate the input. errorLabel.setText(""); String textToServer = nameField.getText(); if (!FieldVerifier.isValidName(textToServer)) { errorLabel.setText("Please enter at least four characters"); return; } // Then, we send the input to the server. sendButton.setEnabled(false); textToServerLabel.setText(textToServer); serverResponseLabel.setText(""); greetingService.greetServer(textToServer, new AsyncCallback<String>() { public void onFailure(Throwable caught) { // Show the RPC error message to the user dialogBox .setText("Remote Procedure Call - Failure"); serverResponseLabel .addStyleName("serverResponseLabelError"); serverResponseLabel.setHTML(SERVER_ERROR); dialogBox.center(); closeButton.setFocus(true); } public void onSuccess(String result) { dialogBox.setText("Remote Procedure Call"); serverResponseLabel .removeStyleName("serverResponseLabelError"); serverResponseLabel.setHTML(result); dialogBox.center(); closeButton.setFocus(true); } }); } } // Add a handler to send the name to the server MyHandler handler = new MyHandler(); sendButton.addClickHandler(handler); nameField.addKeyUpHandler(handler); }
public void onModuleLoad() { final Button sendButton = new Button("Send"); final TextBox nameField = new TextBox(); nameField.setText("GWT User"); final Label errorLabel = new Label(); // We can add style names to widgets sendButton.addStyleName("sendButton"); // Add the nameField and sendButton to the RootPanel // Use RootPanel.get() to get the entire body element RootPanel.get("nameFieldContainer").add(nameField); RootPanel.get("sendButtonContainer").add(sendButton); RootPanel.get("errorLabelContainer").add(errorLabel); // Focus the cursor on the name field when the app loads nameField.setFocus(true); nameField.selectAll(); // Create the popup dialog box final DialogBox dialogBox = new DialogBox(); dialogBox.setText("Remote Procedure Call"); dialogBox.setAnimationEnabled(true); final Button closeButton = new Button("Close"); // We can set the id of a widget by accessing its Element closeButton.getElement().setId("closeButton"); final Label textToServerLabel = new Label(); final HTML serverResponseLabel = new HTML(); VerticalPanel dialogVPanel = new VerticalPanel(); dialogVPanel.addStyleName("dialogVPanel"); dialogVPanel.add(new HTML("<b>Sending name to the server:</b>")); dialogVPanel.add(textToServerLabel); dialogVPanel.add(new HTML("<br><b>Server replies:</b>")); dialogVPanel.add(serverResponseLabel); dialogVPanel.setHorizontalAlignment(VerticalPanel.ALIGN_RIGHT); dialogVPanel.add(closeButton); dialogBox.setWidget(dialogVPanel); // Add a handler to close the DialogBox closeButton.addClickHandler(new ClickHandler() { public void onClick(ClickEvent event) { dialogBox.hide(); sendButton.setEnabled(true); sendButton.setFocus(true); } }); // Create a handler for the sendButton and nameField class MyHandler implements ClickHandler, KeyUpHandler { /** * Fired when the user clicks on the sendButton. */ public void onClick(ClickEvent event) { sendNameToServer(); } /** * Fired when the user types in the nameField. */ public void onKeyUp(KeyUpEvent event) { if (event.getNativeKeyCode() == KeyCodes.KEY_ENTER) { sendNameToServer(); } } /** * Send the name from the nameField to the server and wait for a response. */ private void sendNameToServer() { // First, we validate the input. errorLabel.setText(""); String textToServer = nameField.getText(); if (!FieldVerifier.isValidName(textToServer)) { errorLabel.setText("Please enter at least four characters"); return; } // Then, we send the input to the server. sendButton.setEnabled(false); textToServerLabel.setText(textToServer); serverResponseLabel.setText(""); greetingService.greetServer(textToServer, new AsyncCallback<String>() { public void onFailure(Throwable caught) { // Show the RPC error message to the user dialogBox .setText("Remote Procedure Call - Failure"); serverResponseLabel .addStyleName("error"); serverResponseLabel.setHTML(SERVER_ERROR); dialogBox.center(); closeButton.setFocus(true); } public void onSuccess(String result) { dialogBox.setText("Remote Procedure Call"); serverResponseLabel .removeStyleName("error"); serverResponseLabel.setHTML(result); dialogBox.center(); closeButton.setFocus(true); } }); } } // Add a handler to send the name to the server MyHandler handler = new MyHandler(); sendButton.addClickHandler(handler); nameField.addKeyUpHandler(handler); }
diff --git a/src/edu/sc/seis/sod/NetworkArm.java b/src/edu/sc/seis/sod/NetworkArm.java index 0a0d392b4..65ce6dee6 100644 --- a/src/edu/sc/seis/sod/NetworkArm.java +++ b/src/edu/sc/seis/sod/NetworkArm.java @@ -1,818 +1,820 @@ package edu.sc.seis.sod; import java.sql.SQLException; import java.util.ArrayList; import java.util.Collections; import java.util.HashMap; import java.util.HashSet; import java.util.Iterator; import java.util.LinkedList; import java.util.List; import java.util.Map; import java.util.Queue; import org.apache.log4j.Logger; import org.hibernate.LockMode; import org.hibernate.NonUniqueObjectException; import org.omg.CORBA.BAD_PARAM; import org.w3c.dom.Element; import org.w3c.dom.Node; import org.w3c.dom.NodeList; import edu.iris.Fissures.IfNetwork.Channel; import edu.iris.Fissures.IfNetwork.NetworkAccess; import edu.iris.Fissures.IfNetwork.NetworkAttr; import edu.iris.Fissures.IfNetwork.NetworkDCOperations; import edu.iris.Fissures.IfNetwork.NetworkId; import edu.iris.Fissures.IfNetwork.NetworkNotFound; import edu.iris.Fissures.IfNetwork.Station; import edu.iris.Fissures.IfNetwork.VirtualNetworkHelper; import edu.iris.Fissures.model.MicroSecondDate; import edu.iris.Fissures.model.TimeInterval; import edu.iris.Fissures.network.ChannelIdUtil; import edu.iris.Fissures.network.ChannelImpl; import edu.iris.Fissures.network.NetworkAttrImpl; import edu.iris.Fissures.network.NetworkIdUtil; import edu.iris.Fissures.network.StationIdUtil; import edu.iris.Fissures.network.StationImpl; import edu.sc.seis.fissuresUtil.cache.CacheNetworkAccess; import edu.sc.seis.fissuresUtil.cache.DBCacheNetworkAccess; import edu.sc.seis.fissuresUtil.cache.ProxyNetworkDC; import edu.sc.seis.fissuresUtil.cache.WorkerThreadPool; import edu.sc.seis.fissuresUtil.chooser.ClockUtil; import edu.sc.seis.fissuresUtil.database.NotFound; import edu.sc.seis.fissuresUtil.display.MicroSecondTimeRange; import edu.sc.seis.fissuresUtil.exceptionHandler.GlobalExceptionHandler; import edu.sc.seis.fissuresUtil.hibernate.ChannelGroup; import edu.sc.seis.fissuresUtil.hibernate.NetworkDB; import edu.sc.seis.sod.hibernate.SodDB; import edu.sc.seis.sod.source.event.EventSource; import edu.sc.seis.sod.source.network.NetworkFinder; import edu.sc.seis.sod.status.StringTree; import edu.sc.seis.sod.status.networkArm.NetworkMonitor; import edu.sc.seis.sod.subsetter.channel.ChannelEffectiveTimeOverlap; import edu.sc.seis.sod.subsetter.channel.ChannelSubsetter; import edu.sc.seis.sod.subsetter.channel.PassChannel; import edu.sc.seis.sod.subsetter.network.NetworkCode; import edu.sc.seis.sod.subsetter.network.NetworkEffectiveTimeOverlap; import edu.sc.seis.sod.subsetter.network.NetworkOR; import edu.sc.seis.sod.subsetter.network.NetworkSubsetter; import edu.sc.seis.sod.subsetter.network.PassNetwork; import edu.sc.seis.sod.subsetter.station.PassStation; import edu.sc.seis.sod.subsetter.station.StationEffectiveTimeOverlap; import edu.sc.seis.sod.subsetter.station.StationSubsetter; public class NetworkArm implements Arm { public NetworkArm(Element config) throws SQLException, ConfigurationException { processConfig(config); } public void run() { try { getSuccessfulNetworks(); } catch(Throwable e) { Start.armFailure(this, e); armFinished = true; } } public boolean isActive() { return !armFinished; } public String getName() { return "NetworkArm"; } public CacheNetworkAccess getNetwork(NetworkId network_id) throws NetworkNotFound { CacheNetworkAccess[] netDbs = getSuccessfulNetworks(); MicroSecondDate beginTime = new MicroSecondDate(network_id.begin_time); String netCode = network_id.network_code; for(int i = 0; i < netDbs.length; i++) { NetworkAttr attr = netDbs[i].get_attributes(); if(netCode.equals(attr.get_code()) && new MicroSecondTimeRange(attr.getEffectiveTime()).contains(beginTime)) { return netDbs[i]; } } throw new NetworkNotFound("No network for id: " + NetworkIdUtil.toString(network_id)); } private void processConfig(Element config) throws ConfigurationException { NodeList children = config.getChildNodes(); for(int i = 0; i < children.getLength(); i++) { Node node = children.item(i); if(node instanceof Element) { loadConfigElement(SodUtil.load((Element)node, PACKAGES)); } // end of if (node instanceof Element) } // end of for (int i=0; i<children.getSize(); i++) configureEffectiveTimeCheckers(); } private void configureEffectiveTimeCheckers() { EventArm arm = Start.getEventArm(); if(arm != null && !Start.getRunProps().allowDeadNets()) { EventSource[] sources = arm.getSources(); MicroSecondTimeRange fullTime = sources[0].getEventTimeRange(); for(int i = 1; i < sources.length; i++) { fullTime = new MicroSecondTimeRange(fullTime, sources[i].getEventTimeRange()); } edu.iris.Fissures.TimeRange eventQueryTimes = fullTime.getFissuresTimeRange(); netEffectiveSubsetter = new NetworkEffectiveTimeOverlap(eventQueryTimes); staEffectiveSubsetter = new StationEffectiveTimeOverlap(eventQueryTimes); chanEffectiveSubsetter = new ChannelEffectiveTimeOverlap(eventQueryTimes); } else { logger.debug("No implicit effective time constraint"); } } public static final String[] PACKAGES = {"networkArm", "channel", "site", "station", "network"}; private void loadConfigElement(Object sodElement) throws ConfigurationException { if(sodElement instanceof NetworkFinder) { finder = (NetworkFinder)sodElement; } else if(sodElement instanceof NetworkSubsetter) { attrSubsetter = (NetworkSubsetter)sodElement; } else if(sodElement instanceof StationSubsetter) { stationSubsetter = (StationSubsetter)sodElement; } else if(sodElement instanceof ChannelSubsetter) { chanSubsetters.add(sodElement); } else { throw new ConfigurationException("Unknown configuration object: " + sodElement); } } public void add(NetworkMonitor monitor) { synchronized(statusMonitors) { statusMonitors.add(monitor); } } public ProxyNetworkDC getNetworkDC() { return finder.getNetworkDC(); } public TimeInterval getRefreshInterval() { return finder.getRefreshInterval(); } /** * returns an array of SuccessfulNetworks. if the refreshInterval is valid * it gets the networks from the database(may be embedded or external). if * not it gets the networks again from the network server specified in the * networkFinder. After obtaining the Networks if processes them using the * NetworkSubsetter and returns the successful networks as an array of * NetworkDbObjects. * * @throws NetworkNotFound */ public CacheNetworkAccess[] getSuccessfulNetworks() throws NetworkNotFound { synchronized(netGetSync) { SodDB sodDb = SodDB.getSingleton(); if(lastQueryTime == null) { // try from db lastQueryTime = sodDb.getQueryTime(finder.getName(), finder.getDNS()); } if(lastQueryTime == null) { // still null, must be first time lastQueryTime = new QueryTime(finder.getName(), finder.getDNS(), ClockUtil.now().getTimestamp()); sodDb.putQueryTime(lastQueryTime); } else if(!lastQueryTime.needsRefresh(finder.getRefreshInterval())) { if(cacheNets == null) { cacheNets = getNetworkDB().getAllNets(getNetworkDC()); for(int i = 0; i < cacheNets.length; i++) { // this is for the side effect of creating // networkInfoTemplate stuff // avoids a null ptr later change(cacheNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); } } return cacheNets; } statusChanged("Getting networks"); logger.info("Getting networks"); ArrayList successes = new ArrayList(); CacheNetworkAccess[] allNets; NetworkDCOperations netDC = finder.getNetworkDC(); synchronized(netDC) { String[] constrainingCodes = getConstrainingNetworkCodes(attrSubsetter); if(constrainingCodes.length > 0) { edu.iris.Fissures.IfNetwork.NetworkFinder netFinder = netDC.a_finder(); List<CacheNetworkAccess> constrainedNets = new ArrayList<CacheNetworkAccess>(constrainingCodes.length); for(int i = 0; i < constrainingCodes.length; i++) { CacheNetworkAccess[] found; // this is a bit of a hack as names could be one or two // characters, but works with _US-TA style // virtual networks at the DMC if(constrainingCodes[i].length() > 2) { found = (CacheNetworkAccess[])netFinder.retrieve_by_name(constrainingCodes[i]); } else { found = (CacheNetworkAccess[])netFinder.retrieve_by_code(constrainingCodes[i]); } for(int j = 0; j < found.length; j++) { constrainedNets.add(found[j]); } } allNets = (CacheNetworkAccess[])constrainedNets.toArray(new CacheNetworkAccess[0]); } else { NetworkAccess[] tmpNets = netDC.a_finder().retrieve_all(); ArrayList goodNets = new ArrayList(); for(int i = 0; i < tmpNets.length; i++) { try { VirtualNetworkHelper.narrow(tmpNets[i]); // Ignore any virtual nets returned here logger.debug("ignoring virtual network " + tmpNets[i].get_attributes().get_code()); continue; } catch(BAD_PARAM bp) { // Must be a concrete, keep it goodNets.add(tmpNets[i]); } } allNets = (CacheNetworkAccess[])goodNets.toArray(new CacheNetworkAccess[0]); } } logger.info("Found " + allNets.length + " networks"); NetworkPusher lastPusher = null; for(int i = 0; i < allNets.length; i++) { allNets[i] = new DBCacheNetworkAccess(allNets[i]); + NetworkAttrImpl attr = null; try { - NetworkAttrImpl attr = (NetworkAttrImpl)allNets[i].get_attributes(); + attr = (NetworkAttrImpl)allNets[i].get_attributes(); if(netEffectiveSubsetter.accept(attr).isSuccess()) { if(attrSubsetter.accept(attr).isSuccess()) { NetworkDB ndb = getNetworkDB(); int dbid = ndb.put(attr); NetworkDB.commit(); logger.info("store network: " + attr.getDbid() + " " + dbid); successes.add(allNets[i]); change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); if(Start.getWaveformArm() == null && (! stationSubsetter.getClass().equals(PassStation.class) || chanSubsetters.size() != 0 )) { // only do netpushers if there are more subsetters downstream // and the waveform arm does not exist, otherwise there is no point // or we can let the waveform processors handle via EventNetworkPair if (lastPusher == null) { lastPusher = new NetworkPusher(allNets[i].get_attributes()); netPopulators.invokeLater(lastPusher); } else { lastPusher.addNetwork(allNets[i].get_attributes()); } logger.debug("running network"); //lastPusher.runNetwork(allNets[i].get_attributes()); } } else { change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(NetworkIdUtil.toString(allNets[i].get_attributes() .get_id()) + " was rejected."); } } else { change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(NetworkIdUtil.toString(allNets[i].get_attributes() .get_id()) + " was rejected because it wasn't active during the time range of requested events"); } } catch(Throwable th) { GlobalExceptionHandler.handle("Got an exception while trying getSuccessfulNetworks for the " + i - + "th networkAccess", + + "th networkAccess (" + +(attr==null?"null":NetworkIdUtil.toStringNoDates(((NetworkAttrImpl)allNets[i].get_attributes()))), th); } } if(lastPusher != null) { lastPusher.setLastPusher(); } else { // no pushers if(allNets.length == 0) { logger.warn("Found no networks. Make sure the network codes you entered are valid"); } finish(); } // Set the time of the last check to now lastQueryTime.setTime(ClockUtil.now().getTimestamp()); cacheNets = new CacheNetworkAccess[successes.size()]; successes.toArray(cacheNets); logger.info(cacheNets.length + " networks passed"); statusChanged("Waiting for a request"); return cacheNets; } } /** * Given a network subsetter, return a string array consisting of all the * network codes this subsetter accepts. If it doesn't constrain network * codes, an empty array is returned. */ public static String[] getConstrainingNetworkCodes(NetworkSubsetter ns) { if(ns == null) { return new String[0]; } else if(ns instanceof NetworkOR) { NetworkSubsetter[] kids = ((NetworkOR)ns).getSubsetters(); String[] codes = new String[kids.length]; for(int i = 0; i < kids.length; i++) { if(kids[i] instanceof NetworkCode) { codes[i] = ((NetworkCode)kids[i]).getCode(); } else { return new String[0]; } } return codes; } else if(ns instanceof NetworkCode) { return new String[] {((NetworkCode)ns).getCode()}; } else { return new String[0]; } } /** * retrieves all the stations, sites and channels for a network to populate * the db and cache */ private class NetworkPusher implements Runnable { public NetworkPusher(NetworkAttrImpl net) { netList.add(net); } public void run() { logger.debug("Start NetworkPusher"); NetworkAttrImpl n = netList.poll(); while ( ! lastPusher || n != null) { if (n != null) { runNetwork(n); } else { try { Thread.sleep(100); } catch(InterruptedException e) {} } n = netList.poll(); } logger.debug("Finish NetworkPusher"); synchronized(this) { pusherFinished = true; finishArm(); } } void addNetwork(NetworkAttrImpl net) { logger.debug("Add to NetworkPusher "+net.get_code()); netList.offer(net); } protected void runNetwork(NetworkAttrImpl net) { if(!Start.isArmFailure()) { logger.info("NetworkPusher Starting work on " + net.get_code()); // new thread, so need to attach net attr instance NetworkDB ndb = getNetworkDB(); try { NetworkDB.getSession().lock(net, LockMode.NONE); } catch(NonUniqueObjectException e) { logger.error("Try to lock net=" + NetworkIdUtil.toString(net) + " dbid=" + ((NetworkAttrImpl)net).getDbid(), e); throw e; } StationImpl[] staDbs = getSuccessfulStations(net); if(!(Start.getWaveformArm() == null && chanSubsetters.size() == 0)) { // only get channels if there are subsetters or a // waveform arm for(int j = 0; j < staDbs.length; j++) { // commit for each station synchronized(NetworkArm.this) { NetworkDB.getSession().lock(net, LockMode.NONE); List<ChannelImpl> chans = getSuccessfulChannels(staDbs[j]); } } } else { logger.info("Not getting channels as no subsetters or waveform arm"); } // make sure everything is cleaned up in hibernate session NetworkDB.commit(); } } private void finishArm() { if(lastPusher && pusherFinished) { finish(); } } public synchronized void setLastPusher() { lastPusher = true; finishArm(); } private boolean lastPusher = false, pusherFinished = false; private Queue<NetworkAttrImpl> netList = new LinkedList<NetworkAttrImpl>(); } private void finish() { armFinished = true; logger.info("Network arm finished."); for(Iterator iter = armListeners.iterator(); iter.hasNext();) { ArmListener listener = (ArmListener)iter.next(); listener.finished(this); } } public void add(ArmListener listener) { armListeners.add(listener); if(armFinished == true) { listener.finished(this); } } /** * @return stations for the given network object that pass this arm's * station subsetter */ public StationImpl[] getSuccessfulStations(CacheNetworkAccess net) { return getSuccessfulStations(net.get_attributes()); } public StationImpl[] getSuccessfulStations(NetworkAttrImpl net) { String netCode = net.get_code(); logger.debug("getSuccessfulStations"); if(allStationFailureNets.contains(NetworkIdUtil.toStringNoDates(net))) { return new StationImpl[0]; } synchronized(this) { // try db List<StationImpl> sta = getNetworkDB().getStationForNet((NetworkAttrImpl)net); if(sta.size() != 0) { logger.debug("getSuccessfulStations " + netCode + " - from db " + sta.size()); return sta.toArray(new StationImpl[0]); } // really no dice, go to server statusChanged("Getting stations for " + net.getName()); ArrayList<Station> arrayList = new ArrayList<Station>(); try { CacheNetworkAccess netAccess = CacheNetworkAccess.create((NetworkAttrImpl)net, CommonAccess.getNameService()); Station[] stations = netAccess.retrieve_stations(); for(int i = 0; i < stations.length; i++) { logger.debug("Station in NetworkArm: " + StationIdUtil.toString(stations[i])); } for(int i = 0; i < stations.length; i++) { // hibernate gets angry if the network isn't the same object // as the one already in the thread's session stations[i].setNetworkAttr(net); StringTree effResult = staEffectiveSubsetter.accept(stations[i], netAccess); if(effResult.isSuccess()) { StringTree staResult = stationSubsetter.accept(stations[i], netAccess); if(staResult.isSuccess()) { int dbid = getNetworkDB().put((StationImpl)stations[i]); logger.info("Store " + stations[i].get_code() + " as " + dbid + " in " + getNetworkDB()); arrayList.add(stations[i]); change(stations[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); } else { change(stations[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(StationIdUtil.toString(stations[i].get_id()) + " was rejected: " + staResult); } } else { change(stations[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(StationIdUtil.toString(stations[i].get_id()) + " was rejected based on its effective time not matching the range of requested events: " + effResult); } } NetworkDB.commit(); } catch(Exception e) { GlobalExceptionHandler.handle("Problem in method getSuccessfulStations for net " + NetworkIdUtil.toString(net.get_id()), e); } StationImpl[] rtnValues = new StationImpl[arrayList.size()]; rtnValues = (StationImpl[])arrayList.toArray(rtnValues); statusChanged("Waiting for a request"); logger.debug("getSuccessfulStations " + netCode + " - from server " + rtnValues.length); if(rtnValues.length == 0) { allStationFailureNets.add(NetworkIdUtil.toStringNoDates(net)); } return rtnValues; } } /** * Obtains the Channels corresponding to the station, processes them using * the ChannelSubsetter and returns an array of those that pass * * @throws NetworkNotFound */ public List<ChannelImpl> getSuccessfulChannels(StationImpl station) { if(allChannelFailureStations.contains(StationIdUtil.toStringNoDates(station))) { return new ArrayList<ChannelImpl>(0); } synchronized(this) { // no dice, try db List<ChannelImpl> sta = getNetworkDB().getChannelsForStation(station); if(sta.size() != 0) { logger.debug("successfulChannels " + station.get_code() + " - from db " + sta.size()); return sta; } // really no dice, go to server statusChanged("Getting channels for " + station); List<ChannelImpl> successes = new ArrayList<ChannelImpl>(); try { CacheNetworkAccess networkAccess = CacheNetworkAccess.create((NetworkAttrImpl)station.getNetworkAttr(), CommonAccess.getNameService()); Channel[] tmpChannels = networkAccess.retrieve_for_station(station.get_id()); MicroSecondDate stationBegin = new MicroSecondDate(station.getBeginTime()); // dmc network server ignores date in station id in // retrieve_for_station, so all channels for station code are // returned. This checks to make sure the station is the same. // ProxyNetworkAccess already interns stations in channels // so as long as station begin times are the same, they are // equal...we hope ArrayList<ChannelImpl> chansAtStation = new ArrayList<ChannelImpl>(); for(int i = 0; i < tmpChannels.length; i++) { if(new MicroSecondDate(tmpChannels[i].getSite().getStation().getBeginTime()).equals(stationBegin)) { chansAtStation.add((ChannelImpl)tmpChannels[i]); } else { logger.info("Channel " + ChannelIdUtil.toString(tmpChannels[i].get_id()) + " has a station that is not the same as the requested station: req=" + StationIdUtil.toString(station.get_id()) + " chan sta=" + StationIdUtil.toString(tmpChannels[i].getSite() .getStation())+" "+tmpChannels[i].getSite().getStation().getBeginTime().date_time+" != "+station.getBeginTime().date_time); } } ChannelImpl[] channels = (ChannelImpl[])chansAtStation.toArray(new ChannelImpl[0]); Status inProg = Status.get(Stage.NETWORK_SUBSETTER, Standing.IN_PROG); boolean needCommit = false; for(int i = 0; i < channels.length; i++) { ChannelImpl chan = channels[i]; change(chan, inProg); StringTree effectiveTimeResult = chanEffectiveSubsetter.accept(chan, networkAccess); if(effectiveTimeResult.isSuccess()) { boolean accepted = true; synchronized(chanSubsetters) { Iterator it = chanSubsetters.iterator(); while(it.hasNext()) { ChannelSubsetter cur = (ChannelSubsetter)it.next(); StringTree result = cur.accept(chan, networkAccess); if(!result.isSuccess()) { change(chan, Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info("Rejected " + ChannelIdUtil.toString(chan.get_id()) + ": " + result); accepted = false; break; } } } if(accepted) { Integer dbidInt = new Integer(getNetworkDB().put(chan)); needCommit = true; channelMap.put(dbidInt, chan); channelToSiteMap.put(dbidInt, station); successes.add(chan); change(chan, Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); } } else { change(chan, Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info("Reject based on effective time not matching the range of requested events: " + ChannelIdUtil.toString(chan.get_id()) + effectiveTimeResult); } } if(needCommit) { NetworkDB.commit(); } } catch(Throwable e) { GlobalExceptionHandler.handle("Problem in method getSuccessfulChannels for " + StationIdUtil.toString(station.get_id()), e); NetworkDB.rollback(); } statusChanged("Waiting for a request"); if(successes.size() == 0) { allChannelFailureStations.add(StationIdUtil.toStringNoDates(station)); } return successes; } } public List<ChannelGroup> getSuccessfulChannelGroups(StationImpl station) { if(allChannelFailureStations.contains(StationIdUtil.toStringNoDates(station))) { return new ArrayList<ChannelGroup>(0); } synchronized(this) { // no dice, try db List<ChannelGroup> sta = getNetworkDB().getChannelGroupsForStation(station); if(sta.size() != 0) { logger.debug("successfulChannelGroups " + station.get_code() + " - from db " + sta.size()); return sta; } // really no dice, go to server List<ChannelImpl> failures = new ArrayList<ChannelImpl>(); List<ChannelGroup> chanGroups = channelGrouper.group(getSuccessfulChannels(station), failures); for(ChannelGroup cg : chanGroups) { getNetworkDB().put(cg); } if (chanGroups.size() != 0) { getNetworkDB().commit(); } Iterator it = failures.iterator(); Status chanReject = Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT); while(it.hasNext()) { Channel failchan = (Channel)it.next(); failLogger.info(ChannelIdUtil.toString(failchan.get_id()) + " Channel not grouped."); } return chanGroups; } } // This is a HACK. Since we're already storing the channels whole hog, it // isn't much of a stretch to cache them by dbid, and this allows // JDBCEventChannelStatus to quickly pull them out instead of going to the // Net database public Channel getChannel(int chanId) throws NotFound, SQLException { ChannelImpl chan = (ChannelImpl)channelMap.get(new Integer(chanId)); if(chan != null) { return chan; } chan = getNetworkDB().getChannel(chanId); channelMap.put(new Integer(chanId), chan); return chan; } private QueryTime lastQueryTime = null; private Map channelMap = Collections.synchronizedMap(new HashMap()); private Map channelToSiteMap = Collections.synchronizedMap(new HashMap()); private void statusChanged(String newStatus) { synchronized(statusMonitors) { Iterator it = statusMonitors.iterator(); while(it.hasNext()) { try { ((NetworkMonitor)it.next()).setArmStatus(newStatus); } catch(Throwable e) { // caught for one, but should continue with rest after // logging // it GlobalExceptionHandler.handle("Problem changing status in NetworkArm", e); } } } } private void change(Channel chan, Status newStatus) { synchronized(statusMonitors) { Iterator it = statusMonitors.iterator(); while(it.hasNext()) { try { ((NetworkMonitor)it.next()).change(chan, newStatus); } catch(Throwable e) { // caught for one, but should continue with rest after // logging // it GlobalExceptionHandler.handle("Problem changing channel status in NetworkArm", e); } } } } private void change(Station sta, Status newStatus) { synchronized(statusMonitors) { Iterator it = statusMonitors.iterator(); while(it.hasNext()) { try { ((NetworkMonitor)it.next()).change(sta, newStatus); } catch(Throwable e) { // caught for one, but should continue with rest after // logging // it GlobalExceptionHandler.handle("Problem changing station status in NetworkArm", e); } } } } private void change(NetworkAccess na, Status newStatus) { synchronized(statusMonitors) { Iterator it = statusMonitors.iterator(); while(it.hasNext()) { try { ((NetworkMonitor)it.next()).change(na, newStatus); } catch(Throwable e) { // caught for one, but should continue with rest after // logging // it GlobalExceptionHandler.handle("Problem changing network status in NetworkArm", e); } } } } // Since we synchronize around the NetDC, only 1 thread can get stuff from // the network server at the same time. The pool is here in the off chance // the IRIS Network Server is fixed and we can run multiple threads to fill // up the db. If so, remove SynchronizedNetworkAccess from // BulletproofVestFactory, increase the number of threads here, and chuckle // as the stations stream in. private WorkerThreadPool netPopulators = new WorkerThreadPool("NetPopulator", 1); private NetworkFinder finder = null; private NetworkSubsetter attrSubsetter = new PassNetwork(); private NetworkSubsetter netEffectiveSubsetter = new PassNetwork(); private StationSubsetter stationSubsetter = new PassStation(); private StationSubsetter staEffectiveSubsetter = new PassStation(); private List chanSubsetters = new ArrayList(); private ChannelSubsetter chanEffectiveSubsetter = new PassChannel(); private ChannelGrouper channelGrouper = new ChannelGrouper(); protected NetworkDB getNetworkDB() { return NetworkDB.getSingleton(); } private CacheNetworkAccess[] cacheNets; private HashSet<String> allStationFailureNets = new HashSet<String>(); private HashSet<String> allChannelFailureStations = new HashSet<String>(); private List statusMonitors = new ArrayList(); private List armListeners = new ArrayList(); private static Logger logger = Logger.getLogger(NetworkArm.class); private static final org.apache.log4j.Logger failLogger = org.apache.log4j.Logger.getLogger("Fail.NetworkArm"); private boolean armFinished = false; private final Object netGetSync = new Object(); private final Object staGetSync = new Object(); private final Object chanGetSync = new Object(); }// NetworkArm
false
true
public CacheNetworkAccess[] getSuccessfulNetworks() throws NetworkNotFound { synchronized(netGetSync) { SodDB sodDb = SodDB.getSingleton(); if(lastQueryTime == null) { // try from db lastQueryTime = sodDb.getQueryTime(finder.getName(), finder.getDNS()); } if(lastQueryTime == null) { // still null, must be first time lastQueryTime = new QueryTime(finder.getName(), finder.getDNS(), ClockUtil.now().getTimestamp()); sodDb.putQueryTime(lastQueryTime); } else if(!lastQueryTime.needsRefresh(finder.getRefreshInterval())) { if(cacheNets == null) { cacheNets = getNetworkDB().getAllNets(getNetworkDC()); for(int i = 0; i < cacheNets.length; i++) { // this is for the side effect of creating // networkInfoTemplate stuff // avoids a null ptr later change(cacheNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); } } return cacheNets; } statusChanged("Getting networks"); logger.info("Getting networks"); ArrayList successes = new ArrayList(); CacheNetworkAccess[] allNets; NetworkDCOperations netDC = finder.getNetworkDC(); synchronized(netDC) { String[] constrainingCodes = getConstrainingNetworkCodes(attrSubsetter); if(constrainingCodes.length > 0) { edu.iris.Fissures.IfNetwork.NetworkFinder netFinder = netDC.a_finder(); List<CacheNetworkAccess> constrainedNets = new ArrayList<CacheNetworkAccess>(constrainingCodes.length); for(int i = 0; i < constrainingCodes.length; i++) { CacheNetworkAccess[] found; // this is a bit of a hack as names could be one or two // characters, but works with _US-TA style // virtual networks at the DMC if(constrainingCodes[i].length() > 2) { found = (CacheNetworkAccess[])netFinder.retrieve_by_name(constrainingCodes[i]); } else { found = (CacheNetworkAccess[])netFinder.retrieve_by_code(constrainingCodes[i]); } for(int j = 0; j < found.length; j++) { constrainedNets.add(found[j]); } } allNets = (CacheNetworkAccess[])constrainedNets.toArray(new CacheNetworkAccess[0]); } else { NetworkAccess[] tmpNets = netDC.a_finder().retrieve_all(); ArrayList goodNets = new ArrayList(); for(int i = 0; i < tmpNets.length; i++) { try { VirtualNetworkHelper.narrow(tmpNets[i]); // Ignore any virtual nets returned here logger.debug("ignoring virtual network " + tmpNets[i].get_attributes().get_code()); continue; } catch(BAD_PARAM bp) { // Must be a concrete, keep it goodNets.add(tmpNets[i]); } } allNets = (CacheNetworkAccess[])goodNets.toArray(new CacheNetworkAccess[0]); } } logger.info("Found " + allNets.length + " networks"); NetworkPusher lastPusher = null; for(int i = 0; i < allNets.length; i++) { allNets[i] = new DBCacheNetworkAccess(allNets[i]); try { NetworkAttrImpl attr = (NetworkAttrImpl)allNets[i].get_attributes(); if(netEffectiveSubsetter.accept(attr).isSuccess()) { if(attrSubsetter.accept(attr).isSuccess()) { NetworkDB ndb = getNetworkDB(); int dbid = ndb.put(attr); NetworkDB.commit(); logger.info("store network: " + attr.getDbid() + " " + dbid); successes.add(allNets[i]); change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); if(Start.getWaveformArm() == null && (! stationSubsetter.getClass().equals(PassStation.class) || chanSubsetters.size() != 0 )) { // only do netpushers if there are more subsetters downstream // and the waveform arm does not exist, otherwise there is no point // or we can let the waveform processors handle via EventNetworkPair if (lastPusher == null) { lastPusher = new NetworkPusher(allNets[i].get_attributes()); netPopulators.invokeLater(lastPusher); } else { lastPusher.addNetwork(allNets[i].get_attributes()); } logger.debug("running network"); //lastPusher.runNetwork(allNets[i].get_attributes()); } } else { change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(NetworkIdUtil.toString(allNets[i].get_attributes() .get_id()) + " was rejected."); } } else { change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(NetworkIdUtil.toString(allNets[i].get_attributes() .get_id()) + " was rejected because it wasn't active during the time range of requested events"); } } catch(Throwable th) { GlobalExceptionHandler.handle("Got an exception while trying getSuccessfulNetworks for the " + i + "th networkAccess", th); } } if(lastPusher != null) { lastPusher.setLastPusher(); } else { // no pushers if(allNets.length == 0) { logger.warn("Found no networks. Make sure the network codes you entered are valid"); } finish(); } // Set the time of the last check to now lastQueryTime.setTime(ClockUtil.now().getTimestamp()); cacheNets = new CacheNetworkAccess[successes.size()]; successes.toArray(cacheNets); logger.info(cacheNets.length + " networks passed"); statusChanged("Waiting for a request"); return cacheNets; } }
public CacheNetworkAccess[] getSuccessfulNetworks() throws NetworkNotFound { synchronized(netGetSync) { SodDB sodDb = SodDB.getSingleton(); if(lastQueryTime == null) { // try from db lastQueryTime = sodDb.getQueryTime(finder.getName(), finder.getDNS()); } if(lastQueryTime == null) { // still null, must be first time lastQueryTime = new QueryTime(finder.getName(), finder.getDNS(), ClockUtil.now().getTimestamp()); sodDb.putQueryTime(lastQueryTime); } else if(!lastQueryTime.needsRefresh(finder.getRefreshInterval())) { if(cacheNets == null) { cacheNets = getNetworkDB().getAllNets(getNetworkDC()); for(int i = 0; i < cacheNets.length; i++) { // this is for the side effect of creating // networkInfoTemplate stuff // avoids a null ptr later change(cacheNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); } } return cacheNets; } statusChanged("Getting networks"); logger.info("Getting networks"); ArrayList successes = new ArrayList(); CacheNetworkAccess[] allNets; NetworkDCOperations netDC = finder.getNetworkDC(); synchronized(netDC) { String[] constrainingCodes = getConstrainingNetworkCodes(attrSubsetter); if(constrainingCodes.length > 0) { edu.iris.Fissures.IfNetwork.NetworkFinder netFinder = netDC.a_finder(); List<CacheNetworkAccess> constrainedNets = new ArrayList<CacheNetworkAccess>(constrainingCodes.length); for(int i = 0; i < constrainingCodes.length; i++) { CacheNetworkAccess[] found; // this is a bit of a hack as names could be one or two // characters, but works with _US-TA style // virtual networks at the DMC if(constrainingCodes[i].length() > 2) { found = (CacheNetworkAccess[])netFinder.retrieve_by_name(constrainingCodes[i]); } else { found = (CacheNetworkAccess[])netFinder.retrieve_by_code(constrainingCodes[i]); } for(int j = 0; j < found.length; j++) { constrainedNets.add(found[j]); } } allNets = (CacheNetworkAccess[])constrainedNets.toArray(new CacheNetworkAccess[0]); } else { NetworkAccess[] tmpNets = netDC.a_finder().retrieve_all(); ArrayList goodNets = new ArrayList(); for(int i = 0; i < tmpNets.length; i++) { try { VirtualNetworkHelper.narrow(tmpNets[i]); // Ignore any virtual nets returned here logger.debug("ignoring virtual network " + tmpNets[i].get_attributes().get_code()); continue; } catch(BAD_PARAM bp) { // Must be a concrete, keep it goodNets.add(tmpNets[i]); } } allNets = (CacheNetworkAccess[])goodNets.toArray(new CacheNetworkAccess[0]); } } logger.info("Found " + allNets.length + " networks"); NetworkPusher lastPusher = null; for(int i = 0; i < allNets.length; i++) { allNets[i] = new DBCacheNetworkAccess(allNets[i]); NetworkAttrImpl attr = null; try { attr = (NetworkAttrImpl)allNets[i].get_attributes(); if(netEffectiveSubsetter.accept(attr).isSuccess()) { if(attrSubsetter.accept(attr).isSuccess()) { NetworkDB ndb = getNetworkDB(); int dbid = ndb.put(attr); NetworkDB.commit(); logger.info("store network: " + attr.getDbid() + " " + dbid); successes.add(allNets[i]); change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.SUCCESS)); if(Start.getWaveformArm() == null && (! stationSubsetter.getClass().equals(PassStation.class) || chanSubsetters.size() != 0 )) { // only do netpushers if there are more subsetters downstream // and the waveform arm does not exist, otherwise there is no point // or we can let the waveform processors handle via EventNetworkPair if (lastPusher == null) { lastPusher = new NetworkPusher(allNets[i].get_attributes()); netPopulators.invokeLater(lastPusher); } else { lastPusher.addNetwork(allNets[i].get_attributes()); } logger.debug("running network"); //lastPusher.runNetwork(allNets[i].get_attributes()); } } else { change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(NetworkIdUtil.toString(allNets[i].get_attributes() .get_id()) + " was rejected."); } } else { change(allNets[i], Status.get(Stage.NETWORK_SUBSETTER, Standing.REJECT)); failLogger.info(NetworkIdUtil.toString(allNets[i].get_attributes() .get_id()) + " was rejected because it wasn't active during the time range of requested events"); } } catch(Throwable th) { GlobalExceptionHandler.handle("Got an exception while trying getSuccessfulNetworks for the " + i + "th networkAccess (" +(attr==null?"null":NetworkIdUtil.toStringNoDates(((NetworkAttrImpl)allNets[i].get_attributes()))), th); } } if(lastPusher != null) { lastPusher.setLastPusher(); } else { // no pushers if(allNets.length == 0) { logger.warn("Found no networks. Make sure the network codes you entered are valid"); } finish(); } // Set the time of the last check to now lastQueryTime.setTime(ClockUtil.now().getTimestamp()); cacheNets = new CacheNetworkAccess[successes.size()]; successes.toArray(cacheNets); logger.info(cacheNets.length + " networks passed"); statusChanged("Waiting for a request"); return cacheNets; } }
diff --git a/src/main/java/org/cchmc/bmi/snpomics/OutputField.java b/src/main/java/org/cchmc/bmi/snpomics/OutputField.java index ce879a4..059802a 100644 --- a/src/main/java/org/cchmc/bmi/snpomics/OutputField.java +++ b/src/main/java/org/cchmc/bmi/snpomics/OutputField.java @@ -1,57 +1,58 @@ package org.cchmc.bmi.snpomics; import java.lang.reflect.InvocationTargetException; import java.lang.reflect.Method; import java.util.Arrays; import java.util.List; import org.cchmc.bmi.snpomics.annotation.interactive.InteractiveAnnotation; import org.cchmc.bmi.snpomics.annotation.interactive.MetaAnnotation; import org.cchmc.bmi.snpomics.annotation.reference.ReferenceAnnotation; import org.cchmc.bmi.snpomics.exception.SnpomicsException; public class OutputField { public OutputField(Method source) { method = source; annotation = method.getAnnotation(MetaAnnotation.class); - throw new SnpomicsException("Method '"+method.getClass().getCanonicalName()+"."+method.getName()+ - "' is an OutputField with no MetaAnnotation"); + if (annotation == null) + throw new SnpomicsException("Method '"+method.getDeclaringClass().getCanonicalName()+"."+method.getName()+ + "' is an OutputField with no MetaAnnotation"); } public String getName() { return annotation.name(); } public String getDescription() { return annotation.description(); } public List<String> getGroups() { return Arrays.asList(annotation.groups()); } public List<Class<? extends ReferenceAnnotation>> getReferences() { return Arrays.asList(annotation.ref()); } @SuppressWarnings("unchecked") public Class<? extends InteractiveAnnotation> getDeclaringClass() { return (Class<? extends InteractiveAnnotation>) method.getDeclaringClass(); } public String getOutput(InteractiveAnnotation annot) throws IllegalArgumentException, IllegalAccessException, InvocationTargetException { return method.invoke(annot).toString(); } public String getInternalName() { return method.getName(); } public static boolean isOutputField(Method toCheck) { return toCheck.isAnnotationPresent(MetaAnnotation.class); } private Method method; private MetaAnnotation annotation; }
true
true
public OutputField(Method source) { method = source; annotation = method.getAnnotation(MetaAnnotation.class); throw new SnpomicsException("Method '"+method.getClass().getCanonicalName()+"."+method.getName()+ "' is an OutputField with no MetaAnnotation"); }
public OutputField(Method source) { method = source; annotation = method.getAnnotation(MetaAnnotation.class); if (annotation == null) throw new SnpomicsException("Method '"+method.getDeclaringClass().getCanonicalName()+"."+method.getName()+ "' is an OutputField with no MetaAnnotation"); }
diff --git a/Ingest/src/org/sleuthkit/autopsy/ingest/IngestMessageMainPanel.java b/Ingest/src/org/sleuthkit/autopsy/ingest/IngestMessageMainPanel.java index 8b757d406..88a34a498 100644 --- a/Ingest/src/org/sleuthkit/autopsy/ingest/IngestMessageMainPanel.java +++ b/Ingest/src/org/sleuthkit/autopsy/ingest/IngestMessageMainPanel.java @@ -1,133 +1,135 @@ /* * Autopsy Forensic Browser * * Copyright 2011 Basis Technology Corp. * Contact: carrier <at> sleuthkit <dot> org * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.sleuthkit.autopsy.ingest; import java.awt.Color; import java.awt.Dimension; import java.awt.event.ComponentEvent; import java.awt.event.ComponentListener; import java.util.logging.Level; import java.util.logging.Logger; import javax.swing.BoxLayout; import javax.swing.JLayeredPane; /** * the main layered pane container for messages table (IngestMessagePanel) * and details view (IngestMessageDetailsPanel) */ public class IngestMessageMainPanel extends JLayeredPane { private IngestMessagePanel messagePanel; private IngestMessageDetailsPanel detailsPanel; private Logger logger = Logger.getLogger(IngestMessageMainPanel.class.getName()); //private JLayeredPane layeredPane; /** Creates new form IngestMessageMainPanel */ public IngestMessageMainPanel() { initComponents(); customizeComponents(); } private void customizeComponents() { messagePanel = new IngestMessagePanel(this); detailsPanel = new IngestMessageDetailsPanel(this); //we need to handle resizing ourselves due to absence of layout manager //in layered layout this.addComponentListener(new ComponentListener() { @Override public void componentHidden(ComponentEvent e) { } @Override public void componentMoved(ComponentEvent e) { } @Override public void componentShown(ComponentEvent e) { } @Override public void componentResized(ComponentEvent e) { //we need to handle resizing ourselves due to absence of layout manager //in layered layout Dimension dim = getSize(); messagePanel.setPreferredSize(dim); detailsPanel.setPreferredSize(dim); messagePanel.setBounds(0, 0, dim.width, dim.height); detailsPanel.setBounds(0, 0, dim.width, dim.height); revalidate(); } }); + messagePanel.setOpaque(true); + detailsPanel.setOpaque(true); add(messagePanel, JLayeredPane.PALETTE_LAYER); add(detailsPanel, JLayeredPane.DEFAULT_LAYER); this.setOpaque(true); } IngestMessagePanel getMessagePanel() { return messagePanel; } IngestMessageDetailsPanel getDetailsPanel() { return detailsPanel; } void showMessages() { setLayer(detailsPanel, JLayeredPane.DEFAULT_LAYER); setLayer(messagePanel, JLayeredPane.PALETTE_LAYER); } void showDetails(int rowNumber) { detailsPanel.showDetails(rowNumber); setLayer(detailsPanel, JLayeredPane.PALETTE_LAYER); setLayer(messagePanel, JLayeredPane.DEFAULT_LAYER); } public void addMessage(IngestMessage ingestMessage) { messagePanel.addMessage(ingestMessage); } public void clearMessages() { messagePanel.clearMessages(); } /** This method is called from within the constructor to * initialize the form. * WARNING: Do NOT modify this code. The content of this method is * always regenerated by the Form Editor. */ @SuppressWarnings("unchecked") // <editor-fold defaultstate="collapsed" desc="Generated Code"> private void initComponents() { javax.swing.GroupLayout layout = new javax.swing.GroupLayout(this); this.setLayout(layout); layout.setHorizontalGroup( layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING).addGap(0, 454, Short.MAX_VALUE)); layout.setVerticalGroup( layout.createParallelGroup(javax.swing.GroupLayout.Alignment.LEADING).addGap(0, 309, Short.MAX_VALUE)); }// </editor-fold> // Variables declaration - do not modify // End of variables declaration }
true
true
private void customizeComponents() { messagePanel = new IngestMessagePanel(this); detailsPanel = new IngestMessageDetailsPanel(this); //we need to handle resizing ourselves due to absence of layout manager //in layered layout this.addComponentListener(new ComponentListener() { @Override public void componentHidden(ComponentEvent e) { } @Override public void componentMoved(ComponentEvent e) { } @Override public void componentShown(ComponentEvent e) { } @Override public void componentResized(ComponentEvent e) { //we need to handle resizing ourselves due to absence of layout manager //in layered layout Dimension dim = getSize(); messagePanel.setPreferredSize(dim); detailsPanel.setPreferredSize(dim); messagePanel.setBounds(0, 0, dim.width, dim.height); detailsPanel.setBounds(0, 0, dim.width, dim.height); revalidate(); } }); add(messagePanel, JLayeredPane.PALETTE_LAYER); add(detailsPanel, JLayeredPane.DEFAULT_LAYER); this.setOpaque(true); }
private void customizeComponents() { messagePanel = new IngestMessagePanel(this); detailsPanel = new IngestMessageDetailsPanel(this); //we need to handle resizing ourselves due to absence of layout manager //in layered layout this.addComponentListener(new ComponentListener() { @Override public void componentHidden(ComponentEvent e) { } @Override public void componentMoved(ComponentEvent e) { } @Override public void componentShown(ComponentEvent e) { } @Override public void componentResized(ComponentEvent e) { //we need to handle resizing ourselves due to absence of layout manager //in layered layout Dimension dim = getSize(); messagePanel.setPreferredSize(dim); detailsPanel.setPreferredSize(dim); messagePanel.setBounds(0, 0, dim.width, dim.height); detailsPanel.setBounds(0, 0, dim.width, dim.height); revalidate(); } }); messagePanel.setOpaque(true); detailsPanel.setOpaque(true); add(messagePanel, JLayeredPane.PALETTE_LAYER); add(detailsPanel, JLayeredPane.DEFAULT_LAYER); this.setOpaque(true); }
diff --git a/sinciput/src/com/technosophos/sinciput/commands/admin/RemoveUser.java b/sinciput/src/com/technosophos/sinciput/commands/admin/RemoveUser.java index 866c903..b946d87 100644 --- a/sinciput/src/com/technosophos/sinciput/commands/admin/RemoveUser.java +++ b/sinciput/src/com/technosophos/sinciput/commands/admin/RemoveUser.java @@ -1,171 +1,156 @@ package com.technosophos.sinciput.commands.admin; import java.util.List; import java.util.Map; import com.technosophos.rhizome.command.AbstractCommand; import com.technosophos.rhizome.controller.CommandResult; import com.technosophos.rhizome.controller.ReRouteRequest; import com.technosophos.sinciput.types.admin.UserEnum; import com.technosophos.rhizome.repository.RepositoryAccessException; import com.technosophos.rhizome.repository.RepositorySearcher; import com.technosophos.rhizome.repository.DocumentRepository; import com.technosophos.rhizome.repository.RhizomeInitializationException; import com.technosophos.rhizome.document.Metadatum; import static com.technosophos.sinciput.servlet.ServletConstants.SETTINGS_REPO; public class RemoveUser extends AbstractCommand { /** * Remove a user. * <p>There are two supposedly unique identifiers for a user. The Doc ID, which is truly * unique, and the username, which ought to be unique within the repository. This * will first check for a UID (aka doc ID), and if none is found, it will check for a username.</p> * <p>Once it has found a UID or username, it will attempt to delete the record.</p> * <p>If both a UUID and username are supplied, the command will only try to delete * the UUID.</p> */ public void doCommand(Map<String, Object> params, List<CommandResult> results) throws ReRouteRequest { RepositorySearcher search = null; try { search = this.repoman.getSearcher(SETTINGS_REPO); } catch (RhizomeInitializationException e) { String errMsg = "RepositorySearcher could not be retrieved."; String friendlyErrMsg = "This server has had a woeful tragedy attempting to answer your request. Please try again when I stop whimpering."; results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // CASE 1: We get a document ID to delete. if(this.hasParam(params, "id")){ /* * Get a document, verify it is right, and delete it. */ String docID = this.getParam(params, "id").toString(); try { // #1: Make sure doc exists. DocumentRepository repo = this.repoman.getRepository(SETTINGS_REPO); if( repo.hasDocument(docID)) { // #2 Make sure the document is the correct type. Metadatum m = search.getMetadatumByDocID(UserEnum.TYPE.getKey(), docID); - List<String> vals = m.getValues(); - if(vals == null) { - String errMsg = String.format("DocID %s is not a user account: No type.", docID); - String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); - results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); - return; - } - boolean isUserDoc = false; - // #2b: loop through and see if any value matches the "user" def. value - for(String v: vals) { - if(UserEnum.TYPE.getFieldDescription().getDefaultValue().equalsIgnoreCase(v)) { - isUserDoc = true; - break; - } - } - if(!isUserDoc) { + if(!m.hasValue(UserEnum.TYPE.getFieldDescription().getDefaultValue())) { String errMsg = String.format("DocID %s is not a user account: Wrong type.", docID); String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } // #3: Try to delete from index. try { this.repoman.getIndexer(SETTINGS_REPO).deleteFromIndex(docID); } catch (RhizomeInitializationException e) { String errMsg = String.format("Error deleting from indexer: %.", e.getMessage()); String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // #4: Remove record from repository. repo.removeDocument(docID); } else { String errMsg = String.format("DocID %s not found.", docID); String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } } catch (RhizomeInitializationException e) { String errMsg = "DocumentRepository could not be created."; String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } catch (RepositoryAccessException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", docID); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } results.add(this.createCommandResult(String.format("User %s removed."))); return; // CASE #2: Delete by user name } else if(this.hasParam(params, UserEnum.USERNAME.getKey())) { // Step #1: Get the user record with the given username String username_field = UserEnum.USERNAME.getKey(); String username = this.getParam(params, username_field).toString(); try { String [] docids = search.getDocIDsByMetadataValue(username_field, username); // RepositoryAccessException if(docids == null) { // Shouldn't happen String errMsg = String.format("WARNING: Unexpected null looking for user %s.", username); String friendlyErrMsg = String.format("There is no user named %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } else if( docids.length == 0 ) { // No docs String errMsg = String.format("User %s not found.", username); String friendlyErrMsg = String.format("There is no user named %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } else if (docids.length == 1 ) { // Step #2: BINGO! Now delete document try { this.repoman.removeDocument(SETTINGS_REPO, docids[0]); /*} catch (RhizomeInitializationException e) { String errMsg = "DocumentRepository could not be created."; String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return;*/ } catch (RepositoryAccessException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", username); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } catch (com.technosophos.rhizome.RhizomeException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", username); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } results.add(this.createCommandResult(String.format("User %s removed."))); return; } else { // Oops! How did we get multiple users? Better delete by docID instead! String errMsg = String.format("WARNING: More than one user named %s!.", username); String friendlyErrMsg = String.format("There are multiple users named %s. This is bad. Contact your system administrator. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } } catch (RepositoryAccessException e) { String errMsg = "RepositorySearcher could not be created."; String friendlyErrMsg = String.format("Due to an error on our part, we could not find the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // CASE #3: No user at all! } else { String errMsg = "No user or UUID provided."; String friendlyErrMsg = "You must specify a user to delete."; results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } } }
true
true
public void doCommand(Map<String, Object> params, List<CommandResult> results) throws ReRouteRequest { RepositorySearcher search = null; try { search = this.repoman.getSearcher(SETTINGS_REPO); } catch (RhizomeInitializationException e) { String errMsg = "RepositorySearcher could not be retrieved."; String friendlyErrMsg = "This server has had a woeful tragedy attempting to answer your request. Please try again when I stop whimpering."; results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // CASE 1: We get a document ID to delete. if(this.hasParam(params, "id")){ /* * Get a document, verify it is right, and delete it. */ String docID = this.getParam(params, "id").toString(); try { // #1: Make sure doc exists. DocumentRepository repo = this.repoman.getRepository(SETTINGS_REPO); if( repo.hasDocument(docID)) { // #2 Make sure the document is the correct type. Metadatum m = search.getMetadatumByDocID(UserEnum.TYPE.getKey(), docID); List<String> vals = m.getValues(); if(vals == null) { String errMsg = String.format("DocID %s is not a user account: No type.", docID); String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } boolean isUserDoc = false; // #2b: loop through and see if any value matches the "user" def. value for(String v: vals) { if(UserEnum.TYPE.getFieldDescription().getDefaultValue().equalsIgnoreCase(v)) { isUserDoc = true; break; } } if(!isUserDoc) { String errMsg = String.format("DocID %s is not a user account: Wrong type.", docID); String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } // #3: Try to delete from index. try { this.repoman.getIndexer(SETTINGS_REPO).deleteFromIndex(docID); } catch (RhizomeInitializationException e) { String errMsg = String.format("Error deleting from indexer: %.", e.getMessage()); String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // #4: Remove record from repository. repo.removeDocument(docID); } else { String errMsg = String.format("DocID %s not found.", docID); String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } } catch (RhizomeInitializationException e) { String errMsg = "DocumentRepository could not be created."; String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } catch (RepositoryAccessException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", docID); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } results.add(this.createCommandResult(String.format("User %s removed."))); return; // CASE #2: Delete by user name } else if(this.hasParam(params, UserEnum.USERNAME.getKey())) { // Step #1: Get the user record with the given username String username_field = UserEnum.USERNAME.getKey(); String username = this.getParam(params, username_field).toString(); try { String [] docids = search.getDocIDsByMetadataValue(username_field, username); // RepositoryAccessException if(docids == null) { // Shouldn't happen String errMsg = String.format("WARNING: Unexpected null looking for user %s.", username); String friendlyErrMsg = String.format("There is no user named %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } else if( docids.length == 0 ) { // No docs String errMsg = String.format("User %s not found.", username); String friendlyErrMsg = String.format("There is no user named %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } else if (docids.length == 1 ) { // Step #2: BINGO! Now delete document try { this.repoman.removeDocument(SETTINGS_REPO, docids[0]); /*} catch (RhizomeInitializationException e) { String errMsg = "DocumentRepository could not be created."; String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return;*/ } catch (RepositoryAccessException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", username); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } catch (com.technosophos.rhizome.RhizomeException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", username); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } results.add(this.createCommandResult(String.format("User %s removed."))); return; } else { // Oops! How did we get multiple users? Better delete by docID instead! String errMsg = String.format("WARNING: More than one user named %s!.", username); String friendlyErrMsg = String.format("There are multiple users named %s. This is bad. Contact your system administrator. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } } catch (RepositoryAccessException e) { String errMsg = "RepositorySearcher could not be created."; String friendlyErrMsg = String.format("Due to an error on our part, we could not find the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // CASE #3: No user at all! } else { String errMsg = "No user or UUID provided."; String friendlyErrMsg = "You must specify a user to delete."; results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } }
public void doCommand(Map<String, Object> params, List<CommandResult> results) throws ReRouteRequest { RepositorySearcher search = null; try { search = this.repoman.getSearcher(SETTINGS_REPO); } catch (RhizomeInitializationException e) { String errMsg = "RepositorySearcher could not be retrieved."; String friendlyErrMsg = "This server has had a woeful tragedy attempting to answer your request. Please try again when I stop whimpering."; results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // CASE 1: We get a document ID to delete. if(this.hasParam(params, "id")){ /* * Get a document, verify it is right, and delete it. */ String docID = this.getParam(params, "id").toString(); try { // #1: Make sure doc exists. DocumentRepository repo = this.repoman.getRepository(SETTINGS_REPO); if( repo.hasDocument(docID)) { // #2 Make sure the document is the correct type. Metadatum m = search.getMetadatumByDocID(UserEnum.TYPE.getKey(), docID); if(!m.hasValue(UserEnum.TYPE.getFieldDescription().getDefaultValue())) { String errMsg = String.format("DocID %s is not a user account: Wrong type.", docID); String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } // #3: Try to delete from index. try { this.repoman.getIndexer(SETTINGS_REPO).deleteFromIndex(docID); } catch (RhizomeInitializationException e) { String errMsg = String.format("Error deleting from indexer: %.", e.getMessage()); String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // #4: Remove record from repository. repo.removeDocument(docID); } else { String errMsg = String.format("DocID %s not found.", docID); String friendlyErrMsg = String.format("There is no user record with the ID %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } } catch (RhizomeInitializationException e) { String errMsg = "DocumentRepository could not be created."; String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } catch (RepositoryAccessException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", docID); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", docID); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } results.add(this.createCommandResult(String.format("User %s removed."))); return; // CASE #2: Delete by user name } else if(this.hasParam(params, UserEnum.USERNAME.getKey())) { // Step #1: Get the user record with the given username String username_field = UserEnum.USERNAME.getKey(); String username = this.getParam(params, username_field).toString(); try { String [] docids = search.getDocIDsByMetadataValue(username_field, username); // RepositoryAccessException if(docids == null) { // Shouldn't happen String errMsg = String.format("WARNING: Unexpected null looking for user %s.", username); String friendlyErrMsg = String.format("There is no user named %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } else if( docids.length == 0 ) { // No docs String errMsg = String.format("User %s not found.", username); String friendlyErrMsg = String.format("There is no user named %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } else if (docids.length == 1 ) { // Step #2: BINGO! Now delete document try { this.repoman.removeDocument(SETTINGS_REPO, docids[0]); /*} catch (RhizomeInitializationException e) { String errMsg = "DocumentRepository could not be created."; String friendlyErrMsg = String.format("The system could not access the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return;*/ } catch (RepositoryAccessException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", username); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } catch (com.technosophos.rhizome.RhizomeException e) { String errMsg = String.format("User %s could not be deleted from the document repository.", username); String friendlyErrMsg = String.format("The system could not remove the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } results.add(this.createCommandResult(String.format("User %s removed."))); return; } else { // Oops! How did we get multiple users? Better delete by docID instead! String errMsg = String.format("WARNING: More than one user named %s!.", username); String friendlyErrMsg = String.format("There are multiple users named %s. This is bad. Contact your system administrator. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } } catch (RepositoryAccessException e) { String errMsg = "RepositorySearcher could not be created."; String friendlyErrMsg = String.format("Due to an error on our part, we could not find the record for %s. Nothing deleted.", username); results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg, e)); return; } // CASE #3: No user at all! } else { String errMsg = "No user or UUID provided."; String friendlyErrMsg = "You must specify a user to delete."; results.add(this.createErrorCommandResult(errMsg, friendlyErrMsg)); return; } }
diff --git a/Android/src/pt/traincompany/account/CardAdapter.java b/Android/src/pt/traincompany/account/CardAdapter.java index bb0e631..f71a6c0 100644 --- a/Android/src/pt/traincompany/account/CardAdapter.java +++ b/Android/src/pt/traincompany/account/CardAdapter.java @@ -1,57 +1,58 @@ package pt.traincompany.account; import pt.traincompany.main.R; import android.app.Activity; import android.content.Context; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.TextView; public class CardAdapter extends ArrayAdapter<Card> { Context context; int layoutResourceId; int icon; Card data[] = null; public CardAdapter(Context context, int layoutResourceId, int icon, Card[] data) { super(context, layoutResourceId, data); this.layoutResourceId = layoutResourceId; this.context = context; this.icon = icon; this.data = data; } @Override public View getView(int position, View convertView, ViewGroup parent) { View row = convertView; CardHolder holder = null; if (row == null) { LayoutInflater inflater = ((Activity) context).getLayoutInflater(); row = inflater.inflate(layoutResourceId, parent, false); holder = new CardHolder(); holder.imgIcon = (ImageView) row.findViewById(R.id.removeCard); holder.txtNumber = (TextView) row.findViewById(R.id.creditCardNumber); row.setTag(holder); } else { + holder = (CardHolder) row.getTag(); } Card weather = data[position]; holder.txtNumber.setText(weather.number); holder.imgIcon.setImageResource(this.icon); return row; } static class CardHolder { ImageView imgIcon; TextView txtNumber; } }
true
true
public View getView(int position, View convertView, ViewGroup parent) { View row = convertView; CardHolder holder = null; if (row == null) { LayoutInflater inflater = ((Activity) context).getLayoutInflater(); row = inflater.inflate(layoutResourceId, parent, false); holder = new CardHolder(); holder.imgIcon = (ImageView) row.findViewById(R.id.removeCard); holder.txtNumber = (TextView) row.findViewById(R.id.creditCardNumber); row.setTag(holder); } else { } Card weather = data[position]; holder.txtNumber.setText(weather.number); holder.imgIcon.setImageResource(this.icon); return row; }
public View getView(int position, View convertView, ViewGroup parent) { View row = convertView; CardHolder holder = null; if (row == null) { LayoutInflater inflater = ((Activity) context).getLayoutInflater(); row = inflater.inflate(layoutResourceId, parent, false); holder = new CardHolder(); holder.imgIcon = (ImageView) row.findViewById(R.id.removeCard); holder.txtNumber = (TextView) row.findViewById(R.id.creditCardNumber); row.setTag(holder); } else { holder = (CardHolder) row.getTag(); } Card weather = data[position]; holder.txtNumber.setText(weather.number); holder.imgIcon.setImageResource(this.icon); return row; }
diff --git a/tool/src/java/org/sakaiproject/profile2/tool/entityprovider/ProfileEntityProvider.java b/tool/src/java/org/sakaiproject/profile2/tool/entityprovider/ProfileEntityProvider.java index 0e9417fb..b0e0998e 100644 --- a/tool/src/java/org/sakaiproject/profile2/tool/entityprovider/ProfileEntityProvider.java +++ b/tool/src/java/org/sakaiproject/profile2/tool/entityprovider/ProfileEntityProvider.java @@ -1,688 +1,687 @@ /** * Copyright (c) 2008-2010 The Sakai Foundation * * Licensed under the Educational Community License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.osedu.org/licenses/ECL-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.sakaiproject.profile2.tool.entityprovider; import java.io.IOException; import java.io.OutputStream; import java.util.List; import java.util.Map; import org.apache.commons.lang.StringUtils; import org.sakaiproject.entitybroker.EntityReference; import org.sakaiproject.entitybroker.EntityView; import org.sakaiproject.entitybroker.entityprovider.CoreEntityProvider; import org.sakaiproject.entitybroker.entityprovider.annotations.EntityCustomAction; import org.sakaiproject.entitybroker.entityprovider.annotations.EntityURLRedirect; import org.sakaiproject.entitybroker.entityprovider.capabilities.AutoRegisterEntityProvider; import org.sakaiproject.entitybroker.entityprovider.capabilities.RESTful; import org.sakaiproject.entitybroker.entityprovider.capabilities.RequestAware; import org.sakaiproject.entitybroker.entityprovider.extension.ActionReturn; import org.sakaiproject.entitybroker.entityprovider.extension.Formats; import org.sakaiproject.entitybroker.entityprovider.extension.RequestGetter; import org.sakaiproject.entitybroker.entityprovider.search.Search; import org.sakaiproject.entitybroker.exception.EntityException; import org.sakaiproject.entitybroker.exception.EntityNotFoundException; import org.sakaiproject.entitybroker.util.AbstractEntityProvider; import org.sakaiproject.entitybroker.util.TemplateParseUtil; import org.sakaiproject.profile2.logic.ProfileConnectionsLogic; import org.sakaiproject.profile2.logic.ProfileImageLogic; import org.sakaiproject.profile2.logic.ProfileLogic; import org.sakaiproject.profile2.logic.SakaiProxy; import org.sakaiproject.profile2.model.BasicConnection; import org.sakaiproject.profile2.model.ProfileImage; import org.sakaiproject.profile2.model.UserProfile; import org.sakaiproject.profile2.util.Messages; import org.sakaiproject.profile2.util.ProfileConstants; import org.sakaiproject.profile2.util.ProfileUtils; import org.apache.commons.lang.StringEscapeUtils; /** * This is the entity provider for a user's profile. * * @author Steve Swinsburg ([email protected]) * */ public class ProfileEntityProvider extends AbstractEntityProvider implements CoreEntityProvider, AutoRegisterEntityProvider, RESTful, RequestAware { public final static String ENTITY_PREFIX = "profile"; public String getEntityPrefix() { return ENTITY_PREFIX; } public boolean entityExists(String eid) { return true; } public Object getSampleEntity() { return new UserProfile(); } public Object getEntity(EntityReference ref) { //convert input to uuid String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } //get the full profile for the user, takes care of privacy checks against the current user UserProfile userProfile = profileLogic.getUserProfile(uuid); if(userProfile == null) { throw new EntityNotFoundException("Profile could not be retrieved for " + ref.getId(), ref.getReference()); } return userProfile; } @EntityCustomAction(action="image",viewKey=EntityView.VIEW_SHOW) public Object getProfileImage(OutputStream out, EntityView view, Map<String,Object> params, EntityReference ref) { //convert input to uuid String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } ProfileImage image = new ProfileImage(); boolean wantsThumbnail = "thumb".equals(view.getPathSegment(3)) ? true : false; //optional siteid String siteId = (String)params.get("siteId"); if(StringUtils.isNotBlank(siteId) && !sakaiProxy.checkForSite(siteId)){ throw new EntityNotFoundException("Invalid siteId: " + siteId, ref.getReference()); } //get thumb if requested - will fallback by default if(wantsThumbnail) { image = imageLogic.getProfileImage(uuid, null, null, ProfileConstants.PROFILE_IMAGE_THUMBNAIL, siteId); } else { image = imageLogic.getProfileImage(uuid, null, null, ProfileConstants.PROFILE_IMAGE_MAIN, siteId); } if(image == null) { throw new EntityNotFoundException("No profile image for " + ref.getId(), ref.getReference()); } //check for binary final byte[] bytes = image.getBinary(); if(bytes != null && bytes.length > 0) { try { out.write(bytes); ActionReturn actionReturn = new ActionReturn("BASE64", image.getMimeType(), out); return actionReturn; } catch (IOException e) { throw new EntityException("Error retrieving profile image for " + ref.getId() + " : " + e.getMessage(), ref.getReference()); } } String url = image.getUrl(); if(StringUtils.isNotBlank(url)) { try { requestGetter.getResponse().sendRedirect(url); } catch (IOException e) { throw new EntityException("Error redirecting to external image for " + ref.getId() + " : " + e.getMessage(), ref.getReference()); } } return null; } @EntityCustomAction(action="connections",viewKey=EntityView.VIEW_SHOW) public Object getConnections(EntityView view, EntityReference ref) { if(!sakaiProxy.isLoggedIn()) { throw new SecurityException("You must be logged in to get a connection list."); } //convert input to uuid String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } //get list of connections List<BasicConnection> connections = connectionsLogic.getBasicConnectionsForUser(uuid); if(connections == null) { throw new EntityException("Error retrieving connections for " + ref.getId(), ref.getReference()); } ActionReturn actionReturn = new ActionReturn(connections); return actionReturn; } @EntityCustomAction(action="friendStatus",viewKey=EntityView.VIEW_SHOW) public Object getConnectionStatus(EntityReference ref, Map<String, Object> parameters) { if(!sakaiProxy.isLoggedIn()) { throw new SecurityException("You must be logged in to get a friend status record."); } //convert input to uuid (user making query) String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } if (false == parameters.containsKey("friendId")) { throw new EntityNotFoundException("Parameter must be specified: friendId", ref.getId()); } return connectionsLogic.getConnectionStatus(uuid, parameters.get("friendId").toString()); } @EntityCustomAction(action="formatted",viewKey=EntityView.VIEW_SHOW) public Object getFormattedProfile(EntityReference ref) { //this allows a normal full profile to be returned formatted in HTML //get the full profile UserProfile userProfile = (UserProfile) getEntity(ref); //convert UserProfile to HTML object String formattedProfile = getUserProfileAsHTML(userProfile); //ActionReturn actionReturn = new ActionReturn("UTF-8", "text/html", entity); ActionReturn actionReturn = new ActionReturn(Formats.UTF_8, Formats.HTML_MIME_TYPE, formattedProfile); return actionReturn; } @EntityCustomAction(action="requestFriend",viewKey=EntityView.VIEW_SHOW) public Object requestFriend(EntityReference ref,Map<String,Object> params) { if(!sakaiProxy.isLoggedIn()) { throw new SecurityException("You must be logged in to make a connection request."); } //convert input to uuid String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } String friendId = (String) params.get("friendId"); //get list of connections if(!connectionsLogic.requestFriend(uuid, friendId)) { throw new EntityException("Error requesting friend connection for " + ref.getId(), ref.getReference()); } else return Messages.getString("Label.friend.requested"); } @EntityCustomAction(action="removeFriend",viewKey=EntityView.VIEW_SHOW) public Object removeFriend(EntityReference ref,Map<String,Object> params) { if(!sakaiProxy.isLoggedIn()) { throw new SecurityException("You must be logged in to remove a connection."); } //convert input to uuid String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } String friendId = (String) params.get("friendId"); //get list of connections if(!connectionsLogic.removeFriend(uuid, friendId)) { throw new EntityException("Error removing friend connection for " + ref.getId(), ref.getReference()); } else return Messages.getString("Label.friend.add"); } @EntityCustomAction(action="confirmFriendRequest",viewKey=EntityView.VIEW_SHOW) public Object confirmFriendRequest(EntityReference ref,Map<String,Object> params) { if(!sakaiProxy.isLoggedIn()) { throw new SecurityException("You must be logged in to confirm a connection request."); } //convert input to uuid String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } String friendId = (String) params.get("friendId"); //get list of connections if(!connectionsLogic.confirmFriendRequest(friendId, uuid)) { //if(!connectionsLogic.confirmFriendRequest(uuid, friendId)) { throw new EntityException("Error confirming friend connection for " + ref.getId(), ref.getReference()); } else return Messages.getString("Label.friend.remove"); } @EntityCustomAction(action="ignoreFriendRequest",viewKey=EntityView.VIEW_SHOW) public Object ignoreFriendRequest(EntityReference ref,Map<String,Object> params) { if(!sakaiProxy.isLoggedIn()) { throw new SecurityException("You must be logged in to ignore a connection request."); } //convert input to uuid String uuid = sakaiProxy.ensureUuid(ref.getId()); if(StringUtils.isBlank(uuid)) { throw new EntityNotFoundException("Invalid user.", ref.getId()); } String friendId = (String) params.get("friendId"); //we're ignoring a request FROM the friendId TO the uuid if(!connectionsLogic.ignoreFriendRequest(friendId, uuid)) { throw new EntityException("Error ignoring friend connection for " + ref.getId(), ref.getReference()); } else return Messages.getString("Label.friend.add"); } @EntityURLRedirect("/{prefix}/{id}/account") public String redirectUserAccount(Map<String,String> vars) { return "user/" + vars.get("id") + vars.get(TemplateParseUtil.DOT_EXTENSION); } public void updateEntity(EntityReference ref, Object entity, Map<String, Object> params) { String userId = ref.getId(); if (StringUtils.isBlank(userId)) { throw new IllegalArgumentException("Cannot update, No userId in provided reference: " + ref); } if (entity.getClass().isAssignableFrom(UserProfile.class)) { UserProfile userProfile = (UserProfile) entity; profileLogic.saveUserProfile(userProfile); } else { throw new IllegalArgumentException("Invalid entity for update, must be UserProfile object"); } } public String createEntity(EntityReference ref, Object entity, Map<String, Object> params) { //reference will be the userUuid, which comes from the UserProfile String userUuid = null; if (entity.getClass().isAssignableFrom(UserProfile.class)) { UserProfile userProfile = (UserProfile) entity; if(profileLogic.saveUserProfile(userProfile)) { userUuid = userProfile.getUserUuid(); } if(userUuid == null) { throw new EntityException("Could not create entity", ref.getReference()); } } else { throw new IllegalArgumentException("Invalid entity for create, must be UserProfile object"); } return userUuid; } /** * {@inheritDoc} */ private String getUserProfileAsHTML(UserProfile userProfile) { //note there is no birthday in this field. we need a good way to get the birthday without the year. //maybe it needs to be stored in a separate field and treated differently. Or returned as a localised string. StringBuilder sb = new StringBuilder(); sb.append("<script type=\"text/javascript\" src=\"/profile2-tool/javascript/profile2-eb.js\"></script>"); sb.append("<div class=\"profile2-profile\">"); sb.append("<div class=\"profile2-profile-image\">"); sb.append("<img src=\""); sb.append(userProfile.getImageUrl()); sb.append("\" />"); sb.append("</div>"); sb.append("<div class=\"profile2-profile-content\">"); if(StringUtils.isNotBlank(userProfile.getUserUuid())) { sb.append("<div class=\"profile2-profile-userUuid\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.userUuid")); sb.append("</span>"); sb.append(userProfile.getUserUuid()); sb.append("</div>"); } String displayName = userProfile.getDisplayName(); if(StringUtils.isNotBlank(displayName)) { sb.append("<div class=\"profile2-profile-displayName\">"); - sb.append(userProfile.getDisplayName()); sb.append(StringEscapeUtils.escapeHtml(displayName)); sb.append("</div>"); } if(!sakaiProxy.getCurrentUserId().equals(userProfile.getUserUuid())) { int connectionStatus = connectionsLogic.getConnectionStatus(sakaiProxy.getCurrentUserId(), userProfile.getUserUuid()); if(connectionStatus == ProfileConstants.CONNECTION_CONFIRMED) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-confirmed\"><a href=\"javascript:;\" onClick=\"return removeFriend('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\">" + Messages.getString("Label.friend.remove") + "</a></div>"); } else if(connectionStatus == ProfileConstants.CONNECTION_REQUESTED) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-request\">" + Messages.getString("Label.friend.requested") + "</div>"); } else if(connectionStatus == ProfileConstants.CONNECTION_INCOMING) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-request\">" + Messages.getString("Label.friend.requested") + "<a href=\"javascript:;\" title=\"" + Messages.getString("Label.friend.confirm") + "\" onClick=\"return confirmFriendRequest('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\"><img src=\"/library/image/silk/accept.png\"></a><a href=\"javascript:;\" title=\"" + Messages.getString("Label.friend.ignore") + "\" onClick=\"return ignoreFriendRequest('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\"><img src=\"/library/image/silk/cancel.png\"></a></div>"); } else { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-add\"><a href=\"javascript:;\" onClick=\"return requestFriend('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\">" + Messages.getString("Label.friend.add") + "</a></div>"); } sb.append("<br />"); } //status if(userProfile.getStatus() != null) { String message = userProfile.getStatus().getMessage(); if(StringUtils.isNotBlank(message)) { sb.append("<div class=\"profile2-profile-statusMessage\">"); sb.append(StringEscapeUtils.escapeHtml(message)); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getStatus().getDateFormatted())) { sb.append("<div class=\"profile2-profile-statusDate\">"); sb.append(userProfile.getStatus().getDateFormatted()); sb.append("</div>"); } } //basic info String nickname = userProfile.getNickname(); if(StringUtils.isNotBlank(nickname)) { sb.append("<div class=\"profile2-profile-nickname\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.nickname")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(nickname).toString()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getPersonalSummary())) { sb.append("<div class=\"profile2-profile-personalSummary\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.personalSummary")); sb.append("</span>"); //PRFL-389 abbreviate long personal summary int maxLength = Integer.parseInt(sakaiProxy.getServerConfigurationParameter("profile2.formatted.profile.summary.max", ProfileConstants.FORMATTED_PROFILE_SUMMARY_MAX_LENGTH)); sb.append(ProfileUtils.truncateAndAbbreviate(ProfileUtils.processHtml(userProfile.getPersonalSummary()), maxLength, true)); sb.append("</div>"); } //contact info if(StringUtils.isNotBlank(userProfile.getEmail())) { sb.append("<div class=\"profile2-profile-email\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.email")); sb.append("</span>"); sb.append(userProfile.getEmail()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getHomepage())) { sb.append("<div class=\"profile2-profile-homepage\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.homepage")); sb.append("</span>"); sb.append(userProfile.getHomepage()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getHomephone())) { sb.append("<div class=\"profile2-profile-homephone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.homephone")); sb.append("</span>"); sb.append(userProfile.getHomephone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getWorkphone())) { sb.append("<div class=\"profile2-profile-workphone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.workphone")); sb.append("</span>"); sb.append(userProfile.getWorkphone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getMobilephone())) { sb.append("<div class=\"profile2-profile-mobilephone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.mobilephone")); sb.append("</span>"); sb.append(userProfile.getMobilephone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getFacsimile())) { sb.append("<div class=\"profile2-profile-facsimile\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.facsimile")); sb.append("</span>"); sb.append(userProfile.getFacsimile()); sb.append("</div>"); } //academic info String position = userProfile.getPosition(); if(StringUtils.isNotBlank(position)) { sb.append("<div class=\"profile2-profile-position\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.position")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(position)); sb.append("</div>"); } String department = userProfile.getDepartment(); if(StringUtils.isNotBlank(department)) { sb.append("<div class=\"profile2-profile-department\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.department")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(department)); sb.append("</div>"); } String school = userProfile.getSchool(); if(StringUtils.isNotBlank(school)) { sb.append("<div class=\"profile2-profile-school\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.school")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(school)); sb.append("</div>"); } String room = userProfile.getRoom(); if(StringUtils.isNotBlank(room)) { sb.append("<div class=\"profile2-profile-room\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.room")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(room)); sb.append("</div>"); } String course = userProfile.getCourse(); if(StringUtils.isNotBlank(course)) { sb.append("<div class=\"profile2-profile-course\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.course")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(course)); sb.append("</div>"); } String subjects = userProfile.getSubjects(); if(StringUtils.isNotBlank(subjects)) { sb.append("<div class=\"profile2-profile-subjects\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.subjects")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(subjects)); sb.append("</div>"); } //personal info String favouriteBooks = userProfile.getFavouriteBooks(); if(StringUtils.isNotBlank(favouriteBooks)) { sb.append("<div class=\"profile2-profile-favouriteBooks\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteBooks")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteBooks)); sb.append("</div>"); } String favouriteTvShows = userProfile.getFavouriteTvShows(); if(StringUtils.isNotBlank(favouriteTvShows)) { sb.append("<div class=\"profile2-profile-favouriteTvShows\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteTvShows")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteTvShows)); sb.append("</div>"); } String favouriteMovies = userProfile.getFavouriteMovies(); if(StringUtils.isNotBlank(favouriteMovies)) { sb.append("<div class=\"profile2-profile-favouriteMovies\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteMovies")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteMovies)); sb.append("</div>"); } String favouriteQuotes = userProfile.getFavouriteQuotes(); if(StringUtils.isNotBlank(favouriteQuotes)) { sb.append("<div class=\"profile2-profile-favouriteQuotes\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteQuotes")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteQuotes)); sb.append("</div>"); } sb.append("</div>"); sb.append("</div>"); //add the stylesheet sb.append("<link href=\""); sb.append(ProfileConstants.ENTITY_CSS_PROFILE); sb.append("\" type=\"text/css\" rel=\"stylesheet\" media=\"all\" />"); return sb.toString(); } public void deleteEntity(EntityReference ref, Map<String, Object> params) { // TODO Auto-generated method stub } public List<?> getEntities(EntityReference ref, Search search) { // TODO Auto-generated method stub return null; } private RequestGetter requestGetter; public void setRequestGetter(RequestGetter requestGetter) { this.requestGetter = requestGetter; } public String[] getHandledOutputFormats() { return new String[] {Formats.HTML, Formats.XML, Formats.JSON}; } public String[] getHandledInputFormats() { return new String[] {Formats.XML, Formats.JSON, Formats.HTML}; } private SakaiProxy sakaiProxy; public void setSakaiProxy(SakaiProxy sakaiProxy) { this.sakaiProxy = sakaiProxy; } private ProfileLogic profileLogic; public void setProfileLogic(ProfileLogic profileLogic) { this.profileLogic = profileLogic; } private ProfileConnectionsLogic connectionsLogic; public void setConnectionsLogic(ProfileConnectionsLogic connectionsLogic) { this.connectionsLogic = connectionsLogic; } private ProfileImageLogic imageLogic; public void setImageLogic(ProfileImageLogic imageLogic) { this.imageLogic = imageLogic; } }
true
true
private String getUserProfileAsHTML(UserProfile userProfile) { //note there is no birthday in this field. we need a good way to get the birthday without the year. //maybe it needs to be stored in a separate field and treated differently. Or returned as a localised string. StringBuilder sb = new StringBuilder(); sb.append("<script type=\"text/javascript\" src=\"/profile2-tool/javascript/profile2-eb.js\"></script>"); sb.append("<div class=\"profile2-profile\">"); sb.append("<div class=\"profile2-profile-image\">"); sb.append("<img src=\""); sb.append(userProfile.getImageUrl()); sb.append("\" />"); sb.append("</div>"); sb.append("<div class=\"profile2-profile-content\">"); if(StringUtils.isNotBlank(userProfile.getUserUuid())) { sb.append("<div class=\"profile2-profile-userUuid\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.userUuid")); sb.append("</span>"); sb.append(userProfile.getUserUuid()); sb.append("</div>"); } String displayName = userProfile.getDisplayName(); if(StringUtils.isNotBlank(displayName)) { sb.append("<div class=\"profile2-profile-displayName\">"); sb.append(userProfile.getDisplayName()); sb.append(StringEscapeUtils.escapeHtml(displayName)); sb.append("</div>"); } if(!sakaiProxy.getCurrentUserId().equals(userProfile.getUserUuid())) { int connectionStatus = connectionsLogic.getConnectionStatus(sakaiProxy.getCurrentUserId(), userProfile.getUserUuid()); if(connectionStatus == ProfileConstants.CONNECTION_CONFIRMED) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-confirmed\"><a href=\"javascript:;\" onClick=\"return removeFriend('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\">" + Messages.getString("Label.friend.remove") + "</a></div>"); } else if(connectionStatus == ProfileConstants.CONNECTION_REQUESTED) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-request\">" + Messages.getString("Label.friend.requested") + "</div>"); } else if(connectionStatus == ProfileConstants.CONNECTION_INCOMING) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-request\">" + Messages.getString("Label.friend.requested") + "<a href=\"javascript:;\" title=\"" + Messages.getString("Label.friend.confirm") + "\" onClick=\"return confirmFriendRequest('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\"><img src=\"/library/image/silk/accept.png\"></a><a href=\"javascript:;\" title=\"" + Messages.getString("Label.friend.ignore") + "\" onClick=\"return ignoreFriendRequest('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\"><img src=\"/library/image/silk/cancel.png\"></a></div>"); } else { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-add\"><a href=\"javascript:;\" onClick=\"return requestFriend('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\">" + Messages.getString("Label.friend.add") + "</a></div>"); } sb.append("<br />"); } //status if(userProfile.getStatus() != null) { String message = userProfile.getStatus().getMessage(); if(StringUtils.isNotBlank(message)) { sb.append("<div class=\"profile2-profile-statusMessage\">"); sb.append(StringEscapeUtils.escapeHtml(message)); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getStatus().getDateFormatted())) { sb.append("<div class=\"profile2-profile-statusDate\">"); sb.append(userProfile.getStatus().getDateFormatted()); sb.append("</div>"); } } //basic info String nickname = userProfile.getNickname(); if(StringUtils.isNotBlank(nickname)) { sb.append("<div class=\"profile2-profile-nickname\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.nickname")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(nickname).toString()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getPersonalSummary())) { sb.append("<div class=\"profile2-profile-personalSummary\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.personalSummary")); sb.append("</span>"); //PRFL-389 abbreviate long personal summary int maxLength = Integer.parseInt(sakaiProxy.getServerConfigurationParameter("profile2.formatted.profile.summary.max", ProfileConstants.FORMATTED_PROFILE_SUMMARY_MAX_LENGTH)); sb.append(ProfileUtils.truncateAndAbbreviate(ProfileUtils.processHtml(userProfile.getPersonalSummary()), maxLength, true)); sb.append("</div>"); } //contact info if(StringUtils.isNotBlank(userProfile.getEmail())) { sb.append("<div class=\"profile2-profile-email\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.email")); sb.append("</span>"); sb.append(userProfile.getEmail()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getHomepage())) { sb.append("<div class=\"profile2-profile-homepage\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.homepage")); sb.append("</span>"); sb.append(userProfile.getHomepage()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getHomephone())) { sb.append("<div class=\"profile2-profile-homephone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.homephone")); sb.append("</span>"); sb.append(userProfile.getHomephone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getWorkphone())) { sb.append("<div class=\"profile2-profile-workphone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.workphone")); sb.append("</span>"); sb.append(userProfile.getWorkphone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getMobilephone())) { sb.append("<div class=\"profile2-profile-mobilephone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.mobilephone")); sb.append("</span>"); sb.append(userProfile.getMobilephone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getFacsimile())) { sb.append("<div class=\"profile2-profile-facsimile\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.facsimile")); sb.append("</span>"); sb.append(userProfile.getFacsimile()); sb.append("</div>"); } //academic info String position = userProfile.getPosition(); if(StringUtils.isNotBlank(position)) { sb.append("<div class=\"profile2-profile-position\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.position")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(position)); sb.append("</div>"); } String department = userProfile.getDepartment(); if(StringUtils.isNotBlank(department)) { sb.append("<div class=\"profile2-profile-department\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.department")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(department)); sb.append("</div>"); } String school = userProfile.getSchool(); if(StringUtils.isNotBlank(school)) { sb.append("<div class=\"profile2-profile-school\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.school")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(school)); sb.append("</div>"); } String room = userProfile.getRoom(); if(StringUtils.isNotBlank(room)) { sb.append("<div class=\"profile2-profile-room\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.room")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(room)); sb.append("</div>"); } String course = userProfile.getCourse(); if(StringUtils.isNotBlank(course)) { sb.append("<div class=\"profile2-profile-course\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.course")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(course)); sb.append("</div>"); } String subjects = userProfile.getSubjects(); if(StringUtils.isNotBlank(subjects)) { sb.append("<div class=\"profile2-profile-subjects\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.subjects")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(subjects)); sb.append("</div>"); } //personal info String favouriteBooks = userProfile.getFavouriteBooks(); if(StringUtils.isNotBlank(favouriteBooks)) { sb.append("<div class=\"profile2-profile-favouriteBooks\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteBooks")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteBooks)); sb.append("</div>"); } String favouriteTvShows = userProfile.getFavouriteTvShows(); if(StringUtils.isNotBlank(favouriteTvShows)) { sb.append("<div class=\"profile2-profile-favouriteTvShows\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteTvShows")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteTvShows)); sb.append("</div>"); } String favouriteMovies = userProfile.getFavouriteMovies(); if(StringUtils.isNotBlank(favouriteMovies)) { sb.append("<div class=\"profile2-profile-favouriteMovies\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteMovies")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteMovies)); sb.append("</div>"); } String favouriteQuotes = userProfile.getFavouriteQuotes(); if(StringUtils.isNotBlank(favouriteQuotes)) { sb.append("<div class=\"profile2-profile-favouriteQuotes\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteQuotes")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteQuotes)); sb.append("</div>"); } sb.append("</div>"); sb.append("</div>"); //add the stylesheet sb.append("<link href=\""); sb.append(ProfileConstants.ENTITY_CSS_PROFILE); sb.append("\" type=\"text/css\" rel=\"stylesheet\" media=\"all\" />"); return sb.toString(); }
private String getUserProfileAsHTML(UserProfile userProfile) { //note there is no birthday in this field. we need a good way to get the birthday without the year. //maybe it needs to be stored in a separate field and treated differently. Or returned as a localised string. StringBuilder sb = new StringBuilder(); sb.append("<script type=\"text/javascript\" src=\"/profile2-tool/javascript/profile2-eb.js\"></script>"); sb.append("<div class=\"profile2-profile\">"); sb.append("<div class=\"profile2-profile-image\">"); sb.append("<img src=\""); sb.append(userProfile.getImageUrl()); sb.append("\" />"); sb.append("</div>"); sb.append("<div class=\"profile2-profile-content\">"); if(StringUtils.isNotBlank(userProfile.getUserUuid())) { sb.append("<div class=\"profile2-profile-userUuid\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.userUuid")); sb.append("</span>"); sb.append(userProfile.getUserUuid()); sb.append("</div>"); } String displayName = userProfile.getDisplayName(); if(StringUtils.isNotBlank(displayName)) { sb.append("<div class=\"profile2-profile-displayName\">"); sb.append(StringEscapeUtils.escapeHtml(displayName)); sb.append("</div>"); } if(!sakaiProxy.getCurrentUserId().equals(userProfile.getUserUuid())) { int connectionStatus = connectionsLogic.getConnectionStatus(sakaiProxy.getCurrentUserId(), userProfile.getUserUuid()); if(connectionStatus == ProfileConstants.CONNECTION_CONFIRMED) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-confirmed\"><a href=\"javascript:;\" onClick=\"return removeFriend('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\">" + Messages.getString("Label.friend.remove") + "</a></div>"); } else if(connectionStatus == ProfileConstants.CONNECTION_REQUESTED) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-request\">" + Messages.getString("Label.friend.requested") + "</div>"); } else if(connectionStatus == ProfileConstants.CONNECTION_INCOMING) { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-request\">" + Messages.getString("Label.friend.requested") + "<a href=\"javascript:;\" title=\"" + Messages.getString("Label.friend.confirm") + "\" onClick=\"return confirmFriendRequest('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\"><img src=\"/library/image/silk/accept.png\"></a><a href=\"javascript:;\" title=\"" + Messages.getString("Label.friend.ignore") + "\" onClick=\"return ignoreFriendRequest('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\"><img src=\"/library/image/silk/cancel.png\"></a></div>"); } else { sb.append("<div id=\"profile_friend_" + userProfile.getUserUuid() + "\" class=\"icon connection-add\"><a href=\"javascript:;\" onClick=\"return requestFriend('" + sakaiProxy.getCurrentUserId() + "','" + userProfile.getUserUuid() + "');\">" + Messages.getString("Label.friend.add") + "</a></div>"); } sb.append("<br />"); } //status if(userProfile.getStatus() != null) { String message = userProfile.getStatus().getMessage(); if(StringUtils.isNotBlank(message)) { sb.append("<div class=\"profile2-profile-statusMessage\">"); sb.append(StringEscapeUtils.escapeHtml(message)); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getStatus().getDateFormatted())) { sb.append("<div class=\"profile2-profile-statusDate\">"); sb.append(userProfile.getStatus().getDateFormatted()); sb.append("</div>"); } } //basic info String nickname = userProfile.getNickname(); if(StringUtils.isNotBlank(nickname)) { sb.append("<div class=\"profile2-profile-nickname\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.nickname")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(nickname).toString()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getPersonalSummary())) { sb.append("<div class=\"profile2-profile-personalSummary\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.personalSummary")); sb.append("</span>"); //PRFL-389 abbreviate long personal summary int maxLength = Integer.parseInt(sakaiProxy.getServerConfigurationParameter("profile2.formatted.profile.summary.max", ProfileConstants.FORMATTED_PROFILE_SUMMARY_MAX_LENGTH)); sb.append(ProfileUtils.truncateAndAbbreviate(ProfileUtils.processHtml(userProfile.getPersonalSummary()), maxLength, true)); sb.append("</div>"); } //contact info if(StringUtils.isNotBlank(userProfile.getEmail())) { sb.append("<div class=\"profile2-profile-email\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.email")); sb.append("</span>"); sb.append(userProfile.getEmail()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getHomepage())) { sb.append("<div class=\"profile2-profile-homepage\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.homepage")); sb.append("</span>"); sb.append(userProfile.getHomepage()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getHomephone())) { sb.append("<div class=\"profile2-profile-homephone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.homephone")); sb.append("</span>"); sb.append(userProfile.getHomephone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getWorkphone())) { sb.append("<div class=\"profile2-profile-workphone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.workphone")); sb.append("</span>"); sb.append(userProfile.getWorkphone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getMobilephone())) { sb.append("<div class=\"profile2-profile-mobilephone\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.mobilephone")); sb.append("</span>"); sb.append(userProfile.getMobilephone()); sb.append("</div>"); } if(StringUtils.isNotBlank(userProfile.getFacsimile())) { sb.append("<div class=\"profile2-profile-facsimile\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.facsimile")); sb.append("</span>"); sb.append(userProfile.getFacsimile()); sb.append("</div>"); } //academic info String position = userProfile.getPosition(); if(StringUtils.isNotBlank(position)) { sb.append("<div class=\"profile2-profile-position\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.position")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(position)); sb.append("</div>"); } String department = userProfile.getDepartment(); if(StringUtils.isNotBlank(department)) { sb.append("<div class=\"profile2-profile-department\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.department")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(department)); sb.append("</div>"); } String school = userProfile.getSchool(); if(StringUtils.isNotBlank(school)) { sb.append("<div class=\"profile2-profile-school\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.school")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(school)); sb.append("</div>"); } String room = userProfile.getRoom(); if(StringUtils.isNotBlank(room)) { sb.append("<div class=\"profile2-profile-room\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.room")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(room)); sb.append("</div>"); } String course = userProfile.getCourse(); if(StringUtils.isNotBlank(course)) { sb.append("<div class=\"profile2-profile-course\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.course")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(course)); sb.append("</div>"); } String subjects = userProfile.getSubjects(); if(StringUtils.isNotBlank(subjects)) { sb.append("<div class=\"profile2-profile-subjects\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.subjects")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(subjects)); sb.append("</div>"); } //personal info String favouriteBooks = userProfile.getFavouriteBooks(); if(StringUtils.isNotBlank(favouriteBooks)) { sb.append("<div class=\"profile2-profile-favouriteBooks\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteBooks")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteBooks)); sb.append("</div>"); } String favouriteTvShows = userProfile.getFavouriteTvShows(); if(StringUtils.isNotBlank(favouriteTvShows)) { sb.append("<div class=\"profile2-profile-favouriteTvShows\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteTvShows")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteTvShows)); sb.append("</div>"); } String favouriteMovies = userProfile.getFavouriteMovies(); if(StringUtils.isNotBlank(favouriteMovies)) { sb.append("<div class=\"profile2-profile-favouriteMovies\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteMovies")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteMovies)); sb.append("</div>"); } String favouriteQuotes = userProfile.getFavouriteQuotes(); if(StringUtils.isNotBlank(favouriteQuotes)) { sb.append("<div class=\"profile2-profile-favouriteQuotes\">"); sb.append("<span class=\"profile2-profile-label\">"); sb.append(Messages.getString("Label.favouriteQuotes")); sb.append("</span>"); sb.append(StringEscapeUtils.escapeHtml(favouriteQuotes)); sb.append("</div>"); } sb.append("</div>"); sb.append("</div>"); //add the stylesheet sb.append("<link href=\""); sb.append(ProfileConstants.ENTITY_CSS_PROFILE); sb.append("\" type=\"text/css\" rel=\"stylesheet\" media=\"all\" />"); return sb.toString(); }
diff --git a/insight/insight-camel/src/main/java/org/fusesource/insight/camel/breadcrumb/Breadcrumbs.java b/insight/insight-camel/src/main/java/org/fusesource/insight/camel/breadcrumb/Breadcrumbs.java index b72822ad9..744190aa1 100644 --- a/insight/insight-camel/src/main/java/org/fusesource/insight/camel/breadcrumb/Breadcrumbs.java +++ b/insight/insight-camel/src/main/java/org/fusesource/insight/camel/breadcrumb/Breadcrumbs.java @@ -1,106 +1,107 @@ /** * Copyright (C) FuseSource, Inc. * http://fusesource.com * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.fusesource.insight.camel.breadcrumb; import org.apache.camel.CamelContext; import org.apache.camel.Exchange; import org.apache.camel.Processor; import org.apache.camel.api.management.ManagedResource; import org.apache.camel.model.ProcessorDefinition; import org.apache.camel.spi.ProcessorFactory; import org.apache.camel.spi.RouteContext; import org.fusesource.insight.camel.base.SwitchableContainerStrategy; import java.util.HashSet; import java.util.Set; /** * */ @ManagedResource(description = "Breadcrumbs") public class Breadcrumbs extends SwitchableContainerStrategy implements BreadcrumbsMBean { public static final String BREADCRUMB = "ExtendedBreadcrumb"; public Breadcrumbs() { enable(); } @Override public void manage(CamelContext context) throws Exception { final ProcessorFactory delegate = context.getProcessorFactory(); context.setProcessorFactory(new ProcessorFactory() { @Override public Processor createChildProcessor(RouteContext routeContext, ProcessorDefinition<?> definition, boolean mandatory) throws Exception { Processor proc = delegate != null ? delegate.createChildProcessor(routeContext, definition, mandatory) : definition.createOutputsProcessor(routeContext); return wrap(routeContext, definition, proc); } @Override public Processor createProcessor(RouteContext routeContext, ProcessorDefinition<?> definition) throws Exception { Processor proc = delegate != null ? delegate.createProcessor(routeContext, definition) : definition.createProcessor(routeContext); return wrap(routeContext, definition, proc); } }); } public Processor wrap(RouteContext routeContext, ProcessorDefinition<?> definition, Processor processor) { if (processor == null) { return null; } return new BreadcrumbsProcessor(this, processor); } public static Set<String> getBreadcrumbs(Exchange exchange) { Object val = exchange.getIn().getHeader(BREADCRUMB); Set<String> breadcrumbs; if (val instanceof BreadcrumbSet) { return (BreadcrumbSet) val; } breadcrumbs = new BreadcrumbSet(); + exchange.getIn().setHeader(BREADCRUMB, breadcrumbs); if (val instanceof Iterable) { for (Object o : ((Iterable) val)) { if (o != null) { breadcrumbs.add(o.toString()); } } } else if (val != null) { breadcrumbs.add(val.toString()); } return breadcrumbs; } public static Set<String> getBreadcrumbs(Exchange... exchanges) { Set<String> breadcrumbs = new BreadcrumbSet(); for (Exchange exchange : exchanges) { if (exchange != null) { breadcrumbs.addAll(getBreadcrumbs(exchange)); } } return breadcrumbs; } public static void setBreadcrumbs(Exchange exchange, Set<String> breadcrumbs) { exchange.getIn().setHeader(BREADCRUMB, breadcrumbs); } private static class BreadcrumbSet extends HashSet<String> { } }
true
true
public static Set<String> getBreadcrumbs(Exchange exchange) { Object val = exchange.getIn().getHeader(BREADCRUMB); Set<String> breadcrumbs; if (val instanceof BreadcrumbSet) { return (BreadcrumbSet) val; } breadcrumbs = new BreadcrumbSet(); if (val instanceof Iterable) { for (Object o : ((Iterable) val)) { if (o != null) { breadcrumbs.add(o.toString()); } } } else if (val != null) { breadcrumbs.add(val.toString()); } return breadcrumbs; }
public static Set<String> getBreadcrumbs(Exchange exchange) { Object val = exchange.getIn().getHeader(BREADCRUMB); Set<String> breadcrumbs; if (val instanceof BreadcrumbSet) { return (BreadcrumbSet) val; } breadcrumbs = new BreadcrumbSet(); exchange.getIn().setHeader(BREADCRUMB, breadcrumbs); if (val instanceof Iterable) { for (Object o : ((Iterable) val)) { if (o != null) { breadcrumbs.add(o.toString()); } } } else if (val != null) { breadcrumbs.add(val.toString()); } return breadcrumbs; }
diff --git a/izpack-src/trunk/src/lib/com/izforge/izpack/installer/Unpacker.java b/izpack-src/trunk/src/lib/com/izforge/izpack/installer/Unpacker.java index 32fde411..ca071d6c 100644 --- a/izpack-src/trunk/src/lib/com/izforge/izpack/installer/Unpacker.java +++ b/izpack-src/trunk/src/lib/com/izforge/izpack/installer/Unpacker.java @@ -1,601 +1,606 @@ /* * $Id$ * IzPack - Copyright 2001-2008 Julien Ponge, All Rights Reserved. * * http://izpack.org/ * http://izpack.codehaus.org/ * * Copyright 2001 Johannes Lehtinen * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.izforge.izpack.installer; import com.izforge.izpack.*; import com.izforge.izpack.event.InstallerListener; import com.izforge.izpack.util.*; import java.io.*; import java.lang.reflect.Constructor; import java.net.URL; import java.util.ArrayList; import java.util.List; import java.util.jar.Pack200; /** * Unpacker class. * * @author Julien Ponge * @author Johannes Lehtinen */ public class Unpacker extends UnpackerBase { private static final String tempSubPath = "/IzpackWebTemp"; private Pack200.Unpacker unpacker; /** * The constructor. * * @param idata The installation data. * @param handler The installation progress handler. */ public Unpacker(AutomatedInstallData idata, AbstractUIProgressHandler handler) { super(idata, handler); } /* (non-Javadoc) * @see com.izforge.izpack.installer.IUnpacker#run() */ public void run() { addToInstances(); try { // // Initialisations FileOutputStream out = null; ArrayList<ParsableFile> parsables = new ArrayList<ParsableFile>(); ArrayList<ExecutableFile> executables = new ArrayList<ExecutableFile>(); ArrayList<UpdateCheck> updatechecks = new ArrayList<UpdateCheck>(); List packs = idata.selectedPacks; int npacks = packs.size(); handler.startAction("Unpacking", npacks); udata = UninstallData.getInstance(); // Custom action listener stuff --- load listeners ---- List[] customActions = getCustomActions(); // Custom action listener stuff --- beforePacks ---- informListeners(customActions, InstallerListener.BEFORE_PACKS, idata, npacks, handler); packs = idata.selectedPacks; npacks = packs.size(); // We unpack the selected packs for (int i = 0; i < npacks; i++) { // We get the pack stream //int n = idata.allPacks.indexOf(packs.get(i)); Pack p = (Pack) packs.get(i); // evaluate condition if (p.hasCondition()) { if (rules != null) { if (!rules.isConditionTrue(p.getCondition())) { // skip pack, condition is not fullfilled. continue; } } else { // TODO: skip pack, because condition can not be checked } } // Custom action listener stuff --- beforePack ---- informListeners(customActions, InstallerListener.BEFORE_PACK, packs.get(i), npacks, handler); ObjectInputStream objIn = new ObjectInputStream(getPackAsStream(p.id, p.uninstall)); // We unpack the files int nfiles = objIn.readInt(); // We get the internationalized name of the pack final Pack pack = ((Pack) packs.get(i)); String stepname = pack.name;// the message to be passed to the // installpanel if (langpack != null && !(pack.id == null || "".equals(pack.id))) { final String name = langpack.getString(pack.id); if (name != null && !"".equals(name)) { stepname = name; } } handler.nextStep(stepname, i + 1, nfiles); for (int j = 0; j < nfiles; j++) { // We read the header PackFile pf = (PackFile) objIn.readObject(); // TODO: reaction if condition can not be checked if (pf.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(pf.getCondition())) { if (!pf.isBackReference()){ // skip, condition is not fulfilled objIn.skip(pf.length()); } continue; } } if (OsConstraint.oneMatchesCurrentSystem(pf.osConstraints())) { // We translate & build the path String path = IoHelper.translatePath(pf.getTargetPath(), vs); File pathFile = new File(path); File dest = pathFile; if (!pf.isDirectory()) { dest = pathFile.getParentFile(); } if (!dest.exists()) { // If there are custom actions which would be called // at // creating a directory, create it recursively. List fileListeners = customActions[customActions.length - 1]; if (fileListeners != null && fileListeners.size() > 0) { mkDirsWithEnhancement(dest, pf, customActions); } else // Create it in on step. { if (!dest.mkdirs()) { handler.emitError("Error creating directories", "Could not create directory\n" + dest.getPath()); handler.stopAction(); this.result = false; return; } } } if (pf.isDirectory()) { continue; } // Custom action listener stuff --- beforeFile ---- informListeners(customActions, InstallerListener.BEFORE_FILE, pathFile, pf, null); // We add the path to the log, udata.addFile(path, pack.uninstall); handler.progress(j, path); // if this file exists and should not be overwritten, // check // what to do if ((pathFile.exists()) && (pf.override() != PackFile.OVERRIDE_TRUE)) { boolean overwritefile = false; // don't overwrite file if the user said so if (pf.override() != PackFile.OVERRIDE_FALSE) { if (pf.override() == PackFile.OVERRIDE_TRUE) { overwritefile = true; } else if (pf.override() == PackFile.OVERRIDE_UPDATE) { // check mtime of involved files // (this is not 100% perfect, because the // already existing file might // still be modified but the new installed // is just a bit newer; we would // need the creation time of the existing // file or record with which mtime // it was installed...) overwritefile = (pathFile.lastModified() < pf.lastModified()); } else { int def_choice = -1; if (pf.override() == PackFile.OVERRIDE_ASK_FALSE) { def_choice = AbstractUIHandler.ANSWER_NO; } if (pf.override() == PackFile.OVERRIDE_ASK_TRUE) { def_choice = AbstractUIHandler.ANSWER_YES; } int answer = handler.askQuestion(idata.langpack .getString("InstallPanel.overwrite.title") + " - " + pathFile.getName(), idata.langpack .getString("InstallPanel.overwrite.question") + pathFile.getAbsolutePath(), AbstractUIHandler.CHOICES_YES_NO, def_choice); overwritefile = (answer == AbstractUIHandler.ANSWER_YES); } } if (!overwritefile) { if (!pf.isBackReference() && !((Pack) packs.get(i)).loose) { objIn.skip(pf.length()); } continue; } } // We copy the file InputStream pis = objIn; if (pf.isBackReference()) { InputStream is = getPackAsStream(pf.previousPackId, pack.uninstall); pis = new ObjectInputStream(is); // must wrap for blockdata use by objectstream // (otherwise strange result) // skip on underlaying stream (for some reason not // possible on ObjectStream) is.skip(pf.offsetInPreviousPack - 4); // but the stream header is now already read (== 4 // bytes) } else if (((Pack) packs.get(i)).loose) { /* Old way of doing the job by using the (absolute) sourcepath. * Since this is very likely to fail and does not confirm to the documentation, * prefer using relative path's pis = new FileInputStream(pf.sourcePath); */ File resolvedFile = new File(getAbsolutInstallSource(), pf .getRelativeSourcePath()); if (!resolvedFile.exists()) { //try alternative destination - the current working directory //user.dir is likely (depends on launcher type) the current directory of the executable or jar-file... final File userDir = new File(System.getProperty("user.dir")); resolvedFile = new File(userDir, pf.getRelativeSourcePath()); } if (resolvedFile.exists()) { pis = new FileInputStream(resolvedFile); //may have a different length & last modified than we had at compiletime, therefore we have to build a new PackFile for the copy process... pf = new PackFile(resolvedFile.getParentFile(), resolvedFile, pf.getTargetPath(), pf.osConstraints(), pf.override(), pf.getAdditionals()); } else { //file not found //issue a warning (logging api pending) //since this file was loosely bundled, we continue with the installation. System.out.println("Could not find loosely bundled file: " + pf.getRelativeSourcePath()); out.close(); continue; } } if (pf.isPack200Jar()) { int key = objIn.readInt(); InputStream pack200Input = Unpacker.class.getResourceAsStream("/packs/pack200-" + key); Pack200.Unpacker unpacker = getPack200Unpacker(); java.util.jar.JarOutputStream jarOut = new java.util.jar.JarOutputStream(new FileOutputStream(pathFile)); unpacker.unpack(pack200Input, jarOut); jarOut.close(); } else { out = new FileOutputStream(pathFile); byte[] buffer = new byte[5120]; long bytesCopied = 0; while (bytesCopied < pf.length()) { if (performInterrupted()) { // Interrupt was initiated; perform it. out.close(); if (pis != objIn) { pis.close(); } return; } int maxBytes = (int) Math.min(pf.length() - bytesCopied, buffer.length); int bytesInBuffer = pis.read(buffer, 0, maxBytes); if (bytesInBuffer == -1) { throw new IOException("Unexpected end of stream (installer corrupted?)"); } out.write(buffer, 0, bytesInBuffer); bytesCopied += bytesInBuffer; } out.close(); } if (pis != objIn) { pis.close(); } // Set file modification time if specified if (pf.lastModified() >= 0) { pathFile.setLastModified(pf.lastModified()); } // Custom action listener stuff --- afterFile ---- informListeners(customActions, InstallerListener.AFTER_FILE, pathFile, pf, null); } else { if (!pf.isBackReference()) { objIn.skip(pf.length()); } } } // Load information about parsable files int numParsables = objIn.readInt(); for (int k = 0; k < numParsables; k++) { ParsableFile pf = (ParsableFile) objIn.readObject(); if (pf.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(pf.getCondition())) { // skip, condition is not fulfilled continue; } } pf.path = IoHelper.translatePath(pf.path, vs); parsables.add(pf); } // Load information about executable files int numExecutables = objIn.readInt(); for (int k = 0; k < numExecutables; k++) { ExecutableFile ef = (ExecutableFile) objIn.readObject(); if (ef.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(ef.getCondition())) { // skip, condition is false continue; } } ef.path = IoHelper.translatePath(ef.path, vs); if (null != ef.argList && !ef.argList.isEmpty()) { String arg = null; for (int j = 0; j < ef.argList.size(); j++) { arg = ef.argList.get(j); arg = IoHelper.translatePath(arg, vs); ef.argList.set(j, arg); } } executables.add(ef); if (ef.executionStage == ExecutableFile.UNINSTALL) { udata.addExecutable(ef); } } // Custom action listener stuff --- uninstall data ---- handleAdditionalUninstallData(udata, customActions); // Load information about updatechecks int numUpdateChecks = objIn.readInt(); for (int k = 0; k < numUpdateChecks; k++) { UpdateCheck uc = (UpdateCheck) objIn.readObject(); updatechecks.add(uc); } objIn.close(); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // Custom action listener stuff --- afterPack ---- informListeners(customActions, InstallerListener.AFTER_PACK, packs.get(i), i, handler); } // We use the scripts parser ScriptParser parser = new ScriptParser(parsables, vs); parser.parseFiles(); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // We use the file executor FileExecutor executor = new FileExecutor(executables); if (executor.executeFiles(ExecutableFile.POSTINSTALL, handler) != 0) { handler.emitError("File execution failed", "The installation was not completed"); this.result = false; } if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // We put the uninstaller (it's not yet complete...) putUninstaller(); // update checks _after_ uninstaller was put, so we don't delete it performUpdateChecks(updatechecks); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // Custom action listener stuff --- afterPacks ---- informListeners(customActions, InstallerListener.AFTER_PACKS, idata, handler, null); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // write installation information writeInstallationInformation(); // The end :-) handler.stopAction(); } catch (Exception err) { // TODO: finer grained error handling with useful error messages handler.stopAction(); - if ("Installation cancelled".equals(err.getMessage())) + String message = err.getMessage(); + if ("Installation cancelled".equals(message)) { handler.emitNotification("Installation cancelled"); } else { - handler.emitError("An error occured", err.getMessage()); + if (message == null || message.isEmpty()) + { + message = "Internal error occured : " + err.toString(); + } + handler.emitError("An error occured", message); err.printStackTrace(); } this.result = false; Housekeeper.getInstance().shutDown(4); } finally { removeFromInstances(); } } private Pack200.Unpacker getPack200Unpacker() { if (unpacker == null) { unpacker = Pack200.newUnpacker(); } return unpacker; } /** * Returns a stream to a pack, location depending on if it's web based. * * @param uninstall true if pack must be uninstalled * @return The stream or null if it could not be found. * @throws Exception Description of the Exception */ private InputStream getPackAsStream(String packid, boolean uninstall) throws Exception { InputStream in = null; String webDirURL = idata.info.getWebDirURL(); packid = "-" + packid; if (webDirURL == null) // local { in = Unpacker.class.getResourceAsStream("/packs/pack" + packid); } else // web based { // TODO: Look first in same directory as primary jar // This may include prompting for changing of media // TODO: download and cache them all before starting copy process // See compiler.Packager#getJarOutputStream for the counterpart String baseName = idata.info.getInstallerBase(); String packURL = webDirURL + "/" + baseName + ".pack" + packid + ".jar"; String tf = IoHelper.translatePath(idata.info.getUninstallerPath()+ Unpacker.tempSubPath, vs); String tempfile; try { tempfile = WebRepositoryAccessor.getCachedUrl(packURL, tf); udata.addFile(tempfile, uninstall); } catch (Exception e) { if ("Cancelled".equals(e.getMessage())) { throw new InstallerException("Installation cancelled", e); } else { throw new InstallerException("Installation failed", e); } } URL url = new URL("jar:" + tempfile + "!/packs/pack" + packid); //URL url = new URL("jar:" + packURL + "!/packs/pack" + packid); // JarURLConnection jarConnection = (JarURLConnection) // url.openConnection(); // TODO: what happens when using an automated installer? in = new WebAccessor(null).openInputStream(url); // TODO: Fails miserably when pack jars are not found, so this is // temporary if (in == null) { throw new InstallerException(url.toString() + " not available", new FileNotFoundException(url.toString())); } } if (in != null && idata.info.getPackDecoderClassName() != null) { Class<Object> decoder = (Class<Object>) Class.forName(idata.info.getPackDecoderClassName()); Class[] paramsClasses = new Class[1]; paramsClasses[0] = Class.forName("java.io.InputStream"); Constructor<Object> constructor = decoder.getDeclaredConstructor(paramsClasses); // Our first used decoder input stream (bzip2) reads byte for byte from // the source. Therefore we put a buffering stream between it and the // source. InputStream buffer = new BufferedInputStream(in); Object[] params = {buffer}; Object instance = null; instance = constructor.newInstance(params); if (!InputStream.class.isInstance(instance)) { throw new InstallerException("'" + idata.info.getPackDecoderClassName() + "' must be derived from " + InputStream.class.toString()); } in = (InputStream) instance; } return in; } }
false
true
public void run() { addToInstances(); try { // // Initialisations FileOutputStream out = null; ArrayList<ParsableFile> parsables = new ArrayList<ParsableFile>(); ArrayList<ExecutableFile> executables = new ArrayList<ExecutableFile>(); ArrayList<UpdateCheck> updatechecks = new ArrayList<UpdateCheck>(); List packs = idata.selectedPacks; int npacks = packs.size(); handler.startAction("Unpacking", npacks); udata = UninstallData.getInstance(); // Custom action listener stuff --- load listeners ---- List[] customActions = getCustomActions(); // Custom action listener stuff --- beforePacks ---- informListeners(customActions, InstallerListener.BEFORE_PACKS, idata, npacks, handler); packs = idata.selectedPacks; npacks = packs.size(); // We unpack the selected packs for (int i = 0; i < npacks; i++) { // We get the pack stream //int n = idata.allPacks.indexOf(packs.get(i)); Pack p = (Pack) packs.get(i); // evaluate condition if (p.hasCondition()) { if (rules != null) { if (!rules.isConditionTrue(p.getCondition())) { // skip pack, condition is not fullfilled. continue; } } else { // TODO: skip pack, because condition can not be checked } } // Custom action listener stuff --- beforePack ---- informListeners(customActions, InstallerListener.BEFORE_PACK, packs.get(i), npacks, handler); ObjectInputStream objIn = new ObjectInputStream(getPackAsStream(p.id, p.uninstall)); // We unpack the files int nfiles = objIn.readInt(); // We get the internationalized name of the pack final Pack pack = ((Pack) packs.get(i)); String stepname = pack.name;// the message to be passed to the // installpanel if (langpack != null && !(pack.id == null || "".equals(pack.id))) { final String name = langpack.getString(pack.id); if (name != null && !"".equals(name)) { stepname = name; } } handler.nextStep(stepname, i + 1, nfiles); for (int j = 0; j < nfiles; j++) { // We read the header PackFile pf = (PackFile) objIn.readObject(); // TODO: reaction if condition can not be checked if (pf.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(pf.getCondition())) { if (!pf.isBackReference()){ // skip, condition is not fulfilled objIn.skip(pf.length()); } continue; } } if (OsConstraint.oneMatchesCurrentSystem(pf.osConstraints())) { // We translate & build the path String path = IoHelper.translatePath(pf.getTargetPath(), vs); File pathFile = new File(path); File dest = pathFile; if (!pf.isDirectory()) { dest = pathFile.getParentFile(); } if (!dest.exists()) { // If there are custom actions which would be called // at // creating a directory, create it recursively. List fileListeners = customActions[customActions.length - 1]; if (fileListeners != null && fileListeners.size() > 0) { mkDirsWithEnhancement(dest, pf, customActions); } else // Create it in on step. { if (!dest.mkdirs()) { handler.emitError("Error creating directories", "Could not create directory\n" + dest.getPath()); handler.stopAction(); this.result = false; return; } } } if (pf.isDirectory()) { continue; } // Custom action listener stuff --- beforeFile ---- informListeners(customActions, InstallerListener.BEFORE_FILE, pathFile, pf, null); // We add the path to the log, udata.addFile(path, pack.uninstall); handler.progress(j, path); // if this file exists and should not be overwritten, // check // what to do if ((pathFile.exists()) && (pf.override() != PackFile.OVERRIDE_TRUE)) { boolean overwritefile = false; // don't overwrite file if the user said so if (pf.override() != PackFile.OVERRIDE_FALSE) { if (pf.override() == PackFile.OVERRIDE_TRUE) { overwritefile = true; } else if (pf.override() == PackFile.OVERRIDE_UPDATE) { // check mtime of involved files // (this is not 100% perfect, because the // already existing file might // still be modified but the new installed // is just a bit newer; we would // need the creation time of the existing // file or record with which mtime // it was installed...) overwritefile = (pathFile.lastModified() < pf.lastModified()); } else { int def_choice = -1; if (pf.override() == PackFile.OVERRIDE_ASK_FALSE) { def_choice = AbstractUIHandler.ANSWER_NO; } if (pf.override() == PackFile.OVERRIDE_ASK_TRUE) { def_choice = AbstractUIHandler.ANSWER_YES; } int answer = handler.askQuestion(idata.langpack .getString("InstallPanel.overwrite.title") + " - " + pathFile.getName(), idata.langpack .getString("InstallPanel.overwrite.question") + pathFile.getAbsolutePath(), AbstractUIHandler.CHOICES_YES_NO, def_choice); overwritefile = (answer == AbstractUIHandler.ANSWER_YES); } } if (!overwritefile) { if (!pf.isBackReference() && !((Pack) packs.get(i)).loose) { objIn.skip(pf.length()); } continue; } } // We copy the file InputStream pis = objIn; if (pf.isBackReference()) { InputStream is = getPackAsStream(pf.previousPackId, pack.uninstall); pis = new ObjectInputStream(is); // must wrap for blockdata use by objectstream // (otherwise strange result) // skip on underlaying stream (for some reason not // possible on ObjectStream) is.skip(pf.offsetInPreviousPack - 4); // but the stream header is now already read (== 4 // bytes) } else if (((Pack) packs.get(i)).loose) { /* Old way of doing the job by using the (absolute) sourcepath. * Since this is very likely to fail and does not confirm to the documentation, * prefer using relative path's pis = new FileInputStream(pf.sourcePath); */ File resolvedFile = new File(getAbsolutInstallSource(), pf .getRelativeSourcePath()); if (!resolvedFile.exists()) { //try alternative destination - the current working directory //user.dir is likely (depends on launcher type) the current directory of the executable or jar-file... final File userDir = new File(System.getProperty("user.dir")); resolvedFile = new File(userDir, pf.getRelativeSourcePath()); } if (resolvedFile.exists()) { pis = new FileInputStream(resolvedFile); //may have a different length & last modified than we had at compiletime, therefore we have to build a new PackFile for the copy process... pf = new PackFile(resolvedFile.getParentFile(), resolvedFile, pf.getTargetPath(), pf.osConstraints(), pf.override(), pf.getAdditionals()); } else { //file not found //issue a warning (logging api pending) //since this file was loosely bundled, we continue with the installation. System.out.println("Could not find loosely bundled file: " + pf.getRelativeSourcePath()); out.close(); continue; } } if (pf.isPack200Jar()) { int key = objIn.readInt(); InputStream pack200Input = Unpacker.class.getResourceAsStream("/packs/pack200-" + key); Pack200.Unpacker unpacker = getPack200Unpacker(); java.util.jar.JarOutputStream jarOut = new java.util.jar.JarOutputStream(new FileOutputStream(pathFile)); unpacker.unpack(pack200Input, jarOut); jarOut.close(); } else { out = new FileOutputStream(pathFile); byte[] buffer = new byte[5120]; long bytesCopied = 0; while (bytesCopied < pf.length()) { if (performInterrupted()) { // Interrupt was initiated; perform it. out.close(); if (pis != objIn) { pis.close(); } return; } int maxBytes = (int) Math.min(pf.length() - bytesCopied, buffer.length); int bytesInBuffer = pis.read(buffer, 0, maxBytes); if (bytesInBuffer == -1) { throw new IOException("Unexpected end of stream (installer corrupted?)"); } out.write(buffer, 0, bytesInBuffer); bytesCopied += bytesInBuffer; } out.close(); } if (pis != objIn) { pis.close(); } // Set file modification time if specified if (pf.lastModified() >= 0) { pathFile.setLastModified(pf.lastModified()); } // Custom action listener stuff --- afterFile ---- informListeners(customActions, InstallerListener.AFTER_FILE, pathFile, pf, null); } else { if (!pf.isBackReference()) { objIn.skip(pf.length()); } } } // Load information about parsable files int numParsables = objIn.readInt(); for (int k = 0; k < numParsables; k++) { ParsableFile pf = (ParsableFile) objIn.readObject(); if (pf.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(pf.getCondition())) { // skip, condition is not fulfilled continue; } } pf.path = IoHelper.translatePath(pf.path, vs); parsables.add(pf); } // Load information about executable files int numExecutables = objIn.readInt(); for (int k = 0; k < numExecutables; k++) { ExecutableFile ef = (ExecutableFile) objIn.readObject(); if (ef.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(ef.getCondition())) { // skip, condition is false continue; } } ef.path = IoHelper.translatePath(ef.path, vs); if (null != ef.argList && !ef.argList.isEmpty()) { String arg = null; for (int j = 0; j < ef.argList.size(); j++) { arg = ef.argList.get(j); arg = IoHelper.translatePath(arg, vs); ef.argList.set(j, arg); } } executables.add(ef); if (ef.executionStage == ExecutableFile.UNINSTALL) { udata.addExecutable(ef); } } // Custom action listener stuff --- uninstall data ---- handleAdditionalUninstallData(udata, customActions); // Load information about updatechecks int numUpdateChecks = objIn.readInt(); for (int k = 0; k < numUpdateChecks; k++) { UpdateCheck uc = (UpdateCheck) objIn.readObject(); updatechecks.add(uc); } objIn.close(); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // Custom action listener stuff --- afterPack ---- informListeners(customActions, InstallerListener.AFTER_PACK, packs.get(i), i, handler); } // We use the scripts parser ScriptParser parser = new ScriptParser(parsables, vs); parser.parseFiles(); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // We use the file executor FileExecutor executor = new FileExecutor(executables); if (executor.executeFiles(ExecutableFile.POSTINSTALL, handler) != 0) { handler.emitError("File execution failed", "The installation was not completed"); this.result = false; } if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // We put the uninstaller (it's not yet complete...) putUninstaller(); // update checks _after_ uninstaller was put, so we don't delete it performUpdateChecks(updatechecks); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // Custom action listener stuff --- afterPacks ---- informListeners(customActions, InstallerListener.AFTER_PACKS, idata, handler, null); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // write installation information writeInstallationInformation(); // The end :-) handler.stopAction(); } catch (Exception err) { // TODO: finer grained error handling with useful error messages handler.stopAction(); if ("Installation cancelled".equals(err.getMessage())) { handler.emitNotification("Installation cancelled"); } else { handler.emitError("An error occured", err.getMessage()); err.printStackTrace(); } this.result = false; Housekeeper.getInstance().shutDown(4); } finally { removeFromInstances(); } }
public void run() { addToInstances(); try { // // Initialisations FileOutputStream out = null; ArrayList<ParsableFile> parsables = new ArrayList<ParsableFile>(); ArrayList<ExecutableFile> executables = new ArrayList<ExecutableFile>(); ArrayList<UpdateCheck> updatechecks = new ArrayList<UpdateCheck>(); List packs = idata.selectedPacks; int npacks = packs.size(); handler.startAction("Unpacking", npacks); udata = UninstallData.getInstance(); // Custom action listener stuff --- load listeners ---- List[] customActions = getCustomActions(); // Custom action listener stuff --- beforePacks ---- informListeners(customActions, InstallerListener.BEFORE_PACKS, idata, npacks, handler); packs = idata.selectedPacks; npacks = packs.size(); // We unpack the selected packs for (int i = 0; i < npacks; i++) { // We get the pack stream //int n = idata.allPacks.indexOf(packs.get(i)); Pack p = (Pack) packs.get(i); // evaluate condition if (p.hasCondition()) { if (rules != null) { if (!rules.isConditionTrue(p.getCondition())) { // skip pack, condition is not fullfilled. continue; } } else { // TODO: skip pack, because condition can not be checked } } // Custom action listener stuff --- beforePack ---- informListeners(customActions, InstallerListener.BEFORE_PACK, packs.get(i), npacks, handler); ObjectInputStream objIn = new ObjectInputStream(getPackAsStream(p.id, p.uninstall)); // We unpack the files int nfiles = objIn.readInt(); // We get the internationalized name of the pack final Pack pack = ((Pack) packs.get(i)); String stepname = pack.name;// the message to be passed to the // installpanel if (langpack != null && !(pack.id == null || "".equals(pack.id))) { final String name = langpack.getString(pack.id); if (name != null && !"".equals(name)) { stepname = name; } } handler.nextStep(stepname, i + 1, nfiles); for (int j = 0; j < nfiles; j++) { // We read the header PackFile pf = (PackFile) objIn.readObject(); // TODO: reaction if condition can not be checked if (pf.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(pf.getCondition())) { if (!pf.isBackReference()){ // skip, condition is not fulfilled objIn.skip(pf.length()); } continue; } } if (OsConstraint.oneMatchesCurrentSystem(pf.osConstraints())) { // We translate & build the path String path = IoHelper.translatePath(pf.getTargetPath(), vs); File pathFile = new File(path); File dest = pathFile; if (!pf.isDirectory()) { dest = pathFile.getParentFile(); } if (!dest.exists()) { // If there are custom actions which would be called // at // creating a directory, create it recursively. List fileListeners = customActions[customActions.length - 1]; if (fileListeners != null && fileListeners.size() > 0) { mkDirsWithEnhancement(dest, pf, customActions); } else // Create it in on step. { if (!dest.mkdirs()) { handler.emitError("Error creating directories", "Could not create directory\n" + dest.getPath()); handler.stopAction(); this.result = false; return; } } } if (pf.isDirectory()) { continue; } // Custom action listener stuff --- beforeFile ---- informListeners(customActions, InstallerListener.BEFORE_FILE, pathFile, pf, null); // We add the path to the log, udata.addFile(path, pack.uninstall); handler.progress(j, path); // if this file exists and should not be overwritten, // check // what to do if ((pathFile.exists()) && (pf.override() != PackFile.OVERRIDE_TRUE)) { boolean overwritefile = false; // don't overwrite file if the user said so if (pf.override() != PackFile.OVERRIDE_FALSE) { if (pf.override() == PackFile.OVERRIDE_TRUE) { overwritefile = true; } else if (pf.override() == PackFile.OVERRIDE_UPDATE) { // check mtime of involved files // (this is not 100% perfect, because the // already existing file might // still be modified but the new installed // is just a bit newer; we would // need the creation time of the existing // file or record with which mtime // it was installed...) overwritefile = (pathFile.lastModified() < pf.lastModified()); } else { int def_choice = -1; if (pf.override() == PackFile.OVERRIDE_ASK_FALSE) { def_choice = AbstractUIHandler.ANSWER_NO; } if (pf.override() == PackFile.OVERRIDE_ASK_TRUE) { def_choice = AbstractUIHandler.ANSWER_YES; } int answer = handler.askQuestion(idata.langpack .getString("InstallPanel.overwrite.title") + " - " + pathFile.getName(), idata.langpack .getString("InstallPanel.overwrite.question") + pathFile.getAbsolutePath(), AbstractUIHandler.CHOICES_YES_NO, def_choice); overwritefile = (answer == AbstractUIHandler.ANSWER_YES); } } if (!overwritefile) { if (!pf.isBackReference() && !((Pack) packs.get(i)).loose) { objIn.skip(pf.length()); } continue; } } // We copy the file InputStream pis = objIn; if (pf.isBackReference()) { InputStream is = getPackAsStream(pf.previousPackId, pack.uninstall); pis = new ObjectInputStream(is); // must wrap for blockdata use by objectstream // (otherwise strange result) // skip on underlaying stream (for some reason not // possible on ObjectStream) is.skip(pf.offsetInPreviousPack - 4); // but the stream header is now already read (== 4 // bytes) } else if (((Pack) packs.get(i)).loose) { /* Old way of doing the job by using the (absolute) sourcepath. * Since this is very likely to fail and does not confirm to the documentation, * prefer using relative path's pis = new FileInputStream(pf.sourcePath); */ File resolvedFile = new File(getAbsolutInstallSource(), pf .getRelativeSourcePath()); if (!resolvedFile.exists()) { //try alternative destination - the current working directory //user.dir is likely (depends on launcher type) the current directory of the executable or jar-file... final File userDir = new File(System.getProperty("user.dir")); resolvedFile = new File(userDir, pf.getRelativeSourcePath()); } if (resolvedFile.exists()) { pis = new FileInputStream(resolvedFile); //may have a different length & last modified than we had at compiletime, therefore we have to build a new PackFile for the copy process... pf = new PackFile(resolvedFile.getParentFile(), resolvedFile, pf.getTargetPath(), pf.osConstraints(), pf.override(), pf.getAdditionals()); } else { //file not found //issue a warning (logging api pending) //since this file was loosely bundled, we continue with the installation. System.out.println("Could not find loosely bundled file: " + pf.getRelativeSourcePath()); out.close(); continue; } } if (pf.isPack200Jar()) { int key = objIn.readInt(); InputStream pack200Input = Unpacker.class.getResourceAsStream("/packs/pack200-" + key); Pack200.Unpacker unpacker = getPack200Unpacker(); java.util.jar.JarOutputStream jarOut = new java.util.jar.JarOutputStream(new FileOutputStream(pathFile)); unpacker.unpack(pack200Input, jarOut); jarOut.close(); } else { out = new FileOutputStream(pathFile); byte[] buffer = new byte[5120]; long bytesCopied = 0; while (bytesCopied < pf.length()) { if (performInterrupted()) { // Interrupt was initiated; perform it. out.close(); if (pis != objIn) { pis.close(); } return; } int maxBytes = (int) Math.min(pf.length() - bytesCopied, buffer.length); int bytesInBuffer = pis.read(buffer, 0, maxBytes); if (bytesInBuffer == -1) { throw new IOException("Unexpected end of stream (installer corrupted?)"); } out.write(buffer, 0, bytesInBuffer); bytesCopied += bytesInBuffer; } out.close(); } if (pis != objIn) { pis.close(); } // Set file modification time if specified if (pf.lastModified() >= 0) { pathFile.setLastModified(pf.lastModified()); } // Custom action listener stuff --- afterFile ---- informListeners(customActions, InstallerListener.AFTER_FILE, pathFile, pf, null); } else { if (!pf.isBackReference()) { objIn.skip(pf.length()); } } } // Load information about parsable files int numParsables = objIn.readInt(); for (int k = 0; k < numParsables; k++) { ParsableFile pf = (ParsableFile) objIn.readObject(); if (pf.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(pf.getCondition())) { // skip, condition is not fulfilled continue; } } pf.path = IoHelper.translatePath(pf.path, vs); parsables.add(pf); } // Load information about executable files int numExecutables = objIn.readInt(); for (int k = 0; k < numExecutables; k++) { ExecutableFile ef = (ExecutableFile) objIn.readObject(); if (ef.hasCondition() && (rules != null)) { if (!rules.isConditionTrue(ef.getCondition())) { // skip, condition is false continue; } } ef.path = IoHelper.translatePath(ef.path, vs); if (null != ef.argList && !ef.argList.isEmpty()) { String arg = null; for (int j = 0; j < ef.argList.size(); j++) { arg = ef.argList.get(j); arg = IoHelper.translatePath(arg, vs); ef.argList.set(j, arg); } } executables.add(ef); if (ef.executionStage == ExecutableFile.UNINSTALL) { udata.addExecutable(ef); } } // Custom action listener stuff --- uninstall data ---- handleAdditionalUninstallData(udata, customActions); // Load information about updatechecks int numUpdateChecks = objIn.readInt(); for (int k = 0; k < numUpdateChecks; k++) { UpdateCheck uc = (UpdateCheck) objIn.readObject(); updatechecks.add(uc); } objIn.close(); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // Custom action listener stuff --- afterPack ---- informListeners(customActions, InstallerListener.AFTER_PACK, packs.get(i), i, handler); } // We use the scripts parser ScriptParser parser = new ScriptParser(parsables, vs); parser.parseFiles(); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // We use the file executor FileExecutor executor = new FileExecutor(executables); if (executor.executeFiles(ExecutableFile.POSTINSTALL, handler) != 0) { handler.emitError("File execution failed", "The installation was not completed"); this.result = false; } if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // We put the uninstaller (it's not yet complete...) putUninstaller(); // update checks _after_ uninstaller was put, so we don't delete it performUpdateChecks(updatechecks); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // Custom action listener stuff --- afterPacks ---- informListeners(customActions, InstallerListener.AFTER_PACKS, idata, handler, null); if (performInterrupted()) { // Interrupt was initiated; perform it. return; } // write installation information writeInstallationInformation(); // The end :-) handler.stopAction(); } catch (Exception err) { // TODO: finer grained error handling with useful error messages handler.stopAction(); String message = err.getMessage(); if ("Installation cancelled".equals(message)) { handler.emitNotification("Installation cancelled"); } else { if (message == null || message.isEmpty()) { message = "Internal error occured : " + err.toString(); } handler.emitError("An error occured", message); err.printStackTrace(); } this.result = false; Housekeeper.getInstance().shutDown(4); } finally { removeFromInstances(); } }
diff --git a/src/simple/home/jtbuaa/simpleHome.java b/src/simple/home/jtbuaa/simpleHome.java index 4795ca8..7cd7503 100755 --- a/src/simple/home/jtbuaa/simpleHome.java +++ b/src/simple/home/jtbuaa/simpleHome.java @@ -1,1415 +1,1415 @@ package simple.home.jtbuaa; import java.io.EOFException; import java.io.File; import java.io.FileInputStream; import java.io.FileOutputStream; import java.io.FilenameFilter; import java.io.IOException; import java.io.ObjectInputStream; import java.io.ObjectOutputStream; import java.lang.reflect.Method; import java.util.ArrayList; import java.util.Collections; import java.util.HashMap; import java.util.List; import java.util.Random; import base.lib.HanziToPinyin; import base.lib.util; import android.app.Activity; import android.app.AlertDialog; import android.app.WallpaperManager; import android.content.BroadcastReceiver; import android.content.ContentResolver; import android.content.Context; import android.content.DialogInterface; import android.content.Intent; import android.content.IntentFilter; import android.content.SharedPreferences; import android.content.pm.ActivityInfo; import android.content.pm.ApplicationInfo; import android.content.pm.IPackageStatsObserver; import android.content.pm.PackageInfo; import android.content.pm.PackageManager; import android.content.pm.PackageStats; import android.content.pm.ResolveInfo; import android.content.res.Configuration; import android.database.ContentObserver; import android.database.Cursor; import android.graphics.Bitmap; import android.graphics.BitmapFactory; import android.graphics.Canvas; import android.graphics.ColorFilter; import android.graphics.drawable.BitmapDrawable; import android.graphics.drawable.Drawable; import android.hardware.Sensor; import android.hardware.SensorEvent; import android.hardware.SensorEventListener; import android.hardware.SensorManager; import android.net.Uri; import android.os.AsyncTask; import android.os.Bundle; import android.os.Environment; import android.os.Handler; import android.os.IBinder; import android.os.Message; import android.os.Parcelable; import android.os.RemoteException; import android.preference.PreferenceManager; import android.provider.CallLog.Calls; import android.support.v4.view.PagerAdapter; import android.support.v4.view.ViewPager; import android.support.v4.view.ViewPager.OnPageChangeListener; import android.telephony.TelephonyManager; import android.util.AttributeSet; import android.util.DisplayMetrics; import android.util.Log; import android.view.ContextMenu; import android.view.ContextMenu.ContextMenuInfo; import android.view.KeyEvent; import android.view.LayoutInflater; import android.view.Menu; import android.view.MenuItem; import android.view.MotionEvent; import android.view.View; import android.view.View.OnClickListener; import android.view.View.OnTouchListener; import android.view.ViewGroup; import android.view.ViewGroup.LayoutParams; import android.view.Window; import android.widget.ArrayAdapter; import android.widget.GridView; import android.widget.ImageView; import android.widget.ListView; import android.widget.RadioButton; import android.widget.RadioGroup; import android.widget.RelativeLayout; import android.widget.TextView; public class simpleHome extends Activity implements SensorEventListener, sizedRelativeLayout.OnResizeChangeListener { int homeTab = 1; AlertDialog restartDialog = null; AlertDialog hintDialog = null; //wall paper related String downloadPath; SensorManager sensorMgr; Sensor mSensor; float last_x, last_y, last_z; long lastUpdate, lastSet; ArrayList<String> picList, picList_selected; boolean shakeWallpaper = false; boolean busy; SharedPreferences perferences; String wallpaperFile = ""; AppAlphaList sysAlphaList, userAlphaList; //alpha list related TextView radioText; RadioGroup radioGroup; //app list related private List<View> mListViews; GridView favoAppList; ListView sysAppList, userAppList, shortAppList; ImageView homeBar, shortBar; String version, myPackageName; ViewPager mainlayout; MyPagerAdapter myPagerAdapter; RelativeLayout home; ResolveInfo appDetail; List<ResolveInfo> mAllApps, mFavoApps, mSysApps, mUserApps, mShortApps; PackageManager pm; favoAppAdapter favoAdapter; shortAppAdapter shortAdapter; ResolveInfo ri_phone, ri_sms, ri_contact; CallObserver callObserver; SmsChangeObserver smsObserver; ImageView shortcut_phone, shortcut_sms, shortcut_contact; sizedRelativeLayout base; RelativeLayout apps; appHandler mAppHandler = new appHandler(); final static int UPDATE_RI_PHONE = 0, UPDATE_RI_SMS = 1, UPDATE_RI_CONTACT = 2, UPDATE_USER = 3, UPDATE_SPLASH = 4; ContextMenu mMenu; ricase selected_case; boolean canRoot; DisplayMetrics dm; IBinder token; //package size related HashMap<String, Object> packagesSize; Method getPackageSizeInfo; IPackageStatsObserver sizeObserver; static int sizeM = 1024*1024; static public com.android.internal.telephony.ITelephony getITelephony(TelephonyManager telMgr) throws Exception { Method getITelephonyMethod = telMgr.getClass().getDeclaredMethod("getITelephony"); getITelephonyMethod.setAccessible(true);//even private function can use this return (com.android.internal.telephony.ITelephony)getITelephonyMethod.invoke(telMgr); } WallpaperManager mWallpaperManager; class MyPagerAdapter extends PagerAdapter{ @Override public void destroyItem(View collection, int arg1, Object view) { ((ViewPager) collection).removeView((View) view); } @Override public void finishUpdate(View arg0) { } @Override public int getCount() { return mListViews.size(); } @Override public Object instantiateItem(View arg0, int arg1) { ((ViewPager) arg0).addView(mListViews.get(arg1), 0); return mListViews.get(arg1); } @Override public boolean isViewFromObject(View arg0, Object arg1) { return arg0==(arg1); } @Override public void restoreState(Parcelable arg0, ClassLoader arg1) { } @Override public Parcelable saveState() { return null; } @Override public void startUpdate(View arg0) { } @Override public int getItemPosition(Object object) { return POSITION_NONE; } } @Override protected void onResume() { if (sysAlphaList.appToDel != null) { String apkToDel = sysAlphaList.appToDel.activityInfo.applicationInfo.sourceDir; String res = ShellInterface.doExec(new String[] {"ls /data/data/" + sysAlphaList.appToDel.activityInfo.packageName}, true); if (res.contains("No such file or directory")) {//uninstalled String[] cmds = { "rm " + apkToDel + ".bak", "rm " + apkToDel.replace(".apk", ".odex")}; //ShellInterface.doExec(cmds);// not really delete. } else ShellInterface.doExec(new String[] {"mv " + apkToDel + ".bak " + apkToDel}); sysAlphaList.appToDel = null; } shakeWallpaper = perferences.getBoolean("shake", false); if (shakeWallpaper) { sensorMgr.registerListener(this, mSensor, SensorManager.SENSOR_DELAY_UI); busy = false; } else { sensorMgr.unregisterListener(this); } super.onResume(); } @Override public boolean onCreateOptionsMenu(Menu menu) { super.onCreateOptionsMenu(menu); menu.add(0, 0, 0, R.string.wallpaper).setIcon(android.R.drawable.ic_menu_gallery).setAlphabeticShortcut('W'); menu.add(0, 1, 0, R.string.settings).setIcon(android.R.drawable.ic_menu_preferences) .setIntent(new Intent(android.provider.Settings.ACTION_SETTINGS)); menu.add(0, 2, 0, R.string.help).setIcon(android.R.drawable.ic_menu_help).setAlphabeticShortcut('H'); return true; } public boolean onOptionsItemSelected(MenuItem item){ switch (item.getItemId()) { case 0://wallpaper final Intent pickWallpaper = new Intent(Intent.ACTION_SET_WALLPAPER); util.startActivity(Intent.createChooser(pickWallpaper, getString(R.string.wallpaper)), true, getBaseContext()); break; case 1://settings return super.onOptionsItemSelected(item); case 2://help dialog Intent intent = new Intent("about"); intent.setClassName(getPackageName(), About.class.getName()); intent.putExtra("version", version); intent.putExtra("filename", wallpaperFile); util.startActivity(intent, false, getBaseContext()); break; } return true; } @Override public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo) { super.onCreateContextMenu(menu, v, menuInfo); selected_case = (ricase) v.getTag(); switch (selected_case.mCase) { case 0://on home menu.add(0, 0, 0, getString(R.string.removeFromFavo)); break; case 1://on shortcut menu.add(0, 1, 0, getString(R.string.removeFromShort)); break; case 2://on app list if (mainlayout.getCurrentItem() == 0) { if (sysAlphaList.mIsGrid) menu.add(0, 8, 0, getString(R.string.list_view)); else menu.add(0, 8, 0, getString(R.string.grid_view)); } else if (mainlayout.getCurrentItem() == 2) { if (userAlphaList.mIsGrid) menu.add(0, 8, 0, getString(R.string.list_view)); else menu.add(0, 8, 0, getString(R.string.grid_view)); } menu.add(0, 7, 0, getString(R.string.hideapp)); menu.add(0, 4, 0, getString(R.string.appdetail)); menu.add(0, 5, 0, getString(R.string.addtoFavo)); menu.add(0, 6, 0, getString(R.string.addtoShort)); mMenu = menu; break; } } void writeFile(String name) { try { FileOutputStream fo = this.openFileOutput(name, 0); ObjectOutputStream oos = new ObjectOutputStream(fo); if (name.equals("short")) { for (int i = 0; i < mShortApps.size(); i++) oos.writeObject(((ResolveInfo)mShortApps.get(i)).activityInfo.name); } else if (name.equals("favo")) { for (int i = 0; i < mFavoApps.size(); i++) oos.writeObject(((ResolveInfo)mFavoApps.get(i)).activityInfo.name); } oos.flush(); oos.close(); fo.close(); } catch (Exception e) {} } boolean backup(String sourceDir) {//copy file to sdcard String apk = sourceDir.split("/")[sourceDir.split("/").length-1]; FileOutputStream fos; FileInputStream fis; String filename = downloadPath + "apk/" + apk; try { File target = new File(filename); fos = new FileOutputStream(target, false); fis = new FileInputStream(sourceDir); byte buf[] = new byte[10240]; int readLength = 0; while((readLength = fis.read(buf))>0){ fos.write(buf, 0, readLength); } fos.close(); fis.close(); } catch (Exception e) { hintDialog.setMessage(e.toString()); hintDialog.show(); return false; } return true; } public boolean onContextItemSelected(MenuItem item){ super.onContextItemSelected(item); ResolveInfo info = null; if (item.getItemId() < 8) info = (ResolveInfo) selected_case.mRi; switch (item.getItemId()) { case 0://remove from home favoAdapter.remove(info); writeFile("favo"); break; case 1://remove from shortcut shortAdapter.remove(info); writeFile("short"); //save shortcut to file break; case 4://get app detail info showDetail(info.activityInfo.applicationInfo.sourceDir, info.activityInfo.packageName, info.loadLabel(pm), info.loadIcon(pm)); break; case 5://add to home if (favoAdapter.getPosition(info) < 0) { favoAdapter.add(info); writeFile("favo"); } break; case 6://add to shortcut if (shortAdapter.getPosition(info) < 0) { shortAdapter.insert(info, 0); writeFile("short"); //save shortcut to file } break; case 7://hide the ri if (mainlayout.getCurrentItem() == 0) { sysAlphaList.remove(info.activityInfo.packageName); } else { userAlphaList.remove(info.activityInfo.packageName); } refreshRadioButton(); break; case 8://switch view restartDialog.show(); return true;//break can't finish on some device? case 9://get package detail info PackageInfo pi = (PackageInfo) selected_case.mRi; showDetail(pi.applicationInfo.sourceDir, pi.packageName, pi.applicationInfo.loadLabel(pm), pi.applicationInfo.loadIcon(pm)); break; } return false; } void showDetail(final String sourceDir, final String packageName, final CharSequence label, Drawable icon) { AlertDialog detailDlg = new AlertDialog.Builder(this). setTitle(label). setIcon(icon). setMessage(packageName + "\n\n" + sourceDir). setPositiveButton(R.string.share, new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { Intent intent = new Intent(Intent.ACTION_SEND); intent.setType("text/plain"); intent.putExtra(Intent.EXTRA_SUBJECT, R.string.share); String text = label + getString(R.string.app_share_text) + "http://bpc.borqs.com/market.html?id=" + packageName; intent.putExtra(Intent.EXTRA_TEXT, text); util.startActivity(Intent.createChooser(intent, getString(R.string.sharemode)), true, getBaseContext()); } }).setNeutralButton(R.string.backapp, new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { String apk = sourceDir.split("/")[sourceDir.split("/").length-1]; if (backup(sourceDir)) { String odex = sourceDir.replace(".apk", ".odex"); File target = new File(odex); boolean backupOdex = true; if (target.exists()) if (!backup(odex)) backupOdex = false;//backup odex if any if (backupOdex) { hintDialog.setMessage(getString(R.string.backapp) + " " + label + " to " + downloadPath + "apk/" + apk); hintDialog.show(); } } } }). setNegativeButton(R.string.more, new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface arg0, int arg1) { Intent intent; if (appDetail != null) { intent = new Intent(Intent.ACTION_VIEW); intent.setClassName(appDetail.activityInfo.packageName, appDetail.activityInfo.name); intent.putExtra("pkg", packageName); intent.putExtra("com.android.settings.ApplicationPkgName", packageName); } else {//2.6 tahiti change the action. intent = new Intent("android.settings.APPLICATION_DETAILS_SETTINGS", Uri.fromParts("package", packageName, null)); } util.startActivity(intent, true, getBaseContext()); } }).create(); boolean canBackup = !downloadPath.startsWith(getFilesDir().getPath()); detailDlg.show(); detailDlg.getButton(DialogInterface.BUTTON_NEUTRAL).setEnabled(canBackup);//not backup if no SDcard. } @SuppressWarnings("unchecked") @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); myPackageName = this.getPackageName(); pm = getPackageManager(); version = util.getVersion(this); try { getPackageSizeInfo = PackageManager.class.getMethod( "getPackageSizeInfo", new Class[] {String.class, IPackageStatsObserver.class}); } catch (Exception e) { e.printStackTrace(); } sizeObserver = new IPackageStatsObserver.Stub() { @Override public void onGetStatsCompleted(PackageStats pStats, boolean succeeded) throws RemoteException { long size = pStats.codeSize; String ssize = new String(); if (size > 10 * sizeM) ssize = size / sizeM + "M"; else if (size > 10 * 1024) ssize = size / 1024 + "K"; else if (size > 0) ssize = size + "B"; else ssize = ""; packagesSize.put(pStats.packageName, ssize); } }; packagesSize = new HashMap<String, Object>(); sensorMgr = (SensorManager) getSystemService(SENSOR_SERVICE); mSensor = sensorMgr.getDefaultSensor(Sensor.TYPE_ACCELEROMETER); perferences = PreferenceManager.getDefaultSharedPreferences(this); dm = new DisplayMetrics(); getWindowManager().getDefaultDisplay().getMetrics(dm); //1,2,3,4 are integer value of small, normal, large and XLARGE screen respectively. //int screen_size = getResources().getConfiguration().screenLayout & Configuration.SCREENLAYOUT_SIZE_MASK; //if (screen_size < Configuration.SCREENLAYOUT_SIZE_LARGE)//disable auto rotate screen for small and normal screen. //setRequestedOrientation(ActivityInfo.SCREEN_ORIENTATION_PORTRAIT); requestWindowFeature(Window.FEATURE_NO_TITLE); //hide titlebar of application, must be before setting the layout setContentView(R.layout.ads); home = (RelativeLayout) getLayoutInflater().inflate(R.layout.home, null); //favorite app tab favoAppList = (GridView) home.findViewById(R.id.favos); favoAppList.setVerticalScrollBarEnabled(false); favoAppList.inflate(this, R.layout.app_list, null); favoAppList.setOnTouchListener(new OnTouchListener() { @Override public boolean onTouch(View arg0, MotionEvent arg1) { shortAppList.setVisibility(View.INVISIBLE); return false; } }); shortAppList = (ListView) home.findViewById(R.id.business); shortAppList.bringToFront(); shortAppList.setVisibility(View.INVISIBLE); boolean isGrid = perferences.getBoolean("system", true); sysAlphaList = new AppAlphaList(this, pm, packagesSize, isGrid, dm.widthPixels > 480); isGrid = perferences.getBoolean("user", false); userAlphaList = new AppAlphaList(this, pm, packagesSize, isGrid, dm.widthPixels > 480); mListViews = new ArrayList<View>(); mListViews.add(sysAlphaList.view); mListViews.add(home); mListViews.add(userAlphaList.view); radioText = (TextView) findViewById(R.id.radio_text); radioGroup = (RadioGroup) findViewById(R.id.radio_hint); radioGroup.removeViewAt(0); mWallpaperManager = WallpaperManager.getInstance(this); mainlayout = (ViewPager)findViewById(R.id.mainFrame); mainlayout.setLongClickable(true); myPagerAdapter = new MyPagerAdapter(); mainlayout.setAdapter(myPagerAdapter); mainlayout.setOnPageChangeListener(new OnPageChangeListener() { @Override public void onPageScrollStateChanged(int state) { if (state == ViewPager.SCROLL_STATE_SETTLING) { refreshRadioButton(); } } @Override public void onPageScrolled(int position, float positionOffset, int positionOffsetPixels) { if (!shakeWallpaper) {//don't move wallpaper if change wallpaper by shake if (token == null) token = mainlayout.getWindowToken();//any token from a component is ok mWallpaperManager.setWallpaperOffsets(token, //when slide from home to systems or from systems to home, the "position" is 0, //when slide from home to users or from users to home, it is 1. //positionOffset is from 0 to 1. sometime it will jump from 1 to 0, we just omit it if it is 0. //so we can unify it to (0, 1) by (positionOffset+position)/2 (positionOffset+position)/(mListViews.size()-1), 0); } } @Override public void onPageSelected(int arg0) { } }); mainlayout.setCurrentItem(homeTab); mSysApps = new ArrayList<ResolveInfo>(); mUserApps = new ArrayList<ResolveInfo>(); mFavoApps = new ArrayList<ResolveInfo>(); mShortApps = new ArrayList<ResolveInfo>(); favoAdapter = new favoAppAdapter(getBaseContext(), mFavoApps); favoAppList.setAdapter(favoAdapter); base = (sizedRelativeLayout) home.findViewById(R.id.base); base.setResizeListener(this); homeBar = (ImageView) home.findViewById(R.id.home_bar); homeBar.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { Intent intent = new Intent(Intent.ACTION_MAIN); - intent.setClassName("harley.browsers", "harley.lib.HarleyBrowser"); + intent.setPackage("harley.browsers"); if (!util.startActivity(intent, false, getBaseContext())) { - intent.setClassName("easy.browser", "easy.lib.SimpleBrowser"); + intent.setPackage("easy.browser"); if (!util.startActivity(intent, false, getBaseContext())) { //intent = new Intent(Intent.ACTION_VIEW, Uri.parse("market://details?id=harley.browsers")); - intent.setClassName(myPackageName, "easy.lib.SimpleBrowser");// runtime error. VFY: unable to resolve static field + intent.setPackage(myPackageName);// runtime error. VFY: unable to resolve static field util.startActivity(intent, true, getBaseContext()); } } } }); shortBar = (ImageView) home.findViewById(R.id.business_bar); shortBar.setOnClickListener(new OnClickListener() {//by click this bar to show/hide mainlayout @Override public void onClick(View arg0) { if ((shortAppList.getVisibility() == View.INVISIBLE) && !mShortApps.isEmpty()) shortAppList.setVisibility(View.VISIBLE); else shortAppList.setVisibility(View.INVISIBLE); } }); shortcut_phone = (ImageView) home.findViewById(R.id.shortcut_phone); shortcut_sms = (ImageView) home.findViewById(R.id.shortcut_sms); //shortcut_contact = (ImageView) findViewById(R.id.shortcut_contact); //for package add/remove IntentFilter filter = new IntentFilter(); filter.addAction(Intent.ACTION_PACKAGE_ADDED); filter.addAction(Intent.ACTION_PACKAGE_REMOVED); filter.addDataScheme("package"); registerReceiver(packageReceiver, filter); //for wall paper changed filter = new IntentFilter(Intent.ACTION_WALLPAPER_CHANGED); registerReceiver(wallpaperReceiver, filter); filter = new IntentFilter("simpleHome.action.HOME_CHANGED"); registerReceiver(homeChangeReceiver, filter); filter = new IntentFilter("simpleHome.action.PIC_ADDED"); registerReceiver(picAddReceiver, filter); filter = new IntentFilter("simpleHome.action.SHARE_DESKTOP"); registerReceiver(deskShareReceiver, filter); filter = new IntentFilter(Intent.ACTION_MEDIA_MOUNTED); filter.addAction(Intent.ACTION_MEDIA_SCANNER_STARTED); filter.addAction(Intent.ACTION_MEDIA_SCANNER_FINISHED); filter.addAction(Intent.ACTION_MEDIA_REMOVED); filter.addAction(Intent.ACTION_MEDIA_UNMOUNTED); filter.addAction(Intent.ACTION_MEDIA_BAD_REMOVAL); filter.addDataScheme("file"); registerReceiver(sdcardListener, filter); apps = (RelativeLayout) findViewById(R.id.apps); //mWallpaperManager.setWallpaperOffsets(apps.getWindowToken(), 0.5f, 0);//move wallpaper to center, but null pointer? //TelephonyManager tm = (TelephonyManager) getSystemService(Service.TELEPHONY_SERVICE); //getITelephony(tm).getActivePhoneType(); ContentResolver cr = getContentResolver(); callObserver = new CallObserver(cr, mAppHandler); smsObserver = new SmsChangeObserver(cr, mAppHandler); getContentResolver().registerContentObserver(Calls.CONTENT_URI, true, callObserver); cr.registerContentObserver(Uri.parse("content://mms-sms/"), true, smsObserver); //task for init, such as load webview, load package list InitTask initTask = new InitTask(); initTask.execute(""); restartDialog = new AlertDialog.Builder(this). setTitle(R.string.app_name). setIcon(R.drawable.icon). setMessage(R.string.restart). setPositiveButton("OK", new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { //save the layout SharedPreferences.Editor editor = perferences.edit(); if (mainlayout.getCurrentItem() == 0) editor.putBoolean("system", !sysAlphaList.mIsGrid); else if (mainlayout.getCurrentItem() == 2) editor.putBoolean("user", !userAlphaList.mIsGrid); editor.commit(); //restart the activity. note if set singleinstance or singletask of activity, below will not work on some device. Intent intent = getIntent(); overridePendingTransition(0, 0); intent.addFlags(Intent.FLAG_ACTIVITY_NO_ANIMATION | Intent.FLAG_ACTIVITY_CLEAR_TOP | Intent.FLAG_ACTIVITY_NEW_TASK); finish(); overridePendingTransition(0, 0); startActivity(intent); } }). setNegativeButton(getString(R.string.cancel), new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { } }).create(); hintDialog = new AlertDialog.Builder(this). setNegativeButton("OK", new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { } }).create(); } @Override protected void onDestroy() { unregisterReceiver(packageReceiver); unregisterReceiver(wallpaperReceiver); unregisterReceiver(picAddReceiver); unregisterReceiver(deskShareReceiver); unregisterReceiver(homeChangeReceiver); unregisterReceiver(sdcardListener); super.onDestroy(); } BroadcastReceiver sdcardListener = new BroadcastReceiver() { @Override public void onReceive(Context context, Intent intent) { String action = intent.getAction(); if(Intent.ACTION_MEDIA_MOUNTED.equals(action) || Intent.ACTION_MEDIA_SCANNER_STARTED.equals(action) || Intent.ACTION_MEDIA_SCANNER_FINISHED.equals(action) ){// mount sd card success if (downloadPath != null) downloadPath = Environment.getExternalStorageDirectory() + "/simpleHome/"; if (mMenu != null) mMenu.getItem(3).setEnabled(true); } else if(Intent.ACTION_MEDIA_REMOVED.equals(action) || Intent.ACTION_MEDIA_UNMOUNTED.equals(action) || Intent.ACTION_MEDIA_BAD_REMOVAL.equals(action) ){// fail to mount sd card if (downloadPath != null) downloadPath = getFilesDir().getPath() + "/"; if (mMenu != null) mMenu.getItem(3).setEnabled(false); } } }; BroadcastReceiver wallpaperReceiver = new BroadcastReceiver() { @Override public void onReceive(Context arg0, Intent arg1) { apps.setBackgroundColor(0);//set back ground to transparent to show wallpaper wallpaperFile = ""; } }; BroadcastReceiver picAddReceiver = new BroadcastReceiver() { @Override public void onReceive(Context context, Intent intent) { final String picName = intent.getStringExtra("picFile"); picList.add(picName);//add to picture list SharedPreferences.Editor editor = perferences.edit(); editor.putBoolean("shake_enabled", true); editor.commit(); } }; BroadcastReceiver deskShareReceiver = new BroadcastReceiver() { @Override public void onReceive(Context context, Intent intent) { String snap = downloadPath + "snap/snap.png"; FileOutputStream fos; try {//prepare for share desktop fos = new FileOutputStream(snap); apps.setDrawingCacheEnabled(true); Bitmap bmp = apps.getDrawingCache(); bmp.compress(Bitmap.CompressFormat.PNG, 90, fos); fos.close(); apps.destroyDrawingCache(); } catch (Exception e) { } Intent intentSend = new Intent(Intent.ACTION_SEND); intentSend.setType("image/*"); intentSend.putExtra(Intent.EXTRA_SUBJECT, R.string.share); intentSend.putExtra(Intent.EXTRA_STREAM, Uri.fromFile(new File(downloadPath + "snap/snap.png"))); util.startActivity(Intent.createChooser(intentSend, getString(R.string.sharemode)), true, getBaseContext()); } }; BroadcastReceiver homeChangeReceiver = new BroadcastReceiver() { @Override public void onReceive(Context context, Intent intent) { final String homeName = intent.getStringExtra("old_home"); if(homeName.equals(myPackageName)) finish(); } }; void refreshRadioButton() { int current = mainlayout.getCurrentItem(); radioGroup.clearCheck(); if (current < radioGroup.getChildCount()) ((RadioButton) radioGroup.getChildAt(current)).setChecked(true);// crash once for C lassCastException. if (current == 0) radioText.setText(getString(R.string.systemapps) + "(" + sysAlphaList.getCount() + ")"); else if (current == 2) radioText.setText(getString(R.string.userapps) + "(" + userAlphaList.getCount() + ")"); else radioText.setText("Home"); } BroadcastReceiver packageReceiver = new BroadcastReceiver() { @Override public void onReceive(Context context, Intent intent) { String action = intent.getAction(); String packageName = intent.getDataString().split(":")[1];//it always in the format of package:x.y.z if (action.equals(Intent.ACTION_PACKAGE_REMOVED)) { ResolveInfo info = userAlphaList.remove(packageName); if (info == null) info = sysAlphaList.remove(packageName); refreshRadioButton(); if (!intent.getBooleanExtra(Intent.EXTRA_REPLACING, false)) {//not remove shortcut if it is just replace for (int i = 0; i < favoAdapter.getCount(); i++) { info = favoAdapter.getItem(i); if (info.activityInfo.packageName.equals(packageName)) { favoAdapter.remove(info); writeFile("favo"); break; } } for (int i = 0; i < shortAdapter.getCount(); i++) { info = shortAdapter.getItem(i); if (info.activityInfo.packageName.equals(packageName)) { shortAdapter.remove(info); writeFile("short"); break; } } } } else if (action.equals(Intent.ACTION_PACKAGE_ADDED)) { try {//get size of new installed package getPackageSizeInfo.invoke(pm, packageName, sizeObserver); } catch (Exception e) { e.printStackTrace(); } Intent mainIntent = new Intent(Intent.ACTION_MAIN, null); mainIntent.addCategory(Intent.CATEGORY_LAUNCHER); mainIntent.setPackage(packageName); List<ResolveInfo> targetApps = pm.queryIntentActivities(mainIntent, 0); for (int i = 0; i < targetApps.size(); i++) { if (targetApps.get(i).activityInfo.packageName.equals(packageName) ) {//the new package may not support Launcher category, we will omit it. ResolveInfo ri = targetApps.get(i); CharSequence sa = ri.loadLabel(pm); if (sa == null) sa = ri.activityInfo.name; ri.activityInfo.applicationInfo.dataDir = getToken(sa);//we borrow dataDir to store the Pinyin of the label. String tmp = ri.activityInfo.applicationInfo.dataDir.substring(0, 1); if ((ri.activityInfo.applicationInfo.flags & ApplicationInfo.FLAG_SYSTEM) == ApplicationInfo.FLAG_SYSTEM) { sysAlphaList.add(ri); break; } else { userAlphaList.add(ri); break; } } } refreshRadioButton(); } } }; private class favoAppAdapter extends ArrayAdapter<ResolveInfo> { ArrayList<ResolveInfo> localApplist; public favoAppAdapter(Context context, List<ResolveInfo> apps) { super(context, 0, apps); localApplist = (ArrayList<ResolveInfo>) apps; } @Override public View getView(int position, View convertView, ViewGroup parent) { final ResolveInfo info = (ResolveInfo) localApplist.get(position); if (convertView == null) { final LayoutInflater inflater = getLayoutInflater(); convertView = inflater.inflate(R.layout.favo_list, parent, false); } convertView.setBackgroundColor(0); final ImageView btnIcon = (ImageView) convertView.findViewById(R.id.favoappicon); btnIcon.setImageDrawable(info.loadIcon(pm)); btnIcon.setOnClickListener(new OnClickListener() {//start app @Override public void onClick(View arg0) { util.startApp(info, getBaseContext()); } }); btnIcon.setTag(new ricase(info, 0)); registerForContextMenu(btnIcon); return convertView; } } private class shortAppAdapter extends ArrayAdapter<ResolveInfo> { ArrayList<ResolveInfo> localApplist; public shortAppAdapter(Context context, List<ResolveInfo> apps) { super(context, 0, apps); localApplist = (ArrayList<ResolveInfo>) apps; } @Override public View getView(int position, View convertView, ViewGroup parent) { final ResolveInfo info = (ResolveInfo) localApplist.get(position); if (convertView == null) { final LayoutInflater inflater = getLayoutInflater(); convertView = inflater.inflate(R.layout.favo_list, parent, false); } final ImageView btnIcon = (ImageView) convertView.findViewById(R.id.favoappicon); btnIcon.setImageDrawable(info.loadIcon(pm)); TextView appname = (TextView) convertView.findViewById(R.id.favoappname); appname.setText(info.loadLabel(pm)); convertView.setOnClickListener(new OnClickListener() {//launch app @Override public void onClick(View arg0) { util.startApp(info, getBaseContext()); shortAppList.setVisibility(View.INVISIBLE); } }); convertView.setTag(new ricase(info, 1)); registerForContextMenu(convertView); return convertView; } } void readFile(String name) { FileInputStream fi = null; ObjectInputStream ois = null; try {//read favorite or shortcut data fi = openFileInput(name); ois = new ObjectInputStream(fi); String activityName; while ((activityName = (String) ois.readObject()) != null) { for (int i = 0; i < mAllApps.size(); i++) if (mAllApps.get(i).activityInfo.name.equals(activityName)) { if (name.equals("favo")) mFavoApps.add(mAllApps.get(i)); else if (name.equals("short")) mShortApps.add(mAllApps.get(i)); break; } } } catch (EOFException e) {//only when read eof need send out msg. try { ois.close(); fi.close(); } catch (IOException e1) { e1.printStackTrace(); } } catch (Exception e) { e.printStackTrace(); } } public String getToken(CharSequence sa) { String sa1 = sa.toString().trim(); String sa2 = sa1; if (sa1.length() > 0) { try {//this is to fix a bug report by market sa2 = HanziToPinyin.getInstance().getToken(sa1.charAt(0)).target.trim(); if (sa2.length() > 1) sa2 = sa2.substring(0, 1); } catch(Exception e) { e.printStackTrace(); } } sa2 = sa2.toUpperCase(); if ((sa2.compareTo("A") < 0) || (sa2.compareTo("Z") > 0)) sa2 = "#";//for space or number, we change to # return sa2; } class InitTask extends AsyncTask<String, Integer, String> { @Override protected String doInBackground(String... params) {//do all time consuming work here canRoot = false; String res = ShellInterface.doExec(new String[] {"id"}, true); if (res.contains("root")) { res = ShellInterface.doExec(new String[] {"mount -o rw,remount -t yaffs2 /dev/block/mtdblock3 /system"}, true); if (res.contains("Error")) canRoot = false; else canRoot = true; } Intent mainIntent = new Intent(Intent.ACTION_MAIN, null); mainIntent.addCategory(Intent.CATEGORY_LAUNCHER); mAllApps = pm.queryIntentActivities(mainIntent, 0); readFile("favo"); readFile("short"); boolean shortEmpty = mShortApps.isEmpty(); //read all resolveinfo String label_sms = "簡訊 Messaging Messages メッセージ 信息 消息 短信 메시지 Mensajes Messaggi Berichten SMS a MMS SMS/MMS"; //use label name to get short cut String label_phone = "電話 Phone 电话 电话和联系人 拨号键盘 키패드 Telefon Teléfono Téléphone Telefono Telefoon Телефон 휴대전화 Dialer"; String label_contact = "聯絡人 联系人 Contacts People 連絡先 通讯录 전화번호부 Kontakty Kontakte Contactos Contatti Contacten Контакты 주소록"; int match = 0; for (int i = 0; i < mAllApps.size(); i++) { ResolveInfo ri = mAllApps.get(i); CharSequence sa = ri.loadLabel(pm); if (sa == null) sa = ri.activityInfo.name; ri.activityInfo.applicationInfo.dataDir = getToken(sa);//we borrow dataDir to store the Pinyin of the label. if ((ri.activityInfo.applicationInfo.flags & ApplicationInfo.FLAG_SYSTEM) == ApplicationInfo.FLAG_SYSTEM) { sysAlphaList.add(ri, false, false); if (match < 3) {//only find 3 match: sms, phone, contact String name = sa.toString() ; //Log.d("===============", name); if (label_phone.contains(name)) { if (ri_phone == null) { ri_phone = ri; Message msgphone = mAppHandler.obtainMessage(); msgphone.what = UPDATE_RI_PHONE; mAppHandler.sendMessage(msgphone);//inform UI thread to update UI. match += 1; } } else if (label_sms.contains(name)) { if ((ri_sms == null) && (!name.equals("MM"))) { ri_sms = ri; Message msgsms = mAppHandler.obtainMessage(); msgsms.what = UPDATE_RI_SMS; mAppHandler.sendMessage(msgsms);//inform UI thread to update UI. match += 1; } } else if ((shortEmpty) && label_contact.contains(name)) {//only add contact to shortcut if shortcut is empty. if (ri_contact == null) { mShortApps.add(ri); /*ri_contact = ri; Message msgcontact = mAppHandler.obtainMessage(); msgcontact.what = UPDATE_RI_CONTACT; mAppHandler.sendMessage(msgcontact);//inform UI thread to update UI.*/ match += 1; } } } } else userAlphaList.add(ri, false, false); try { getPackageSizeInfo.invoke(pm, ri.activityInfo.packageName, sizeObserver); } catch (Exception e) { e.printStackTrace(); } } sysAlphaList.sortAlpha(); userAlphaList.sortAlpha(); Message msguser = mAppHandler.obtainMessage(); msguser.what = UPDATE_USER; mAppHandler.sendMessage(msguser);//inform UI thread to update UI. downloadPath = util.preparePath(getBaseContext()); picList = new ArrayList(); picList_selected = new ArrayList(); new File(downloadPath).list(new OnlyPic()); if (picList.size() > 0) { SharedPreferences.Editor editor = perferences.edit(); editor.putBoolean("shake_enabled", true); editor.commit(); } mainIntent = new Intent(Intent.ACTION_VIEW, null); mainIntent.addCategory(Intent.CATEGORY_DEFAULT); List<ResolveInfo> viewApps = pm.queryIntentActivities(mainIntent, 0); appDetail = null; for (int i = 0; i < viewApps.size(); i++) { if (viewApps.get(i).activityInfo.name.contains("InstalledAppDetails")) { appDetail = viewApps.get(i);//get the activity for app detail setting break; } } return null; } } class OnlyPic implements FilenameFilter { public boolean accept(File dir, String s) { String name = s.toLowerCase(); if (s.endsWith(".png") || s.endsWith(".jpg")) { picList.add(s); return true; } else return false; } } class appHandler extends Handler { public void handleMessage(Message msg) { switch (msg.what) { case UPDATE_USER: sysAlphaList.setAdapter(); userAlphaList.setAdapter(); refreshRadioButton();//this will update the radio button with correct app number. only for very slow phone shortAdapter = new shortAppAdapter(getBaseContext(), mShortApps); shortAppList.setAdapter(shortAdapter); break; case UPDATE_RI_PHONE: int missCallCount = callObserver.countUnread(); if (missCallCount > 0) { Bitmap bm = BitmapFactory.decodeResource(getResources(), R.drawable.phone); shortcut_phone.setImageBitmap(util.generatorCountIcon(bm, missCallCount, 1, 1, getBaseContext())); } else shortcut_phone.setImageResource(R.drawable.phone); shortcut_phone.setOnClickListener(new OnClickListener() {//start app @Override public void onClick(View arg0) { util.startApp(ri_phone, getBaseContext()); } }); break; case UPDATE_RI_SMS: int unreadCount = smsObserver.countUnread(); if (unreadCount > 0) { Bitmap bm = BitmapFactory.decodeResource(getResources(), R.drawable.sms); shortcut_sms.setImageBitmap(util.generatorCountIcon(bm, unreadCount, 1, 1, getBaseContext())); } else shortcut_sms.setImageResource(R.drawable.sms); shortcut_sms.setOnClickListener(new OnClickListener() {//start app @Override public void onClick(View arg0) { util.startApp(ri_sms, getBaseContext()); } }); break; case UPDATE_RI_CONTACT: shortcut_contact.setImageDrawable(ri_contact.loadIcon(pm)); shortcut_contact.setOnClickListener(new OnClickListener() {//start app @Override public void onClick(View arg0) { util.startApp(ri_contact, getBaseContext()); } }); break; } } }; @Override protected void onNewIntent(Intent intent) {//go back to home if press Home key. if ((intent.getAction().equals(Intent.ACTION_MAIN)) && (intent.hasCategory(Intent.CATEGORY_HOME))) { if (mainlayout.getCurrentItem() != homeTab) mainlayout.setCurrentItem(homeTab); else if (shortAppList.getVisibility() == View.VISIBLE) shortBar.performClick(); } super.onNewIntent(intent); } @Override public boolean onKeyDown(int keyCode, KeyEvent event) { if (event.getRepeatCount() == 0) { if (keyCode == KeyEvent.KEYCODE_BACK) {//press Back key in webview will go backword. if (mainlayout.getCurrentItem() != homeTab) mainlayout.setCurrentItem(homeTab); else if (shortAppList.getVisibility() == View.VISIBLE) shortBar.performClick(); else this.openOptionsMenu(); return true; } } return false; } @Override public void onConfigurationChanged(Configuration newConfig) { super.onConfigurationChanged(newConfig); //not restart activity each time screen orientation changes getWindowManager().getDefaultDisplay().getMetrics(dm); if (newConfig.hardKeyboardHidden == Configuration.HARDKEYBOARDHIDDEN_NO) setRequestedOrientation(ActivityInfo.SCREEN_ORIENTATION_UNSPECIFIED); } @Override public void onAccuracyChanged(Sensor arg0, int arg1) { } @Override public void onSensorChanged(SensorEvent arg0) { if (arg0.sensor.getType() == Sensor.TYPE_ACCELEROMETER) { long curTime = System.currentTimeMillis(); // detect every 100ms if ((curTime - lastUpdate) > 100) { long timeInterval = (curTime - lastUpdate); lastUpdate = curTime; float x = arg0.values[SensorManager.DATA_X]; float y = arg0.values[SensorManager.DATA_Y]; float z = arg0.values[SensorManager.DATA_Z]; float deltaX = x - last_x; float deltaY = y - last_y; float deltaZ = z - last_z; double speed = Math.sqrt(deltaX*deltaX + deltaY*deltaY + deltaZ*deltaZ)/timeInterval * 100; //condition to change wallpaper: speed is enough; frequency is not too high; picList is not empty. if ((!busy) && (speed > 8) && (curTime - lastSet > 500) && (picList != null) && (picList.size() > 0)) { busy = true; Random random = new Random(); int id = random.nextInt(picList.size()); try { wallpaperFile = downloadPath + picList.get(id); BitmapDrawable bd = (BitmapDrawable) BitmapDrawable.createFromPath(wallpaperFile); double factor = 1.0 * bd.getIntrinsicWidth() / bd.getIntrinsicHeight(); if (factor >= 1.2) {//if too wide, we want use setWallpaperOffsets to move it, so we need set it to wallpaper int tmpWidth = (int) (dm.heightPixels * factor); mWallpaperManager.setBitmap(Bitmap.createScaledBitmap(bd.getBitmap(), tmpWidth, dm.heightPixels, false)); mWallpaperManager.suggestDesiredDimensions(tmpWidth, dm.heightPixels); sensorMgr.unregisterListener(this); SharedPreferences.Editor editor = perferences.edit(); shakeWallpaper = false; editor.putBoolean("shake", false); editor.commit(); } else {//otherwise just change the background is ok. ClippedDrawable cd = new ClippedDrawable(bd, apps.getWidth(), apps.getHeight()); apps.setBackgroundDrawable(cd); } picList_selected.add(picList.get(id)); picList.remove(id);//prevent it be selected again before a full cycle lastSet = System.currentTimeMillis(); } catch (Exception e) { e.printStackTrace(); picList.remove(id); wallpaperFile = ""; } if (picList.isEmpty()) { if (picList_selected.isEmpty()) { sensorMgr.unregisterListener(this); SharedPreferences.Editor editor = perferences.edit(); editor.putBoolean("shake_enabled", false); shakeWallpaper = false; editor.putBoolean("shake", false); editor.commit(); } else { picList = (ArrayList<String>) picList_selected.clone(); picList_selected.clear(); } } busy = false; } last_x = x; last_y = y; last_z = z; } } } @Override public void onSizeChanged(int w, int h, int oldW, int oldH) { //setLayout(oldW); } } /** from Android Home sample * When a drawable is attached to a View, the View gives the Drawable its dimensions * by calling Drawable.setBounds(). In this application, the View that draws the * wallpaper has the same size as the screen. However, the wallpaper might be larger * that the screen which means it will be automatically stretched. Because stretching * a bitmap while drawing it is very expensive, we use a ClippedDrawable instead. * This drawable simply draws another wallpaper but makes sure it is not stretched * by always giving it its intrinsic dimensions. If the wallpaper is larger than the * screen, it will simply get clipped but it won't impact performance. */ class ClippedDrawable extends Drawable { private final Drawable mWallpaper; int screenWidth, screenHeight; boolean tooWide = false; public ClippedDrawable(Drawable wallpaper, int sw, int sh) { mWallpaper = wallpaper; screenWidth = sw; screenHeight = sh; } @Override public void setBounds(int left, int top, int right, int bottom) { super.setBounds(left, top, right, bottom); // Ensure the wallpaper is as large as it really is, to avoid stretching it at drawing time int tmpHeight = mWallpaper.getIntrinsicHeight() * screenWidth / mWallpaper.getIntrinsicWidth(); int tmpWidth = mWallpaper.getIntrinsicWidth() * screenHeight / mWallpaper.getIntrinsicHeight(); if (tmpHeight >= screenHeight) { top -= (tmpHeight - screenHeight)/2; mWallpaper.setBounds(left, top, left + screenWidth, top + tmpHeight); } else {//if the pic width is wider than screen width, then we need show part of the pic. tooWide = true; left -= (tmpWidth - screenWidth)/2; mWallpaper.setBounds(left, top, left + tmpWidth, top + screenHeight); } } public void draw(Canvas canvas) { mWallpaper.draw(canvas); } public void setAlpha(int alpha) { mWallpaper.setAlpha(alpha); } public void setColorFilter(ColorFilter cf) { mWallpaper.setColorFilter(cf); } public int getOpacity() { return mWallpaper.getOpacity(); } } class sizedRelativeLayout extends RelativeLayout { public sizedRelativeLayout(Context context) { super(context); } public sizedRelativeLayout(Context context, AttributeSet attrs) { super(context, attrs); } private OnResizeChangeListener mOnResizeChangeListener; protected void onSizeChanged(int w, int h, int oldW, int oldH) { if(mOnResizeChangeListener!=null){ mOnResizeChangeListener.onSizeChanged(w,h,oldW,oldH); } super.onSizeChanged(w,h,oldW,oldH); } public void setResizeListener(OnResizeChangeListener l) { mOnResizeChangeListener = l; } public interface OnResizeChangeListener{ void onSizeChanged(int w,int h,int oldW,int oldH); } } class SmsChangeObserver extends ContentObserver { ContentResolver mCR; Handler mHandler; public SmsChangeObserver(ContentResolver cr, Handler handler) { super(handler); mCR = cr; mHandler = handler; } public int countUnread() { //get sms unread count int ret = 0; Cursor csr = mCR.query(Uri.parse("content://sms"), new String[] {"thread_id"}, "read=0", null, null); if (csr != null) ret = csr.getCount(); //get mms unread count csr = mCR.query(Uri.parse("content://mms"), new String[] {"thread_id"}, "read=0", null, null); if (csr != null) ret += csr.getCount(); return ret; } @Override public void onChange(boolean selfChange) { super.onChange(selfChange); Message msgsms = mHandler.obtainMessage(); msgsms.what = 1;//UPDATE_RI_SMS; mHandler.sendMessage(msgsms);//inform UI thread to update UI. } } class CallObserver extends ContentObserver { ContentResolver mCR; Handler mHandler; public CallObserver(ContentResolver cr, Handler handler) { super(handler); mHandler = handler; mCR = cr; } public int countUnread() { //get missed call number Cursor csr = mCR.query(Calls.CONTENT_URI, new String[] {Calls.NUMBER, Calls.TYPE, Calls.NEW}, Calls.TYPE + "=" + Calls.MISSED_TYPE + " AND " + Calls.NEW + "=1", null, Calls.DEFAULT_SORT_ORDER); if (csr != null) return csr.getCount(); else return 0; } @Override public void onChange(boolean selfChange) { super.onChange(selfChange); Message msgphone = mHandler.obtainMessage(); msgphone.what = 0;//UPDATE_RI_PHONE; mHandler.sendMessage(msgphone);//inform UI thread to update UI. } }
false
true
public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); myPackageName = this.getPackageName(); pm = getPackageManager(); version = util.getVersion(this); try { getPackageSizeInfo = PackageManager.class.getMethod( "getPackageSizeInfo", new Class[] {String.class, IPackageStatsObserver.class}); } catch (Exception e) { e.printStackTrace(); } sizeObserver = new IPackageStatsObserver.Stub() { @Override public void onGetStatsCompleted(PackageStats pStats, boolean succeeded) throws RemoteException { long size = pStats.codeSize; String ssize = new String(); if (size > 10 * sizeM) ssize = size / sizeM + "M"; else if (size > 10 * 1024) ssize = size / 1024 + "K"; else if (size > 0) ssize = size + "B"; else ssize = ""; packagesSize.put(pStats.packageName, ssize); } }; packagesSize = new HashMap<String, Object>(); sensorMgr = (SensorManager) getSystemService(SENSOR_SERVICE); mSensor = sensorMgr.getDefaultSensor(Sensor.TYPE_ACCELEROMETER); perferences = PreferenceManager.getDefaultSharedPreferences(this); dm = new DisplayMetrics(); getWindowManager().getDefaultDisplay().getMetrics(dm); //1,2,3,4 are integer value of small, normal, large and XLARGE screen respectively. //int screen_size = getResources().getConfiguration().screenLayout & Configuration.SCREENLAYOUT_SIZE_MASK; //if (screen_size < Configuration.SCREENLAYOUT_SIZE_LARGE)//disable auto rotate screen for small and normal screen. //setRequestedOrientation(ActivityInfo.SCREEN_ORIENTATION_PORTRAIT); requestWindowFeature(Window.FEATURE_NO_TITLE); //hide titlebar of application, must be before setting the layout setContentView(R.layout.ads); home = (RelativeLayout) getLayoutInflater().inflate(R.layout.home, null); //favorite app tab favoAppList = (GridView) home.findViewById(R.id.favos); favoAppList.setVerticalScrollBarEnabled(false); favoAppList.inflate(this, R.layout.app_list, null); favoAppList.setOnTouchListener(new OnTouchListener() { @Override public boolean onTouch(View arg0, MotionEvent arg1) { shortAppList.setVisibility(View.INVISIBLE); return false; } }); shortAppList = (ListView) home.findViewById(R.id.business); shortAppList.bringToFront(); shortAppList.setVisibility(View.INVISIBLE); boolean isGrid = perferences.getBoolean("system", true); sysAlphaList = new AppAlphaList(this, pm, packagesSize, isGrid, dm.widthPixels > 480); isGrid = perferences.getBoolean("user", false); userAlphaList = new AppAlphaList(this, pm, packagesSize, isGrid, dm.widthPixels > 480); mListViews = new ArrayList<View>(); mListViews.add(sysAlphaList.view); mListViews.add(home); mListViews.add(userAlphaList.view); radioText = (TextView) findViewById(R.id.radio_text); radioGroup = (RadioGroup) findViewById(R.id.radio_hint); radioGroup.removeViewAt(0); mWallpaperManager = WallpaperManager.getInstance(this); mainlayout = (ViewPager)findViewById(R.id.mainFrame); mainlayout.setLongClickable(true); myPagerAdapter = new MyPagerAdapter(); mainlayout.setAdapter(myPagerAdapter); mainlayout.setOnPageChangeListener(new OnPageChangeListener() { @Override public void onPageScrollStateChanged(int state) { if (state == ViewPager.SCROLL_STATE_SETTLING) { refreshRadioButton(); } } @Override public void onPageScrolled(int position, float positionOffset, int positionOffsetPixels) { if (!shakeWallpaper) {//don't move wallpaper if change wallpaper by shake if (token == null) token = mainlayout.getWindowToken();//any token from a component is ok mWallpaperManager.setWallpaperOffsets(token, //when slide from home to systems or from systems to home, the "position" is 0, //when slide from home to users or from users to home, it is 1. //positionOffset is from 0 to 1. sometime it will jump from 1 to 0, we just omit it if it is 0. //so we can unify it to (0, 1) by (positionOffset+position)/2 (positionOffset+position)/(mListViews.size()-1), 0); } } @Override public void onPageSelected(int arg0) { } }); mainlayout.setCurrentItem(homeTab); mSysApps = new ArrayList<ResolveInfo>(); mUserApps = new ArrayList<ResolveInfo>(); mFavoApps = new ArrayList<ResolveInfo>(); mShortApps = new ArrayList<ResolveInfo>(); favoAdapter = new favoAppAdapter(getBaseContext(), mFavoApps); favoAppList.setAdapter(favoAdapter); base = (sizedRelativeLayout) home.findViewById(R.id.base); base.setResizeListener(this); homeBar = (ImageView) home.findViewById(R.id.home_bar); homeBar.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { Intent intent = new Intent(Intent.ACTION_MAIN); intent.setClassName("harley.browsers", "harley.lib.HarleyBrowser"); if (!util.startActivity(intent, false, getBaseContext())) { intent.setClassName("easy.browser", "easy.lib.SimpleBrowser"); if (!util.startActivity(intent, false, getBaseContext())) { //intent = new Intent(Intent.ACTION_VIEW, Uri.parse("market://details?id=harley.browsers")); intent.setClassName(myPackageName, "easy.lib.SimpleBrowser");// runtime error. VFY: unable to resolve static field util.startActivity(intent, true, getBaseContext()); } } } }); shortBar = (ImageView) home.findViewById(R.id.business_bar); shortBar.setOnClickListener(new OnClickListener() {//by click this bar to show/hide mainlayout @Override public void onClick(View arg0) { if ((shortAppList.getVisibility() == View.INVISIBLE) && !mShortApps.isEmpty()) shortAppList.setVisibility(View.VISIBLE); else shortAppList.setVisibility(View.INVISIBLE); } }); shortcut_phone = (ImageView) home.findViewById(R.id.shortcut_phone); shortcut_sms = (ImageView) home.findViewById(R.id.shortcut_sms); //shortcut_contact = (ImageView) findViewById(R.id.shortcut_contact); //for package add/remove IntentFilter filter = new IntentFilter(); filter.addAction(Intent.ACTION_PACKAGE_ADDED); filter.addAction(Intent.ACTION_PACKAGE_REMOVED); filter.addDataScheme("package"); registerReceiver(packageReceiver, filter); //for wall paper changed filter = new IntentFilter(Intent.ACTION_WALLPAPER_CHANGED); registerReceiver(wallpaperReceiver, filter); filter = new IntentFilter("simpleHome.action.HOME_CHANGED"); registerReceiver(homeChangeReceiver, filter); filter = new IntentFilter("simpleHome.action.PIC_ADDED"); registerReceiver(picAddReceiver, filter); filter = new IntentFilter("simpleHome.action.SHARE_DESKTOP"); registerReceiver(deskShareReceiver, filter); filter = new IntentFilter(Intent.ACTION_MEDIA_MOUNTED); filter.addAction(Intent.ACTION_MEDIA_SCANNER_STARTED); filter.addAction(Intent.ACTION_MEDIA_SCANNER_FINISHED); filter.addAction(Intent.ACTION_MEDIA_REMOVED); filter.addAction(Intent.ACTION_MEDIA_UNMOUNTED); filter.addAction(Intent.ACTION_MEDIA_BAD_REMOVAL); filter.addDataScheme("file"); registerReceiver(sdcardListener, filter); apps = (RelativeLayout) findViewById(R.id.apps); //mWallpaperManager.setWallpaperOffsets(apps.getWindowToken(), 0.5f, 0);//move wallpaper to center, but null pointer? //TelephonyManager tm = (TelephonyManager) getSystemService(Service.TELEPHONY_SERVICE); //getITelephony(tm).getActivePhoneType(); ContentResolver cr = getContentResolver(); callObserver = new CallObserver(cr, mAppHandler); smsObserver = new SmsChangeObserver(cr, mAppHandler); getContentResolver().registerContentObserver(Calls.CONTENT_URI, true, callObserver); cr.registerContentObserver(Uri.parse("content://mms-sms/"), true, smsObserver); //task for init, such as load webview, load package list InitTask initTask = new InitTask(); initTask.execute(""); restartDialog = new AlertDialog.Builder(this). setTitle(R.string.app_name). setIcon(R.drawable.icon). setMessage(R.string.restart). setPositiveButton("OK", new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { //save the layout SharedPreferences.Editor editor = perferences.edit(); if (mainlayout.getCurrentItem() == 0) editor.putBoolean("system", !sysAlphaList.mIsGrid); else if (mainlayout.getCurrentItem() == 2) editor.putBoolean("user", !userAlphaList.mIsGrid); editor.commit(); //restart the activity. note if set singleinstance or singletask of activity, below will not work on some device. Intent intent = getIntent(); overridePendingTransition(0, 0); intent.addFlags(Intent.FLAG_ACTIVITY_NO_ANIMATION | Intent.FLAG_ACTIVITY_CLEAR_TOP | Intent.FLAG_ACTIVITY_NEW_TASK); finish(); overridePendingTransition(0, 0); startActivity(intent); } }). setNegativeButton(getString(R.string.cancel), new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { } }).create(); hintDialog = new AlertDialog.Builder(this). setNegativeButton("OK", new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { } }).create(); }
public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); myPackageName = this.getPackageName(); pm = getPackageManager(); version = util.getVersion(this); try { getPackageSizeInfo = PackageManager.class.getMethod( "getPackageSizeInfo", new Class[] {String.class, IPackageStatsObserver.class}); } catch (Exception e) { e.printStackTrace(); } sizeObserver = new IPackageStatsObserver.Stub() { @Override public void onGetStatsCompleted(PackageStats pStats, boolean succeeded) throws RemoteException { long size = pStats.codeSize; String ssize = new String(); if (size > 10 * sizeM) ssize = size / sizeM + "M"; else if (size > 10 * 1024) ssize = size / 1024 + "K"; else if (size > 0) ssize = size + "B"; else ssize = ""; packagesSize.put(pStats.packageName, ssize); } }; packagesSize = new HashMap<String, Object>(); sensorMgr = (SensorManager) getSystemService(SENSOR_SERVICE); mSensor = sensorMgr.getDefaultSensor(Sensor.TYPE_ACCELEROMETER); perferences = PreferenceManager.getDefaultSharedPreferences(this); dm = new DisplayMetrics(); getWindowManager().getDefaultDisplay().getMetrics(dm); //1,2,3,4 are integer value of small, normal, large and XLARGE screen respectively. //int screen_size = getResources().getConfiguration().screenLayout & Configuration.SCREENLAYOUT_SIZE_MASK; //if (screen_size < Configuration.SCREENLAYOUT_SIZE_LARGE)//disable auto rotate screen for small and normal screen. //setRequestedOrientation(ActivityInfo.SCREEN_ORIENTATION_PORTRAIT); requestWindowFeature(Window.FEATURE_NO_TITLE); //hide titlebar of application, must be before setting the layout setContentView(R.layout.ads); home = (RelativeLayout) getLayoutInflater().inflate(R.layout.home, null); //favorite app tab favoAppList = (GridView) home.findViewById(R.id.favos); favoAppList.setVerticalScrollBarEnabled(false); favoAppList.inflate(this, R.layout.app_list, null); favoAppList.setOnTouchListener(new OnTouchListener() { @Override public boolean onTouch(View arg0, MotionEvent arg1) { shortAppList.setVisibility(View.INVISIBLE); return false; } }); shortAppList = (ListView) home.findViewById(R.id.business); shortAppList.bringToFront(); shortAppList.setVisibility(View.INVISIBLE); boolean isGrid = perferences.getBoolean("system", true); sysAlphaList = new AppAlphaList(this, pm, packagesSize, isGrid, dm.widthPixels > 480); isGrid = perferences.getBoolean("user", false); userAlphaList = new AppAlphaList(this, pm, packagesSize, isGrid, dm.widthPixels > 480); mListViews = new ArrayList<View>(); mListViews.add(sysAlphaList.view); mListViews.add(home); mListViews.add(userAlphaList.view); radioText = (TextView) findViewById(R.id.radio_text); radioGroup = (RadioGroup) findViewById(R.id.radio_hint); radioGroup.removeViewAt(0); mWallpaperManager = WallpaperManager.getInstance(this); mainlayout = (ViewPager)findViewById(R.id.mainFrame); mainlayout.setLongClickable(true); myPagerAdapter = new MyPagerAdapter(); mainlayout.setAdapter(myPagerAdapter); mainlayout.setOnPageChangeListener(new OnPageChangeListener() { @Override public void onPageScrollStateChanged(int state) { if (state == ViewPager.SCROLL_STATE_SETTLING) { refreshRadioButton(); } } @Override public void onPageScrolled(int position, float positionOffset, int positionOffsetPixels) { if (!shakeWallpaper) {//don't move wallpaper if change wallpaper by shake if (token == null) token = mainlayout.getWindowToken();//any token from a component is ok mWallpaperManager.setWallpaperOffsets(token, //when slide from home to systems or from systems to home, the "position" is 0, //when slide from home to users or from users to home, it is 1. //positionOffset is from 0 to 1. sometime it will jump from 1 to 0, we just omit it if it is 0. //so we can unify it to (0, 1) by (positionOffset+position)/2 (positionOffset+position)/(mListViews.size()-1), 0); } } @Override public void onPageSelected(int arg0) { } }); mainlayout.setCurrentItem(homeTab); mSysApps = new ArrayList<ResolveInfo>(); mUserApps = new ArrayList<ResolveInfo>(); mFavoApps = new ArrayList<ResolveInfo>(); mShortApps = new ArrayList<ResolveInfo>(); favoAdapter = new favoAppAdapter(getBaseContext(), mFavoApps); favoAppList.setAdapter(favoAdapter); base = (sizedRelativeLayout) home.findViewById(R.id.base); base.setResizeListener(this); homeBar = (ImageView) home.findViewById(R.id.home_bar); homeBar.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { Intent intent = new Intent(Intent.ACTION_MAIN); intent.setPackage("harley.browsers"); if (!util.startActivity(intent, false, getBaseContext())) { intent.setPackage("easy.browser"); if (!util.startActivity(intent, false, getBaseContext())) { //intent = new Intent(Intent.ACTION_VIEW, Uri.parse("market://details?id=harley.browsers")); intent.setPackage(myPackageName);// runtime error. VFY: unable to resolve static field util.startActivity(intent, true, getBaseContext()); } } } }); shortBar = (ImageView) home.findViewById(R.id.business_bar); shortBar.setOnClickListener(new OnClickListener() {//by click this bar to show/hide mainlayout @Override public void onClick(View arg0) { if ((shortAppList.getVisibility() == View.INVISIBLE) && !mShortApps.isEmpty()) shortAppList.setVisibility(View.VISIBLE); else shortAppList.setVisibility(View.INVISIBLE); } }); shortcut_phone = (ImageView) home.findViewById(R.id.shortcut_phone); shortcut_sms = (ImageView) home.findViewById(R.id.shortcut_sms); //shortcut_contact = (ImageView) findViewById(R.id.shortcut_contact); //for package add/remove IntentFilter filter = new IntentFilter(); filter.addAction(Intent.ACTION_PACKAGE_ADDED); filter.addAction(Intent.ACTION_PACKAGE_REMOVED); filter.addDataScheme("package"); registerReceiver(packageReceiver, filter); //for wall paper changed filter = new IntentFilter(Intent.ACTION_WALLPAPER_CHANGED); registerReceiver(wallpaperReceiver, filter); filter = new IntentFilter("simpleHome.action.HOME_CHANGED"); registerReceiver(homeChangeReceiver, filter); filter = new IntentFilter("simpleHome.action.PIC_ADDED"); registerReceiver(picAddReceiver, filter); filter = new IntentFilter("simpleHome.action.SHARE_DESKTOP"); registerReceiver(deskShareReceiver, filter); filter = new IntentFilter(Intent.ACTION_MEDIA_MOUNTED); filter.addAction(Intent.ACTION_MEDIA_SCANNER_STARTED); filter.addAction(Intent.ACTION_MEDIA_SCANNER_FINISHED); filter.addAction(Intent.ACTION_MEDIA_REMOVED); filter.addAction(Intent.ACTION_MEDIA_UNMOUNTED); filter.addAction(Intent.ACTION_MEDIA_BAD_REMOVAL); filter.addDataScheme("file"); registerReceiver(sdcardListener, filter); apps = (RelativeLayout) findViewById(R.id.apps); //mWallpaperManager.setWallpaperOffsets(apps.getWindowToken(), 0.5f, 0);//move wallpaper to center, but null pointer? //TelephonyManager tm = (TelephonyManager) getSystemService(Service.TELEPHONY_SERVICE); //getITelephony(tm).getActivePhoneType(); ContentResolver cr = getContentResolver(); callObserver = new CallObserver(cr, mAppHandler); smsObserver = new SmsChangeObserver(cr, mAppHandler); getContentResolver().registerContentObserver(Calls.CONTENT_URI, true, callObserver); cr.registerContentObserver(Uri.parse("content://mms-sms/"), true, smsObserver); //task for init, such as load webview, load package list InitTask initTask = new InitTask(); initTask.execute(""); restartDialog = new AlertDialog.Builder(this). setTitle(R.string.app_name). setIcon(R.drawable.icon). setMessage(R.string.restart). setPositiveButton("OK", new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { //save the layout SharedPreferences.Editor editor = perferences.edit(); if (mainlayout.getCurrentItem() == 0) editor.putBoolean("system", !sysAlphaList.mIsGrid); else if (mainlayout.getCurrentItem() == 2) editor.putBoolean("user", !userAlphaList.mIsGrid); editor.commit(); //restart the activity. note if set singleinstance or singletask of activity, below will not work on some device. Intent intent = getIntent(); overridePendingTransition(0, 0); intent.addFlags(Intent.FLAG_ACTIVITY_NO_ANIMATION | Intent.FLAG_ACTIVITY_CLEAR_TOP | Intent.FLAG_ACTIVITY_NEW_TASK); finish(); overridePendingTransition(0, 0); startActivity(intent); } }). setNegativeButton(getString(R.string.cancel), new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { } }).create(); hintDialog = new AlertDialog.Builder(this). setNegativeButton("OK", new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { } }).create(); }
diff --git a/se/sics/mspsim/core/MSP430Core.java b/se/sics/mspsim/core/MSP430Core.java index a6c7c3d..5ed2a40 100644 --- a/se/sics/mspsim/core/MSP430Core.java +++ b/se/sics/mspsim/core/MSP430Core.java @@ -1,1210 +1,1211 @@ /** * Copyright (c) 2007, Swedish Institute of Computer Science. * All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions are met: * 1. Redistributions of source code must retain the above copyright * notice, this list of conditions and the following disclaimer. * 2. Redistributions in binary form must reproduce the above copyright * notice, this list of conditions and the following disclaimer in the * documentation and/or other materials provided with the distribution. * 3. Neither the name of the Institute nor the names of its contributors * may be used to endorse or promote products derived from this software * without specific prior written permission. * * THIS SOFTWARE IS PROVIDED BY THE INSTITUTE AND CONTRIBUTORS ``AS IS'' AND * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE * ARE DISCLAIMED. IN NO EVENT SHALL THE INSTITUTE OR CONTRIBUTORS BE LIABLE * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF * SUCH DAMAGE. * * This file is part of MSPSim. * * $Id$ * * ----------------------------------------------------------------- * * MSP430Core * * Author : Joakim Eriksson * Created : Sun Oct 21 22:00:00 2007 * Updated : $Date$ * $Revision$ */ package se.sics.mspsim.core; import se.sics.mspsim.util.Utils; /** * The CPU of the MSP430 */ public class MSP430Core extends Chip implements MSP430Constants { public static final boolean DEBUG = false; public static final boolean debugInterrupts = true; //false; // Try it out with 64 k memory public static final int MAX_MEM = 64*1024; public static final int MAX_MEM_IO = 0x200; public static final int INTERNAL_IO_SIZE = 3; public static final int PORTS = 6; // 16 registers of which some are "special" - PC, SP, etc. public int[] reg = new int[16]; public CPUMonitor[] regWriteMonitors = new CPUMonitor[16]; public CPUMonitor[] regReadMonitors = new CPUMonitor[16]; // For breakpoints, etc... how should memory monitors be implemented? // Maybe monitors should have a "next" pointer...? or just have a [][]? public CPUMonitor[] breakPoints = new CPUMonitor[MAX_MEM]; // true => breakpoints can occur! boolean breakpointActive = true; public int memory[] = new int[MAX_MEM]; public long cycles = 0; public long cpuCycles = 0; // Most HW needs only notify write and clocking, others need also read... // For notify write... public IOUnit[] memOut = new IOUnit[MAX_MEM_IO]; // For notify read... -> which will happen before actual read! public IOUnit[] memIn = new IOUnit[MAX_MEM_IO]; private IOUnit[] ioUnits; private IOUnit[] passiveIOUnits; private SFR sfr; private long[] ioCycles; private long nextIOTickCycles; private int nextIOTickIndex; private int lastIOUnitPos = INTERNAL_IO_SIZE; // From the possible interrupt sources - to be able to indicate is serviced. private IOUnit interruptSource[] = new IOUnit[16]; private int interruptMax = -1; // Op/instruction represents the last executed OP / instruction private int op; int instruction; int servicedInterrupt = -1; IOUnit servicedInterruptUnit = null; private boolean interruptsEnabled = false; private boolean cpuOff = false; // Not private since they are needed (for fast access...) private int dcoFrq = 2500000; int aclkFrq = 32768; int smclkFrq = dcoFrq; long lastCyclesTime = 0; long lastVTime = 0; long currentTime = 0; double currentDCOFactor = 1.0; // Clk A can be "captured" by timers - needs to be handled close to CPU...? private int clkACaptureMode = CLKCAPTURE_NONE; // Other clocks too... private long nextEventCycles; private EventQueue vTimeEventQueue = new EventQueue(); private long nextVTimeEventCycles; private EventQueue cycleEventQueue = new EventQueue(); private long nextCycleEventCycles; public MSP430Core(int type) { // Ignore type for now... setModeNames(MODE_NAMES); // Internal Active IOUnits int passIO = 0; int actIO = 0; ioUnits = new IOUnit[INTERNAL_IO_SIZE + 10]; ioCycles = new long[INTERNAL_IO_SIZE + 10]; // Passive IOUnits (no tick) - do we need to remember them??? // Maybe for debugging purposes... passiveIOUnits = new IOUnit[PORTS + 2]; Timer ta = new Timer(this, Timer.TIMER_Ax149, memory, 0x160); Timer tb = new Timer(this, Timer.TIMER_Bx149, memory, 0x180); for (int i = 0, n = 0x20; i < n; i++) { memOut[0x160 + i] = ta; memOut[0x180 + i] = tb; memIn[0x160 + i] = ta; memIn[0x180 + i] = tb; } Watchdog wdt = new Watchdog(this); memOut[0x120] = wdt; memIn[0x120] = wdt; sfr = new SFR(this, memory); for (int i = 0, n = 0x10; i < n; i++) { memOut[i] = sfr; memIn[i] = sfr; } memIn[Timer.TAIV] = ta; memIn[Timer.TBIV] = tb; BasicClockModule bcs = new BasicClockModule(this, memory, 0); for (int i = 0x56, n = 0x59; i < n; i++) { memOut[i] = bcs; } Multiplier mp = new Multiplier(this, memory, 0); // Only cares of writes! for (int i = 0x130, n = 0x13f; i < n; i++) { memOut[i] = mp; memIn[i] = mp; } // ioUnits[0] = ta; // ioUnits[1] = tb; ioUnits[actIO++] = bcs; USART usart0 = new USART(this, memory, 0x70); USART usart1 = new USART(this, memory, 0x78); ioUnits[actIO++] = usart0; ioUnits[actIO++] = usart1; for (int i = 0, n = 8; i < n; i++) { memOut[0x70 + i] = usart0; memIn[0x70 + i] = usart0; memOut[0x78 + i] = usart1; memIn[0x78 + i] = usart1; } ADC12 adc12 = new ADC12(this); ioUnits[actIO++] = adc12; for (int i = 0, n = 16; i < n; i++) { memOut[0x80 + i] = adc12; memIn[0x80 + i] = adc12; memOut[0x140 + i] = adc12; memIn[0x140 + i] = adc12; memOut[0x150 + i] = adc12; memIn[0x150 + i] = adc12; } for (int i = 0, n = 8; i < n; i++) { memOut[0x1A0 + i] = adc12; memIn[0x1A0 + i] = adc12; } // Add port 1,2 with interrupt capability! passiveIOUnits[0] = new IOPort(this, "1", 4, memory, 0x20); passiveIOUnits[1] = new IOPort(this, "2", 1, memory, 0x28); for (int i = 0, n = 8; i < n; i++) { memOut[0x20 + i] = passiveIOUnits[0]; memOut[0x28 + i] = passiveIOUnits[1]; } // Add port 3,4 & 5,6 for (int i = 0, n = 2; i < n; i++) { passiveIOUnits[i + 2] = new IOPort(this, "" + (3 + i), 0, memory, 0x18 + i * 4); memOut[0x18 + i * 4] = passiveIOUnits[i + 2]; memOut[0x19 + i * 4] = passiveIOUnits[i + 2]; memOut[0x1a + i * 4] = passiveIOUnits[i + 2]; memOut[0x1b + i * 4] = passiveIOUnits[i + 2]; passiveIOUnits[i + 4] = new IOPort(this, "" + (5 + i), 0, memory, 0x30 + i * 4); memOut[0x30 + i * 4] = passiveIOUnits[i + 4]; memOut[0x31 + i * 4] = passiveIOUnits[i + 4]; memOut[0x32 + i * 4] = passiveIOUnits[i + 4]; memOut[0x33 + i * 4] = passiveIOUnits[i + 4]; } passIO = 6; // Add the timers passiveIOUnits[passIO++] = ta; passiveIOUnits[passIO++] = tb; initIOUnit(); } public SFR getSFR() { return sfr; } public void addIOUnit(int loReadMem, int hiReadMem, int loWriteMem, int hiWriteMem, IOUnit unit, boolean active) { // Not implemented yet... IS it needed? // if (loReadMem != -1) { // for (int i = lo, n = hiMem; i < n; i++) { // } // } if (active) { ioUnits[lastIOUnitPos++] = unit; } } public void setBreakPoint(int address, CPUMonitor mon) { breakPoints[address] = mon; } public boolean hasBreakPoint(int address) { return breakPoints[address] != null; } public void clearBreakPoint(int address) { breakPoints[address] = null; } public void setRegisterWriteMonitor(int r, CPUMonitor mon) { regWriteMonitors[r] = mon; } public void setRegisterReadMonitor(int r, CPUMonitor mon) { regReadMonitors[r] = mon; } public int[] getMemory() { return memory; } public void writeRegister(int r, int value) { // Before the write! if (regWriteMonitors[r] != null) { regWriteMonitors[r].cpuAction(CPUMonitor.REGISTER_WRITE, r, value); } reg[r] = value; if (r == SR) { boolean oldCpuOff = cpuOff; interruptsEnabled = ((value & GIE) == GIE); cpuOff = ((value & CPUOFF) == CPUOFF); if (cpuOff != oldCpuOff) { // System.out.println("LPM CPUOff: " + cpuOff + " cycles: " + cycles); } if (cpuOff) { boolean scg0 = (value & SCG0) == SCG0; boolean scg1 = (value & SCG1) == SCG1; boolean oscoff = (value & OSCOFF) == OSCOFF; if (oscoff && scg1 && scg0) { setMode(MODE_LPM4); } else if (scg1 && scg0){ setMode(MODE_LPM3); } else if (scg1) { setMode(MODE_LPM2); } else if (scg0) { setMode(MODE_LPM1); } else { setMode(MODE_LPM0); } } else { setMode(MODE_ACTIVE); } } } public int readRegister(int r) { if (regReadMonitors[r] != null) { regReadMonitors[r].cpuAction(CPUMonitor.REGISTER_READ, r, reg[r]); } return reg[r]; } public int readRegisterCG(int r, int m) { // CG1 + m == 0 => SR! if ((r == CG1 && m != 0) || r == CG2) { // No monitoring here... just return the CG values return CREG_VALUES[r - 2][m]; } if (regReadMonitors[r] != null) { regReadMonitors[r].cpuAction(CPUMonitor.REGISTER_READ, r, reg[r]); } return reg[r]; } public int incRegister(int r, int value) { if (regReadMonitors[r] != null) { regReadMonitors[r].cpuAction(CPUMonitor.REGISTER_READ, r, reg[r]); } if (regWriteMonitors[r] != null) { regWriteMonitors[r].cpuAction(CPUMonitor.REGISTER_WRITE, r, reg[r] + value); } reg[r] += value; return reg[r]; } public void setACLKFrq(int frequency) { aclkFrq = frequency; } public void setDCOFrq(int frequency, int smclkFrq) { dcoFrq = frequency; this.smclkFrq = smclkFrq; // update last virtual time before updating DCOfactor lastCyclesTime = cycles; lastVTime = getTime(); currentDCOFactor = 1.0 * BasicClockModule.MAX_DCO_FRQ / frequency; if (DEBUG) System.out.println("Set smclkFrq: " + smclkFrq); } // returns global time counted in max speed of DCOs (~5Mhz) public long getTime() { long diff = cycles - lastCyclesTime; return lastVTime + (long) (diff * currentDCOFactor); } // Converts a virtual time to a cycles time according to the current // cycle speed private long convertVTime(long vTime) { long tmpTime = lastCyclesTime + (long) ((vTime - lastVTime) / currentDCOFactor); // System.out.println("ConvertVTime: vTime=" + vTime + " => " + tmpTime); return tmpTime; } // get elapsed time in seconds public double getTimeMillis() { return 1000.0 * getTime() / BasicClockModule.MAX_DCO_FRQ; } private void executeEvents() { if (cycles >= nextVTimeEventCycles) { if (vTimeEventQueue.eventCount == 0) { nextVTimeEventCycles = cycles + 10000; } else { TimeEvent te = vTimeEventQueue.popFirst(); long now = getTime(); te.execute(now); if (vTimeEventQueue.eventCount > 0) { nextVTimeEventCycles = convertVTime(vTimeEventQueue.nextTime); } else { nextVTimeEventCycles = cycles + 10000; } } } if (cycles >= nextCycleEventCycles) { if (cycleEventQueue.eventCount == 0) { nextCycleEventCycles = cycles + 10000; } else { TimeEvent te = cycleEventQueue.popFirst(); te.execute(cycles); if (cycleEventQueue.eventCount > 0) { nextCycleEventCycles = cycleEventQueue.nextTime; } else { nextCycleEventCycles = cycles + 10000; } } } // Pick the one with shortest time in the future. nextEventCycles = nextCycleEventCycles < nextVTimeEventCycles ? nextCycleEventCycles : nextVTimeEventCycles; } /** * Schedules a new Time event using the cycles counter * @param event * @param time */ public void scheduleCycleEvent(TimeEvent event, long cycles) { long currentNext = cycleEventQueue.nextTime; cycleEventQueue.addEvent(event, cycles); if (currentNext != cycleEventQueue.nextTime) { nextCycleEventCycles = cycleEventQueue.nextTime; if (nextEventCycles > nextCycleEventCycles) { nextEventCycles = nextCycleEventCycles; } } } /** * Schedules a new Time event using the virtual time clock * @param event * @param time */ public void scheduleTimeEvent(TimeEvent event, long time) { long currentNext = vTimeEventQueue.nextTime; vTimeEventQueue.addEvent(event, time); if (currentNext != vTimeEventQueue.nextTime) { // This is only valid when not having a cycle event queue also... // if we have it needs to be checked also! nextVTimeEventCycles = convertVTime(vTimeEventQueue.nextTime); if (nextEventCycles > nextVTimeEventCycles) { nextEventCycles = nextVTimeEventCycles; } } } /** * Schedules a new Time event msec milliseconds in the future * @param event * @param time */ public long scheduleTimeEventMillis(TimeEvent event, double msec) { long time = (long) (getTime() + msec / 1000 * BasicClockModule.MAX_DCO_FRQ); // System.out.println("Scheduling at: " + time + " (" + msec + ") getTime: " + getTime()); scheduleTimeEvent(event, time); return time; } // Should also return active units... public IOUnit getIOUnit(String name) { for (int i = 0, n = passiveIOUnits.length; i < n; i++) { if (name.equals(passiveIOUnits[i].getName())) { return passiveIOUnits[i]; } } for (int i = 0, n = ioUnits.length; i < n; i++) { if (name.equals(ioUnits[i].getName())) { return ioUnits[i]; } } return null; } private void initIOUnit() { long smallestCyc = 10000000l; for (int i = 0, n = lastIOUnitPos; i < n; i++) { if ((ioCycles[i] = ioUnits[i].ioTick(0)) < smallestCyc) { smallestCyc = ioCycles[i]; nextIOTickIndex = i; } } } private void resetIOUnits() { for (int i = 0, n = lastIOUnitPos; i < n; i++) { ioUnits[i].reset(RESET_POR); } for (int i = 0, n = passiveIOUnits.length; i < n; i++) { passiveIOUnits[i].reset(RESET_POR); } } private void internalReset() { resetIOUnits(); for (int i = 0, n = 16; i < n; i++) { interruptSource[i] = null; } servicedInterruptUnit = null; servicedInterrupt = -1; interruptMax = -1; writeRegister(SR, 0); cycleEventQueue.removeAll(); vTimeEventQueue.removeAll(); } public void reset() { // reg[PC] = memory[0xfffe] + (memory[0xffff] << 8); // System.out.println("Reset the CPU: " + reg[PC]); flagInterrupt(15, null, true); } // Indicate that we have an interrupt now! // We should only get same IOUnit for same interrupt level public void flagInterrupt(int interrupt, IOUnit source, boolean triggerIR) { if (triggerIR) { interruptSource[interrupt] = source; if (debugInterrupts) { if (source != null) { System.out.println("### Interrupt flagged ON by " + source.getName()); } else { System.out.println("### Interrupt flagged ON by <null>"); } } // MAX priority is executed first - update max if this is higher! if (interrupt > interruptMax) { interruptMax = interrupt; if (interruptMax == 15) { // This can not be masked at all! interruptsEnabled = true; } } } else { if (interruptSource[interrupt] == source) { if (debugInterrupts) { System.out.println("### Interrupt flagged OFF by " + source.getName()); } interruptSource[interrupt] = null; } } } // returns the currently serviced interrupt (vector ID) public int getServicedInterrupt() { return servicedInterrupt; } // This will be called after an interrupt have been handled // In the main-CPU loop public void handlePendingInterrupts() { // By default no int. left to process... interruptMax = -1; // Find next pending interrupt for (int i = 0, n = 16; i < n; i++) { if (interruptSource[i] != null) interruptMax = i; } servicedInterrupt = -1; servicedInterruptUnit = null; } private void handleIO() { // Call the IO unit! // System.out.println("Calling: " + ioUnits[nextIOTickIndex].getName()); ioCycles[nextIOTickIndex] = ioUnits[nextIOTickIndex].ioTick(cycles); // Find the next unit to call... long smallestCyc = cycles + 1000000l; int index = 0; for (int i = 0, n = lastIOUnitPos; i < n; i++) { if (ioCycles[i] < smallestCyc) { smallestCyc = ioCycles[i]; index = i; } } nextIOTickCycles = smallestCyc; nextIOTickIndex = index; // System.out.println("Smallest IO cycles: " + smallestCyc + " => " + // ioUnits[index].getName()); } // Read method that handles read from IO units! public int read(int address, boolean word) { int val = 0; // Only word reads at 0x1fe which is highest address... if (address < 0x1ff && memIn[address] != null) { val = memIn[address].read(address, word, cycles); } else { address &= 0xffff; val = memory[address] & 0xff; if (word) { val |= (memory[(address + 1) & 0xffff] << 8); } } if (breakPoints[address] != null) { breakPoints[address].cpuAction(CPUMonitor.MEMORY_READ, address, val); } return val; } public void write(int dstAddress, int dst, boolean word) { if (breakPoints[dstAddress] != null) { breakPoints[dstAddress].cpuAction(CPUMonitor.MEMORY_WRITE, dstAddress, dst); } // Only word writes at 0x1fe which is highest address... if (dstAddress < 0x1ff && memOut[dstAddress] != null) { if (!word) dst &= 0xff; memOut[dstAddress].write(dstAddress, dst, word, cycles); } else { // TODO: add check for Flash / RAM! memory[dstAddress] = dst & 0xff; if (word) { memory[dstAddress + 1] = (dst >> 8) & 0xff; } } } private int serviceInterrupt(int pc) { int pcBefore = pc; int spBefore = readRegister(SP); int sp = spBefore; int sr = readRegister(SR); // Only store stuff on irq except reset... - not sure if this is correct... // TODO: Check what to do if reset is called! if (interruptMax < 15) { // Push PC and SR to stack // store on stack - always move 2 steps (W) even if B. writeRegister(SP, sp = spBefore - 2); // Put lo & hi on stack! memory[sp] = pc & 0xff; memory[sp + 1] = (pc >> 8) & 0xff; writeRegister(SP, sp = sp - 2); // Put lo & hi on stack! memory[sp] = sr & 0xff; memory[sp + 1] = (sr >> 8) & 0xff; } // Clear SR - except ... // Jump to the address specified in the interrupt vector writeRegister(PC, pc = memory[0xffe0 + interruptMax * 2] + (memory[0xffe0 + interruptMax * 2 + 1] << 8)); writeRegister(SR, sr & ~CPUOFF & ~SCG1 & ~OSCOFF); servicedInterrupt = interruptMax; servicedInterruptUnit = interruptSource[servicedInterrupt]; // Flag off this interrupt - for now - as soon as RETI is // executed things might change! interruptMax = -1; if (servicedInterrupt == 15) { // System.out.println("**** Servicing RESET! => " + Utils.hex16(pc)); internalReset(); } // Interrupts take 6 cycles! cycles += 6; if (debugInterrupts) { System.out.println("### Executing interrupt: " + servicedInterrupt + " at " + pcBefore + " to " + pc + " SP before: " + spBefore); } // And call the serviced routine (which can cause another interrupt) if (servicedInterruptUnit != null) { if (debugInterrupts) { System.out.println("### Calling serviced interrupt on: " + servicedInterruptUnit.getName()); } servicedInterruptUnit.interruptServiced(servicedInterrupt); } return pc; } /* returns true if any instruction was emulated - false if CpuOff */ public boolean emulateOP() { //System.out.println("CYCLES BEFORE: " + cycles); int pc = readRegister(PC); long startCycles = cycles; // ------------------------------------------------------------------- // Event processing // ------------------------------------------------------------------- if (cycles >= nextEventCycles) { executeEvents(); } // ------------------------------------------------------------------- // (old) I/O processing // ------------------------------------------------------------------- if (cycles >= nextIOTickCycles) { handleIO(); } // ------------------------------------------------------------------- // Interrupt processing [after the last instruction was executed] // ------------------------------------------------------------------- if (interruptsEnabled && servicedInterrupt == -1 && interruptMax >= 0) { pc = serviceInterrupt(pc); } /* Did not execute any instructions */ if (cpuOff) { // System.out.println("Jumping: " + (nextIOTickCycles - cycles)); cycles = nextIOTickCycles; return false; } // This is quite costly... should probably be made more // efficiently if (breakPoints[pc] != null) { if (breakpointActive) { breakPoints[pc].cpuAction(CPUMonitor.BREAK, pc, 0); breakpointActive = false; return false; } else { // Execute this instruction - this is second call... breakpointActive = true; } } instruction = memory[pc] + (memory[pc + 1] << 8); op = instruction >> 12; int sp = 0; int sr = 0; boolean word = (instruction & 0x40) == 0; // Destination vars int dstRegister = 0; int dstAddress = -1; boolean dstRegMode = false; int dst = 0; boolean write = false; boolean updateStatus = true; // When is PC increased probably immediately (e.g. here)? pc += 2; writeRegister(PC, pc); switch (op) { case 1: // ------------------------------------------------------------------- // Single operand instructions // ------------------------------------------------------------------- { // Register dstRegister = instruction & 0xf; // Adress mode of destination... int ad = (instruction >> 4) & 3; int nxtCarry = 0; op = instruction & 0xff80; if (op == PUSH) { // The PUSH operation increase the SP before address resolution! // store on stack - always move 2 steps (W) even if B./ sp = readRegister(SP) - 2; writeRegister(SP, sp); } if ((dstRegister == CG1 && ad != AM_INDEX) || dstRegister == CG2) { dstRegMode = true; cycles++; } else { switch(ad) { // Operand in register! case AM_REG: dstRegMode = true; cycles++; break; case AM_INDEX: dstAddress = readRegisterCG(dstRegister, ad) + memory[pc] + (memory[pc + 1] << 8); // When is PC incremented - assuming immediately after "read"? pc += 2; writeRegister(PC, pc); cycles += 4; break; // Indirect register case AM_IND_REG: dstAddress = readRegister(dstRegister); cycles += 3; break; // Bugfix suggested by Matt Thompson case AM_IND_AUTOINC: if(dstRegister == PC) { dstAddress = readRegister(PC); pc += 2; writeRegister(PC, pc); cycles += 5; } else { dstAddress = readRegister(dstRegister); writeRegister(dstRegister, dstAddress + (word ? 2 : 1)); cycles += 3; } break; } // case AM_IND_AUTOINC: // dstAddress = readRegister(dstRegister); // writeRegister(dstRegister, dstAddress + (word ? 2 : 1)); // cycles += 3; // break; // } } // Perform the read if (dstRegMode) { dst = readRegisterCG(dstRegister, ad); if (!word) { dst &= 0xff; } } else { dst = read(dstAddress, word); } switch(op) { case RRC: nxtCarry = (dst & 1) > 0 ? CARRY : 0; dst = dst >> 1; if (word) { dst |= (readRegister(SR) & CARRY) > 0 ? 0x8000 : 0; } else { dst |= (readRegister(SR) & CARRY) > 0 ? 0x80 : 0; } // Indicate write to memory!! write = true; // Set the next carry! writeRegister(SR, (readRegister(SR) & ~CARRY) | nxtCarry); break; case SWPB: int tmp = dst; dst = ((tmp >> 8) & 0xff) + ((tmp << 8) & 0xff00); write = true; break; case RRA: nxtCarry = (dst & 1) > 0 ? CARRY : 0; if (word) { dst = (dst & 0x8000) | (dst >> 1); } else { dst = (dst & 0x80) | (dst >> 1); } write = true; writeRegister(SR, (readRegister(SR) & ~CARRY) | nxtCarry); break; case SXT: // Extend Sign (bit 8-15 => same as bit 7) dst = (dst & 0x80) > 0 ? dst | 0xff00 : dst & 0x7f; write = true; break; case PUSH: if (word) { // Put lo & hi on stack! memory[sp] = dst & 0xff; memory[sp + 1] = dst >> 8; } else { // Byte => only lo byte memory[sp] = dst & 0xff; memory[sp + 1] = 0; } write = false; updateStatus = false; break; case CALL: // store current PC on stack... (current PC points to next instr.) sp = readRegister(SP) - 2; writeRegister(SP, sp); pc = readRegister(PC); memory[sp] = pc & 0xff; memory[sp + 1] = pc >> 8; writeRegister(PC, dst); write = false; updateStatus = false; break; case RETI: // Put Top of stack to Status DstRegister (TOS -> SR) sp = readRegister(SP); writeRegister(SR, memory[sp++] + (memory[sp++] << 8)); // TOS -> PC writeRegister(PC, memory[sp++] + (memory[sp++] << 8)); writeRegister(SP, sp); write = false; updateStatus = false; if (debugInterrupts) { System.out.println("### RETI at " + pc + " => " + reg[PC] + " SP after: " + reg[SP]); } // This assumes that all interrupts will get back using RETI! handlePendingInterrupts(); break; default: System.out.println("Error: Not implemented instruction:" + instruction); } } break; // Jump instructions case 2: case 3: // 10 bits for address for these => 0x00fc => remove 2 bits int jmpOffset = instruction & 0x3ff; jmpOffset = (jmpOffset & 0x200) == 0 ? 2 * jmpOffset : -(2 * (0x200 - (jmpOffset & 0x1ff))); boolean jump = false; // All jump takes two cycles cycles += 2; sr = readRegister(SR); switch(instruction & 0xfc00) { case JNE: jump = (sr & ZERO) == 0; break; case JEQ: jump = (sr & ZERO) > 0; break; case JNC: jump = (sr & CARRY) == 0; break; case JC: jump = (sr & CARRY) > 0; break; case JN: jump = (sr & NEGATIVE) > 0; break; case JGE: jump = (sr & NEGATIVE) > 0 == (sr & OVERFLOW) > 0; break; case JL: jump = (sr & NEGATIVE) > 0 != (sr & OVERFLOW) > 0; break; case JMP: jump = true; break; default: System.out.println("Not implemented instruction: " + Utils.binary16(instruction)); } // Perform the Jump if (jump) { writeRegister(PC, pc + jmpOffset); } break; default: // --------------------------------------------------------------- // Double operand instructions! // --------------------------------------------------------------- dstRegister = instruction & 0xf; int srcRegister = (instruction >> 8) & 0xf; int as = (instruction >> 4) & 3; // AD: 0 => register direct, 1 => register index, e.g. X(Rn) dstRegMode = ((instruction >> 7) & 1) == 0; dstAddress = -1; int srcAddress = -1; int src = 0; // Some CGs should be handled as registry reads only... if ((srcRegister == CG1 && as != AM_INDEX) || srcRegister == CG2) { src = CREG_VALUES[srcRegister - 2][as]; if (!word) { src &= 0xff; } cycles += dstRegMode ? 1 : 4; } else { switch(as) { // Operand in register! case AM_REG: // CG handled above! src = readRegister(srcRegister); if (!word) { src &= 0xff; } cycles += dstRegMode ? 1 : 4; break; case AM_INDEX: // Indexed if reg != PC & CG1/CG2 - will PC be incremented? srcAddress = readRegisterCG(srcRegister, as) + memory[pc] + (memory[pc + 1] << 8); // When is PC incremented - assuming immediately after "read"? incRegister(PC, 2); cycles += dstRegMode ? 3 : 6; break; // Indirect register case AM_IND_REG: srcAddress = readRegister(srcRegister); cycles += dstRegMode ? 2 : 5; break; case AM_IND_AUTOINC: if (srcRegister == PC) { srcAddress = readRegister(PC); pc += 2; incRegister(PC, 2); cycles += 3; } else { srcAddress = readRegister(srcRegister); incRegister(srcRegister, word ? 2 : 1); cycles += dstRegMode ? 2 : 5; } break; } } // Perform the read of destination! if (dstRegMode) { dst = readRegister(dstRegister); if (!word) { dst &= 0xff; } } else { // PC Could have changed above! pc = readRegister(PC); if (dstRegister == 2) { dstAddress = memory[pc] + (memory[pc + 1] << 8); } else { // CG here??? dstAddress = readRegister(dstRegister) + memory[pc] + (memory[pc + 1] << 8); } dst = read(dstAddress, word); pc += 2; incRegister(PC, 2); } // **** Perform the read... if (srcAddress != -1) { // Got very high address - check that?!! srcAddress = srcAddress & 0xffff; src = read(srcAddress, word); // if (debug) { // System.out.println("Reading from " + Utils.hex16(srcAddress) + // " => " + src); // } } int tmp = 0; int tmpAdd = 0; switch (op) { case MOV: // MOV dst = src; write = true; break; // FIX THIS!!! - make SUB a separate operation so that // it is clear that overflow flag is corretct... case SUB: // Carry always 1 with SUB tmpAdd = 1; case SUBC: // Both sub and subc does one complement (not) + 1 (or carry) src = (src ^ 0xffff) & 0xffff; case ADDC: // ADDC if (op == ADDC || op == SUBC) tmpAdd = ((readRegister(SR) & CARRY) > 0) ? 1 : 0; case ADD: // ADD // Tmp gives zero if same sign! if sign is different after -> overf. sr = readRegister(SR); sr &= ~(OVERFLOW | CARRY); tmp = (src ^ dst) & (word ? 0x8000 : 0x80); // Includes carry if carry should be added... dst = dst + src + tmpAdd; if (dst > (word ? 0xffff : 0xff)) { sr |= CARRY; } // If tmp == 0 and currenly not the same sign for src & dst if (tmp == 0 && ((src ^ dst) & (word ? 0x8000 : 0x80)) != 0) { sr |= OVERFLOW; // System.out.println("OVERFLOW - ADD/SUB " + Utils.hex16(src) // + " + " + Utils.hex16(tmpDst)); } // System.out.println(Utils.hex16(dst) + " [SR=" + // Utils.hex16(reg[SR]) + "]"); writeRegister(SR, sr); write = true; break; case CMP: // CMP // Set CARRY if A >= B, and it's clear if A < B int b = word ? 0x8000 : 0x80; sr = readRegister(SR); sr = (sr & ~(CARRY | OVERFLOW)) | (dst >= src ? CARRY : 0); tmp = dst - src; if (((src ^ tmp) & b) == 0 && (((src ^ dst) & b) != 0)) { sr |= OVERFLOW; } writeRegister(SR, sr); // Must set dst to the result to set the rest of the status register dst = tmp; break; case DADD: // DADD if (DEBUG) System.out.println("DADD: Decimal add executed - result error!!!"); // Decimal add... this is wrong... each nibble is 0-9... // So this has to be reimplemented... dst = dst + src + ((readRegister(SR) & CARRY) > 0 ? 1 : 0); write = true; break; case BIT: // BIT dst = src & dst; sr = readRegister(SR); // Clear overflow and carry! sr = sr & ~(CARRY | OVERFLOW); // Set carry if result is non-zero! if (dst != 0) { sr |= CARRY; } writeRegister(SR, sr); break; case BIC: // BIC // No status reg change // System.out.println("BIC: =>" + Utils.hex16(dstAddress) + " => " // + Utils.hex16(dst) + " AS: " + as + // " sReg: " + srcRegister + " => " + src + // " dReg: " + dstRegister + " => " + dst); dst = (~src) & dst; write = true; updateStatus = false; break; case BIS: // BIS dst = src | dst; write = true; updateStatus = false; break; case XOR: // XOR dst = src ^ dst; write = true; break; case AND: // AND dst = src & dst; write = true; break; default: System.out.println("DoubleOperand not implemented: " + op + " at " + pc); } } dst &= 0xffff; if (write) { if (dstRegMode) { + if (!word) dst &= 0xff; writeRegister(dstRegister, dst); } else { dstAddress &= 0xffff; write(dstAddress, dst, word); } } if (updateStatus) { // Update the Zero and Negative status! // Carry and overflow must be set separately! sr = readRegister(SR); sr = (sr & ~(ZERO | NEGATIVE)) | ((dst == 0) ? ZERO : 0) | (word ? ((dst & 0x8000) > 0 ? NEGATIVE : 0) : ((dst & 0x80) > 0 ? NEGATIVE : 0)); writeRegister(SR, sr); } //System.out.println("CYCLES AFTER: " + cycles); cpuCycles += cycles - startCycles; return true; } public String getName() { return "MSP430 Core"; } public int getModeMax() { return MODE_MAX; } }
true
true
public boolean emulateOP() { //System.out.println("CYCLES BEFORE: " + cycles); int pc = readRegister(PC); long startCycles = cycles; // ------------------------------------------------------------------- // Event processing // ------------------------------------------------------------------- if (cycles >= nextEventCycles) { executeEvents(); } // ------------------------------------------------------------------- // (old) I/O processing // ------------------------------------------------------------------- if (cycles >= nextIOTickCycles) { handleIO(); } // ------------------------------------------------------------------- // Interrupt processing [after the last instruction was executed] // ------------------------------------------------------------------- if (interruptsEnabled && servicedInterrupt == -1 && interruptMax >= 0) { pc = serviceInterrupt(pc); } /* Did not execute any instructions */ if (cpuOff) { // System.out.println("Jumping: " + (nextIOTickCycles - cycles)); cycles = nextIOTickCycles; return false; } // This is quite costly... should probably be made more // efficiently if (breakPoints[pc] != null) { if (breakpointActive) { breakPoints[pc].cpuAction(CPUMonitor.BREAK, pc, 0); breakpointActive = false; return false; } else { // Execute this instruction - this is second call... breakpointActive = true; } } instruction = memory[pc] + (memory[pc + 1] << 8); op = instruction >> 12; int sp = 0; int sr = 0; boolean word = (instruction & 0x40) == 0; // Destination vars int dstRegister = 0; int dstAddress = -1; boolean dstRegMode = false; int dst = 0; boolean write = false; boolean updateStatus = true; // When is PC increased probably immediately (e.g. here)? pc += 2; writeRegister(PC, pc); switch (op) { case 1: // ------------------------------------------------------------------- // Single operand instructions // ------------------------------------------------------------------- { // Register dstRegister = instruction & 0xf; // Adress mode of destination... int ad = (instruction >> 4) & 3; int nxtCarry = 0; op = instruction & 0xff80; if (op == PUSH) { // The PUSH operation increase the SP before address resolution! // store on stack - always move 2 steps (W) even if B./ sp = readRegister(SP) - 2; writeRegister(SP, sp); } if ((dstRegister == CG1 && ad != AM_INDEX) || dstRegister == CG2) { dstRegMode = true; cycles++; } else { switch(ad) { // Operand in register! case AM_REG: dstRegMode = true; cycles++; break; case AM_INDEX: dstAddress = readRegisterCG(dstRegister, ad) + memory[pc] + (memory[pc + 1] << 8); // When is PC incremented - assuming immediately after "read"? pc += 2; writeRegister(PC, pc); cycles += 4; break; // Indirect register case AM_IND_REG: dstAddress = readRegister(dstRegister); cycles += 3; break; // Bugfix suggested by Matt Thompson case AM_IND_AUTOINC: if(dstRegister == PC) { dstAddress = readRegister(PC); pc += 2; writeRegister(PC, pc); cycles += 5; } else { dstAddress = readRegister(dstRegister); writeRegister(dstRegister, dstAddress + (word ? 2 : 1)); cycles += 3; } break; } // case AM_IND_AUTOINC: // dstAddress = readRegister(dstRegister); // writeRegister(dstRegister, dstAddress + (word ? 2 : 1)); // cycles += 3; // break; // } } // Perform the read if (dstRegMode) { dst = readRegisterCG(dstRegister, ad); if (!word) { dst &= 0xff; } } else { dst = read(dstAddress, word); } switch(op) { case RRC: nxtCarry = (dst & 1) > 0 ? CARRY : 0; dst = dst >> 1; if (word) { dst |= (readRegister(SR) & CARRY) > 0 ? 0x8000 : 0; } else { dst |= (readRegister(SR) & CARRY) > 0 ? 0x80 : 0; } // Indicate write to memory!! write = true; // Set the next carry! writeRegister(SR, (readRegister(SR) & ~CARRY) | nxtCarry); break; case SWPB: int tmp = dst; dst = ((tmp >> 8) & 0xff) + ((tmp << 8) & 0xff00); write = true; break; case RRA: nxtCarry = (dst & 1) > 0 ? CARRY : 0; if (word) { dst = (dst & 0x8000) | (dst >> 1); } else { dst = (dst & 0x80) | (dst >> 1); } write = true; writeRegister(SR, (readRegister(SR) & ~CARRY) | nxtCarry); break; case SXT: // Extend Sign (bit 8-15 => same as bit 7) dst = (dst & 0x80) > 0 ? dst | 0xff00 : dst & 0x7f; write = true; break; case PUSH: if (word) { // Put lo & hi on stack! memory[sp] = dst & 0xff; memory[sp + 1] = dst >> 8; } else { // Byte => only lo byte memory[sp] = dst & 0xff; memory[sp + 1] = 0; } write = false; updateStatus = false; break; case CALL: // store current PC on stack... (current PC points to next instr.) sp = readRegister(SP) - 2; writeRegister(SP, sp); pc = readRegister(PC); memory[sp] = pc & 0xff; memory[sp + 1] = pc >> 8; writeRegister(PC, dst); write = false; updateStatus = false; break; case RETI: // Put Top of stack to Status DstRegister (TOS -> SR) sp = readRegister(SP); writeRegister(SR, memory[sp++] + (memory[sp++] << 8)); // TOS -> PC writeRegister(PC, memory[sp++] + (memory[sp++] << 8)); writeRegister(SP, sp); write = false; updateStatus = false; if (debugInterrupts) { System.out.println("### RETI at " + pc + " => " + reg[PC] + " SP after: " + reg[SP]); } // This assumes that all interrupts will get back using RETI! handlePendingInterrupts(); break; default: System.out.println("Error: Not implemented instruction:" + instruction); } } break; // Jump instructions case 2: case 3: // 10 bits for address for these => 0x00fc => remove 2 bits int jmpOffset = instruction & 0x3ff; jmpOffset = (jmpOffset & 0x200) == 0 ? 2 * jmpOffset : -(2 * (0x200 - (jmpOffset & 0x1ff))); boolean jump = false; // All jump takes two cycles cycles += 2; sr = readRegister(SR); switch(instruction & 0xfc00) { case JNE: jump = (sr & ZERO) == 0; break; case JEQ: jump = (sr & ZERO) > 0; break; case JNC: jump = (sr & CARRY) == 0; break; case JC: jump = (sr & CARRY) > 0; break; case JN: jump = (sr & NEGATIVE) > 0; break; case JGE: jump = (sr & NEGATIVE) > 0 == (sr & OVERFLOW) > 0; break; case JL: jump = (sr & NEGATIVE) > 0 != (sr & OVERFLOW) > 0; break; case JMP: jump = true; break; default: System.out.println("Not implemented instruction: " + Utils.binary16(instruction)); } // Perform the Jump if (jump) { writeRegister(PC, pc + jmpOffset); } break; default: // --------------------------------------------------------------- // Double operand instructions! // --------------------------------------------------------------- dstRegister = instruction & 0xf; int srcRegister = (instruction >> 8) & 0xf; int as = (instruction >> 4) & 3; // AD: 0 => register direct, 1 => register index, e.g. X(Rn) dstRegMode = ((instruction >> 7) & 1) == 0; dstAddress = -1; int srcAddress = -1; int src = 0; // Some CGs should be handled as registry reads only... if ((srcRegister == CG1 && as != AM_INDEX) || srcRegister == CG2) { src = CREG_VALUES[srcRegister - 2][as]; if (!word) { src &= 0xff; } cycles += dstRegMode ? 1 : 4; } else { switch(as) { // Operand in register! case AM_REG: // CG handled above! src = readRegister(srcRegister); if (!word) { src &= 0xff; } cycles += dstRegMode ? 1 : 4; break; case AM_INDEX: // Indexed if reg != PC & CG1/CG2 - will PC be incremented? srcAddress = readRegisterCG(srcRegister, as) + memory[pc] + (memory[pc + 1] << 8); // When is PC incremented - assuming immediately after "read"? incRegister(PC, 2); cycles += dstRegMode ? 3 : 6; break; // Indirect register case AM_IND_REG: srcAddress = readRegister(srcRegister); cycles += dstRegMode ? 2 : 5; break; case AM_IND_AUTOINC: if (srcRegister == PC) { srcAddress = readRegister(PC); pc += 2; incRegister(PC, 2); cycles += 3; } else { srcAddress = readRegister(srcRegister); incRegister(srcRegister, word ? 2 : 1); cycles += dstRegMode ? 2 : 5; } break; } } // Perform the read of destination! if (dstRegMode) { dst = readRegister(dstRegister); if (!word) { dst &= 0xff; } } else { // PC Could have changed above! pc = readRegister(PC); if (dstRegister == 2) { dstAddress = memory[pc] + (memory[pc + 1] << 8); } else { // CG here??? dstAddress = readRegister(dstRegister) + memory[pc] + (memory[pc + 1] << 8); } dst = read(dstAddress, word); pc += 2; incRegister(PC, 2); } // **** Perform the read... if (srcAddress != -1) { // Got very high address - check that?!! srcAddress = srcAddress & 0xffff; src = read(srcAddress, word); // if (debug) { // System.out.println("Reading from " + Utils.hex16(srcAddress) + // " => " + src); // } } int tmp = 0; int tmpAdd = 0; switch (op) { case MOV: // MOV dst = src; write = true; break; // FIX THIS!!! - make SUB a separate operation so that // it is clear that overflow flag is corretct... case SUB: // Carry always 1 with SUB tmpAdd = 1; case SUBC: // Both sub and subc does one complement (not) + 1 (or carry) src = (src ^ 0xffff) & 0xffff; case ADDC: // ADDC if (op == ADDC || op == SUBC) tmpAdd = ((readRegister(SR) & CARRY) > 0) ? 1 : 0; case ADD: // ADD // Tmp gives zero if same sign! if sign is different after -> overf. sr = readRegister(SR); sr &= ~(OVERFLOW | CARRY); tmp = (src ^ dst) & (word ? 0x8000 : 0x80); // Includes carry if carry should be added... dst = dst + src + tmpAdd; if (dst > (word ? 0xffff : 0xff)) { sr |= CARRY; } // If tmp == 0 and currenly not the same sign for src & dst if (tmp == 0 && ((src ^ dst) & (word ? 0x8000 : 0x80)) != 0) { sr |= OVERFLOW; // System.out.println("OVERFLOW - ADD/SUB " + Utils.hex16(src) // + " + " + Utils.hex16(tmpDst)); } // System.out.println(Utils.hex16(dst) + " [SR=" + // Utils.hex16(reg[SR]) + "]"); writeRegister(SR, sr); write = true; break; case CMP: // CMP // Set CARRY if A >= B, and it's clear if A < B int b = word ? 0x8000 : 0x80; sr = readRegister(SR); sr = (sr & ~(CARRY | OVERFLOW)) | (dst >= src ? CARRY : 0); tmp = dst - src; if (((src ^ tmp) & b) == 0 && (((src ^ dst) & b) != 0)) { sr |= OVERFLOW; } writeRegister(SR, sr); // Must set dst to the result to set the rest of the status register dst = tmp; break; case DADD: // DADD if (DEBUG) System.out.println("DADD: Decimal add executed - result error!!!"); // Decimal add... this is wrong... each nibble is 0-9... // So this has to be reimplemented... dst = dst + src + ((readRegister(SR) & CARRY) > 0 ? 1 : 0); write = true; break; case BIT: // BIT dst = src & dst; sr = readRegister(SR); // Clear overflow and carry! sr = sr & ~(CARRY | OVERFLOW); // Set carry if result is non-zero! if (dst != 0) { sr |= CARRY; } writeRegister(SR, sr); break; case BIC: // BIC // No status reg change // System.out.println("BIC: =>" + Utils.hex16(dstAddress) + " => " // + Utils.hex16(dst) + " AS: " + as + // " sReg: " + srcRegister + " => " + src + // " dReg: " + dstRegister + " => " + dst); dst = (~src) & dst; write = true; updateStatus = false; break; case BIS: // BIS dst = src | dst; write = true; updateStatus = false; break; case XOR: // XOR dst = src ^ dst; write = true; break; case AND: // AND dst = src & dst; write = true; break; default: System.out.println("DoubleOperand not implemented: " + op + " at " + pc); } } dst &= 0xffff; if (write) { if (dstRegMode) { writeRegister(dstRegister, dst); } else { dstAddress &= 0xffff; write(dstAddress, dst, word); } } if (updateStatus) { // Update the Zero and Negative status! // Carry and overflow must be set separately! sr = readRegister(SR); sr = (sr & ~(ZERO | NEGATIVE)) | ((dst == 0) ? ZERO : 0) | (word ? ((dst & 0x8000) > 0 ? NEGATIVE : 0) : ((dst & 0x80) > 0 ? NEGATIVE : 0)); writeRegister(SR, sr); } //System.out.println("CYCLES AFTER: " + cycles); cpuCycles += cycles - startCycles; return true; }
public boolean emulateOP() { //System.out.println("CYCLES BEFORE: " + cycles); int pc = readRegister(PC); long startCycles = cycles; // ------------------------------------------------------------------- // Event processing // ------------------------------------------------------------------- if (cycles >= nextEventCycles) { executeEvents(); } // ------------------------------------------------------------------- // (old) I/O processing // ------------------------------------------------------------------- if (cycles >= nextIOTickCycles) { handleIO(); } // ------------------------------------------------------------------- // Interrupt processing [after the last instruction was executed] // ------------------------------------------------------------------- if (interruptsEnabled && servicedInterrupt == -1 && interruptMax >= 0) { pc = serviceInterrupt(pc); } /* Did not execute any instructions */ if (cpuOff) { // System.out.println("Jumping: " + (nextIOTickCycles - cycles)); cycles = nextIOTickCycles; return false; } // This is quite costly... should probably be made more // efficiently if (breakPoints[pc] != null) { if (breakpointActive) { breakPoints[pc].cpuAction(CPUMonitor.BREAK, pc, 0); breakpointActive = false; return false; } else { // Execute this instruction - this is second call... breakpointActive = true; } } instruction = memory[pc] + (memory[pc + 1] << 8); op = instruction >> 12; int sp = 0; int sr = 0; boolean word = (instruction & 0x40) == 0; // Destination vars int dstRegister = 0; int dstAddress = -1; boolean dstRegMode = false; int dst = 0; boolean write = false; boolean updateStatus = true; // When is PC increased probably immediately (e.g. here)? pc += 2; writeRegister(PC, pc); switch (op) { case 1: // ------------------------------------------------------------------- // Single operand instructions // ------------------------------------------------------------------- { // Register dstRegister = instruction & 0xf; // Adress mode of destination... int ad = (instruction >> 4) & 3; int nxtCarry = 0; op = instruction & 0xff80; if (op == PUSH) { // The PUSH operation increase the SP before address resolution! // store on stack - always move 2 steps (W) even if B./ sp = readRegister(SP) - 2; writeRegister(SP, sp); } if ((dstRegister == CG1 && ad != AM_INDEX) || dstRegister == CG2) { dstRegMode = true; cycles++; } else { switch(ad) { // Operand in register! case AM_REG: dstRegMode = true; cycles++; break; case AM_INDEX: dstAddress = readRegisterCG(dstRegister, ad) + memory[pc] + (memory[pc + 1] << 8); // When is PC incremented - assuming immediately after "read"? pc += 2; writeRegister(PC, pc); cycles += 4; break; // Indirect register case AM_IND_REG: dstAddress = readRegister(dstRegister); cycles += 3; break; // Bugfix suggested by Matt Thompson case AM_IND_AUTOINC: if(dstRegister == PC) { dstAddress = readRegister(PC); pc += 2; writeRegister(PC, pc); cycles += 5; } else { dstAddress = readRegister(dstRegister); writeRegister(dstRegister, dstAddress + (word ? 2 : 1)); cycles += 3; } break; } // case AM_IND_AUTOINC: // dstAddress = readRegister(dstRegister); // writeRegister(dstRegister, dstAddress + (word ? 2 : 1)); // cycles += 3; // break; // } } // Perform the read if (dstRegMode) { dst = readRegisterCG(dstRegister, ad); if (!word) { dst &= 0xff; } } else { dst = read(dstAddress, word); } switch(op) { case RRC: nxtCarry = (dst & 1) > 0 ? CARRY : 0; dst = dst >> 1; if (word) { dst |= (readRegister(SR) & CARRY) > 0 ? 0x8000 : 0; } else { dst |= (readRegister(SR) & CARRY) > 0 ? 0x80 : 0; } // Indicate write to memory!! write = true; // Set the next carry! writeRegister(SR, (readRegister(SR) & ~CARRY) | nxtCarry); break; case SWPB: int tmp = dst; dst = ((tmp >> 8) & 0xff) + ((tmp << 8) & 0xff00); write = true; break; case RRA: nxtCarry = (dst & 1) > 0 ? CARRY : 0; if (word) { dst = (dst & 0x8000) | (dst >> 1); } else { dst = (dst & 0x80) | (dst >> 1); } write = true; writeRegister(SR, (readRegister(SR) & ~CARRY) | nxtCarry); break; case SXT: // Extend Sign (bit 8-15 => same as bit 7) dst = (dst & 0x80) > 0 ? dst | 0xff00 : dst & 0x7f; write = true; break; case PUSH: if (word) { // Put lo & hi on stack! memory[sp] = dst & 0xff; memory[sp + 1] = dst >> 8; } else { // Byte => only lo byte memory[sp] = dst & 0xff; memory[sp + 1] = 0; } write = false; updateStatus = false; break; case CALL: // store current PC on stack... (current PC points to next instr.) sp = readRegister(SP) - 2; writeRegister(SP, sp); pc = readRegister(PC); memory[sp] = pc & 0xff; memory[sp + 1] = pc >> 8; writeRegister(PC, dst); write = false; updateStatus = false; break; case RETI: // Put Top of stack to Status DstRegister (TOS -> SR) sp = readRegister(SP); writeRegister(SR, memory[sp++] + (memory[sp++] << 8)); // TOS -> PC writeRegister(PC, memory[sp++] + (memory[sp++] << 8)); writeRegister(SP, sp); write = false; updateStatus = false; if (debugInterrupts) { System.out.println("### RETI at " + pc + " => " + reg[PC] + " SP after: " + reg[SP]); } // This assumes that all interrupts will get back using RETI! handlePendingInterrupts(); break; default: System.out.println("Error: Not implemented instruction:" + instruction); } } break; // Jump instructions case 2: case 3: // 10 bits for address for these => 0x00fc => remove 2 bits int jmpOffset = instruction & 0x3ff; jmpOffset = (jmpOffset & 0x200) == 0 ? 2 * jmpOffset : -(2 * (0x200 - (jmpOffset & 0x1ff))); boolean jump = false; // All jump takes two cycles cycles += 2; sr = readRegister(SR); switch(instruction & 0xfc00) { case JNE: jump = (sr & ZERO) == 0; break; case JEQ: jump = (sr & ZERO) > 0; break; case JNC: jump = (sr & CARRY) == 0; break; case JC: jump = (sr & CARRY) > 0; break; case JN: jump = (sr & NEGATIVE) > 0; break; case JGE: jump = (sr & NEGATIVE) > 0 == (sr & OVERFLOW) > 0; break; case JL: jump = (sr & NEGATIVE) > 0 != (sr & OVERFLOW) > 0; break; case JMP: jump = true; break; default: System.out.println("Not implemented instruction: " + Utils.binary16(instruction)); } // Perform the Jump if (jump) { writeRegister(PC, pc + jmpOffset); } break; default: // --------------------------------------------------------------- // Double operand instructions! // --------------------------------------------------------------- dstRegister = instruction & 0xf; int srcRegister = (instruction >> 8) & 0xf; int as = (instruction >> 4) & 3; // AD: 0 => register direct, 1 => register index, e.g. X(Rn) dstRegMode = ((instruction >> 7) & 1) == 0; dstAddress = -1; int srcAddress = -1; int src = 0; // Some CGs should be handled as registry reads only... if ((srcRegister == CG1 && as != AM_INDEX) || srcRegister == CG2) { src = CREG_VALUES[srcRegister - 2][as]; if (!word) { src &= 0xff; } cycles += dstRegMode ? 1 : 4; } else { switch(as) { // Operand in register! case AM_REG: // CG handled above! src = readRegister(srcRegister); if (!word) { src &= 0xff; } cycles += dstRegMode ? 1 : 4; break; case AM_INDEX: // Indexed if reg != PC & CG1/CG2 - will PC be incremented? srcAddress = readRegisterCG(srcRegister, as) + memory[pc] + (memory[pc + 1] << 8); // When is PC incremented - assuming immediately after "read"? incRegister(PC, 2); cycles += dstRegMode ? 3 : 6; break; // Indirect register case AM_IND_REG: srcAddress = readRegister(srcRegister); cycles += dstRegMode ? 2 : 5; break; case AM_IND_AUTOINC: if (srcRegister == PC) { srcAddress = readRegister(PC); pc += 2; incRegister(PC, 2); cycles += 3; } else { srcAddress = readRegister(srcRegister); incRegister(srcRegister, word ? 2 : 1); cycles += dstRegMode ? 2 : 5; } break; } } // Perform the read of destination! if (dstRegMode) { dst = readRegister(dstRegister); if (!word) { dst &= 0xff; } } else { // PC Could have changed above! pc = readRegister(PC); if (dstRegister == 2) { dstAddress = memory[pc] + (memory[pc + 1] << 8); } else { // CG here??? dstAddress = readRegister(dstRegister) + memory[pc] + (memory[pc + 1] << 8); } dst = read(dstAddress, word); pc += 2; incRegister(PC, 2); } // **** Perform the read... if (srcAddress != -1) { // Got very high address - check that?!! srcAddress = srcAddress & 0xffff; src = read(srcAddress, word); // if (debug) { // System.out.println("Reading from " + Utils.hex16(srcAddress) + // " => " + src); // } } int tmp = 0; int tmpAdd = 0; switch (op) { case MOV: // MOV dst = src; write = true; break; // FIX THIS!!! - make SUB a separate operation so that // it is clear that overflow flag is corretct... case SUB: // Carry always 1 with SUB tmpAdd = 1; case SUBC: // Both sub and subc does one complement (not) + 1 (or carry) src = (src ^ 0xffff) & 0xffff; case ADDC: // ADDC if (op == ADDC || op == SUBC) tmpAdd = ((readRegister(SR) & CARRY) > 0) ? 1 : 0; case ADD: // ADD // Tmp gives zero if same sign! if sign is different after -> overf. sr = readRegister(SR); sr &= ~(OVERFLOW | CARRY); tmp = (src ^ dst) & (word ? 0x8000 : 0x80); // Includes carry if carry should be added... dst = dst + src + tmpAdd; if (dst > (word ? 0xffff : 0xff)) { sr |= CARRY; } // If tmp == 0 and currenly not the same sign for src & dst if (tmp == 0 && ((src ^ dst) & (word ? 0x8000 : 0x80)) != 0) { sr |= OVERFLOW; // System.out.println("OVERFLOW - ADD/SUB " + Utils.hex16(src) // + " + " + Utils.hex16(tmpDst)); } // System.out.println(Utils.hex16(dst) + " [SR=" + // Utils.hex16(reg[SR]) + "]"); writeRegister(SR, sr); write = true; break; case CMP: // CMP // Set CARRY if A >= B, and it's clear if A < B int b = word ? 0x8000 : 0x80; sr = readRegister(SR); sr = (sr & ~(CARRY | OVERFLOW)) | (dst >= src ? CARRY : 0); tmp = dst - src; if (((src ^ tmp) & b) == 0 && (((src ^ dst) & b) != 0)) { sr |= OVERFLOW; } writeRegister(SR, sr); // Must set dst to the result to set the rest of the status register dst = tmp; break; case DADD: // DADD if (DEBUG) System.out.println("DADD: Decimal add executed - result error!!!"); // Decimal add... this is wrong... each nibble is 0-9... // So this has to be reimplemented... dst = dst + src + ((readRegister(SR) & CARRY) > 0 ? 1 : 0); write = true; break; case BIT: // BIT dst = src & dst; sr = readRegister(SR); // Clear overflow and carry! sr = sr & ~(CARRY | OVERFLOW); // Set carry if result is non-zero! if (dst != 0) { sr |= CARRY; } writeRegister(SR, sr); break; case BIC: // BIC // No status reg change // System.out.println("BIC: =>" + Utils.hex16(dstAddress) + " => " // + Utils.hex16(dst) + " AS: " + as + // " sReg: " + srcRegister + " => " + src + // " dReg: " + dstRegister + " => " + dst); dst = (~src) & dst; write = true; updateStatus = false; break; case BIS: // BIS dst = src | dst; write = true; updateStatus = false; break; case XOR: // XOR dst = src ^ dst; write = true; break; case AND: // AND dst = src & dst; write = true; break; default: System.out.println("DoubleOperand not implemented: " + op + " at " + pc); } } dst &= 0xffff; if (write) { if (dstRegMode) { if (!word) dst &= 0xff; writeRegister(dstRegister, dst); } else { dstAddress &= 0xffff; write(dstAddress, dst, word); } } if (updateStatus) { // Update the Zero and Negative status! // Carry and overflow must be set separately! sr = readRegister(SR); sr = (sr & ~(ZERO | NEGATIVE)) | ((dst == 0) ? ZERO : 0) | (word ? ((dst & 0x8000) > 0 ? NEGATIVE : 0) : ((dst & 0x80) > 0 ? NEGATIVE : 0)); writeRegister(SR, sr); } //System.out.println("CYCLES AFTER: " + cycles); cpuCycles += cycles - startCycles; return true; }
diff --git a/src/java/org/grails/plugin/config/AbstractConfigHelper.java b/src/java/org/grails/plugin/config/AbstractConfigHelper.java index 37bd017..730033b 100644 --- a/src/java/org/grails/plugin/config/AbstractConfigHelper.java +++ b/src/java/org/grails/plugin/config/AbstractConfigHelper.java @@ -1,371 +1,372 @@ /* * Copyright 2011 the original author or authors. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.grails.plugin.config; import grails.util.Environment; import grails.util.Metadata; import groovy.lang.Closure; import groovy.lang.GroovyClassLoader; import groovy.lang.GroovyObject; import groovy.util.ConfigObject; import groovy.util.ConfigSlurper; import java.lang.reflect.InvocationHandler; import java.lang.reflect.Method; import java.util.ArrayList; import java.util.Arrays; import java.util.Collections; import java.util.LinkedHashMap; import java.util.LinkedHashSet; import java.util.List; import java.util.Map; import java.util.Set; import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; import org.codehaus.groovy.grails.commons.GrailsApplication; import org.codehaus.groovy.grails.commons.GrailsClassUtils; import org.codehaus.groovy.grails.commons.cfg.ConfigurationHelper; import org.codehaus.groovy.grails.plugins.GrailsPlugin; import org.codehaus.groovy.grails.plugins.GrailsPluginManager; import org.springframework.context.ApplicationContext; import org.springframework.util.Assert; /** * @author Daniel Henrique Alves Lima */ public abstract class AbstractConfigHelper { private static final String GRAILS_PLUGIN_SUFFIX = "GrailsPlugin"; private static final String DEFAULT_CONFIG_SUFFIX = "DefaultConfig"; protected final Log log = LogFactory.getLog(getClass()); private GrailsPluginManager defaultPluginManager; public void setDefaultPluginManager(GrailsPluginManager defaultPluginManager) { if (log.isDebugEnabled()) { log.debug("setPluginManager(): " + defaultPluginManager); } this.defaultPluginManager = defaultPluginManager; } public abstract void enhanceClasses(); public abstract void notifyConfigChange(); protected ConfigObject buildMergedConfig(GrailsPluginManager pluginManager, GrailsApplication grailsApplication) { if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl()"); } Assert.notNull(pluginManager); Assert.notNull(grailsApplication); Metadata applicationMetaData = grailsApplication.getMetadata(); String applicationName = applicationMetaData.getApplicationName(); List<Class<?>> defaultConfigClasses = new ArrayList<Class<?>>(); /* * Search for all the default configurations using the plugin manager * processing order. */ List<Closure> afterConfigMergeClosures = new ArrayList<Closure>(); boolean classesLoaded = false; if (grailsApplication.isInitialised()) { Class<?>[] classes = grailsApplication.getAllClasses(); if (classes != null && classes.length > 0) { classesLoaded = true; } } - for (GrailsPlugin plugin : pluginManager.getAllPlugins()) { + GrailsPlugin[] allPlugins = pluginManager.getAllPlugins(); + for (GrailsPlugin plugin : allPlugins) { if (plugin.isEnabled()) { Class<?> defaultConfigClass = null; Class<?> pluginClass = plugin.getPluginClass(); org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin pluginClassMetadata = null; org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin defaultConfigClassMetadata = null; String configName = pluginClass.getSimpleName(); if (configName.endsWith(GRAILS_PLUGIN_SUFFIX)) { configName = configName.replace(GRAILS_PLUGIN_SUFFIX, DEFAULT_CONFIG_SUFFIX); } else { configName = configName + DEFAULT_CONFIG_SUFFIX; } if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): configName " + configName); } if (classesLoaded) { defaultConfigClass = grailsApplication.getClassForName(configName); } else { /* * When called from doWithWebDescriptor, classes aren't loaded yet. */ try { defaultConfigClass = grailsApplication.getClassLoader().loadClass(configName); // defaultConfigClass = null; } catch (ClassNotFoundException e) { } } if (defaultConfigClass != null) { /* The class is inside one grails-app subdirectory. */ pluginClassMetadata = pluginClass.getAnnotation( org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin.class); defaultConfigClassMetadata = defaultConfigClass.getAnnotation( org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin.class); if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): pluginClassMetadata " + pluginClassMetadata); log.debug("getMergedConfigImpl(): defaultConfigClassMetadata " + defaultConfigClassMetadata); } if (pluginClassMetadata == null && defaultConfigClassMetadata == null || pluginClassMetadata != null && defaultConfigClassMetadata != null && pluginClassMetadata.name().equals(defaultConfigClassMetadata.name()) || /* Workaround when building this as a Grails 2.0.0 plugin. */ applicationName != null && applicationName.equals(plugin.getFileSystemShortName())) { /* The default config belongs to this plugin. */ log.debug("getMergedConfigImpl(): default config found"); } else { if (log.isWarnEnabled()) { log.warn("getMergedConfigImpl(): " + defaultConfigClass + " doesn't belong to " + plugin.getName()); } defaultConfigClass = null; } } if (defaultConfigClass != null) { defaultConfigClasses.add(defaultConfigClass); } GroovyObject pluginInstance = plugin.getInstance(); Object o = GrailsClassUtils.getPropertyOrStaticPropertyOrFieldValue(pluginInstance, "afterConfigMerge"); if (o != null) { Closure c = null; if (o instanceof Closure) { c = (Closure) o; if (c.getMaximumNumberOfParameters() > 0) { afterConfigMergeClosures.add(c); //c.setDelegate(plugin); } else { c = null; } } if (c == null) { if (log.isWarnEnabled()) { log.warn("getMergedConfigImpl(): Invalid afterConfigMerge closure " + o); } } } } } if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): defaultConfigClasses " + defaultConfigClasses); } GroovyClassLoader classLoader = null; ClassLoader parentClassLoader = grailsApplication.getClassLoader(); if (parentClassLoader == null) { parentClassLoader = Thread.currentThread().getContextClassLoader(); if (parentClassLoader == null) { parentClassLoader = getClass().getClassLoader(); } } if (parentClassLoader instanceof GroovyClassLoader) { classLoader = (GroovyClassLoader) parentClassLoader; } else { classLoader = new GroovyClassLoader(parentClassLoader); } ConfigObject config = new ConfigObject(); mergeInDefaultConfigs(config, defaultConfigClasses, classLoader); ConfigurationHelper.initConfig(config, null, classLoader); config.merge(grailsApplication.getConfig()); if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): config " + config); } /* * Executed the collected closures. It's the last chance of influencing * the merged config. */ Map<String, Object> ctx = new LinkedHashMap<String, Object>(); ctx.put("appConfig", grailsApplication.getConfig()); ctx = Collections.unmodifiableMap(ctx); Object arg = config; Object[] args = new Object[]{config, ctx}; for (Closure closure : afterConfigMergeClosures) { try { if (closure.getMaximumNumberOfParameters() == 1) { closure.call(arg); } else { closure.call(args); } } catch (RuntimeException e) { log.error("getMergedConfigImpl(): error executing afterConfigClosure", e); } } return config; } protected void mergeInDefaultConfigs(ConfigObject config, List<Class<?>> defaultConfigClasses, GroovyClassLoader classLoader) { ConfigSlurper configSlurper = new ConfigSlurper(Environment .getCurrent().getName()); configSlurper.setClassLoader(classLoader); for (Class<?> defaultConfigClass : defaultConfigClasses) { try { configSlurper.setBinding(config); ConfigObject newConfig = configSlurper.parse(defaultConfigClass); if (log.isDebugEnabled()) { log.debug("mergeInDefaultConfigs(): newConfig " + newConfig); } config.merge(newConfig); } catch (RuntimeException e) { log.error("mergeInDefaultConfigs(): Error merging " + defaultConfigClass, e); } } if (log.isDebugEnabled()) { log.debug("mergeInDefaultConfigs(): config " + config); } } protected GrailsPluginManager getPluginManager( GrailsApplication grailsApplication) { GrailsPluginManager pluginManager = null; { ApplicationContext mainContext = grailsApplication.getMainContext(); if (mainContext != null) { pluginManager = (GrailsPluginManager) mainContext .getBean("pluginManager"); } } if (pluginManager == null) { ApplicationContext mainContext = grailsApplication .getParentContext(); if (mainContext != null) { try { pluginManager = (GrailsPluginManager) mainContext .getBean("pluginManager"); } catch (org.springframework.beans.factory.NoSuchBeanDefinitionException e) { /* Workaround for Grails 2.0.0. */ log.warn("getPluginManager()", e); } } } if (pluginManager == null) { pluginManager = defaultPluginManager; } Assert.notNull(pluginManager); return pluginManager; } protected static class ConfigObjectProxy implements InvocationHandler { private static final Log LOG = LogFactory .getLog(ConfigObjectProxy.class); private boolean isCheckedMap; private Map<Object, Object> config; public static Object newInstance(Map<Object, Object> config, boolean isCheckedMap) { ClassLoader cl = config.getClass().getClassLoader(); Class<?>[] configInterfaces = config.getClass().getInterfaces(); Set<Class<?>> interfaces = new LinkedHashSet<Class<?>>( Arrays.asList(configInterfaces)); interfaces.add(Map.class); Assert.notNull(interfaces.remove(GroovyObject.class)); @SuppressWarnings("unchecked") Map<Object, Object> result = (Map<Object, Object>) java.lang.reflect.Proxy .newProxyInstance( cl, interfaces.toArray(new Class<?>[interfaces.size()]), new ConfigObjectProxy(config, isCheckedMap)); return result; } private ConfigObjectProxy(Map<Object, Object> config, boolean isCheckedMap) { this.config = config; this.isCheckedMap = isCheckedMap; } @SuppressWarnings({"unchecked"}) public Object invoke(Object proxy, Method m, Object[] args) throws Throwable { Object result = null; try { if (LOG.isDebugEnabled()) { LOG.debug("before method " + m.getName()); } if (m.getDeclaringClass().equals(Map.class) && m.getName().equals("get")) { boolean containsKey = config.containsKey(args[0]); if (!containsKey) { result = null; if (isCheckedMap) { throw new IllegalArgumentException("Inexistent key " + args[0]); } } } if (result == null) { result = m.invoke(config, args); } if (result != null && result instanceof ConfigObject) { result = newInstance((Map<Object, Object>) result, isCheckedMap); } /* * } catch (Exception e) { throw new * RuntimeException("unexpected invocation exception: " + * e.getMessage()); */ } finally { if (LOG.isDebugEnabled()) { LOG.debug("after method " + m.getName()); } } return result; } } }
true
true
protected ConfigObject buildMergedConfig(GrailsPluginManager pluginManager, GrailsApplication grailsApplication) { if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl()"); } Assert.notNull(pluginManager); Assert.notNull(grailsApplication); Metadata applicationMetaData = grailsApplication.getMetadata(); String applicationName = applicationMetaData.getApplicationName(); List<Class<?>> defaultConfigClasses = new ArrayList<Class<?>>(); /* * Search for all the default configurations using the plugin manager * processing order. */ List<Closure> afterConfigMergeClosures = new ArrayList<Closure>(); boolean classesLoaded = false; if (grailsApplication.isInitialised()) { Class<?>[] classes = grailsApplication.getAllClasses(); if (classes != null && classes.length > 0) { classesLoaded = true; } } for (GrailsPlugin plugin : pluginManager.getAllPlugins()) { if (plugin.isEnabled()) { Class<?> defaultConfigClass = null; Class<?> pluginClass = plugin.getPluginClass(); org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin pluginClassMetadata = null; org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin defaultConfigClassMetadata = null; String configName = pluginClass.getSimpleName(); if (configName.endsWith(GRAILS_PLUGIN_SUFFIX)) { configName = configName.replace(GRAILS_PLUGIN_SUFFIX, DEFAULT_CONFIG_SUFFIX); } else { configName = configName + DEFAULT_CONFIG_SUFFIX; } if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): configName " + configName); } if (classesLoaded) { defaultConfigClass = grailsApplication.getClassForName(configName); } else { /* * When called from doWithWebDescriptor, classes aren't loaded yet. */ try { defaultConfigClass = grailsApplication.getClassLoader().loadClass(configName); // defaultConfigClass = null; } catch (ClassNotFoundException e) { } } if (defaultConfigClass != null) { /* The class is inside one grails-app subdirectory. */ pluginClassMetadata = pluginClass.getAnnotation( org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin.class); defaultConfigClassMetadata = defaultConfigClass.getAnnotation( org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin.class); if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): pluginClassMetadata " + pluginClassMetadata); log.debug("getMergedConfigImpl(): defaultConfigClassMetadata " + defaultConfigClassMetadata); } if (pluginClassMetadata == null && defaultConfigClassMetadata == null || pluginClassMetadata != null && defaultConfigClassMetadata != null && pluginClassMetadata.name().equals(defaultConfigClassMetadata.name()) || /* Workaround when building this as a Grails 2.0.0 plugin. */ applicationName != null && applicationName.equals(plugin.getFileSystemShortName())) { /* The default config belongs to this plugin. */ log.debug("getMergedConfigImpl(): default config found"); } else { if (log.isWarnEnabled()) { log.warn("getMergedConfigImpl(): " + defaultConfigClass + " doesn't belong to " + plugin.getName()); } defaultConfigClass = null; } } if (defaultConfigClass != null) { defaultConfigClasses.add(defaultConfigClass); } GroovyObject pluginInstance = plugin.getInstance(); Object o = GrailsClassUtils.getPropertyOrStaticPropertyOrFieldValue(pluginInstance, "afterConfigMerge"); if (o != null) { Closure c = null; if (o instanceof Closure) { c = (Closure) o; if (c.getMaximumNumberOfParameters() > 0) { afterConfigMergeClosures.add(c); //c.setDelegate(plugin); } else { c = null; } } if (c == null) { if (log.isWarnEnabled()) { log.warn("getMergedConfigImpl(): Invalid afterConfigMerge closure " + o); } } } } } if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): defaultConfigClasses " + defaultConfigClasses); } GroovyClassLoader classLoader = null; ClassLoader parentClassLoader = grailsApplication.getClassLoader(); if (parentClassLoader == null) { parentClassLoader = Thread.currentThread().getContextClassLoader(); if (parentClassLoader == null) { parentClassLoader = getClass().getClassLoader(); } } if (parentClassLoader instanceof GroovyClassLoader) { classLoader = (GroovyClassLoader) parentClassLoader; } else { classLoader = new GroovyClassLoader(parentClassLoader); } ConfigObject config = new ConfigObject(); mergeInDefaultConfigs(config, defaultConfigClasses, classLoader); ConfigurationHelper.initConfig(config, null, classLoader); config.merge(grailsApplication.getConfig()); if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): config " + config); } /* * Executed the collected closures. It's the last chance of influencing * the merged config. */ Map<String, Object> ctx = new LinkedHashMap<String, Object>(); ctx.put("appConfig", grailsApplication.getConfig()); ctx = Collections.unmodifiableMap(ctx); Object arg = config; Object[] args = new Object[]{config, ctx}; for (Closure closure : afterConfigMergeClosures) { try { if (closure.getMaximumNumberOfParameters() == 1) { closure.call(arg); } else { closure.call(args); } } catch (RuntimeException e) { log.error("getMergedConfigImpl(): error executing afterConfigClosure", e); } } return config; }
protected ConfigObject buildMergedConfig(GrailsPluginManager pluginManager, GrailsApplication grailsApplication) { if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl()"); } Assert.notNull(pluginManager); Assert.notNull(grailsApplication); Metadata applicationMetaData = grailsApplication.getMetadata(); String applicationName = applicationMetaData.getApplicationName(); List<Class<?>> defaultConfigClasses = new ArrayList<Class<?>>(); /* * Search for all the default configurations using the plugin manager * processing order. */ List<Closure> afterConfigMergeClosures = new ArrayList<Closure>(); boolean classesLoaded = false; if (grailsApplication.isInitialised()) { Class<?>[] classes = grailsApplication.getAllClasses(); if (classes != null && classes.length > 0) { classesLoaded = true; } } GrailsPlugin[] allPlugins = pluginManager.getAllPlugins(); for (GrailsPlugin plugin : allPlugins) { if (plugin.isEnabled()) { Class<?> defaultConfigClass = null; Class<?> pluginClass = plugin.getPluginClass(); org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin pluginClassMetadata = null; org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin defaultConfigClassMetadata = null; String configName = pluginClass.getSimpleName(); if (configName.endsWith(GRAILS_PLUGIN_SUFFIX)) { configName = configName.replace(GRAILS_PLUGIN_SUFFIX, DEFAULT_CONFIG_SUFFIX); } else { configName = configName + DEFAULT_CONFIG_SUFFIX; } if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): configName " + configName); } if (classesLoaded) { defaultConfigClass = grailsApplication.getClassForName(configName); } else { /* * When called from doWithWebDescriptor, classes aren't loaded yet. */ try { defaultConfigClass = grailsApplication.getClassLoader().loadClass(configName); // defaultConfigClass = null; } catch (ClassNotFoundException e) { } } if (defaultConfigClass != null) { /* The class is inside one grails-app subdirectory. */ pluginClassMetadata = pluginClass.getAnnotation( org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin.class); defaultConfigClassMetadata = defaultConfigClass.getAnnotation( org.codehaus.groovy.grails.plugins.metadata.GrailsPlugin.class); if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): pluginClassMetadata " + pluginClassMetadata); log.debug("getMergedConfigImpl(): defaultConfigClassMetadata " + defaultConfigClassMetadata); } if (pluginClassMetadata == null && defaultConfigClassMetadata == null || pluginClassMetadata != null && defaultConfigClassMetadata != null && pluginClassMetadata.name().equals(defaultConfigClassMetadata.name()) || /* Workaround when building this as a Grails 2.0.0 plugin. */ applicationName != null && applicationName.equals(plugin.getFileSystemShortName())) { /* The default config belongs to this plugin. */ log.debug("getMergedConfigImpl(): default config found"); } else { if (log.isWarnEnabled()) { log.warn("getMergedConfigImpl(): " + defaultConfigClass + " doesn't belong to " + plugin.getName()); } defaultConfigClass = null; } } if (defaultConfigClass != null) { defaultConfigClasses.add(defaultConfigClass); } GroovyObject pluginInstance = plugin.getInstance(); Object o = GrailsClassUtils.getPropertyOrStaticPropertyOrFieldValue(pluginInstance, "afterConfigMerge"); if (o != null) { Closure c = null; if (o instanceof Closure) { c = (Closure) o; if (c.getMaximumNumberOfParameters() > 0) { afterConfigMergeClosures.add(c); //c.setDelegate(plugin); } else { c = null; } } if (c == null) { if (log.isWarnEnabled()) { log.warn("getMergedConfigImpl(): Invalid afterConfigMerge closure " + o); } } } } } if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): defaultConfigClasses " + defaultConfigClasses); } GroovyClassLoader classLoader = null; ClassLoader parentClassLoader = grailsApplication.getClassLoader(); if (parentClassLoader == null) { parentClassLoader = Thread.currentThread().getContextClassLoader(); if (parentClassLoader == null) { parentClassLoader = getClass().getClassLoader(); } } if (parentClassLoader instanceof GroovyClassLoader) { classLoader = (GroovyClassLoader) parentClassLoader; } else { classLoader = new GroovyClassLoader(parentClassLoader); } ConfigObject config = new ConfigObject(); mergeInDefaultConfigs(config, defaultConfigClasses, classLoader); ConfigurationHelper.initConfig(config, null, classLoader); config.merge(grailsApplication.getConfig()); if (log.isDebugEnabled()) { log.debug("getMergedConfigImpl(): config " + config); } /* * Executed the collected closures. It's the last chance of influencing * the merged config. */ Map<String, Object> ctx = new LinkedHashMap<String, Object>(); ctx.put("appConfig", grailsApplication.getConfig()); ctx = Collections.unmodifiableMap(ctx); Object arg = config; Object[] args = new Object[]{config, ctx}; for (Closure closure : afterConfigMergeClosures) { try { if (closure.getMaximumNumberOfParameters() == 1) { closure.call(arg); } else { closure.call(args); } } catch (RuntimeException e) { log.error("getMergedConfigImpl(): error executing afterConfigClosure", e); } } return config; }
diff --git a/src/checkstyle/com/puppycrawl/tools/checkstyle/ConfigurationLoader.java b/src/checkstyle/com/puppycrawl/tools/checkstyle/ConfigurationLoader.java index 11e99b9c..2eec1a9d 100644 --- a/src/checkstyle/com/puppycrawl/tools/checkstyle/ConfigurationLoader.java +++ b/src/checkstyle/com/puppycrawl/tools/checkstyle/ConfigurationLoader.java @@ -1,172 +1,174 @@ //////////////////////////////////////////////////////////////////////////////// // checkstyle: Checks Java source code for adherence to a set of rules. // Copyright (C) 2001-2002 Oliver Burn // // This library is free software; you can redistribute it and/or // modify it under the terms of the GNU Lesser General Public // License as published by the Free Software Foundation; either // version 2.1 of the License, or (at your option) any later version. // // This library is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU // Lesser General Public License for more details. // // You should have received a copy of the GNU Lesser General Public // License along with this library; if not, write to the Free Software // Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA //////////////////////////////////////////////////////////////////////////////// package com.puppycrawl.tools.checkstyle; import java.io.FileNotFoundException; import java.io.FileReader; import java.io.IOException; import java.util.Properties; import java.util.Stack; import javax.xml.parsers.ParserConfigurationException; import javax.xml.parsers.SAXParserFactory; import com.puppycrawl.tools.checkstyle.api.Configuration; import org.xml.sax.Attributes; import org.xml.sax.InputSource; import org.xml.sax.SAXException; import org.xml.sax.XMLReader; import org.xml.sax.helpers.DefaultHandler; import com.puppycrawl.tools.checkstyle.api.CheckstyleException; // TODO: Fix the loader so it doesn't validate the document /** * Describe class <code>ConfigurationLoader</code> here. * * @author <a href="mailto:[email protected]">Oliver Burn</a> * @version 1.0 */ class ConfigurationLoader extends DefaultHandler { /** overriding properties **/ private Properties mOverrideProps = new Properties(); /** parser to read XML files **/ private final XMLReader mParser; /** the loaded configuration **/ private Stack mConfigStack = new Stack(); /** the Configuration that is beeing built */ private Configuration mConfiguration = null; /** * Creates a new <code>ConfigurationLoader</code> instance. * @throws ParserConfigurationException if an error occurs * @throws SAXException if an error occurs */ private ConfigurationLoader() throws ParserConfigurationException, SAXException { mParser = SAXParserFactory.newInstance().newSAXParser().getXMLReader(); mParser.setContentHandler(this); } /** * Parses the specified file loading the configuration information. * @param aFilename the file to parse * @throws FileNotFoundException if an error occurs * @throws IOException if an error occurs * @throws SAXException if an error occurs */ void parseFile(String aFilename) throws FileNotFoundException, IOException, SAXException { mParser.parse(new InputSource(new FileReader(aFilename))); } /////////////////////////////////////////////////////////////////////////// // Document handler methods /////////////////////////////////////////////////////////////////////////// /** @see org.xml.sax.helpers.DefaultHandler **/ public void startElement(String aNamespaceURI, String aLocalName, String aQName, Attributes aAtts) throws SAXException { // TODO: debug logging for support puposes DefaultConfiguration conf = new DefaultConfiguration(aQName); final int attCount = aAtts.getLength(); for (int i = 0; i < attCount; i++) { String name = aAtts.getQName(i); String value = aAtts.getValue(i); // expand properties if (value.startsWith("${") && value.endsWith("}")) { String propName = value.substring(2, value.length() - 1); value = mOverrideProps.getProperty(propName); if (value == null) { - throw new SAXException("missing external property " + propName); + throw new SAXException( + "missing external property " + propName); } } conf.addAttribute(name, value); } if (mConfiguration == null) { mConfiguration = conf; } if (!mConfigStack.isEmpty()) { - DefaultConfiguration top = (DefaultConfiguration) mConfigStack.peek(); + DefaultConfiguration top = + (DefaultConfiguration) mConfigStack.peek(); top.addChild(conf); } mConfigStack.push(conf); } /** @see org.xml.sax.helpers.DefaultHandler **/ public void endElement(String aNamespaceURI, String aLocalName, String aQName) { mConfigStack.pop(); } /** * Returns the check configurations in a specified file. * @param aConfigFname name of config file * @param aOverrideProps overriding properties * @return the check configurations * @throws CheckstyleException if an error occurs */ public static Configuration loadConfiguration(String aConfigFname, Properties aOverrideProps) throws CheckstyleException { try { final ConfigurationLoader loader = new ConfigurationLoader(); loader.mOverrideProps = aOverrideProps; loader.parseFile(aConfigFname); return loader.getConfiguration(); } catch (FileNotFoundException e) { throw new CheckstyleException("unable to find " + aConfigFname); } catch (ParserConfigurationException e) { throw new CheckstyleException("unable to parse " + aConfigFname); } catch (SAXException e) { throw new CheckstyleException("unable to parse " + aConfigFname + " - " + e.getMessage()); } catch (IOException e) { throw new CheckstyleException("unable to read " + aConfigFname); } } /** * Returns the configuration in the last file parsed. * @return Configuration object */ private Configuration getConfiguration() { return mConfiguration; } }
false
true
public void startElement(String aNamespaceURI, String aLocalName, String aQName, Attributes aAtts) throws SAXException { // TODO: debug logging for support puposes DefaultConfiguration conf = new DefaultConfiguration(aQName); final int attCount = aAtts.getLength(); for (int i = 0; i < attCount; i++) { String name = aAtts.getQName(i); String value = aAtts.getValue(i); // expand properties if (value.startsWith("${") && value.endsWith("}")) { String propName = value.substring(2, value.length() - 1); value = mOverrideProps.getProperty(propName); if (value == null) { throw new SAXException("missing external property " + propName); } } conf.addAttribute(name, value); } if (mConfiguration == null) { mConfiguration = conf; } if (!mConfigStack.isEmpty()) { DefaultConfiguration top = (DefaultConfiguration) mConfigStack.peek(); top.addChild(conf); } mConfigStack.push(conf); }
public void startElement(String aNamespaceURI, String aLocalName, String aQName, Attributes aAtts) throws SAXException { // TODO: debug logging for support puposes DefaultConfiguration conf = new DefaultConfiguration(aQName); final int attCount = aAtts.getLength(); for (int i = 0; i < attCount; i++) { String name = aAtts.getQName(i); String value = aAtts.getValue(i); // expand properties if (value.startsWith("${") && value.endsWith("}")) { String propName = value.substring(2, value.length() - 1); value = mOverrideProps.getProperty(propName); if (value == null) { throw new SAXException( "missing external property " + propName); } } conf.addAttribute(name, value); } if (mConfiguration == null) { mConfiguration = conf; } if (!mConfigStack.isEmpty()) { DefaultConfiguration top = (DefaultConfiguration) mConfigStack.peek(); top.addChild(conf); } mConfigStack.push(conf); }
diff --git a/test/edu/msu/cme/rdp/kmer/cli/KmerCoverageTest.java b/test/edu/msu/cme/rdp/kmer/cli/KmerCoverageTest.java index d0deaa6..7cbf19d 100644 --- a/test/edu/msu/cme/rdp/kmer/cli/KmerCoverageTest.java +++ b/test/edu/msu/cme/rdp/kmer/cli/KmerCoverageTest.java @@ -1,112 +1,112 @@ /* * Copyright (C) 2014 wangqion * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ package edu.msu.cme.rdp.kmer.cli; import edu.msu.cme.rdp.kmer.cli.KmerCoverage.Contig; import edu.msu.cme.rdp.readseq.readers.SequenceReader; import edu.msu.cme.rdp.readseq.readers.core.SeqReaderCore; import edu.msu.cme.rdp.readseq.utils.SeqUtils; import java.io.BufferedInputStream; import java.io.ByteArrayInputStream; import java.io.ByteArrayOutputStream; import java.util.concurrent.ConcurrentHashMap; import org.junit.Test; import static org.junit.Assert.*; /** * * @author wangqion */ public class KmerCoverageTest { public KmerCoverageTest() { } /** * Test of printCovereage method, of class KmerCoverage. */ @Test public void testGetContigMap() throws Exception { System.out.println("getContigMap"); int kmer_size = 30; String contigs = ">contig1\n" + "ccccacgagcaggcgaccaagcaaggcccgaagatcatggaattccggctcacggttga\n" + ">contig2\n" + "caggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgaggagaagcgaattgtcatcgacgacatgg\n" + ">contig3\n" + "caggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgagN\n"; String reads = ">r1\n" + "ccccacgagcaggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgaggagaagcgaattgtcatcgacgacatgg\n" + ">r2 reverse of r1 \n" + "CCATGTCGTCGATGACAATTCGCTTCTCCTCAACCGTGAGCCGGAATTCCATGATCTTCGGGCCTTGCTTGGTCGCCTGCTCGTGGGG\n" + ">r3 one mismatch\n" + "ccccacgagcaggcgaccaagcaaggcccgNagatcatggaattccggctcacggttgaggC"; SeqReaderCore readsReader = SeqUtils.getSeqReaderCore(new BufferedInputStream(new ByteArrayInputStream(reads.getBytes()))); SequenceReader contigReader = new SequenceReader(new BufferedInputStream(new ByteArrayInputStream(contigs.getBytes()))); ByteArrayOutputStream coverage_out = new ByteArrayOutputStream(); ByteArrayOutputStream abundance_out = new ByteArrayOutputStream(); KmerCoverage instance = new KmerCoverage(kmer_size, contigReader, readsReader, null); ConcurrentHashMap<Integer, Contig> contigMap = instance.getContigMap(); // contig 1 should have full coverage Contig contig1 = contigMap.get(0); assertEquals(contig1.name, "contig1"); // offset from 1, assertEquals(contig1.coverage[0], 3, 0.005); assertEquals(contig1.coverage[8], 2, 0.005); assertEquals(contig1.coverage[9], 0.6666, 0.005); assertEquals(contig1.coverage[29], 0.6666, 0.005); //contig2 is the reverse complement of contig1, should have the same coverage Contig contig2 = contigMap.get(1); assertEquals(contig2.name, "contig2"); // offset from 1, assertEquals(contig2.coverage[0], 0.6666, 0.005); assertEquals(contig2.coverage[20], 0.6666, 0.005); assertEquals(contig2.coverage[21], 1, 0.005); assertEquals(contig2.coverage[22], 3, 0.005); assertEquals(contig2.coverage[23], 2, 0.005); assertEquals(contig2.coverage[49], 2, 0.005); //contig3 has a few mismatches Contig contig3 = contigMap.get(2); assertEquals(contig3.name, "contig3"); //offset from 1, assertEquals(contig3.coverage[0], 0.6666, 0.005); assertEquals(contig3.coverage[21], 1, 0.005); assertEquals(contig3.coverage[22], 0, 0.005); // check summary instance.printCovereage(coverage_out, abundance_out); String[] summary = coverage_out.toString().split("\n"); - assertEquals("contig1\t0.667\t1.100\t30\t30\t1.000", summary[1]); - assertEquals("contig3\t0.667\t0.652\t23\t22\t0.957", summary[2]); - assertEquals("contig2\t2.000\t1.440\t50\t50\t1.000", summary[3]); + assertEquals("contig1\t1.100\t0.667\t30\t30\t1.000", summary[3]); + assertEquals("contig3\t0.652\t0.667\t23\t22\t0.957", summary[4]); + assertEquals("contig2\t1.440\t2.000\t50\t50\t1.000", summary[5]); } }
true
true
public void testGetContigMap() throws Exception { System.out.println("getContigMap"); int kmer_size = 30; String contigs = ">contig1\n" + "ccccacgagcaggcgaccaagcaaggcccgaagatcatggaattccggctcacggttga\n" + ">contig2\n" + "caggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgaggagaagcgaattgtcatcgacgacatgg\n" + ">contig3\n" + "caggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgagN\n"; String reads = ">r1\n" + "ccccacgagcaggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgaggagaagcgaattgtcatcgacgacatgg\n" + ">r2 reverse of r1 \n" + "CCATGTCGTCGATGACAATTCGCTTCTCCTCAACCGTGAGCCGGAATTCCATGATCTTCGGGCCTTGCTTGGTCGCCTGCTCGTGGGG\n" + ">r3 one mismatch\n" + "ccccacgagcaggcgaccaagcaaggcccgNagatcatggaattccggctcacggttgaggC"; SeqReaderCore readsReader = SeqUtils.getSeqReaderCore(new BufferedInputStream(new ByteArrayInputStream(reads.getBytes()))); SequenceReader contigReader = new SequenceReader(new BufferedInputStream(new ByteArrayInputStream(contigs.getBytes()))); ByteArrayOutputStream coverage_out = new ByteArrayOutputStream(); ByteArrayOutputStream abundance_out = new ByteArrayOutputStream(); KmerCoverage instance = new KmerCoverage(kmer_size, contigReader, readsReader, null); ConcurrentHashMap<Integer, Contig> contigMap = instance.getContigMap(); // contig 1 should have full coverage Contig contig1 = contigMap.get(0); assertEquals(contig1.name, "contig1"); // offset from 1, assertEquals(contig1.coverage[0], 3, 0.005); assertEquals(contig1.coverage[8], 2, 0.005); assertEquals(contig1.coverage[9], 0.6666, 0.005); assertEquals(contig1.coverage[29], 0.6666, 0.005); //contig2 is the reverse complement of contig1, should have the same coverage Contig contig2 = contigMap.get(1); assertEquals(contig2.name, "contig2"); // offset from 1, assertEquals(contig2.coverage[0], 0.6666, 0.005); assertEquals(contig2.coverage[20], 0.6666, 0.005); assertEquals(contig2.coverage[21], 1, 0.005); assertEquals(contig2.coverage[22], 3, 0.005); assertEquals(contig2.coverage[23], 2, 0.005); assertEquals(contig2.coverage[49], 2, 0.005); //contig3 has a few mismatches Contig contig3 = contigMap.get(2); assertEquals(contig3.name, "contig3"); //offset from 1, assertEquals(contig3.coverage[0], 0.6666, 0.005); assertEquals(contig3.coverage[21], 1, 0.005); assertEquals(contig3.coverage[22], 0, 0.005); // check summary instance.printCovereage(coverage_out, abundance_out); String[] summary = coverage_out.toString().split("\n"); assertEquals("contig1\t0.667\t1.100\t30\t30\t1.000", summary[1]); assertEquals("contig3\t0.667\t0.652\t23\t22\t0.957", summary[2]); assertEquals("contig2\t2.000\t1.440\t50\t50\t1.000", summary[3]); }
public void testGetContigMap() throws Exception { System.out.println("getContigMap"); int kmer_size = 30; String contigs = ">contig1\n" + "ccccacgagcaggcgaccaagcaaggcccgaagatcatggaattccggctcacggttga\n" + ">contig2\n" + "caggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgaggagaagcgaattgtcatcgacgacatgg\n" + ">contig3\n" + "caggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgagN\n"; String reads = ">r1\n" + "ccccacgagcaggcgaccaagcaaggcccgaagatcatggaattccggctcacggttgaggagaagcgaattgtcatcgacgacatgg\n" + ">r2 reverse of r1 \n" + "CCATGTCGTCGATGACAATTCGCTTCTCCTCAACCGTGAGCCGGAATTCCATGATCTTCGGGCCTTGCTTGGTCGCCTGCTCGTGGGG\n" + ">r3 one mismatch\n" + "ccccacgagcaggcgaccaagcaaggcccgNagatcatggaattccggctcacggttgaggC"; SeqReaderCore readsReader = SeqUtils.getSeqReaderCore(new BufferedInputStream(new ByteArrayInputStream(reads.getBytes()))); SequenceReader contigReader = new SequenceReader(new BufferedInputStream(new ByteArrayInputStream(contigs.getBytes()))); ByteArrayOutputStream coverage_out = new ByteArrayOutputStream(); ByteArrayOutputStream abundance_out = new ByteArrayOutputStream(); KmerCoverage instance = new KmerCoverage(kmer_size, contigReader, readsReader, null); ConcurrentHashMap<Integer, Contig> contigMap = instance.getContigMap(); // contig 1 should have full coverage Contig contig1 = contigMap.get(0); assertEquals(contig1.name, "contig1"); // offset from 1, assertEquals(contig1.coverage[0], 3, 0.005); assertEquals(contig1.coverage[8], 2, 0.005); assertEquals(contig1.coverage[9], 0.6666, 0.005); assertEquals(contig1.coverage[29], 0.6666, 0.005); //contig2 is the reverse complement of contig1, should have the same coverage Contig contig2 = contigMap.get(1); assertEquals(contig2.name, "contig2"); // offset from 1, assertEquals(contig2.coverage[0], 0.6666, 0.005); assertEquals(contig2.coverage[20], 0.6666, 0.005); assertEquals(contig2.coverage[21], 1, 0.005); assertEquals(contig2.coverage[22], 3, 0.005); assertEquals(contig2.coverage[23], 2, 0.005); assertEquals(contig2.coverage[49], 2, 0.005); //contig3 has a few mismatches Contig contig3 = contigMap.get(2); assertEquals(contig3.name, "contig3"); //offset from 1, assertEquals(contig3.coverage[0], 0.6666, 0.005); assertEquals(contig3.coverage[21], 1, 0.005); assertEquals(contig3.coverage[22], 0, 0.005); // check summary instance.printCovereage(coverage_out, abundance_out); String[] summary = coverage_out.toString().split("\n"); assertEquals("contig1\t1.100\t0.667\t30\t30\t1.000", summary[3]); assertEquals("contig3\t0.652\t0.667\t23\t22\t0.957", summary[4]); assertEquals("contig2\t1.440\t2.000\t50\t50\t1.000", summary[5]); }
diff --git a/logic/src/de/zib/gndms/logic/model/gorfx/AbstractTransferORQCalculator.java b/logic/src/de/zib/gndms/logic/model/gorfx/AbstractTransferORQCalculator.java index ce5fcbbc..ff3f2a3f 100644 --- a/logic/src/de/zib/gndms/logic/model/gorfx/AbstractTransferORQCalculator.java +++ b/logic/src/de/zib/gndms/logic/model/gorfx/AbstractTransferORQCalculator.java @@ -1,159 +1,159 @@ package de.zib.gndms.logic.model.gorfx; /* * Copyright 2008-2011 Zuse Institute Berlin (ZIB) * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ import de.zib.gndms.kit.network.GNDMSFileTransfer; import de.zib.gndms.kit.network.NetworkAuxiliariesProvider; import de.zib.gndms.model.common.types.FutureTime; import de.zib.gndms.model.common.types.TransientContract; import de.zib.gndms.model.gorfx.types.FileTransferORQ; import org.apache.axis.types.URI; import org.globus.ftp.GridFTPClient; import org.globus.ftp.exception.ClientException; import org.globus.ftp.exception.ServerException; import org.joda.time.Duration; import java.util.concurrent.TimeoutException; import java.io.IOException; /** * @author try ma ik jo rr a zib * @version $Id$ * <p/> * User: mjorra, Date: 30.09.2008, Time: 10:51:38 */ public abstract class AbstractTransferORQCalculator<M extends FileTransferORQ, C extends AbstractORQCalculator<M, C>> extends AbstractORQCalculator<M,C> { private Long estimatedTransferSize; // estimatedTransferSize private Float estimatedBandWidth; protected AbstractTransferORQCalculator( Class<M> cls ) { super(); super.setORQModelClass( cls ); } @Override public TransientContract createOffer() throws ServerException, IOException, ClientException { estimateTransferSize(); estimateBandWidth(); return calculateOffer( ); } @SuppressWarnings({ "FeatureEnvy" }) protected Long estimateTransferSize( ) throws ServerException, IOException, ClientException { GridFTPClient clnt = null; try { URI suri = new URI( getORQArguments().getSourceURI() ); clnt = NetworkAuxiliariesProvider.getGridFTPClientFactory().createClient( suri, getCredentialProvider() ); GNDMSFileTransfer ft = NetworkAuxiliariesProvider.newGNDMSFileTransfer(); ft.setSourceClient( clnt ); ft.setSourcePath( suri.getPath( ) ); ft.setFiles( getORQArguments().getFileMap() ); estimatedTransferSize = ft.estimateTransferSize( ); - } catch( TimeoutException e ) { - throw new RuntimeException( e ); + } catch( TimeoutException e ) { + throw new RuntimeException( e ); } finally { if ( clnt != null ) clnt.close( true ); // none blocking close op } return estimatedTransferSize; } /** * PRECONDITION estimateTransferSize must have been called before. * @return The estimated transfer size or NULL if it wasn't estimated yet. */ public Long getEstimatedTransferSize( ) throws ServerException, IOException, ClientException { return estimatedTransferSize; } /** * Estimates the bandwidth */ protected Float estimateBandWidth( ) throws IOException { estimatedBandWidth = NetworkAuxiliariesProvider.getBandWidthEstimater().estimateBandWidthFromTo( getORQArguments( ).getSourceURI(), getORQArguments( ).getTargetURI() ); if( estimatedBandWidth == null ) throw new IOException( "Couldn't estimate bandwidth." ); return estimatedBandWidth; } /** * PRECONDITION estimateBandWidth must have been called before. * @return The band width NULL if it wasn't estimated yet. */ public Float getEstimatedBandWidth( ) { return estimatedBandWidth; } /** * PRECONDITION estimateTransferSize and estimateBandWidth or their associated setters * must have been called before. * @return The band width NULL if it wasn't estimated yet. */ protected TransientContract calculateOffer( ) { // may at least take 10 s to cover comunication overhead. long ms = NetworkAuxiliariesProvider.calculateTransferTime( estimatedTransferSize, estimatedBandWidth, 10000 ); TransientContract ct = new TransientContract( ); ct.setDeadline( FutureTime.atOffset( new Duration( ms ) ) ); // none means forever // ct.setResultValidity( FutureTime.atTime(dat.plusHours( ContractConstants.FILE_TRANSFER_RESULT_VALIDITY )) ); return ct; } /** * Use this method to set the download size manually. * * This is the alternativ to calling estimateTransferSize. * * @param estimatedTransferSize -- what the name implies. */ protected void setEstimatedTransferSize( long estimatedTransferSize ) { this.estimatedTransferSize = estimatedTransferSize; } /** * Use this method to set the available band-width manually. * * This is the alternativ to calling estimateBandWidth. * * @param estimatedBandWidth -- Guess what. */ protected void setEstimatedBandWidth( float estimatedBandWidth ) { this.estimatedBandWidth = estimatedBandWidth; } }
true
true
protected Long estimateTransferSize( ) throws ServerException, IOException, ClientException { GridFTPClient clnt = null; try { URI suri = new URI( getORQArguments().getSourceURI() ); clnt = NetworkAuxiliariesProvider.getGridFTPClientFactory().createClient( suri, getCredentialProvider() ); GNDMSFileTransfer ft = NetworkAuxiliariesProvider.newGNDMSFileTransfer(); ft.setSourceClient( clnt ); ft.setSourcePath( suri.getPath( ) ); ft.setFiles( getORQArguments().getFileMap() ); estimatedTransferSize = ft.estimateTransferSize( ); } catch( TimeoutException e ) { throw new RuntimeException( e ); } finally { if ( clnt != null ) clnt.close( true ); // none blocking close op } return estimatedTransferSize; }
protected Long estimateTransferSize( ) throws ServerException, IOException, ClientException { GridFTPClient clnt = null; try { URI suri = new URI( getORQArguments().getSourceURI() ); clnt = NetworkAuxiliariesProvider.getGridFTPClientFactory().createClient( suri, getCredentialProvider() ); GNDMSFileTransfer ft = NetworkAuxiliariesProvider.newGNDMSFileTransfer(); ft.setSourceClient( clnt ); ft.setSourcePath( suri.getPath( ) ); ft.setFiles( getORQArguments().getFileMap() ); estimatedTransferSize = ft.estimateTransferSize( ); } catch( TimeoutException e ) { throw new RuntimeException( e ); } finally { if ( clnt != null ) clnt.close( true ); // none blocking close op } return estimatedTransferSize; }
diff --git a/src/java/com/eviware/soapui/impl/wsdl/submit/filters/HttpRequestFilter.java b/src/java/com/eviware/soapui/impl/wsdl/submit/filters/HttpRequestFilter.java index 0a00e6a52..b309fe599 100644 --- a/src/java/com/eviware/soapui/impl/wsdl/submit/filters/HttpRequestFilter.java +++ b/src/java/com/eviware/soapui/impl/wsdl/submit/filters/HttpRequestFilter.java @@ -1,458 +1,458 @@ /* * soapUI, copyright (C) 2004-2011 eviware.com * * soapUI is free software; you can redistribute it and/or modify it under the * terms of version 2.1 of the GNU Lesser General Public License as published by * the Free Software Foundation. * * soapUI is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without * even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. * See the GNU Lesser General Public License for more details at gnu.org. */ package com.eviware.soapui.impl.wsdl.submit.filters; import java.io.File; import java.io.UnsupportedEncodingException; import java.net.URLEncoder; import java.util.ArrayList; import java.util.List; import javax.activation.DataHandler; import javax.activation.FileDataSource; import javax.mail.MessagingException; import javax.mail.internet.MimeBodyPart; import javax.mail.internet.MimeMessage; import javax.mail.internet.MimeMultipart; import javax.mail.internet.PreencodedMimeBodyPart; import org.apache.http.HttpEntityEnclosingRequest; import org.apache.http.client.methods.HttpEntityEnclosingRequestBase; import org.apache.http.client.methods.HttpRequestBase; import org.apache.http.client.utils.URIUtils; import org.apache.http.entity.ByteArrayEntity; import org.apache.http.entity.InputStreamEntity; import org.apache.http.entity.StringEntity; import org.apache.xmlbeans.XmlBoolean; import com.eviware.soapui.SoapUI; import com.eviware.soapui.impl.rest.RestRequest; import com.eviware.soapui.impl.rest.support.RestParamProperty; import com.eviware.soapui.impl.rest.support.RestParamsPropertyHolder; import com.eviware.soapui.impl.rest.support.RestParamsPropertyHolder.ParameterStyle; import com.eviware.soapui.impl.rest.support.RestUtils; import com.eviware.soapui.impl.support.http.HttpRequestInterface; import com.eviware.soapui.impl.wsdl.submit.transports.http.BaseHttpRequestTransport; import com.eviware.soapui.impl.wsdl.submit.transports.http.support.attachments.AttachmentDataSource; import com.eviware.soapui.impl.wsdl.submit.transports.http.support.attachments.AttachmentUtils; import com.eviware.soapui.impl.wsdl.submit.transports.http.support.attachments.RestRequestDataSource; import com.eviware.soapui.impl.wsdl.submit.transports.http.support.attachments.RestRequestMimeMessageRequestEntity; import com.eviware.soapui.impl.wsdl.support.FileAttachment; import com.eviware.soapui.impl.wsdl.support.PathUtils; import com.eviware.soapui.impl.wsdl.teststeps.HttpTestRequest; import com.eviware.soapui.model.iface.Attachment; import com.eviware.soapui.model.iface.SubmitContext; import com.eviware.soapui.model.propertyexpansion.PropertyExpander; import com.eviware.soapui.settings.HttpSettings; import com.eviware.soapui.support.StringUtils; import com.eviware.soapui.support.editor.inspectors.attachments.ContentTypeHandler; import com.eviware.soapui.support.types.StringToStringMap; import com.eviware.soapui.support.uri.URI; /** * RequestFilter that adds SOAP specific headers * * @author Ole.Matzura */ public class HttpRequestFilter extends AbstractRequestFilter { @SuppressWarnings( "deprecation" ) @Override public void filterHttpRequest( SubmitContext context, HttpRequestInterface<?> request ) { HttpRequestBase httpMethod = ( HttpRequestBase )context.getProperty( BaseHttpRequestTransport.HTTP_METHOD ); String path = PropertyExpander.expandProperties( context, request.getPath() ); StringBuffer query = new StringBuffer(); StringToStringMap responseProperties = ( StringToStringMap )context .getProperty( BaseHttpRequestTransport.RESPONSE_PROPERTIES ); MimeMultipart formMp = "multipart/form-data".equals( request.getMediaType() ) && httpMethod instanceof HttpEntityEnclosingRequestBase ? new MimeMultipart() : null; RestParamsPropertyHolder params = request.getParams(); for( int c = 0; c < params.getPropertyCount(); c++ ) { RestParamProperty param = params.getPropertyAt( c ); String value = PropertyExpander.expandProperties( context, param.getValue() ); responseProperties.put( param.getName(), value ); List<String> valueParts = sendEmptyParameters( request ) || ( !StringUtils.hasContent( value ) && param.getRequired() ) ? RestUtils .splitMultipleParametersEmptyIncluded( value, request.getMultiValueDelimiter() ) : RestUtils .splitMultipleParameters( value, request.getMultiValueDelimiter() ); // skip HEADER and TEMPLATE parameter encoding (TEMPLATE is encoded by // the URI handling further down) if( value != null && param.getStyle() != ParameterStyle.HEADER && param.getStyle() != ParameterStyle.TEMPLATE && !param.isDisableUrlEncoding() ) { try { String encoding = System.getProperty( "soapui.request.encoding", request.getEncoding() ); if( StringUtils.hasContent( encoding ) ) { value = URLEncoder.encode( value, encoding ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ), encoding ) ); } else { value = URLEncoder.encode( value ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ) ) ); } } catch( UnsupportedEncodingException e1 ) { SoapUI.logError( e1 ); value = URLEncoder.encode( value ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ) ) ); } // URLEncoder replaces space with "+", but we want "%20". value = value.replaceAll( "\\+", "%20" ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, valueParts.get( i ).replaceAll( "\\+", "%20" ) ); } if( param.getStyle() == ParameterStyle.QUERY && !sendEmptyParameters( request ) ) { if( !StringUtils.hasContent( value ) && !param.getRequired() ) continue; } switch( param.getStyle() ) { case HEADER : for( String valuePart : valueParts ) httpMethod.addHeader( param.getName(), valuePart ); break; case QUERY : if( formMp == null || !request.isPostQueryString() ) { for( String valuePart : valueParts ) { if( query.length() > 0 ) query.append( '&' ); query.append( URLEncoder.encode( param.getName() ) ); query.append( '=' ); if( StringUtils.hasContent( valuePart ) ) query.append( valuePart ); } } else { try { addFormMultipart( request, formMp, param.getName(), responseProperties.get( param.getName() ) ); } catch( MessagingException e ) { SoapUI.logError( e ); } } break; case TEMPLATE : path = path.replaceAll( "\\{" + param.getName() + "\\}", value == null ? "" : value ); break; case MATRIX : if( param.getType().equals( XmlBoolean.type.getName() ) ) { if( value.toUpperCase().equals( "TRUE" ) || value.equals( "1" ) ) { path += ";" + param.getName(); } } else { path += ";" + param.getName(); if( StringUtils.hasContent( value ) ) { path += "=" + value; } } case PLAIN : break; } } if( request.getSettings().getBoolean( HttpSettings.FORWARD_SLASHES ) ) path = PathUtils.fixForwardSlashesInPath( path ); if( PathUtils.isHttpPath( path ) ) { try { // URI(String) automatically URLencodes the input, so we need to // decode it first... - URI uri = new URI( path, false ); + URI uri = new URI( path, request.getSettings().getBoolean( HttpSettings.ENCODED_URLS ) ); context.setProperty( BaseHttpRequestTransport.REQUEST_URI, uri ); httpMethod.setURI( new java.net.URI( uri.toString() ) ); } catch( Exception e ) { SoapUI.logError( e ); } } else if( StringUtils.hasContent( path ) ) { try { java.net.URI oldUri = httpMethod.getURI(); httpMethod.setURI( URIUtils.createURI( oldUri.getScheme(), oldUri.getHost(), oldUri.getPort(), path, oldUri.getQuery(), oldUri.getFragment() ) ); } catch( Exception e ) { SoapUI.logError( e ); } } if( query.length() > 0 && !request.isPostQueryString() ) { java.net.URI oldUri = httpMethod.getURI(); try { java.net.URI tempUri = URIUtils.createURI( oldUri.getScheme(), oldUri.getHost(), oldUri.getPort(), oldUri.getPath(), query.toString(), null ); httpMethod.setURI( tempUri ); } catch( Exception e ) { SoapUI.logError( e ); } } if( request instanceof RestRequest ) { String acceptEncoding = ( ( RestRequest )request ).getAccept(); if( StringUtils.hasContent( acceptEncoding ) ) { httpMethod.setHeader( "Accept", acceptEncoding ); } } String encoding = System.getProperty( "soapui.request.encoding", StringUtils.unquote( request.getEncoding() ) ); if( formMp != null ) { // create request message try { if( request.hasRequestBody() && httpMethod instanceof HttpEntityEnclosingRequest ) { String requestContent = PropertyExpander.expandProperties( context, request.getRequestContent(), request.isEntitizeProperties() ); if( StringUtils.hasContent( requestContent ) ) { initRootPart( request, requestContent, formMp ); } } for( Attachment attachment : request.getAttachments() ) { MimeBodyPart part = new PreencodedMimeBodyPart( "binary" ); if( attachment instanceof FileAttachment<?> ) { String name = attachment.getName(); if( StringUtils.hasContent( attachment.getContentID() ) && !name.equals( attachment.getContentID() ) ) name = attachment.getContentID(); part.setDisposition( "form-data; name=\"" + name + "\"; filename=\"" + attachment.getName() + "\"" ); } else part.setDisposition( "form-data; name=\"" + attachment.getName() + "\"" ); part.setDataHandler( new DataHandler( new AttachmentDataSource( attachment ) ) ); formMp.addBodyPart( part ); } MimeMessage message = new MimeMessage( AttachmentUtils.JAVAMAIL_SESSION ); message.setContent( formMp ); message.saveChanges(); RestRequestMimeMessageRequestEntity mimeMessageRequestEntity = new RestRequestMimeMessageRequestEntity( message, request ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( mimeMessageRequestEntity ); httpMethod.setHeader( "Content-Type", mimeMessageRequestEntity.getContentType().getValue() ); httpMethod.setHeader( "MIME-Version", "1.0" ); } catch( Throwable e ) { SoapUI.logError( e ); } } else if( request.hasRequestBody() && httpMethod instanceof HttpEntityEnclosingRequest ) { if( StringUtils.hasContent( request.getMediaType() ) ) httpMethod.setHeader( "Content-Type", getContentTypeHeader( request.getMediaType(), encoding ) ); if( request.isPostQueryString() ) { try { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new StringEntity( query.toString() ) ); } catch( UnsupportedEncodingException e ) { SoapUI.logError( e ); } } else { String requestContent = PropertyExpander.expandProperties( context, request.getRequestContent(), request.isEntitizeProperties() ); List<Attachment> attachments = new ArrayList<Attachment>(); for( Attachment attachment : request.getAttachments() ) { if( attachment.getContentType().equals( request.getMediaType() ) ) { attachments.add( attachment ); } } if( StringUtils.hasContent( requestContent ) && attachments.isEmpty() ) { try { byte[] content = encoding == null ? requestContent.getBytes() : requestContent.getBytes( encoding ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new ByteArrayEntity( content ) ); } catch( UnsupportedEncodingException e ) { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new ByteArrayEntity( requestContent .getBytes() ) ); } } else if( attachments.size() > 0 ) { try { MimeMultipart mp = null; if( StringUtils.hasContent( requestContent ) ) { mp = new MimeMultipart(); initRootPart( request, requestContent, mp ); } else if( attachments.size() == 1 ) { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new InputStreamEntity( attachments.get( 0 ) .getInputStream(), -1 ) ); httpMethod.setHeader( "Content-Type", getContentTypeHeader( request.getMediaType(), encoding ) ); } if( ( ( HttpEntityEnclosingRequest )httpMethod ).getEntity() == null ) { if( mp == null ) mp = new MimeMultipart(); // init mimeparts AttachmentUtils.addMimeParts( request, attachments, mp, new StringToStringMap() ); // create request message MimeMessage message = new MimeMessage( AttachmentUtils.JAVAMAIL_SESSION ); message.setContent( mp ); message.saveChanges(); RestRequestMimeMessageRequestEntity mimeMessageRequestEntity = new RestRequestMimeMessageRequestEntity( message, request ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( mimeMessageRequestEntity ); httpMethod.setHeader( "Content-Type", getContentTypeHeader( mimeMessageRequestEntity.getContentType().getValue(), encoding ) ); httpMethod.setHeader( "MIME-Version", "1.0" ); } } catch( Exception e ) { SoapUI.logError( e ); } } } } } private boolean sendEmptyParameters( HttpRequestInterface<?> request ) { return request instanceof HttpTestRequest && ( ( HttpTestRequest )request ).isSendEmptyParameters(); } private String getContentTypeHeader( String contentType, String encoding ) { return ( encoding == null || encoding.trim().length() == 0 ) ? contentType : contentType + ";charset=" + encoding; } private void addFormMultipart( HttpRequestInterface<?> request, MimeMultipart formMp, String name, String value ) throws MessagingException { MimeBodyPart part = new MimeBodyPart(); if( value.startsWith( "file:" ) ) { String fileName = value.substring( 5 ); File file = new File( fileName ); part.setDisposition( "form-data; name=\"" + name + "\"; filename=\"" + file.getName() + "\"" ); if( file.exists() ) { part.setDataHandler( new DataHandler( new FileDataSource( file ) ) ); } else { for( Attachment attachment : request.getAttachments() ) { if( attachment.getName().equals( fileName ) ) { part.setDataHandler( new DataHandler( new AttachmentDataSource( attachment ) ) ); break; } } } part.setHeader( "Content-Type", ContentTypeHandler.getContentTypeFromFilename( file.getName() ) ); part.setHeader( "Content-Transfer-Encoding", "binary" ); } else { part.setDisposition( "form-data; name=\"" + name + "\"" ); part.setText( value, System.getProperty( "soapui.request.encoding", request.getEncoding() ) ); } if( part != null ) { formMp.addBodyPart( part ); } } protected void initRootPart( HttpRequestInterface<?> wsdlRequest, String requestContent, MimeMultipart mp ) throws MessagingException { MimeBodyPart rootPart = new PreencodedMimeBodyPart( "8bit" ); // rootPart.setContentID( AttachmentUtils.ROOTPART_SOAPUI_ORG ); mp.addBodyPart( rootPart, 0 ); DataHandler dataHandler = new DataHandler( new RestRequestDataSource( wsdlRequest, requestContent ) ); rootPart.setDataHandler( dataHandler ); } }
true
true
public void filterHttpRequest( SubmitContext context, HttpRequestInterface<?> request ) { HttpRequestBase httpMethod = ( HttpRequestBase )context.getProperty( BaseHttpRequestTransport.HTTP_METHOD ); String path = PropertyExpander.expandProperties( context, request.getPath() ); StringBuffer query = new StringBuffer(); StringToStringMap responseProperties = ( StringToStringMap )context .getProperty( BaseHttpRequestTransport.RESPONSE_PROPERTIES ); MimeMultipart formMp = "multipart/form-data".equals( request.getMediaType() ) && httpMethod instanceof HttpEntityEnclosingRequestBase ? new MimeMultipart() : null; RestParamsPropertyHolder params = request.getParams(); for( int c = 0; c < params.getPropertyCount(); c++ ) { RestParamProperty param = params.getPropertyAt( c ); String value = PropertyExpander.expandProperties( context, param.getValue() ); responseProperties.put( param.getName(), value ); List<String> valueParts = sendEmptyParameters( request ) || ( !StringUtils.hasContent( value ) && param.getRequired() ) ? RestUtils .splitMultipleParametersEmptyIncluded( value, request.getMultiValueDelimiter() ) : RestUtils .splitMultipleParameters( value, request.getMultiValueDelimiter() ); // skip HEADER and TEMPLATE parameter encoding (TEMPLATE is encoded by // the URI handling further down) if( value != null && param.getStyle() != ParameterStyle.HEADER && param.getStyle() != ParameterStyle.TEMPLATE && !param.isDisableUrlEncoding() ) { try { String encoding = System.getProperty( "soapui.request.encoding", request.getEncoding() ); if( StringUtils.hasContent( encoding ) ) { value = URLEncoder.encode( value, encoding ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ), encoding ) ); } else { value = URLEncoder.encode( value ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ) ) ); } } catch( UnsupportedEncodingException e1 ) { SoapUI.logError( e1 ); value = URLEncoder.encode( value ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ) ) ); } // URLEncoder replaces space with "+", but we want "%20". value = value.replaceAll( "\\+", "%20" ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, valueParts.get( i ).replaceAll( "\\+", "%20" ) ); } if( param.getStyle() == ParameterStyle.QUERY && !sendEmptyParameters( request ) ) { if( !StringUtils.hasContent( value ) && !param.getRequired() ) continue; } switch( param.getStyle() ) { case HEADER : for( String valuePart : valueParts ) httpMethod.addHeader( param.getName(), valuePart ); break; case QUERY : if( formMp == null || !request.isPostQueryString() ) { for( String valuePart : valueParts ) { if( query.length() > 0 ) query.append( '&' ); query.append( URLEncoder.encode( param.getName() ) ); query.append( '=' ); if( StringUtils.hasContent( valuePart ) ) query.append( valuePart ); } } else { try { addFormMultipart( request, formMp, param.getName(), responseProperties.get( param.getName() ) ); } catch( MessagingException e ) { SoapUI.logError( e ); } } break; case TEMPLATE : path = path.replaceAll( "\\{" + param.getName() + "\\}", value == null ? "" : value ); break; case MATRIX : if( param.getType().equals( XmlBoolean.type.getName() ) ) { if( value.toUpperCase().equals( "TRUE" ) || value.equals( "1" ) ) { path += ";" + param.getName(); } } else { path += ";" + param.getName(); if( StringUtils.hasContent( value ) ) { path += "=" + value; } } case PLAIN : break; } } if( request.getSettings().getBoolean( HttpSettings.FORWARD_SLASHES ) ) path = PathUtils.fixForwardSlashesInPath( path ); if( PathUtils.isHttpPath( path ) ) { try { // URI(String) automatically URLencodes the input, so we need to // decode it first... URI uri = new URI( path, false ); context.setProperty( BaseHttpRequestTransport.REQUEST_URI, uri ); httpMethod.setURI( new java.net.URI( uri.toString() ) ); } catch( Exception e ) { SoapUI.logError( e ); } } else if( StringUtils.hasContent( path ) ) { try { java.net.URI oldUri = httpMethod.getURI(); httpMethod.setURI( URIUtils.createURI( oldUri.getScheme(), oldUri.getHost(), oldUri.getPort(), path, oldUri.getQuery(), oldUri.getFragment() ) ); } catch( Exception e ) { SoapUI.logError( e ); } } if( query.length() > 0 && !request.isPostQueryString() ) { java.net.URI oldUri = httpMethod.getURI(); try { java.net.URI tempUri = URIUtils.createURI( oldUri.getScheme(), oldUri.getHost(), oldUri.getPort(), oldUri.getPath(), query.toString(), null ); httpMethod.setURI( tempUri ); } catch( Exception e ) { SoapUI.logError( e ); } } if( request instanceof RestRequest ) { String acceptEncoding = ( ( RestRequest )request ).getAccept(); if( StringUtils.hasContent( acceptEncoding ) ) { httpMethod.setHeader( "Accept", acceptEncoding ); } } String encoding = System.getProperty( "soapui.request.encoding", StringUtils.unquote( request.getEncoding() ) ); if( formMp != null ) { // create request message try { if( request.hasRequestBody() && httpMethod instanceof HttpEntityEnclosingRequest ) { String requestContent = PropertyExpander.expandProperties( context, request.getRequestContent(), request.isEntitizeProperties() ); if( StringUtils.hasContent( requestContent ) ) { initRootPart( request, requestContent, formMp ); } } for( Attachment attachment : request.getAttachments() ) { MimeBodyPart part = new PreencodedMimeBodyPart( "binary" ); if( attachment instanceof FileAttachment<?> ) { String name = attachment.getName(); if( StringUtils.hasContent( attachment.getContentID() ) && !name.equals( attachment.getContentID() ) ) name = attachment.getContentID(); part.setDisposition( "form-data; name=\"" + name + "\"; filename=\"" + attachment.getName() + "\"" ); } else part.setDisposition( "form-data; name=\"" + attachment.getName() + "\"" ); part.setDataHandler( new DataHandler( new AttachmentDataSource( attachment ) ) ); formMp.addBodyPart( part ); } MimeMessage message = new MimeMessage( AttachmentUtils.JAVAMAIL_SESSION ); message.setContent( formMp ); message.saveChanges(); RestRequestMimeMessageRequestEntity mimeMessageRequestEntity = new RestRequestMimeMessageRequestEntity( message, request ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( mimeMessageRequestEntity ); httpMethod.setHeader( "Content-Type", mimeMessageRequestEntity.getContentType().getValue() ); httpMethod.setHeader( "MIME-Version", "1.0" ); } catch( Throwable e ) { SoapUI.logError( e ); } } else if( request.hasRequestBody() && httpMethod instanceof HttpEntityEnclosingRequest ) { if( StringUtils.hasContent( request.getMediaType() ) ) httpMethod.setHeader( "Content-Type", getContentTypeHeader( request.getMediaType(), encoding ) ); if( request.isPostQueryString() ) { try { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new StringEntity( query.toString() ) ); } catch( UnsupportedEncodingException e ) { SoapUI.logError( e ); } } else { String requestContent = PropertyExpander.expandProperties( context, request.getRequestContent(), request.isEntitizeProperties() ); List<Attachment> attachments = new ArrayList<Attachment>(); for( Attachment attachment : request.getAttachments() ) { if( attachment.getContentType().equals( request.getMediaType() ) ) { attachments.add( attachment ); } } if( StringUtils.hasContent( requestContent ) && attachments.isEmpty() ) { try { byte[] content = encoding == null ? requestContent.getBytes() : requestContent.getBytes( encoding ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new ByteArrayEntity( content ) ); } catch( UnsupportedEncodingException e ) { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new ByteArrayEntity( requestContent .getBytes() ) ); } } else if( attachments.size() > 0 ) { try { MimeMultipart mp = null; if( StringUtils.hasContent( requestContent ) ) { mp = new MimeMultipart(); initRootPart( request, requestContent, mp ); } else if( attachments.size() == 1 ) { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new InputStreamEntity( attachments.get( 0 ) .getInputStream(), -1 ) ); httpMethod.setHeader( "Content-Type", getContentTypeHeader( request.getMediaType(), encoding ) ); } if( ( ( HttpEntityEnclosingRequest )httpMethod ).getEntity() == null ) { if( mp == null ) mp = new MimeMultipart(); // init mimeparts AttachmentUtils.addMimeParts( request, attachments, mp, new StringToStringMap() ); // create request message MimeMessage message = new MimeMessage( AttachmentUtils.JAVAMAIL_SESSION ); message.setContent( mp ); message.saveChanges(); RestRequestMimeMessageRequestEntity mimeMessageRequestEntity = new RestRequestMimeMessageRequestEntity( message, request ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( mimeMessageRequestEntity ); httpMethod.setHeader( "Content-Type", getContentTypeHeader( mimeMessageRequestEntity.getContentType().getValue(), encoding ) ); httpMethod.setHeader( "MIME-Version", "1.0" ); } } catch( Exception e ) { SoapUI.logError( e ); } } } } }
public void filterHttpRequest( SubmitContext context, HttpRequestInterface<?> request ) { HttpRequestBase httpMethod = ( HttpRequestBase )context.getProperty( BaseHttpRequestTransport.HTTP_METHOD ); String path = PropertyExpander.expandProperties( context, request.getPath() ); StringBuffer query = new StringBuffer(); StringToStringMap responseProperties = ( StringToStringMap )context .getProperty( BaseHttpRequestTransport.RESPONSE_PROPERTIES ); MimeMultipart formMp = "multipart/form-data".equals( request.getMediaType() ) && httpMethod instanceof HttpEntityEnclosingRequestBase ? new MimeMultipart() : null; RestParamsPropertyHolder params = request.getParams(); for( int c = 0; c < params.getPropertyCount(); c++ ) { RestParamProperty param = params.getPropertyAt( c ); String value = PropertyExpander.expandProperties( context, param.getValue() ); responseProperties.put( param.getName(), value ); List<String> valueParts = sendEmptyParameters( request ) || ( !StringUtils.hasContent( value ) && param.getRequired() ) ? RestUtils .splitMultipleParametersEmptyIncluded( value, request.getMultiValueDelimiter() ) : RestUtils .splitMultipleParameters( value, request.getMultiValueDelimiter() ); // skip HEADER and TEMPLATE parameter encoding (TEMPLATE is encoded by // the URI handling further down) if( value != null && param.getStyle() != ParameterStyle.HEADER && param.getStyle() != ParameterStyle.TEMPLATE && !param.isDisableUrlEncoding() ) { try { String encoding = System.getProperty( "soapui.request.encoding", request.getEncoding() ); if( StringUtils.hasContent( encoding ) ) { value = URLEncoder.encode( value, encoding ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ), encoding ) ); } else { value = URLEncoder.encode( value ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ) ) ); } } catch( UnsupportedEncodingException e1 ) { SoapUI.logError( e1 ); value = URLEncoder.encode( value ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, URLEncoder.encode( valueParts.get( i ) ) ); } // URLEncoder replaces space with "+", but we want "%20". value = value.replaceAll( "\\+", "%20" ); for( int i = 0; i < valueParts.size(); i++ ) valueParts.set( i, valueParts.get( i ).replaceAll( "\\+", "%20" ) ); } if( param.getStyle() == ParameterStyle.QUERY && !sendEmptyParameters( request ) ) { if( !StringUtils.hasContent( value ) && !param.getRequired() ) continue; } switch( param.getStyle() ) { case HEADER : for( String valuePart : valueParts ) httpMethod.addHeader( param.getName(), valuePart ); break; case QUERY : if( formMp == null || !request.isPostQueryString() ) { for( String valuePart : valueParts ) { if( query.length() > 0 ) query.append( '&' ); query.append( URLEncoder.encode( param.getName() ) ); query.append( '=' ); if( StringUtils.hasContent( valuePart ) ) query.append( valuePart ); } } else { try { addFormMultipart( request, formMp, param.getName(), responseProperties.get( param.getName() ) ); } catch( MessagingException e ) { SoapUI.logError( e ); } } break; case TEMPLATE : path = path.replaceAll( "\\{" + param.getName() + "\\}", value == null ? "" : value ); break; case MATRIX : if( param.getType().equals( XmlBoolean.type.getName() ) ) { if( value.toUpperCase().equals( "TRUE" ) || value.equals( "1" ) ) { path += ";" + param.getName(); } } else { path += ";" + param.getName(); if( StringUtils.hasContent( value ) ) { path += "=" + value; } } case PLAIN : break; } } if( request.getSettings().getBoolean( HttpSettings.FORWARD_SLASHES ) ) path = PathUtils.fixForwardSlashesInPath( path ); if( PathUtils.isHttpPath( path ) ) { try { // URI(String) automatically URLencodes the input, so we need to // decode it first... URI uri = new URI( path, request.getSettings().getBoolean( HttpSettings.ENCODED_URLS ) ); context.setProperty( BaseHttpRequestTransport.REQUEST_URI, uri ); httpMethod.setURI( new java.net.URI( uri.toString() ) ); } catch( Exception e ) { SoapUI.logError( e ); } } else if( StringUtils.hasContent( path ) ) { try { java.net.URI oldUri = httpMethod.getURI(); httpMethod.setURI( URIUtils.createURI( oldUri.getScheme(), oldUri.getHost(), oldUri.getPort(), path, oldUri.getQuery(), oldUri.getFragment() ) ); } catch( Exception e ) { SoapUI.logError( e ); } } if( query.length() > 0 && !request.isPostQueryString() ) { java.net.URI oldUri = httpMethod.getURI(); try { java.net.URI tempUri = URIUtils.createURI( oldUri.getScheme(), oldUri.getHost(), oldUri.getPort(), oldUri.getPath(), query.toString(), null ); httpMethod.setURI( tempUri ); } catch( Exception e ) { SoapUI.logError( e ); } } if( request instanceof RestRequest ) { String acceptEncoding = ( ( RestRequest )request ).getAccept(); if( StringUtils.hasContent( acceptEncoding ) ) { httpMethod.setHeader( "Accept", acceptEncoding ); } } String encoding = System.getProperty( "soapui.request.encoding", StringUtils.unquote( request.getEncoding() ) ); if( formMp != null ) { // create request message try { if( request.hasRequestBody() && httpMethod instanceof HttpEntityEnclosingRequest ) { String requestContent = PropertyExpander.expandProperties( context, request.getRequestContent(), request.isEntitizeProperties() ); if( StringUtils.hasContent( requestContent ) ) { initRootPart( request, requestContent, formMp ); } } for( Attachment attachment : request.getAttachments() ) { MimeBodyPart part = new PreencodedMimeBodyPart( "binary" ); if( attachment instanceof FileAttachment<?> ) { String name = attachment.getName(); if( StringUtils.hasContent( attachment.getContentID() ) && !name.equals( attachment.getContentID() ) ) name = attachment.getContentID(); part.setDisposition( "form-data; name=\"" + name + "\"; filename=\"" + attachment.getName() + "\"" ); } else part.setDisposition( "form-data; name=\"" + attachment.getName() + "\"" ); part.setDataHandler( new DataHandler( new AttachmentDataSource( attachment ) ) ); formMp.addBodyPart( part ); } MimeMessage message = new MimeMessage( AttachmentUtils.JAVAMAIL_SESSION ); message.setContent( formMp ); message.saveChanges(); RestRequestMimeMessageRequestEntity mimeMessageRequestEntity = new RestRequestMimeMessageRequestEntity( message, request ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( mimeMessageRequestEntity ); httpMethod.setHeader( "Content-Type", mimeMessageRequestEntity.getContentType().getValue() ); httpMethod.setHeader( "MIME-Version", "1.0" ); } catch( Throwable e ) { SoapUI.logError( e ); } } else if( request.hasRequestBody() && httpMethod instanceof HttpEntityEnclosingRequest ) { if( StringUtils.hasContent( request.getMediaType() ) ) httpMethod.setHeader( "Content-Type", getContentTypeHeader( request.getMediaType(), encoding ) ); if( request.isPostQueryString() ) { try { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new StringEntity( query.toString() ) ); } catch( UnsupportedEncodingException e ) { SoapUI.logError( e ); } } else { String requestContent = PropertyExpander.expandProperties( context, request.getRequestContent(), request.isEntitizeProperties() ); List<Attachment> attachments = new ArrayList<Attachment>(); for( Attachment attachment : request.getAttachments() ) { if( attachment.getContentType().equals( request.getMediaType() ) ) { attachments.add( attachment ); } } if( StringUtils.hasContent( requestContent ) && attachments.isEmpty() ) { try { byte[] content = encoding == null ? requestContent.getBytes() : requestContent.getBytes( encoding ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new ByteArrayEntity( content ) ); } catch( UnsupportedEncodingException e ) { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new ByteArrayEntity( requestContent .getBytes() ) ); } } else if( attachments.size() > 0 ) { try { MimeMultipart mp = null; if( StringUtils.hasContent( requestContent ) ) { mp = new MimeMultipart(); initRootPart( request, requestContent, mp ); } else if( attachments.size() == 1 ) { ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( new InputStreamEntity( attachments.get( 0 ) .getInputStream(), -1 ) ); httpMethod.setHeader( "Content-Type", getContentTypeHeader( request.getMediaType(), encoding ) ); } if( ( ( HttpEntityEnclosingRequest )httpMethod ).getEntity() == null ) { if( mp == null ) mp = new MimeMultipart(); // init mimeparts AttachmentUtils.addMimeParts( request, attachments, mp, new StringToStringMap() ); // create request message MimeMessage message = new MimeMessage( AttachmentUtils.JAVAMAIL_SESSION ); message.setContent( mp ); message.saveChanges(); RestRequestMimeMessageRequestEntity mimeMessageRequestEntity = new RestRequestMimeMessageRequestEntity( message, request ); ( ( HttpEntityEnclosingRequest )httpMethod ).setEntity( mimeMessageRequestEntity ); httpMethod.setHeader( "Content-Type", getContentTypeHeader( mimeMessageRequestEntity.getContentType().getValue(), encoding ) ); httpMethod.setHeader( "MIME-Version", "1.0" ); } } catch( Exception e ) { SoapUI.logError( e ); } } } } }
diff --git a/flexmojos-testing/flexmojos-test-harness/src/test/java/org/sonatype/flexmojos/tests/concept/ArchetypesTest.java b/flexmojos-testing/flexmojos-test-harness/src/test/java/org/sonatype/flexmojos/tests/concept/ArchetypesTest.java index a4f91bf42..49fc3bdd7 100644 --- a/flexmojos-testing/flexmojos-test-harness/src/test/java/org/sonatype/flexmojos/tests/concept/ArchetypesTest.java +++ b/flexmojos-testing/flexmojos-test-harness/src/test/java/org/sonatype/flexmojos/tests/concept/ArchetypesTest.java @@ -1,74 +1,74 @@ /** * Flexmojos is a set of maven goals to allow maven users to compile, optimize and test Flex SWF, Flex SWC, Air SWF and Air SWC. * Copyright (C) 2008-2012 Marvin Froeder <[email protected]> * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ package org.sonatype.flexmojos.tests.concept; import java.io.File; import java.io.IOException; import org.apache.maven.it.VerificationException; import org.sonatype.flexmojos.tests.AbstractFlexMojosTests; import org.testng.annotations.Test; public class ArchetypesTest extends AbstractFlexMojosTests { private static File baseTestDir; @Test public void testApplication() throws Exception { testArchetype( "application" ); } @Test public void testLibrary() throws Exception { testArchetype( "library" ); } @Test public void testModular() throws Exception { testArchetype( "modular-webapp" ); } private void testArchetype( String kind ) throws IOException, VerificationException { if ( baseTestDir == null ) { baseTestDir = getProject( "/concept/archetype" ); } String artifactId = "artifact-it-" + kind; String[] args = new String[] { "-DarchetypeGroupId=org.sonatype.flexmojos", "-DarchetypeArtifactId=flexmojos-archetypes-" + kind, "-DarchetypeVersion=" + getFlexmojosVersion(), "-DgroupId=org.sonatype.flexmojos.it", "-DartifactId=" + artifactId, "-Dversion=1.0-SNAPSHOT" }; - test( baseTestDir, "org.apache.maven.plugins:maven-archetype-plugin:2.0-alpha-4:create", args ); + test( baseTestDir, "org.apache.maven.plugins:maven-archetype-plugin:2.0-alpha-5:create", args ); File testDir2 = new File( baseTestDir, artifactId ); test( testDir2, "install" ); } }
true
true
private void testArchetype( String kind ) throws IOException, VerificationException { if ( baseTestDir == null ) { baseTestDir = getProject( "/concept/archetype" ); } String artifactId = "artifact-it-" + kind; String[] args = new String[] { "-DarchetypeGroupId=org.sonatype.flexmojos", "-DarchetypeArtifactId=flexmojos-archetypes-" + kind, "-DarchetypeVersion=" + getFlexmojosVersion(), "-DgroupId=org.sonatype.flexmojos.it", "-DartifactId=" + artifactId, "-Dversion=1.0-SNAPSHOT" }; test( baseTestDir, "org.apache.maven.plugins:maven-archetype-plugin:2.0-alpha-4:create", args ); File testDir2 = new File( baseTestDir, artifactId ); test( testDir2, "install" ); }
private void testArchetype( String kind ) throws IOException, VerificationException { if ( baseTestDir == null ) { baseTestDir = getProject( "/concept/archetype" ); } String artifactId = "artifact-it-" + kind; String[] args = new String[] { "-DarchetypeGroupId=org.sonatype.flexmojos", "-DarchetypeArtifactId=flexmojos-archetypes-" + kind, "-DarchetypeVersion=" + getFlexmojosVersion(), "-DgroupId=org.sonatype.flexmojos.it", "-DartifactId=" + artifactId, "-Dversion=1.0-SNAPSHOT" }; test( baseTestDir, "org.apache.maven.plugins:maven-archetype-plugin:2.0-alpha-5:create", args ); File testDir2 = new File( baseTestDir, artifactId ); test( testDir2, "install" ); }
diff --git a/src/de/bwv_aachen/dijkstra/gui/Mainwindow.java b/src/de/bwv_aachen/dijkstra/gui/Mainwindow.java index 5394aa1..8ba619d 100644 --- a/src/de/bwv_aachen/dijkstra/gui/Mainwindow.java +++ b/src/de/bwv_aachen/dijkstra/gui/Mainwindow.java @@ -1,228 +1,228 @@ /** * Mainwindow * <p> * The main window * * @author Serjoscha Bassauer */ package de.bwv_aachen.dijkstra.gui; import java.awt.Color; import java.awt.GridLayout; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.awt.event.WindowEvent; import java.awt.event.WindowFocusListener; import java.awt.event.WindowListener; import java.awt.event.WindowStateListener; import java.io.File; import java.util.Vector; import java.util.regex.Pattern; import javax.swing.BorderFactory; import javax.swing.JButton; import javax.swing.JComboBox; import javax.swing.JComponent; import javax.swing.JFileChooser; import javax.swing.JFrame; import javax.swing.JLabel; import javax.swing.JMenu; import javax.swing.JMenuBar; import javax.swing.JMenuItem; import javax.swing.JOptionPane; import de.bwv_aachen.dijkstra.controller.Controller; import de.bwv_aachen.dijkstra.helpers.JSONFileChooser; import de.bwv_aachen.dijkstra.model.Airport; import de.bwv_aachen.dijkstra.model.ListDataModel; @SuppressWarnings("serial") public class Mainwindow extends View implements ActionListener { private JComboBox<Object> leftList; private JComboBox<Object> rightList; boolean file_changed; private File connectionFile; private final JSONFileChooser chooser = new JSONFileChooser(); public Mainwindow(Controller c) { super(c); connectionFile = controller.getDefaultConnectionFile(); file_changed = true; //Every time when the Mainwindow gains the focus, redraw it this.addWindowFocusListener(new WindowFocusListener() { @Override public void windowGainedFocus(WindowEvent e) { draw(); } @Override public void windowLostFocus(WindowEvent e) { } }); } @Override public void draw() { super.getContentPane().removeAll(); // making this function being able // to repaint the mainwindow super.setTitle("Dijkstra"); super.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); super.setResizable(false); super.setLayout(new GridLayout(3, 2, 2, 2)); ((JComponent) getContentPane()).setBorder(BorderFactory .createMatteBorder(4, 4, 4, 4, Color.LIGHT_GRAY)); if (file_changed) { try { Controller.INSTANCE.readFile(connectionFile); } catch (Exception e) { JOptionPane.showMessageDialog(this, - "Die Datei konnte nicht ge�ffnet werden", "Fehler", + "Die Datei konnte nicht geöffnet werden", "Fehler", JOptionPane.ERROR_MESSAGE); } file_changed = false; } ListDataModel model = controller.getModel(); Object[] locations = model.getAirportList().values().toArray(); // Create the lists leftList = new JComboBox<>(locations); rightList = new JComboBox<>(locations); rightList.setSelectedIndex(1); // just for a more professional // impression of the program -> mark // the second element in the second // list as active // Create a button for being able to submit the action JButton startAction = new JButton("Berechnen"); startAction.setActionCommand("calc"); startAction.addActionListener(this); // Add elements to the frame super.add(new JLabel("Start")); super.add(leftList); super.add(new JLabel("Ziel")); super.add(rightList); super.add(startAction); super.add(new JLabel()); // Create a menu for various actions JMenuBar menuBar = new JMenuBar(); super.setJMenuBar(menuBar); // Define Menu Cats JMenu fileMenu = new JMenu("Datei"); menuBar.add(fileMenu); JMenu infoMenu = new JMenu("Info"); menuBar.add(infoMenu); // Define Menu Items within the cats - JMenuItem openFile = new JMenuItem("�ffnen..."); + JMenuItem openFile = new JMenuItem("Öffnen..."); openFile.addActionListener(this); openFile.setActionCommand("loadFile"); fileMenu.add(openFile); JMenuItem editFile = new JMenuItem("Bearbeiten..."); editFile.addActionListener(this); editFile.setActionCommand("editFile"); fileMenu.add(editFile); JMenuItem saveFile = new JMenuItem("Speichern unter..."); saveFile.addActionListener(this); saveFile.setActionCommand("saveFile"); fileMenu.add(saveFile); // Info menu JMenuItem fileInfo = new JMenuItem(connectionFile.getAbsolutePath() .toString()); fileInfo.setEnabled(false); JMenuItem textLabelFileInfo = new JMenuItem( "Momentan ge�ffnete Datei:"); textLabelFileInfo.setEnabled(false); infoMenu.add(textLabelFileInfo); infoMenu.add(fileInfo); // Do the rest for displaying the window super.pack(); super.setLocationRelativeTo(null); // center the frame // Show the window super.setVisible(true); } @Override public void actionPerformed(ActionEvent e) { switch (e.getActionCommand()) { case "calc": { Airport from = (Airport) leftList.getSelectedItem(); Airport to = (Airport) rightList.getSelectedItem(); Vector<Vector<Object>> test = Controller.INSTANCE.getModel() .getRoute(from, to); new ConnectionTableWindow(test).draw(); break; } case "loadFile": { chooser.setDialogType(JFileChooser.OPEN_DIALOG); if (chooser.showOpenDialog(this) == JFileChooser.APPROVE_OPTION) { connectionFile = new File(chooser.getSelectedFile() .getAbsolutePath()); // set the new file to parse before // redrawing the gui with new // data file_changed = true; // draw(); // repaint the gui! } break; } case "editFile": { EditorWindow ew = new EditorWindow(controller); ew.draw(); break; } case "saveFile": { File oldFile = connectionFile; chooser.setDialogType(JFileChooser.SAVE_DIALOG); if (chooser.showSaveDialog(this) == JFileChooser.APPROVE_OPTION) { String path = chooser.getSelectedFile().getAbsolutePath(); // Add file ending if missing if (!Pattern.matches(".*\\.json", path)) { path = path.concat(".json"); } connectionFile = new File(path); try { Controller.INSTANCE.writeFile(connectionFile); file_changed = true; } catch (Exception ex) { // TODO Show an error message depending on the thrown // exception connectionFile = oldFile; JOptionPane.showMessageDialog(this, "Die Datei konnte nicht gespeichert werden", "Fehler", JOptionPane.ERROR_MESSAGE); } } break; } } } }
false
true
public void draw() { super.getContentPane().removeAll(); // making this function being able // to repaint the mainwindow super.setTitle("Dijkstra"); super.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); super.setResizable(false); super.setLayout(new GridLayout(3, 2, 2, 2)); ((JComponent) getContentPane()).setBorder(BorderFactory .createMatteBorder(4, 4, 4, 4, Color.LIGHT_GRAY)); if (file_changed) { try { Controller.INSTANCE.readFile(connectionFile); } catch (Exception e) { JOptionPane.showMessageDialog(this, "Die Datei konnte nicht ge�ffnet werden", "Fehler", JOptionPane.ERROR_MESSAGE); } file_changed = false; } ListDataModel model = controller.getModel(); Object[] locations = model.getAirportList().values().toArray(); // Create the lists leftList = new JComboBox<>(locations); rightList = new JComboBox<>(locations); rightList.setSelectedIndex(1); // just for a more professional // impression of the program -> mark // the second element in the second // list as active // Create a button for being able to submit the action JButton startAction = new JButton("Berechnen"); startAction.setActionCommand("calc"); startAction.addActionListener(this); // Add elements to the frame super.add(new JLabel("Start")); super.add(leftList); super.add(new JLabel("Ziel")); super.add(rightList); super.add(startAction); super.add(new JLabel()); // Create a menu for various actions JMenuBar menuBar = new JMenuBar(); super.setJMenuBar(menuBar); // Define Menu Cats JMenu fileMenu = new JMenu("Datei"); menuBar.add(fileMenu); JMenu infoMenu = new JMenu("Info"); menuBar.add(infoMenu); // Define Menu Items within the cats JMenuItem openFile = new JMenuItem("�ffnen..."); openFile.addActionListener(this); openFile.setActionCommand("loadFile"); fileMenu.add(openFile); JMenuItem editFile = new JMenuItem("Bearbeiten..."); editFile.addActionListener(this); editFile.setActionCommand("editFile"); fileMenu.add(editFile); JMenuItem saveFile = new JMenuItem("Speichern unter..."); saveFile.addActionListener(this); saveFile.setActionCommand("saveFile"); fileMenu.add(saveFile); // Info menu JMenuItem fileInfo = new JMenuItem(connectionFile.getAbsolutePath() .toString()); fileInfo.setEnabled(false); JMenuItem textLabelFileInfo = new JMenuItem( "Momentan ge�ffnete Datei:"); textLabelFileInfo.setEnabled(false); infoMenu.add(textLabelFileInfo); infoMenu.add(fileInfo); // Do the rest for displaying the window super.pack(); super.setLocationRelativeTo(null); // center the frame // Show the window super.setVisible(true); }
public void draw() { super.getContentPane().removeAll(); // making this function being able // to repaint the mainwindow super.setTitle("Dijkstra"); super.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); super.setResizable(false); super.setLayout(new GridLayout(3, 2, 2, 2)); ((JComponent) getContentPane()).setBorder(BorderFactory .createMatteBorder(4, 4, 4, 4, Color.LIGHT_GRAY)); if (file_changed) { try { Controller.INSTANCE.readFile(connectionFile); } catch (Exception e) { JOptionPane.showMessageDialog(this, "Die Datei konnte nicht geöffnet werden", "Fehler", JOptionPane.ERROR_MESSAGE); } file_changed = false; } ListDataModel model = controller.getModel(); Object[] locations = model.getAirportList().values().toArray(); // Create the lists leftList = new JComboBox<>(locations); rightList = new JComboBox<>(locations); rightList.setSelectedIndex(1); // just for a more professional // impression of the program -> mark // the second element in the second // list as active // Create a button for being able to submit the action JButton startAction = new JButton("Berechnen"); startAction.setActionCommand("calc"); startAction.addActionListener(this); // Add elements to the frame super.add(new JLabel("Start")); super.add(leftList); super.add(new JLabel("Ziel")); super.add(rightList); super.add(startAction); super.add(new JLabel()); // Create a menu for various actions JMenuBar menuBar = new JMenuBar(); super.setJMenuBar(menuBar); // Define Menu Cats JMenu fileMenu = new JMenu("Datei"); menuBar.add(fileMenu); JMenu infoMenu = new JMenu("Info"); menuBar.add(infoMenu); // Define Menu Items within the cats JMenuItem openFile = new JMenuItem("Öffnen..."); openFile.addActionListener(this); openFile.setActionCommand("loadFile"); fileMenu.add(openFile); JMenuItem editFile = new JMenuItem("Bearbeiten..."); editFile.addActionListener(this); editFile.setActionCommand("editFile"); fileMenu.add(editFile); JMenuItem saveFile = new JMenuItem("Speichern unter..."); saveFile.addActionListener(this); saveFile.setActionCommand("saveFile"); fileMenu.add(saveFile); // Info menu JMenuItem fileInfo = new JMenuItem(connectionFile.getAbsolutePath() .toString()); fileInfo.setEnabled(false); JMenuItem textLabelFileInfo = new JMenuItem( "Momentan ge�ffnete Datei:"); textLabelFileInfo.setEnabled(false); infoMenu.add(textLabelFileInfo); infoMenu.add(fileInfo); // Do the rest for displaying the window super.pack(); super.setLocationRelativeTo(null); // center the frame // Show the window super.setVisible(true); }
diff --git a/chips/src/com/android/ex/chips/SingleAddressAdapter.java b/chips/src/com/android/ex/chips/SingleAddressAdapter.java index 97ad21e..8131fc3 100644 --- a/chips/src/com/android/ex/chips/SingleAddressAdapter.java +++ b/chips/src/com/android/ex/chips/SingleAddressAdapter.java @@ -1,63 +1,63 @@ /* * Copyright (C) 2011 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.android.ex.chips; import android.content.Context; import android.text.util.Rfc822Tokenizer; import android.view.LayoutInflater; import android.view.View; import android.view.ViewGroup; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.TextView; class SingleRecipientArrayAdapter extends ArrayAdapter<RecipientEntry> { private int mLayoutId; private final LayoutInflater mLayoutInflater; public SingleRecipientArrayAdapter(Context context, int resourceId, RecipientEntry entry) { super(context, resourceId, new RecipientEntry[] { entry }); mLayoutInflater = LayoutInflater.from(context); mLayoutId = resourceId; } @Override public View getView(int position, View convertView, ViewGroup parent) { if (convertView == null) { convertView = newView(); } bindView(convertView, convertView.getContext(), getItem(position)); return convertView; } private View newView() { return mLayoutInflater.inflate(mLayoutId, null); } private void bindView(View view, Context context, RecipientEntry entry) { - TextView display = (TextView) view.findViewById(android.R.id.text1); + TextView display = (TextView) view.findViewById(android.R.id.title); ImageView imageView = (ImageView) view.findViewById(android.R.id.icon); display.setText(entry.getDisplayName()); display.setVisibility(View.VISIBLE); imageView.setVisibility(View.VISIBLE); - TextView destination = (TextView) view.findViewById(android.R.id.text2); + TextView destination = (TextView) view.findViewById(android.R.id.text1); destination.setText(Rfc822Tokenizer.tokenize(entry.getDestination())[0].getAddress()); } }
false
true
private void bindView(View view, Context context, RecipientEntry entry) { TextView display = (TextView) view.findViewById(android.R.id.text1); ImageView imageView = (ImageView) view.findViewById(android.R.id.icon); display.setText(entry.getDisplayName()); display.setVisibility(View.VISIBLE); imageView.setVisibility(View.VISIBLE); TextView destination = (TextView) view.findViewById(android.R.id.text2); destination.setText(Rfc822Tokenizer.tokenize(entry.getDestination())[0].getAddress()); }
private void bindView(View view, Context context, RecipientEntry entry) { TextView display = (TextView) view.findViewById(android.R.id.title); ImageView imageView = (ImageView) view.findViewById(android.R.id.icon); display.setText(entry.getDisplayName()); display.setVisibility(View.VISIBLE); imageView.setVisibility(View.VISIBLE); TextView destination = (TextView) view.findViewById(android.R.id.text1); destination.setText(Rfc822Tokenizer.tokenize(entry.getDestination())[0].getAddress()); }
diff --git a/util/plugins/eu.esdihumboldt.util/src/eu/esdihumboldt/util/StructuredEquals.java b/util/plugins/eu.esdihumboldt.util/src/eu/esdihumboldt/util/StructuredEquals.java index 3ea38784a..2c1b99806 100644 --- a/util/plugins/eu.esdihumboldt.util/src/eu/esdihumboldt/util/StructuredEquals.java +++ b/util/plugins/eu.esdihumboldt.util/src/eu/esdihumboldt/util/StructuredEquals.java @@ -1,122 +1,122 @@ /* * HUMBOLDT: A Framework for Data Harmonisation and Service Integration. * EU Integrated Project #030962 01.10.2006 - 30.09.2010 * * For more information on the project, please refer to the this web site: * http://www.esdi-humboldt.eu * * LICENSE: For information on the license under which this program is * available, please refer to http:/www.esdi-humboldt.eu/license.html#core * (c) the HUMBOLDT Consortium, 2007 to 2011. */ package eu.esdihumboldt.util; import java.util.ArrayList; import java.util.Arrays; import java.util.Collection; import java.util.Collections; import java.util.Iterator; import java.util.NoSuchElementException; import com.google.common.base.Objects; import com.google.common.collect.Iterables; /** * StructuredEquals provides methods for equals and hashCode implementations * for complex structures. * * @author Simon Templer */ public class StructuredEquals { /** * Determines if the given objects are equal, in turn descending into * {@link Iterable}s and arrays and checking if the elements are equal * (in order). * @param o1 the first object * @param o2 the second object * @return if both objects are equal * @see #deepIterableHashCode(Object) */ public boolean deepIterableEquals(Object o1, Object o2) { if (o1 == o2) { return true; } Iterable<?> iterable1 = asIterable(o1); - Iterable<?> iterable2 = asIterable(o1); + Iterable<?> iterable2 = asIterable(o2); if (iterable1 != null && iterable2 != null) { if (Iterables.size(iterable1) == Iterables.size(iterable2)) { // size check Iterator<?> it1 = iterable1.iterator(); Iterator<?> it2 = iterable2.iterator(); while (it1.hasNext() || it2.hasNext()) { try { if (!deepIterableEquals(it1.next(), it2.next())) { return false; } } catch (NoSuchElementException e) { return false; } } return true; } return false; } else { return Objects.equal(o1, o2); } } /** * Get the hash code for all contained objects, descending into * {@link Iterable}s and arrays. * @param object the object to determine the hash code from * @return the hash code * @see #deepIterableEquals(Object, Object) */ public int deepIterableHashCode(Object object) { return Arrays.hashCode(collectObjects(object).toArray()); } /** * Collect all objects contained in an {@link Iterable} or array and in * their elements. * @param object the object to collect objects on * @return the collected objects */ public Collection<?> collectObjects(Object object) { Iterable<?> iterable = asIterable(object); if (iterable == null) { return Collections.singleton(object); } else { Collection<Object> result = new ArrayList<Object>(); for (Object child : iterable) { result.addAll(collectObjects(child)); } return result; } } /** * Returns an iterable for the given objects contents, or null * if it does not contain anything that needs to be compared. * * @param object the object in question * @return an iterable for the given object */ protected Iterable<?> asIterable(Object object) { if (object == null) return null; if (object instanceof Iterable<?>) { return (Iterable<?>) object; } if (object.getClass().isArray()) { return Arrays.asList((Object[]) object); } return null; } }
true
true
public boolean deepIterableEquals(Object o1, Object o2) { if (o1 == o2) { return true; } Iterable<?> iterable1 = asIterable(o1); Iterable<?> iterable2 = asIterable(o1); if (iterable1 != null && iterable2 != null) { if (Iterables.size(iterable1) == Iterables.size(iterable2)) { // size check Iterator<?> it1 = iterable1.iterator(); Iterator<?> it2 = iterable2.iterator(); while (it1.hasNext() || it2.hasNext()) { try { if (!deepIterableEquals(it1.next(), it2.next())) { return false; } } catch (NoSuchElementException e) { return false; } } return true; } return false; } else { return Objects.equal(o1, o2); } }
public boolean deepIterableEquals(Object o1, Object o2) { if (o1 == o2) { return true; } Iterable<?> iterable1 = asIterable(o1); Iterable<?> iterable2 = asIterable(o2); if (iterable1 != null && iterable2 != null) { if (Iterables.size(iterable1) == Iterables.size(iterable2)) { // size check Iterator<?> it1 = iterable1.iterator(); Iterator<?> it2 = iterable2.iterator(); while (it1.hasNext() || it2.hasNext()) { try { if (!deepIterableEquals(it1.next(), it2.next())) { return false; } } catch (NoSuchElementException e) { return false; } } return true; } return false; } else { return Objects.equal(o1, o2); } }
diff --git a/src/impl/java/org/wyona/yarep/impl/repo/xmldb/XMLDBStorage.java b/src/impl/java/org/wyona/yarep/impl/repo/xmldb/XMLDBStorage.java index a83da06..b119749 100644 --- a/src/impl/java/org/wyona/yarep/impl/repo/xmldb/XMLDBStorage.java +++ b/src/impl/java/org/wyona/yarep/impl/repo/xmldb/XMLDBStorage.java @@ -1,354 +1,354 @@ package org.wyona.yarep.impl.repo.xmldb; import java.io.File; import java.io.InputStream; import java.io.OutputStream; import java.io.Reader; import java.io.Writer; import org.wyona.yarep.core.Path; import org.wyona.yarep.core.RepositoryException; import org.wyona.yarep.core.Storage; import org.wyona.yarep.core.UID; import org.wyona.commons.io.FileUtil; import org.apache.avalon.framework.configuration.Configuration; import org.apache.avalon.framework.configuration.DefaultConfigurationBuilder; import org.apache.log4j.Category; import org.xmldb.api.DatabaseManager; import org.xmldb.api.base.Collection; import org.xmldb.api.base.Database; import org.xmldb.api.base.Service; import org.xmldb.api.base.XMLDBException; import org.xmldb.api.modules.CollectionManagementService; /** * @author Andreas Wuest */ public class XMLDBStorage implements Storage { private static Category mLog = Category.getInstance(XMLDBStorage.class); private Credentials mCredentials; private String mDatabaseURIPrefix; /** * XMLDBStorage constructor. */ public XMLDBStorage() {} /** * XMLDBStorage constructor. * * @param aID the repository ID * @param aRepoConfigFile the repsitory configuration file */ public XMLDBStorage(String aID, File aRepoConfigFile) throws RepositoryException { Configuration storageConfig; try { storageConfig = (new DefaultConfigurationBuilder()).buildFromFile(aRepoConfigFile).getChild("storage", false); } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } readConfig(storageConfig, aRepoConfigFile); } /** * Reads the repository configuration and initialises the database. * * @param aStorageConfig the storage configuration * @param aRepoConfigFile the storage configuration as a raw file */ public void readConfig(Configuration aStorageConfig, File aRepoConfigFile) throws RepositoryException { - Boolean createPrefix; + boolean createPrefix; Configuration repositoryConfig; Configuration credentialsConfig; Database database; File databaseHomeDir; Service collectionService; String driverName; String databaseHome; String rootCollection; String pathPrefix; String databaseAddress; String databaseName; String databaseURIPrefix; /* TODO: replace most mLog.error() invocations by mLog.debug(). * Unfortunately, mLog.debug() produces no output, even if activated * in the log4.properties. */ // check if we received a storage configuration and a repo config file if (aStorageConfig == null || aRepoConfigFile == null) throw new RepositoryException("No storage/repository configuration available."); try { // retrieve the database driver name (e.g. "org.apache.xindice.client.xmldb.DatabaseImpl") [mandatory] driverName = aStorageConfig.getChild("driver").getValue(""); mLog.error("Specified driver name = \"" + driverName + "\"."); // retrieve the database home (e.g. "../data") [optional] databaseHome = aStorageConfig.getChild("db-home").getValue(null); mLog.error("Specified database home = \"" + databaseHome + "\"."); // retrieve the root collection name (e.g. "db") [mandatory] rootCollection = aStorageConfig.getChild("root").getValue(""); mLog.error("Specified root collection = \"" + rootCollection + "\"."); // retrieve the path prefix (e.g. "some/sample/collection") [optional] pathPrefix = aStorageConfig.getChild("prefix").getValue(""); createPrefix = aStorageConfig.getChild("prefix").getAttributeAsBoolean("createIfNotExists", false); mLog.error("Specified collection prefix = \"" + pathPrefix + "\" (create if not exists: \"" + createPrefix + "\")."); // retrieve the name of the database host (e.g. "myhost.domain.com:8080") [optional] databaseAddress = aStorageConfig.getChild("address").getValue(""); mLog.error("Specified database address = \"" + databaseAddress + "\"."); // retrieve credentials [optional] credentialsConfig = aStorageConfig.getChild("credentials", false); if (credentialsConfig != null) { mCredentials = new Credentials(credentialsConfig.getChild("username").getValue(""), credentialsConfig.getChild("password").getValue("")); mLog.error("Specified credentials read."); } } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } // check if the driver name was specified if (driverName.equals("")) throw new RepositoryException("Database driver not specified."); // check if the root collection was specified if (rootCollection.equals("")) throw new RepositoryException("Database root collection not specified."); // register the database with the database manager try { database = (Database) Class.forName(driverName).newInstance(); // determine the database location if (databaseHome != null) { // resolve the database home relative to the repo config file directory databaseHomeDir = new File(databaseHome); if (!databaseHomeDir.isAbsolute()) { databaseHomeDir = FileUtil.file(aRepoConfigFile.getParent(), databaseHomeDir.toString()); } mLog.error("Resolved database home directory = \"" + databaseHomeDir + "\""); database.setProperty("db-home", databaseHomeDir.toString()); } // set the database location DatabaseManager.registerDatabase(database); databaseName = database.getName(); } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } // construct the database URI prefix up to (and inluding) the root collection databaseURIPrefix = "xmldb:" + databaseName + "://" + databaseAddress + "/" + rootCollection + "/"; // construct the complete database URI prefix including a potential path prefix if (pathPrefix.equals("")) { mDatabaseURIPrefix = databaseURIPrefix; } else { mDatabaseURIPrefix = databaseURIPrefix + "/" + pathPrefix + "/"; } mLog.error("Collection base path = \"" + databaseURIPrefix + "\"."); mLog.error("Complete collection base path = \"" + mDatabaseURIPrefix + "\"."); // test drive our new database instance try { database.acceptsURI(mDatabaseURIPrefix); } catch (XMLDBException exception) { mLog.error(exception); if (exception.errorCode == org.xmldb.api.base.ErrorCodes.INVALID_URI) { throw new RepositoryException("The database does not accept the URI prefix \"" + mDatabaseURIPrefix + "\" as valid. Please make sure that the database host address (\"" + databaseAddress + "\") is correct. Original message: " + exception.getMessage(), exception); } else { throw new RepositoryException(exception.getMessage(), exception); } } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } try { // check if the specified root collection exists if (getCollection(databaseURIPrefix) == null) throw new RepositoryException("Specified root collection (\"" + rootCollection + "\") does not exist."); // check if the complete collection prefix exists if (getCollectionRelative(null) == null) { if (createPrefix) { // create the prefix collection try { collectionService = getCollection(databaseURIPrefix).getService("CollectionManagementService", "1.0"); ((CollectionManagementService) collectionService).createCollection(pathPrefix); // re-check if complete collection prefix exists now, we don't want to take any chances here if (getCollectionRelative(null) == null) throw new RepositoryException("Specified collection prefix (\"" + pathPrefix + "\") does not exist."); } catch (Exception exception) { mLog.error(exception); throw new RepositoryException("Failed to create prefix collection (\"" + pathPrefix + "\"). Original message: " + exception.getMessage(), exception); } mLog.error("Created new collection \"" + pathPrefix + "\"."); } else { // the prefix collection does not exist throw new RepositoryException("Specified collection prefix (\"" + pathPrefix + "\") does not exist."); } } } catch (Exception exception) { // something went wrong after registering the database, we have to deregister it now try { DatabaseManager.deregisterDatabase(database); } catch (Exception databaseException) { mLog.error(databaseException); throw new RepositoryException(databaseException.getMessage(), databaseException); } /* Rethrow exception. We have to construct a new exception here, because the type system * doesn't know that only RepositoryExceptions can get to this point (we catch all other * exceptions above already), and would therefore complain. */ throw new RepositoryException(exception.getMessage(), exception); } } /** *@deprecated */ public Writer getWriter(UID aUID, Path aPath) { mLog.warn("Not implemented yet!"); return null; } /** * */ public OutputStream getOutputStream(UID aUID, Path aPath) throws RepositoryException { mLog.warn("Not implemented yet!"); return null; } /** *@deprecated */ public Reader getReader(UID aUID, Path aPath) { mLog.warn("Not implemented yet!"); return null; } /** * */ public InputStream getInputStream(UID aUID, Path aPath) throws RepositoryException { mLog.warn("Not implemented yet!"); return null; } /** * */ public long getLastModified(UID aUID, Path aPath) throws RepositoryException { mLog.warn("Not implemented yet!"); return 0; } /** * */ public long getSize(UID aUID, Path aPath) throws RepositoryException { mLog.warn("Not implemented yet!"); return 0; } /** * */ public boolean delete(UID aUID, Path aPath) throws RepositoryException { mLog.error("TODO: Not implemented yet!"); return false; } /** * */ public String[] getRevisions(UID aUID, Path aPath) throws RepositoryException { mLog.warn("Versioning not implemented yet"); return null; } /** * Retrieves the collection for the specified collection URI, relative to * the global collection prefix path. * * @param aCollectionURI the relative URI of the collection to retrieve, or null to * retrieve the global prefix collection * @return a collection instance for the requested collection or * null if the collection could not be found * @throws RepositoryException if an error occurred retrieving the collection (e.g. * permission was denied) */ private Collection getCollectionRelative(String aCollectionURI) throws RepositoryException { return getCollection(constructCollectionURI(aCollectionURI)); } /** * Retrieves the collection for the specified collection URI. * * @param aCollectionURI the xmldb URI of the collection to retrieve * @return a collection instance for the requested collection or * null if the collection could not be found * @throws RepositoryException if an error occurred retrieving the collection (e.g. * permission was denied) */ private Collection getCollection(String aCollectionURI) throws RepositoryException { try { if (mCredentials != null) { return DatabaseManager.getCollection(aCollectionURI, mCredentials.getUsername(), mCredentials.getPassword()); } else { return DatabaseManager.getCollection(aCollectionURI); } } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } } private String constructCollectionURI(String aCollectionURI) { return mDatabaseURIPrefix + "/" + (aCollectionURI != null ? aCollectionURI : ""); } private class Credentials { private final String mUsername; private final String mPassword; public Credentials(String aUsername, String aPassword) { mUsername = aUsername; mPassword = aPassword; } public String getUsername() { return mUsername; } public String getPassword() { return mPassword; } } }
true
true
public void readConfig(Configuration aStorageConfig, File aRepoConfigFile) throws RepositoryException { Boolean createPrefix; Configuration repositoryConfig; Configuration credentialsConfig; Database database; File databaseHomeDir; Service collectionService; String driverName; String databaseHome; String rootCollection; String pathPrefix; String databaseAddress; String databaseName; String databaseURIPrefix; /* TODO: replace most mLog.error() invocations by mLog.debug(). * Unfortunately, mLog.debug() produces no output, even if activated * in the log4.properties. */ // check if we received a storage configuration and a repo config file if (aStorageConfig == null || aRepoConfigFile == null) throw new RepositoryException("No storage/repository configuration available."); try { // retrieve the database driver name (e.g. "org.apache.xindice.client.xmldb.DatabaseImpl") [mandatory] driverName = aStorageConfig.getChild("driver").getValue(""); mLog.error("Specified driver name = \"" + driverName + "\"."); // retrieve the database home (e.g. "../data") [optional] databaseHome = aStorageConfig.getChild("db-home").getValue(null); mLog.error("Specified database home = \"" + databaseHome + "\"."); // retrieve the root collection name (e.g. "db") [mandatory] rootCollection = aStorageConfig.getChild("root").getValue(""); mLog.error("Specified root collection = \"" + rootCollection + "\"."); // retrieve the path prefix (e.g. "some/sample/collection") [optional] pathPrefix = aStorageConfig.getChild("prefix").getValue(""); createPrefix = aStorageConfig.getChild("prefix").getAttributeAsBoolean("createIfNotExists", false); mLog.error("Specified collection prefix = \"" + pathPrefix + "\" (create if not exists: \"" + createPrefix + "\")."); // retrieve the name of the database host (e.g. "myhost.domain.com:8080") [optional] databaseAddress = aStorageConfig.getChild("address").getValue(""); mLog.error("Specified database address = \"" + databaseAddress + "\"."); // retrieve credentials [optional] credentialsConfig = aStorageConfig.getChild("credentials", false); if (credentialsConfig != null) { mCredentials = new Credentials(credentialsConfig.getChild("username").getValue(""), credentialsConfig.getChild("password").getValue("")); mLog.error("Specified credentials read."); } } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } // check if the driver name was specified if (driverName.equals("")) throw new RepositoryException("Database driver not specified."); // check if the root collection was specified if (rootCollection.equals("")) throw new RepositoryException("Database root collection not specified."); // register the database with the database manager try { database = (Database) Class.forName(driverName).newInstance(); // determine the database location if (databaseHome != null) { // resolve the database home relative to the repo config file directory databaseHomeDir = new File(databaseHome); if (!databaseHomeDir.isAbsolute()) { databaseHomeDir = FileUtil.file(aRepoConfigFile.getParent(), databaseHomeDir.toString()); } mLog.error("Resolved database home directory = \"" + databaseHomeDir + "\""); database.setProperty("db-home", databaseHomeDir.toString()); } // set the database location DatabaseManager.registerDatabase(database); databaseName = database.getName(); } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } // construct the database URI prefix up to (and inluding) the root collection databaseURIPrefix = "xmldb:" + databaseName + "://" + databaseAddress + "/" + rootCollection + "/"; // construct the complete database URI prefix including a potential path prefix if (pathPrefix.equals("")) { mDatabaseURIPrefix = databaseURIPrefix; } else { mDatabaseURIPrefix = databaseURIPrefix + "/" + pathPrefix + "/"; } mLog.error("Collection base path = \"" + databaseURIPrefix + "\"."); mLog.error("Complete collection base path = \"" + mDatabaseURIPrefix + "\"."); // test drive our new database instance try { database.acceptsURI(mDatabaseURIPrefix); } catch (XMLDBException exception) { mLog.error(exception); if (exception.errorCode == org.xmldb.api.base.ErrorCodes.INVALID_URI) { throw new RepositoryException("The database does not accept the URI prefix \"" + mDatabaseURIPrefix + "\" as valid. Please make sure that the database host address (\"" + databaseAddress + "\") is correct. Original message: " + exception.getMessage(), exception); } else { throw new RepositoryException(exception.getMessage(), exception); } } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } try { // check if the specified root collection exists if (getCollection(databaseURIPrefix) == null) throw new RepositoryException("Specified root collection (\"" + rootCollection + "\") does not exist."); // check if the complete collection prefix exists if (getCollectionRelative(null) == null) { if (createPrefix) { // create the prefix collection try { collectionService = getCollection(databaseURIPrefix).getService("CollectionManagementService", "1.0"); ((CollectionManagementService) collectionService).createCollection(pathPrefix); // re-check if complete collection prefix exists now, we don't want to take any chances here if (getCollectionRelative(null) == null) throw new RepositoryException("Specified collection prefix (\"" + pathPrefix + "\") does not exist."); } catch (Exception exception) { mLog.error(exception); throw new RepositoryException("Failed to create prefix collection (\"" + pathPrefix + "\"). Original message: " + exception.getMessage(), exception); } mLog.error("Created new collection \"" + pathPrefix + "\"."); } else { // the prefix collection does not exist throw new RepositoryException("Specified collection prefix (\"" + pathPrefix + "\") does not exist."); } } } catch (Exception exception) { // something went wrong after registering the database, we have to deregister it now try { DatabaseManager.deregisterDatabase(database); } catch (Exception databaseException) { mLog.error(databaseException); throw new RepositoryException(databaseException.getMessage(), databaseException); } /* Rethrow exception. We have to construct a new exception here, because the type system * doesn't know that only RepositoryExceptions can get to this point (we catch all other * exceptions above already), and would therefore complain. */ throw new RepositoryException(exception.getMessage(), exception); } }
public void readConfig(Configuration aStorageConfig, File aRepoConfigFile) throws RepositoryException { boolean createPrefix; Configuration repositoryConfig; Configuration credentialsConfig; Database database; File databaseHomeDir; Service collectionService; String driverName; String databaseHome; String rootCollection; String pathPrefix; String databaseAddress; String databaseName; String databaseURIPrefix; /* TODO: replace most mLog.error() invocations by mLog.debug(). * Unfortunately, mLog.debug() produces no output, even if activated * in the log4.properties. */ // check if we received a storage configuration and a repo config file if (aStorageConfig == null || aRepoConfigFile == null) throw new RepositoryException("No storage/repository configuration available."); try { // retrieve the database driver name (e.g. "org.apache.xindice.client.xmldb.DatabaseImpl") [mandatory] driverName = aStorageConfig.getChild("driver").getValue(""); mLog.error("Specified driver name = \"" + driverName + "\"."); // retrieve the database home (e.g. "../data") [optional] databaseHome = aStorageConfig.getChild("db-home").getValue(null); mLog.error("Specified database home = \"" + databaseHome + "\"."); // retrieve the root collection name (e.g. "db") [mandatory] rootCollection = aStorageConfig.getChild("root").getValue(""); mLog.error("Specified root collection = \"" + rootCollection + "\"."); // retrieve the path prefix (e.g. "some/sample/collection") [optional] pathPrefix = aStorageConfig.getChild("prefix").getValue(""); createPrefix = aStorageConfig.getChild("prefix").getAttributeAsBoolean("createIfNotExists", false); mLog.error("Specified collection prefix = \"" + pathPrefix + "\" (create if not exists: \"" + createPrefix + "\")."); // retrieve the name of the database host (e.g. "myhost.domain.com:8080") [optional] databaseAddress = aStorageConfig.getChild("address").getValue(""); mLog.error("Specified database address = \"" + databaseAddress + "\"."); // retrieve credentials [optional] credentialsConfig = aStorageConfig.getChild("credentials", false); if (credentialsConfig != null) { mCredentials = new Credentials(credentialsConfig.getChild("username").getValue(""), credentialsConfig.getChild("password").getValue("")); mLog.error("Specified credentials read."); } } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } // check if the driver name was specified if (driverName.equals("")) throw new RepositoryException("Database driver not specified."); // check if the root collection was specified if (rootCollection.equals("")) throw new RepositoryException("Database root collection not specified."); // register the database with the database manager try { database = (Database) Class.forName(driverName).newInstance(); // determine the database location if (databaseHome != null) { // resolve the database home relative to the repo config file directory databaseHomeDir = new File(databaseHome); if (!databaseHomeDir.isAbsolute()) { databaseHomeDir = FileUtil.file(aRepoConfigFile.getParent(), databaseHomeDir.toString()); } mLog.error("Resolved database home directory = \"" + databaseHomeDir + "\""); database.setProperty("db-home", databaseHomeDir.toString()); } // set the database location DatabaseManager.registerDatabase(database); databaseName = database.getName(); } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } // construct the database URI prefix up to (and inluding) the root collection databaseURIPrefix = "xmldb:" + databaseName + "://" + databaseAddress + "/" + rootCollection + "/"; // construct the complete database URI prefix including a potential path prefix if (pathPrefix.equals("")) { mDatabaseURIPrefix = databaseURIPrefix; } else { mDatabaseURIPrefix = databaseURIPrefix + "/" + pathPrefix + "/"; } mLog.error("Collection base path = \"" + databaseURIPrefix + "\"."); mLog.error("Complete collection base path = \"" + mDatabaseURIPrefix + "\"."); // test drive our new database instance try { database.acceptsURI(mDatabaseURIPrefix); } catch (XMLDBException exception) { mLog.error(exception); if (exception.errorCode == org.xmldb.api.base.ErrorCodes.INVALID_URI) { throw new RepositoryException("The database does not accept the URI prefix \"" + mDatabaseURIPrefix + "\" as valid. Please make sure that the database host address (\"" + databaseAddress + "\") is correct. Original message: " + exception.getMessage(), exception); } else { throw new RepositoryException(exception.getMessage(), exception); } } catch (Exception exception) { mLog.error(exception); throw new RepositoryException(exception.getMessage(), exception); } try { // check if the specified root collection exists if (getCollection(databaseURIPrefix) == null) throw new RepositoryException("Specified root collection (\"" + rootCollection + "\") does not exist."); // check if the complete collection prefix exists if (getCollectionRelative(null) == null) { if (createPrefix) { // create the prefix collection try { collectionService = getCollection(databaseURIPrefix).getService("CollectionManagementService", "1.0"); ((CollectionManagementService) collectionService).createCollection(pathPrefix); // re-check if complete collection prefix exists now, we don't want to take any chances here if (getCollectionRelative(null) == null) throw new RepositoryException("Specified collection prefix (\"" + pathPrefix + "\") does not exist."); } catch (Exception exception) { mLog.error(exception); throw new RepositoryException("Failed to create prefix collection (\"" + pathPrefix + "\"). Original message: " + exception.getMessage(), exception); } mLog.error("Created new collection \"" + pathPrefix + "\"."); } else { // the prefix collection does not exist throw new RepositoryException("Specified collection prefix (\"" + pathPrefix + "\") does not exist."); } } } catch (Exception exception) { // something went wrong after registering the database, we have to deregister it now try { DatabaseManager.deregisterDatabase(database); } catch (Exception databaseException) { mLog.error(databaseException); throw new RepositoryException(databaseException.getMessage(), databaseException); } /* Rethrow exception. We have to construct a new exception here, because the type system * doesn't know that only RepositoryExceptions can get to this point (we catch all other * exceptions above already), and would therefore complain. */ throw new RepositoryException(exception.getMessage(), exception); } }
diff --git a/mes-plugins/mes-plugins-time-norms-for-operations/src/test/java/com/qcadoo/mes/timeNormsForOperations/hooks/TechnologyOperationComponentDetailsHooksTest.java b/mes-plugins/mes-plugins-time-norms-for-operations/src/test/java/com/qcadoo/mes/timeNormsForOperations/hooks/TechnologyOperationComponentDetailsHooksTest.java index 07c06bbe3e..579d4573eb 100644 --- a/mes-plugins/mes-plugins-time-norms-for-operations/src/test/java/com/qcadoo/mes/timeNormsForOperations/hooks/TechnologyOperationComponentDetailsHooksTest.java +++ b/mes-plugins/mes-plugins-time-norms-for-operations/src/test/java/com/qcadoo/mes/timeNormsForOperations/hooks/TechnologyOperationComponentDetailsHooksTest.java @@ -1,142 +1,142 @@ package com.qcadoo.mes.timeNormsForOperations.hooks; import static org.mockito.BDDMockito.given; import static org.mockito.Mockito.verify; import java.math.BigDecimal; import java.math.MathContext; import java.math.RoundingMode; import java.text.DecimalFormat; import java.util.Locale; import org.junit.Before; import org.junit.Test; import org.mockito.Mock; import org.mockito.Mockito; import org.mockito.MockitoAnnotations; import org.mockito.invocation.InvocationOnMock; import org.mockito.stubbing.Answer; import org.springframework.context.i18n.LocaleContextHolder; import org.springframework.test.util.ReflectionTestUtils; import com.qcadoo.localization.api.TranslationService; import com.qcadoo.mes.technologies.TechnologyService; import com.qcadoo.model.api.DataDefinition; import com.qcadoo.model.api.Entity; import com.qcadoo.model.api.NumberService; import com.qcadoo.view.api.ComponentState; import com.qcadoo.view.api.ComponentState.MessageType; import com.qcadoo.view.api.ViewDefinitionState; import com.qcadoo.view.api.components.FormComponent; public class TechnologyOperationComponentDetailsHooksTest { private TechnologyOperationComponentDetailsHooks technologyOperationComponentDetailsHooks; @Mock private ViewDefinitionState view; @Mock private TechnologyService technologyService; @Mock private TranslationService translationService; @Mock private NumberService numberService; @Mock private Entity opComp1, prodComp1, product1; @Mock private FormComponent form; @Mock private DataDefinition dd; @Mock private ComponentState productionInOneCycle; private DecimalFormat decimalFormat; private Locale locale; @Before public void init() { MockitoAnnotations.initMocks(this); technologyOperationComponentDetailsHooks = new TechnologyOperationComponentDetailsHooks(); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "technologyService", technologyService); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "translationService", translationService); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "numberService", numberService); given(numberService.getMathContext()).willReturn(MathContext.DECIMAL64); locale = LocaleContextHolder.getLocale(); decimalFormat = (DecimalFormat) DecimalFormat.getInstance(locale); decimalFormat.setMaximumFractionDigits(3); decimalFormat.setMinimumFractionDigits(3); decimalFormat.setRoundingMode(RoundingMode.HALF_EVEN); given(numberService.format(Mockito.any(BigDecimal.class))).willAnswer(new Answer<String>() { @Override public String answer(InvocationOnMock invocation) throws Throwable { Object[] args = invocation.getArguments(); BigDecimal number = (BigDecimal) args[0]; return decimalFormat.format(number); } }); given(view.getComponentByReference("form")).willReturn(form); given(form.getEntity()).willReturn(opComp1); given(opComp1.getDataDefinition()).willReturn(dd); - given(dd.get(0l)).willReturn(opComp1); + given(dd.get(0L)).willReturn(opComp1); given(technologyService.getMainOutputProductComponent(opComp1)).willReturn(prodComp1); given(prodComp1.getDecimalField("quantity")).willReturn(new BigDecimal(1.1f)); given(opComp1.getDecimalField("productionInOneCycle")).willReturn(new BigDecimal(1.2f)); given(view.getComponentByReference("productionInOneCycle")).willReturn(productionInOneCycle); given(prodComp1.getBelongsToField("product")).willReturn(product1); given(product1.getStringField("unit")).willReturn("unit"); } @Test public void shouldNotFreakOutWhenTheOutputProductComponentCannotBeFound() { given(technologyService.getMainOutputProductComponent(opComp1)).willThrow(new IllegalStateException()); // when technologyOperationComponentDetailsHooks.checkOperationOutputQuantities(view); } @Test public void shouldAttachCorrectErrorToTheRightComponentIfQuantitiesAreDifferent() { // given given(translationService.translate("technologies.technologyOperationComponent.validate.error.invalidQuantity1", locale)) .willReturn("message1"); given(translationService.translate("technologies.technologyOperationComponent.validate.error.invalidQuantity2", locale)) .willReturn("message2"); String number = decimalFormat.format(prodComp1.getDecimalField("quantity")); // when technologyOperationComponentDetailsHooks.checkOperationOutputQuantities(view); // then verify(productionInOneCycle).addMessage("message1 " + number + " unit message2", MessageType.FAILURE); } @Test public void shouldNotGiveAnyErrorIfQuantitiesAreTheSame() { // given given(prodComp1.getDecimalField("quantity")).willReturn(new BigDecimal(1.1f)); given(opComp1.getDecimalField("productionInOneCycle")).willReturn(new BigDecimal(1.1f)); // when technologyOperationComponentDetailsHooks.checkOperationOutputQuantities(view); // then verify(productionInOneCycle, Mockito.never()).addMessage(Mockito.anyString(), Mockito.eq(MessageType.FAILURE)); } }
true
true
public void init() { MockitoAnnotations.initMocks(this); technologyOperationComponentDetailsHooks = new TechnologyOperationComponentDetailsHooks(); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "technologyService", technologyService); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "translationService", translationService); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "numberService", numberService); given(numberService.getMathContext()).willReturn(MathContext.DECIMAL64); locale = LocaleContextHolder.getLocale(); decimalFormat = (DecimalFormat) DecimalFormat.getInstance(locale); decimalFormat.setMaximumFractionDigits(3); decimalFormat.setMinimumFractionDigits(3); decimalFormat.setRoundingMode(RoundingMode.HALF_EVEN); given(numberService.format(Mockito.any(BigDecimal.class))).willAnswer(new Answer<String>() { @Override public String answer(InvocationOnMock invocation) throws Throwable { Object[] args = invocation.getArguments(); BigDecimal number = (BigDecimal) args[0]; return decimalFormat.format(number); } }); given(view.getComponentByReference("form")).willReturn(form); given(form.getEntity()).willReturn(opComp1); given(opComp1.getDataDefinition()).willReturn(dd); given(dd.get(0l)).willReturn(opComp1); given(technologyService.getMainOutputProductComponent(opComp1)).willReturn(prodComp1); given(prodComp1.getDecimalField("quantity")).willReturn(new BigDecimal(1.1f)); given(opComp1.getDecimalField("productionInOneCycle")).willReturn(new BigDecimal(1.2f)); given(view.getComponentByReference("productionInOneCycle")).willReturn(productionInOneCycle); given(prodComp1.getBelongsToField("product")).willReturn(product1); given(product1.getStringField("unit")).willReturn("unit"); }
public void init() { MockitoAnnotations.initMocks(this); technologyOperationComponentDetailsHooks = new TechnologyOperationComponentDetailsHooks(); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "technologyService", technologyService); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "translationService", translationService); ReflectionTestUtils.setField(technologyOperationComponentDetailsHooks, "numberService", numberService); given(numberService.getMathContext()).willReturn(MathContext.DECIMAL64); locale = LocaleContextHolder.getLocale(); decimalFormat = (DecimalFormat) DecimalFormat.getInstance(locale); decimalFormat.setMaximumFractionDigits(3); decimalFormat.setMinimumFractionDigits(3); decimalFormat.setRoundingMode(RoundingMode.HALF_EVEN); given(numberService.format(Mockito.any(BigDecimal.class))).willAnswer(new Answer<String>() { @Override public String answer(InvocationOnMock invocation) throws Throwable { Object[] args = invocation.getArguments(); BigDecimal number = (BigDecimal) args[0]; return decimalFormat.format(number); } }); given(view.getComponentByReference("form")).willReturn(form); given(form.getEntity()).willReturn(opComp1); given(opComp1.getDataDefinition()).willReturn(dd); given(dd.get(0L)).willReturn(opComp1); given(technologyService.getMainOutputProductComponent(opComp1)).willReturn(prodComp1); given(prodComp1.getDecimalField("quantity")).willReturn(new BigDecimal(1.1f)); given(opComp1.getDecimalField("productionInOneCycle")).willReturn(new BigDecimal(1.2f)); given(view.getComponentByReference("productionInOneCycle")).willReturn(productionInOneCycle); given(prodComp1.getBelongsToField("product")).willReturn(product1); given(product1.getStringField("unit")).willReturn("unit"); }
diff --git a/com.mountainminds.eclemma.ui/src/com/mountainminds/eclemma/internal/ui/launching/InplaceInstrumentationWarning.java b/com.mountainminds.eclemma.ui/src/com/mountainminds/eclemma/internal/ui/launching/InplaceInstrumentationWarning.java index f590ea2..8089c89 100644 --- a/com.mountainminds.eclemma.ui/src/com/mountainminds/eclemma/internal/ui/launching/InplaceInstrumentationWarning.java +++ b/com.mountainminds.eclemma.ui/src/com/mountainminds/eclemma/internal/ui/launching/InplaceInstrumentationWarning.java @@ -1,56 +1,56 @@ /* * $Id$ */ package com.mountainminds.eclemma.internal.ui.launching; import org.eclipse.core.runtime.CoreException; import org.eclipse.core.runtime.IStatus; import org.eclipse.debug.core.ILaunchConfiguration; import org.eclipse.debug.core.IStatusHandler; import org.eclipse.jface.dialogs.IDialogConstants; import org.eclipse.jface.dialogs.MessageDialog; import org.eclipse.jface.dialogs.MessageDialogWithToggle; import org.eclipse.jface.preference.IPreferenceStore; import org.eclipse.osgi.util.NLS; import org.eclipse.swt.widgets.Shell; import com.mountainminds.eclemma.internal.ui.EclEmmaUIPlugin; import com.mountainminds.eclemma.internal.ui.UIMessages; import com.mountainminds.eclemma.internal.ui.UIPreferences; /** * Status handler that issues a warning for in place instrumentation. * * @author Marc R. Hoffmann * @version $Revision$ */ public class InplaceInstrumentationWarning implements IStatusHandler { public Object handleStatus(IStatus status, Object source) throws CoreException { ILaunchConfiguration config = (ILaunchConfiguration) source; Shell parent = EclEmmaUIPlugin.getInstance().getShell(); String title = UIMessages.InstrumentationWarning_title; String message = NLS.bind(UIMessages.InstrumentationWarning_message, config .getName()); IPreferenceStore store = EclEmmaUIPlugin.getInstance().getPreferenceStore(); if (MessageDialogWithToggle.ALWAYS.equals(store .getString(UIPreferences.PREF_ALLOW_INPLACE_INSTRUMENTATION))) { return Boolean.TRUE; } MessageDialogWithToggle dialog = new MessageDialogWithToggle(parent, title, null, message, MessageDialog.WARNING, new String[] { IDialogConstants.OK_LABEL, IDialogConstants.CANCEL_LABEL }, 0, null, false); dialog.setPrefKey(UIPreferences.PREF_ALLOW_INPLACE_INSTRUMENTATION); dialog.setPrefStore(store); dialog.open(); - return new Boolean(dialog.getReturnCode() == IDialogConstants.OK_ID); + return Boolean.valueOf(dialog.getReturnCode() == IDialogConstants.OK_ID); } }
true
true
public Object handleStatus(IStatus status, Object source) throws CoreException { ILaunchConfiguration config = (ILaunchConfiguration) source; Shell parent = EclEmmaUIPlugin.getInstance().getShell(); String title = UIMessages.InstrumentationWarning_title; String message = NLS.bind(UIMessages.InstrumentationWarning_message, config .getName()); IPreferenceStore store = EclEmmaUIPlugin.getInstance().getPreferenceStore(); if (MessageDialogWithToggle.ALWAYS.equals(store .getString(UIPreferences.PREF_ALLOW_INPLACE_INSTRUMENTATION))) { return Boolean.TRUE; } MessageDialogWithToggle dialog = new MessageDialogWithToggle(parent, title, null, message, MessageDialog.WARNING, new String[] { IDialogConstants.OK_LABEL, IDialogConstants.CANCEL_LABEL }, 0, null, false); dialog.setPrefKey(UIPreferences.PREF_ALLOW_INPLACE_INSTRUMENTATION); dialog.setPrefStore(store); dialog.open(); return new Boolean(dialog.getReturnCode() == IDialogConstants.OK_ID); }
public Object handleStatus(IStatus status, Object source) throws CoreException { ILaunchConfiguration config = (ILaunchConfiguration) source; Shell parent = EclEmmaUIPlugin.getInstance().getShell(); String title = UIMessages.InstrumentationWarning_title; String message = NLS.bind(UIMessages.InstrumentationWarning_message, config .getName()); IPreferenceStore store = EclEmmaUIPlugin.getInstance().getPreferenceStore(); if (MessageDialogWithToggle.ALWAYS.equals(store .getString(UIPreferences.PREF_ALLOW_INPLACE_INSTRUMENTATION))) { return Boolean.TRUE; } MessageDialogWithToggle dialog = new MessageDialogWithToggle(parent, title, null, message, MessageDialog.WARNING, new String[] { IDialogConstants.OK_LABEL, IDialogConstants.CANCEL_LABEL }, 0, null, false); dialog.setPrefKey(UIPreferences.PREF_ALLOW_INPLACE_INSTRUMENTATION); dialog.setPrefStore(store); dialog.open(); return Boolean.valueOf(dialog.getReturnCode() == IDialogConstants.OK_ID); }
diff --git a/src/node/src/main/java/vdi/node/rest/InitializeContext.java b/src/node/src/main/java/vdi/node/rest/InitializeContext.java index 07525aa..b5fb864 100644 --- a/src/node/src/main/java/vdi/node/rest/InitializeContext.java +++ b/src/node/src/main/java/vdi/node/rest/InitializeContext.java @@ -1,57 +1,57 @@ package vdi.node.rest; import java.io.IOException; import java.io.InputStream; import java.util.Timer; import java.util.logging.Logger; import javax.servlet.ServletContextEvent; import javax.servlet.ServletContextListener; import vdi.commons.common.Configuration; import vdi.node.management.Registration; import vdi.node.management.VirtualMachine; /** * Initialization. */ public class InitializeContext implements ServletContextListener { private static final Logger LOGGER = Logger.getLogger(InitializeContext.class.getName()); @Override public void contextInitialized(ServletContextEvent contextEvent) { // Load configuration InputStream is = contextEvent.getServletContext().getResourceAsStream("/WEB-INF/configuration.properties"); if (is != null) { Configuration.loadProperties(is); try { is.close(); } catch (IOException e) { e.printStackTrace(); } } else { throw new Error("Missing configuration file '/WEB-INF/configuration.properties'"); } - // start registration in 10s + // Start registration after delay int seconds = Integer.parseInt(Configuration.getProperty("node.registration_delay")); LOGGER.info("starting registration to '" + Configuration.getProperty("managementserver.uri") + "' in " + seconds + " seconds."); Timer registration = new Timer(); registration.schedule(new Registration(), seconds * 1000); } @Override public void contextDestroyed(ServletContextEvent contextEvent) { // Clean up VirtualBox try { VirtualMachine.cleanup(); } catch (ExceptionInInitializerError e) { } // unregister this NodeController at ManagementServer Registration.unregister(); } }
true
true
public void contextInitialized(ServletContextEvent contextEvent) { // Load configuration InputStream is = contextEvent.getServletContext().getResourceAsStream("/WEB-INF/configuration.properties"); if (is != null) { Configuration.loadProperties(is); try { is.close(); } catch (IOException e) { e.printStackTrace(); } } else { throw new Error("Missing configuration file '/WEB-INF/configuration.properties'"); } // start registration in 10s int seconds = Integer.parseInt(Configuration.getProperty("node.registration_delay")); LOGGER.info("starting registration to '" + Configuration.getProperty("managementserver.uri") + "' in " + seconds + " seconds."); Timer registration = new Timer(); registration.schedule(new Registration(), seconds * 1000); }
public void contextInitialized(ServletContextEvent contextEvent) { // Load configuration InputStream is = contextEvent.getServletContext().getResourceAsStream("/WEB-INF/configuration.properties"); if (is != null) { Configuration.loadProperties(is); try { is.close(); } catch (IOException e) { e.printStackTrace(); } } else { throw new Error("Missing configuration file '/WEB-INF/configuration.properties'"); } // Start registration after delay int seconds = Integer.parseInt(Configuration.getProperty("node.registration_delay")); LOGGER.info("starting registration to '" + Configuration.getProperty("managementserver.uri") + "' in " + seconds + " seconds."); Timer registration = new Timer(); registration.schedule(new Registration(), seconds * 1000); }
diff --git a/src/main/java/com/p000ison/dev/copybooks/commands/DownloadCommand.java b/src/main/java/com/p000ison/dev/copybooks/commands/DownloadCommand.java index 43f5dec..81f6d28 100644 --- a/src/main/java/com/p000ison/dev/copybooks/commands/DownloadCommand.java +++ b/src/main/java/com/p000ison/dev/copybooks/commands/DownloadCommand.java @@ -1,62 +1,62 @@ package com.p000ison.dev.copybooks.commands; import com.p000ison.dev.copybooks.CopyBooks; import com.p000ison.dev.copybooks.api.InvalidBookException; import com.p000ison.dev.copybooks.api.WrittenBook; import com.p000ison.dev.copybooks.objects.GenericCommand; import com.p000ison.dev.copybooks.util.Helper; import org.bukkit.command.CommandSender; import org.bukkit.entity.Player; import java.io.IOException; /** * Represents a AcceptCommand */ public class DownloadCommand extends GenericCommand { public DownloadCommand(CopyBooks plugin, String name) { super(plugin, name); setArgumentRange(2, 3); setIdentifiers("download"); setUsages("/cb download <url> <title> [author]- Downloads a url from this page."); } @Override public void execute(CommandSender sender, String label, String[] args) { if (sender instanceof Player) { Player player = (Player) sender; String author = player.getName(); if (args.length == 3) { author = args[2]; } WrittenBook book; try { - book = Helper.createBookFromURL(author, Helper.formatURL(args[0]), args[1]); + book = Helper.createBookFromURL(Helper.formatURL(args[0]), args[1], author); } catch (IOException e) { player.sendMessage("Invalid URL! [" + e.getMessage() + "]"); return; } catch (InvalidBookException e) { player.sendMessage("Failed to create book!"); return; } try { player.getInventory().addItem(book.toItemStack(1)); } catch (InvalidBookException e) { player.sendMessage("Failed to create book!"); return; } player.sendMessage("Book downloaded!"); } else { } } }
true
true
public void execute(CommandSender sender, String label, String[] args) { if (sender instanceof Player) { Player player = (Player) sender; String author = player.getName(); if (args.length == 3) { author = args[2]; } WrittenBook book; try { book = Helper.createBookFromURL(author, Helper.formatURL(args[0]), args[1]); } catch (IOException e) { player.sendMessage("Invalid URL! [" + e.getMessage() + "]"); return; } catch (InvalidBookException e) { player.sendMessage("Failed to create book!"); return; } try { player.getInventory().addItem(book.toItemStack(1)); } catch (InvalidBookException e) { player.sendMessage("Failed to create book!"); return; } player.sendMessage("Book downloaded!"); } else { } }
public void execute(CommandSender sender, String label, String[] args) { if (sender instanceof Player) { Player player = (Player) sender; String author = player.getName(); if (args.length == 3) { author = args[2]; } WrittenBook book; try { book = Helper.createBookFromURL(Helper.formatURL(args[0]), args[1], author); } catch (IOException e) { player.sendMessage("Invalid URL! [" + e.getMessage() + "]"); return; } catch (InvalidBookException e) { player.sendMessage("Failed to create book!"); return; } try { player.getInventory().addItem(book.toItemStack(1)); } catch (InvalidBookException e) { player.sendMessage("Failed to create book!"); return; } player.sendMessage("Book downloaded!"); } else { } }
diff --git a/src/com/cyanogenmod/filemanager/ui/dialogs/InitialDirectoryDialog.java b/src/com/cyanogenmod/filemanager/ui/dialogs/InitialDirectoryDialog.java index 9e5e0e2..2761531 100644 --- a/src/com/cyanogenmod/filemanager/ui/dialogs/InitialDirectoryDialog.java +++ b/src/com/cyanogenmod/filemanager/ui/dialogs/InitialDirectoryDialog.java @@ -1,185 +1,185 @@ /* * Copyright (C) 2012 The CyanogenMod Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.cyanogenmod.filemanager.ui.dialogs; import android.app.AlertDialog; import android.content.Context; import android.content.DialogInterface; import android.util.Log; import android.view.LayoutInflater; import android.view.View; import android.widget.LinearLayout; import android.widget.Toast; import com.cyanogenmod.filemanager.R; import com.cyanogenmod.filemanager.preferences.FileManagerSettings; import com.cyanogenmod.filemanager.preferences.Preferences; import com.cyanogenmod.filemanager.ui.widgets.DirectoryInlineAutocompleteTextView; import com.cyanogenmod.filemanager.util.DialogHelper; import java.io.File; /** * A class that wraps a dialog for showing list of consoles for choosing one. * This class lets the user to set the default console. */ public class InitialDirectoryDialog implements DialogInterface.OnClickListener { /** * An interface to communicate events for value changing. */ public interface OnValueChangedListener { /** * Method invoked when the value of the initial directory was changed. * * @param newInitialDir The new initial directory */ void onValueChanged(String newInitialDir); } private static final String TAG = "InitialDirectoryDialog"; //$NON-NLS-1$ private final Context mContext; /** * @hide */ final AlertDialog mDialog; private final DirectoryInlineAutocompleteTextView mAutocomplete; private OnValueChangedListener mOnValueChangedListener; /** * Constructor of <code>InitialDirectoryDialog</code>. * * @param context The current context */ public InitialDirectoryDialog(Context context) { super(); //Save the context this.mContext = context; //Extract current value String value = Preferences.getSharedPreferences().getString( FileManagerSettings.SETTINGS_INITIAL_DIR.getId(), (String)FileManagerSettings.SETTINGS_INITIAL_DIR.getDefaultValue()); //Create the layout LayoutInflater li = (LayoutInflater)context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); LinearLayout layout = (LinearLayout)li.inflate(R.layout.initial_directory, null); final View msgView = layout.findViewById(R.id.initial_directory_info_msg); this.mAutocomplete = (DirectoryInlineAutocompleteTextView)layout.findViewById( R.id.initial_directory_edittext); this.mAutocomplete.setOnValidationListener( new DirectoryInlineAutocompleteTextView.OnValidationListener() { @Override public void onVoidValue() { msgView.setVisibility(View.GONE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(false); } } @Override public void onValidValue() { msgView.setVisibility(View.GONE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(true); } } @Override public void onInvalidValue() { msgView.setVisibility(View.VISIBLE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(false); } } }); this.mAutocomplete.setText(value); //Create the dialog this.mDialog = DialogHelper.createDialog( context, - R.drawable.ic_holo_light_home, + 0, R.string.initial_directory_dialog_title, layout); this.mDialog.setButton( DialogInterface.BUTTON_POSITIVE, context.getString(android.R.string.ok), this); this.mDialog.setButton( DialogInterface.BUTTON_NEGATIVE, context.getString(android.R.string.cancel), this); } /** * Method that set the listener for retrieve value changed events. * * @param onValueChangedListener The listener for retrieve value changed events */ public void setOnValueChangedListener(OnValueChangedListener onValueChangedListener) { this.mOnValueChangedListener = onValueChangedListener; } /** * Method that shows the dialog. */ public void show() { this.mDialog.show(); } /** * {@inheritDoc} */ @Override public void onClick(DialogInterface dialog, int which) { switch (which) { case DialogInterface.BUTTON_POSITIVE: done(); break; default: break; } } /** * Method invoked when the user press ok, or Enter key */ private void done() { //Check that the directory is a valid directory String newInitialDir = this.mAutocomplete.getText().toString(); try { if (!newInitialDir.endsWith(File.separator)) { newInitialDir += File.separator; } Preferences.savePreference( FileManagerSettings.SETTINGS_INITIAL_DIR, newInitialDir, true); if (this.mOnValueChangedListener != null) { this.mOnValueChangedListener.onValueChanged(newInitialDir); } } catch (Throwable ex) { Log.e(TAG, "The save initial directory setting operation fails", ex); //$NON-NLS-1$ DialogHelper.showToast( this.mContext, R.string.initial_directory_error_msg, Toast.LENGTH_LONG); } } }
true
true
public InitialDirectoryDialog(Context context) { super(); //Save the context this.mContext = context; //Extract current value String value = Preferences.getSharedPreferences().getString( FileManagerSettings.SETTINGS_INITIAL_DIR.getId(), (String)FileManagerSettings.SETTINGS_INITIAL_DIR.getDefaultValue()); //Create the layout LayoutInflater li = (LayoutInflater)context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); LinearLayout layout = (LinearLayout)li.inflate(R.layout.initial_directory, null); final View msgView = layout.findViewById(R.id.initial_directory_info_msg); this.mAutocomplete = (DirectoryInlineAutocompleteTextView)layout.findViewById( R.id.initial_directory_edittext); this.mAutocomplete.setOnValidationListener( new DirectoryInlineAutocompleteTextView.OnValidationListener() { @Override public void onVoidValue() { msgView.setVisibility(View.GONE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(false); } } @Override public void onValidValue() { msgView.setVisibility(View.GONE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(true); } } @Override public void onInvalidValue() { msgView.setVisibility(View.VISIBLE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(false); } } }); this.mAutocomplete.setText(value); //Create the dialog this.mDialog = DialogHelper.createDialog( context, R.drawable.ic_holo_light_home, R.string.initial_directory_dialog_title, layout); this.mDialog.setButton( DialogInterface.BUTTON_POSITIVE, context.getString(android.R.string.ok), this); this.mDialog.setButton( DialogInterface.BUTTON_NEGATIVE, context.getString(android.R.string.cancel), this); }
public InitialDirectoryDialog(Context context) { super(); //Save the context this.mContext = context; //Extract current value String value = Preferences.getSharedPreferences().getString( FileManagerSettings.SETTINGS_INITIAL_DIR.getId(), (String)FileManagerSettings.SETTINGS_INITIAL_DIR.getDefaultValue()); //Create the layout LayoutInflater li = (LayoutInflater)context.getSystemService(Context.LAYOUT_INFLATER_SERVICE); LinearLayout layout = (LinearLayout)li.inflate(R.layout.initial_directory, null); final View msgView = layout.findViewById(R.id.initial_directory_info_msg); this.mAutocomplete = (DirectoryInlineAutocompleteTextView)layout.findViewById( R.id.initial_directory_edittext); this.mAutocomplete.setOnValidationListener( new DirectoryInlineAutocompleteTextView.OnValidationListener() { @Override public void onVoidValue() { msgView.setVisibility(View.GONE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(false); } } @Override public void onValidValue() { msgView.setVisibility(View.GONE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(true); } } @Override public void onInvalidValue() { msgView.setVisibility(View.VISIBLE); //The first invocation is valid. Can be ignore safely if (InitialDirectoryDialog.this.mDialog != null) { InitialDirectoryDialog.this.mDialog.getButton( DialogInterface.BUTTON_POSITIVE).setEnabled(false); } } }); this.mAutocomplete.setText(value); //Create the dialog this.mDialog = DialogHelper.createDialog( context, 0, R.string.initial_directory_dialog_title, layout); this.mDialog.setButton( DialogInterface.BUTTON_POSITIVE, context.getString(android.R.string.ok), this); this.mDialog.setButton( DialogInterface.BUTTON_NEGATIVE, context.getString(android.R.string.cancel), this); }
diff --git a/Edge3.java b/Edge3.java index 60bc2e67..c0d116f9 100644 --- a/Edge3.java +++ b/Edge3.java @@ -1,253 +1,253 @@ package cs.threephase; import java.util.*; import java.io.*; import static cs.threephase.Util.*; import static cs.threephase.Moves.*; final class Edge3 implements Runnable { int[] edge = new int[12]; int[] temp; static int[] prun; final static int[][] edgex = { { 3, 0, 1, 2, 4, 5, 6, 7, 8, 9,10,11}, { 2, 3, 0, 1, 4, 5, 6, 7, 8, 9,10,11}, { 1, 2, 3, 0, 4, 5, 6, 7, 8, 9,10,11}, { 0, 1, 2, 7, 4, 5, 6, 3, 8, 9,11,10}, { 8, 1, 2, 3, 4, 5,11, 7, 6, 9,10, 0}, { 6, 1, 2, 3, 4, 5, 0, 7,11, 9,10, 8}, {11, 1, 2, 3, 4, 5, 8, 7, 0, 9,10, 6}, { 0, 1, 2, 3, 7, 4, 5, 6, 8, 9,10,11}, { 0, 1, 2, 3, 6, 7, 4, 5, 8, 9,10,11}, { 0, 1, 2, 3, 5, 6, 7, 4, 8, 9,10,11}, { 0, 5, 2, 3, 4, 1, 6, 7, 9, 8,10,11}, { 0, 1,10, 3, 9, 5, 6, 7, 8, 2, 4,11}, { 0, 1, 4, 3, 2, 5, 6, 7, 8,10, 9,11}, { 0, 1, 9, 3,10, 5, 6, 7, 8, 4, 2,11}, { 2, 3, 0, 1, 4, 5, 6, 7, 8,11,10, 9}, { 0, 1, 6, 7, 4, 5, 2, 3, 8, 9,11,10}, { 6, 1, 2, 5, 4, 3, 0, 7,11, 9,10, 8}, { 0, 1, 2, 3, 6, 7, 4, 5,10, 9, 8,11}, { 4, 5, 2, 3, 0, 1, 6, 7, 9, 8,10,11}, { 0, 7, 4, 3, 2, 5, 6, 1, 8,10, 9,11}}; final static int[][] edgeox = { { 1, 2, 3, 0, 4, 5, 6, 7, 8, 9,10,11}, { 2, 3, 0, 1, 4, 5, 6, 7, 8, 9,10,11}, { 3, 0, 1, 2, 4, 5, 6, 7, 8, 9,10,11}, { 0, 1, 2, 7, 4, 5, 6, 3, 8, 9,11,10}, {11, 1, 2, 3, 4, 5, 8, 7, 0, 9,10, 6}, { 6, 1, 2, 3, 4, 5, 0, 7,11, 9,10, 8}, { 8, 1, 2, 3, 4, 5,11, 7, 6, 9,10, 0}, { 0, 1, 2, 3, 5, 6, 7, 4, 8, 9,10,11}, { 0, 1, 2, 3, 6, 7, 4, 5, 8, 9,10,11}, { 0, 1, 2, 3, 7, 4, 5, 6, 8, 9,10,11}, { 0, 5, 2, 3, 4, 1, 6, 7, 9, 8,10,11}, { 0, 1, 9, 3,10, 5, 6, 7, 8, 4, 2,11}, { 0, 1, 4, 3, 2, 5, 6, 7, 8,10, 9,11}, { 0, 1,10, 3, 9, 5, 6, 7, 8, 2, 4,11}, { 2, 3, 0, 1, 4, 5, 6, 7,10, 9, 8,11}, { 4, 1, 2, 7, 0, 5, 6, 3, 8, 9,11,10}, { 6, 7, 2, 3, 4, 5, 0, 1,11, 9,10, 8}, { 0, 1, 2, 3, 6, 7, 4, 5, 8,11,10, 9}, { 0, 5, 6, 3, 4, 1, 2, 7, 9, 8,10,11}, { 0, 1, 4, 5, 2, 3, 6, 7, 8,10, 9,11}}; private static int[] fact = {19958400, 1814400, 181440, 20160, 2520, 360, 60, 12, 3, 1}; static int[] factX = {1, 1, 2/2, 6/2, 24/2, 120/2, 720/2, 5040/2, 40320/2, 362880/2, 3628800/2, 39916800/2, 479001600/2}; int idx = 0; final static int MOD = 12; static int doneMod = 1; static byte[] modedTable = new byte[12*11*10*9*8*7*6*5*4*3/MOD/2]; final static int SPLIT = 4; static int done = 0; static int depth = 0; static int depm3;// = depth % 3; static int depp3;// = 3 ^ ((depth+1) % 3); static boolean inv;// = depth > 10; static int check;// = inv ? 3 : depm3; static int found;// = inv ? depm3 : 3; public void run() { int offset = 239500800 / SPLIT * idx; int[] mvarr = new int[17]; for (int i=0; i<239500800 / SPLIT;) { int cx=prun[(i + offset)>>4]; if (cx == -1 && !inv) { i+=16; continue; } for (int j=i+16; i<j; i++, cx>>=2) { if ((cx & 3) == check) { this.set(i + offset); for (int m=0; m<17; m++) { mvarr[m] = getmv(this.edge, m); } synchronized (prun) { for (int m=0; m<17; m++) { getAndSet(mvarr[m], depp3); } } } } } } static void getAndSet(int index, int value) { int shift = (index & 0x0f) << 1, idx = index >> 4; if (((prun[idx] >> shift) & 3) == 3) { prun[idx] ^= value << shift; ++done; if (getPruning(modedTable, index/MOD) == 0xb) { setPruning(modedTable, index/MOD, depth+1); ++doneMod; } if ((done & 0x3ffff) == 0) { System.out.print(String.format("%5.2f%%\t%d\r", done / 897632.96, doneMod)); } } } static void createPrun() { System.out.println("Create Phase3 Edge Pruning Table..."); prun = new int[12*11*10*9*8*7*6*5*4*3/16]; - Arrays.fill(prun, (int)-1); + Arrays.fill(prun, -1); Arrays.fill(modedTable, (byte)0xbb); setPruning(modedTable, 0, 0); prun[0] = 0xfffffffc; for (depth=0; depth<10; depth++) { depm3 = depth % 3; depp3 = 3 ^ ((depth+1) % 3); inv = depth > 10; check = inv ? 3 : depm3; found = inv ? depm3 : 3; Edge3[] ts = new Edge3[SPLIT]; for (int i=0; i<SPLIT; i++) { ts[i] = new Edge3(); ts[i].idx = i; } Thread[] r = new Thread[SPLIT]; for (int i=0; i<SPLIT; i++) { r[i] = new Thread(ts[i]); r[i].start(); } for (int i=0; i<SPLIT; i++) { try { r[i].join(); } catch (Exception ea) { ea.printStackTrace(); } } System.out.println(String.format("%2d%10d%10d", depth+1, done, doneMod)); } prun = null; System.gc(); } static void setPruning(byte[] table, int index, int value) { table[index >> 1] ^= (0x0b ^ value) << ((index & 1) << 2); } static int getPruning(byte[] table, int index) { return (table[index >> 1] >> ((index & 1) << 2)) & 0x0f; } static int getprunmod(int edge) { return getPruning(modedTable, edge/MOD); } int set(EdgeCube c) { if (temp == null) { temp = new int[12]; } for (int i=0; i<12; i++) { temp[i] = i; edge[i] = c.ep[i+12]%12; } int parity = 0; for (int i=0; i<12; i++) { while (edge[i] != i) { int t = edge[i]; edge[i] = edge[t]; edge[t] = t; int s = temp[i]; temp[i] = temp[t]; temp[t] = s; parity ^= 1; } } for (int i=0; i<12; i++) { edge[i] = temp[c.ep[i]%12]; } return parity; } static int getmv(int[] ep, int mv) { int[] movo = edgeox[mv]; int[] mov = edgex[mv]; int idx = 0; long val = 0xba9876543210L; for (int i=0; i<10; i++) { int v = movo[ep[mov[i]]] << 2; idx *= 12-i; idx += (val >> v) & 0xf; val -= 0x111111111110L << v; } return idx; } static int[] movX = { 6,11, 0, 8, 2,10, 4, 9, 7, 3, 1, 5}; static int[] movoX ={ 2,10, 4, 9, 6,11, 0, 8, 3, 7, 5, 1}; int getmv_x() { int idx = 0; long val = 0xba9876543210L; for (int i=0; i<10; i++) { int v = movoX[edge[movX[i]]] << 2; idx *= 12-i; idx += (val >> v) & 0xf; val -= 0x111111111110L << v; } return idx; } int get() { int idx = 0; long val = 0xba9876543210L; for (int i=0; i<10; i++) { int v = edge[i] << 2; idx *= 12-i; idx += (val >> v) & 0xf; val -= 0x111111111110L << v; } return idx; } void set(int idx) { long val = 0xba9876543210L; int parity = 0; for (int i=0; i<11; i++) { int p = factX[11-i]; int v = idx / p; idx -= v*p; parity ^= v; v <<= 2; edge[i] = (int) ((val >> v) & 0xf); long m = (1L << v) - 1; val = (val & m) + ((val >> 4) & ~m); } if ((parity & 1) == 0) { edge[11] = (int)val; } else { edge[11] = edge[10]; edge[10] = (int)val; } } }
true
true
static void createPrun() { System.out.println("Create Phase3 Edge Pruning Table..."); prun = new int[12*11*10*9*8*7*6*5*4*3/16]; Arrays.fill(prun, (int)-1); Arrays.fill(modedTable, (byte)0xbb); setPruning(modedTable, 0, 0); prun[0] = 0xfffffffc; for (depth=0; depth<10; depth++) { depm3 = depth % 3; depp3 = 3 ^ ((depth+1) % 3); inv = depth > 10; check = inv ? 3 : depm3; found = inv ? depm3 : 3; Edge3[] ts = new Edge3[SPLIT]; for (int i=0; i<SPLIT; i++) { ts[i] = new Edge3(); ts[i].idx = i; } Thread[] r = new Thread[SPLIT]; for (int i=0; i<SPLIT; i++) { r[i] = new Thread(ts[i]); r[i].start(); } for (int i=0; i<SPLIT; i++) { try { r[i].join(); } catch (Exception ea) { ea.printStackTrace(); } } System.out.println(String.format("%2d%10d%10d", depth+1, done, doneMod)); } prun = null; System.gc(); }
static void createPrun() { System.out.println("Create Phase3 Edge Pruning Table..."); prun = new int[12*11*10*9*8*7*6*5*4*3/16]; Arrays.fill(prun, -1); Arrays.fill(modedTable, (byte)0xbb); setPruning(modedTable, 0, 0); prun[0] = 0xfffffffc; for (depth=0; depth<10; depth++) { depm3 = depth % 3; depp3 = 3 ^ ((depth+1) % 3); inv = depth > 10; check = inv ? 3 : depm3; found = inv ? depm3 : 3; Edge3[] ts = new Edge3[SPLIT]; for (int i=0; i<SPLIT; i++) { ts[i] = new Edge3(); ts[i].idx = i; } Thread[] r = new Thread[SPLIT]; for (int i=0; i<SPLIT; i++) { r[i] = new Thread(ts[i]); r[i].start(); } for (int i=0; i<SPLIT; i++) { try { r[i].join(); } catch (Exception ea) { ea.printStackTrace(); } } System.out.println(String.format("%2d%10d%10d", depth+1, done, doneMod)); } prun = null; System.gc(); }
diff --git a/TestNetworkTable/src/NetworkTablesDesktopClient.java b/TestNetworkTable/src/NetworkTablesDesktopClient.java index 4f7a4f9..1349a18 100644 --- a/TestNetworkTable/src/NetworkTablesDesktopClient.java +++ b/TestNetworkTable/src/NetworkTablesDesktopClient.java @@ -1,42 +1,42 @@ import edu.wpi.first.smartdashboard.robot.Robot; import edu.wpi.first.wpilibj.networktables.NetworkTable; import edu.wpi.first.wpilibj.networktables2.*; public class NetworkTablesDesktopClient { /** * @param args */ public static void main(String[] args) { new NetworkTablesDesktopClient(); NetworkTablesDesktopClient.run(); } static void run() { - NetworkTable.setTeam(2557); //sets our team number - NetworkTable table = (NetworkTable) Robot.getTable(); + NetworkTable.setIPAddress("10.25.57.2"); //sets our team number + NetworkTable table = NetworkTable.getTable("SmartDashboard"); while (true) { try { Thread.sleep(1000); } catch (InterruptedException e) { e.printStackTrace(); } table.putNumber("Q", 11); //puts the number "11" into a key called "Q" try { Thread.sleep(1000); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } System.out.println(table.getNumber("Q")); //Gets the value "Q" that we put in earlier } } }
true
true
static void run() { NetworkTable.setTeam(2557); //sets our team number NetworkTable table = (NetworkTable) Robot.getTable(); while (true) { try { Thread.sleep(1000); } catch (InterruptedException e) { e.printStackTrace(); } table.putNumber("Q", 11); //puts the number "11" into a key called "Q" try { Thread.sleep(1000); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } System.out.println(table.getNumber("Q")); //Gets the value "Q" that we put in earlier } }
static void run() { NetworkTable.setIPAddress("10.25.57.2"); //sets our team number NetworkTable table = NetworkTable.getTable("SmartDashboard"); while (true) { try { Thread.sleep(1000); } catch (InterruptedException e) { e.printStackTrace(); } table.putNumber("Q", 11); //puts the number "11" into a key called "Q" try { Thread.sleep(1000); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } System.out.println(table.getNumber("Q")); //Gets the value "Q" that we put in earlier } }
diff --git a/src/graphview/LineShape.java b/src/graphview/LineShape.java index eb188ee..9a86f8b 100644 --- a/src/graphview/LineShape.java +++ b/src/graphview/LineShape.java @@ -1,200 +1,200 @@ /* * To change this template, choose Tools | Templates * and open the template in the editor. */ package graphview; import geometry.Intersect; import geometry.Rect; import geometry.Vec2; import graphevents.ShapeMouseEvent; import java.awt.Color; import java.awt.Graphics2D; import java.util.ArrayList; /** * * @author Kirill */ public class LineShape extends BaseShape { protected BaseShape portNodeA=null; protected BaseShape portNodeB=null; protected ArrayList<BaseShape> points=new ArrayList<BaseShape>(); public LineShape(BaseShape portA, BaseShape portB) { portNodeA=portA; portNodeB=portB; bMoveable=false; bUnbodied=true; }; @Override public void draw(Graphics2D g) { g.setColor(color); if(bSelected) g.setColor(Color.red); Vec2 point=null; Vec2 point1=null; for(int i=0;i<getNumPointsWithPort()-1;i++) { point=getPointWithPort(i); point1=getPointWithPort(i+1); g.drawLine((int)point.x, (int)point.y, (int)point1.x, (int)point1.y); if(i==0) { g.fillOval((int)point.x-3, (int)point.y-3, 6, 6); } - else if(i==getNumPointsWithPort()-2) + if(i==getNumPointsWithPort()-2) { g.fillOval((int)point1.x-3, (int)point1.y-3, 6, 6); }; }; super.draw(g); return; } public void insertPoint(BaseShape shape, int index) { for(int i=0;i<points.size();i++) { if(points.get(i)==shape) return; }; points.add(index, shape); addChild(shape); }; public Vec2 getPoint(int index){ return points.get(index).getGlobalPosition(); } public void setPoint(Vec2 pt, int index){ points.get(index).setGlobalPosition(pt); update(); }; public int getNumPoints() { return points.size(); }; public Vec2 getPointWithPort(int index){ int offset=0; if(portNodeA!=null) offset=1; if(index==0) { if(portNodeA!=null) return getPortPointA(); }; if(index==(getNumPointsWithPort()-1)) { if(portNodeB!=null) return getPortPointB(); }; return points.get(index-offset).getGlobalPlacement().getCenter(); } public int getNumPointsWithPort() { int count=points.size(); if(portNodeA!=null) count++; if(portNodeB!=null) count++; return count; }; public void setPortA(BaseShape shape){ portNodeA=shape; update(); } public void setPortB(BaseShape shape){ portNodeB=shape; update(); } public Vec2 getPortPointA(){ Vec2 point; Vec2 portA; if(getNumPoints()==0) { if(portNodeB!=null) point=portNodeB.getGlobalPlacement().getCenter(); else return new Vec2(); } else point=points.get(0).getGlobalPlacement().getCenter(); if(portNodeA!=null) portA=portNodeA.getPortPoint(point); else portA=point; return portA; } public Vec2 getPortPointB(){ Vec2 point; Vec2 portB; if(getNumPoints()==0) { if(portNodeA!=null) point=portNodeA.getGlobalPlacement().getCenter(); else return new Vec2(); } else point=points.get(points.size()-1).getGlobalPlacement().getCenter(); if(portNodeB!=null) portB=portNodeB.getPortPoint(point); else portB=point; return portB; } @Override public boolean onMouseClick(ShapeMouseEvent evt){ if(evt.getButton()==1 && evt.getIntersectedChild()==-1 && isIntersects(evt.getPosition())) { boolean bSel=bSelected; clearSelection(); setSelected(!bSel); return true; } return false; } @Override public boolean isIntersects(Vec2 pt) { if(testChildIntersect(pt)!=-1) return true; Vec2 point=null; Vec2 point1=null; for(int i=0;i<getNumPointsWithPort()-1;i++) { point=getPointWithPort(i); point1=getPointWithPort(i+1); if(Intersect.lineseg_point(point, point1, 5,pt)==Intersect.INCLUSION) return true; }; return false; } @Override public boolean isIntersects(Rect r) { return false; } @Override public Vec2 getPortPoint(Vec2 from) { return null; } }
true
true
public void draw(Graphics2D g) { g.setColor(color); if(bSelected) g.setColor(Color.red); Vec2 point=null; Vec2 point1=null; for(int i=0;i<getNumPointsWithPort()-1;i++) { point=getPointWithPort(i); point1=getPointWithPort(i+1); g.drawLine((int)point.x, (int)point.y, (int)point1.x, (int)point1.y); if(i==0) { g.fillOval((int)point.x-3, (int)point.y-3, 6, 6); } else if(i==getNumPointsWithPort()-2) { g.fillOval((int)point1.x-3, (int)point1.y-3, 6, 6); }; }; super.draw(g); return; }
public void draw(Graphics2D g) { g.setColor(color); if(bSelected) g.setColor(Color.red); Vec2 point=null; Vec2 point1=null; for(int i=0;i<getNumPointsWithPort()-1;i++) { point=getPointWithPort(i); point1=getPointWithPort(i+1); g.drawLine((int)point.x, (int)point.y, (int)point1.x, (int)point1.y); if(i==0) { g.fillOval((int)point.x-3, (int)point.y-3, 6, 6); } if(i==getNumPointsWithPort()-2) { g.fillOval((int)point1.x-3, (int)point1.y-3, 6, 6); }; }; super.draw(g); return; }
diff --git a/src/main/java/com/laurinka/skga/server/data/SearchProducer.java b/src/main/java/com/laurinka/skga/server/data/SearchProducer.java index 8e5b652..e21a9f7 100644 --- a/src/main/java/com/laurinka/skga/server/data/SearchProducer.java +++ b/src/main/java/com/laurinka/skga/server/data/SearchProducer.java @@ -1,152 +1,150 @@ package com.laurinka.skga.server.data; import com.laurinka.skga.server.model.Result; import com.laurinka.skga.server.model.Snapshot; import com.laurinka.skga.server.rest.CgfMemberResourceRESTService; import com.laurinka.skga.server.rest.SearchCgfResourceRESTService; import com.laurinka.skga.server.rest.SearchMemberResourceRESTService; import com.laurinka.skga.server.rest.SkgaMemberResourceRESTService; import com.laurinka.skga.server.rest.model.Hcp; import com.laurinka.skga.server.rest.model.NameNumberXml; import com.laurinka.skga.server.scratch.CgfGolferNumber; import com.laurinka.skga.server.scratch.SkgaGolferNumber; import com.laurinka.skga.server.services.WebsiteService; import javax.annotation.PostConstruct; import javax.enterprise.context.RequestScoped; import javax.enterprise.inject.Produces; import javax.inject.Inject; import javax.inject.Named; import javax.persistence.EntityManager; import javax.ws.rs.WebApplicationException; import java.util.Collections; import java.util.LinkedList; import java.util.List; import java.util.logging.Logger; import java.util.regex.Pattern; @RequestScoped @Named("search") public class SearchProducer { static Pattern number = Pattern.compile("\\d{1,7}"); @Inject private EntityManager em; @Inject private WebsiteService service; @Inject Logger log; @Inject SkgaMemberResourceRESTService skga; @Inject CgfMemberResourceRESTService cgf; private List<Snapshot> results; private String q; @Inject SearchCgfResourceRESTService cgfSearch; @Inject SearchMemberResourceRESTService skSearch; @Produces @Named public List<Snapshot> getResults() { return results; } @PostConstruct public void retrieveLastSnapshotsOrderedByName() { if (null == q || q.isEmpty()) { log.info("search string is empty!"); results = Collections.emptyList(); return; } if (number.matcher(q).matches()) { log.info("User entered number on page:" + q); //search by number Result detailSk = service.findDetail(new SkgaGolferNumber(q)); Result detailCz = service.findDetail(new CgfGolferNumber(q)); if (null == detailCz && null == detailSk) { log.info("Nothing found."); results = Collections.emptyList(); return; } results = new LinkedList<Snapshot>(); if (detailSk != null) { log.info("Found sk:" + detailSk.toString()); Snapshot sk = new Snapshot(); sk.setResult(detailSk); results.add(sk); } if (detailCz != null) { log.info("Found cz: " + detailCz.toString()); Snapshot cz = new Snapshot(); cz.setResult(detailCz); results.add(cz); } return; } else { results = new LinkedList<Snapshot>(); List<NameNumberXml> czs = cgfSearch.lookupMemberByName(q); for (NameNumberXml n : czs) { log.info("Query cgf: " + n.getNumber()); Hcp hcp = null; try { hcp = cgf.lookupMemberById(n.getNumber()); } catch (WebApplicationException e) { log.warning(e.getLocalizedMessage()); continue; } Snapshot s = new Snapshot(); Result result = Result.newCgf(); result.setClub(hcp.getClub()); result.setHcp(hcp.getHandicap()); result.setName(hcp.getName()); result.setSkgaNr(hcp.getNumber()); s.setResult(result); results.add(s); } List<NameNumberXml> sks = skSearch.lookupMemberByName(q); for (NameNumberXml n : sks) { log.info("Query skga: " + n.getNumber()); Hcp hcp = null; try { hcp = cgf.lookupMemberById(n.getNumber()); } catch (WebApplicationException e) { log.warning(e.getLocalizedMessage()); continue; } Snapshot s = new Snapshot(); Result result = Result.newSkga(); result.setClub(hcp.getClub()); result.setHcp(hcp.getHandicap()); result.setName(hcp.getName()); result.setSkgaNr(hcp.getNumber()); s.setResult(result); results.add(s); } - // search by name - results = Collections.emptyList(); - } + } } public String getQ() { return q; } public void setQ(String q) { this.q = q; } public void setService(WebsiteService service) { this.service = service; } }
true
true
public void retrieveLastSnapshotsOrderedByName() { if (null == q || q.isEmpty()) { log.info("search string is empty!"); results = Collections.emptyList(); return; } if (number.matcher(q).matches()) { log.info("User entered number on page:" + q); //search by number Result detailSk = service.findDetail(new SkgaGolferNumber(q)); Result detailCz = service.findDetail(new CgfGolferNumber(q)); if (null == detailCz && null == detailSk) { log.info("Nothing found."); results = Collections.emptyList(); return; } results = new LinkedList<Snapshot>(); if (detailSk != null) { log.info("Found sk:" + detailSk.toString()); Snapshot sk = new Snapshot(); sk.setResult(detailSk); results.add(sk); } if (detailCz != null) { log.info("Found cz: " + detailCz.toString()); Snapshot cz = new Snapshot(); cz.setResult(detailCz); results.add(cz); } return; } else { results = new LinkedList<Snapshot>(); List<NameNumberXml> czs = cgfSearch.lookupMemberByName(q); for (NameNumberXml n : czs) { log.info("Query cgf: " + n.getNumber()); Hcp hcp = null; try { hcp = cgf.lookupMemberById(n.getNumber()); } catch (WebApplicationException e) { log.warning(e.getLocalizedMessage()); continue; } Snapshot s = new Snapshot(); Result result = Result.newCgf(); result.setClub(hcp.getClub()); result.setHcp(hcp.getHandicap()); result.setName(hcp.getName()); result.setSkgaNr(hcp.getNumber()); s.setResult(result); results.add(s); } List<NameNumberXml> sks = skSearch.lookupMemberByName(q); for (NameNumberXml n : sks) { log.info("Query skga: " + n.getNumber()); Hcp hcp = null; try { hcp = cgf.lookupMemberById(n.getNumber()); } catch (WebApplicationException e) { log.warning(e.getLocalizedMessage()); continue; } Snapshot s = new Snapshot(); Result result = Result.newSkga(); result.setClub(hcp.getClub()); result.setHcp(hcp.getHandicap()); result.setName(hcp.getName()); result.setSkgaNr(hcp.getNumber()); s.setResult(result); results.add(s); } // search by name results = Collections.emptyList(); } }
public void retrieveLastSnapshotsOrderedByName() { if (null == q || q.isEmpty()) { log.info("search string is empty!"); results = Collections.emptyList(); return; } if (number.matcher(q).matches()) { log.info("User entered number on page:" + q); //search by number Result detailSk = service.findDetail(new SkgaGolferNumber(q)); Result detailCz = service.findDetail(new CgfGolferNumber(q)); if (null == detailCz && null == detailSk) { log.info("Nothing found."); results = Collections.emptyList(); return; } results = new LinkedList<Snapshot>(); if (detailSk != null) { log.info("Found sk:" + detailSk.toString()); Snapshot sk = new Snapshot(); sk.setResult(detailSk); results.add(sk); } if (detailCz != null) { log.info("Found cz: " + detailCz.toString()); Snapshot cz = new Snapshot(); cz.setResult(detailCz); results.add(cz); } return; } else { results = new LinkedList<Snapshot>(); List<NameNumberXml> czs = cgfSearch.lookupMemberByName(q); for (NameNumberXml n : czs) { log.info("Query cgf: " + n.getNumber()); Hcp hcp = null; try { hcp = cgf.lookupMemberById(n.getNumber()); } catch (WebApplicationException e) { log.warning(e.getLocalizedMessage()); continue; } Snapshot s = new Snapshot(); Result result = Result.newCgf(); result.setClub(hcp.getClub()); result.setHcp(hcp.getHandicap()); result.setName(hcp.getName()); result.setSkgaNr(hcp.getNumber()); s.setResult(result); results.add(s); } List<NameNumberXml> sks = skSearch.lookupMemberByName(q); for (NameNumberXml n : sks) { log.info("Query skga: " + n.getNumber()); Hcp hcp = null; try { hcp = cgf.lookupMemberById(n.getNumber()); } catch (WebApplicationException e) { log.warning(e.getLocalizedMessage()); continue; } Snapshot s = new Snapshot(); Result result = Result.newSkga(); result.setClub(hcp.getClub()); result.setHcp(hcp.getHandicap()); result.setName(hcp.getName()); result.setSkgaNr(hcp.getNumber()); s.setResult(result); results.add(s); } } }
diff --git a/src/com/android/camera/PhotoModule.java b/src/com/android/camera/PhotoModule.java index 0ab6bd596..53fb46058 100644 --- a/src/com/android/camera/PhotoModule.java +++ b/src/com/android/camera/PhotoModule.java @@ -1,2291 +1,2283 @@ /* * Copyright (C) 2012 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.android.camera; import android.annotation.TargetApi; import android.app.Activity; import android.app.AlertDialog; import android.content.ContentProviderClient; import android.content.ContentResolver; import android.content.Context; import android.content.DialogInterface; import android.content.Intent; import android.content.SharedPreferences.Editor; import android.content.res.Configuration; import android.graphics.Bitmap; import android.graphics.BitmapFactory; import android.graphics.Matrix; import android.graphics.SurfaceTexture; import android.hardware.Camera.CameraInfo; import android.hardware.Camera.Parameters; import android.hardware.Camera.PictureCallback; import android.hardware.Camera.Size; import android.hardware.Sensor; import android.hardware.SensorEvent; import android.hardware.SensorEventListener; import android.hardware.SensorManager; import android.location.Location; import android.media.CameraProfile; import android.net.Uri; import android.os.Bundle; import android.os.ConditionVariable; import android.os.Handler; import android.os.Looper; import android.os.Message; import android.os.MessageQueue; import android.os.SystemClock; import android.provider.MediaStore; import android.util.Log; import android.view.KeyEvent; import android.view.MotionEvent; import android.view.OrientationEventListener; import android.view.SurfaceHolder; import android.view.View; import android.view.WindowManager; import com.android.camera.CameraManager.CameraProxy; import com.android.camera.ui.CountDownView.OnCountDownFinishedListener; import com.android.camera.ui.PopupManager; import com.android.camera.ui.RotateTextToast; import com.android.gallery3d.R; import com.android.gallery3d.common.ApiHelper; import com.android.gallery3d.exif.ExifInterface; import com.android.gallery3d.exif.ExifTag; import com.android.gallery3d.exif.Rational; import com.android.gallery3d.filtershow.FilterShowActivity; import com.android.gallery3d.filtershow.crop.CropExtras; import com.android.gallery3d.util.UsageStatistics; import java.io.ByteArrayOutputStream; import java.io.File; import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import java.io.OutputStream; import java.util.ArrayList; import java.util.Collections; import java.util.Formatter; import java.util.List; import java.util.TimeZone; public class PhotoModule implements CameraModule, PhotoController, FocusOverlayManager.Listener, CameraPreference.OnPreferenceChangedListener, ShutterButton.OnShutterButtonListener, MediaSaveService.Listener, OnCountDownFinishedListener, SensorEventListener { private static final String TAG = "CAM_PhotoModule"; private boolean mRestartPreview = false; private boolean mAspectRatioChanged = false; // We number the request code from 1000 to avoid collision with Gallery. private static final int REQUEST_CROP = 1000; private static final int SETUP_PREVIEW = 1; private static final int FIRST_TIME_INIT = 2; private static final int CLEAR_SCREEN_DELAY = 3; private static final int SET_CAMERA_PARAMETERS_WHEN_IDLE = 4; private static final int CHECK_DISPLAY_ROTATION = 5; private static final int SHOW_TAP_TO_FOCUS_TOAST = 6; private static final int SWITCH_CAMERA = 7; private static final int SWITCH_CAMERA_START_ANIMATION = 8; private static final int CAMERA_OPEN_DONE = 9; private static final int START_PREVIEW_DONE = 10; private static final int OPEN_CAMERA_FAIL = 11; private static final int CAMERA_DISABLED = 12; private static final int CAPTURE_ANIMATION_DONE = 13; private static final int SET_PHOTO_UI_PARAMS = 15; // The subset of parameters we need to update in setCameraParameters(). private static final int UPDATE_PARAM_INITIALIZE = 1; private static final int UPDATE_PARAM_ZOOM = 2; private static final int UPDATE_PARAM_PREFERENCE = 4; private static final int UPDATE_PARAM_ALL = -1; // This is the timeout to keep the camera in onPause for the first time // after screen on if the activity is started from secure lock screen. private static final int KEEP_CAMERA_TIMEOUT = 1000; // ms // copied from Camera hierarchy private CameraActivity mActivity; private CameraProxy mCameraDevice; private int mCameraId; private Parameters mParameters; private boolean mPaused; private PhotoUI mUI; // these are only used by Camera // The activity is going to switch to the specified camera id. This is // needed because texture copy is done in GL thread. -1 means camera is not // switching. protected int mPendingSwitchCameraId = -1; private boolean mOpenCameraFail; private boolean mCameraDisabled; // When setCameraParametersWhenIdle() is called, we accumulate the subsets // needed to be updated in mUpdateSet. private int mUpdateSet; private static final int SCREEN_DELAY = 2 * 60 * 1000; private int mZoomValue; // The current zoom value. private Parameters mInitialParams; private boolean mFocusAreaSupported; private boolean mMeteringAreaSupported; private boolean mAeLockSupported; private boolean mAwbLockSupported; private boolean mContinousFocusSupported; // The degrees of the device rotated clockwise from its natural orientation. private int mOrientation = OrientationEventListener.ORIENTATION_UNKNOWN; private ComboPreferences mPreferences; private static final String sTempCropFilename = "crop-temp"; private ContentProviderClient mMediaProviderClient; private ShutterButton mShutterButton; private boolean mFaceDetectionStarted = false; // mCropValue and mSaveUri are used only if isImageCaptureIntent() is true. private String mCropValue; private Uri mSaveUri; // We use a queue to generated names of the images to be used later // when the image is ready to be saved. private NamedImages mNamedImages; private Runnable mDoSnapRunnable = new Runnable() { @Override public void run() { onShutterButtonClick(); } }; private Runnable mFlashRunnable = new Runnable() { @Override public void run() { animateFlash(); } }; private final StringBuilder mBuilder = new StringBuilder(); private final Formatter mFormatter = new Formatter(mBuilder); private final Object[] mFormatterArgs = new Object[1]; /** * An unpublished intent flag requesting to return as soon as capturing * is completed. * * TODO: consider publishing by moving into MediaStore. */ private static final String EXTRA_QUICK_CAPTURE = "android.intent.extra.quickCapture"; // The display rotation in degrees. This is only valid when mCameraState is // not PREVIEW_STOPPED. private int mDisplayRotation; // The value for android.hardware.Camera.setDisplayOrientation. private int mCameraDisplayOrientation; // The value for UI components like indicators. private int mDisplayOrientation; // The value for android.hardware.Camera.Parameters.setRotation. private int mJpegRotation; private boolean mFirstTimeInitialized; private boolean mIsImageCaptureIntent; private int mCameraState = PREVIEW_STOPPED; private boolean mSnapshotOnIdle = false; private ContentResolver mContentResolver; private LocationManager mLocationManager; private final PostViewPictureCallback mPostViewPictureCallback = new PostViewPictureCallback(); private final RawPictureCallback mRawPictureCallback = new RawPictureCallback(); private final AutoFocusCallback mAutoFocusCallback = new AutoFocusCallback(); private final Object mAutoFocusMoveCallback = ApiHelper.HAS_AUTO_FOCUS_MOVE_CALLBACK ? new AutoFocusMoveCallback() : null; private final CameraErrorCallback mErrorCallback = new CameraErrorCallback(); private long mFocusStartTime; private long mShutterCallbackTime; private long mPostViewPictureCallbackTime; private long mRawPictureCallbackTime; private long mJpegPictureCallbackTime; private long mOnResumeTime; private byte[] mJpegImageData; // These latency time are for the CameraLatency test. public long mAutoFocusTime; public long mShutterLag; public long mShutterToPictureDisplayedTime; public long mPictureDisplayedToJpegCallbackTime; public long mJpegCallbackFinishTime; public long mCaptureStartTime; // This handles everything about focus. private FocusOverlayManager mFocusManager; private String mSceneMode; private final Handler mHandler = new MainHandler(); private PreferenceGroup mPreferenceGroup; private boolean mQuickCapture; CameraStartUpThread mCameraStartUpThread; ConditionVariable mStartPreviewPrerequisiteReady = new ConditionVariable(); private SensorManager mSensorManager; private float[] mGData = new float[3]; private float[] mMData = new float[3]; private float[] mR = new float[16]; private int mHeading = -1; private MediaSaveService.OnMediaSavedListener mOnMediaSavedListener = new MediaSaveService.OnMediaSavedListener() { @Override public void onMediaSaved(Uri uri) { if (uri != null) { mActivity.addSecureAlbumItemIfNeeded(false, uri); Util.broadcastNewPicture(mActivity, uri); } } }; // The purpose is not to block the main thread in onCreate and onResume. private class CameraStartUpThread extends Thread { private volatile boolean mCancelled; public void cancel() { mCancelled = true; interrupt(); } public boolean isCanceled() { return mCancelled; } @Override public void run() { try { // We need to check whether the activity is paused before long // operations to ensure that onPause() can be done ASAP. if (mCancelled) return; mCameraDevice = Util.openCamera(mActivity, mCameraId); mParameters = mCameraDevice.getParameters(); // Wait until all the initialization needed by startPreview are // done. mStartPreviewPrerequisiteReady.block(); initializeCapabilities(); if (mFocusManager == null) initializeFocusManager(); if (mCancelled) return; setCameraParameters(UPDATE_PARAM_ALL); mHandler.sendEmptyMessage(CAMERA_OPEN_DONE); if (mCancelled) return; startPreview(); mHandler.sendEmptyMessage(START_PREVIEW_DONE); mOnResumeTime = SystemClock.uptimeMillis(); mHandler.sendEmptyMessage(CHECK_DISPLAY_ROTATION); } catch (CameraHardwareException e) { mHandler.sendEmptyMessage(OPEN_CAMERA_FAIL); } catch (CameraDisabledException e) { mHandler.sendEmptyMessage(CAMERA_DISABLED); } } } /** * This Handler is used to post message back onto the main thread of the * application */ private class MainHandler extends Handler { @Override public void handleMessage(Message msg) { switch (msg.what) { case SETUP_PREVIEW: { setupPreview(); break; } case CLEAR_SCREEN_DELAY: { mActivity.getWindow().clearFlags( WindowManager.LayoutParams.FLAG_KEEP_SCREEN_ON); break; } case FIRST_TIME_INIT: { initializeFirstTime(); break; } case SET_CAMERA_PARAMETERS_WHEN_IDLE: { setCameraParametersWhenIdle(0); break; } case CHECK_DISPLAY_ROTATION: { // Set the display orientation if display rotation has changed. // Sometimes this happens when the device is held upside // down and camera app is opened. Rotation animation will // take some time and the rotation value we have got may be // wrong. Framework does not have a callback for this now. if (Util.getDisplayRotation(mActivity) != mDisplayRotation) { setDisplayOrientation(); } if (SystemClock.uptimeMillis() - mOnResumeTime < 5000) { mHandler.sendEmptyMessageDelayed(CHECK_DISPLAY_ROTATION, 100); } break; } case SHOW_TAP_TO_FOCUS_TOAST: { showTapToFocusToast(); break; } case SWITCH_CAMERA: { switchCamera(); break; } case SWITCH_CAMERA_START_ANIMATION: { ((CameraScreenNail) mActivity.mCameraScreenNail).animateSwitchCamera(); break; } case CAMERA_OPEN_DONE: { onCameraOpened(); break; } case START_PREVIEW_DONE: { onPreviewStarted(); break; } case OPEN_CAMERA_FAIL: { mCameraStartUpThread = null; mOpenCameraFail = true; Util.showErrorAndFinish(mActivity, R.string.cannot_connect_camera); break; } case CAMERA_DISABLED: { mCameraStartUpThread = null; mCameraDisabled = true; Util.showErrorAndFinish(mActivity, R.string.camera_disabled); break; } case CAPTURE_ANIMATION_DONE: { mUI.enablePreviewThumb(false); break; } case SET_PHOTO_UI_PARAMS: { setCameraParametersWhenIdle(UPDATE_PARAM_PREFERENCE); resizeForPreviewAspectRatio(); mUI.updateOnScreenIndicators(mParameters, mPreferenceGroup, mPreferences); break; } } } } @Override public void init(CameraActivity activity, View parent, boolean reuseNail) { mActivity = activity; mUI = new PhotoUI(activity, this, parent); mPreferences = new ComboPreferences(mActivity); CameraSettings.upgradeGlobalPreferences(mPreferences.getGlobal()); mCameraId = getPreferredCameraId(mPreferences); mContentResolver = mActivity.getContentResolver(); // To reduce startup time, open the camera and start the preview in // another thread. mCameraStartUpThread = new CameraStartUpThread(); mCameraStartUpThread.start(); // Surface texture is from camera screen nail and startPreview needs it. // This must be done before startPreview. mIsImageCaptureIntent = isImageCaptureIntent(); if (reuseNail) { mActivity.reuseCameraScreenNail(!mIsImageCaptureIntent); } else { mActivity.createCameraScreenNail(!mIsImageCaptureIntent); } mPreferences.setLocalId(mActivity, mCameraId); CameraSettings.upgradeLocalPreferences(mPreferences.getLocal()); mActivity.setStoragePath(mPreferences); // we need to reset exposure for the preview resetExposureCompensation(); // Starting the preview needs preferences, camera screen nail, and // focus area indicator. mStartPreviewPrerequisiteReady.open(); initializeControlByIntent(); mQuickCapture = mActivity.getIntent().getBooleanExtra(EXTRA_QUICK_CAPTURE, false); mLocationManager = new LocationManager(mActivity, mUI); mSensorManager = (SensorManager)(mActivity.getSystemService(Context.SENSOR_SERVICE)); } private void initializeControlByIntent() { mUI.initializeControlByIntent(); if (mIsImageCaptureIntent) { setupCaptureParams(); } } private void onPreviewStarted() { mCameraStartUpThread = null; setCameraState(IDLE); if (!ApiHelper.HAS_SURFACE_TEXTURE) { // This may happen if surfaceCreated has arrived. mCameraDevice.setPreviewDisplayAsync(mUI.getSurfaceHolder()); } startFaceDetection(); locationFirstRun(); } // Prompt the user to pick to record location for the very first run of // camera only private void locationFirstRun() { if (RecordLocationPreference.isSet(mPreferences)) { return; } if (mActivity.isSecureCamera()) return; // Check if the back camera exists int backCameraId = CameraHolder.instance().getBackCameraId(); if (backCameraId == -1) { // If there is no back camera, do not show the prompt. return; } new AlertDialog.Builder(mActivity) .setTitle(R.string.remember_location_title) .setMessage(R.string.remember_location_prompt) .setPositiveButton(R.string.remember_location_yes, new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int arg1) { setLocationPreference(RecordLocationPreference.VALUE_ON); } }) .setNegativeButton(R.string.remember_location_no, new DialogInterface.OnClickListener() { @Override public void onClick(DialogInterface dialog, int arg1) { dialog.cancel(); } }) .setOnCancelListener(new DialogInterface.OnCancelListener() { @Override public void onCancel(DialogInterface dialog) { setLocationPreference(RecordLocationPreference.VALUE_OFF); } }) .show(); } private void setLocationPreference(String value) { mPreferences.edit() .putString(CameraSettings.KEY_RECORD_LOCATION, value) .apply(); // TODO: Fix this to use the actual onSharedPreferencesChanged listener // instead of invoking manually onSharedPreferenceChanged(); } private void onCameraOpened() { View root = mUI.getRootView(); // These depend on camera parameters. int width = mUI.mPreviewFrameLayout.getWidth(); int height = mUI.mPreviewFrameLayout.getHeight(); openCameraCommon(); resizeForPreviewAspectRatio(); mFocusManager.setPreviewSize(width, height); // Full-screen screennail if (Util.getDisplayRotation(mActivity) % 180 == 0) { ((CameraScreenNail) mActivity.mCameraScreenNail).setPreviewFrameLayoutSize(width, height); } else { ((CameraScreenNail) mActivity.mCameraScreenNail).setPreviewFrameLayoutSize(height, width); } // Set touch focus listener. mActivity.setSingleTapUpListener(root); onFullScreenChanged(mActivity.isInCameraApp()); } private void switchCamera() { if (mPaused) return; Log.v(TAG, "Start to switch camera. id=" + mPendingSwitchCameraId); mCameraId = mPendingSwitchCameraId; mPendingSwitchCameraId = -1; setCameraId(mCameraId); // from onPause closeCamera(); mUI.collapseCameraControls(); mUI.clearFaces(); if (mFocusManager != null) mFocusManager.removeMessages(); // Restart the camera and initialize the UI. From onCreate. mPreferences.setLocalId(mActivity, mCameraId); CameraSettings.upgradeLocalPreferences(mPreferences.getLocal()); try { mCameraDevice = Util.openCamera(mActivity, mCameraId); mParameters = mCameraDevice.getParameters(); } catch (CameraHardwareException e) { Util.showErrorAndFinish(mActivity, R.string.cannot_connect_camera); return; } catch (CameraDisabledException e) { Util.showErrorAndFinish(mActivity, R.string.camera_disabled); return; } initializeCapabilities(); CameraInfo info = CameraHolder.instance().getCameraInfo()[mCameraId]; boolean mirror = (info.facing == CameraInfo.CAMERA_FACING_FRONT); mFocusManager.setMirror(mirror); mFocusManager.setParameters(mInitialParams); setupPreview(); resizeForPreviewAspectRatio(); openCameraCommon(); if (ApiHelper.HAS_SURFACE_TEXTURE) { // Start switch camera animation. Post a message because // onFrameAvailable from the old camera may already exist. mHandler.sendEmptyMessage(SWITCH_CAMERA_START_ANIMATION); } } protected void setCameraId(int cameraId) { ListPreference pref = mPreferenceGroup.findPreference(CameraSettings.KEY_CAMERA_ID); pref.setValue("" + cameraId); } // either open a new camera or switch cameras private void openCameraCommon() { loadCameraPreferences(); mUI.onCameraOpened(mPreferenceGroup, mPreferences, mParameters, this); updateSceneMode(); showTapToFocusToastIfNeeded(); } public void onScreenSizeChanged(int width, int height, int previewWidth, int previewHeight) { Log.d(TAG, "Preview size changed."); if (mFocusManager != null) mFocusManager.setPreviewSize(width, height); ((CameraScreenNail) mActivity.mCameraScreenNail).setPreviewFrameLayoutSize( previewWidth, previewHeight); mActivity.notifyScreenNailChanged(); } private void resetExposureCompensation() { String value = mPreferences.getString(CameraSettings.KEY_EXPOSURE, CameraSettings.EXPOSURE_DEFAULT_VALUE); if (!CameraSettings.EXPOSURE_DEFAULT_VALUE.equals(value)) { Editor editor = mPreferences.edit(); editor.putString(CameraSettings.KEY_EXPOSURE, "0"); editor.apply(); } } private void keepMediaProviderInstance() { // We want to keep a reference to MediaProvider in camera's lifecycle. // TODO: Utilize mMediaProviderClient instance to replace // ContentResolver calls. if (mMediaProviderClient == null) { mMediaProviderClient = mContentResolver .acquireContentProviderClient(MediaStore.AUTHORITY); } } // Snapshots can only be taken after this is called. It should be called // once only. We could have done these things in onCreate() but we want to // make preview screen appear as soon as possible. private void initializeFirstTime() { if (mFirstTimeInitialized) return; // Initialize location service. boolean recordLocation = RecordLocationPreference.get( mPreferences, mContentResolver); mLocationManager.recordLocation(recordLocation); keepMediaProviderInstance(); mShutterButton = mActivity.getShutterButton(); mUI.initializeFirstTime(); MediaSaveService s = mActivity.getMediaSaveService(); // We set the listener only when both service and shutterbutton // are initialized. if (s != null) { s.setListener(this); } mNamedImages = new NamedImages(); mFirstTimeInitialized = true; addIdleHandler(); mActivity.updateStorageSpaceAndHint(); } // If the activity is paused and resumed, this method will be called in // onResume. private void initializeSecondTime() { // Start location update if needed. boolean recordLocation = RecordLocationPreference.get( mPreferences, mContentResolver); mLocationManager.recordLocation(recordLocation); MediaSaveService s = mActivity.getMediaSaveService(); if (s != null) { s.setListener(this); } mNamedImages = new NamedImages(); mUI.initializeSecondTime(mParameters); keepMediaProviderInstance(); } @Override public void onSurfaceCreated(SurfaceHolder holder) { // Do not access the camera if camera start up thread is not finished. if (mCameraDevice == null || mCameraStartUpThread != null) return; mCameraDevice.setPreviewDisplayAsync(holder); // This happens when onConfigurationChanged arrives, surface has been // destroyed, and there is no onFullScreenChanged. if (mCameraState == PREVIEW_STOPPED) { setupPreview(); } } private void showTapToFocusToastIfNeeded() { // Show the tap to focus toast if this is the first start. if (mFocusAreaSupported && mPreferences.getBoolean(CameraSettings.KEY_CAMERA_FIRST_USE_HINT_SHOWN, true)) { // Delay the toast for one second to wait for orientation. mHandler.sendEmptyMessageDelayed(SHOW_TAP_TO_FOCUS_TOAST, 1000); } } private void addIdleHandler() { MessageQueue queue = Looper.myQueue(); queue.addIdleHandler(new MessageQueue.IdleHandler() { @Override public boolean queueIdle() { Storage.getInstance().ensureOSXCompatible(); return false; } }); } @TargetApi(ApiHelper.VERSION_CODES.ICE_CREAM_SANDWICH) @Override public void startFaceDetection() { if (!ApiHelper.HAS_FACE_DETECTION) return; CameraInfo info = CameraHolder.instance().getCameraInfo()[mCameraId]; // Workaround for a buggy camera library if (Util.noFaceDetectOnFrontCamera() && info.facing == CameraInfo.CAMERA_FACING_FRONT) { return; } if (mFaceDetectionStarted || mCameraState != IDLE) return; if (mParameters.getMaxNumDetectedFaces() > 0) { mFaceDetectionStarted = true; mUI.onStartFaceDetection(mDisplayOrientation, (info.facing == CameraInfo.CAMERA_FACING_FRONT)); mCameraDevice.setFaceDetectionListener(mUI); mCameraDevice.startFaceDetection(); } } @TargetApi(ApiHelper.VERSION_CODES.ICE_CREAM_SANDWICH) @Override public void stopFaceDetection() { if (!ApiHelper.HAS_FACE_DETECTION) return; if (!mFaceDetectionStarted) return; if (mParameters.getMaxNumDetectedFaces() > 0) { mFaceDetectionStarted = false; mCameraDevice.setFaceDetectionListener(null); mCameraDevice.stopFaceDetection(); mUI.clearFaces(); } } @Override public boolean dispatchTouchEvent(MotionEvent m) { if (mCameraState == SWITCHING_CAMERA) return true; return mUI.dispatchTouchEvent(m); } private final class ShutterCallback implements android.hardware.Camera.ShutterCallback { private boolean mAnimateFlash; public ShutterCallback(boolean animateFlash) { mAnimateFlash = animateFlash; } @Override public void onShutter() { mShutterCallbackTime = System.currentTimeMillis(); mShutterLag = mShutterCallbackTime - mCaptureStartTime; Log.v(TAG, "mShutterLag = " + mShutterLag + "ms"); if (mAnimateFlash) { mActivity.runOnUiThread(mFlashRunnable); } } } private final class PostViewPictureCallback implements PictureCallback { @Override public void onPictureTaken( byte [] data, android.hardware.Camera camera) { mPostViewPictureCallbackTime = System.currentTimeMillis(); Log.v(TAG, "mShutterToPostViewCallbackTime = " + (mPostViewPictureCallbackTime - mShutterCallbackTime) + "ms"); } } private final class RawPictureCallback implements PictureCallback { @Override public void onPictureTaken( byte [] rawData, android.hardware.Camera camera) { mRawPictureCallbackTime = System.currentTimeMillis(); Log.v(TAG, "mShutterToRawCallbackTime = " + (mRawPictureCallbackTime - mShutterCallbackTime) + "ms"); } } private final class JpegPictureCallback implements PictureCallback { Location mLocation; public JpegPictureCallback(Location loc) { mLocation = loc; } @Override public void onPictureTaken( final byte [] jpegData, final android.hardware.Camera camera) { if (mPaused) { return; } if (mSceneMode == Util.SCENE_MODE_HDR) { mActivity.showSwitcher(); mActivity.setSwipingEnabled(true); } mJpegPictureCallbackTime = System.currentTimeMillis(); // If postview callback has arrived, the captured image is displayed // in postview callback. If not, the captured image is displayed in // raw picture callback. if (mPostViewPictureCallbackTime != 0) { mShutterToPictureDisplayedTime = mPostViewPictureCallbackTime - mShutterCallbackTime; mPictureDisplayedToJpegCallbackTime = mJpegPictureCallbackTime - mPostViewPictureCallbackTime; } else { mShutterToPictureDisplayedTime = mRawPictureCallbackTime - mShutterCallbackTime; mPictureDisplayedToJpegCallbackTime = mJpegPictureCallbackTime - mRawPictureCallbackTime; } Log.v(TAG, "mPictureDisplayedToJpegCallbackTime = " + mPictureDisplayedToJpegCallbackTime + "ms"); // Only animate when in full screen capture mode // i.e. If monkey/a user swipes to the gallery during picture taking, // don't show animation if (ApiHelper.HAS_SURFACE_TEXTURE && !mIsImageCaptureIntent && mActivity.mShowCameraAppView) { // Finish capture animation mHandler.removeMessages(CAPTURE_ANIMATION_DONE); ((CameraScreenNail) mActivity.mCameraScreenNail).animateSlide(); mHandler.sendEmptyMessageDelayed(CAPTURE_ANIMATION_DONE, CaptureAnimManager.getAnimationDuration()); } mFocusManager.updateFocusUI(); // Ensure focus indicator is hidden. boolean isSamsungHDR = (mSceneMode == Util.SCENE_MODE_HDR && Util.needSamsungHDRFormat()); if (!mIsImageCaptureIntent && (!Util.isZSLEnabled() || isSamsungHDR)) { if (ApiHelper.CAN_START_PREVIEW_IN_JPEG_CALLBACK) { setupPreview(); } else { // Camera HAL of some devices have a bug. Starting preview // immediately after taking a picture will fail. Wait some // time before starting the preview. mHandler.sendEmptyMessageDelayed(SETUP_PREVIEW, 300); } - } else if (Util.isZSLEnabled() && !isSamsungHDR) { - // In ZSL mode, the preview is not stopped, due to which the - // review mode (ImageCapture) doesn't show the captured frame. - // Hence stop the preview if ZSL mode is active so that the - // preview can be restarted using the onReviewRetakeClicked(). - if (mIsImageCaptureIntent) { - stopPreview(); - } else { - mFocusManager.resetTouchFocus(); - setCameraState(IDLE); - } + } else { + mFocusManager.resetTouchFocus(); + setCameraState(IDLE); } if (!mIsImageCaptureIntent) { // Calculate the width and the height of the jpeg. Size s = mParameters.getPictureSize(); final ExifInterface exif = Exif.getExif(jpegData); final int orientation = Exif.getOrientation(exif); final int width, height; if ((mJpegRotation + orientation) % 180 == 0 || isSamsungHDR) { width = s.width; height = s.height; } else { width = s.height; height = s.width; } final String title = mNamedImages.getTitle(); long date = mNamedImages.getDate(); if (title == null) { Log.e(TAG, "Unbalanced name/data pair"); } else { if (date == -1) date = mCaptureStartTime; if (mHeading >= 0) { // heading direction has been updated by the sensor. ExifTag directionRefTag = exif.buildTag( ExifInterface.TAG_GPS_IMG_DIRECTION_REF, ExifInterface.GpsTrackRef.MAGNETIC_DIRECTION); ExifTag directionTag = exif.buildTag( ExifInterface.TAG_GPS_IMG_DIRECTION, new Rational(mHeading, 1)); exif.setTag(directionRefTag); exif.setTag(directionTag); } if (mLocation != null) { exif.addGpsTags(mLocation.getLatitude(), mLocation.getLongitude()); exif.addGpsDateTimeStampTag(date); exif.setTag(exif.buildTag(ExifInterface.TAG_GPS_PROCESSING_METHOD, mLocation.getProvider())); } exif.addDateTimeStampTag(ExifInterface.TAG_DATE_TIME, date, TimeZone.getDefault()); if (isSamsungHDR) { final long finalDate = date; new Thread(new Runnable() { public void run() { ByteArrayOutputStream baos = new ByteArrayOutputStream(); Bitmap bm = Util.decodeYUV422P(jpegData, width, height); if (mJpegRotation != 0) { Matrix matrix = new Matrix(); matrix.postRotate(mJpegRotation); bm = Bitmap.createBitmap(bm, 0, 0, width, height, matrix, true); } bm.compress(Bitmap.CompressFormat.JPEG, CameraSettings.getJpegQualityIntValue(mPreferences), baos); boolean rotated = (mJpegRotation % 180) != 0; mActivity.getMediaSaveService().addImage( baos.toByteArray(), title, finalDate, mLocation, rotated ? height : width, rotated ? width : height, orientation, exif, mOnMediaSavedListener, mContentResolver); } }).start(); } else { mActivity.getMediaSaveService().addImage( jpegData, title, date, mLocation, width, height, orientation, exif, mOnMediaSavedListener, mContentResolver); } } } else { mJpegImageData = jpegData; if (!mQuickCapture) { mUI.showPostCaptureAlert(); } else { onCaptureDone(); } } // Check this in advance of each shot so we don't add to shutter // latency. It's true that someone else could write to the SD card in // the mean time and fill it, but that could have happened between the // shutter press and saving the JPEG too. mActivity.updateStorageSpaceAndHint(); long now = System.currentTimeMillis(); mJpegCallbackFinishTime = now - mJpegPictureCallbackTime; Log.v(TAG, "mJpegCallbackFinishTime = " + mJpegCallbackFinishTime + "ms"); mJpegPictureCallbackTime = 0; } } private final class AutoFocusCallback implements android.hardware.Camera.AutoFocusCallback { @Override public void onAutoFocus( boolean focused, android.hardware.Camera camera) { if (mPaused) return; mAutoFocusTime = System.currentTimeMillis() - mFocusStartTime; Log.v(TAG, "mAutoFocusTime = " + mAutoFocusTime + "ms"); setCameraState(IDLE); mFocusManager.onAutoFocus(focused, mUI.isShutterPressed()); } } @TargetApi(ApiHelper.VERSION_CODES.JELLY_BEAN) private final class AutoFocusMoveCallback implements android.hardware.Camera.AutoFocusMoveCallback { @Override public void onAutoFocusMoving( boolean moving, android.hardware.Camera camera) { mFocusManager.onAutoFocusMoving(moving); } } private static class NamedImages { private ArrayList<NamedEntity> mQueue; private boolean mStop; private NamedEntity mNamedEntity; public NamedImages() { mQueue = new ArrayList<NamedEntity>(); } public void nameNewImage(ContentResolver resolver, long date) { NamedEntity r = new NamedEntity(); r.title = Util.createJpegName(date); r.date = date; mQueue.add(r); } public String getTitle() { if (mQueue.isEmpty()) { mNamedEntity = null; return null; } mNamedEntity = mQueue.get(0); mQueue.remove(0); return mNamedEntity.title; } // Must be called after getTitle(). public long getDate() { if (mNamedEntity == null) return -1; return mNamedEntity.date; } private static class NamedEntity { String title; long date; } } private void setCameraState(int state) { mCameraState = state; switch (state) { case PhotoController.PREVIEW_STOPPED: case PhotoController.SNAPSHOT_IN_PROGRESS: case PhotoController.FOCUSING: case PhotoController.SWITCHING_CAMERA: mUI.enableGestures(false); break; case PhotoController.IDLE: if (mActivity.isInCameraApp()) { mUI.enableGestures(true); } break; } } private void animateFlash() { // Only animate when in full screen capture mode // i.e. If monkey/a user swipes to the gallery during picture taking, // don't show animation if (ApiHelper.HAS_SURFACE_TEXTURE && !mIsImageCaptureIntent && mActivity.mShowCameraAppView) { // Start capture animation. ((CameraScreenNail) mActivity.mCameraScreenNail).animateFlash(mDisplayRotation); mUI.enablePreviewThumb(true); mHandler.sendEmptyMessageDelayed(CAPTURE_ANIMATION_DONE, CaptureAnimManager.getAnimationDuration()); } } @Override public boolean capture() { // If we are already in the middle of taking a snapshot or the image save request // is full then ignore. if (mCameraDevice == null || mCameraState == SNAPSHOT_IN_PROGRESS || mCameraState == SWITCHING_CAMERA || mActivity.getMediaSaveService().isQueueFull()) { return false; } mCaptureStartTime = System.currentTimeMillis(); mPostViewPictureCallbackTime = 0; mJpegImageData = null; final boolean animateBefore = (mSceneMode == Util.SCENE_MODE_HDR); if (animateBefore) { animateFlash(); } // Set rotation and gps data. int orientation; // We need to be consistent with the framework orientation (i.e. the // orientation of the UI.) when the auto-rotate screen setting is on. if (mActivity.isAutoRotateScreen()) { orientation = (360 - mDisplayRotation) % 360; } else { orientation = mOrientation; } mJpegRotation = Util.getJpegRotation(mCameraId, orientation); mParameters.setRotation(mJpegRotation); Location loc = mLocationManager.getCurrentLocation(); Util.setGpsParameters(mParameters, loc); mCameraDevice.setParameters(mParameters); mCameraDevice.takePicture2(new ShutterCallback(!animateBefore), mRawPictureCallback, mPostViewPictureCallback, new JpegPictureCallback(loc), mCameraState, mFocusManager.getFocusState()); mNamedImages.nameNewImage(mContentResolver, mCaptureStartTime); if (Util.isZSLEnabled() && (mSceneMode != Util.SCENE_MODE_HDR || !Util.needSamsungHDRFormat())) { mRestartPreview = false; } mFaceDetectionStarted = false; setCameraState(SNAPSHOT_IN_PROGRESS); UsageStatistics.onEvent(UsageStatistics.COMPONENT_CAMERA, UsageStatistics.ACTION_CAPTURE_DONE, "Photo"); return true; } @Override public void setFocusParameters() { setCameraParameters(UPDATE_PARAM_PREFERENCE); } private int getPreferredCameraId(ComboPreferences preferences) { int intentCameraId = Util.getCameraFacingIntentExtras(mActivity); if (intentCameraId != -1) { // Testing purpose. Launch a specific camera through the intent // extras. return intentCameraId; } else { return CameraSettings.readPreferredCameraId(preferences); } } @Override public void onFullScreenChanged(boolean full) { mUI.onFullScreenChanged(full); if (ApiHelper.HAS_SURFACE_TEXTURE) { if (mActivity.mCameraScreenNail != null) { ((CameraScreenNail) mActivity.mCameraScreenNail).setFullScreen(full); } return; } } private void updateSceneMode() { // If scene mode is set, we cannot set flash mode, white balance, and // focus mode, instead, we read it from driver if (!Parameters.SCENE_MODE_AUTO.equals(mSceneMode)) { overrideCameraSettings(mParameters.getFlashMode(), mParameters.getWhiteBalance(), mParameters.getFocusMode()); } else { overrideCameraSettings(null, null, null); } } private void overrideCameraSettings(final String flashMode, final String whiteBalance, final String focusMode) { mUI.overrideSettings( CameraSettings.KEY_FLASH_MODE, flashMode, CameraSettings.KEY_WHITE_BALANCE, whiteBalance, CameraSettings.KEY_FOCUS_MODE, focusMode); if (Util.needSamsungHDRFormat()){ if (mSceneMode == Util.SCENE_MODE_HDR) { mUI.overrideSettings(CameraSettings.KEY_EXPOSURE, String.valueOf(mParameters.getMaxExposureCompensation())); mParameters.setExposureCompensation(mParameters.getMaxExposureCompensation()); } else { mUI.overrideSettings(CameraSettings.KEY_EXPOSURE, null); mParameters.setExposureCompensation(CameraSettings.readExposure(mPreferences)); } mCameraDevice.setParameters(mParameters); } } private void loadCameraPreferences() { CameraSettings settings = new CameraSettings(mActivity, mInitialParams, mCameraId, CameraHolder.instance().getCameraInfo()); mPreferenceGroup = settings.getPreferenceGroup(R.xml.camera_preferences); } @Override public void onOrientationChanged(int orientation) { // We keep the last known orientation. So if the user first orient // the camera then point the camera to floor or sky, we still have // the correct orientation. if (orientation == OrientationEventListener.ORIENTATION_UNKNOWN) return; mOrientation = Util.roundOrientation(orientation, mOrientation); // Show the toast after getting the first orientation changed. if (mHandler.hasMessages(SHOW_TAP_TO_FOCUS_TOAST)) { mHandler.removeMessages(SHOW_TAP_TO_FOCUS_TOAST); showTapToFocusToast(); } } @Override public void onStop() { if (mMediaProviderClient != null) { mMediaProviderClient.release(); mMediaProviderClient = null; } } @Override public void onCaptureCancelled() { mActivity.setResultEx(Activity.RESULT_CANCELED, new Intent()); mActivity.finish(); } @Override public void onCaptureRetake() { if (mPaused) return; mUI.hidePostCaptureAlert(); setupPreview(); } @Override public void onCaptureDone() { if (mPaused) { return; } byte[] data = mJpegImageData; if (mCropValue == null) { // First handle the no crop case -- just return the value. If the // caller specifies a "save uri" then write the data to its // stream. Otherwise, pass back a scaled down version of the bitmap // directly in the extras. if (mSaveUri != null) { OutputStream outputStream = null; try { outputStream = mContentResolver.openOutputStream(mSaveUri); outputStream.write(data); outputStream.close(); mActivity.setResultEx(Activity.RESULT_OK); mActivity.finish(); } catch (IOException ex) { // ignore exception } finally { Util.closeSilently(outputStream); } } else { ExifInterface exif = Exif.getExif(data); int orientation = Exif.getOrientation(exif); Bitmap bitmap = Util.makeBitmap(data, 50 * 1024); bitmap = Util.rotate(bitmap, orientation); mActivity.setResultEx(Activity.RESULT_OK, new Intent("inline-data").putExtra("data", bitmap)); mActivity.finish(); } } else { // Save the image to a temp file and invoke the cropper Uri tempUri = null; FileOutputStream tempStream = null; try { File path = mActivity.getFileStreamPath(sTempCropFilename); path.delete(); tempStream = mActivity.openFileOutput(sTempCropFilename, 0); tempStream.write(data); tempStream.close(); tempUri = Uri.fromFile(path); } catch (FileNotFoundException ex) { mActivity.setResultEx(Activity.RESULT_CANCELED); mActivity.finish(); return; } catch (IOException ex) { mActivity.setResultEx(Activity.RESULT_CANCELED); mActivity.finish(); return; } finally { Util.closeSilently(tempStream); } Bundle newExtras = new Bundle(); if (mCropValue.equals("circle")) { newExtras.putString("circleCrop", "true"); } if (mSaveUri != null) { newExtras.putParcelable(MediaStore.EXTRA_OUTPUT, mSaveUri); } else { newExtras.putBoolean(CropExtras.KEY_RETURN_DATA, true); } if (mActivity.isSecureCamera()) { newExtras.putBoolean(CropExtras.KEY_SHOW_WHEN_LOCKED, true); } Intent cropIntent = new Intent(FilterShowActivity.CROP_ACTION); cropIntent.setData(tempUri); cropIntent.putExtras(newExtras); mActivity.startActivityForResult(cropIntent, REQUEST_CROP); } } @Override public void onShutterButtonFocus(boolean pressed) { if (mPaused || mUI.collapseCameraControls() || (mCameraState == SNAPSHOT_IN_PROGRESS) || (mCameraState == PREVIEW_STOPPED)) return; // Do not do focus if there is not enough storage. if (pressed && !canTakePicture()) return; if (pressed) { mFocusManager.onShutterDown(); } else { // for countdown mode, we need to postpone the shutter release // i.e. lock the focus during countdown. if (!mUI.isCountingDown()) { mFocusManager.onShutterUp(); } } } @Override public void onShutterButtonClick() { if (mPaused || mUI.collapseCameraControls() || (mCameraState == SWITCHING_CAMERA) || (mCameraState == PREVIEW_STOPPED)) return; // Do not take the picture if there is not enough storage. if (mActivity.getStorageSpace() <= Storage.LOW_STORAGE_THRESHOLD) { Log.i(TAG, "Not enough space or storage not ready. remaining=" + mActivity.getStorageSpace()); return; } Log.v(TAG, "onShutterButtonClick: mCameraState=" + mCameraState); if (mSceneMode == Util.SCENE_MODE_HDR) { mActivity.hideSwitcher(); mActivity.setSwipingEnabled(false); } // If the user wants to do a snapshot while the previous one is still // in progress, remember the fact and do it after we finish the previous // one and re-start the preview. Snapshot in progress also includes the // state that autofocus is focusing and a picture will be taken when // focus callback arrives. if ((mFocusManager.isFocusingSnapOnFinish() || mCameraState == SNAPSHOT_IN_PROGRESS) && !mIsImageCaptureIntent) { mSnapshotOnIdle = true; return; } String timer = mPreferences.getString( CameraSettings.KEY_TIMER, mActivity.getString(R.string.pref_camera_timer_default)); boolean playSound = mPreferences.getString(CameraSettings.KEY_TIMER_SOUND_EFFECTS, mActivity.getString(R.string.pref_camera_timer_sound_default)) .equals(mActivity.getString(R.string.setting_on_value)); int seconds = Integer.parseInt(timer); // When shutter button is pressed, check whether the previous countdown is // finished. If not, cancel the previous countdown and start a new one. if (mUI.isCountingDown()) { mUI.cancelCountDown(); } if (seconds > 0) { mUI.startCountDown(seconds, playSound); } else { mSnapshotOnIdle = false; mFocusManager.doSnap(); } } void setPreviewFrameLayoutCameraOrientation(){ CameraInfo info = CameraHolder.instance().getCameraInfo()[mCameraId]; //if camera mount angle is 0 or 180, we want to resize preview if(info.orientation % 180 == 0){ mUI.mPreviewFrameLayout.setRenderer(mUI.mPieRenderer); mUI.mPreviewFrameLayout.cameraOrientationPreviewResize(true); } else{ mUI.mPreviewFrameLayout.cameraOrientationPreviewResize(false); } } private void resizeForPreviewAspectRatio() { if ( mCameraDevice == null || mParameters == null) { Log.e(TAG, "Camera not yet initialized"); return; } setPreviewFrameLayoutCameraOrientation(); Size size = mParameters.getPictureSize(); Log.e(TAG,"Width = "+ size.width+ "Height = "+size.height); mUI.setAspectRatio((double) size.width / size.height); } @Override public void installIntentFilter() { } @Override public boolean updateStorageHintOnResume() { return mFirstTimeInitialized; } @Override public void updateCameraAppView() { } @Override public void onResumeBeforeSuper() { mPaused = false; } @Override public void onResumeAfterSuper() { if (mOpenCameraFail || mCameraDisabled) return; mJpegPictureCallbackTime = 0; mZoomValue = 0; // Start the preview if it is not started. if (mCameraState == PREVIEW_STOPPED && mCameraStartUpThread == null) { resetExposureCompensation(); mCameraStartUpThread = new CameraStartUpThread(); mCameraStartUpThread.start(); } // If first time initialization is not finished, put it in the // message queue. if (!mFirstTimeInitialized) { mHandler.sendEmptyMessage(FIRST_TIME_INIT); } else { initializeSecondTime(); } keepScreenOnAwhile(); // Dismiss open menu if exists. PopupManager.getInstance(mActivity).notifyShowPopup(null); UsageStatistics.onContentViewChanged( UsageStatistics.COMPONENT_CAMERA, "PhotoModule"); Sensor gsensor = mSensorManager.getDefaultSensor(Sensor.TYPE_ACCELEROMETER); if (gsensor != null) { mSensorManager.registerListener(this, gsensor, SensorManager.SENSOR_DELAY_NORMAL); } Sensor msensor = mSensorManager.getDefaultSensor(Sensor.TYPE_MAGNETIC_FIELD); if (msensor != null) { mSensorManager.registerListener(this, msensor, SensorManager.SENSOR_DELAY_NORMAL); } } void waitCameraStartUpThread() { try { if (mCameraStartUpThread != null) { mCameraStartUpThread.cancel(); mCameraStartUpThread.join(); mCameraStartUpThread = null; setCameraState(IDLE); } } catch (InterruptedException e) { // ignore } } @Override public void onPauseBeforeSuper() { mPaused = true; Sensor gsensor = mSensorManager.getDefaultSensor(Sensor.TYPE_ACCELEROMETER); if (gsensor != null) { mSensorManager.unregisterListener(this, gsensor); } Sensor msensor = mSensorManager.getDefaultSensor(Sensor.TYPE_MAGNETIC_FIELD); if (msensor != null) { mSensorManager.unregisterListener(this, msensor); } } @Override public void onPauseAfterSuper() { // Wait the camera start up thread to finish. waitCameraStartUpThread(); // When camera is started from secure lock screen for the first time // after screen on, the activity gets onCreate->onResume->onPause->onResume. // To reduce the latency, keep the camera for a short time so it does // not need to be opened again. if (mCameraDevice != null && mActivity.isSecureCamera() && ActivityBase.isFirstStartAfterScreenOn()) { ActivityBase.resetFirstStartAfterScreenOn(); CameraHolder.instance().keep(KEEP_CAMERA_TIMEOUT); } // Reset the focus first. Camera CTS does not guarantee that // cancelAutoFocus is allowed after preview stops. if (mCameraDevice != null && mCameraState != PREVIEW_STOPPED) { mCameraDevice.cancelAutoFocus(); } stopPreview(); // Release surface texture. mActivity.getCameraScreenNail().releaseSurfaceTexture(); resetScreenOn(); mNamedImages = null; if (mLocationManager != null) mLocationManager.recordLocation(false); // If we are in an image capture intent and has taken // a picture, we just clear it in onPause. mJpegImageData = null; // Remove the messages in the event queue. mHandler.removeMessages(SETUP_PREVIEW); mHandler.removeMessages(FIRST_TIME_INIT); mHandler.removeMessages(CHECK_DISPLAY_ROTATION); mHandler.removeMessages(SWITCH_CAMERA); mHandler.removeMessages(SWITCH_CAMERA_START_ANIMATION); mHandler.removeMessages(CAMERA_OPEN_DONE); mHandler.removeMessages(START_PREVIEW_DONE); mHandler.removeMessages(OPEN_CAMERA_FAIL); mHandler.removeMessages(CAMERA_DISABLED); closeCamera(); resetScreenOn(); mUI.onPause(); mPendingSwitchCameraId = -1; if (mFocusManager != null) mFocusManager.removeMessages(); MediaSaveService s = mActivity.getMediaSaveService(); if (s != null) { s.setListener(null); } } /** * The focus manager is the first UI related element to get initialized, * and it requires the RenderOverlay, so initialize it here */ private void initializeFocusManager() { // Create FocusManager object. startPreview needs it. // if mFocusManager not null, reuse it // otherwise create a new instance if (mFocusManager != null) { mFocusManager.removeMessages(); } else { CameraInfo info = CameraHolder.instance().getCameraInfo()[mCameraId]; boolean mirror = (info.facing == CameraInfo.CAMERA_FACING_FRONT); String[] defaultFocusModes = mActivity.getResources().getStringArray( R.array.pref_camera_focusmode_default_array); mFocusManager = new FocusOverlayManager(mPreferences, defaultFocusModes, mInitialParams, this, mirror, mActivity.getMainLooper(), mUI); } } @Override public void onConfigurationChanged(Configuration newConfig) { Log.v(TAG, "onConfigurationChanged"); // Ignore until the hardware is started if (mCameraStartUpThread != null) { return; } setDisplayOrientation(); resizeForPreviewAspectRatio(); } @Override public void onActivityResult( int requestCode, int resultCode, Intent data) { switch (requestCode) { case REQUEST_CROP: { Intent intent = new Intent(); if (data != null) { Bundle extras = data.getExtras(); if (extras != null) { intent.putExtras(extras); } } mActivity.setResultEx(resultCode, intent); mActivity.finish(); File path = mActivity.getFileStreamPath(sTempCropFilename); path.delete(); break; } } } private boolean canTakePicture() { return isCameraIdle() && (mActivity.getStorageSpace() > Storage.LOW_STORAGE_THRESHOLD); } @Override public void autoFocus() { mFocusStartTime = System.currentTimeMillis(); mCameraDevice.autoFocus(mAutoFocusCallback); setCameraState(FOCUSING); } @Override public void cancelAutoFocus() { mCameraDevice.cancelAutoFocus(); setCameraState(IDLE); setCameraParameters(UPDATE_PARAM_PREFERENCE); } // Preview area is touched. Handle touch focus. @Override public void onSingleTapUp(View view, int x, int y) { if (mPaused || mCameraDevice == null || !mFirstTimeInitialized || mCameraState == SNAPSHOT_IN_PROGRESS || mCameraState == SWITCHING_CAMERA || mCameraState == PREVIEW_STOPPED) { return; } // Do not trigger touch focus if popup window is opened. if (mUI.removeTopLevelPopup()) return; // Check if metering area or focus area is supported. if (!mFocusAreaSupported && !mMeteringAreaSupported) return; mFocusManager.onSingleTapUp(x, y); } @Override public boolean onBackPressed() { return mUI.onBackPressed(); } @Override public boolean onKeyDown(int keyCode, KeyEvent event) { switch (keyCode) { case KeyEvent.KEYCODE_VOLUME_UP: if (mActivity.isInCameraApp() && mFirstTimeInitialized && (mUI.mMenuInitialized)) { mUI.onScaleStepResize(true); } return true; case KeyEvent.KEYCODE_VOLUME_DOWN: if (mActivity.isInCameraApp() && mFirstTimeInitialized && (mUI.mMenuInitialized)) { mUI.onScaleStepResize(false); } return true; case KeyEvent.KEYCODE_FOCUS: if (mActivity.isInCameraApp() && mFirstTimeInitialized && mShutterButton.getVisibility() == View.VISIBLE) { if (event.getRepeatCount() == 0) { onShutterButtonFocus(true); } return true; } return false; case KeyEvent.KEYCODE_CAMERA: if (mFirstTimeInitialized && event.getRepeatCount() == 0) { // Only capture when in full screen capture mode if (mActivity.isInCameraApp() && mShutterButton.getVisibility() == View.VISIBLE) onShutterButtonClick(); } return true; case KeyEvent.KEYCODE_DPAD_CENTER: // If we get a dpad center event without any focused view, move // the focus to the shutter button and press it. if (mFirstTimeInitialized && event.getRepeatCount() == 0) { // Start auto-focus immediately to reduce shutter lag. After // the shutter button gets the focus, onShutterButtonFocus() // will be called again but it is fine. if (mUI.removeTopLevelPopup()) return true; onShutterButtonFocus(true); mUI.pressShutterButton(); } return true; } return false; } @Override public boolean onKeyUp(int keyCode, KeyEvent event) { switch (keyCode) { case KeyEvent.KEYCODE_VOLUME_UP: case KeyEvent.KEYCODE_VOLUME_DOWN: return true; case KeyEvent.KEYCODE_FOCUS: if (mFirstTimeInitialized) { onShutterButtonFocus(false); } return true; } return false; } @TargetApi(ApiHelper.VERSION_CODES.ICE_CREAM_SANDWICH) private void closeCamera() { if (mCameraDevice != null) { mCameraDevice.setZoomChangeListener(null); if(ApiHelper.HAS_FACE_DETECTION) { mCameraDevice.setFaceDetectionListener(null); } mCameraDevice.setErrorCallback(null); CameraHolder.instance().release(); mFaceDetectionStarted = false; mCameraDevice = null; setCameraState(PREVIEW_STOPPED); mFocusManager.onCameraReleased(); } } private void setDisplayOrientation() { mDisplayRotation = Util.getDisplayRotation(mActivity); mDisplayOrientation = Util.getDisplayOrientation(mDisplayRotation, mCameraId); mCameraDisplayOrientation = Util.getDisplayOrientation(0, mCameraId); mUI.setDisplayOrientation(mDisplayOrientation); if (mFocusManager != null) { mFocusManager.setDisplayOrientation(mDisplayOrientation); } // GLRoot also uses the DisplayRotation, and needs to be told to layout to update mActivity.getGLRoot().requestLayoutContentPane(); } // Only called by UI thread. private void setupPreview() { mFocusManager.resetTouchFocus(); startPreview(); setCameraState(IDLE); startFaceDetection(); } // This can be called by UI Thread or CameraStartUpThread. So this should // not modify the views. private void startPreview() { mCameraDevice.setErrorCallback(mErrorCallback); // ICS camera frameworks has a bug. Face detection state is not cleared // after taking a picture. Stop the preview to work around it. The bug // was fixed in JB. if (mCameraState != PREVIEW_STOPPED && (!mActivity.getResources().getBoolean(R.bool.previewStopsDuringSnapshot) || mCameraState != SNAPSHOT_IN_PROGRESS)) { stopPreview(); } setDisplayOrientation(); if (!mSnapshotOnIdle && !mAspectRatioChanged) { // If the focus mode is continuous autofocus, call cancelAutoFocus to // resume it because it may have been paused by autoFocus call. if (Util.FOCUS_MODE_CONTINUOUS_PICTURE.equals(mFocusManager.getFocusMode()) && mCameraState != PREVIEW_STOPPED) { mCameraDevice.cancelAutoFocus(); } mFocusManager.setAeAwbLock(false); // Unlock AE and AWB. } setCameraParameters(UPDATE_PARAM_ALL); if (ApiHelper.HAS_SURFACE_TEXTURE) { if (mUI.getSurfaceTexture() == null) { if (mCameraStartUpThread != null && mCameraStartUpThread.isCanceled()) { return; // Exiting, so no need to get the surface texture. } } SurfaceTexture texture = mActivity.getScreenNailTextureForPreviewSize( mCameraId, mCameraDisplayOrientation, mParameters); mUI.setSurfaceTexture(texture); mCameraDevice.setDisplayOrientation(mCameraDisplayOrientation); if (texture == null) { if (mCameraStartUpThread != null && mCameraStartUpThread.isCanceled()) { return; // Exiting, so no need to get the surface texture. } } else { mCameraDevice.setPreviewTextureAsync(texture); } } else { mCameraDevice.setDisplayOrientation(mDisplayOrientation); mCameraDevice.setPreviewDisplayAsync(mUI.getSurfaceHolder()); } Log.v(TAG, "startPreview"); mCameraDevice.startPreviewAsync(); mFocusManager.onPreviewStarted(); // Set camera mode CameraSettings.setVideoMode(mParameters, false); mCameraDevice.setParameters(mParameters); if (mSnapshotOnIdle) { mHandler.post(mDoSnapRunnable); } } @Override public void stopPreview() { if (mCameraDevice != null && mCameraState != PREVIEW_STOPPED) { Log.v(TAG, "stopPreview"); mCameraDevice.stopPreview(); //mFaceDetectionStarted = false; } setCameraState(PREVIEW_STOPPED); if (mFocusManager != null) mFocusManager.onPreviewStopped(); } @SuppressWarnings("deprecation") private void updateCameraParametersInitialize() { // Reset preview frame rate to the maximum because it may be lowered by // video camera application. List<Integer> frameRates = mParameters.getSupportedPreviewFrameRates(); if (frameRates != null) { Integer max = Collections.max(frameRates); mParameters.setPreviewFrameRate(max); } CameraSettings.setReducePurple(mParameters, true); mParameters.set(Util.RECORDING_HINT, Util.FALSE); // Disable video stabilization. Convenience methods not available in API // level <= 14 String vstabSupported = mParameters.get("video-stabilization-supported"); if ("true".equals(vstabSupported)) { mParameters.set("video-stabilization", "false"); } // Enable face detection if needed List<String> faceSupported = mParameters.getSupportedFaceDetectionModes(); if (faceSupported != null && faceSupported.contains("on")) { mParameters.setFaceDetectionMode("on"); } } private void updateCameraParametersZoom() { // Set zoom. if (mParameters.isZoomSupported()) { mParameters.setZoom(mZoomValue); } } @TargetApi(ApiHelper.VERSION_CODES.JELLY_BEAN) private void setAutoExposureLockIfSupported() { if (mAeLockSupported) { mParameters.setAutoExposureLock(mFocusManager.getAeAwbLock()); } } @TargetApi(ApiHelper.VERSION_CODES.JELLY_BEAN) private void setAutoWhiteBalanceLockIfSupported() { if (mAwbLockSupported) { mParameters.setAutoWhiteBalanceLock(mFocusManager.getAeAwbLock()); } } @TargetApi(ApiHelper.VERSION_CODES.ICE_CREAM_SANDWICH) private void setFocusAreasIfSupported() { if (mFocusAreaSupported) { mParameters.setFocusAreas(mFocusManager.getFocusAreas()); } } @TargetApi(ApiHelper.VERSION_CODES.ICE_CREAM_SANDWICH) private void setMeteringAreasIfSupported() { if (mMeteringAreaSupported) { // Use the same area for focus and metering. mParameters.setMeteringAreas(mFocusManager.getMeteringAreas()); } } private void updateCameraParametersPreference() { setAutoExposureLockIfSupported(); setAutoWhiteBalanceLockIfSupported(); setFocusAreasIfSupported(); setMeteringAreasIfSupported(); // Set picture size. String pictureSize = mPreferences.getString( CameraSettings.KEY_PICTURE_SIZE, null); if (pictureSize == null) { CameraSettings.initialCameraPictureSize(mActivity, mParameters); } else { Size oldSize = mParameters.getPictureSize(); List<Size> supported = mParameters.getSupportedPictureSizes(); CameraSettings.setCameraPictureSize( pictureSize, supported, mParameters); Size size = mParameters.getPictureSize(); if (oldSize != null && size != null) { if (!size.equals(oldSize) && mCameraState != PREVIEW_STOPPED) { Log.d(TAG, "Picture size changed. Restart preview"); mAspectRatioChanged = true; stopPreview(); } } } Size size = mParameters.getPictureSize(); // Set a preview size that is closest to the viewfinder height and has // the right aspect ratio. List<Size> sizes = mParameters.getSupportedPreviewSizes(); Size optimalSize = Util.getOptimalPreviewSize(mActivity, sizes, (double) size.width / size.height); Size original = mParameters.getPreviewSize(); if (!original.equals(optimalSize)) { mParameters.setPreviewSize(optimalSize.width, optimalSize.height); // Zoom related settings will be changed for different preview // sizes, so set and read the parameters to get latest values if (mHandler.getLooper() == Looper.myLooper()) { // On UI thread only, not when camera starts up setupPreview(); } else { mCameraDevice.setParameters(mParameters); } mParameters = mCameraDevice.getParameters(); } Log.v(TAG, "Preview size is " + optimalSize.width + "x" + optimalSize.height); // Since changing scene mode may change supported values, set scene mode // first. HDR is a scene mode. To promote it in UI, it is stored in a // separate preference. String hdr = mPreferences.getString(CameraSettings.KEY_CAMERA_HDR, mActivity.getString(R.string.pref_camera_hdr_default)); if (mActivity.getString(R.string.setting_on_value).equals(hdr)) { mSceneMode = Util.SCENE_MODE_HDR; } else { mSceneMode = mPreferences.getString( CameraSettings.KEY_SCENE_MODE, mActivity.getString(R.string.pref_camera_scenemode_default)); } if (Util.isSupported(mSceneMode, mParameters.getSupportedSceneModes())) { if (!mParameters.getSceneMode().equals(mSceneMode)) { mParameters.setSceneMode(mSceneMode); // Setting scene mode will change the settings of flash mode, // white balance, and focus mode. Here we read back the // parameters, so we can know those settings. mCameraDevice.setParameters(mParameters); mParameters = mCameraDevice.getParameters(); } } else { mSceneMode = mParameters.getSceneMode(); if (mSceneMode == null) { mSceneMode = Parameters.SCENE_MODE_AUTO; } } if (Util.isZSLEnabled()) { if (Util.sendMagicSamsungZSLCommand()) { mCameraDevice.sendMagicSamsungZSLCommand(); } // Switch on ZSL mode mParameters.set("zsl", "on"); mParameters.set("camera-mode", "1"); } // Set JPEG quality. int jpegQuality = CameraProfile.getJpegEncodingQualityParameter(mCameraId, CameraProfile.QUALITY_HIGH); mParameters.setJpegQuality(jpegQuality); // For the following settings, we need to check if the settings are // still supported by latest driver, if not, ignore the settings. // Set exposure compensation int value = CameraSettings.readExposure(mPreferences); int max = mParameters.getMaxExposureCompensation(); int min = mParameters.getMinExposureCompensation(); if (value >= min && value <= max) { if (mSceneMode != Util.SCENE_MODE_HDR || !Util.needSamsungHDRFormat()) { mParameters.setExposureCompensation(value); } } else { Log.w(TAG, "invalid exposure range: " + value); } if (Parameters.SCENE_MODE_AUTO.equals(mSceneMode)) { // Set flash mode. String flashMode = mPreferences.getString( CameraSettings.KEY_FLASH_MODE, mActivity.getString(R.string.pref_camera_flashmode_default)); List<String> supportedFlash = mParameters.getSupportedFlashModes(); if (Util.isSupported(flashMode, supportedFlash)) { mParameters.setFlashMode(flashMode); } else { flashMode = mParameters.getFlashMode(); if (flashMode == null) { flashMode = mActivity.getString( R.string.pref_camera_flashmode_no_flash); } } // Set white balance parameter. String whiteBalance = mPreferences.getString( CameraSettings.KEY_WHITE_BALANCE, mActivity.getString(R.string.pref_camera_whitebalance_default)); if (Util.isSupported(whiteBalance, mParameters.getSupportedWhiteBalance())) { mParameters.setWhiteBalance(whiteBalance); } else { whiteBalance = mParameters.getWhiteBalance(); if (whiteBalance == null) { whiteBalance = Parameters.WHITE_BALANCE_AUTO; } } // Set focus mode. mFocusManager.overrideFocusMode(null); mParameters.setFocusMode(mFocusManager.getFocusMode()); } else { mFocusManager.overrideFocusMode(mParameters.getFocusMode()); } if (mContinousFocusSupported && ApiHelper.HAS_AUTO_FOCUS_MOVE_CALLBACK) { updateAutoFocusMoveCallback(); } } @TargetApi(ApiHelper.VERSION_CODES.JELLY_BEAN) private void updateAutoFocusMoveCallback() { if (mParameters.getFocusMode().equals(Util.FOCUS_MODE_CONTINUOUS_PICTURE)) { mCameraDevice.setAutoFocusMoveCallback( (AutoFocusMoveCallback) mAutoFocusMoveCallback); } else { mCameraDevice.setAutoFocusMoveCallback(null); } } // We separate the parameters into several subsets, so we can update only // the subsets actually need updating. The PREFERENCE set needs extra // locking because the preference can be changed from GLThread as well. private void setCameraParameters(int updateSet) { if ((updateSet & UPDATE_PARAM_INITIALIZE) != 0) { updateCameraParametersInitialize(); // Set camera mode CameraSettings.setVideoMode(mParameters, false); } if ((updateSet & UPDATE_PARAM_ZOOM) != 0) { updateCameraParametersZoom(); } if ((updateSet & UPDATE_PARAM_PREFERENCE) != 0) { updateCameraParametersPreference(); } Util.dumpParameters(mParameters); mCameraDevice.setParameters(mParameters); } // If the Camera is idle, update the parameters immediately, otherwise // accumulate them in mUpdateSet and update later. private void setCameraParametersWhenIdle(int additionalUpdateSet) { mUpdateSet |= additionalUpdateSet; if (mCameraDevice == null) { // We will update all the parameters when we open the device, so // we don't need to do anything now. mUpdateSet = 0; return; } else if (isCameraIdle()) { if (mRestartPreview) { Log.d(TAG, "Restarting preview"); resizeForPreviewAspectRatio(); startPreview(); mRestartPreview = false; } setCameraParameters(mUpdateSet); updateSceneMode(); mUpdateSet = 0; } else { if (!mHandler.hasMessages(SET_CAMERA_PARAMETERS_WHEN_IDLE)) { mHandler.sendEmptyMessageDelayed( SET_CAMERA_PARAMETERS_WHEN_IDLE, 1000); } } if (mAspectRatioChanged || mRestartPreview) { Log.e(TAG, "Aspect ratio changed, restarting preview"); startPreview(); mAspectRatioChanged = false; mRestartPreview = false; mHandler.sendEmptyMessage(START_PREVIEW_DONE); } } public boolean isCameraIdle() { return (mCameraState == IDLE) || (mCameraState == PREVIEW_STOPPED) || ((mFocusManager != null) && mFocusManager.isFocusCompleted() && (mCameraState != SWITCHING_CAMERA)); } public boolean isImageCaptureIntent() { String action = mActivity.getIntent().getAction(); return (MediaStore.ACTION_IMAGE_CAPTURE.equals(action) || ActivityBase.ACTION_IMAGE_CAPTURE_SECURE.equals(action)); } private void setupCaptureParams() { Bundle myExtras = mActivity.getIntent().getExtras(); if (myExtras != null) { mSaveUri = (Uri) myExtras.getParcelable(MediaStore.EXTRA_OUTPUT); mCropValue = myExtras.getString("crop"); } } @Override public void onSharedPreferenceChanged() { // ignore the events after "onPause()" if (mPaused) return; boolean recordLocation = RecordLocationPreference.get( mPreferences, mContentResolver); mLocationManager.recordLocation(recordLocation); if (mActivity.setStoragePath(mPreferences)) { mActivity.updateStorageSpaceAndHint(); mActivity.reuseCameraScreenNail(!mIsImageCaptureIntent); } /* Check if the PhotoUI Menu is initialized or not. This * should be initialized during onCameraOpen() which should * have been called by now. But for some reason that is not * executed till now, then schedule these functionality for * later by posting a message to the handler */ if (mUI.mMenuInitialized) { setCameraParametersWhenIdle(UPDATE_PARAM_PREFERENCE); resizeForPreviewAspectRatio(); mUI.updateOnScreenIndicators(mParameters, mPreferenceGroup, mPreferences); } else { mHandler.sendEmptyMessage(SET_PHOTO_UI_PARAMS); } } @Override public void onCameraPickerClicked(int cameraId) { if (mPaused || mPendingSwitchCameraId != -1) return; mPendingSwitchCameraId = cameraId; if (ApiHelper.HAS_SURFACE_TEXTURE) { Log.v(TAG, "Start to copy texture. cameraId=" + cameraId); // We need to keep a preview frame for the animation before // releasing the camera. This will trigger onPreviewTextureCopied. ((CameraScreenNail) mActivity.mCameraScreenNail).copyTexture(); // Disable all camera controls. setCameraState(SWITCHING_CAMERA); } else { switchCamera(); } } @Override public void onCameraPickerSuperClicked() { } // Preview texture has been copied. Now camera can be released and the // animation can be started. @Override public void onPreviewTextureCopied() { mHandler.sendEmptyMessage(SWITCH_CAMERA); } @Override public void onCaptureTextureCopied() { } @Override public void onUserInteraction() { if (!mActivity.isFinishing()) keepScreenOnAwhile(); } private void resetScreenOn() { mHandler.removeMessages(CLEAR_SCREEN_DELAY); mActivity.getWindow().clearFlags(WindowManager.LayoutParams.FLAG_KEEP_SCREEN_ON); } private void keepScreenOnAwhile() { mHandler.removeMessages(CLEAR_SCREEN_DELAY); mActivity.getWindow().addFlags(WindowManager.LayoutParams.FLAG_KEEP_SCREEN_ON); mHandler.sendEmptyMessageDelayed(CLEAR_SCREEN_DELAY, SCREEN_DELAY); } // TODO: Delete this function after old camera code is removed @Override public void onRestorePreferencesClicked() { } @Override public void onOverriddenPreferencesClicked() { if (mPaused) return; mUI.showPreferencesToast(); } private void showTapToFocusToast() { // TODO: Use a toast? new RotateTextToast(mActivity, R.string.tap_to_focus, 0).show(); // Clear the preference. Editor editor = mPreferences.edit(); editor.putBoolean(CameraSettings.KEY_CAMERA_FIRST_USE_HINT_SHOWN, false); editor.apply(); } private void initializeCapabilities() { mInitialParams = mCameraDevice.getParameters(); mFocusAreaSupported = Util.isFocusAreaSupported(mInitialParams); mMeteringAreaSupported = Util.isMeteringAreaSupported(mInitialParams); mAeLockSupported = Util.isAutoExposureLockSupported(mInitialParams); mAwbLockSupported = Util.isAutoWhiteBalanceLockSupported(mInitialParams); mContinousFocusSupported = mInitialParams.getSupportedFocusModes().contains( Util.FOCUS_MODE_CONTINUOUS_PICTURE); } @Override public void onCountDownFinished() { mSnapshotOnIdle = false; mFocusManager.doSnap(); mFocusManager.onShutterUp(); } @Override public boolean needsSwitcher() { return !mIsImageCaptureIntent; } @Override public boolean needsPieMenu() { return true; } @Override public void onShowSwitcherPopup() { mUI.onShowSwitcherPopup(); } @Override public int onZoomChanged(int index) { // Not useful to change zoom value when the activity is paused. if (mPaused) return index; mZoomValue = index; if (mParameters == null || mCameraDevice == null) return index; // Set zoom parameters asynchronously mParameters.setZoom(mZoomValue); mCameraDevice.setParameters(mParameters); Parameters p = mCameraDevice.getParameters(); if (p != null) return p.getZoom(); return index; } @Override public int getCameraState() { return mCameraState; } @Override public void onQueueStatus(boolean full) { mUI.enableShutter(!full); } @Override public void onMediaSaveServiceConnected(MediaSaveService s) { // We set the listener only when both service and shutterbutton // are initialized. if (mFirstTimeInitialized) { s.setListener(this); } } @Override public void onAccuracyChanged(Sensor sensor, int accuracy) { } @Override public void onSensorChanged(SensorEvent event) { int type = event.sensor.getType(); float[] data; if (type == Sensor.TYPE_ACCELEROMETER) { data = mGData; } else if (type == Sensor.TYPE_MAGNETIC_FIELD) { data = mMData; } else { // we should not be here. return; } for (int i = 0; i < 3 ; i++) { data[i] = event.values[i]; } float[] orientation = new float[3]; SensorManager.getRotationMatrix(mR, null, mGData, mMData); SensorManager.getOrientation(mR, orientation); mHeading = (int) (orientation[0] * 180f / Math.PI) % 360; if (mHeading < 0) { mHeading += 360; } } }
true
true
public void onPictureTaken( final byte [] jpegData, final android.hardware.Camera camera) { if (mPaused) { return; } if (mSceneMode == Util.SCENE_MODE_HDR) { mActivity.showSwitcher(); mActivity.setSwipingEnabled(true); } mJpegPictureCallbackTime = System.currentTimeMillis(); // If postview callback has arrived, the captured image is displayed // in postview callback. If not, the captured image is displayed in // raw picture callback. if (mPostViewPictureCallbackTime != 0) { mShutterToPictureDisplayedTime = mPostViewPictureCallbackTime - mShutterCallbackTime; mPictureDisplayedToJpegCallbackTime = mJpegPictureCallbackTime - mPostViewPictureCallbackTime; } else { mShutterToPictureDisplayedTime = mRawPictureCallbackTime - mShutterCallbackTime; mPictureDisplayedToJpegCallbackTime = mJpegPictureCallbackTime - mRawPictureCallbackTime; } Log.v(TAG, "mPictureDisplayedToJpegCallbackTime = " + mPictureDisplayedToJpegCallbackTime + "ms"); // Only animate when in full screen capture mode // i.e. If monkey/a user swipes to the gallery during picture taking, // don't show animation if (ApiHelper.HAS_SURFACE_TEXTURE && !mIsImageCaptureIntent && mActivity.mShowCameraAppView) { // Finish capture animation mHandler.removeMessages(CAPTURE_ANIMATION_DONE); ((CameraScreenNail) mActivity.mCameraScreenNail).animateSlide(); mHandler.sendEmptyMessageDelayed(CAPTURE_ANIMATION_DONE, CaptureAnimManager.getAnimationDuration()); } mFocusManager.updateFocusUI(); // Ensure focus indicator is hidden. boolean isSamsungHDR = (mSceneMode == Util.SCENE_MODE_HDR && Util.needSamsungHDRFormat()); if (!mIsImageCaptureIntent && (!Util.isZSLEnabled() || isSamsungHDR)) { if (ApiHelper.CAN_START_PREVIEW_IN_JPEG_CALLBACK) { setupPreview(); } else { // Camera HAL of some devices have a bug. Starting preview // immediately after taking a picture will fail. Wait some // time before starting the preview. mHandler.sendEmptyMessageDelayed(SETUP_PREVIEW, 300); } } else if (Util.isZSLEnabled() && !isSamsungHDR) { // In ZSL mode, the preview is not stopped, due to which the // review mode (ImageCapture) doesn't show the captured frame. // Hence stop the preview if ZSL mode is active so that the // preview can be restarted using the onReviewRetakeClicked(). if (mIsImageCaptureIntent) { stopPreview(); } else { mFocusManager.resetTouchFocus(); setCameraState(IDLE); } } if (!mIsImageCaptureIntent) { // Calculate the width and the height of the jpeg. Size s = mParameters.getPictureSize(); final ExifInterface exif = Exif.getExif(jpegData); final int orientation = Exif.getOrientation(exif); final int width, height; if ((mJpegRotation + orientation) % 180 == 0 || isSamsungHDR) { width = s.width; height = s.height; } else { width = s.height; height = s.width; } final String title = mNamedImages.getTitle(); long date = mNamedImages.getDate(); if (title == null) { Log.e(TAG, "Unbalanced name/data pair"); } else { if (date == -1) date = mCaptureStartTime; if (mHeading >= 0) { // heading direction has been updated by the sensor. ExifTag directionRefTag = exif.buildTag( ExifInterface.TAG_GPS_IMG_DIRECTION_REF, ExifInterface.GpsTrackRef.MAGNETIC_DIRECTION); ExifTag directionTag = exif.buildTag( ExifInterface.TAG_GPS_IMG_DIRECTION, new Rational(mHeading, 1)); exif.setTag(directionRefTag); exif.setTag(directionTag); } if (mLocation != null) { exif.addGpsTags(mLocation.getLatitude(), mLocation.getLongitude()); exif.addGpsDateTimeStampTag(date); exif.setTag(exif.buildTag(ExifInterface.TAG_GPS_PROCESSING_METHOD, mLocation.getProvider())); } exif.addDateTimeStampTag(ExifInterface.TAG_DATE_TIME, date, TimeZone.getDefault()); if (isSamsungHDR) { final long finalDate = date; new Thread(new Runnable() { public void run() { ByteArrayOutputStream baos = new ByteArrayOutputStream(); Bitmap bm = Util.decodeYUV422P(jpegData, width, height); if (mJpegRotation != 0) { Matrix matrix = new Matrix(); matrix.postRotate(mJpegRotation); bm = Bitmap.createBitmap(bm, 0, 0, width, height, matrix, true); } bm.compress(Bitmap.CompressFormat.JPEG, CameraSettings.getJpegQualityIntValue(mPreferences), baos); boolean rotated = (mJpegRotation % 180) != 0; mActivity.getMediaSaveService().addImage( baos.toByteArray(), title, finalDate, mLocation, rotated ? height : width, rotated ? width : height, orientation, exif, mOnMediaSavedListener, mContentResolver); } }).start(); } else { mActivity.getMediaSaveService().addImage( jpegData, title, date, mLocation, width, height, orientation, exif, mOnMediaSavedListener, mContentResolver); } } } else { mJpegImageData = jpegData; if (!mQuickCapture) { mUI.showPostCaptureAlert(); } else { onCaptureDone(); } } // Check this in advance of each shot so we don't add to shutter // latency. It's true that someone else could write to the SD card in // the mean time and fill it, but that could have happened between the // shutter press and saving the JPEG too. mActivity.updateStorageSpaceAndHint(); long now = System.currentTimeMillis(); mJpegCallbackFinishTime = now - mJpegPictureCallbackTime; Log.v(TAG, "mJpegCallbackFinishTime = " + mJpegCallbackFinishTime + "ms"); mJpegPictureCallbackTime = 0; }
public void onPictureTaken( final byte [] jpegData, final android.hardware.Camera camera) { if (mPaused) { return; } if (mSceneMode == Util.SCENE_MODE_HDR) { mActivity.showSwitcher(); mActivity.setSwipingEnabled(true); } mJpegPictureCallbackTime = System.currentTimeMillis(); // If postview callback has arrived, the captured image is displayed // in postview callback. If not, the captured image is displayed in // raw picture callback. if (mPostViewPictureCallbackTime != 0) { mShutterToPictureDisplayedTime = mPostViewPictureCallbackTime - mShutterCallbackTime; mPictureDisplayedToJpegCallbackTime = mJpegPictureCallbackTime - mPostViewPictureCallbackTime; } else { mShutterToPictureDisplayedTime = mRawPictureCallbackTime - mShutterCallbackTime; mPictureDisplayedToJpegCallbackTime = mJpegPictureCallbackTime - mRawPictureCallbackTime; } Log.v(TAG, "mPictureDisplayedToJpegCallbackTime = " + mPictureDisplayedToJpegCallbackTime + "ms"); // Only animate when in full screen capture mode // i.e. If monkey/a user swipes to the gallery during picture taking, // don't show animation if (ApiHelper.HAS_SURFACE_TEXTURE && !mIsImageCaptureIntent && mActivity.mShowCameraAppView) { // Finish capture animation mHandler.removeMessages(CAPTURE_ANIMATION_DONE); ((CameraScreenNail) mActivity.mCameraScreenNail).animateSlide(); mHandler.sendEmptyMessageDelayed(CAPTURE_ANIMATION_DONE, CaptureAnimManager.getAnimationDuration()); } mFocusManager.updateFocusUI(); // Ensure focus indicator is hidden. boolean isSamsungHDR = (mSceneMode == Util.SCENE_MODE_HDR && Util.needSamsungHDRFormat()); if (!mIsImageCaptureIntent && (!Util.isZSLEnabled() || isSamsungHDR)) { if (ApiHelper.CAN_START_PREVIEW_IN_JPEG_CALLBACK) { setupPreview(); } else { // Camera HAL of some devices have a bug. Starting preview // immediately after taking a picture will fail. Wait some // time before starting the preview. mHandler.sendEmptyMessageDelayed(SETUP_PREVIEW, 300); } } else { mFocusManager.resetTouchFocus(); setCameraState(IDLE); } if (!mIsImageCaptureIntent) { // Calculate the width and the height of the jpeg. Size s = mParameters.getPictureSize(); final ExifInterface exif = Exif.getExif(jpegData); final int orientation = Exif.getOrientation(exif); final int width, height; if ((mJpegRotation + orientation) % 180 == 0 || isSamsungHDR) { width = s.width; height = s.height; } else { width = s.height; height = s.width; } final String title = mNamedImages.getTitle(); long date = mNamedImages.getDate(); if (title == null) { Log.e(TAG, "Unbalanced name/data pair"); } else { if (date == -1) date = mCaptureStartTime; if (mHeading >= 0) { // heading direction has been updated by the sensor. ExifTag directionRefTag = exif.buildTag( ExifInterface.TAG_GPS_IMG_DIRECTION_REF, ExifInterface.GpsTrackRef.MAGNETIC_DIRECTION); ExifTag directionTag = exif.buildTag( ExifInterface.TAG_GPS_IMG_DIRECTION, new Rational(mHeading, 1)); exif.setTag(directionRefTag); exif.setTag(directionTag); } if (mLocation != null) { exif.addGpsTags(mLocation.getLatitude(), mLocation.getLongitude()); exif.addGpsDateTimeStampTag(date); exif.setTag(exif.buildTag(ExifInterface.TAG_GPS_PROCESSING_METHOD, mLocation.getProvider())); } exif.addDateTimeStampTag(ExifInterface.TAG_DATE_TIME, date, TimeZone.getDefault()); if (isSamsungHDR) { final long finalDate = date; new Thread(new Runnable() { public void run() { ByteArrayOutputStream baos = new ByteArrayOutputStream(); Bitmap bm = Util.decodeYUV422P(jpegData, width, height); if (mJpegRotation != 0) { Matrix matrix = new Matrix(); matrix.postRotate(mJpegRotation); bm = Bitmap.createBitmap(bm, 0, 0, width, height, matrix, true); } bm.compress(Bitmap.CompressFormat.JPEG, CameraSettings.getJpegQualityIntValue(mPreferences), baos); boolean rotated = (mJpegRotation % 180) != 0; mActivity.getMediaSaveService().addImage( baos.toByteArray(), title, finalDate, mLocation, rotated ? height : width, rotated ? width : height, orientation, exif, mOnMediaSavedListener, mContentResolver); } }).start(); } else { mActivity.getMediaSaveService().addImage( jpegData, title, date, mLocation, width, height, orientation, exif, mOnMediaSavedListener, mContentResolver); } } } else { mJpegImageData = jpegData; if (!mQuickCapture) { mUI.showPostCaptureAlert(); } else { onCaptureDone(); } } // Check this in advance of each shot so we don't add to shutter // latency. It's true that someone else could write to the SD card in // the mean time and fill it, but that could have happened between the // shutter press and saving the JPEG too. mActivity.updateStorageSpaceAndHint(); long now = System.currentTimeMillis(); mJpegCallbackFinishTime = now - mJpegPictureCallbackTime; Log.v(TAG, "mJpegCallbackFinishTime = " + mJpegCallbackFinishTime + "ms"); mJpegPictureCallbackTime = 0; }
diff --git a/src/net/mcft/copy/betterstorage/block/BlockReinforcedChest.java b/src/net/mcft/copy/betterstorage/block/BlockReinforcedChest.java index a1524ca..d33f300 100644 --- a/src/net/mcft/copy/betterstorage/block/BlockReinforcedChest.java +++ b/src/net/mcft/copy/betterstorage/block/BlockReinforcedChest.java @@ -1,180 +1,181 @@ package net.mcft.copy.betterstorage.block; import java.util.List; import java.util.Random; import cpw.mods.fml.relauncher.Side; import cpw.mods.fml.relauncher.SideOnly; import net.mcft.copy.betterstorage.api.BetterStorageEnchantment; import net.mcft.copy.betterstorage.api.IKey; import net.mcft.copy.betterstorage.api.ILock; import net.mcft.copy.betterstorage.proxy.ClientProxy; import net.mcft.copy.betterstorage.utils.DirectionUtils; import net.mcft.copy.betterstorage.utils.StackUtils; import net.mcft.copy.betterstorage.utils.WorldUtils; import net.minecraft.block.Block; import net.minecraft.block.BlockContainer; import net.minecraft.block.material.Material; import net.minecraft.client.renderer.texture.IconRegister; import net.minecraft.creativetab.CreativeTabs; import net.minecraft.entity.Entity; import net.minecraft.entity.EntityLiving; import net.minecraft.entity.player.EntityPlayer; import net.minecraft.item.ItemStack; import net.minecraft.tileentity.TileEntity; import net.minecraft.world.IBlockAccess; import net.minecraft.world.World; import net.minecraftforge.common.ForgeDirection; import net.minecraftforge.common.MinecraftForge; public class BlockReinforcedChest extends BlockContainer { public BlockReinforcedChest(int id) { super(id, Material.wood); setHardness(8.0f); setResistance(20.0f); setStepSound(Block.soundWoodFootstep); setBlockBounds(0.0625F, 0.0F, 0.0625F, 0.9375F, 0.875F, 0.9375F); MinecraftForge.setBlockHarvestLevel(this, "axe", 2); } @Override @SideOnly(Side.CLIENT) public void registerIcons(IconRegister iconRegister) { blockIcon = iconRegister.registerIcon("tree_side"); } @Override public boolean isOpaqueCube() { return false; } @Override public boolean renderAsNormalBlock() { return false; } @Override @SideOnly(Side.CLIENT) public int getRenderType() { return ClientProxy.reinforcedChestRenderId; } @Override public int damageDropped(int metadata) { return metadata; } @Override public void getSubBlocks(int id, CreativeTabs tab, List list) { for (ChestMaterial material : ChestMaterial.materials) list.add(new ItemStack(id, 1, material.id)); } @Override public float getBlockHardness(World world, int x, int y, int z) { TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); float hardness = blockHardness; if (chest != null && chest.getLock() != null) { hardness *= 15.0F; int persistance = BetterStorageEnchantment.getLevel(chest.getLock(), "persistance"); if (persistance > 0) hardness *= persistance + 2; } return hardness; } @Override public float getExplosionResistance(Entity entity, World world, int x, int y, int z, double explosionX, double explosionY, double explosionZ) { float modifier = 1.0F; TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); if (chest != null) { int persistance = BetterStorageEnchantment.getLevel(chest.getLock(), "persistance"); if (persistance > 0) modifier += Math.pow(2, persistance); } return super.getExplosionResistance(entity) * modifier; } @Override public void setBlockBoundsBasedOnState(IBlockAccess world, int x, int y, int z) { TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); if (chest.isConnected()) { if (chest.connected == ForgeDirection.NORTH) setBlockBounds(0.0625F, 0.0F, 0.0F, 0.9375F, 0.875F, 0.9375F); else if (chest.connected == ForgeDirection.SOUTH) setBlockBounds(0.0625F, 0.0F, 0.0625F, 0.9375F, 0.875F, 1.0F); else if (chest.connected == ForgeDirection.WEST) setBlockBounds(0.0F, 0.0F, 0.0625F, 0.9375F, 0.875F, 0.9375F); else if (chest.connected == ForgeDirection.EAST) setBlockBounds(0.0625F, 0.0F, 0.0625F, 1.0F, 0.875F, 0.9375F); } else setBlockBounds(0.0625F, 0.0F, 0.0625F, 0.9375F, 0.875F, 0.9375F); } @Override public void onBlockPlacedBy(World world, int x, int y, int z, EntityLiving player, ItemStack stack) { TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); chest.orientation = DirectionUtils.getOrientation(player).getOpposite(); chest.checkForConnections(); } @Override public void breakBlock(World world, int x, int y, int z, int id, int meta) { TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); super.breakBlock(world, x, y, z, id, meta); if (chest != null) { chest.dropContents(); chest.disconnect(); } } @Override public TileEntity createNewTileEntity(World world) { return new TileEntityReinforcedChest(); } @Override public boolean onBlockActivated(World world, int x, int y, int z, EntityPlayer player, int par6, float par7, float par8, float par9) { if (world.isRemote) return true; TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); ItemStack holding = player.getHeldItem(); ItemStack lock = chest.getLock(); ItemStack key = (StackUtils.isKey(holding) ? holding : null); ILock lockType = ((lock != null) ? (ILock)lock.getItem() : null); IKey keyType = ((key != null) ? (IKey)key.getItem() : null); // If the chest isn't locked and item held is // a lock, use it instead of opening the chest. if (lock == null && StackUtils.isLock(holding)) return false; boolean success = (lock == null || chest.canUse(player) || (key != null && keyType.unlock(key, lock, true))); - lockType.onUnlock(lock, key, chest, player, success); + if (lockType != null) + lockType.onUnlock(lock, key, chest, player, success); if (success) chest.openGui(player); return true; } @Override public void onBlockClicked(World world, int x, int y, int z, EntityPlayer player) { if (world.isRemote) return; TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); ItemStack lock = chest.getLock(); if (lock == null) return; ILock lockType = (ILock)lock.getItem(); lockType.applyEffects(lock, chest, player, 3); } // Trigger enchantment related @Override public boolean canProvidePower() { return true; } @Override public int isProvidingWeakPower(IBlockAccess world, int x, int y, int z, int side) { return (WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class).isPowered() ? 15 : 0); } @Override public int isProvidingStrongPower(IBlockAccess world, int x, int y, int z, int side) { return isProvidingWeakPower(world, x, y, z, side); } @Override public void updateTick(World world, int x, int y, int z, Random random) { WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class).setPowered(false); } }
true
true
public boolean onBlockActivated(World world, int x, int y, int z, EntityPlayer player, int par6, float par7, float par8, float par9) { if (world.isRemote) return true; TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); ItemStack holding = player.getHeldItem(); ItemStack lock = chest.getLock(); ItemStack key = (StackUtils.isKey(holding) ? holding : null); ILock lockType = ((lock != null) ? (ILock)lock.getItem() : null); IKey keyType = ((key != null) ? (IKey)key.getItem() : null); // If the chest isn't locked and item held is // a lock, use it instead of opening the chest. if (lock == null && StackUtils.isLock(holding)) return false; boolean success = (lock == null || chest.canUse(player) || (key != null && keyType.unlock(key, lock, true))); lockType.onUnlock(lock, key, chest, player, success); if (success) chest.openGui(player); return true; }
public boolean onBlockActivated(World world, int x, int y, int z, EntityPlayer player, int par6, float par7, float par8, float par9) { if (world.isRemote) return true; TileEntityReinforcedChest chest = WorldUtils.get(world, x, y, z, TileEntityReinforcedChest.class); ItemStack holding = player.getHeldItem(); ItemStack lock = chest.getLock(); ItemStack key = (StackUtils.isKey(holding) ? holding : null); ILock lockType = ((lock != null) ? (ILock)lock.getItem() : null); IKey keyType = ((key != null) ? (IKey)key.getItem() : null); // If the chest isn't locked and item held is // a lock, use it instead of opening the chest. if (lock == null && StackUtils.isLock(holding)) return false; boolean success = (lock == null || chest.canUse(player) || (key != null && keyType.unlock(key, lock, true))); if (lockType != null) lockType.onUnlock(lock, key, chest, player, success); if (success) chest.openGui(player); return true; }
diff --git a/core/java/src/net/i2p/client/naming/SingleFileNamingService.java b/core/java/src/net/i2p/client/naming/SingleFileNamingService.java index f00102c46..30722a04f 100644 --- a/core/java/src/net/i2p/client/naming/SingleFileNamingService.java +++ b/core/java/src/net/i2p/client/naming/SingleFileNamingService.java @@ -1,453 +1,454 @@ /* * free (adj.): unencumbered; not under the control of others * Written by mihi in 2004 and released into the public domain * with no warranty of any kind, either expressed or implied. * It probably won't make your computer catch on fire, or eat * your children, but it might. Use at your own risk. */ package net.i2p.client.naming; import java.io.BufferedReader; import java.io.BufferedWriter; import java.io.File; import java.io.FileInputStream; import java.io.InputStreamReader; import java.io.IOException; import java.io.OutputStream; import java.io.OutputStreamWriter; import java.util.Collections; import java.util.HashMap; import java.util.Iterator; import java.util.List; import java.util.Map; import java.util.Properties; import java.util.Set; import java.util.concurrent.TimeUnit; import java.util.concurrent.locks.ReentrantReadWriteLock; import net.i2p.I2PAppContext; import net.i2p.data.DataFormatException; import net.i2p.data.DataHelper; import net.i2p.data.Destination; import net.i2p.util.FileUtil; import net.i2p.util.Log; import net.i2p.util.SecureFile; import net.i2p.util.SecureFileOutputStream; /** * A naming service based on a single file using the "hosts.txt" format. * Supports adds, removes, and listeners. * * All methods here are case-sensitive. * Conversion to lower case is done in HostsTxtNamingService. * * This does NOT provide .b32.i2p or {b64} resolution. * It also does not do any caching. * Use from HostsTxtNamingService or chain with another NamingService * via MetaNamingService if you need those features. * * @since 0.8.5 */ public class SingleFileNamingService extends NamingService { private final static Log _log = new Log(SingleFileNamingService.class); private final File _file; private final ReentrantReadWriteLock _fileLock; /** cached number of entries */ private int _size; /** last write time */ private long _lastWrite; public SingleFileNamingService(I2PAppContext context, String filename) { super(context); File file = new File(filename); if (!file.isAbsolute()) file = new File(context.getRouterDir(), filename); _file = file; _fileLock = new ReentrantReadWriteLock(true); } /** * @return the base file name */ @Override public String getName() { return _file.getAbsolutePath(); } /** * @param hostname case-sensitive; caller should convert to lower case * @param lookupOptions ignored * @param storedOptions ignored */ @Override public Destination lookup(String hostname, Properties lookupOptions, Properties storedOptions) { try { String key = getKey(hostname); if (key != null) return lookupBase64(key); } catch (Exception ioe) { if (_file.exists()) _log.error("Error loading hosts file " + _file, ioe); else if (_log.shouldLog(Log.WARN)) _log.warn("Error loading hosts file " + _file, ioe); } return null; } /** * @param options ignored */ @Override public String reverseLookup(Destination dest, Properties options) { String destkey = dest.toBase64(); BufferedReader in = null; getReadLock(); try { in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); String line = null; while ( (line = in.readLine()) != null) { if (line.startsWith("#")) continue; if (line.indexOf('#') > 0) // trim off any end of line comment line = line.substring(0, line.indexOf('#')).trim(); int split = line.indexOf('='); if (split <= 0) continue; if (destkey.equals(line.substring(split + 1))) return line.substring(0, split); } return null; } catch (Exception ioe) { if (_file.exists()) _log.error("Error loading hosts file " + _file, ioe); else if (_log.shouldLog(Log.WARN)) _log.warn("Error loading hosts file " + _file, ioe); return null; } finally { releaseReadLock(); } } /** * Better than DataHelper.loadProps(), doesn't load the whole file into memory, * and stops when it finds a match. * * @param host case-sensitive; caller should convert to lower case */ private String getKey(String host) throws IOException { BufferedReader in = null; getReadLock(); try { in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); String line = null; String search = host + '='; while ( (line = in.readLine()) != null) { if (!line.startsWith(search)) continue; if (line.indexOf('#') > 0) // trim off any end of line comment line = line.substring(0, line.indexOf('#')).trim(); int split = line.indexOf('='); return line.substring(split+1); //.trim() ?????????????? } } finally { if (in != null) try { in.close(); } catch (IOException ioe) {} releaseReadLock(); } return null; } /** * @param hostname case-sensitive; caller should convert to lower case * @param options ignored */ @Override public boolean put(String hostname, Destination d, Properties options) { // try easy way first, most adds are not replaces if (putIfAbsent(hostname, d, options)) return true; if (!getWriteLock()) return false; BufferedReader in = null; BufferedWriter out = null; try { File tmp = SecureFile.createTempFile("temp-", ".tmp", _file.getAbsoluteFile().getParentFile()); out = new BufferedWriter(new OutputStreamWriter(new SecureFileOutputStream(tmp), "UTF-8")); if (_file.exists()) { in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); String line = null; String search = hostname + '='; while ( (line = in.readLine()) != null) { if (line.startsWith(search)) continue; out.write(line); out.newLine(); } in.close(); } out.write(hostname); out.write('='); out.write(d.toBase64()); out.newLine(); out.close(); boolean success = rename(tmp, _file); if (success) { for (NamingServiceListener nsl : _listeners) { nsl.entryChanged(this, hostname, d, options); } } return success; } catch (IOException ioe) { if (in != null) try { in.close(); } catch (IOException e) {} if (out != null) try { out.close(); } catch (IOException e) {} _log.error("Error adding " + hostname, ioe); return false; } finally { releaseWriteLock(); } } /** * @param hostname case-sensitive; caller should convert to lower case * @param options ignored */ @Override public boolean putIfAbsent(String hostname, Destination d, Properties options) { if (!getWriteLock()) return false; OutputStream out = null; try { // simply check if present, and if not, append try { if (getKey(hostname) != null) return false; } catch (IOException ioe) { if (_file.exists()) { _log.error("Error adding " + hostname, ioe); return false; } // else new file } out = new SecureFileOutputStream(_file, true); // FIXME fails if previous last line didn't have a trailing \n out.write(hostname.getBytes("UTF-8")); out.write('='); out.write(d.toBase64().getBytes()); out.write('\n'); out.close(); for (NamingServiceListener nsl : _listeners) { nsl.entryAdded(this, hostname, d, options); } return true; } catch (IOException ioe) { if (out != null) try { out.close(); } catch (IOException e) {} _log.error("Error adding " + hostname, ioe); return false; } finally { releaseWriteLock(); } } /** * @param hostname case-sensitive; caller should convert to lower case * @param options ignored */ @Override public boolean remove(String hostname, Properties options) { if (!getWriteLock()) return false; if (!_file.exists()) return false; BufferedReader in = null; BufferedWriter out = null; try { in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); File tmp = SecureFile.createTempFile("temp-", ".tmp", _file.getAbsoluteFile().getParentFile()); out = new BufferedWriter(new OutputStreamWriter(new SecureFileOutputStream(tmp), "UTF-8")); String line = null; String search = hostname + '='; boolean success = false; while ( (line = in.readLine()) != null) { if (line.startsWith(search)) { success = true; continue; } out.write(line); out.newLine(); } in.close(); out.close(); if (!success) { tmp.delete(); return false; } success = rename(tmp, _file); if (success) { for (NamingServiceListener nsl : _listeners) { nsl.entryRemoved(this, hostname); } } return success; } catch (IOException ioe) { if (in != null) try { in.close(); } catch (IOException e) {} if (out != null) try { out.close(); } catch (IOException e) {} _log.error("Error removing " + hostname, ioe); return false; } finally { releaseWriteLock(); } } /** * @param options As follows: * Key "search": return only those matching substring * Key "startsWith": return only those starting with * ("[0-9]" allowed) */ @Override public Map<String, Destination> getEntries(Properties options) { if (!_file.exists()) return Collections.EMPTY_MAP; String searchOpt = null; String startsWith = null; if (options != null) { searchOpt = options.getProperty("search"); startsWith = options.getProperty("startsWith"); } + if (_log.shouldLog(Log.DEBUG)) + _log.debug("Searching " + " starting with " + startsWith + " search string " + searchOpt); BufferedReader in = null; getReadLock(); try { in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); String line = null; - String search = startsWith == null ? null : startsWith + '='; Map<String, Destination> rv = new HashMap(); while ( (line = in.readLine()) != null) { if (line.length() <= 0) continue; - if (search != null) { + if (startsWith != null) { if (startsWith.equals("[0-9]")) { if (line.charAt(0) < '0' || line.charAt(0) > '9') continue; - } else if (!line.startsWith(search)) { + } else if (!line.startsWith(startsWith)) { continue; } } if (line.startsWith("#")) continue; if (line.indexOf('#') > 0) // trim off any end of line comment line = line.substring(0, line.indexOf('#')).trim(); int split = line.indexOf('='); if (split <= 0) continue; String key = line.substring(0, split); if (searchOpt != null && key.indexOf(searchOpt) < 0) continue; String b64 = line.substring(split+1); //.trim() ?????????????? try { Destination dest = new Destination(b64); rv.put(key, dest); } catch (DataFormatException dfe) {} } if (searchOpt == null && startsWith == null) { _lastWrite = _file.lastModified(); _size = rv.size(); } return rv; } catch (IOException ioe) { _log.error("getEntries error", ioe); return Collections.EMPTY_MAP; } finally { if (in != null) try { in.close(); } catch (IOException ioe) {} releaseReadLock(); } } /** * @param options ignored */ @Override public int size(Properties options) { if (!_file.exists()) return 0; BufferedReader in = null; getReadLock(); try { if (_file.lastModified() <= _lastWrite) return _size; in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); String line = null; int rv = 0; while ( (line = in.readLine()) != null) { if (line.startsWith("#") || line.length() <= 0) continue; rv++; } _lastWrite = _file.lastModified(); _size = rv; return rv; } catch (IOException ioe) { _log.error("size() error", ioe); return -1; } finally { if (in != null) try { in.close(); } catch (IOException ioe) {} releaseReadLock(); } } private static boolean rename(File from, File to) { boolean success = false; boolean isWindows = System.getProperty("os.name").startsWith("Win"); // overwrite fails on windows if (!isWindows) success = from.renameTo(to); if (!success) { to.delete(); success = from.renameTo(to); if (!success) { // hard way success = FileUtil.copy(from.getAbsolutePath(), to.getAbsolutePath(), true, true); from.delete(); } } return success; } private void getReadLock() { _fileLock.readLock().lock(); } private void releaseReadLock() { _fileLock.readLock().unlock(); } /** @return true if the lock was acquired */ private boolean getWriteLock() { try { boolean rv = _fileLock.writeLock().tryLock(10000, TimeUnit.MILLISECONDS); if ((!rv) && _log.shouldLog(Log.WARN)) _log.warn("no lock, size is: " + _fileLock.getQueueLength(), new Exception("rats")); return rv; } catch (InterruptedException ie) {} return false; } private void releaseWriteLock() { _fileLock.writeLock().unlock(); } public static void main(String[] args) { NamingService ns = new SingleFileNamingService(I2PAppContext.getGlobalContext(), "hosts.txt"); Destination d = new Destination(); try { d.readBytes(new byte[387], 0); } catch (DataFormatException dfe) {} boolean b = ns.put("aaaaa", d); System.out.println("Test 1 pass? " + b); b = ns.put("bbbbb", d); System.out.println("Test 2 pass? " + b); b = ns.remove("aaaaa"); System.out.println("Test 3 pass? " + b); b = ns.lookup("aaaaa") == null; System.out.println("Test 4 pass? " + b); b = ns.lookup("bbbbb") != null; System.out.println("Test 5 pass? " + b); b = !ns.putIfAbsent("bbbbb", d); System.out.println("Test 6 pass? " + b); } }
false
true
public Map<String, Destination> getEntries(Properties options) { if (!_file.exists()) return Collections.EMPTY_MAP; String searchOpt = null; String startsWith = null; if (options != null) { searchOpt = options.getProperty("search"); startsWith = options.getProperty("startsWith"); } BufferedReader in = null; getReadLock(); try { in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); String line = null; String search = startsWith == null ? null : startsWith + '='; Map<String, Destination> rv = new HashMap(); while ( (line = in.readLine()) != null) { if (line.length() <= 0) continue; if (search != null) { if (startsWith.equals("[0-9]")) { if (line.charAt(0) < '0' || line.charAt(0) > '9') continue; } else if (!line.startsWith(search)) { continue; } } if (line.startsWith("#")) continue; if (line.indexOf('#') > 0) // trim off any end of line comment line = line.substring(0, line.indexOf('#')).trim(); int split = line.indexOf('='); if (split <= 0) continue; String key = line.substring(0, split); if (searchOpt != null && key.indexOf(searchOpt) < 0) continue; String b64 = line.substring(split+1); //.trim() ?????????????? try { Destination dest = new Destination(b64); rv.put(key, dest); } catch (DataFormatException dfe) {} } if (searchOpt == null && startsWith == null) { _lastWrite = _file.lastModified(); _size = rv.size(); } return rv; } catch (IOException ioe) { _log.error("getEntries error", ioe); return Collections.EMPTY_MAP; } finally { if (in != null) try { in.close(); } catch (IOException ioe) {} releaseReadLock(); } }
public Map<String, Destination> getEntries(Properties options) { if (!_file.exists()) return Collections.EMPTY_MAP; String searchOpt = null; String startsWith = null; if (options != null) { searchOpt = options.getProperty("search"); startsWith = options.getProperty("startsWith"); } if (_log.shouldLog(Log.DEBUG)) _log.debug("Searching " + " starting with " + startsWith + " search string " + searchOpt); BufferedReader in = null; getReadLock(); try { in = new BufferedReader(new InputStreamReader(new FileInputStream(_file), "UTF-8"), 16*1024); String line = null; Map<String, Destination> rv = new HashMap(); while ( (line = in.readLine()) != null) { if (line.length() <= 0) continue; if (startsWith != null) { if (startsWith.equals("[0-9]")) { if (line.charAt(0) < '0' || line.charAt(0) > '9') continue; } else if (!line.startsWith(startsWith)) { continue; } } if (line.startsWith("#")) continue; if (line.indexOf('#') > 0) // trim off any end of line comment line = line.substring(0, line.indexOf('#')).trim(); int split = line.indexOf('='); if (split <= 0) continue; String key = line.substring(0, split); if (searchOpt != null && key.indexOf(searchOpt) < 0) continue; String b64 = line.substring(split+1); //.trim() ?????????????? try { Destination dest = new Destination(b64); rv.put(key, dest); } catch (DataFormatException dfe) {} } if (searchOpt == null && startsWith == null) { _lastWrite = _file.lastModified(); _size = rv.size(); } return rv; } catch (IOException ioe) { _log.error("getEntries error", ioe); return Collections.EMPTY_MAP; } finally { if (in != null) try { in.close(); } catch (IOException ioe) {} releaseReadLock(); } }
diff --git a/OpTalk/OpTalk/src/be/infogroep/optalk/ItemShare.java b/OpTalk/OpTalk/src/be/infogroep/optalk/ItemShare.java index 5669fbc..938df38 100644 --- a/OpTalk/OpTalk/src/be/infogroep/optalk/ItemShare.java +++ b/OpTalk/OpTalk/src/be/infogroep/optalk/ItemShare.java @@ -1,129 +1,131 @@ package be.infogroep.optalk; //import java.util.Map; import java.util.*; import org.bukkit.Bukkit; import org.bukkit.Material; import org.bukkit.command.CommandSender; import org.bukkit.enchantments.Enchantment; import org.bukkit.entity.*; import org.bukkit.inventory.*; import org.bukkit.inventory.meta.*; import org.bukkit.potion.*; public class ItemShare { private int header = 5; private boolean potion = false; private Player receiver_ = null; private Player sender_; private ItemStack item_; private ItemMeta meta_; private String itemName_; ItemShare(CommandSender sender, String[] msg) { Bukkit.getLogger().info("ItemShare"); if (msg.length > 0) { String name = msg[0]; receiver_ = Bukkit.getServer().getPlayer(name); } sender_ = (Player) sender; item_ = sender_.getItemInHand(); meta_ = item_.getItemMeta(); if (meta_ != null) { if (meta_.hasDisplayName()) itemName_ = meta_.getDisplayName(); else itemName_ = item_.getType().name(); } else itemName_ = // item_.getType().name(); item_.getData().getClass().getName(); Map<Enchantment, Integer> enchants = /* item_.getEnchantments(); */ item_.getEnchantments(); Collection<PotionEffect> effects = null; Material material_ = item_.getType(); if (material_.getId() == 387) {// special case book BookMeta BM = (BookMeta) meta_; itemName_ = BM.getTitle() + " - " + BM.getAuthor(); } if (material_.getId() == 403) {// special case enchanted book EnchantmentStorageMeta ESM = (EnchantmentStorageMeta) meta_; enchants = ESM.getStoredEnchants(); } if (material_.getId() == 373) {// special case potions potion = true; PotionMeta PM = (PotionMeta) meta_; if (PM.hasDisplayName()) itemName_ = PM.getDisplayName(); effects = PM.getCustomEffects(); } // Recipe R = ShapedRecipe(item_); int EnchantsSize = enchants.size(); int EnchantsHeaderSize = 1; if (EnchantsSize > 0) EnchantsHeaderSize = EnchantsSize; else if (effects != null) { if (effects.size() != 0) EnchantsHeaderSize = effects.size(); } String[] message = new String[header + EnchantsHeaderSize]; message[0] = "§5" + sender.getName() + ": §6shared an item"; message[1] = "§aItem name: §b" + itemName_; message[2] = "§aType: §b" + material_.name().replace("_", " ").toLowerCase(); if (potion) message[3] = "§aEffect: "; else message[3] = "§aEnchanments: "; int index = 4; if (EnchantsSize > 0) { for (Map.Entry<Enchantment, Integer> current : enchants.entrySet()) { message[index] = current.getKey().getName() + " Level: " + current.getValue(); index = index + 1; } - } else if (!effects.isEmpty()) { - for (PotionEffect P : effects) { - message[index] = P.getType().getName() + ": " + P.getDuration(); + } else if (effects != null) + if (!effects.isEmpty()) { + for (PotionEffect P : effects) { + message[index] = P.getType().getName() + ": " + + P.getDuration(); + } + } else { + message[index] = "None"; + index = index + 1; } - } else { - message[index] = "None"; - index = index + 1; - } message[index] = "§a-------------------"; if (null == receiver_) { if (msg.length == 0) { Bukkit.getServer().broadcastMessage("§a§nPublicly shared item"); for (String s : message) { Bukkit.getServer().broadcastMessage(s); } } else { sender.sendMessage("§ccould not find player: " + msg[0]); } } else { receiver_.sendMessage(message); sender.sendMessage("§asuccesfully shared your item with " + msg[0]); } } }
false
true
ItemShare(CommandSender sender, String[] msg) { Bukkit.getLogger().info("ItemShare"); if (msg.length > 0) { String name = msg[0]; receiver_ = Bukkit.getServer().getPlayer(name); } sender_ = (Player) sender; item_ = sender_.getItemInHand(); meta_ = item_.getItemMeta(); if (meta_ != null) { if (meta_.hasDisplayName()) itemName_ = meta_.getDisplayName(); else itemName_ = item_.getType().name(); } else itemName_ = // item_.getType().name(); item_.getData().getClass().getName(); Map<Enchantment, Integer> enchants = /* item_.getEnchantments(); */ item_.getEnchantments(); Collection<PotionEffect> effects = null; Material material_ = item_.getType(); if (material_.getId() == 387) {// special case book BookMeta BM = (BookMeta) meta_; itemName_ = BM.getTitle() + " - " + BM.getAuthor(); } if (material_.getId() == 403) {// special case enchanted book EnchantmentStorageMeta ESM = (EnchantmentStorageMeta) meta_; enchants = ESM.getStoredEnchants(); } if (material_.getId() == 373) {// special case potions potion = true; PotionMeta PM = (PotionMeta) meta_; if (PM.hasDisplayName()) itemName_ = PM.getDisplayName(); effects = PM.getCustomEffects(); } // Recipe R = ShapedRecipe(item_); int EnchantsSize = enchants.size(); int EnchantsHeaderSize = 1; if (EnchantsSize > 0) EnchantsHeaderSize = EnchantsSize; else if (effects != null) { if (effects.size() != 0) EnchantsHeaderSize = effects.size(); } String[] message = new String[header + EnchantsHeaderSize]; message[0] = "§5" + sender.getName() + ": §6shared an item"; message[1] = "§aItem name: §b" + itemName_; message[2] = "§aType: §b" + material_.name().replace("_", " ").toLowerCase(); if (potion) message[3] = "§aEffect: "; else message[3] = "§aEnchanments: "; int index = 4; if (EnchantsSize > 0) { for (Map.Entry<Enchantment, Integer> current : enchants.entrySet()) { message[index] = current.getKey().getName() + " Level: " + current.getValue(); index = index + 1; } } else if (!effects.isEmpty()) { for (PotionEffect P : effects) { message[index] = P.getType().getName() + ": " + P.getDuration(); } } else { message[index] = "None"; index = index + 1; } message[index] = "§a-------------------"; if (null == receiver_) { if (msg.length == 0) { Bukkit.getServer().broadcastMessage("§a§nPublicly shared item"); for (String s : message) { Bukkit.getServer().broadcastMessage(s); } } else { sender.sendMessage("§ccould not find player: " + msg[0]); } } else { receiver_.sendMessage(message); sender.sendMessage("§asuccesfully shared your item with " + msg[0]); } }
ItemShare(CommandSender sender, String[] msg) { Bukkit.getLogger().info("ItemShare"); if (msg.length > 0) { String name = msg[0]; receiver_ = Bukkit.getServer().getPlayer(name); } sender_ = (Player) sender; item_ = sender_.getItemInHand(); meta_ = item_.getItemMeta(); if (meta_ != null) { if (meta_.hasDisplayName()) itemName_ = meta_.getDisplayName(); else itemName_ = item_.getType().name(); } else itemName_ = // item_.getType().name(); item_.getData().getClass().getName(); Map<Enchantment, Integer> enchants = /* item_.getEnchantments(); */ item_.getEnchantments(); Collection<PotionEffect> effects = null; Material material_ = item_.getType(); if (material_.getId() == 387) {// special case book BookMeta BM = (BookMeta) meta_; itemName_ = BM.getTitle() + " - " + BM.getAuthor(); } if (material_.getId() == 403) {// special case enchanted book EnchantmentStorageMeta ESM = (EnchantmentStorageMeta) meta_; enchants = ESM.getStoredEnchants(); } if (material_.getId() == 373) {// special case potions potion = true; PotionMeta PM = (PotionMeta) meta_; if (PM.hasDisplayName()) itemName_ = PM.getDisplayName(); effects = PM.getCustomEffects(); } // Recipe R = ShapedRecipe(item_); int EnchantsSize = enchants.size(); int EnchantsHeaderSize = 1; if (EnchantsSize > 0) EnchantsHeaderSize = EnchantsSize; else if (effects != null) { if (effects.size() != 0) EnchantsHeaderSize = effects.size(); } String[] message = new String[header + EnchantsHeaderSize]; message[0] = "§5" + sender.getName() + ": §6shared an item"; message[1] = "§aItem name: §b" + itemName_; message[2] = "§aType: §b" + material_.name().replace("_", " ").toLowerCase(); if (potion) message[3] = "§aEffect: "; else message[3] = "§aEnchanments: "; int index = 4; if (EnchantsSize > 0) { for (Map.Entry<Enchantment, Integer> current : enchants.entrySet()) { message[index] = current.getKey().getName() + " Level: " + current.getValue(); index = index + 1; } } else if (effects != null) if (!effects.isEmpty()) { for (PotionEffect P : effects) { message[index] = P.getType().getName() + ": " + P.getDuration(); } } else { message[index] = "None"; index = index + 1; } message[index] = "§a-------------------"; if (null == receiver_) { if (msg.length == 0) { Bukkit.getServer().broadcastMessage("§a§nPublicly shared item"); for (String s : message) { Bukkit.getServer().broadcastMessage(s); } } else { sender.sendMessage("§ccould not find player: " + msg[0]); } } else { receiver_.sendMessage(message); sender.sendMessage("§asuccesfully shared your item with " + msg[0]); } }
diff --git a/plugins/org.bigraph.model/src/org/bigraph/model/SignatureDescriptorHandler.java b/plugins/org.bigraph.model/src/org/bigraph/model/SignatureDescriptorHandler.java index 1bc57f15..c1eaa54c 100644 --- a/plugins/org.bigraph.model/src/org/bigraph/model/SignatureDescriptorHandler.java +++ b/plugins/org.bigraph.model/src/org/bigraph/model/SignatureDescriptorHandler.java @@ -1,99 +1,99 @@ package org.bigraph.model; import org.bigraph.model.Signature.ChangeAddControlDescriptor; import org.bigraph.model.Signature.ChangeAddSignatureDescriptor; import org.bigraph.model.Signature.ChangeRemoveControlDescriptor; import org.bigraph.model.Signature.ChangeRemoveSignatureDescriptor; import org.bigraph.model.assistants.PropertyScratchpad; import org.bigraph.model.assistants.IObjectIdentifier.Resolver; import org.bigraph.model.changes.descriptors.ChangeCreationException; import org.bigraph.model.changes.descriptors.IChangeDescriptor; final class SignatureDescriptorHandler extends HandlerUtilities.DescriptorHandlerImpl { @Override public boolean tryValidateChange(Process context, IChangeDescriptor change) throws ChangeCreationException { final PropertyScratchpad scratch = context.getScratch(); final Resolver resolver = context.getResolver(); if (change instanceof ChangeAddControlDescriptor) { ChangeAddControlDescriptor cd = (ChangeAddControlDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); NamedModelObjectDescriptorHandler.checkName(scratch, cd, cd.getControl(), s.getNamespace(), cd.getControl().getName()); } else if (change instanceof ChangeRemoveControlDescriptor) { ChangeRemoveControlDescriptor cd = (ChangeRemoveControlDescriptor)change; tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); Control c = tryLookup( cd, cd.getControl(), scratch, resolver, Control.class); if (c.getPorts(scratch).size() != 0) throw new ChangeCreationException(cd, "" + cd.getControl() + " still has ports " + "that must be removed first"); - if (c.getExtendedDataMap().size() != 0) + if (c.getExtendedDataMap(scratch).size() != 0) throw new ChangeCreationException(cd, "" + cd.getControl() + " still has extended data " + "that must be removed first"); } else if (change instanceof ChangeAddSignatureDescriptor) { ChangeAddSignatureDescriptor cd = (ChangeAddSignatureDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); Signature ch = cd.getSignature(); if (ch == null) throw new ChangeCreationException(cd, "Can't insert a null signature"); HandlerUtilities.checkAddBounds(cd, s.getSignatures(scratch), cd.getPosition()); } else if (change instanceof ChangeRemoveSignatureDescriptor) { ChangeRemoveSignatureDescriptor cd = (ChangeRemoveSignatureDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); HandlerUtilities.checkRemove(cd, s.getSignatures(scratch), cd.getSignature(), cd.getPosition()); } else return false; return true; } @Override public boolean executeChange(Resolver resolver, IChangeDescriptor change) { if (change instanceof ChangeAddControlDescriptor) { ChangeAddControlDescriptor cd = (ChangeAddControlDescriptor)change; Signature s = cd.getTarget().lookup(null, resolver); Control c = new Control(); c.setName(s.getNamespace().put(cd.getControl().getName(), c)); s.addControl(c); } else if (change instanceof ChangeRemoveControlDescriptor) { ChangeRemoveControlDescriptor cd = (ChangeRemoveControlDescriptor)change; Signature s = cd.getTarget().lookup(null, resolver); Control c = cd.getControl().lookup(null, resolver); s.removeControl(c); s.getNamespace().remove(c.getName()); } else if (change instanceof ChangeAddSignatureDescriptor) { ChangeAddSignatureDescriptor cd = (ChangeAddSignatureDescriptor)change; cd.getTarget().lookup(null, resolver).addSignature( cd.getPosition(), cd.getSignature()); } else if (change instanceof ChangeRemoveSignatureDescriptor) { ChangeRemoveSignatureDescriptor cd = (ChangeRemoveSignatureDescriptor)change; cd.getTarget().lookup(null, resolver).removeSignature( cd.getSignature()); } else return false; return true; } }
true
true
public boolean tryValidateChange(Process context, IChangeDescriptor change) throws ChangeCreationException { final PropertyScratchpad scratch = context.getScratch(); final Resolver resolver = context.getResolver(); if (change instanceof ChangeAddControlDescriptor) { ChangeAddControlDescriptor cd = (ChangeAddControlDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); NamedModelObjectDescriptorHandler.checkName(scratch, cd, cd.getControl(), s.getNamespace(), cd.getControl().getName()); } else if (change instanceof ChangeRemoveControlDescriptor) { ChangeRemoveControlDescriptor cd = (ChangeRemoveControlDescriptor)change; tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); Control c = tryLookup( cd, cd.getControl(), scratch, resolver, Control.class); if (c.getPorts(scratch).size() != 0) throw new ChangeCreationException(cd, "" + cd.getControl() + " still has ports " + "that must be removed first"); if (c.getExtendedDataMap().size() != 0) throw new ChangeCreationException(cd, "" + cd.getControl() + " still has extended data " + "that must be removed first"); } else if (change instanceof ChangeAddSignatureDescriptor) { ChangeAddSignatureDescriptor cd = (ChangeAddSignatureDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); Signature ch = cd.getSignature(); if (ch == null) throw new ChangeCreationException(cd, "Can't insert a null signature"); HandlerUtilities.checkAddBounds(cd, s.getSignatures(scratch), cd.getPosition()); } else if (change instanceof ChangeRemoveSignatureDescriptor) { ChangeRemoveSignatureDescriptor cd = (ChangeRemoveSignatureDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); HandlerUtilities.checkRemove(cd, s.getSignatures(scratch), cd.getSignature(), cd.getPosition()); } else return false; return true; }
public boolean tryValidateChange(Process context, IChangeDescriptor change) throws ChangeCreationException { final PropertyScratchpad scratch = context.getScratch(); final Resolver resolver = context.getResolver(); if (change instanceof ChangeAddControlDescriptor) { ChangeAddControlDescriptor cd = (ChangeAddControlDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); NamedModelObjectDescriptorHandler.checkName(scratch, cd, cd.getControl(), s.getNamespace(), cd.getControl().getName()); } else if (change instanceof ChangeRemoveControlDescriptor) { ChangeRemoveControlDescriptor cd = (ChangeRemoveControlDescriptor)change; tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); Control c = tryLookup( cd, cd.getControl(), scratch, resolver, Control.class); if (c.getPorts(scratch).size() != 0) throw new ChangeCreationException(cd, "" + cd.getControl() + " still has ports " + "that must be removed first"); if (c.getExtendedDataMap(scratch).size() != 0) throw new ChangeCreationException(cd, "" + cd.getControl() + " still has extended data " + "that must be removed first"); } else if (change instanceof ChangeAddSignatureDescriptor) { ChangeAddSignatureDescriptor cd = (ChangeAddSignatureDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); Signature ch = cd.getSignature(); if (ch == null) throw new ChangeCreationException(cd, "Can't insert a null signature"); HandlerUtilities.checkAddBounds(cd, s.getSignatures(scratch), cd.getPosition()); } else if (change instanceof ChangeRemoveSignatureDescriptor) { ChangeRemoveSignatureDescriptor cd = (ChangeRemoveSignatureDescriptor)change; Signature s = tryLookup(cd, cd.getTarget(), scratch, resolver, Signature.class); HandlerUtilities.checkRemove(cd, s.getSignatures(scratch), cd.getSignature(), cd.getPosition()); } else return false; return true; }
diff --git a/src/main/java/org/jsonman/NodeUpdater.java b/src/main/java/org/jsonman/NodeUpdater.java index e465c39..37c64aa 100644 --- a/src/main/java/org/jsonman/NodeUpdater.java +++ b/src/main/java/org/jsonman/NodeUpdater.java @@ -1,113 +1,113 @@ /* * Copyright 2013 Takao Nakaguchi. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.jsonman; import java.text.ParseException; import java.util.Iterator; import org.jsonman.finder.Reference; import org.jsonman.finder.ReferenceParser; import org.jsonman.node.ArrayNode; import org.jsonman.node.MapNode; public class NodeUpdater { public NodeUpdater(Node target){ this.target = target; } public Node getTarget() { return target; } public void update(String referencePath, Node node) throws ParseException{ update(ReferenceParser.parse(referencePath), node); } public void update(Iterable<Reference> path, Node node){ final Iterator<Reference> it = path.iterator(); Node t = target; while(true){ Reference r = it.next(); if(t.isArray() && r.isArray()){ ArrayNode an = t.cast(); Integer index = r.getId(); t = an.getChild(index); if(t != null){ if(!it.hasNext()){ if(t.isMap() && node.isMap()){ ((MapNode)t).mergeValue((MapNode)node); } else{ t.setValue(node.getValue()); } break; } continue; } else{ an.setChild(index, createNode(it, node)); break; } } else if(t.isMap() && r.isMap()){ MapNode mn = t.cast(); String name = r.getId(); t = mn.getChild(name); if(t != null){ if(!it.hasNext()){ if(t.isMap() && node.isMap()){ ((MapNode)t).mergeValue((MapNode)node); } else{ - t.setValue(node.getValue()); + mn.setChild(name, node); } break; } continue; } else{ mn.setChild(name, createNode(it, node)); break; } } else{ throw new RuntimeException(String.format( "type of node(%s) and reference(%s) not match.", t.getClass().getName(), r.getClass().getName() )); } } } static Node createNode(Iterator<Reference> it, Node leaf){ Reference ref = it.next(); Node child = null; if(it.hasNext()){ child = createNode(it, leaf); } else{ child = leaf; } Node n = null; if(ref.isMap()){ MapNode mn = new MapNode(); mn.appendChild((String)ref.getId(), child); n = mn; } else if(ref.isArray()){ ArrayNode an = new ArrayNode(); an.setChild((Integer)ref.getId(), child); n = an; } else{ return null; } return n; } private Node target; }
true
true
public void update(Iterable<Reference> path, Node node){ final Iterator<Reference> it = path.iterator(); Node t = target; while(true){ Reference r = it.next(); if(t.isArray() && r.isArray()){ ArrayNode an = t.cast(); Integer index = r.getId(); t = an.getChild(index); if(t != null){ if(!it.hasNext()){ if(t.isMap() && node.isMap()){ ((MapNode)t).mergeValue((MapNode)node); } else{ t.setValue(node.getValue()); } break; } continue; } else{ an.setChild(index, createNode(it, node)); break; } } else if(t.isMap() && r.isMap()){ MapNode mn = t.cast(); String name = r.getId(); t = mn.getChild(name); if(t != null){ if(!it.hasNext()){ if(t.isMap() && node.isMap()){ ((MapNode)t).mergeValue((MapNode)node); } else{ t.setValue(node.getValue()); } break; } continue; } else{ mn.setChild(name, createNode(it, node)); break; } } else{ throw new RuntimeException(String.format( "type of node(%s) and reference(%s) not match.", t.getClass().getName(), r.getClass().getName() )); } } }
public void update(Iterable<Reference> path, Node node){ final Iterator<Reference> it = path.iterator(); Node t = target; while(true){ Reference r = it.next(); if(t.isArray() && r.isArray()){ ArrayNode an = t.cast(); Integer index = r.getId(); t = an.getChild(index); if(t != null){ if(!it.hasNext()){ if(t.isMap() && node.isMap()){ ((MapNode)t).mergeValue((MapNode)node); } else{ t.setValue(node.getValue()); } break; } continue; } else{ an.setChild(index, createNode(it, node)); break; } } else if(t.isMap() && r.isMap()){ MapNode mn = t.cast(); String name = r.getId(); t = mn.getChild(name); if(t != null){ if(!it.hasNext()){ if(t.isMap() && node.isMap()){ ((MapNode)t).mergeValue((MapNode)node); } else{ mn.setChild(name, node); } break; } continue; } else{ mn.setChild(name, createNode(it, node)); break; } } else{ throw new RuntimeException(String.format( "type of node(%s) and reference(%s) not match.", t.getClass().getName(), r.getClass().getName() )); } } }
diff --git a/core/src/java/org/apache/ftpserver/command/MKD.java b/core/src/java/org/apache/ftpserver/command/MKD.java index d2e9af5a..bccabf36 100644 --- a/core/src/java/org/apache/ftpserver/command/MKD.java +++ b/core/src/java/org/apache/ftpserver/command/MKD.java @@ -1,144 +1,144 @@ /* * Licensed to the Apache Software Foundation (ASF) under one * or more contributor license agreements. See the NOTICE file * distributed with this work for additional information * regarding copyright ownership. The ASF licenses this file * to you under the Apache License, Version 2.0 (the * "License"); you may not use this file except in compliance * with the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, * software distributed under the License is distributed on an * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY * KIND, either express or implied. See the License for the * specific language governing permissions and limitations * under the License. */ package org.apache.ftpserver.command; import java.io.File; import java.io.IOException; import org.apache.ftpserver.FtpSessionImpl; import org.apache.ftpserver.ftplet.FileObject; import org.apache.ftpserver.ftplet.FtpException; import org.apache.ftpserver.ftplet.FtpReply; import org.apache.ftpserver.ftplet.FtpReplyOutput; import org.apache.ftpserver.ftplet.FtpRequest; import org.apache.ftpserver.ftplet.Ftplet; import org.apache.ftpserver.ftplet.FtpletEnum; import org.apache.ftpserver.interfaces.FtpServerContext; import org.apache.ftpserver.interfaces.ServerFtpStatistics; import org.apache.ftpserver.listener.Connection; import org.apache.ftpserver.util.FtpReplyUtil; import org.slf4j.Logger; import org.slf4j.LoggerFactory; /** * <code>MKD &lt;SP&gt; &lt;pathname&gt; &lt;CRLF&gt;</code><br> * * This command causes the directory specified in the pathname * to be created as a directory (if the pathname is absolute) * or as a subdirectory of the current working directory (if * the pathname is relative). */ public class MKD extends AbstractCommand { private final Logger LOG = LoggerFactory.getLogger(MKD.class); /** * Execute command. */ public void execute(Connection connection, FtpRequest request, FtpSessionImpl session, FtpReplyOutput out) throws IOException, FtpException { // reset state session.resetState(); FtpServerContext serverContext = connection.getServerContext(); // argument check String fileName = request.getArgument(); if(fileName == null || fileName.indexOf(File.pathSeparatorChar) > -1) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_501_SYNTAX_ERROR_IN_PARAMETERS_OR_ARGUMENTS, "MKD", null)); return; } // call Ftplet.onMkdirStart() method Ftplet ftpletContainer = serverContext.getFtpletContainer(); FtpletEnum ftpletRet; try{ ftpletRet = ftpletContainer.onMkdirStart(session, request, out); } catch(Exception e) { LOG.debug("Ftplet container threw exception", e); ftpletRet = FtpletEnum.RET_DISCONNECT; } if(ftpletRet == FtpletEnum.RET_SKIP) { return; } else if(ftpletRet == FtpletEnum.RET_DISCONNECT) { serverContext.getConnectionManager().closeConnection(connection); return; } // get file object FileObject file = null; try { file = session.getFileSystemView().getFileObject(fileName); } catch(Exception ex) { LOG.debug("Exception getting file object", ex); } if(file == null) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.invalid", fileName)); return; } // check permission fileName = file.getFullName(); if( !file.hasWritePermission() ) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.permission", fileName)); return; } // check file existance if(file.doesExist()) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.exists", fileName)); return; } // now create directory if(file.mkdir()) { - out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_250_REQUESTED_FILE_ACTION_OKAY, "MKD", fileName)); + out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_257_PATHNAME_CREATED, "MKD", fileName)); // write log message String userName = session.getUser().getName(); LOG.info("Directory create : " + userName + " - " + fileName); // notify statistics object ServerFtpStatistics ftpStat = (ServerFtpStatistics)connection.getServerContext().getFtpStatistics(); ftpStat.setMkdir(connection, file); // call Ftplet.onMkdirEnd() method try{ ftpletRet = ftpletContainer.onMkdirEnd(session, request, out); } catch(Exception e) { LOG.debug("Ftplet container threw exception", e); ftpletRet = FtpletEnum.RET_DISCONNECT; } if(ftpletRet == FtpletEnum.RET_DISCONNECT) { serverContext.getConnectionManager().closeConnection(connection); return; } } else { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD", fileName)); } } }
true
true
public void execute(Connection connection, FtpRequest request, FtpSessionImpl session, FtpReplyOutput out) throws IOException, FtpException { // reset state session.resetState(); FtpServerContext serverContext = connection.getServerContext(); // argument check String fileName = request.getArgument(); if(fileName == null || fileName.indexOf(File.pathSeparatorChar) > -1) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_501_SYNTAX_ERROR_IN_PARAMETERS_OR_ARGUMENTS, "MKD", null)); return; } // call Ftplet.onMkdirStart() method Ftplet ftpletContainer = serverContext.getFtpletContainer(); FtpletEnum ftpletRet; try{ ftpletRet = ftpletContainer.onMkdirStart(session, request, out); } catch(Exception e) { LOG.debug("Ftplet container threw exception", e); ftpletRet = FtpletEnum.RET_DISCONNECT; } if(ftpletRet == FtpletEnum.RET_SKIP) { return; } else if(ftpletRet == FtpletEnum.RET_DISCONNECT) { serverContext.getConnectionManager().closeConnection(connection); return; } // get file object FileObject file = null; try { file = session.getFileSystemView().getFileObject(fileName); } catch(Exception ex) { LOG.debug("Exception getting file object", ex); } if(file == null) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.invalid", fileName)); return; } // check permission fileName = file.getFullName(); if( !file.hasWritePermission() ) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.permission", fileName)); return; } // check file existance if(file.doesExist()) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.exists", fileName)); return; } // now create directory if(file.mkdir()) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_250_REQUESTED_FILE_ACTION_OKAY, "MKD", fileName)); // write log message String userName = session.getUser().getName(); LOG.info("Directory create : " + userName + " - " + fileName); // notify statistics object ServerFtpStatistics ftpStat = (ServerFtpStatistics)connection.getServerContext().getFtpStatistics(); ftpStat.setMkdir(connection, file); // call Ftplet.onMkdirEnd() method try{ ftpletRet = ftpletContainer.onMkdirEnd(session, request, out); } catch(Exception e) { LOG.debug("Ftplet container threw exception", e); ftpletRet = FtpletEnum.RET_DISCONNECT; } if(ftpletRet == FtpletEnum.RET_DISCONNECT) { serverContext.getConnectionManager().closeConnection(connection); return; } } else { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD", fileName)); } }
public void execute(Connection connection, FtpRequest request, FtpSessionImpl session, FtpReplyOutput out) throws IOException, FtpException { // reset state session.resetState(); FtpServerContext serverContext = connection.getServerContext(); // argument check String fileName = request.getArgument(); if(fileName == null || fileName.indexOf(File.pathSeparatorChar) > -1) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_501_SYNTAX_ERROR_IN_PARAMETERS_OR_ARGUMENTS, "MKD", null)); return; } // call Ftplet.onMkdirStart() method Ftplet ftpletContainer = serverContext.getFtpletContainer(); FtpletEnum ftpletRet; try{ ftpletRet = ftpletContainer.onMkdirStart(session, request, out); } catch(Exception e) { LOG.debug("Ftplet container threw exception", e); ftpletRet = FtpletEnum.RET_DISCONNECT; } if(ftpletRet == FtpletEnum.RET_SKIP) { return; } else if(ftpletRet == FtpletEnum.RET_DISCONNECT) { serverContext.getConnectionManager().closeConnection(connection); return; } // get file object FileObject file = null; try { file = session.getFileSystemView().getFileObject(fileName); } catch(Exception ex) { LOG.debug("Exception getting file object", ex); } if(file == null) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.invalid", fileName)); return; } // check permission fileName = file.getFullName(); if( !file.hasWritePermission() ) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.permission", fileName)); return; } // check file existance if(file.doesExist()) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD.exists", fileName)); return; } // now create directory if(file.mkdir()) { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_257_PATHNAME_CREATED, "MKD", fileName)); // write log message String userName = session.getUser().getName(); LOG.info("Directory create : " + userName + " - " + fileName); // notify statistics object ServerFtpStatistics ftpStat = (ServerFtpStatistics)connection.getServerContext().getFtpStatistics(); ftpStat.setMkdir(connection, file); // call Ftplet.onMkdirEnd() method try{ ftpletRet = ftpletContainer.onMkdirEnd(session, request, out); } catch(Exception e) { LOG.debug("Ftplet container threw exception", e); ftpletRet = FtpletEnum.RET_DISCONNECT; } if(ftpletRet == FtpletEnum.RET_DISCONNECT) { serverContext.getConnectionManager().closeConnection(connection); return; } } else { out.write(FtpReplyUtil.translate(session, FtpReply.REPLY_550_REQUESTED_ACTION_NOT_TAKEN, "MKD", fileName)); } }
diff --git a/search-util/src/test/org/sakaiproject/search/util/test/HTMLParserTest.java b/search-util/src/test/org/sakaiproject/search/util/test/HTMLParserTest.java index 9e8d9a58..c1fbbb9b 100644 --- a/search-util/src/test/org/sakaiproject/search/util/test/HTMLParserTest.java +++ b/search-util/src/test/org/sakaiproject/search/util/test/HTMLParserTest.java @@ -1,105 +1,105 @@ /********************************************************************************** * $URL$ * $Id$ *********************************************************************************** * * Copyright (c) 2003, 2004, 2005, 2006, 2007 The Sakai Foundation. * * Licensed under the Educational Community License, Version 1.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.opensource.org/licenses/ecl1.php * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. * **********************************************************************************/ package org.sakaiproject.search.util.test; import java.io.BufferedReader; import java.io.IOException; import java.io.InputStream; import java.io.InputStreamReader; import java.util.Iterator; import java.util.Properties; import junit.framework.TestCase; import org.sakaiproject.search.api.SearchUtils; import org.sakaiproject.search.util.HTMLParser; /** * @author ieb * */ public class HTMLParserTest extends TestCase { /** * @param arg0 */ public HTMLParserTest(String arg0) { super(arg0); } /* (non-Javadoc) * @see junit.framework.TestCase#setUp() */ protected void setUp() throws Exception { super.setUp(); } /* (non-Javadoc) * @see junit.framework.TestCase#tearDown() */ protected void tearDown() throws Exception { super.tearDown(); } public void testParser() throws Exception { Properties p = new Properties(); InputStream inStream = getClass().getResourceAsStream("parsertest.config"); p.load(inStream); inStream.close(); for ( Iterator tests = p.keySet().iterator(); tests.hasNext(); ) { String tname = (String)tests.next(); StringBuilder sb = new StringBuilder(); for ( Iterator<String> i = new HTMLParser(loadFile(p.getProperty(tname))); i.hasNext();) { String n = i.next(); SearchUtils.appendCleanString(n, sb); } String result = sb.toString(); - System.err.println("Result is "+result); +// System.err.println("Result is "+result); if ( p.containsKey(tname+".result") ) { assertEquals("Tokens dont match ", loadFile(p.getProperty(tname+".result")), sb.toString()); } } } /** * @param property * @return * @throws IOException */ private String loadFile(String property) throws IOException { System.err.println("Loading :"+property+":"); BufferedReader br = new BufferedReader(new InputStreamReader(getClass().getResourceAsStream(property),"UTF-8")); StringBuffer sb = new StringBuffer(); for ( String s = br.readLine(); s != null; s = br.readLine()) { sb.append(s).append("\n"); } br.close(); return sb.toString(); } }
true
true
public void testParser() throws Exception { Properties p = new Properties(); InputStream inStream = getClass().getResourceAsStream("parsertest.config"); p.load(inStream); inStream.close(); for ( Iterator tests = p.keySet().iterator(); tests.hasNext(); ) { String tname = (String)tests.next(); StringBuilder sb = new StringBuilder(); for ( Iterator<String> i = new HTMLParser(loadFile(p.getProperty(tname))); i.hasNext();) { String n = i.next(); SearchUtils.appendCleanString(n, sb); } String result = sb.toString(); System.err.println("Result is "+result); if ( p.containsKey(tname+".result") ) { assertEquals("Tokens dont match ", loadFile(p.getProperty(tname+".result")), sb.toString()); } } }
public void testParser() throws Exception { Properties p = new Properties(); InputStream inStream = getClass().getResourceAsStream("parsertest.config"); p.load(inStream); inStream.close(); for ( Iterator tests = p.keySet().iterator(); tests.hasNext(); ) { String tname = (String)tests.next(); StringBuilder sb = new StringBuilder(); for ( Iterator<String> i = new HTMLParser(loadFile(p.getProperty(tname))); i.hasNext();) { String n = i.next(); SearchUtils.appendCleanString(n, sb); } String result = sb.toString(); // System.err.println("Result is "+result); if ( p.containsKey(tname+".result") ) { assertEquals("Tokens dont match ", loadFile(p.getProperty(tname+".result")), sb.toString()); } } }
diff --git a/patientview-parent/radar/src/test/java/org/patientview/radar/test/service/PatientLinkManagerTest.java b/patientview-parent/radar/src/test/java/org/patientview/radar/test/service/PatientLinkManagerTest.java index 1ff3f482..68b2f0a2 100644 --- a/patientview-parent/radar/src/test/java/org/patientview/radar/test/service/PatientLinkManagerTest.java +++ b/patientview-parent/radar/src/test/java/org/patientview/radar/test/service/PatientLinkManagerTest.java @@ -1,100 +1,100 @@ package org.patientview.radar.test.service; import org.apache.commons.collections.CollectionUtils; import org.junit.After; import org.junit.Assert; import org.junit.Before; import org.junit.Test; import org.junit.runner.RunWith; import org.patientview.model.Patient; import org.patientview.model.generic.DiseaseGroup; import org.patientview.radar.dao.DemographicsDao; import org.patientview.radar.dao.UtilityDao; import org.patientview.radar.model.PatientLink; import org.patientview.radar.service.PatientLinkManager; import org.patientview.radar.test.TestPvDbSchema; import org.springframework.test.context.ContextConfiguration; import javax.inject.Inject; import java.util.Date; import java.util.List; /** * User: [email protected] * Date: 15/11/13 * Time: 14:32 */ @RunWith(org.springframework.test.context.junit4.SpringJUnit4ClassRunner.class) @ContextConfiguration(locations = {"classpath:test-context.xml"}) public class PatientLinkManagerTest extends TestPvDbSchema { private final static String testDiseaseUnit = "Allports"; private final static String testRenalUnit = "RENALA"; @Inject private PatientLinkManager patientLinkManager; @Inject private DemographicsDao demographicsDao; @Inject private UtilityDao utilityDao; /** * A unit admin is created by the superadmin in PV. * <p/> * Create a basic PV user structure - User - Role as unit admin etc */ @Before public void setup() { // Setup a Renal Unit and Disease Group try { utilityDao.createUnit(testRenalUnit); utilityDao.createUnit(testDiseaseUnit); } catch (Exception e) { } } /** * Test to create a link record and then query to find is that record is linked. * */ @Test - public void testLinkingPatientRecord() { + public void testLinkingPatientRecord() throws Exception { Patient patient = new Patient(); patient.setUnitcode(testRenalUnit); patient.setSurname("Test"); patient.setForename("Test"); patient.setDob(new Date()); patient.setNhsno("234235242"); DiseaseGroup diseaseGroup = new DiseaseGroup(); diseaseGroup.setId(testDiseaseUnit); patient.setDiseaseGroup(diseaseGroup); // Save the patient record before linking because the record should already exist demographicsDao.saveDemographics(patient); patientLinkManager.linkPatientRecord(patient); List<PatientLink> patientLink = patientLinkManager.getPatientLink(patient.getNhsno(), testRenalUnit); Assert.assertTrue("The list return should not be empty." , CollectionUtils.isNotEmpty(patientLink)); Assert.assertTrue("The should only be one link recreated", patientLink.size() == 1); } @After public void tearDown(){ try { this.clearData(); } catch (Exception e) { e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. } } }
true
true
public void testLinkingPatientRecord() { Patient patient = new Patient(); patient.setUnitcode(testRenalUnit); patient.setSurname("Test"); patient.setForename("Test"); patient.setDob(new Date()); patient.setNhsno("234235242"); DiseaseGroup diseaseGroup = new DiseaseGroup(); diseaseGroup.setId(testDiseaseUnit); patient.setDiseaseGroup(diseaseGroup); // Save the patient record before linking because the record should already exist demographicsDao.saveDemographics(patient); patientLinkManager.linkPatientRecord(patient); List<PatientLink> patientLink = patientLinkManager.getPatientLink(patient.getNhsno(), testRenalUnit); Assert.assertTrue("The list return should not be empty." , CollectionUtils.isNotEmpty(patientLink)); Assert.assertTrue("The should only be one link recreated", patientLink.size() == 1); }
public void testLinkingPatientRecord() throws Exception { Patient patient = new Patient(); patient.setUnitcode(testRenalUnit); patient.setSurname("Test"); patient.setForename("Test"); patient.setDob(new Date()); patient.setNhsno("234235242"); DiseaseGroup diseaseGroup = new DiseaseGroup(); diseaseGroup.setId(testDiseaseUnit); patient.setDiseaseGroup(diseaseGroup); // Save the patient record before linking because the record should already exist demographicsDao.saveDemographics(patient); patientLinkManager.linkPatientRecord(patient); List<PatientLink> patientLink = patientLinkManager.getPatientLink(patient.getNhsno(), testRenalUnit); Assert.assertTrue("The list return should not be empty." , CollectionUtils.isNotEmpty(patientLink)); Assert.assertTrue("The should only be one link recreated", patientLink.size() == 1); }
diff --git a/src/ch/amana/android/cputuner/view/fragments/ProfilesListFragment.java b/src/ch/amana/android/cputuner/view/fragments/ProfilesListFragment.java index 51cac8c9..e1f62d2d 100644 --- a/src/ch/amana/android/cputuner/view/fragments/ProfilesListFragment.java +++ b/src/ch/amana/android/cputuner/view/fragments/ProfilesListFragment.java @@ -1,400 +1,400 @@ package ch.amana.android.cputuner.view.fragments; import java.util.ArrayList; import java.util.List; import android.app.Activity; import android.app.AlertDialog; import android.app.AlertDialog.Builder; import android.content.ContentUris; import android.content.DialogInterface; import android.content.DialogInterface.OnClickListener; import android.content.Intent; import android.database.Cursor; import android.graphics.Color; import android.net.Uri; import android.os.Bundle; import android.view.ContextMenu; import android.view.ContextMenu.ContextMenuInfo; import android.view.Menu; import android.view.MenuInflater; import android.view.MenuItem; import android.view.View; import android.view.animation.Animation; import android.view.animation.Animation.AnimationListener; import android.view.animation.AnimationSet; import android.view.animation.AnimationUtils; import android.widget.AdapterView; import android.widget.ImageView; import android.widget.ListView; import android.widget.SimpleCursorAdapter; import android.widget.SimpleCursorAdapter.ViewBinder; import android.widget.TextView; import ch.amana.android.cputuner.R; import ch.amana.android.cputuner.helper.GeneralMenuHelper; import ch.amana.android.cputuner.helper.Logger; import ch.amana.android.cputuner.helper.SettingsStorage; import ch.amana.android.cputuner.hw.HardwareHandler; import ch.amana.android.cputuner.hw.PowerProfiles; import ch.amana.android.cputuner.model.ModelAccess; import ch.amana.android.cputuner.model.ProfileModel; import ch.amana.android.cputuner.model.VirtualGovernorModel; import ch.amana.android.cputuner.provider.CpuTunerProvider; import ch.amana.android.cputuner.provider.db.DB; import ch.amana.android.cputuner.provider.db.DB.CpuProfile; import ch.amana.android.cputuner.provider.db.DB.VirtualGovernor; import ch.amana.android.cputuner.view.activity.CpuTunerViewpagerActivity; import ch.amana.android.cputuner.view.activity.CpuTunerViewpagerActivity.StateChangeListener; import ch.amana.android.cputuner.view.activity.HelpActivity; import ch.amana.android.cputuner.view.adapter.PagerAdapter; import com.markupartist.android.widget.ActionBar; import com.markupartist.android.widget.ActionBar.Action; public class ProfilesListFragment extends PagerListFragment implements StateChangeListener { private static final int ALPHA_ON = 200; private static final int ALPHA_OFF = 40; private static final int ALPHA_LEAVE = 100; private SimpleCursorAdapter adapter; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); } @Override public void onActivityCreated(Bundle savedInstanceState) { super.onActivityCreated(savedInstanceState); Activity act = getActivity(); Cursor c = act.managedQuery(DB.CpuProfile.CONTENT_URI, DB.CpuProfile.PROJECTION_DEFAULT, null, null, DB.CpuProfile.SORTORDER_DEFAULT); adapter = new SimpleCursorAdapter(act, R.layout.profile_item, c, new String[] { DB.CpuProfile.NAME_PROFILE_NAME, DB.CpuProfile.NAME_GOVERNOR, DB.CpuProfile.NAME_FREQUENCY_MIN, DB.CpuProfile.NAME_FREQUENCY_MAX, DB.CpuProfile.NAME_WIFI_STATE, DB.CpuProfile.NAME_GPS_STATE, DB.CpuProfile.NAME_BLUETOOTH_STATE, DB.CpuProfile.NAME_MOBILEDATA_3G_STATE, DB.CpuProfile.NAME_BACKGROUND_SYNC_STATE, DB.CpuProfile.NAME_MOBILEDATA_CONNECTION_STATE, DB.CpuProfile.NAME_AIRPLANEMODE_STATE }, new int[] { R.id.tvName, R.id.tvGov, R.id.tvFreqMin, R.id.tvFreqMax, R.id.ivServiceWifi, R.id.ivServiceGPS, R.id.ivServiceBluetooth, R.id.ivServiceMD3g, R.id.ivServiceSync, R.id.ivServiceMDCon, R.id.ivServiceAirplane }); adapter.setViewBinder(new ViewBinder() { @Override public boolean setViewValue(View view, Cursor cursor, int columnIndex) { if (cursor == null) { return false; } if (columnIndex == DB.CpuProfile.INDEX_PROFILE_NAME) { - ProfileModel currentProfile = PowerProfiles.getInstance().getCurrentProfile(); + ProfileModel currentProfile = PowerProfiles.getInstance(getActivity()).getCurrentProfile(); int color = Color.LTGRAY; if (currentProfile != null && currentProfile.getDbId() == cursor.getLong(DB.INDEX_ID) && SettingsStorage.getInstance().isEnableProfiles()) { color = getResources().getColor(R.color.cputuner_green); } ((TextView) view).setTextColor(color); } else if (columnIndex == DB.CpuProfile.INDEX_GOVERNOR) { if (SettingsStorage.getInstance().isUseVirtualGovernors()) { int virtGovId = cursor.getInt(CpuProfile.INDEX_VIRTUAL_GOVERNOR); if (virtGovId > -1) { Cursor virtGovCursor = getActivity().managedQuery(VirtualGovernor.CONTENT_URI, VirtualGovernor.PROJECTION_DEFAULT, DB.SELECTION_BY_ID, new String[] { virtGovId + "" }, VirtualGovernor.SORTORDER_DEFAULT); if (virtGovCursor.moveToFirst()) { VirtualGovernorModel vgm = new VirtualGovernorModel(virtGovCursor); ((TextView) view).setText(vgm.getVirtualGovernorName()); ((TextView) ((View) view.getParent()).findViewById(R.id.labelGovernor)).setText(R.string.labelVirtualGovernor); return true; } } } StringBuilder sb = new StringBuilder(); sb.append(cursor.getString(DB.CpuProfile.INDEX_GOVERNOR)); int up = cursor.getInt(DB.CpuProfile.INDEX_GOVERNOR_THRESHOLD_UP); if (up > 0) { sb.append(" ("); int down = cursor.getInt(DB.CpuProfile.INDEX_GOVERNOR_THRESHOLD_DOWN); if (down > 0) { sb.append(down).append("% - "); } sb.append(up).append("%)"); } ((TextView) view).setText(sb.toString()); return true; } else if (columnIndex == DB.CpuProfile.INDEX_FREQUENCY_MIN || columnIndex == DB.CpuProfile.INDEX_FREQUENCY_MAX) { int freq = cursor.getInt(columnIndex); if (freq == HardwareHandler.NO_VALUE_INT) { ((TextView) view).setText(R.string.notAvailable); } else { ((TextView) view).setText(ProfileModel.convertFreq2GHz(freq)); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_GPS_STATE) { if (SettingsStorage.getInstance().isEnableSwitchGps()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_WIFI_STATE) { if (SettingsStorage.getInstance().isEnableSwitchWifi()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_BLUETOOTH_STATE) { if (SettingsStorage.getInstance().isEnableSwitchBluetooth()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_BACKGROUND_SYNC_STATE) { if (SettingsStorage.getInstance().isEnableSwitchBackgroundSync()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_MOBILEDATA_3G_STATE) { if (!SettingsStorage.getInstance().isEnableSwitchMobiledata3G()) { view.setVisibility(View.GONE); return true; } view.setVisibility(View.VISIBLE); ImageView icon = (ImageView) view; icon.clearAnimation(); int state = cursor.getInt(columnIndex); if (state == PowerProfiles.SERVICE_STATE_2G) { icon.setImageResource(R.drawable.serviceicon_md_2g); } else if (state == PowerProfiles.SERVICE_STATE_2G_3G) { icon.setImageResource(R.drawable.serviceicon_md_2g3g); } else if (state == PowerProfiles.SERVICE_STATE_3G) { icon.setImageResource(R.drawable.serviceicon_md_3g); } else if (state == PowerProfiles.SERVICE_STATE_PREV) { icon.setImageResource(R.drawable.serviceicon_md_2g3g); setAnimation(icon, R.anim.back); } if (state == PowerProfiles.SERVICE_STATE_LEAVE) { icon.setAlpha(ALPHA_LEAVE); } else { icon.setAlpha(ALPHA_ON); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_MOBILEDATA_CONNECTION_STATE) { if (SettingsStorage.getInstance().isEnableSwitchMobiledataConnection()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_AIRPLANEMODE_STATE) { if (SettingsStorage.getInstance().isEnableAirplaneMode()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } return false; } private void setServiceStateIcon(ImageView icon, int state) { icon.clearAnimation(); if (state == PowerProfiles.SERVICE_STATE_LEAVE) { icon.setAlpha(ALPHA_LEAVE); } else if (state == PowerProfiles.SERVICE_STATE_OFF) { icon.setAlpha(ALPHA_OFF); } else if (state == PowerProfiles.SERVICE_STATE_PREV) { setAnimation(icon, R.anim.back); } else if (state == PowerProfiles.SERVICE_STATE_PULSE) { setAnimation(icon, R.anim.pluse); } else { icon.setAlpha(ALPHA_ON); } } }); setListAdapter(adapter); getListView().setOnCreateContextMenuListener(this); if (act instanceof CpuTunerViewpagerActivity) { ((CpuTunerViewpagerActivity) act).addStateChangeListener(this); } } @Override public void onDestroy() { Activity act = getActivity(); if (act instanceof CpuTunerViewpagerActivity) { if (act != null) { ((CpuTunerViewpagerActivity) act).addStateChangeListener(this); } } super.onDestroy(); } private void setAnimation(final View v, int resID) { final AnimationSet c = (AnimationSet) AnimationUtils.loadAnimation(getActivity(), resID); c.setRepeatMode(Animation.RESTART); c.setRepeatCount(Animation.INFINITE); c.setAnimationListener(new AnimationListener() { @Override public void onAnimationStart(Animation animation) { } @Override public void onAnimationRepeat(Animation animation) { Logger.i("Repeat anim"); } @Override public void onAnimationEnd(Animation animation) { v.clearAnimation(); v.startAnimation(c); } }); v.clearAnimation(); v.startAnimation(c); } @Override public void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); Uri uri = ContentUris.withAppendedId(DB.CpuProfile.CONTENT_URI, id); startActivity(new Intent(Intent.ACTION_EDIT, uri)); } @Override public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo) { super.onCreateContextMenu(menu, v, menuInfo); getActivity().getMenuInflater().inflate(R.menu.db_list_context, menu); } @Override public boolean onContextItemSelected(MenuItem item) { if (!this.getClass().equals(PagerAdapter.getCurrentItem().getClass())) { return false; } super.onContextItemSelected(item); AdapterView.AdapterContextMenuInfo info; try { info = (AdapterView.AdapterContextMenuInfo) item.getMenuInfo(); } catch (ClassCastException e) { Logger.e("bad menuInfo", e); return false; } final Uri uri = ContentUris.withAppendedId(DB.CpuProfile.CONTENT_URI, info.id); switch (item.getItemId()) { case R.id.menuItemDelete: deleteProfile(uri); return true; case R.id.menuItemEdit: startActivity(new Intent(Intent.ACTION_EDIT, uri)); return true; case R.id.menuItemInsertAsNew: startActivity(new Intent(CpuTunerProvider.ACTION_INSERT_AS_NEW, uri)); return true; default: return handleCommonMenu(getActivity(), item); } } private void deleteProfile(final Uri uri) { final Activity act = getActivity(); Builder alertBuilder = new AlertDialog.Builder(act); if (ModelAccess.getInstace(getActivity()).isProfileUsed(ContentUris.parseId(uri))) { // no not delete alertBuilder.setTitle(R.string.menuItemDelete); alertBuilder.setMessage(R.string.msgDeleteTriggerNotPossible); alertBuilder.setNegativeButton(android.R.string.ok, null); } else { alertBuilder.setTitle(R.string.menuItemDelete); alertBuilder.setMessage(R.string.msg_delete_selected_item); alertBuilder.setNegativeButton(android.R.string.no, null); alertBuilder.setPositiveButton(android.R.string.yes, new OnClickListener() { @Override public void onClick(DialogInterface dialog, int which) { ModelAccess.getInstace(getActivity()).delete(uri); } }); } AlertDialog alert = alertBuilder.create(); alert.show(); } @Override public void onCreateOptionsMenu(Menu menu, MenuInflater inflater) { super.onCreateOptionsMenu(menu, inflater); inflater.inflate(R.menu.list_option, menu); } @Override public boolean onOptionsItemSelected(Activity act, MenuItem item) { if (handleCommonMenu(act, item)) { return true; } if (GeneralMenuHelper.onOptionsItemSelected(act, item, HelpActivity.PAGE_PROFILE)) { return true; } return false; } private boolean handleCommonMenu(Activity act, MenuItem item) { switch (item.getItemId()) { case R.id.menuItemInsert: act.startActivity(new Intent(Intent.ACTION_INSERT, DB.CpuProfile.CONTENT_URI)); return true; } return false; } @Override public List<Action> getActions() { List<Action> actions = new ArrayList<ActionBar.Action>(1); actions.add(new Action() { @Override public void performAction(View view) { Intent intent = new Intent(Intent.ACTION_INSERT, DB.CpuProfile.CONTENT_URI); view.getContext().startActivity(intent); } @Override public int getDrawable() { return android.R.drawable.ic_menu_add; } }); return actions; } @Override public void profileChanged() { getListView().setAdapter(adapter); } @Override public void deviceStatusChanged() { } @Override public void triggerChanged() { } }
true
true
public void onActivityCreated(Bundle savedInstanceState) { super.onActivityCreated(savedInstanceState); Activity act = getActivity(); Cursor c = act.managedQuery(DB.CpuProfile.CONTENT_URI, DB.CpuProfile.PROJECTION_DEFAULT, null, null, DB.CpuProfile.SORTORDER_DEFAULT); adapter = new SimpleCursorAdapter(act, R.layout.profile_item, c, new String[] { DB.CpuProfile.NAME_PROFILE_NAME, DB.CpuProfile.NAME_GOVERNOR, DB.CpuProfile.NAME_FREQUENCY_MIN, DB.CpuProfile.NAME_FREQUENCY_MAX, DB.CpuProfile.NAME_WIFI_STATE, DB.CpuProfile.NAME_GPS_STATE, DB.CpuProfile.NAME_BLUETOOTH_STATE, DB.CpuProfile.NAME_MOBILEDATA_3G_STATE, DB.CpuProfile.NAME_BACKGROUND_SYNC_STATE, DB.CpuProfile.NAME_MOBILEDATA_CONNECTION_STATE, DB.CpuProfile.NAME_AIRPLANEMODE_STATE }, new int[] { R.id.tvName, R.id.tvGov, R.id.tvFreqMin, R.id.tvFreqMax, R.id.ivServiceWifi, R.id.ivServiceGPS, R.id.ivServiceBluetooth, R.id.ivServiceMD3g, R.id.ivServiceSync, R.id.ivServiceMDCon, R.id.ivServiceAirplane }); adapter.setViewBinder(new ViewBinder() { @Override public boolean setViewValue(View view, Cursor cursor, int columnIndex) { if (cursor == null) { return false; } if (columnIndex == DB.CpuProfile.INDEX_PROFILE_NAME) { ProfileModel currentProfile = PowerProfiles.getInstance().getCurrentProfile(); int color = Color.LTGRAY; if (currentProfile != null && currentProfile.getDbId() == cursor.getLong(DB.INDEX_ID) && SettingsStorage.getInstance().isEnableProfiles()) { color = getResources().getColor(R.color.cputuner_green); } ((TextView) view).setTextColor(color); } else if (columnIndex == DB.CpuProfile.INDEX_GOVERNOR) { if (SettingsStorage.getInstance().isUseVirtualGovernors()) { int virtGovId = cursor.getInt(CpuProfile.INDEX_VIRTUAL_GOVERNOR); if (virtGovId > -1) { Cursor virtGovCursor = getActivity().managedQuery(VirtualGovernor.CONTENT_URI, VirtualGovernor.PROJECTION_DEFAULT, DB.SELECTION_BY_ID, new String[] { virtGovId + "" }, VirtualGovernor.SORTORDER_DEFAULT); if (virtGovCursor.moveToFirst()) { VirtualGovernorModel vgm = new VirtualGovernorModel(virtGovCursor); ((TextView) view).setText(vgm.getVirtualGovernorName()); ((TextView) ((View) view.getParent()).findViewById(R.id.labelGovernor)).setText(R.string.labelVirtualGovernor); return true; } } } StringBuilder sb = new StringBuilder(); sb.append(cursor.getString(DB.CpuProfile.INDEX_GOVERNOR)); int up = cursor.getInt(DB.CpuProfile.INDEX_GOVERNOR_THRESHOLD_UP); if (up > 0) { sb.append(" ("); int down = cursor.getInt(DB.CpuProfile.INDEX_GOVERNOR_THRESHOLD_DOWN); if (down > 0) { sb.append(down).append("% - "); } sb.append(up).append("%)"); } ((TextView) view).setText(sb.toString()); return true; } else if (columnIndex == DB.CpuProfile.INDEX_FREQUENCY_MIN || columnIndex == DB.CpuProfile.INDEX_FREQUENCY_MAX) { int freq = cursor.getInt(columnIndex); if (freq == HardwareHandler.NO_VALUE_INT) { ((TextView) view).setText(R.string.notAvailable); } else { ((TextView) view).setText(ProfileModel.convertFreq2GHz(freq)); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_GPS_STATE) { if (SettingsStorage.getInstance().isEnableSwitchGps()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_WIFI_STATE) { if (SettingsStorage.getInstance().isEnableSwitchWifi()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_BLUETOOTH_STATE) { if (SettingsStorage.getInstance().isEnableSwitchBluetooth()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_BACKGROUND_SYNC_STATE) { if (SettingsStorage.getInstance().isEnableSwitchBackgroundSync()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_MOBILEDATA_3G_STATE) { if (!SettingsStorage.getInstance().isEnableSwitchMobiledata3G()) { view.setVisibility(View.GONE); return true; } view.setVisibility(View.VISIBLE); ImageView icon = (ImageView) view; icon.clearAnimation(); int state = cursor.getInt(columnIndex); if (state == PowerProfiles.SERVICE_STATE_2G) { icon.setImageResource(R.drawable.serviceicon_md_2g); } else if (state == PowerProfiles.SERVICE_STATE_2G_3G) { icon.setImageResource(R.drawable.serviceicon_md_2g3g); } else if (state == PowerProfiles.SERVICE_STATE_3G) { icon.setImageResource(R.drawable.serviceicon_md_3g); } else if (state == PowerProfiles.SERVICE_STATE_PREV) { icon.setImageResource(R.drawable.serviceicon_md_2g3g); setAnimation(icon, R.anim.back); } if (state == PowerProfiles.SERVICE_STATE_LEAVE) { icon.setAlpha(ALPHA_LEAVE); } else { icon.setAlpha(ALPHA_ON); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_MOBILEDATA_CONNECTION_STATE) { if (SettingsStorage.getInstance().isEnableSwitchMobiledataConnection()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_AIRPLANEMODE_STATE) { if (SettingsStorage.getInstance().isEnableAirplaneMode()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } return false; } private void setServiceStateIcon(ImageView icon, int state) { icon.clearAnimation(); if (state == PowerProfiles.SERVICE_STATE_LEAVE) { icon.setAlpha(ALPHA_LEAVE); } else if (state == PowerProfiles.SERVICE_STATE_OFF) { icon.setAlpha(ALPHA_OFF); } else if (state == PowerProfiles.SERVICE_STATE_PREV) { setAnimation(icon, R.anim.back); } else if (state == PowerProfiles.SERVICE_STATE_PULSE) { setAnimation(icon, R.anim.pluse); } else { icon.setAlpha(ALPHA_ON); } } }); setListAdapter(adapter); getListView().setOnCreateContextMenuListener(this); if (act instanceof CpuTunerViewpagerActivity) { ((CpuTunerViewpagerActivity) act).addStateChangeListener(this); } }
public void onActivityCreated(Bundle savedInstanceState) { super.onActivityCreated(savedInstanceState); Activity act = getActivity(); Cursor c = act.managedQuery(DB.CpuProfile.CONTENT_URI, DB.CpuProfile.PROJECTION_DEFAULT, null, null, DB.CpuProfile.SORTORDER_DEFAULT); adapter = new SimpleCursorAdapter(act, R.layout.profile_item, c, new String[] { DB.CpuProfile.NAME_PROFILE_NAME, DB.CpuProfile.NAME_GOVERNOR, DB.CpuProfile.NAME_FREQUENCY_MIN, DB.CpuProfile.NAME_FREQUENCY_MAX, DB.CpuProfile.NAME_WIFI_STATE, DB.CpuProfile.NAME_GPS_STATE, DB.CpuProfile.NAME_BLUETOOTH_STATE, DB.CpuProfile.NAME_MOBILEDATA_3G_STATE, DB.CpuProfile.NAME_BACKGROUND_SYNC_STATE, DB.CpuProfile.NAME_MOBILEDATA_CONNECTION_STATE, DB.CpuProfile.NAME_AIRPLANEMODE_STATE }, new int[] { R.id.tvName, R.id.tvGov, R.id.tvFreqMin, R.id.tvFreqMax, R.id.ivServiceWifi, R.id.ivServiceGPS, R.id.ivServiceBluetooth, R.id.ivServiceMD3g, R.id.ivServiceSync, R.id.ivServiceMDCon, R.id.ivServiceAirplane }); adapter.setViewBinder(new ViewBinder() { @Override public boolean setViewValue(View view, Cursor cursor, int columnIndex) { if (cursor == null) { return false; } if (columnIndex == DB.CpuProfile.INDEX_PROFILE_NAME) { ProfileModel currentProfile = PowerProfiles.getInstance(getActivity()).getCurrentProfile(); int color = Color.LTGRAY; if (currentProfile != null && currentProfile.getDbId() == cursor.getLong(DB.INDEX_ID) && SettingsStorage.getInstance().isEnableProfiles()) { color = getResources().getColor(R.color.cputuner_green); } ((TextView) view).setTextColor(color); } else if (columnIndex == DB.CpuProfile.INDEX_GOVERNOR) { if (SettingsStorage.getInstance().isUseVirtualGovernors()) { int virtGovId = cursor.getInt(CpuProfile.INDEX_VIRTUAL_GOVERNOR); if (virtGovId > -1) { Cursor virtGovCursor = getActivity().managedQuery(VirtualGovernor.CONTENT_URI, VirtualGovernor.PROJECTION_DEFAULT, DB.SELECTION_BY_ID, new String[] { virtGovId + "" }, VirtualGovernor.SORTORDER_DEFAULT); if (virtGovCursor.moveToFirst()) { VirtualGovernorModel vgm = new VirtualGovernorModel(virtGovCursor); ((TextView) view).setText(vgm.getVirtualGovernorName()); ((TextView) ((View) view.getParent()).findViewById(R.id.labelGovernor)).setText(R.string.labelVirtualGovernor); return true; } } } StringBuilder sb = new StringBuilder(); sb.append(cursor.getString(DB.CpuProfile.INDEX_GOVERNOR)); int up = cursor.getInt(DB.CpuProfile.INDEX_GOVERNOR_THRESHOLD_UP); if (up > 0) { sb.append(" ("); int down = cursor.getInt(DB.CpuProfile.INDEX_GOVERNOR_THRESHOLD_DOWN); if (down > 0) { sb.append(down).append("% - "); } sb.append(up).append("%)"); } ((TextView) view).setText(sb.toString()); return true; } else if (columnIndex == DB.CpuProfile.INDEX_FREQUENCY_MIN || columnIndex == DB.CpuProfile.INDEX_FREQUENCY_MAX) { int freq = cursor.getInt(columnIndex); if (freq == HardwareHandler.NO_VALUE_INT) { ((TextView) view).setText(R.string.notAvailable); } else { ((TextView) view).setText(ProfileModel.convertFreq2GHz(freq)); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_GPS_STATE) { if (SettingsStorage.getInstance().isEnableSwitchGps()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_WIFI_STATE) { if (SettingsStorage.getInstance().isEnableSwitchWifi()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_BLUETOOTH_STATE) { if (SettingsStorage.getInstance().isEnableSwitchBluetooth()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_BACKGROUND_SYNC_STATE) { if (SettingsStorage.getInstance().isEnableSwitchBackgroundSync()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_MOBILEDATA_3G_STATE) { if (!SettingsStorage.getInstance().isEnableSwitchMobiledata3G()) { view.setVisibility(View.GONE); return true; } view.setVisibility(View.VISIBLE); ImageView icon = (ImageView) view; icon.clearAnimation(); int state = cursor.getInt(columnIndex); if (state == PowerProfiles.SERVICE_STATE_2G) { icon.setImageResource(R.drawable.serviceicon_md_2g); } else if (state == PowerProfiles.SERVICE_STATE_2G_3G) { icon.setImageResource(R.drawable.serviceicon_md_2g3g); } else if (state == PowerProfiles.SERVICE_STATE_3G) { icon.setImageResource(R.drawable.serviceicon_md_3g); } else if (state == PowerProfiles.SERVICE_STATE_PREV) { icon.setImageResource(R.drawable.serviceicon_md_2g3g); setAnimation(icon, R.anim.back); } if (state == PowerProfiles.SERVICE_STATE_LEAVE) { icon.setAlpha(ALPHA_LEAVE); } else { icon.setAlpha(ALPHA_ON); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_MOBILEDATA_CONNECTION_STATE) { if (SettingsStorage.getInstance().isEnableSwitchMobiledataConnection()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } else if (columnIndex == DB.CpuProfile.INDEX_AIRPLANEMODE_STATE) { if (SettingsStorage.getInstance().isEnableAirplaneMode()) { view.setVisibility(View.VISIBLE); setServiceStateIcon((ImageView) view, cursor.getInt(columnIndex)); } else { view.setVisibility(View.GONE); } return true; } return false; } private void setServiceStateIcon(ImageView icon, int state) { icon.clearAnimation(); if (state == PowerProfiles.SERVICE_STATE_LEAVE) { icon.setAlpha(ALPHA_LEAVE); } else if (state == PowerProfiles.SERVICE_STATE_OFF) { icon.setAlpha(ALPHA_OFF); } else if (state == PowerProfiles.SERVICE_STATE_PREV) { setAnimation(icon, R.anim.back); } else if (state == PowerProfiles.SERVICE_STATE_PULSE) { setAnimation(icon, R.anim.pluse); } else { icon.setAlpha(ALPHA_ON); } } }); setListAdapter(adapter); getListView().setOnCreateContextMenuListener(this); if (act instanceof CpuTunerViewpagerActivity) { ((CpuTunerViewpagerActivity) act).addStateChangeListener(this); } }
diff --git a/org.eclipse.jface.text/src/org/eclipse/jface/text/source/OverviewRuler.java b/org.eclipse.jface.text/src/org/eclipse/jface/text/source/OverviewRuler.java index eeaf65c16..b4a07b87d 100644 --- a/org.eclipse.jface.text/src/org/eclipse/jface/text/source/OverviewRuler.java +++ b/org.eclipse.jface.text/src/org/eclipse/jface/text/source/OverviewRuler.java @@ -1,1233 +1,1233 @@ /******************************************************************************* * Copyright (c) 2000, 2003 IBM Corporation and others. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Common Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/cpl-v10.html * * Contributors: * IBM Corporation - initial API and implementation *******************************************************************************/ package org.eclipse.jface.text.source; import java.util.ArrayList; import java.util.HashMap; import java.util.HashSet; import java.util.Iterator; import java.util.List; import java.util.Map; import java.util.Set; import org.eclipse.swt.SWT; import org.eclipse.swt.custom.StyledText; import org.eclipse.swt.custom.ViewForm; import org.eclipse.swt.events.DisposeEvent; import org.eclipse.swt.events.DisposeListener; import org.eclipse.swt.events.MouseAdapter; import org.eclipse.swt.events.MouseEvent; import org.eclipse.swt.events.MouseMoveListener; import org.eclipse.swt.events.PaintEvent; import org.eclipse.swt.events.PaintListener; import org.eclipse.swt.graphics.Color; import org.eclipse.swt.graphics.Cursor; import org.eclipse.swt.graphics.GC; import org.eclipse.swt.graphics.Image; import org.eclipse.swt.graphics.Point; import org.eclipse.swt.graphics.RGB; import org.eclipse.swt.graphics.Rectangle; import org.eclipse.swt.widgets.Canvas; import org.eclipse.swt.widgets.Composite; import org.eclipse.swt.widgets.Control; import org.eclipse.swt.widgets.Display; import org.eclipse.jface.text.BadLocationException; import org.eclipse.jface.text.IDocument; import org.eclipse.jface.text.IRegion; import org.eclipse.jface.text.ITextListener; import org.eclipse.jface.text.ITextViewer; import org.eclipse.jface.text.ITextViewerExtension5; import org.eclipse.jface.text.Position; import org.eclipse.jface.text.Region; import org.eclipse.jface.text.TextEvent; /** * Ruler presented next to a source viewer showing all annotations of the * viewer's annotation model in a compact format. The ruler has the same height * as the source viewer.<p> * Clients usually instantiate and configure objects of this class. * * @since 2.1 */ public class OverviewRuler implements IOverviewRuler { /** * Internal listener class. */ class InternalListener implements ITextListener, IAnnotationModelListener { /* * @see ITextListener#textChanged */ public void textChanged(TextEvent e) { if (fTextViewer != null && e.getDocumentEvent() == null && e.getViewerRedrawState()) { // handle only changes of visible document redraw(); } } /* * @see IAnnotationModelListener#modelChanged(IAnnotationModel) */ public void modelChanged(IAnnotationModel model) { update(); } } /** * Enumerates the annotations of a specified type and characteristics * of the associated annotation model. */ class FilterIterator implements Iterator { private final static int IGNORE= 0; private final static int TEMPORARY= 1; private final static int PERSISTENT= 2; private Iterator fIterator; private Object fType; private Annotation fNext; private int fTemporary; public FilterIterator() { this(null, IGNORE); } public FilterIterator(Object annotationType) { this(annotationType, IGNORE); } public FilterIterator(Object annotationType, boolean temporary) { this(annotationType, temporary ? TEMPORARY : PERSISTENT); } private FilterIterator(Object annotationType, int temporary) { fType= annotationType; fTemporary= temporary; if (fModel != null) { fIterator= fModel.getAnnotationIterator(); skip(); } } public FilterIterator(Object annotationType, boolean temporary, Iterator iterator) { fType= annotationType; fTemporary= temporary ? TEMPORARY : PERSISTENT; fIterator= iterator; skip(); } private void skip() { while (fIterator.hasNext()) { Annotation next= (Annotation) fIterator.next(); if (next.isMarkedDeleted()) continue; fNext= next; Object annotationType= next.getType(); if (fType == null || isSubtype(annotationType)) { if (fTemporary == IGNORE) return; boolean temporary= !next.isPersistent(); if (fTemporary == TEMPORARY && temporary) return; if (fTemporary == PERSISTENT && !temporary) return; } } fNext= null; } private boolean isSubtype(Object annotationType) { if (fAnnotationAccess instanceof IAnnotationAccessExtension) { IAnnotationAccessExtension extension= (IAnnotationAccessExtension) fAnnotationAccess; return extension.isSubtype(annotationType, fType); } return fType.equals(annotationType); } /* * @see Iterator#hasNext() */ public boolean hasNext() { return fNext != null; } /* * @see Iterator#next() */ public Object next() { try { return fNext; } finally { if (fIterator != null) skip(); } } /* * @see Iterator#remove() */ public void remove() { throw new UnsupportedOperationException(); } } /** * The painter of the overview ruler's header. */ class HeaderPainter implements PaintListener { private Color fIndicatorColor; private Color fSeparatorColor; public HeaderPainter() { fSeparatorColor= fSharedTextColors.getColor(ViewForm.borderInsideRGB); } public void setColor(Color color) { fIndicatorColor= color; } private void drawBevelRect(GC gc, int x, int y, int w, int h, Color topLeft, Color bottomRight) { gc.setForeground(topLeft == null ? fSeparatorColor : topLeft); gc.drawLine(x, y, x + w -1, y); gc.drawLine(x, y, x, y + h -1); gc.setForeground(bottomRight == null ? fSeparatorColor : bottomRight); gc.drawLine(x + w, y, x + w, y + h); gc.drawLine(x, y + h, x + w, y + h); } public void paintControl(PaintEvent e) { Point s= fHeader.getSize(); if (fIndicatorColor != null) { e.gc.setBackground(fIndicatorColor); Rectangle r= new Rectangle(INSET, (s.y - (2*ANNOTATION_HEIGHT)) / 2, s.x - (2*INSET), 2*ANNOTATION_HEIGHT); e.gc.fillRectangle(r); Display d= fHeader.getDisplay(); if (d != null) // drawBevelRect(e.gc, r.x, r.y, r.width -1, r.height -1, d.getSystemColor(SWT.COLOR_WIDGET_NORMAL_SHADOW), d.getSystemColor(SWT.COLOR_WIDGET_HIGHLIGHT_SHADOW)); drawBevelRect(e.gc, r.x, r.y, r.width -1, r.height -1, null, null); } e.gc.setForeground(fSeparatorColor); e.gc.setLineWidth(1); e.gc.drawLine(0, s.y -1, s.x -1, s.y -1); } } private static final int INSET= 2; private static final int ANNOTATION_HEIGHT= 4; private static boolean ANNOTATION_HEIGHT_SCALABLE= true; /** The model of the overview ruler */ private IAnnotationModel fModel; /** The view to which this ruler is connected */ private ITextViewer fTextViewer; /** The ruler's canvas */ private Canvas fCanvas; /** The ruler's header */ private Canvas fHeader; /** The drawable for double buffering */ private Image fBuffer; /** The internal listener */ private InternalListener fInternalListener= new InternalListener(); /** The width of this vertical ruler */ private int fWidth; /** The hit detection cursor */ private Cursor fHitDetectionCursor; /** The last cursor */ private Cursor fLastCursor; /** The line of the last mouse button activity */ private int fLastMouseButtonActivityLine= -1; /** The actual annotation height */ private int fAnnotationHeight= -1; /** The annotation access */ private IAnnotationAccess fAnnotationAccess; /** The header painter */ private HeaderPainter fHeaderPainter; /** * The list of annotation types to be shown in this ruler. * @since 3.0 */ private Set fConfiguredAnnotationTypes= new HashSet(); /** * The list of annotation types to be shown in the header of this ruler. * @since 3.0 */ private Set fConfiguredHeaderAnnotationTypes= new HashSet(); /** The mapping between annotation types and colors */ private Map fAnnotationTypes2Colors= new HashMap(); /** The color manager */ private ISharedTextColors fSharedTextColors; /** * All available annotation types sorted by layer. * * @since 3.0 */ private List fAnnotationsSortedByLayer= new ArrayList(); /** * All available layers sorted by layer. * This list may contain duplicates. * @since 3.0 */ private List fLayersSortedByLayer= new ArrayList(); /** * Map of allowed annotation types. * An allowed annotation type maps to <code>true</code>, a disallowed * to <code>false</code>. * @since 3.0 */ private Map fAllowedAnnotationTypes= new HashMap(); /** * Map of allowed header annotation types. * An allowed annotation type maps to <code>true</code>, a disallowed * to <code>false</code>. * @since 3.0 */ private Map fAllowedHeaderAnnotationTypes= new HashMap(); /** * The cached annotations. * @since 3.0 */ private List fCachedAnnotations= new ArrayList(); /** * Constructs a overview ruler of the given width using the given annotation access and the given * color manager. * * @param annotationAccess the annotation access * @param width the width of the vertical ruler * @param sharedColors the color manager */ public OverviewRuler(IAnnotationAccess annotationAccess, int width, ISharedTextColors sharedColors) { fAnnotationAccess= annotationAccess; fWidth= width; fSharedTextColors= sharedColors; } /* * @see org.eclipse.jface.text.source.IVerticalRulerInfo#getControl() */ public Control getControl() { return fCanvas; } /* * @see org.eclipse.jface.text.source.IVerticalRulerInfo#getWidth() */ public int getWidth() { return fWidth; } /* * @see org.eclipse.jface.text.source.IVerticalRuler#setModel(org.eclipse.jface.text.source.IAnnotationModel) */ public void setModel(IAnnotationModel model) { if (model != fModel || model != null) { if (fModel != null) fModel.removeAnnotationModelListener(fInternalListener); fModel= model; if (fModel != null) fModel.addAnnotationModelListener(fInternalListener); update(); } } /* * @see org.eclipse.jface.text.source.IVerticalRuler#createControl(org.eclipse.swt.widgets.Composite, org.eclipse.jface.text.ITextViewer) */ public Control createControl(Composite parent, ITextViewer textViewer) { fTextViewer= textViewer; fHitDetectionCursor= new Cursor(parent.getDisplay(), SWT.CURSOR_HAND); fHeader= new Canvas(parent, SWT.NONE); fCanvas= new Canvas(parent, SWT.NO_BACKGROUND); fCanvas.addPaintListener(new PaintListener() { public void paintControl(PaintEvent event) { if (fTextViewer != null) doubleBufferPaint(event.gc); } }); fCanvas.addDisposeListener(new DisposeListener() { public void widgetDisposed(DisposeEvent event) { handleDispose(); fTextViewer= null; } }); fCanvas.addMouseListener(new MouseAdapter() { public void mouseDown(MouseEvent event) { handleMouseDown(event); } }); fCanvas.addMouseMoveListener(new MouseMoveListener() { public void mouseMove(MouseEvent event) { handleMouseMove(event); } }); if (fTextViewer != null) fTextViewer.addTextListener(fInternalListener); return fCanvas; } /** * Disposes the ruler's resources. */ private void handleDispose() { if (fTextViewer != null) { fTextViewer.removeTextListener(fInternalListener); fTextViewer= null; } if (fModel != null) fModel.removeAnnotationModelListener(fInternalListener); if (fBuffer != null) { fBuffer.dispose(); fBuffer= null; } if (fHitDetectionCursor != null) { fHitDetectionCursor.dispose(); fHitDetectionCursor= null; } fConfiguredAnnotationTypes.clear(); fAllowedAnnotationTypes.clear(); fConfiguredHeaderAnnotationTypes.clear(); fAllowedHeaderAnnotationTypes.clear(); fAnnotationTypes2Colors.clear(); fAnnotationsSortedByLayer.clear(); fLayersSortedByLayer.clear(); } /** * Double buffer drawing. * * @param dest the GC to draw into */ private void doubleBufferPaint(GC dest) { Point size= fCanvas.getSize(); if (size.x <= 0 || size.y <= 0) return; if (fBuffer != null) { Rectangle r= fBuffer.getBounds(); if (r.width != size.x || r.height != size.y) { fBuffer.dispose(); fBuffer= null; } } if (fBuffer == null) fBuffer= new Image(fCanvas.getDisplay(), size.x, size.y); GC gc= new GC(fBuffer); try { gc.setBackground(fCanvas.getBackground()); gc.fillRectangle(0, 0, size.x, size.y); if (fTextViewer instanceof ITextViewerExtension5) doPaint1(gc); else doPaint(gc); } finally { gc.dispose(); } dest.drawImage(fBuffer, 0, 0); } /** * Draws this overview ruler. * * @param gc the GC to draw into */ private void doPaint(GC gc) { if (fTextViewer == null) return; Rectangle r= new Rectangle(0, 0, 0, 0); int yy, hh= ANNOTATION_HEIGHT; IDocument document= fTextViewer.getDocument(); IRegion visible= fTextViewer.getVisibleRegion(); StyledText textWidget= fTextViewer.getTextWidget(); int maxLines= textWidget.getLineCount(); Point size= fCanvas.getSize(); int writable= maxLines * textWidget.getLineHeight(); if (size.y > writable) size.y= Math.max(writable - fHeader.getSize().y, 0); for (Iterator iterator= fAnnotationsSortedByLayer.iterator(); iterator.hasNext();) { Object annotationType= iterator.next(); if (skip(annotationType)) continue; boolean[] temporary= new boolean[] { false, true }; for (int t=0; t < temporary.length; t++) { Iterator e= new FilterIterator(annotationType, temporary[t]); Color fill= getFillColor(annotationType, temporary[t]); Color stroke= getStrokeColor(annotationType, temporary[t]); for (int i= 0; e.hasNext(); i++) { Annotation a= (Annotation) e.next(); Position p= fModel.getPosition(a); if (p == null || !p.overlapsWith(visible.getOffset(), visible.getLength())) continue; int annotationOffset= Math.max(p.getOffset(), visible.getOffset()); int annotationEnd= Math.min(p.getOffset() + p.getLength(), visible.getOffset() + visible.getLength()); int annotationLength= annotationEnd - annotationOffset; try { if (ANNOTATION_HEIGHT_SCALABLE) { int numbersOfLines= document.getNumberOfLines(annotationOffset, annotationLength); // don't count empty trailing lines IRegion lastLine= document.getLineInformationOfOffset(annotationOffset + annotationLength); if (lastLine.getOffset() == annotationOffset + annotationLength) { numbersOfLines -= 2; hh= (numbersOfLines * size.y) / maxLines + ANNOTATION_HEIGHT; if (hh < ANNOTATION_HEIGHT) hh= ANNOTATION_HEIGHT; } else hh= ANNOTATION_HEIGHT; } fAnnotationHeight= hh; int startLine= textWidget.getLineAtOffset(annotationOffset - visible.getOffset()); yy= Math.min((startLine * size.y) / maxLines, size.y - hh); if (fill != null) { gc.setBackground(fill); gc.fillRectangle(INSET, yy, size.x-(2*INSET), hh); } if (stroke != null) { gc.setForeground(stroke); r.x= INSET; r.y= yy; r.width= size.x - (2 * INSET) - 1; r.height= hh; gc.setLineWidth(1); gc.drawRectangle(r); } } catch (BadLocationException x) { } } } } } /** * Draws this overview ruler. Uses <code>ITextViewerExtension5</code> for * its implementation. Will replace <code>doPaint(GC)</code>. * * @param gc the GC to draw into */ private void doPaint1(GC gc) { - if (fTextViewer == null) + if (fTextViewer == null || fModel == null) return; Rectangle r= new Rectangle(0, 0, 0, 0); int yy, hh= ANNOTATION_HEIGHT; ITextViewerExtension5 extension= (ITextViewerExtension5) fTextViewer; IDocument document= fTextViewer.getDocument(); StyledText textWidget= fTextViewer.getTextWidget(); int maxLines= textWidget.getLineCount(); Point size= fCanvas.getSize(); int writable= maxLines * textWidget.getLineHeight(); if (size.y > writable) size.y= Math.max(writable - fHeader.getSize().y, 0); fCachedAnnotations.clear(); Iterator iter= fModel.getAnnotationIterator(); while (iter.hasNext()) { Annotation annotation= (Annotation) iter.next(); if (annotation.isMarkedDeleted()) continue; if (skip(annotation.getType())) continue; fCachedAnnotations.add(annotation); } for (Iterator iterator= fAnnotationsSortedByLayer.iterator(); iterator.hasNext();) { Object annotationType= iterator.next(); if (skip(annotationType)) continue; boolean[] temporary= new boolean[] { false, true }; for (int t=0; t < temporary.length; t++) { Iterator e= new FilterIterator(annotationType, temporary[t], fCachedAnnotations.iterator()); Color fill= getFillColor(annotationType, temporary[t]); Color stroke= getStrokeColor(annotationType, temporary[t]); for (int i= 0; e.hasNext(); i++) { Annotation a= (Annotation) e.next(); Position p= fModel.getPosition(a); if (p == null) continue; IRegion widgetRegion= extension.modelRange2WidgetRange(new Region(p.getOffset(), p.getLength())); if (widgetRegion == null) continue; try { if (ANNOTATION_HEIGHT_SCALABLE) { int numbersOfLines= document.getNumberOfLines(p.getOffset(), p.getLength()); // don't count empty trailing lines IRegion lastLine= document.getLineInformationOfOffset(p.getOffset() + p.getLength()); if (lastLine.getOffset() == p.getOffset() + p.getLength()) { numbersOfLines -= 2; hh= (numbersOfLines * size.y) / maxLines + ANNOTATION_HEIGHT; if (hh < ANNOTATION_HEIGHT) hh= ANNOTATION_HEIGHT; } else hh= ANNOTATION_HEIGHT; } fAnnotationHeight= hh; int startLine= textWidget.getLineAtOffset(widgetRegion.getOffset()); yy= Math.min((startLine * size.y) / maxLines, size.y - hh); if (fill != null) { gc.setBackground(fill); gc.fillRectangle(INSET, yy, size.x-(2*INSET), hh); } if (stroke != null) { gc.setForeground(stroke); r.x= INSET; r.y= yy; r.width= size.x - (2 * INSET) - 1; r.height= hh; gc.setLineWidth(1); gc.drawRectangle(r); } } catch (BadLocationException x) { } } } } fCachedAnnotations.clear(); } /* * @see org.eclipse.jface.text.source.IVerticalRuler#update() */ public void update() { if (fCanvas != null && !fCanvas.isDisposed()) { Display d= fCanvas.getDisplay(); if (d != null) { d.asyncExec(new Runnable() { public void run() { redraw(); updateHeader(); } }); } } } /** * Redraws the overview ruler. */ private void redraw() { if (fCanvas != null && !fCanvas.isDisposed()) { GC gc= new GC(fCanvas); doubleBufferPaint(gc); gc.dispose(); } } /** * Translates a given y-coordinate of this ruler into the corresponding * document lines. The number of lines depends on the concrete scaling * given as the ration between the height of this ruler and the length * of the document. * * @param y_coordinate the y-coordinate * @return the corresponding document lines */ private int[] toLineNumbers(int y_coordinate) { StyledText textWidget= fTextViewer.getTextWidget(); int maxLines= textWidget.getContent().getLineCount(); int rulerLength= fCanvas.getSize().y; int writable= maxLines * textWidget.getLineHeight(); if (rulerLength > writable) rulerLength= Math.max(writable - fHeader.getSize().y, 0); if (y_coordinate >= writable || y_coordinate >= rulerLength) return new int[] {-1, -1}; int[] lines= new int[2]; int pixel= Math.max(y_coordinate - 1, 0); lines[0]= (pixel * maxLines) / rulerLength; pixel= Math.min(rulerLength, y_coordinate + 1); lines[1]= (pixel * maxLines) / rulerLength; if (fTextViewer instanceof ITextViewerExtension5) { ITextViewerExtension5 extension= (ITextViewerExtension5) fTextViewer; lines[0]= extension.widgetLine2ModelLine(lines[0]); lines[1]= extension.widgetLine2ModelLine(lines[1]); } else { try { IRegion visible= fTextViewer.getVisibleRegion(); int lineNumber= fTextViewer.getDocument().getLineOfOffset(visible.getOffset()); lines[0] += lineNumber; lines[1] += lineNumber; } catch (BadLocationException x) { } } return lines; } /** * Returns the position of the first annotation found in the given line range. * * @param lineNumbers the line range * @param ignoreSelectedAnnotation whether to ignore the current selection * @return the position of the first found annotation */ private Position getAnnotationPosition(int[] lineNumbers, boolean ignoreSelectedAnnotation) { if (lineNumbers[0] == -1) return null; Position found= null; try { IDocument d= fTextViewer.getDocument(); IRegion line= d.getLineInformation(lineNumbers[0]); Point currentSelection= fTextViewer.getSelectedRange(); int start= line.getOffset(); line= d.getLineInformation(lineNumbers[lineNumbers.length - 1]); int end= line.getOffset() + line.getLength(); for (int i= fAnnotationsSortedByLayer.size() -1; i >= 0; i--) { Object annotationType= fAnnotationsSortedByLayer.get(i); Iterator e= new FilterIterator(annotationType); while (e.hasNext() && found == null) { Annotation a= (Annotation) e.next(); if (a.isMarkedDeleted()) continue; if (skip(a.getType())) continue; Position p= fModel.getPosition(a); if (p == null) continue; int posOffset= p.getOffset(); int posEnd= posOffset + p.getLength(); IRegion region= d.getLineInformationOfOffset(posEnd); // trailing empty lines don't count if (posEnd > posOffset && region.getOffset() == posEnd) { posEnd--; region= d.getLineInformationOfOffset(posEnd); } if (posOffset <= end && posEnd >= start) { if ((found == null || posOffset < found.getOffset()) && (ignoreSelectedAnnotation || currentSelection.x != posOffset || currentSelection.y != p.getLength())) found= p; } } } } catch (BadLocationException x) { } return found; } /** * Returns the line which corresponds best to one of * the underlying annotations at the given y-coordinate. * * @param lineNumbers the line numbers * @return the best matching line or <code>-1</code> if no such line can be found */ private int findBestMatchingLineNumber(int[] lineNumbers) { if (lineNumbers == null || lineNumbers.length < 1) return -1; try { Position pos= getAnnotationPosition(lineNumbers, true); if (pos == null) return -1; return fTextViewer.getDocument().getLineOfOffset(pos.getOffset()); } catch (BadLocationException ex) { return -1; } } /** * Handles mouse clicks. * * @param event the mouse button down event */ private void handleMouseDown(MouseEvent event) { if (fTextViewer != null) { int[] lines= toLineNumbers(event.y); Position p= getAnnotationPosition(lines, false); if (p != null) { fTextViewer.revealRange(p.getOffset(), p.getLength()); fTextViewer.setSelectedRange(p.getOffset(), p.getLength()); } fTextViewer.getTextWidget().setFocus(); } fLastMouseButtonActivityLine= toDocumentLineNumber(event.y); } /** * Handles mouse moves. * * @param event the mouse move event */ private void handleMouseMove(MouseEvent event) { if (fTextViewer != null) { int[] lines= toLineNumbers(event.y); Position p= getAnnotationPosition(lines, true); Cursor cursor= (p != null ? fHitDetectionCursor : null); if (cursor != fLastCursor) { fCanvas.setCursor(cursor); fLastCursor= cursor; } } } /* * @see org.eclipse.jface.text.source.IOverviewRuler#addAnnotationType(java.lang.Object) */ public void addAnnotationType(Object annotationType) { fConfiguredAnnotationTypes.add(annotationType); fAllowedAnnotationTypes.clear(); } /* * @see org.eclipse.jface.text.source.IOverviewRuler#removeAnnotationType(java.lang.Object) */ public void removeAnnotationType(Object annotationType) { fConfiguredAnnotationTypes.remove(annotationType); fAllowedAnnotationTypes.clear(); } /* * @see org.eclipse.jface.text.source.IOverviewRuler#setAnnotationTypeLayer(java.lang.Object, int) */ public void setAnnotationTypeLayer(Object annotationType, int layer) { Integer layerObj= new Integer(layer); if (fAnnotationsSortedByLayer.remove(annotationType)) fLayersSortedByLayer.remove(layerObj); if (layer >= 0) { int i= 0; int size= fLayersSortedByLayer.size(); while (i < size && layer >= ((Integer)fLayersSortedByLayer.get(i)).intValue()) i++; fLayersSortedByLayer.add(i, layerObj); fAnnotationsSortedByLayer.add(i, annotationType); } } /* * @see org.eclipse.jface.text.source.IOverviewRuler#setAnnotationTypeColor(java.lang.Object, org.eclipse.swt.graphics.Color) */ public void setAnnotationTypeColor(Object annotationType, Color color) { if (color != null) fAnnotationTypes2Colors.put(annotationType, color); else fAnnotationTypes2Colors.remove(annotationType); } /** * Returns whether the given annotation type should be skipped by the drawing routine. * * @param annotationType the annotation type * @return <code>true</code> if annotation of the given type should be skipped */ private boolean skip(Object annotationType) { return !contains(annotationType, fAllowedAnnotationTypes, fConfiguredAnnotationTypes); } /** * Returns whether the given annotation type should be skipped by the drawing routine of the header. * * @param annotationType the annotation type * @return <code>true</code> if annotation of the given type should be skipped * @since 3.0 */ private boolean skipInHeader(Object annotationType) { return !contains(annotationType, fAllowedHeaderAnnotationTypes, fConfiguredHeaderAnnotationTypes); } /** * Returns whether the given annotation type is mapped to <code>true</code> * in the given <code>allowed</code> map or covered by the <code>configured</code> * set. * * @param annotationType the annotation type * @param allowed the map with allowed annotation types mapped to booleans * @param configured the set with configured annotation types * @return <code>true</code> if annotation is contained, <code>false</code> * otherwise * @since 3.0 */ private boolean contains(Object annotationType, Map allowed, Set configured) { Boolean cached= (Boolean) allowed.get(annotationType); if (cached != null) return cached.booleanValue(); boolean covered= isCovered(annotationType, configured); allowed.put(annotationType, covered ? Boolean.TRUE : Boolean.FALSE); return covered; } /** * Computes whether the annotations of the given type are covered by the given <code>configured</code> * set. This is the case if either the type of the annotation or any of its * super types is contained in the <code>configured</code> set. * * @param annotationType the annotation type * @param configured the set with configured annotation types * @return <code>true</code> if annotation is covered, <code>false</code> * otherwise * @since 3.0 */ private boolean isCovered(Object annotationType, Set configured) { if (fAnnotationAccess instanceof IAnnotationAccessExtension) { IAnnotationAccessExtension extension= (IAnnotationAccessExtension) fAnnotationAccess; Iterator e= configured.iterator(); while (e.hasNext()) { if (extension.isSubtype(annotationType,e.next())) return true; } return false; } return configured.contains(annotationType); } /** * Returns a specification of a color that lies between the given * foreground and background color using the given scale factor. * * @param fg the foreground color * @param bg the background color * @param scale the scale factor * @return the interpolated color */ private static RGB interpolate(RGB fg, RGB bg, double scale) { return new RGB( (int) ((1.0-scale) * fg.red + scale * bg.red), (int) ((1.0-scale) * fg.green + scale * bg.green), (int) ((1.0-scale) * fg.blue + scale * bg.blue) ); } /** * Returns the grey value in which the given color would be drawn in grey-scale. * * @param rgb the color * @return the grey-scale value */ private static double greyLevel(RGB rgb) { if (rgb.red == rgb.green && rgb.green == rgb.blue) return rgb.red; return (0.299 * rgb.red + 0.587 * rgb.green + 0.114 * rgb.blue + 0.5); } /** * Returns whether the given color is dark or light depending on the colors grey-scale level. * * @param rgb the color * @return <code>true</code> if the color is dark, <code>false</code> if it is light */ private static boolean isDark(RGB rgb) { return greyLevel(rgb) > 128; } /** * Returns a color based on the color configured for the given annotation type and the given scale factor. * * @param annotationType the annotation type * @param scale the scale factor * @return the computed color */ private Color getColor(Object annotationType, double scale) { Color base= findColor(annotationType); if (base == null) return null; RGB baseRGB= base.getRGB(); RGB background= fCanvas.getBackground().getRGB(); boolean darkBase= isDark(baseRGB); boolean darkBackground= isDark(background); if (darkBase && darkBackground) background= new RGB(255, 255, 255); else if (!darkBase && !darkBackground) background= new RGB(0, 0, 0); return fSharedTextColors.getColor(interpolate(baseRGB, background, scale)); } /** * Returns the color for the given annotation type * * @param annotationType the annotation type * @return the color * @since 3.0 */ private Color findColor(Object annotationType) { Color color= (Color) fAnnotationTypes2Colors.get(annotationType); if (color != null) return color; if (fAnnotationAccess instanceof IAnnotationAccessExtension) { IAnnotationAccessExtension extension= (IAnnotationAccessExtension) fAnnotationAccess; Object[] superTypes= extension.getSupertypes(annotationType); if (superTypes != null) { for (int i= 0; i < superTypes.length; i++) { color= (Color) fAnnotationTypes2Colors.get(superTypes[i]); if (color != null) return color; } } } return null; } /** * Returns the stroke color for the given annotation type and characteristics. * * @param annotationType the annotation type * @param temporary <code>true</code> if for temporary annotations * @return the stroke color */ private Color getStrokeColor(Object annotationType, boolean temporary) { return getColor(annotationType, temporary ? 0.5 : 0.2); } /** * Returns the fill color for the given annotation type and characteristics. * * @param annotationType the annotation type * @param temporary <code>true</code> if for temporary annotations * @return the fill color */ private Color getFillColor(Object annotationType, boolean temporary) { return getColor(annotationType, temporary ? 0.9 : 0.6); } /* * @see IVerticalRulerInfo#getLineOfLastMouseButtonActivity() */ public int getLineOfLastMouseButtonActivity() { return fLastMouseButtonActivityLine; } /* * @see IVerticalRulerInfo#toDocumentLineNumber(int) */ public int toDocumentLineNumber(int y_coordinate) { if (fTextViewer == null || y_coordinate == -1) return -1; int[] lineNumbers= toLineNumbers(y_coordinate); int bestLine= findBestMatchingLineNumber(lineNumbers); if (bestLine == -1 && lineNumbers.length > 0) return lineNumbers[0]; return bestLine; } /* * @see org.eclipse.jface.text.source.IVerticalRuler#getModel() */ public IAnnotationModel getModel() { return fModel; } /* * @see org.eclipse.jface.text.source.IOverviewRuler#getAnnotationHeight() */ public int getAnnotationHeight() { return fAnnotationHeight; } /* * @see org.eclipse.jface.text.source.IOverviewRuler#hasAnnotation(int) */ public boolean hasAnnotation(int y) { return findBestMatchingLineNumber(toLineNumbers(y)) != -1; } /* * @see org.eclipse.jface.text.source.IOverviewRuler#getHeaderControl() */ public Control getHeaderControl() { return fHeader; } /* * @see org.eclipse.jface.text.source.IOverviewRuler#addHeaderAnnotationType(java.lang.Object) */ public void addHeaderAnnotationType(Object annotationType) { fConfiguredHeaderAnnotationTypes.add(annotationType); fAllowedHeaderAnnotationTypes.clear(); } /* * @see org.eclipse.jface.text.source.IOverviewRuler#removeHeaderAnnotationType(java.lang.Object) */ public void removeHeaderAnnotationType(Object annotationType) { fConfiguredHeaderAnnotationTypes.remove(annotationType); fAllowedHeaderAnnotationTypes.clear(); } /** * Updates the header of this ruler. */ private void updateHeader() { if (fHeader == null || fHeader.isDisposed()) return; Object colorType= null; outer: for (int i= fAnnotationsSortedByLayer.size() -1; i >= 0; i--) { Object annotationType= fAnnotationsSortedByLayer.get(i); if (skipInHeader(annotationType) || skip(annotationType)) continue; for (Iterator e= new FilterIterator(annotationType); e.hasNext();) { if (e.next() != null) { colorType= annotationType; break outer; } } } Color color= null; if (colorType != null) color= findColor(colorType); if (color == null) { if (fHeaderPainter != null) fHeaderPainter.setColor(null); } else { if (fHeaderPainter == null) { fHeaderPainter= new HeaderPainter(); fHeader.addPaintListener(fHeaderPainter); } fHeaderPainter.setColor(color); } fHeader.redraw(); updateHeaderToolTipText(); } /** * Updates the tool tip text of the header of this ruler. * * @since 3.0 */ private void updateHeaderToolTipText() { if (fHeader == null || fHeader.isDisposed()) return; fHeader.setToolTipText(null); if (!(fAnnotationAccess instanceof IAnnotationAccessExtension)) return; String overview= ""; //$NON-NLS-1$ for (int i= fAnnotationsSortedByLayer.size() -1; i >= 0; i--) { Object annotationType= fAnnotationsSortedByLayer.get(i); if (skipInHeader(annotationType) || skip(annotationType)) continue; int count= 0; String annotationTypeLabel= null; for (Iterator e= new FilterIterator(annotationType); e.hasNext();) { Annotation annotation= (Annotation)e.next(); if (annotation != null) { if (annotationTypeLabel == null) annotationTypeLabel= ((IAnnotationAccessExtension)fAnnotationAccess).getTypeLabel(annotation); count++; } } if (annotationTypeLabel != null) { if (overview.length() > 0) overview += "\n"; //$NON-NLS-1$ overview += JFaceTextMessages.getFormattedString("OverviewRulerHeader.toolTipTextEntry", new Object[] {annotationTypeLabel, new Integer(count)}); //$NON-NLS-1$ } } if (overview.length() > 0) fHeader.setToolTipText(overview); } }
true
true
private void doPaint1(GC gc) { if (fTextViewer == null) return; Rectangle r= new Rectangle(0, 0, 0, 0); int yy, hh= ANNOTATION_HEIGHT; ITextViewerExtension5 extension= (ITextViewerExtension5) fTextViewer; IDocument document= fTextViewer.getDocument(); StyledText textWidget= fTextViewer.getTextWidget(); int maxLines= textWidget.getLineCount(); Point size= fCanvas.getSize(); int writable= maxLines * textWidget.getLineHeight(); if (size.y > writable) size.y= Math.max(writable - fHeader.getSize().y, 0); fCachedAnnotations.clear(); Iterator iter= fModel.getAnnotationIterator(); while (iter.hasNext()) { Annotation annotation= (Annotation) iter.next(); if (annotation.isMarkedDeleted()) continue; if (skip(annotation.getType())) continue; fCachedAnnotations.add(annotation); } for (Iterator iterator= fAnnotationsSortedByLayer.iterator(); iterator.hasNext();) { Object annotationType= iterator.next(); if (skip(annotationType)) continue; boolean[] temporary= new boolean[] { false, true }; for (int t=0; t < temporary.length; t++) { Iterator e= new FilterIterator(annotationType, temporary[t], fCachedAnnotations.iterator()); Color fill= getFillColor(annotationType, temporary[t]); Color stroke= getStrokeColor(annotationType, temporary[t]); for (int i= 0; e.hasNext(); i++) { Annotation a= (Annotation) e.next(); Position p= fModel.getPosition(a); if (p == null) continue; IRegion widgetRegion= extension.modelRange2WidgetRange(new Region(p.getOffset(), p.getLength())); if (widgetRegion == null) continue; try { if (ANNOTATION_HEIGHT_SCALABLE) { int numbersOfLines= document.getNumberOfLines(p.getOffset(), p.getLength()); // don't count empty trailing lines IRegion lastLine= document.getLineInformationOfOffset(p.getOffset() + p.getLength()); if (lastLine.getOffset() == p.getOffset() + p.getLength()) { numbersOfLines -= 2; hh= (numbersOfLines * size.y) / maxLines + ANNOTATION_HEIGHT; if (hh < ANNOTATION_HEIGHT) hh= ANNOTATION_HEIGHT; } else hh= ANNOTATION_HEIGHT; } fAnnotationHeight= hh; int startLine= textWidget.getLineAtOffset(widgetRegion.getOffset()); yy= Math.min((startLine * size.y) / maxLines, size.y - hh); if (fill != null) { gc.setBackground(fill); gc.fillRectangle(INSET, yy, size.x-(2*INSET), hh); } if (stroke != null) { gc.setForeground(stroke); r.x= INSET; r.y= yy; r.width= size.x - (2 * INSET) - 1; r.height= hh; gc.setLineWidth(1); gc.drawRectangle(r); } } catch (BadLocationException x) { } } } } fCachedAnnotations.clear(); }
private void doPaint1(GC gc) { if (fTextViewer == null || fModel == null) return; Rectangle r= new Rectangle(0, 0, 0, 0); int yy, hh= ANNOTATION_HEIGHT; ITextViewerExtension5 extension= (ITextViewerExtension5) fTextViewer; IDocument document= fTextViewer.getDocument(); StyledText textWidget= fTextViewer.getTextWidget(); int maxLines= textWidget.getLineCount(); Point size= fCanvas.getSize(); int writable= maxLines * textWidget.getLineHeight(); if (size.y > writable) size.y= Math.max(writable - fHeader.getSize().y, 0); fCachedAnnotations.clear(); Iterator iter= fModel.getAnnotationIterator(); while (iter.hasNext()) { Annotation annotation= (Annotation) iter.next(); if (annotation.isMarkedDeleted()) continue; if (skip(annotation.getType())) continue; fCachedAnnotations.add(annotation); } for (Iterator iterator= fAnnotationsSortedByLayer.iterator(); iterator.hasNext();) { Object annotationType= iterator.next(); if (skip(annotationType)) continue; boolean[] temporary= new boolean[] { false, true }; for (int t=0; t < temporary.length; t++) { Iterator e= new FilterIterator(annotationType, temporary[t], fCachedAnnotations.iterator()); Color fill= getFillColor(annotationType, temporary[t]); Color stroke= getStrokeColor(annotationType, temporary[t]); for (int i= 0; e.hasNext(); i++) { Annotation a= (Annotation) e.next(); Position p= fModel.getPosition(a); if (p == null) continue; IRegion widgetRegion= extension.modelRange2WidgetRange(new Region(p.getOffset(), p.getLength())); if (widgetRegion == null) continue; try { if (ANNOTATION_HEIGHT_SCALABLE) { int numbersOfLines= document.getNumberOfLines(p.getOffset(), p.getLength()); // don't count empty trailing lines IRegion lastLine= document.getLineInformationOfOffset(p.getOffset() + p.getLength()); if (lastLine.getOffset() == p.getOffset() + p.getLength()) { numbersOfLines -= 2; hh= (numbersOfLines * size.y) / maxLines + ANNOTATION_HEIGHT; if (hh < ANNOTATION_HEIGHT) hh= ANNOTATION_HEIGHT; } else hh= ANNOTATION_HEIGHT; } fAnnotationHeight= hh; int startLine= textWidget.getLineAtOffset(widgetRegion.getOffset()); yy= Math.min((startLine * size.y) / maxLines, size.y - hh); if (fill != null) { gc.setBackground(fill); gc.fillRectangle(INSET, yy, size.x-(2*INSET), hh); } if (stroke != null) { gc.setForeground(stroke); r.x= INSET; r.y= yy; r.width= size.x - (2 * INSET) - 1; r.height= hh; gc.setLineWidth(1); gc.drawRectangle(r); } } catch (BadLocationException x) { } } } } fCachedAnnotations.clear(); }
diff --git a/src/cz/muni/stanse/cppparser/CppUnit.java b/src/cz/muni/stanse/cppparser/CppUnit.java index 01971cf..d1a549a 100644 --- a/src/cz/muni/stanse/cppparser/CppUnit.java +++ b/src/cz/muni/stanse/cppparser/CppUnit.java @@ -1,76 +1,76 @@ /* Distributed under GPLv2 */ package cz.muni.stanse.cppparser; import java.io.File; import java.io.IOException; import java.util.ArrayList; import java.util.List; import org.json.JSONException; import org.json.JSONObject; import org.json.JSONTokener; import cz.muni.stanse.Stanse; import cz.muni.stanse.cfgparser.CfgUnit; import cz.muni.stanse.codestructures.Unit; import cz.muni.stanse.codestructures.ParserException; import cz.muni.stanse.codestructures.CFG; import cz.muni.stanse.codestructures.CFGHandle; /** * Holds all the code-related data for C++ compilation units (files). */ public final class CppUnit extends Unit { private List<String> args = null; public CppUnit(List<String> args) { this.args = args; this.fileName = new File(args.get(0)); } public void parse() throws ParserException { String command = Stanse.getInstance().getRootDirectory() - + File.separator + "bin" + File.separator + "cppparser"; + + File.separator + "bin" + File.separator + "cpp2sir"; List<String> parserArgs = new ArrayList<String>(); parserArgs.add(command); parserArgs.add("-J"); parserArgs.addAll(args); ProcessBuilder builder = new ProcessBuilder(parserArgs); try { final Process p = builder.start(); new Thread() { public void run() { java.io.InputStreamReader sr = new java.io.InputStreamReader( p.getErrorStream()); java.io.BufferedReader br = new java.io.BufferedReader(sr); try { String line = br.readLine(); while (line != null) { System.err.println(line); line = br.readLine(); } br.close(); } catch (IOException ex) { } } }.start(); java.io.InputStreamReader sr = new java.io.InputStreamReader( p.getInputStream()); JSONTokener jsonTokener = new JSONTokener(sr); JSONObject jsonUnit = new JSONObject(jsonTokener); CFGs = CfgUnit.parseUnit(this.fileName.getParentFile(), jsonUnit); } catch (IOException e) { throw new ParserException("parser: " + e.getLocalizedMessage(), e); } catch (JSONException e) { throw new ParserException("parser: " + e.getLocalizedMessage(), e); } this.CFGHs = new ArrayList<CFGHandle>(); for (CFG cfg : CFGs) CFGHs.add(new CFGHandle(this, cfg)); } }
true
true
public void parse() throws ParserException { String command = Stanse.getInstance().getRootDirectory() + File.separator + "bin" + File.separator + "cppparser"; List<String> parserArgs = new ArrayList<String>(); parserArgs.add(command); parserArgs.add("-J"); parserArgs.addAll(args); ProcessBuilder builder = new ProcessBuilder(parserArgs); try { final Process p = builder.start(); new Thread() { public void run() { java.io.InputStreamReader sr = new java.io.InputStreamReader( p.getErrorStream()); java.io.BufferedReader br = new java.io.BufferedReader(sr); try { String line = br.readLine(); while (line != null) { System.err.println(line); line = br.readLine(); } br.close(); } catch (IOException ex) { } } }.start(); java.io.InputStreamReader sr = new java.io.InputStreamReader( p.getInputStream()); JSONTokener jsonTokener = new JSONTokener(sr); JSONObject jsonUnit = new JSONObject(jsonTokener); CFGs = CfgUnit.parseUnit(this.fileName.getParentFile(), jsonUnit); } catch (IOException e) { throw new ParserException("parser: " + e.getLocalizedMessage(), e); } catch (JSONException e) { throw new ParserException("parser: " + e.getLocalizedMessage(), e); } this.CFGHs = new ArrayList<CFGHandle>(); for (CFG cfg : CFGs) CFGHs.add(new CFGHandle(this, cfg)); }
public void parse() throws ParserException { String command = Stanse.getInstance().getRootDirectory() + File.separator + "bin" + File.separator + "cpp2sir"; List<String> parserArgs = new ArrayList<String>(); parserArgs.add(command); parserArgs.add("-J"); parserArgs.addAll(args); ProcessBuilder builder = new ProcessBuilder(parserArgs); try { final Process p = builder.start(); new Thread() { public void run() { java.io.InputStreamReader sr = new java.io.InputStreamReader( p.getErrorStream()); java.io.BufferedReader br = new java.io.BufferedReader(sr); try { String line = br.readLine(); while (line != null) { System.err.println(line); line = br.readLine(); } br.close(); } catch (IOException ex) { } } }.start(); java.io.InputStreamReader sr = new java.io.InputStreamReader( p.getInputStream()); JSONTokener jsonTokener = new JSONTokener(sr); JSONObject jsonUnit = new JSONObject(jsonTokener); CFGs = CfgUnit.parseUnit(this.fileName.getParentFile(), jsonUnit); } catch (IOException e) { throw new ParserException("parser: " + e.getLocalizedMessage(), e); } catch (JSONException e) { throw new ParserException("parser: " + e.getLocalizedMessage(), e); } this.CFGHs = new ArrayList<CFGHandle>(); for (CFG cfg : CFGs) CFGHs.add(new CFGHandle(this, cfg)); }
diff --git a/tests/org.eclipse.xtext.generator.tests/src/org/eclipse/xtext/parser/AbstractXtextGrammarParsingTest.java b/tests/org.eclipse.xtext.generator.tests/src/org/eclipse/xtext/parser/AbstractXtextGrammarParsingTest.java index 9d11989ed..e8c7f43e2 100644 --- a/tests/org.eclipse.xtext.generator.tests/src/org/eclipse/xtext/parser/AbstractXtextGrammarParsingTest.java +++ b/tests/org.eclipse.xtext.generator.tests/src/org/eclipse/xtext/parser/AbstractXtextGrammarParsingTest.java @@ -1,43 +1,43 @@ /******************************************************************************* * Copyright (c) 2009 itemis AG (http://www.itemis.eu) and others. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/epl-v10.html *******************************************************************************/ package org.eclipse.xtext.parser; import java.io.IOException; import java.util.Arrays; import java.util.List; import org.eclipse.xtext.GenerateAllTestGrammars; import org.eclipse.xtext.util.CollectionUtils; import org.eclipse.xtext.util.Function; import org.eclipse.xtext.util.Pair; import org.eclipse.xtext.util.Tuples; /** * @author Sebastian Zarnekow - Initial contribution and API */ public abstract class AbstractXtextGrammarParsingTest extends AbstractPackratAntlrComparingTest { @Override protected Iterable<Pair<String, String>> getAllModels() { List<Class<?>> classes = Arrays.asList(GenerateAllTestGrammars.testclasses); return CollectionUtils.map(classes, new Function<Class<?>, Pair<String, String>>() { public Pair<String, String> exec(Class<?> param) { - String filename = "" + param.getName().replace('.', '/') + ".xtext"; + String filename = GenerateAllTestGrammars.getGrammarFileName(param); String model; try { model = readFileIntoString(filename); } catch (IOException e) { throw new RuntimeException(e); } return Tuples.create(param.getSimpleName(), model); } }); } }
true
true
protected Iterable<Pair<String, String>> getAllModels() { List<Class<?>> classes = Arrays.asList(GenerateAllTestGrammars.testclasses); return CollectionUtils.map(classes, new Function<Class<?>, Pair<String, String>>() { public Pair<String, String> exec(Class<?> param) { String filename = "" + param.getName().replace('.', '/') + ".xtext"; String model; try { model = readFileIntoString(filename); } catch (IOException e) { throw new RuntimeException(e); } return Tuples.create(param.getSimpleName(), model); } }); }
protected Iterable<Pair<String, String>> getAllModels() { List<Class<?>> classes = Arrays.asList(GenerateAllTestGrammars.testclasses); return CollectionUtils.map(classes, new Function<Class<?>, Pair<String, String>>() { public Pair<String, String> exec(Class<?> param) { String filename = GenerateAllTestGrammars.getGrammarFileName(param); String model; try { model = readFileIntoString(filename); } catch (IOException e) { throw new RuntimeException(e); } return Tuples.create(param.getSimpleName(), model); } }); }
diff --git a/weasis-base/weasis-base-explorer/src/main/java/org/weasis/base/explorer/JIThumbnailCache.java b/weasis-base/weasis-base-explorer/src/main/java/org/weasis/base/explorer/JIThumbnailCache.java index fd93329c6..d3d27e152 100644 --- a/weasis-base/weasis-base-explorer/src/main/java/org/weasis/base/explorer/JIThumbnailCache.java +++ b/weasis-base/weasis-base-explorer/src/main/java/org/weasis/base/explorer/JIThumbnailCache.java @@ -1,175 +1,177 @@ package org.weasis.base.explorer; import java.awt.image.BufferedImage; import java.awt.image.RenderedImage; import java.io.File; import java.io.IOException; import java.util.Collections; import java.util.LinkedHashMap; import java.util.Map; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import javax.media.jai.PlanarImage; import javax.media.jai.operator.SubsampleAverageDescriptor; import javax.swing.Icon; import org.weasis.core.api.gui.util.GuiExecutor; import org.weasis.core.api.image.util.ImageFiler; import org.weasis.core.api.media.data.ImageElement; import org.weasis.core.api.media.data.Thumbnail; import com.sun.media.jai.codec.FileSeekableStream; import com.sun.media.jai.codec.ImageCodec; import com.sun.media.jai.codec.ImageDecoder; public final class JIThumbnailCache { private static JIThumbnailCache instance; // Set only one concurrent thread, because of the imageio issue with native library // (https://jai-imageio-core.dev.java.net/issues/show_bug.cgi?id=126) private static final ExecutorService qExecutor = Executors.newFixedThreadPool(1); private final Map<String, ThumbnailIcon> cachedThumbnails; private JIThumbnailCache() { this.cachedThumbnails = Collections.synchronizedMap(new LinkedHashMap<String, ThumbnailIcon>(80) { private static final int MAX_ENTRIES = 50; @Override protected boolean removeEldestEntry(final Map.Entry eldest) { return size() > MAX_ENTRIES; } }); } public static JIThumbnailCache getInstance() { if (instance == null) { instance = new JIThumbnailCache(); } return instance; } public synchronized void invalidate() { this.cachedThumbnails.clear(); } public Icon getThumbnailFor(final ImageElement diskObject, final JIThumbnailList list, final int index) { try { final ThumbnailIcon jiIcon = this.cachedThumbnails.get(diskObject.getFile().getPath()); if (jiIcon != null) { return jiIcon; } } catch (final Exception e) { // log.debug(e); } if (!diskObject.isLoading()) { loadThumbnail(diskObject, list, index); } return null; } private void loadThumbnail(final ImageElement diskObject, final JIThumbnailList thumbnailList, final int index) { if ((index > thumbnailList.getLastVisibleIndex()) || (index < thumbnailList.getFirstVisibleIndex())) { return; } try { // /////////////////////////////////////////////////////////////////////// JIThumbnailCache.qExecutor.execute(new Runnable() { @Override public void run() { RenderedImage img = null; String mime = diskObject.getMimeType(); if (mime == null) { mime = ""; } String cfile = diskObject.getFile().getAbsolutePath(); String tiled_File = thumbnailList.getThumbnailListModel().getFileInCache(cfile); if (tiled_File != null) { try { ImageDecoder dec = ImageCodec.createImageDecoder("tiff", new FileSeekableStream(tiled_File == null ? diskObject.getFile() : new File(JIListModel.EXPLORER_CACHE_DIR, tiled_File)), null); int count = dec.getNumPages(); if (count == 2) { RenderedImage src2 = dec.decodeAsRenderedImage(1); if (src2.getWidth() <= Thumbnail.MAX_SIZE) { img = src2; } } } catch (IOException ex) { ex.printStackTrace(); } } if (img == null) { img = diskObject.getRenderedImage(diskObject.getImage(null)); } if (img == null) { return; } if (tiled_File == null) { /* * Make an image cache with its thumbnail when the image size is larger than a tile size and if * not DICOM file */ if ((img.getWidth() > ImageFiler.TILESIZE || img.getHeight() > ImageFiler.TILESIZE) && !mime.contains("dicom")) { File imgCacheFile = null; try { imgCacheFile = File.createTempFile("tiled_", ".tif", JIListModel.EXPLORER_CACHE_DIR); //$NON-NLS-1$ //$NON-NLS-2$ } catch (IOException e) { e.printStackTrace(); } if (ImageFiler.writeTIFF(imgCacheFile, img, true, true, false)) { + // Prevent to many files open on Linux (Ubuntu => 1024) and close image stream + diskObject.removeImageFromCache(); thumbnailList.getThumbnailListModel().putFileInCache(cfile, imgCacheFile.getName()); } else { // TODO make it invalid } return; } } final double scale = Math.min(ThumbnailRenderer.ICON_DIM.height / (double) img.getHeight(), ThumbnailRenderer.ICON_DIM.width / (double) img.getWidth()); final BufferedImage tIcon = scale <= 1.0 ? scale > 0.005 ? SubsampleAverageDescriptor.create(img, scale, scale, Thumbnail.DownScaleQualityHints).getAsBufferedImage() : null : PlanarImage .wrapRenderedImage(img).getAsBufferedImage(); // Prevent to many files open on Linux (Ubuntu => 1024) and close image stream diskObject.removeImageFromCache(); GuiExecutor.instance().execute(new Runnable() { @Override public void run() { if (tIcon != null) { JIThumbnailCache.this.cachedThumbnails.put(diskObject.getFile().getPath(), new ThumbnailIcon(tIcon)); } thumbnailList.getThumbnailListModel().notifyAsUpdated(index); } }); } }); // /////////////////////////////////////////////////////////////////////// } catch (final Exception exp) { // log.debug(exp); } } }
true
true
private void loadThumbnail(final ImageElement diskObject, final JIThumbnailList thumbnailList, final int index) { if ((index > thumbnailList.getLastVisibleIndex()) || (index < thumbnailList.getFirstVisibleIndex())) { return; } try { // /////////////////////////////////////////////////////////////////////// JIThumbnailCache.qExecutor.execute(new Runnable() { @Override public void run() { RenderedImage img = null; String mime = diskObject.getMimeType(); if (mime == null) { mime = ""; } String cfile = diskObject.getFile().getAbsolutePath(); String tiled_File = thumbnailList.getThumbnailListModel().getFileInCache(cfile); if (tiled_File != null) { try { ImageDecoder dec = ImageCodec.createImageDecoder("tiff", new FileSeekableStream(tiled_File == null ? diskObject.getFile() : new File(JIListModel.EXPLORER_CACHE_DIR, tiled_File)), null); int count = dec.getNumPages(); if (count == 2) { RenderedImage src2 = dec.decodeAsRenderedImage(1); if (src2.getWidth() <= Thumbnail.MAX_SIZE) { img = src2; } } } catch (IOException ex) { ex.printStackTrace(); } } if (img == null) { img = diskObject.getRenderedImage(diskObject.getImage(null)); } if (img == null) { return; } if (tiled_File == null) { /* * Make an image cache with its thumbnail when the image size is larger than a tile size and if * not DICOM file */ if ((img.getWidth() > ImageFiler.TILESIZE || img.getHeight() > ImageFiler.TILESIZE) && !mime.contains("dicom")) { File imgCacheFile = null; try { imgCacheFile = File.createTempFile("tiled_", ".tif", JIListModel.EXPLORER_CACHE_DIR); //$NON-NLS-1$ //$NON-NLS-2$ } catch (IOException e) { e.printStackTrace(); } if (ImageFiler.writeTIFF(imgCacheFile, img, true, true, false)) { thumbnailList.getThumbnailListModel().putFileInCache(cfile, imgCacheFile.getName()); } else { // TODO make it invalid } return; } } final double scale = Math.min(ThumbnailRenderer.ICON_DIM.height / (double) img.getHeight(), ThumbnailRenderer.ICON_DIM.width / (double) img.getWidth()); final BufferedImage tIcon = scale <= 1.0 ? scale > 0.005 ? SubsampleAverageDescriptor.create(img, scale, scale, Thumbnail.DownScaleQualityHints).getAsBufferedImage() : null : PlanarImage .wrapRenderedImage(img).getAsBufferedImage(); // Prevent to many files open on Linux (Ubuntu => 1024) and close image stream diskObject.removeImageFromCache(); GuiExecutor.instance().execute(new Runnable() { @Override public void run() { if (tIcon != null) { JIThumbnailCache.this.cachedThumbnails.put(diskObject.getFile().getPath(), new ThumbnailIcon(tIcon)); } thumbnailList.getThumbnailListModel().notifyAsUpdated(index); } }); } }); // /////////////////////////////////////////////////////////////////////// } catch (final Exception exp) { // log.debug(exp); } }
private void loadThumbnail(final ImageElement diskObject, final JIThumbnailList thumbnailList, final int index) { if ((index > thumbnailList.getLastVisibleIndex()) || (index < thumbnailList.getFirstVisibleIndex())) { return; } try { // /////////////////////////////////////////////////////////////////////// JIThumbnailCache.qExecutor.execute(new Runnable() { @Override public void run() { RenderedImage img = null; String mime = diskObject.getMimeType(); if (mime == null) { mime = ""; } String cfile = diskObject.getFile().getAbsolutePath(); String tiled_File = thumbnailList.getThumbnailListModel().getFileInCache(cfile); if (tiled_File != null) { try { ImageDecoder dec = ImageCodec.createImageDecoder("tiff", new FileSeekableStream(tiled_File == null ? diskObject.getFile() : new File(JIListModel.EXPLORER_CACHE_DIR, tiled_File)), null); int count = dec.getNumPages(); if (count == 2) { RenderedImage src2 = dec.decodeAsRenderedImage(1); if (src2.getWidth() <= Thumbnail.MAX_SIZE) { img = src2; } } } catch (IOException ex) { ex.printStackTrace(); } } if (img == null) { img = diskObject.getRenderedImage(diskObject.getImage(null)); } if (img == null) { return; } if (tiled_File == null) { /* * Make an image cache with its thumbnail when the image size is larger than a tile size and if * not DICOM file */ if ((img.getWidth() > ImageFiler.TILESIZE || img.getHeight() > ImageFiler.TILESIZE) && !mime.contains("dicom")) { File imgCacheFile = null; try { imgCacheFile = File.createTempFile("tiled_", ".tif", JIListModel.EXPLORER_CACHE_DIR); //$NON-NLS-1$ //$NON-NLS-2$ } catch (IOException e) { e.printStackTrace(); } if (ImageFiler.writeTIFF(imgCacheFile, img, true, true, false)) { // Prevent to many files open on Linux (Ubuntu => 1024) and close image stream diskObject.removeImageFromCache(); thumbnailList.getThumbnailListModel().putFileInCache(cfile, imgCacheFile.getName()); } else { // TODO make it invalid } return; } } final double scale = Math.min(ThumbnailRenderer.ICON_DIM.height / (double) img.getHeight(), ThumbnailRenderer.ICON_DIM.width / (double) img.getWidth()); final BufferedImage tIcon = scale <= 1.0 ? scale > 0.005 ? SubsampleAverageDescriptor.create(img, scale, scale, Thumbnail.DownScaleQualityHints).getAsBufferedImage() : null : PlanarImage .wrapRenderedImage(img).getAsBufferedImage(); // Prevent to many files open on Linux (Ubuntu => 1024) and close image stream diskObject.removeImageFromCache(); GuiExecutor.instance().execute(new Runnable() { @Override public void run() { if (tIcon != null) { JIThumbnailCache.this.cachedThumbnails.put(diskObject.getFile().getPath(), new ThumbnailIcon(tIcon)); } thumbnailList.getThumbnailListModel().notifyAsUpdated(index); } }); } }); // /////////////////////////////////////////////////////////////////////// } catch (final Exception exp) { // log.debug(exp); } }
diff --git a/src/web/org/openmrs/web/filter/initialization/InitializationFilter.java b/src/web/org/openmrs/web/filter/initialization/InitializationFilter.java index 23787c9f..84a72abb 100644 --- a/src/web/org/openmrs/web/filter/initialization/InitializationFilter.java +++ b/src/web/org/openmrs/web/filter/initialization/InitializationFilter.java @@ -1,848 +1,850 @@ /** * The contents of this file are subject to the OpenMRS Public License * Version 1.0 (the "License"); you may not use this file except in * compliance with the License. You may obtain a copy of the License at * http://license.openmrs.org * * Software distributed under the License is distributed on an "AS IS" * basis, WITHOUT WARRANTY OF ANY KIND, either express or implied. See the * License for the specific language governing rights and limitations * under the License. * * Copyright (C) OpenMRS, LLC. All Rights Reserved. */ package org.openmrs.web.filter.initialization; import java.io.File; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import java.io.InputStream; import java.io.InputStreamReader; import java.io.Writer; import java.lang.reflect.Field; import java.sql.Connection; import java.sql.DriverManager; import java.sql.SQLException; import java.sql.Statement; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Properties; import java.util.Random; import javax.servlet.Filter; import javax.servlet.FilterChain; import javax.servlet.FilterConfig; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.ServletRequest; import javax.servlet.ServletResponse; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; import org.apache.velocity.VelocityContext; import org.apache.velocity.app.VelocityEngine; import org.apache.velocity.runtime.RuntimeConstants; import org.openmrs.ImplementationId; import org.openmrs.api.PasswordException; import org.openmrs.api.context.Context; import org.openmrs.module.web.WebModuleUtil; import org.openmrs.scheduler.SchedulerConstants; import org.openmrs.scheduler.SchedulerUtil; import org.openmrs.util.DatabaseUpdateException; import org.openmrs.util.DatabaseUpdater; import org.openmrs.util.InputRequiredException; import org.openmrs.util.OpenmrsConstants; import org.openmrs.util.OpenmrsUtil; import org.openmrs.web.Listener; import org.openmrs.web.WebConstants; import org.springframework.web.context.ContextLoader; /** * This is the first filter that is processed. It is only active when starting OpenMRS for the very * first time. It will redirect all requests to the {@link WebConstants#SETUP_PAGE_URL} if the * {@link Listener} wasn't able to find any runtime properties */ public class InitializationFilter implements Filter { protected final Log log = LogFactory.getLog(getClass()); private static final String LIQUIBASE_SCHEMA_DATA = "liquibase-schema-only.xml"; private static final String LIQUIBASE_CORE_DATA = "liquibase-core-data.xml"; private static final String LIQUIBASE_DEMO_DATA = "liquibase-demo-data.xml"; private static VelocityEngine velocityEngine = null; /** * The velocity macro page to redirect to if an error occurs or on initial startup */ private final String DEFAULT_PAGE = "databasesetup.vm"; /** * Set by the {@link #init(FilterConfig)} method so that we have access to the current * {@link ServletContext} */ private FilterConfig filterConfig = null; /** * The model object that holds all the properties that the rendered templates use. All * attributes on this object are made available to all templates via reflection in the * {@link #renderTemplate(String, Map, Writer)} method. */ private InitializationWizardModel wizardModel = null; /** * Variable set at the end of the wizard when spring is being restarted */ private boolean initializationComplete = false; /** * The web.xml file sets this {@link InitializationFilter} to be the first filter for all * requests. * * @see javax.servlet.Filter#doFilter(javax.servlet.ServletRequest, * javax.servlet.ServletResponse, javax.servlet.FilterChain) */ public void doFilter(ServletRequest request, ServletResponse response, FilterChain chain) throws IOException, ServletException { if (Listener.runtimePropertiesFound() || isInitializationComplete()) { chain.doFilter(request, response); } else { // we only get here if the Listener didn't find a runtime // properties files HttpServletRequest httpRequest = (HttpServletRequest) request; HttpServletResponse httpResponse = (HttpServletResponse) response; String servletPath = httpRequest.getServletPath(); // for all /images files, write the path if (servletPath.startsWith("/images") || servletPath.startsWith("/scripts")) { // writes the actual image file path to the response File file = new File(filterConfig.getServletContext().getRealPath(httpRequest.getServletPath())); if (httpRequest.getPathInfo() != null) file = new File(file, httpRequest.getPathInfo()); try { InputStream imageFileInputStream = new FileInputStream(file); OpenmrsUtil.copyFile(imageFileInputStream, httpResponse.getOutputStream()); imageFileInputStream.close(); } catch (FileNotFoundException e) { log.error("Unable to find file: " + file.getAbsolutePath()); } } // for anything but /initialsetup else if (!httpRequest.getServletPath().equals("/" + WebConstants.SETUP_PAGE_URL)) { // send the user to the setup page httpResponse.sendRedirect("/" + WebConstants.WEBAPP_NAME + "/" + WebConstants.SETUP_PAGE_URL); } else { // does the wizard // clear the error message that was potentially there from // the last page wizardModel.workLog.clear(); wizardModel.errors.clear(); if (httpRequest.getMethod().equals("GET")) { doGet(httpRequest, httpResponse); } else if (httpRequest.getMethod().equals("POST")) { doPost(httpRequest, httpResponse); } } // Don't continue down the filter chain otherwise Spring complains // that it hasn't been set up yet. // The jsp and servlet filter are also on this chain, so writing to // the response directly here is the only option } } /** * Convenience method to set up the velocity context properly */ private void initializeVelocity() { if (velocityEngine == null) { velocityEngine = new VelocityEngine(); Properties props = new Properties(); props.setProperty(RuntimeConstants.RUNTIME_LOG, "initial_wizard_vel.log"); // props.setProperty( RuntimeConstants.RUNTIME_LOG_LOGSYSTEM_CLASS, // "org.apache.velocity.runtime.log.CommonsLogLogChute" ); // props.setProperty(CommonsLogLogChute.LOGCHUTE_COMMONS_LOG_NAME, // "initial_wizard_velocity"); // so the vm pages can import the header/footer props.setProperty(RuntimeConstants.RESOURCE_LOADER, "class"); props.setProperty("class.resource.loader.description", "Velocity Classpath Resource Loader"); props.setProperty("class.resource.loader.class", "org.apache.velocity.runtime.resource.loader.ClasspathResourceLoader"); try { velocityEngine.init(props); } catch (Exception e) { log.error("velocity init failed, because: " + e); } } } /** * Called by {@link #doFilter(ServletRequest, ServletResponse, FilterChain)} on GET requests * * @param httpRequest * @param httpResponse */ private void doGet(HttpServletRequest httpRequest, HttpServletResponse httpResponse) throws IOException { Writer writer = httpResponse.getWriter(); Map<String, Object> referenceMap = new HashMap<String, Object>(); File runtimeProperties = getRuntimePropertiesFile(); if (!runtimeProperties.exists()) { try { runtimeProperties.createNewFile(); } catch (IOException io) { wizardModel.canCreate = false; wizardModel.cannotCreateErrorMessage = io.getMessage(); } // check this before deleting the file again wizardModel.canWrite = runtimeProperties.canWrite(); // delete the file again after testing the create/write // so that if the user stops the webapp before finishing // this wizard, they can still get back into it runtimeProperties.delete(); } else { wizardModel.canWrite = runtimeProperties.canWrite(); } wizardModel.runtimePropertiesPath = runtimeProperties.getAbsolutePath(); // do step one of the wizard renderTemplate(DEFAULT_PAGE, referenceMap, writer); } /** * Called by {@link #doFilter(ServletRequest, ServletResponse, FilterChain)} on POST requests * * @param httpRequest * @param httpResponse */ private void doPost(HttpServletRequest httpRequest, HttpServletResponse httpResponse) throws IOException { String page = httpRequest.getParameter("page"); Map<String, Object> referenceMap = new HashMap<String, Object>(); Writer writer = httpResponse.getWriter(); // clear existing errors wizardModel.errors.clear(); // step one if ("databasesetup.vm".equals(page)) { wizardModel.databaseConnection = httpRequest.getParameter("database_connection"); checkForEmptyValue(wizardModel.databaseConnection, wizardModel.errors, "Database connection string"); // asked the user for their desired database name if ("yes".equals(httpRequest.getParameter("current_openmrs_database"))) { wizardModel.databaseName = httpRequest.getParameter("openmrs_current_database_name"); checkForEmptyValue(wizardModel.databaseName, wizardModel.errors, "Current database name"); wizardModel.hasCurrentOpenmrsDatabase = true; // TODO check to see if this is an active database } else { // mark this wizard as a "to create database" (done at the end) wizardModel.hasCurrentOpenmrsDatabase = false; wizardModel.createTables = true; wizardModel.databaseName = httpRequest.getParameter("openmrs_new_database_name"); checkForEmptyValue(wizardModel.databaseName, wizardModel.errors, "New database name"); // TODO create database now to check if its possible? wizardModel.createDatabaseUsername = httpRequest.getParameter("create_database_username"); checkForEmptyValue(wizardModel.createDatabaseUsername, wizardModel.errors, "A user that has 'CREATE DATABASE' privileges"); wizardModel.createDatabasePassword = httpRequest.getParameter("create_database_password"); checkForEmptyValue(wizardModel.createDatabasePassword, wizardModel.errors, "Password for user with 'CREATE DATABASE' privileges"); } if (wizardModel.errors.isEmpty()) { page = "databasetablesanduser.vm"; } renderTemplate(page, referenceMap, writer); } // step two else if ("databasetablesanduser.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("databasesetup.vm", referenceMap, writer); return; } if (wizardModel.hasCurrentOpenmrsDatabase) { wizardModel.createTables = "yes".equals(httpRequest.getParameter("create_tables")); } wizardModel.addDemoData = "yes".equals(httpRequest.getParameter("add_demo_data")); if ("yes".equals(httpRequest.getParameter("current_database_user"))) { wizardModel.currentDatabaseUsername = httpRequest.getParameter("current_database_username"); checkForEmptyValue(wizardModel.currentDatabaseUsername, wizardModel.errors, "Curent user account"); wizardModel.currentDatabasePassword = httpRequest.getParameter("current_database_password"); checkForEmptyValue(wizardModel.currentDatabasePassword, wizardModel.errors, "Current user account password"); wizardModel.hasCurrentDatabaseUser = true; wizardModel.createDatabaseUser = false; } else { wizardModel.hasCurrentDatabaseUser = false; wizardModel.createDatabaseUser = true; // asked for the root mysql username/password wizardModel.createUserUsername = httpRequest.getParameter("create_user_username"); checkForEmptyValue(wizardModel.createUserUsername, wizardModel.errors, "A user that has 'CREATE USER' privileges"); wizardModel.createUserPassword = httpRequest.getParameter("create_user_password"); checkForEmptyValue(wizardModel.createUserPassword, wizardModel.errors, "Password for user that has 'CREATE USER' privileges"); } if (wizardModel.errors.isEmpty()) { // go to next page page = "otherruntimeproperties.vm"; } renderTemplate(page, referenceMap, writer); } // step three else if ("otherruntimeproperties.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("databasetablesanduser.vm", referenceMap, writer); return; } wizardModel.moduleWebAdmin = "yes".equals(httpRequest.getParameter("module_web_admin")); wizardModel.autoUpdateDatabase = "yes".equals(httpRequest.getParameter("auto_update_database")); if (wizardModel.createTables) { // go to next page if they are creating tables page = "adminusersetup.vm"; } else { // skip a page page = "implementationidsetup.vm"; } renderTemplate(page, referenceMap, writer); } // optional step four else if ("adminusersetup.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("otherruntimeproperties.vm", referenceMap, writer); return; } wizardModel.adminUserPassword = httpRequest.getParameter("new_admin_password"); String adminUserConfirm = httpRequest.getParameter("new_admin_password_confirm"); // throw back to admin user if passwords don't match if (!wizardModel.adminUserPassword.equals(adminUserConfirm)) { wizardModel.errors.add("Admin passwords don't match"); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } // throw back if the user didn't put in a password if (wizardModel.adminUserPassword.equals("")) { wizardModel.errors.add("An admin password is required"); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } try { OpenmrsUtil.validatePassword("admin", wizardModel.adminUserPassword, "admin"); } catch (PasswordException p) { wizardModel.errors.add("The password is not long enough, does not contain both uppercase characters and a number, or matches the username."); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } if (wizardModel.errors.isEmpty()) { // go to next page page = "implementationidsetup.vm"; } renderTemplate(page, referenceMap, writer); } // optional step five else if ("implementationidsetup.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { if (wizardModel.createTables) renderTemplate("adminusersetup.vm", referenceMap, writer); else renderTemplate("otherruntimeproperties.vm", referenceMap, writer); return; } wizardModel.implementationIdName = httpRequest.getParameter("implementation_name"); wizardModel.implementationId = httpRequest.getParameter("implementation_id"); wizardModel.implementationIdPassPhrase = httpRequest.getParameter("pass_phrase"); wizardModel.implementationIdDescription = httpRequest.getParameter("description"); // throw back if the user-specified ID is invalid (contains ^ or |). if (wizardModel.implementationId.indexOf('^') != -1 || wizardModel.implementationId.indexOf('|') != -1) { wizardModel.errors.add("Implementation ID cannot contain '^' or '|'"); renderTemplate("implementationidsetup.vm", referenceMap, writer); return; } if (wizardModel.errors.isEmpty()) { // go to next page page = "wizardcomplete.vm"; } renderTemplate(page, referenceMap, writer); } else if ("wizardcomplete.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("implementationidsetup.vm", referenceMap, writer); return; } Properties runtimeProperties = new Properties(); String connectionUsername; String connectionPassword; if (!wizardModel.hasCurrentOpenmrsDatabase) { // connect via jdbc and create a database String sql = "create database `?` default character set utf8"; int result = executeStatement(false, wizardModel.createDatabaseUsername, wizardModel.createDatabasePassword, sql, wizardModel.databaseName); // throw the user back to the main screen if this error occurs if (result < 0) { renderTemplate(DEFAULT_PAGE, null, writer); return; } else { wizardModel.workLog.add("Created database " + wizardModel.databaseName); } } if (wizardModel.createDatabaseUser) { connectionUsername = wizardModel.databaseName + "_user"; if (connectionUsername.length() > 16) connectionUsername = wizardModel.databaseName.substring(0, 11) + "_user"; // trim off enough to leave space for _user at the end connectionPassword = ""; // generate random password from this subset of alphabet // intentionally left out these characters: ufsb$() to prevent certain words forming randomly String chars = "acdeghijklmnopqrtvwxyzACDEGHIJKLMNOPQRTVWXYZ0123456789.|~@#^&"; Random r = new Random(); for (int x = 0; x < 12; x++) { connectionPassword += chars.charAt(r.nextInt(chars.length())); } // connect via jdbc with root user and create an openmrs user String sql = "drop user '?'@'localhost'"; executeStatement(true, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, connectionUsername); sql = "create user '?'@'localhost' identified by '?'"; if (-1 != executeStatement(false, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, connectionUsername, connectionPassword)) { wizardModel.workLog.add("Created user " + connectionUsername); } else { // if error occurs stop renderTemplate(DEFAULT_PAGE, null, writer); return; } // grant the roles sql = "GRANT ALL ON `?`.* TO '?'@'localhost'"; int result = executeStatement(false, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, wizardModel.databaseName, connectionUsername); // throw the user back to the main screen if this error occurs if (result < 0) { renderTemplate(DEFAULT_PAGE, null, writer); return; } else { wizardModel.workLog.add("Granted user " + connectionUsername + " all privileges to database " + wizardModel.databaseName); } } else { connectionUsername = wizardModel.currentDatabaseUsername; connectionPassword = wizardModel.currentDatabasePassword; } String finalDatabaseConnectionString = wizardModel.databaseConnection.replace("@DBNAME@", wizardModel.databaseName); // verify that the database connection works if (!verifyConnection(connectionUsername, connectionPassword, finalDatabaseConnectionString)) { // redirect to setup page if we got an error renderTemplate(DEFAULT_PAGE, null, writer); return; } // save the properties for startup purposes runtimeProperties.put("connection.url", finalDatabaseConnectionString); runtimeProperties.put("connection.username", connectionUsername); runtimeProperties.put("connection.password", connectionPassword); runtimeProperties.put("module.allow_web_admin", wizardModel.moduleWebAdmin.toString()); runtimeProperties.put("auto_update_database", wizardModel.autoUpdateDatabase.toString()); runtimeProperties.put(SchedulerConstants.SCHEDULER_USERNAME_PROPERTY, "admin"); runtimeProperties.put(SchedulerConstants.SCHEDULER_PASSWORD_PROPERTY, wizardModel.adminUserPassword); Context.setRuntimeProperties(runtimeProperties); if (wizardModel.createTables) { // use liquibase to create core data + tables try { DatabaseUpdater.executeChangelog(LIQUIBASE_SCHEMA_DATA, null); DatabaseUpdater.executeChangelog(LIQUIBASE_CORE_DATA, null); wizardModel.workLog.add("Created database tables and added core data"); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " See the error log for more details"); // TODO internationalize this log.warn("Error while trying to create tables and demo data", e); } } // add demo data only if creating tables fresh and user selected the option add demo data if (wizardModel.createTables && wizardModel.addDemoData) { try { DatabaseUpdater.executeChangelog(LIQUIBASE_DEMO_DATA, null); wizardModel.workLog.add("Added demo data"); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " See the error log for more details"); // TODO internationalize this log.warn("Error while trying to add demo data", e); } } // update the database to the latest version try { DatabaseUpdater.update(); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " Error while trying to update to the latest database version"); // TODO internationalize this log.warn("Error while trying to update to the latest database version", e); renderTemplate(DEFAULT_PAGE, null, writer); return; } // start spring // after this point, all errors need to also call: contextLoader.closeWebApplicationContext(event.getServletContext()) // logic copied from org.springframework.web.context.ContextLoaderListener ContextLoader contextLoader = new ContextLoader(); contextLoader.initWebApplicationContext(filterConfig.getServletContext()); // start openmrs try { + Context.openSession(); Context.startup(runtimeProperties); } catch (DatabaseUpdateException updateEx) { log.warn("Error while running the database update file", updateEx); wizardModel.errors.add(updateEx.getMessage() + " There was an error while running the database update file: " + updateEx.getMessage()); // TODO internationalize this renderTemplate(DEFAULT_PAGE, null, writer); return; } catch (InputRequiredException inputRequiredEx) { // TODO display a page looping over the required input and ask the user for each. // When done and the user and put in their say, call DatabaseUpdater.update(Map); // with the user's question/answer pairs log .warn("Unable to continue because user input is required for the db updates, but I am not doing anything about that right now"); wizardModel.errors .add("Unable to continue because user input is required for the db updates, but I am not doing anything about that right now"); renderTemplate(DEFAULT_PAGE, null, writer); return; } // TODO catch openmrs errors here and drop the user back out to the setup screen if (!wizardModel.implementationId.equals("")) { try { Context.addProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_GLOBAL_PROPERTIES); Context.addProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_CONCEPT_SOURCES); Context.addProxyPrivilege(OpenmrsConstants.PRIV_VIEW_CONCEPT_SOURCES); ImplementationId implId = new ImplementationId(); implId.setName(wizardModel.implementationIdName); implId.setImplementationId(wizardModel.implementationId); implId.setPassphrase(wizardModel.implementationIdPassPhrase); implId.setDescription(wizardModel.implementationIdDescription); Context.getAdministrationService().setImplementationId(implId); } catch (Throwable t) { wizardModel.errors.add(t.getMessage() + " Implementation ID could not be set."); log.warn("Implementation ID could not be set.", t); renderTemplate(DEFAULT_PAGE, null, writer); Context.shutdown(); WebModuleUtil.shutdownModules(filterConfig.getServletContext()); contextLoader.closeWebApplicationContext(filterConfig.getServletContext()); return; } finally { Context.removeProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_GLOBAL_PROPERTIES); Context.removeProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_CONCEPT_SOURCES); Context.removeProxyPrivilege(OpenmrsConstants.PRIV_VIEW_CONCEPT_SOURCES); } } try { // change the admin user password from "test" to what they input above if (wizardModel.createTables) { Context.authenticate("admin", "test"); Context.getUserService().changePassword("test", wizardModel.adminUserPassword); Context.logout(); } // load modules Listener.loadCoreModules(filterConfig.getServletContext()); // web load modules Listener.performWebStartOfModules(filterConfig.getServletContext()); // start the scheduled tasks SchedulerUtil.startup(runtimeProperties); } catch (Throwable t) { Context.shutdown(); WebModuleUtil.shutdownModules(filterConfig.getServletContext()); contextLoader.closeWebApplicationContext(filterConfig.getServletContext()); wizardModel.errors.add(t.getMessage() + " Unable to complete the startup."); log.warn("Unable to complete the startup.", t); renderTemplate(DEFAULT_PAGE, null, writer); return; } // output properties to the openmrs runtime properties file so that this wizard is not run again FileOutputStream fos = null; try { fos = new FileOutputStream(getRuntimePropertiesFile()); runtimeProperties.store(fos, "Auto generated by OpenMRS initialization wizard"); wizardModel.workLog.add("Saved runtime properties file " + getRuntimePropertiesFile()); // don't need to catch errors here because we tested it at the beginning of the wizard } finally { if (fos != null) { fos.close(); } } // set this so that the wizard isn't run again on next page load initializationComplete = true; + Context.closeSession(); // TODO send user to confirmation page with results of wizard, location of runtime props, etc instead? httpResponse.sendRedirect("/" + WebConstants.WEBAPP_NAME); } } /** * Verify the database connection works. * * @param connectionUsername * @param connectionPassword * @param databaseConnectionFinalUrl * @return true/false whether it was verified or not */ private boolean verifyConnection(String connectionUsername, String connectionPassword, String databaseConnectionFinalUrl) { try { // verify connection // TODO how to get the driver for the other dbs... Class.forName("com.mysql.jdbc.Driver").newInstance(); DriverManager.getConnection(databaseConnectionFinalUrl, connectionUsername, connectionPassword); return true; } catch (Exception e) { wizardModel.errors.add("User account " + connectionUsername + " does not work. " + e.getMessage() + " See the error log for more details"); // TODO internationalize this log.warn("Error while checking the connection user account", e); return false; } } /** * Convenience method to load the runtime properties in the application data directory * * @return */ private File getRuntimePropertiesFile() { String filename = WebConstants.WEBAPP_NAME + "-runtime.properties"; File file = new File(OpenmrsUtil.getApplicationDataDirectory(), filename); log.debug("Using file: " + file.getAbsolutePath()); return file; } /** * All private attributes on this class are returned to the template via the velocity context * and reflection * * @param templateName * @param referenceMap * @param writer */ private void renderTemplate(String templateName, Map<String, Object> referenceMap, Writer writer) throws IOException { VelocityContext velocityContext = new VelocityContext(); if (referenceMap != null) { for (Map.Entry<String, Object> entry : referenceMap.entrySet()) { velocityContext.put(entry.getKey(), entry.getValue()); } } // put each of the private varibles into the template for convenience for (Field field : InitializationWizardModel.class.getDeclaredFields()) { try { velocityContext.put(field.getName(), field.get(wizardModel)); } catch (IllegalArgumentException e) { log.error("Error generated while getting field value: " + field.getName(), e); } catch (IllegalAccessException e) { log.error("Error generated while getting field value: " + field.getName(), e); } } String fullTemplatePath = "org/openmrs/web/filter/initialization/" + templateName; InputStream templateInputStream = getClass().getClassLoader().getResourceAsStream(fullTemplatePath); if (templateInputStream == null) { throw new IOException("Unable to find " + fullTemplatePath); } try { velocityEngine.evaluate(velocityContext, writer, this.getClass().getName(), new InputStreamReader( templateInputStream)); } catch (Exception e) { throw new RuntimeException("Unable to process template: " + fullTemplatePath, e); } } /** * @see javax.servlet.Filter#destroy() */ public void destroy() { } /** * @see javax.servlet.Filter#init(javax.servlet.FilterConfig) */ public void init(FilterConfig filterConfig) throws ServletException { this.filterConfig = filterConfig; initializeVelocity(); wizardModel = new InitializationWizardModel(); } /** * @param silent if this statement fails do not display stack trace or record an error in the * wizard object. * @param user username to connect with * @param pw password to connect with * @param sql String containing sql and question marks * @param args the strings to fill into the question marks in the given sql * @return result of executeUpdate or -1 for error */ private int executeStatement(boolean silent, String user, String pw, String sql, String... args) { Connection connection = null; try { String replacedSql = sql; // TODO how to get the driver for the other dbs... if (wizardModel.databaseConnection.contains("mysql")) { Class.forName("com.mysql.jdbc.Driver").newInstance(); } else { replacedSql = replacedSql.replaceAll("`", "\""); } String tempDatabaseConnection = ""; if (sql.contains("create database")) { tempDatabaseConnection = wizardModel.databaseConnection.replace("@DBNAME@", ""); // make this dbname agnostic so we can create the db } else { tempDatabaseConnection = wizardModel.databaseConnection.replace("@DBNAME@", wizardModel.databaseName); } connection = DriverManager.getConnection(tempDatabaseConnection, user, pw); for (String arg : args) { arg = arg.replace(";", "&#094"); // to prevent any sql injection replacedSql = replacedSql.replaceFirst("\\?", arg); } // run the sql statement Statement statement = connection.createStatement(); return statement.executeUpdate(replacedSql); } catch (SQLException sqlex) { if (!silent) { // log and add error log.warn("error executing sql: " + sql, sqlex); wizardModel.errors.add("Error executing sql: " + sql + " - " + sqlex.getMessage()); } } catch (InstantiationException e) { log.error("Error generated", e); } catch (IllegalAccessException e) { log.error("Error generated", e); } catch (ClassNotFoundException e) { log.error("Error generated", e); } finally { try { if (connection != null) { connection.close(); } } catch (Throwable t) { log.warn("Error while closing connection", t); } } return -1; } /** * Convenience variable to know if this wizard has completed successfully and that this wizard * does not need to be executed again * * @return */ private boolean isInitializationComplete() { return initializationComplete; } /** * Check if the given value is null or a zero-length String * * @param value the string to check * @param errors the list of errors to append the errorMessage to if value is empty * @param errorMessage the string error message to append if value is empty * @return true if the value is non-empty */ private boolean checkForEmptyValue(String value, List<String> errors, String errorMessage) { if (value != null && !value.equals("")) { return true; } errors.add(errorMessage + " required."); return false; } }
false
true
private void doPost(HttpServletRequest httpRequest, HttpServletResponse httpResponse) throws IOException { String page = httpRequest.getParameter("page"); Map<String, Object> referenceMap = new HashMap<String, Object>(); Writer writer = httpResponse.getWriter(); // clear existing errors wizardModel.errors.clear(); // step one if ("databasesetup.vm".equals(page)) { wizardModel.databaseConnection = httpRequest.getParameter("database_connection"); checkForEmptyValue(wizardModel.databaseConnection, wizardModel.errors, "Database connection string"); // asked the user for their desired database name if ("yes".equals(httpRequest.getParameter("current_openmrs_database"))) { wizardModel.databaseName = httpRequest.getParameter("openmrs_current_database_name"); checkForEmptyValue(wizardModel.databaseName, wizardModel.errors, "Current database name"); wizardModel.hasCurrentOpenmrsDatabase = true; // TODO check to see if this is an active database } else { // mark this wizard as a "to create database" (done at the end) wizardModel.hasCurrentOpenmrsDatabase = false; wizardModel.createTables = true; wizardModel.databaseName = httpRequest.getParameter("openmrs_new_database_name"); checkForEmptyValue(wizardModel.databaseName, wizardModel.errors, "New database name"); // TODO create database now to check if its possible? wizardModel.createDatabaseUsername = httpRequest.getParameter("create_database_username"); checkForEmptyValue(wizardModel.createDatabaseUsername, wizardModel.errors, "A user that has 'CREATE DATABASE' privileges"); wizardModel.createDatabasePassword = httpRequest.getParameter("create_database_password"); checkForEmptyValue(wizardModel.createDatabasePassword, wizardModel.errors, "Password for user with 'CREATE DATABASE' privileges"); } if (wizardModel.errors.isEmpty()) { page = "databasetablesanduser.vm"; } renderTemplate(page, referenceMap, writer); } // step two else if ("databasetablesanduser.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("databasesetup.vm", referenceMap, writer); return; } if (wizardModel.hasCurrentOpenmrsDatabase) { wizardModel.createTables = "yes".equals(httpRequest.getParameter("create_tables")); } wizardModel.addDemoData = "yes".equals(httpRequest.getParameter("add_demo_data")); if ("yes".equals(httpRequest.getParameter("current_database_user"))) { wizardModel.currentDatabaseUsername = httpRequest.getParameter("current_database_username"); checkForEmptyValue(wizardModel.currentDatabaseUsername, wizardModel.errors, "Curent user account"); wizardModel.currentDatabasePassword = httpRequest.getParameter("current_database_password"); checkForEmptyValue(wizardModel.currentDatabasePassword, wizardModel.errors, "Current user account password"); wizardModel.hasCurrentDatabaseUser = true; wizardModel.createDatabaseUser = false; } else { wizardModel.hasCurrentDatabaseUser = false; wizardModel.createDatabaseUser = true; // asked for the root mysql username/password wizardModel.createUserUsername = httpRequest.getParameter("create_user_username"); checkForEmptyValue(wizardModel.createUserUsername, wizardModel.errors, "A user that has 'CREATE USER' privileges"); wizardModel.createUserPassword = httpRequest.getParameter("create_user_password"); checkForEmptyValue(wizardModel.createUserPassword, wizardModel.errors, "Password for user that has 'CREATE USER' privileges"); } if (wizardModel.errors.isEmpty()) { // go to next page page = "otherruntimeproperties.vm"; } renderTemplate(page, referenceMap, writer); } // step three else if ("otherruntimeproperties.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("databasetablesanduser.vm", referenceMap, writer); return; } wizardModel.moduleWebAdmin = "yes".equals(httpRequest.getParameter("module_web_admin")); wizardModel.autoUpdateDatabase = "yes".equals(httpRequest.getParameter("auto_update_database")); if (wizardModel.createTables) { // go to next page if they are creating tables page = "adminusersetup.vm"; } else { // skip a page page = "implementationidsetup.vm"; } renderTemplate(page, referenceMap, writer); } // optional step four else if ("adminusersetup.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("otherruntimeproperties.vm", referenceMap, writer); return; } wizardModel.adminUserPassword = httpRequest.getParameter("new_admin_password"); String adminUserConfirm = httpRequest.getParameter("new_admin_password_confirm"); // throw back to admin user if passwords don't match if (!wizardModel.adminUserPassword.equals(adminUserConfirm)) { wizardModel.errors.add("Admin passwords don't match"); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } // throw back if the user didn't put in a password if (wizardModel.adminUserPassword.equals("")) { wizardModel.errors.add("An admin password is required"); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } try { OpenmrsUtil.validatePassword("admin", wizardModel.adminUserPassword, "admin"); } catch (PasswordException p) { wizardModel.errors.add("The password is not long enough, does not contain both uppercase characters and a number, or matches the username."); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } if (wizardModel.errors.isEmpty()) { // go to next page page = "implementationidsetup.vm"; } renderTemplate(page, referenceMap, writer); } // optional step five else if ("implementationidsetup.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { if (wizardModel.createTables) renderTemplate("adminusersetup.vm", referenceMap, writer); else renderTemplate("otherruntimeproperties.vm", referenceMap, writer); return; } wizardModel.implementationIdName = httpRequest.getParameter("implementation_name"); wizardModel.implementationId = httpRequest.getParameter("implementation_id"); wizardModel.implementationIdPassPhrase = httpRequest.getParameter("pass_phrase"); wizardModel.implementationIdDescription = httpRequest.getParameter("description"); // throw back if the user-specified ID is invalid (contains ^ or |). if (wizardModel.implementationId.indexOf('^') != -1 || wizardModel.implementationId.indexOf('|') != -1) { wizardModel.errors.add("Implementation ID cannot contain '^' or '|'"); renderTemplate("implementationidsetup.vm", referenceMap, writer); return; } if (wizardModel.errors.isEmpty()) { // go to next page page = "wizardcomplete.vm"; } renderTemplate(page, referenceMap, writer); } else if ("wizardcomplete.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("implementationidsetup.vm", referenceMap, writer); return; } Properties runtimeProperties = new Properties(); String connectionUsername; String connectionPassword; if (!wizardModel.hasCurrentOpenmrsDatabase) { // connect via jdbc and create a database String sql = "create database `?` default character set utf8"; int result = executeStatement(false, wizardModel.createDatabaseUsername, wizardModel.createDatabasePassword, sql, wizardModel.databaseName); // throw the user back to the main screen if this error occurs if (result < 0) { renderTemplate(DEFAULT_PAGE, null, writer); return; } else { wizardModel.workLog.add("Created database " + wizardModel.databaseName); } } if (wizardModel.createDatabaseUser) { connectionUsername = wizardModel.databaseName + "_user"; if (connectionUsername.length() > 16) connectionUsername = wizardModel.databaseName.substring(0, 11) + "_user"; // trim off enough to leave space for _user at the end connectionPassword = ""; // generate random password from this subset of alphabet // intentionally left out these characters: ufsb$() to prevent certain words forming randomly String chars = "acdeghijklmnopqrtvwxyzACDEGHIJKLMNOPQRTVWXYZ0123456789.|~@#^&"; Random r = new Random(); for (int x = 0; x < 12; x++) { connectionPassword += chars.charAt(r.nextInt(chars.length())); } // connect via jdbc with root user and create an openmrs user String sql = "drop user '?'@'localhost'"; executeStatement(true, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, connectionUsername); sql = "create user '?'@'localhost' identified by '?'"; if (-1 != executeStatement(false, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, connectionUsername, connectionPassword)) { wizardModel.workLog.add("Created user " + connectionUsername); } else { // if error occurs stop renderTemplate(DEFAULT_PAGE, null, writer); return; } // grant the roles sql = "GRANT ALL ON `?`.* TO '?'@'localhost'"; int result = executeStatement(false, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, wizardModel.databaseName, connectionUsername); // throw the user back to the main screen if this error occurs if (result < 0) { renderTemplate(DEFAULT_PAGE, null, writer); return; } else { wizardModel.workLog.add("Granted user " + connectionUsername + " all privileges to database " + wizardModel.databaseName); } } else { connectionUsername = wizardModel.currentDatabaseUsername; connectionPassword = wizardModel.currentDatabasePassword; } String finalDatabaseConnectionString = wizardModel.databaseConnection.replace("@DBNAME@", wizardModel.databaseName); // verify that the database connection works if (!verifyConnection(connectionUsername, connectionPassword, finalDatabaseConnectionString)) { // redirect to setup page if we got an error renderTemplate(DEFAULT_PAGE, null, writer); return; } // save the properties for startup purposes runtimeProperties.put("connection.url", finalDatabaseConnectionString); runtimeProperties.put("connection.username", connectionUsername); runtimeProperties.put("connection.password", connectionPassword); runtimeProperties.put("module.allow_web_admin", wizardModel.moduleWebAdmin.toString()); runtimeProperties.put("auto_update_database", wizardModel.autoUpdateDatabase.toString()); runtimeProperties.put(SchedulerConstants.SCHEDULER_USERNAME_PROPERTY, "admin"); runtimeProperties.put(SchedulerConstants.SCHEDULER_PASSWORD_PROPERTY, wizardModel.adminUserPassword); Context.setRuntimeProperties(runtimeProperties); if (wizardModel.createTables) { // use liquibase to create core data + tables try { DatabaseUpdater.executeChangelog(LIQUIBASE_SCHEMA_DATA, null); DatabaseUpdater.executeChangelog(LIQUIBASE_CORE_DATA, null); wizardModel.workLog.add("Created database tables and added core data"); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " See the error log for more details"); // TODO internationalize this log.warn("Error while trying to create tables and demo data", e); } } // add demo data only if creating tables fresh and user selected the option add demo data if (wizardModel.createTables && wizardModel.addDemoData) { try { DatabaseUpdater.executeChangelog(LIQUIBASE_DEMO_DATA, null); wizardModel.workLog.add("Added demo data"); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " See the error log for more details"); // TODO internationalize this log.warn("Error while trying to add demo data", e); } } // update the database to the latest version try { DatabaseUpdater.update(); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " Error while trying to update to the latest database version"); // TODO internationalize this log.warn("Error while trying to update to the latest database version", e); renderTemplate(DEFAULT_PAGE, null, writer); return; } // start spring // after this point, all errors need to also call: contextLoader.closeWebApplicationContext(event.getServletContext()) // logic copied from org.springframework.web.context.ContextLoaderListener ContextLoader contextLoader = new ContextLoader(); contextLoader.initWebApplicationContext(filterConfig.getServletContext()); // start openmrs try { Context.startup(runtimeProperties); } catch (DatabaseUpdateException updateEx) { log.warn("Error while running the database update file", updateEx); wizardModel.errors.add(updateEx.getMessage() + " There was an error while running the database update file: " + updateEx.getMessage()); // TODO internationalize this renderTemplate(DEFAULT_PAGE, null, writer); return; } catch (InputRequiredException inputRequiredEx) { // TODO display a page looping over the required input and ask the user for each. // When done and the user and put in their say, call DatabaseUpdater.update(Map); // with the user's question/answer pairs log .warn("Unable to continue because user input is required for the db updates, but I am not doing anything about that right now"); wizardModel.errors .add("Unable to continue because user input is required for the db updates, but I am not doing anything about that right now"); renderTemplate(DEFAULT_PAGE, null, writer); return; } // TODO catch openmrs errors here and drop the user back out to the setup screen if (!wizardModel.implementationId.equals("")) { try { Context.addProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_GLOBAL_PROPERTIES); Context.addProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_CONCEPT_SOURCES); Context.addProxyPrivilege(OpenmrsConstants.PRIV_VIEW_CONCEPT_SOURCES); ImplementationId implId = new ImplementationId(); implId.setName(wizardModel.implementationIdName); implId.setImplementationId(wizardModel.implementationId); implId.setPassphrase(wizardModel.implementationIdPassPhrase); implId.setDescription(wizardModel.implementationIdDescription); Context.getAdministrationService().setImplementationId(implId); } catch (Throwable t) { wizardModel.errors.add(t.getMessage() + " Implementation ID could not be set."); log.warn("Implementation ID could not be set.", t); renderTemplate(DEFAULT_PAGE, null, writer); Context.shutdown(); WebModuleUtil.shutdownModules(filterConfig.getServletContext()); contextLoader.closeWebApplicationContext(filterConfig.getServletContext()); return; } finally { Context.removeProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_GLOBAL_PROPERTIES); Context.removeProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_CONCEPT_SOURCES); Context.removeProxyPrivilege(OpenmrsConstants.PRIV_VIEW_CONCEPT_SOURCES); } } try { // change the admin user password from "test" to what they input above if (wizardModel.createTables) { Context.authenticate("admin", "test"); Context.getUserService().changePassword("test", wizardModel.adminUserPassword); Context.logout(); } // load modules Listener.loadCoreModules(filterConfig.getServletContext()); // web load modules Listener.performWebStartOfModules(filterConfig.getServletContext()); // start the scheduled tasks SchedulerUtil.startup(runtimeProperties); } catch (Throwable t) { Context.shutdown(); WebModuleUtil.shutdownModules(filterConfig.getServletContext()); contextLoader.closeWebApplicationContext(filterConfig.getServletContext()); wizardModel.errors.add(t.getMessage() + " Unable to complete the startup."); log.warn("Unable to complete the startup.", t); renderTemplate(DEFAULT_PAGE, null, writer); return; } // output properties to the openmrs runtime properties file so that this wizard is not run again FileOutputStream fos = null; try { fos = new FileOutputStream(getRuntimePropertiesFile()); runtimeProperties.store(fos, "Auto generated by OpenMRS initialization wizard"); wizardModel.workLog.add("Saved runtime properties file " + getRuntimePropertiesFile()); // don't need to catch errors here because we tested it at the beginning of the wizard } finally { if (fos != null) { fos.close(); } } // set this so that the wizard isn't run again on next page load initializationComplete = true; // TODO send user to confirmation page with results of wizard, location of runtime props, etc instead? httpResponse.sendRedirect("/" + WebConstants.WEBAPP_NAME); } }
private void doPost(HttpServletRequest httpRequest, HttpServletResponse httpResponse) throws IOException { String page = httpRequest.getParameter("page"); Map<String, Object> referenceMap = new HashMap<String, Object>(); Writer writer = httpResponse.getWriter(); // clear existing errors wizardModel.errors.clear(); // step one if ("databasesetup.vm".equals(page)) { wizardModel.databaseConnection = httpRequest.getParameter("database_connection"); checkForEmptyValue(wizardModel.databaseConnection, wizardModel.errors, "Database connection string"); // asked the user for their desired database name if ("yes".equals(httpRequest.getParameter("current_openmrs_database"))) { wizardModel.databaseName = httpRequest.getParameter("openmrs_current_database_name"); checkForEmptyValue(wizardModel.databaseName, wizardModel.errors, "Current database name"); wizardModel.hasCurrentOpenmrsDatabase = true; // TODO check to see if this is an active database } else { // mark this wizard as a "to create database" (done at the end) wizardModel.hasCurrentOpenmrsDatabase = false; wizardModel.createTables = true; wizardModel.databaseName = httpRequest.getParameter("openmrs_new_database_name"); checkForEmptyValue(wizardModel.databaseName, wizardModel.errors, "New database name"); // TODO create database now to check if its possible? wizardModel.createDatabaseUsername = httpRequest.getParameter("create_database_username"); checkForEmptyValue(wizardModel.createDatabaseUsername, wizardModel.errors, "A user that has 'CREATE DATABASE' privileges"); wizardModel.createDatabasePassword = httpRequest.getParameter("create_database_password"); checkForEmptyValue(wizardModel.createDatabasePassword, wizardModel.errors, "Password for user with 'CREATE DATABASE' privileges"); } if (wizardModel.errors.isEmpty()) { page = "databasetablesanduser.vm"; } renderTemplate(page, referenceMap, writer); } // step two else if ("databasetablesanduser.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("databasesetup.vm", referenceMap, writer); return; } if (wizardModel.hasCurrentOpenmrsDatabase) { wizardModel.createTables = "yes".equals(httpRequest.getParameter("create_tables")); } wizardModel.addDemoData = "yes".equals(httpRequest.getParameter("add_demo_data")); if ("yes".equals(httpRequest.getParameter("current_database_user"))) { wizardModel.currentDatabaseUsername = httpRequest.getParameter("current_database_username"); checkForEmptyValue(wizardModel.currentDatabaseUsername, wizardModel.errors, "Curent user account"); wizardModel.currentDatabasePassword = httpRequest.getParameter("current_database_password"); checkForEmptyValue(wizardModel.currentDatabasePassword, wizardModel.errors, "Current user account password"); wizardModel.hasCurrentDatabaseUser = true; wizardModel.createDatabaseUser = false; } else { wizardModel.hasCurrentDatabaseUser = false; wizardModel.createDatabaseUser = true; // asked for the root mysql username/password wizardModel.createUserUsername = httpRequest.getParameter("create_user_username"); checkForEmptyValue(wizardModel.createUserUsername, wizardModel.errors, "A user that has 'CREATE USER' privileges"); wizardModel.createUserPassword = httpRequest.getParameter("create_user_password"); checkForEmptyValue(wizardModel.createUserPassword, wizardModel.errors, "Password for user that has 'CREATE USER' privileges"); } if (wizardModel.errors.isEmpty()) { // go to next page page = "otherruntimeproperties.vm"; } renderTemplate(page, referenceMap, writer); } // step three else if ("otherruntimeproperties.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("databasetablesanduser.vm", referenceMap, writer); return; } wizardModel.moduleWebAdmin = "yes".equals(httpRequest.getParameter("module_web_admin")); wizardModel.autoUpdateDatabase = "yes".equals(httpRequest.getParameter("auto_update_database")); if (wizardModel.createTables) { // go to next page if they are creating tables page = "adminusersetup.vm"; } else { // skip a page page = "implementationidsetup.vm"; } renderTemplate(page, referenceMap, writer); } // optional step four else if ("adminusersetup.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("otherruntimeproperties.vm", referenceMap, writer); return; } wizardModel.adminUserPassword = httpRequest.getParameter("new_admin_password"); String adminUserConfirm = httpRequest.getParameter("new_admin_password_confirm"); // throw back to admin user if passwords don't match if (!wizardModel.adminUserPassword.equals(adminUserConfirm)) { wizardModel.errors.add("Admin passwords don't match"); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } // throw back if the user didn't put in a password if (wizardModel.adminUserPassword.equals("")) { wizardModel.errors.add("An admin password is required"); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } try { OpenmrsUtil.validatePassword("admin", wizardModel.adminUserPassword, "admin"); } catch (PasswordException p) { wizardModel.errors.add("The password is not long enough, does not contain both uppercase characters and a number, or matches the username."); renderTemplate("adminusersetup.vm", referenceMap, writer); return; } if (wizardModel.errors.isEmpty()) { // go to next page page = "implementationidsetup.vm"; } renderTemplate(page, referenceMap, writer); } // optional step five else if ("implementationidsetup.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { if (wizardModel.createTables) renderTemplate("adminusersetup.vm", referenceMap, writer); else renderTemplate("otherruntimeproperties.vm", referenceMap, writer); return; } wizardModel.implementationIdName = httpRequest.getParameter("implementation_name"); wizardModel.implementationId = httpRequest.getParameter("implementation_id"); wizardModel.implementationIdPassPhrase = httpRequest.getParameter("pass_phrase"); wizardModel.implementationIdDescription = httpRequest.getParameter("description"); // throw back if the user-specified ID is invalid (contains ^ or |). if (wizardModel.implementationId.indexOf('^') != -1 || wizardModel.implementationId.indexOf('|') != -1) { wizardModel.errors.add("Implementation ID cannot contain '^' or '|'"); renderTemplate("implementationidsetup.vm", referenceMap, writer); return; } if (wizardModel.errors.isEmpty()) { // go to next page page = "wizardcomplete.vm"; } renderTemplate(page, referenceMap, writer); } else if ("wizardcomplete.vm".equals(page)) { if ("Back".equals(httpRequest.getParameter("back"))) { renderTemplate("implementationidsetup.vm", referenceMap, writer); return; } Properties runtimeProperties = new Properties(); String connectionUsername; String connectionPassword; if (!wizardModel.hasCurrentOpenmrsDatabase) { // connect via jdbc and create a database String sql = "create database `?` default character set utf8"; int result = executeStatement(false, wizardModel.createDatabaseUsername, wizardModel.createDatabasePassword, sql, wizardModel.databaseName); // throw the user back to the main screen if this error occurs if (result < 0) { renderTemplate(DEFAULT_PAGE, null, writer); return; } else { wizardModel.workLog.add("Created database " + wizardModel.databaseName); } } if (wizardModel.createDatabaseUser) { connectionUsername = wizardModel.databaseName + "_user"; if (connectionUsername.length() > 16) connectionUsername = wizardModel.databaseName.substring(0, 11) + "_user"; // trim off enough to leave space for _user at the end connectionPassword = ""; // generate random password from this subset of alphabet // intentionally left out these characters: ufsb$() to prevent certain words forming randomly String chars = "acdeghijklmnopqrtvwxyzACDEGHIJKLMNOPQRTVWXYZ0123456789.|~@#^&"; Random r = new Random(); for (int x = 0; x < 12; x++) { connectionPassword += chars.charAt(r.nextInt(chars.length())); } // connect via jdbc with root user and create an openmrs user String sql = "drop user '?'@'localhost'"; executeStatement(true, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, connectionUsername); sql = "create user '?'@'localhost' identified by '?'"; if (-1 != executeStatement(false, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, connectionUsername, connectionPassword)) { wizardModel.workLog.add("Created user " + connectionUsername); } else { // if error occurs stop renderTemplate(DEFAULT_PAGE, null, writer); return; } // grant the roles sql = "GRANT ALL ON `?`.* TO '?'@'localhost'"; int result = executeStatement(false, wizardModel.createUserUsername, wizardModel.createUserPassword, sql, wizardModel.databaseName, connectionUsername); // throw the user back to the main screen if this error occurs if (result < 0) { renderTemplate(DEFAULT_PAGE, null, writer); return; } else { wizardModel.workLog.add("Granted user " + connectionUsername + " all privileges to database " + wizardModel.databaseName); } } else { connectionUsername = wizardModel.currentDatabaseUsername; connectionPassword = wizardModel.currentDatabasePassword; } String finalDatabaseConnectionString = wizardModel.databaseConnection.replace("@DBNAME@", wizardModel.databaseName); // verify that the database connection works if (!verifyConnection(connectionUsername, connectionPassword, finalDatabaseConnectionString)) { // redirect to setup page if we got an error renderTemplate(DEFAULT_PAGE, null, writer); return; } // save the properties for startup purposes runtimeProperties.put("connection.url", finalDatabaseConnectionString); runtimeProperties.put("connection.username", connectionUsername); runtimeProperties.put("connection.password", connectionPassword); runtimeProperties.put("module.allow_web_admin", wizardModel.moduleWebAdmin.toString()); runtimeProperties.put("auto_update_database", wizardModel.autoUpdateDatabase.toString()); runtimeProperties.put(SchedulerConstants.SCHEDULER_USERNAME_PROPERTY, "admin"); runtimeProperties.put(SchedulerConstants.SCHEDULER_PASSWORD_PROPERTY, wizardModel.adminUserPassword); Context.setRuntimeProperties(runtimeProperties); if (wizardModel.createTables) { // use liquibase to create core data + tables try { DatabaseUpdater.executeChangelog(LIQUIBASE_SCHEMA_DATA, null); DatabaseUpdater.executeChangelog(LIQUIBASE_CORE_DATA, null); wizardModel.workLog.add("Created database tables and added core data"); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " See the error log for more details"); // TODO internationalize this log.warn("Error while trying to create tables and demo data", e); } } // add demo data only if creating tables fresh and user selected the option add demo data if (wizardModel.createTables && wizardModel.addDemoData) { try { DatabaseUpdater.executeChangelog(LIQUIBASE_DEMO_DATA, null); wizardModel.workLog.add("Added demo data"); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " See the error log for more details"); // TODO internationalize this log.warn("Error while trying to add demo data", e); } } // update the database to the latest version try { DatabaseUpdater.update(); } catch (Exception e) { wizardModel.errors.add(e.getMessage() + " Error while trying to update to the latest database version"); // TODO internationalize this log.warn("Error while trying to update to the latest database version", e); renderTemplate(DEFAULT_PAGE, null, writer); return; } // start spring // after this point, all errors need to also call: contextLoader.closeWebApplicationContext(event.getServletContext()) // logic copied from org.springframework.web.context.ContextLoaderListener ContextLoader contextLoader = new ContextLoader(); contextLoader.initWebApplicationContext(filterConfig.getServletContext()); // start openmrs try { Context.openSession(); Context.startup(runtimeProperties); } catch (DatabaseUpdateException updateEx) { log.warn("Error while running the database update file", updateEx); wizardModel.errors.add(updateEx.getMessage() + " There was an error while running the database update file: " + updateEx.getMessage()); // TODO internationalize this renderTemplate(DEFAULT_PAGE, null, writer); return; } catch (InputRequiredException inputRequiredEx) { // TODO display a page looping over the required input and ask the user for each. // When done and the user and put in their say, call DatabaseUpdater.update(Map); // with the user's question/answer pairs log .warn("Unable to continue because user input is required for the db updates, but I am not doing anything about that right now"); wizardModel.errors .add("Unable to continue because user input is required for the db updates, but I am not doing anything about that right now"); renderTemplate(DEFAULT_PAGE, null, writer); return; } // TODO catch openmrs errors here and drop the user back out to the setup screen if (!wizardModel.implementationId.equals("")) { try { Context.addProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_GLOBAL_PROPERTIES); Context.addProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_CONCEPT_SOURCES); Context.addProxyPrivilege(OpenmrsConstants.PRIV_VIEW_CONCEPT_SOURCES); ImplementationId implId = new ImplementationId(); implId.setName(wizardModel.implementationIdName); implId.setImplementationId(wizardModel.implementationId); implId.setPassphrase(wizardModel.implementationIdPassPhrase); implId.setDescription(wizardModel.implementationIdDescription); Context.getAdministrationService().setImplementationId(implId); } catch (Throwable t) { wizardModel.errors.add(t.getMessage() + " Implementation ID could not be set."); log.warn("Implementation ID could not be set.", t); renderTemplate(DEFAULT_PAGE, null, writer); Context.shutdown(); WebModuleUtil.shutdownModules(filterConfig.getServletContext()); contextLoader.closeWebApplicationContext(filterConfig.getServletContext()); return; } finally { Context.removeProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_GLOBAL_PROPERTIES); Context.removeProxyPrivilege(OpenmrsConstants.PRIV_MANAGE_CONCEPT_SOURCES); Context.removeProxyPrivilege(OpenmrsConstants.PRIV_VIEW_CONCEPT_SOURCES); } } try { // change the admin user password from "test" to what they input above if (wizardModel.createTables) { Context.authenticate("admin", "test"); Context.getUserService().changePassword("test", wizardModel.adminUserPassword); Context.logout(); } // load modules Listener.loadCoreModules(filterConfig.getServletContext()); // web load modules Listener.performWebStartOfModules(filterConfig.getServletContext()); // start the scheduled tasks SchedulerUtil.startup(runtimeProperties); } catch (Throwable t) { Context.shutdown(); WebModuleUtil.shutdownModules(filterConfig.getServletContext()); contextLoader.closeWebApplicationContext(filterConfig.getServletContext()); wizardModel.errors.add(t.getMessage() + " Unable to complete the startup."); log.warn("Unable to complete the startup.", t); renderTemplate(DEFAULT_PAGE, null, writer); return; } // output properties to the openmrs runtime properties file so that this wizard is not run again FileOutputStream fos = null; try { fos = new FileOutputStream(getRuntimePropertiesFile()); runtimeProperties.store(fos, "Auto generated by OpenMRS initialization wizard"); wizardModel.workLog.add("Saved runtime properties file " + getRuntimePropertiesFile()); // don't need to catch errors here because we tested it at the beginning of the wizard } finally { if (fos != null) { fos.close(); } } // set this so that the wizard isn't run again on next page load initializationComplete = true; Context.closeSession(); // TODO send user to confirmation page with results of wizard, location of runtime props, etc instead? httpResponse.sendRedirect("/" + WebConstants.WEBAPP_NAME); } }
diff --git a/wings/src/org/wings/SRootContainer.java b/wings/src/org/wings/SRootContainer.java index 67b9085f..5831b163 100644 --- a/wings/src/org/wings/SRootContainer.java +++ b/wings/src/org/wings/SRootContainer.java @@ -1,126 +1,126 @@ /* * $Id$ * (c) Copyright 2001 wingS development team. * * This file is part of wingS (http://wings.mercatis.de). * * wingS is free software; you can redistribute it and/or modify * it under the terms of the GNU Lesser General Public License * as published by the Free Software Foundation; either version 2.1 * of the License, or (at your option) any later version. * * Please see COPYING for the complete licence. */ package org.wings; import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; /** * A root container. * The classes derived from this class ({@link SFrame} and * {@link SInternalFrame}) render in the content pane of this RootContainer. * * <p>The RootContainer has a stack of components. Ususally, the stack * contains only <em>one</em> element, the content pane; this is the bottommost * component. When dialogs are added to the RootContainer, then these dialogs * are stacked on top of this content pane, and only <em>this</em> dialog is * visible then. This emulates the behaviour of modal dialogs in a windowing * system. * * @author <a href="mailto:[email protected]">Holger Engels</a> * @author <a href="mailto:[email protected]">Henner Zeller</a> * @author <a href="mailto:[email protected]">Armin Haaf</a> */ public abstract class SRootContainer extends SContainer { private final static Log logger = LogFactory.getLog("org.wings"); /** * The container for the contentPane. */ protected final SContainer contentPane; /** * default constructor initializes the stack layout system of this * SRootContainer. */ public SRootContainer() { contentPane = new SPanel(); super.setLayout(new SRootLayout()); super.addComponent(getContentPane(), null, getComponentCount()); } /** * Push a new dialog on top of the stack. If this RootContainer is * rendered, then only this dialog is shown. * @param dialog the SDialog that is to be shown on top. */ public void pushDialog(SDialog dialog) { super.addComponent(dialog, null, getComponentCount()); int count = getComponentCount(); logger.debug("pushDialog: " + count); dialog.setFrame(this); reload(ReloadManager.RELOAD_CODE); } /** * remove the dialog, that is on top of the stack. * * @return the dialog, that is popped from the stack. */ public SDialog popDialog() { int count = getComponentCount(); if (count <= 1) throw new IllegalStateException("there's no dialog left!"); SDialog dialog = (SDialog) getComponent(count - 1); super.remove(dialog); logger.debug("popDialog: " + count); - dialog.setFrame((SFrame) null); +// dialog.setFrame((SFrame) null); reload(ReloadManager.RELOAD_CODE); return dialog; } public void removeDialog(SDialog dialog) { super.remove(dialog); dialog.setFrame((SFrame) null); reload(ReloadManager.RELOAD_CODE); } /** * @return the number of dialogs that are on the stack currently. */ public int getDialogCount() { return getComponentCount() - 1; } /** * returns the content pane of this RootContainer. */ public SContainer getContentPane() { return contentPane; } /** * Use getContentPane().addComponent(c) instead. */ public SComponent addComponent(SComponent c, Object constraint, int index) { throw new IllegalArgumentException("use getContentPane().addComponent()"); } /** * Use getContentPane().removeComponent(c) instead. */ public void remove(SComponent c) { throw new IllegalArgumentException("use getContentPane().removeComponent()"); } } /* * Local variables: * c-basic-offset: 4 * indent-tabs-mode: nil * compile-command: "ant -emacs -find build.xml" * End: */
true
true
public SDialog popDialog() { int count = getComponentCount(); if (count <= 1) throw new IllegalStateException("there's no dialog left!"); SDialog dialog = (SDialog) getComponent(count - 1); super.remove(dialog); logger.debug("popDialog: " + count); dialog.setFrame((SFrame) null); reload(ReloadManager.RELOAD_CODE); return dialog; }
public SDialog popDialog() { int count = getComponentCount(); if (count <= 1) throw new IllegalStateException("there's no dialog left!"); SDialog dialog = (SDialog) getComponent(count - 1); super.remove(dialog); logger.debug("popDialog: " + count); // dialog.setFrame((SFrame) null); reload(ReloadManager.RELOAD_CODE); return dialog; }
diff --git a/src/com/facebook/buck/cli/Main.java b/src/com/facebook/buck/cli/Main.java index 58ea0a3cf2..66f548faeb 100644 --- a/src/com/facebook/buck/cli/Main.java +++ b/src/com/facebook/buck/cli/Main.java @@ -1,685 +1,690 @@ /* * Copyright 2012-present Facebook, Inc. * * Licensed under the Apache License, Version 2.0 (the "License"); you may * not use this file except in compliance with the License. You may obtain * a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, WITHOUT * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the * License for the specific language governing permissions and limitations * under the License. */ package com.facebook.buck.cli; import com.facebook.buck.event.BuckEventBus; import com.facebook.buck.event.BuckEventListener; import com.facebook.buck.event.LogEvent; import com.facebook.buck.event.listener.AbstractConsoleEventBusListener; import com.facebook.buck.event.listener.ChromeTraceBuildListener; import com.facebook.buck.event.listener.JavaUtilsLoggingBuildListener; import com.facebook.buck.event.listener.SimpleConsoleEventBusListener; import com.facebook.buck.event.listener.SuperConsoleEventBusListener; import com.facebook.buck.httpserver.WebServer; import com.facebook.buck.parser.Parser; import com.facebook.buck.rules.BuildRule; import com.facebook.buck.rules.KnownBuildRuleTypes; import com.facebook.buck.rules.RuleKey; import com.facebook.buck.rules.RuleKey.Builder; import com.facebook.buck.rules.RuleKeyBuilderFactory; import com.facebook.buck.timing.Clock; import com.facebook.buck.timing.DefaultClock; import com.facebook.buck.util.Ansi; import com.facebook.buck.util.Console; import com.facebook.buck.util.DefaultFileHashCache; import com.facebook.buck.util.FileHashCache; import com.facebook.buck.util.HumanReadableException; import com.facebook.buck.util.MoreStrings; import com.facebook.buck.util.ProjectFilesystem; import com.facebook.buck.util.ProjectFilesystemWatcher; import com.facebook.buck.util.Verbosity; import com.facebook.buck.util.WatchServiceWatcher; import com.facebook.buck.util.WatchmanWatcher; import com.facebook.buck.util.concurrent.TimeSpan; import com.facebook.buck.util.environment.DefaultExecutionEnvironment; import com.facebook.buck.util.environment.ExecutionEnvironment; import com.facebook.buck.util.environment.Platform; import com.google.common.annotations.VisibleForTesting; import com.google.common.base.Optional; import com.google.common.base.Preconditions; import com.google.common.base.Strings; import com.google.common.collect.ImmutableList; import com.google.common.collect.ImmutableSet; import com.google.common.eventbus.EventBus; import com.google.common.reflect.ClassPath; import com.martiansoftware.nailgun.NGClientListener; import com.martiansoftware.nailgun.NGContext; import java.io.Closeable; import java.io.File; import java.io.IOException; import java.io.PrintStream; import java.net.MalformedURLException; import java.net.URL; import java.net.URLClassLoader; import java.nio.file.FileSystems; import java.nio.file.Paths; import java.util.Arrays; import java.util.concurrent.Semaphore; import java.util.concurrent.TimeUnit; import javax.annotation.Nullable; public final class Main { /** * Trying again won't help. */ public static final int FAIL_EXIT_CODE = 1; /** * Trying again later might work. */ public static final int BUSY_EXIT_CODE = 2; private static final String DEFAULT_BUCK_CONFIG_FILE_NAME = ".buckconfig"; private static final String DEFAULT_BUCK_CONFIG_OVERRIDE_FILE_NAME = ".buckconfig.local"; private static final String BUCK_VERSION_UID_KEY = "buck.version_uid"; private static final String BUCK_VERSION_UID = System.getProperty(BUCK_VERSION_UID_KEY, "N/A"); private static final String BUCKD_COLOR_DEFAULT_ENV_VAR = "BUCKD_COLOR_DEFAULT"; private static final int ARTIFACT_CACHE_TIMEOUT_IN_SECONDS = 15; private static final TimeSpan SUPER_CONSOLE_REFRESH_RATE = new TimeSpan(100, TimeUnit.MILLISECONDS); /** * Path to a directory of static content that should be served by the {@link WebServer}. */ private static final String STATIC_CONTENT_DIRECTORY = System.getProperty( "buck.path_to_static_content", "webserver/static"); private final PrintStream stdOut; private final PrintStream stdErr; private static final Semaphore commandSemaphore = new Semaphore(1); private final Platform platform; /** * Daemon used to monitor the file system and cache build rules between Main() method * invocations is static so that it can outlive Main() objects and survive for the lifetime * of the potentially long running Buck process. */ private final class Daemon implements Closeable { private final Parser parser; private final DefaultFileHashCache hashCache; private final EventBus fileEventBus; private final ProjectFilesystemWatcher filesystemWatcher; private final BuckConfig config; private final Optional<WebServer> webServer; private final Console console; public Daemon(ProjectFilesystem projectFilesystem, BuckConfig config, Console console) throws IOException { this.config = Preconditions.checkNotNull(config); this.console = Preconditions.checkNotNull(console); this.hashCache = new DefaultFileHashCache(projectFilesystem, console); this.parser = new Parser(projectFilesystem, KnownBuildRuleTypes.getDefault(), console, config.getPythonInterpreter(), config.getTempFilePatterns(), createRuleKeyBuilderFactory(hashCache)); this.fileEventBus = new EventBus("file-change-events"); this.filesystemWatcher = createWatcher(projectFilesystem); fileEventBus.register(parser); fileEventBus.register(hashCache); webServer = createWebServer(config, console, projectFilesystem); JavaUtilsLoggingBuildListener.ensureLogFileIsWritten(); } private ProjectFilesystemWatcher createWatcher(ProjectFilesystem projectFilesystem) throws IOException { if (System.getProperty("buck.buckd_watcher", "WatchService").equals("Watchman")) { return new WatchmanWatcher( projectFilesystem, fileEventBus, config.getIgnorePaths()); } return new WatchServiceWatcher( projectFilesystem, fileEventBus, config.getIgnorePaths(), FileSystems.getDefault().newWatchService()); } private Optional<WebServer> createWebServer(BuckConfig config, Console console, ProjectFilesystem projectFilesystem) { // Enable the web httpserver if it is given by command line parameter or specified in // .buckconfig. The presence of a port number is sufficient. Optional<String> serverPort = Optional.fromNullable(System.getProperty("buck.httpserver.port")); if (!serverPort.isPresent()) { serverPort = config.getValue("httpserver", "port"); } Optional<WebServer> webServer; if (serverPort.isPresent()) { String rawPort = serverPort.get(); try { int port = Integer.parseInt(rawPort, 10); webServer = Optional.of(new WebServer(port, projectFilesystem, STATIC_CONTENT_DIRECTORY)); } catch (NumberFormatException e) { console.printErrorText(String.format("Could not parse port for httpserver: %s.", rawPort)); webServer = Optional.absent(); } } else { webServer = Optional.absent(); } return webServer; } public Optional<WebServer> getWebServer() { return webServer; } private Parser getParser() { return parser; } private void watchClient(final NGContext context) { context.addClientListener(new NGClientListener() { @Override public void clientDisconnected() throws InterruptedException { // Synchronize on parser object so that the main command processing thread is not // interrupted mid way through a Parser cache update by the Thread.interrupt() call // triggered by System.exit(). The Parser cache will be reused by subsequent commands // so needs to be left in a consistent state even if the current command is interrupted // due to a client disconnection. synchronized (parser) { // Client should no longer be connected, but printing helps detect false disconnections. context.err.println("Client disconnected."); throw new InterruptedException("Client disconnected."); } } }); } private void watchFileSystem(Console console, CommandEvent commandEvent) throws IOException { // Synchronize on parser object so that all outstanding watch events are processed // as a single, atomic Parser cache update and are not interleaved with Parser cache // invalidations triggered by requests to parse build files or interrupted by client // disconnections. synchronized (parser) { parser.setConsole(console); hashCache.setConsole(console); fileEventBus.post(commandEvent); filesystemWatcher.postEvents(); } } /** @return true if the web server was started successfully. */ private boolean initWebServer() { if (webServer.isPresent()) { try { webServer.get().start(); return true; } catch (WebServer.WebServerException e) { e.printStackTrace(console.getStdErr()); } } return false; } public BuckConfig getConfig() { return config; } @Override public void close() throws IOException { filesystemWatcher.close(); shutdownWebServer(); } private void shutdownWebServer() { if (webServer.isPresent()) { try { webServer.get().stop(); } catch (WebServer.WebServerException e) { e.printStackTrace(console.getStdErr()); } } } } @Nullable volatile private static Daemon daemon; /** * Get or create Daemon. */ private Daemon getDaemon(ProjectFilesystem filesystem, BuckConfig config, Console console) throws IOException { if (daemon == null) { daemon = new Daemon(filesystem, config, console); } else { // Buck daemons cache build files within a single project root, changing to a different // project root is not supported and will likely result in incorrect builds. The buck and // buckd scripts attempt to enforce this, so a change in project root is an error that // should be reported rather than silently worked around by invalidating the cache and // creating a new daemon object. File parserRoot = daemon.getParser().getProjectRoot(); if (!filesystem.getProjectRoot().equals(parserRoot)) { throw new HumanReadableException(String.format("Unsupported root path change from %s to %s", filesystem.getProjectRoot(), parserRoot)); } // If Buck config has changed, invalidate the cache and create a new daemon. if (!daemon.getConfig().equals(config)) { daemon.close(); daemon = new Daemon(filesystem, config, console); } } return daemon; } @VisibleForTesting public Main(PrintStream stdOut, PrintStream stdErr) { this.stdOut = Preconditions.checkNotNull(stdOut); this.stdErr = Preconditions.checkNotNull(stdErr); this.platform = Platform.detect(); } /** Prints the usage message to standard error. */ @VisibleForTesting int usage() { stdErr.println("buck build tool"); stdErr.println("usage:"); stdErr.println(" buck [options]"); stdErr.println(" buck command --help"); stdErr.println(" buck command [command-options]"); stdErr.println("available commands:"); int lengthOfLongestCommand = 0; for (Command command : Command.values()) { String name = command.name(); if (name.length() > lengthOfLongestCommand) { lengthOfLongestCommand = name.length(); } } for (Command command : Command.values()) { String name = command.name().toLowerCase(); stdErr.printf(" %s%s %s\n", name, Strings.repeat(" ", lengthOfLongestCommand - name.length()), command.getShortDescription()); } stdErr.println("options:"); new GenericBuckOptions(stdOut, stdErr).printUsage(); return 1; } /** * @param context an optional NGContext that is present if running inside a Nailgun server. * @param args command line arguments * @return an exit code or {@code null} if this is a process that should not exit */ public int runMainWithExitCode(File projectRoot, Optional<NGContext> context, String... args) throws IOException { if (args.length == 0) { return usage(); } // Find and execute command. int exitCode; Command.ParseResult command = Command.parseCommandName(args[0]); if (command.getCommand().isPresent()) { return executeCommand(projectRoot, command, context, args); } else { exitCode = new GenericBuckOptions(stdOut, stdErr).execute(args); if (exitCode == GenericBuckOptions.SHOW_MAIN_HELP_SCREEN_EXIT_CODE) { return usage(); } else { return exitCode; } } } /** * @param context an optional NGContext that is present if running inside a Nailgun server. * @param args command line arguments * @return an exit code or {@code null} if this is a process that should not exit */ @SuppressWarnings("PMD.EmptyCatchBlock") public int executeCommand( File projectRoot, Command.ParseResult commandParseResult, Optional<NGContext> context, String... args) throws IOException { // Create common command parameters. projectFilesystem initialization looks odd because it needs // ignorePaths from a BuckConfig instance, which in turn needs a ProjectFilesystem (i.e. this // solves a bootstrapping issue). ProjectFilesystem projectFilesystem = new ProjectFilesystem( projectRoot, createBuckConfig(new ProjectFilesystem(projectRoot), platform).getIgnorePaths()); BuckConfig config = createBuckConfig(projectFilesystem, platform); Verbosity verbosity = VerbosityParser.parse(args); Optional<String> color; final boolean isDaemon = context.isPresent(); if (isDaemon && (context.get().getEnv() != null)) { String colorString = context.get().getEnv().getProperty(BUCKD_COLOR_DEFAULT_ENV_VAR); color = Optional.fromNullable(colorString); } else { color = Optional.absent(); } final Console console = new Console(verbosity, stdOut, stdErr, config.createAnsi(color)); if (commandParseResult.getErrorText().isPresent()) { console.getStdErr().println(commandParseResult.getErrorText().get()); } // No more early outs: acquire the command semaphore and become the only executing command. if (!commandSemaphore.tryAcquire()) { return BUSY_EXIT_CODE; } int exitCode; ImmutableList<BuckEventListener> eventListeners; String buildId = MoreStrings.createRandomString(); Clock clock = new DefaultClock(); ExecutionEnvironment executionEnvironment = new DefaultExecutionEnvironment(); // The order of resources in the try-with-resources block is important: the BuckEventBus must // be the last resource, so that it is closed first and can deliver its queued events to the // other resources before they are closed. try (AbstractConsoleEventBusListener consoleListener = createConsoleEventListener(clock, console, verbosity, executionEnvironment); BuckEventBus buildEventBus = new BuckEventBus(clock, buildId)) { Optional<WebServer> webServer = getWebServerIfDaemon(context, projectFilesystem, config, console); eventListeners = addEventListeners(buildEventBus, projectFilesystem, config, webServer, consoleListener); ImmutableList<String> remainingArgs = ImmutableList.copyOf( Arrays.copyOfRange(args, 1, args.length)); Command executingCommand = commandParseResult.getCommand().get(); String commandName = executingCommand.name().toLowerCase(); CommandEvent commandEvent = CommandEvent.started(commandName, remainingArgs, isDaemon); buildEventBus.post(commandEvent); // The ArtifactCache is constructed lazily so that we do not try to connect to Cassandra when // running commands such as `buck clean`. ArtifactCacheFactory artifactCacheFactory = new LoggingArtifactCacheFactory(buildEventBus); // Create or get Parser and invalidate cached command parameters. Parser parser; KnownBuildRuleTypes buildRuleTypes = KnownBuildRuleTypes.getConfigured(config); if (isDaemon) { parser = getParserFromDaemon(context, projectFilesystem, config, console, commandEvent); } else { // Initialize logging and create new Parser for new process. JavaUtilsLoggingBuildListener.ensureLogFileIsWritten(); parser = new Parser(projectFilesystem, buildRuleTypes, console, config.getPythonInterpreter(), config.getTempFilePatterns(), createRuleKeyBuilderFactory(new DefaultFileHashCache(projectFilesystem, console))); } exitCode = executingCommand.execute(remainingArgs, config, new CommandRunnerParams( console, projectFilesystem, buildRuleTypes, artifactCacheFactory, buildEventBus, parser, platform)); // TODO(user): allocate artifactCacheFactory in the try-with-resources block to avoid leaks. artifactCacheFactory.closeCreatedArtifactCaches(ARTIFACT_CACHE_TIMEOUT_IN_SECONDS); // If the Daemon is running and serving web traffic, print the URL to the Chrome Trace. if (webServer.isPresent()) { int port = webServer.get().getPort(); buildEventBus.post(LogEvent.info( "See trace at http://localhost:%s/trace/%s", port, buildId)); } buildEventBus.post(CommandEvent.finished(commandName, remainingArgs, isDaemon, exitCode)); } finally { commandSemaphore.release(); // Allow another command to execute while outputting traces. } if (isDaemon) { context.get().in.close(); // Avoid client exit triggering client disconnection handling. context.get().exit(exitCode); // Allow nailgun client to exit while outputting traces. } for (BuckEventListener eventListener : eventListeners) { - eventListener.outputTrace(buildId); + try { + eventListener.outputTrace(buildId); + } catch (RuntimeException e) { + System.err.println("Skipping over non-fatal error"); + e.printStackTrace(); + } } return exitCode; } private Parser getParserFromDaemon( Optional<NGContext> context, ProjectFilesystem projectFilesystem, BuckConfig config, Console console, CommandEvent commandEvent) throws IOException { // Wire up daemon to new client and console and get cached Parser. Daemon daemon = getDaemon(projectFilesystem, config, console); daemon.watchClient(context.get()); daemon.watchFileSystem(console, commandEvent); daemon.initWebServer(); return daemon.getParser(); } private Optional<WebServer> getWebServerIfDaemon( Optional<NGContext> context, ProjectFilesystem projectFilesystem, BuckConfig config, Console console) throws IOException { if (context.isPresent()) { return getDaemon(projectFilesystem, config, console).getWebServer(); } return Optional.absent(); } private void loadListenersFromBuckConfig( ImmutableList.Builder<BuckEventListener> eventListeners, ProjectFilesystem projectFilesystem, BuckConfig config) { final ImmutableSet<String> paths = config.getListenerJars(); if (paths.isEmpty()) { return; } URL[] urlsArray = new URL[paths.size()]; try { int i = 0; for (String path : paths) { String urlString = "file://" + projectFilesystem.getAbsolutifier().apply(Paths.get(path)); urlsArray[i] = new URL(urlString); i++; } } catch (MalformedURLException e) { throw new HumanReadableException(e.getMessage()); } // This ClassLoader is disconnected to allow searching the JARs (and just the JARs) for classes. ClassLoader isolatedClassLoader = URLClassLoader.newInstance(urlsArray, null); ImmutableSet<ClassPath.ClassInfo> classInfos; try { ClassPath classPath = ClassPath.from(isolatedClassLoader); classInfos = classPath.getTopLevelClasses(); } catch (IOException e) { throw new HumanReadableException(e.getMessage()); } // This ClassLoader will actually work, because it is joined to the parent ClassLoader. URLClassLoader workingClassLoader = URLClassLoader.newInstance(urlsArray); for (ClassPath.ClassInfo classInfo : classInfos) { String className = classInfo.getName(); try { Class<?> aClass = Class.forName(className, true, workingClassLoader); if (BuckEventListener.class.isAssignableFrom(aClass)) { BuckEventListener listener = aClass.asSubclass(BuckEventListener.class).newInstance(); eventListeners.add(listener); } } catch (ReflectiveOperationException e) { throw new HumanReadableException("Error loading event listener class '%s': %s: %s", className, e.getClass(), e.getMessage()); } } } private ImmutableList<BuckEventListener> addEventListeners( BuckEventBus buckEvents, ProjectFilesystem projectFilesystem, BuckConfig config, Optional<WebServer> webServer, AbstractConsoleEventBusListener consoleEventBusListener) { ImmutableList.Builder<BuckEventListener> eventListenersBuilder = ImmutableList.<BuckEventListener>builder() .add(new JavaUtilsLoggingBuildListener()) .add(new ChromeTraceBuildListener(projectFilesystem, config.getMaxTraces())) .add(consoleEventBusListener); if (webServer.isPresent()) { eventListenersBuilder.add(webServer.get().createListener()); } loadListenersFromBuckConfig(eventListenersBuilder, projectFilesystem, config); ImmutableList<BuckEventListener> eventListeners = eventListenersBuilder.build(); for (BuckEventListener eventListener : eventListeners) { buckEvents.register(eventListener); } return eventListeners; } private AbstractConsoleEventBusListener createConsoleEventListener( Clock clock, Console console, Verbosity verbosity, ExecutionEnvironment executionEnvironment) { if (console.getAnsi().isAnsiTerminal() && !verbosity.shouldPrintCommand()) { SuperConsoleEventBusListener superConsole = new SuperConsoleEventBusListener(console, clock, executionEnvironment); superConsole.startRenderScheduler(SUPER_CONSOLE_REFRESH_RATE.getDuration(), SUPER_CONSOLE_REFRESH_RATE.getUnit()); return superConsole; } return new SimpleConsoleEventBusListener(console, clock); } /** * @param projectFilesystem The directory that is the root of the project being built. */ private static BuckConfig createBuckConfig(ProjectFilesystem projectFilesystem, Platform platform) throws IOException { ImmutableList.Builder<File> configFileBuilder = ImmutableList.builder(); File configFile = projectFilesystem.getFileForRelativePath(DEFAULT_BUCK_CONFIG_FILE_NAME); if (configFile.isFile()) { configFileBuilder.add(configFile); } File overrideConfigFile = projectFilesystem.getFileForRelativePath( DEFAULT_BUCK_CONFIG_OVERRIDE_FILE_NAME); if (overrideConfigFile.isFile()) { configFileBuilder.add(overrideConfigFile); } ImmutableList<File> configFiles = configFileBuilder.build(); return BuckConfig.createFromFiles(projectFilesystem, configFiles, platform); } /** * @param hashCache A cache of file content hashes, used to avoid reading and hashing input files. */ private static RuleKeyBuilderFactory createRuleKeyBuilderFactory(final FileHashCache hashCache) { return new RuleKeyBuilderFactory() { @Override public Builder newInstance(BuildRule buildRule) { RuleKey.Builder builder = RuleKey.builder(buildRule, hashCache); builder.set("buckVersionUid", BUCK_VERSION_UID); return builder; } }; } @VisibleForTesting int tryRunMainWithExitCode(File projectRoot, Optional<NGContext> context, String... args) throws IOException { // TODO(user): enforce write command exclusion, but allow concurrent read only commands? try { return runMainWithExitCode(projectRoot, context, args); } catch (HumanReadableException e) { Console console = new Console(Verbosity.STANDARD_INFORMATION, stdOut, stdErr, new Ansi(platform)); console.printBuildFailure(e.getHumanReadableErrorMessage()); return FAIL_EXIT_CODE; } } private void runMainThenExit(String[] args, Optional<NGContext> context) { File projectRoot = new File("."); int exitCode = FAIL_EXIT_CODE; try { exitCode = tryRunMainWithExitCode(projectRoot, context, args); } catch (Throwable t) { t.printStackTrace(); } finally { // Exit explicitly so that non-daemon threads (of which we use many) don't // keep the VM alive. System.exit(exitCode); } } public static void main(String[] args) { new Main(System.out, System.err).runMainThenExit(args, Optional.<NGContext>absent()); } /** * When running as a daemon in the NailGun server, {@link #nailMain(NGContext)} is called instead * of {@link #main(String[])} so that the given context can be used to listen for client * disconnections and interrupt command processing when they occur. */ public static void nailMain(final NGContext context) throws InterruptedException { new Main(context.out, context.err).runMainThenExit(context.getArgs(), Optional.of(context)); } }
true
true
public int executeCommand( File projectRoot, Command.ParseResult commandParseResult, Optional<NGContext> context, String... args) throws IOException { // Create common command parameters. projectFilesystem initialization looks odd because it needs // ignorePaths from a BuckConfig instance, which in turn needs a ProjectFilesystem (i.e. this // solves a bootstrapping issue). ProjectFilesystem projectFilesystem = new ProjectFilesystem( projectRoot, createBuckConfig(new ProjectFilesystem(projectRoot), platform).getIgnorePaths()); BuckConfig config = createBuckConfig(projectFilesystem, platform); Verbosity verbosity = VerbosityParser.parse(args); Optional<String> color; final boolean isDaemon = context.isPresent(); if (isDaemon && (context.get().getEnv() != null)) { String colorString = context.get().getEnv().getProperty(BUCKD_COLOR_DEFAULT_ENV_VAR); color = Optional.fromNullable(colorString); } else { color = Optional.absent(); } final Console console = new Console(verbosity, stdOut, stdErr, config.createAnsi(color)); if (commandParseResult.getErrorText().isPresent()) { console.getStdErr().println(commandParseResult.getErrorText().get()); } // No more early outs: acquire the command semaphore and become the only executing command. if (!commandSemaphore.tryAcquire()) { return BUSY_EXIT_CODE; } int exitCode; ImmutableList<BuckEventListener> eventListeners; String buildId = MoreStrings.createRandomString(); Clock clock = new DefaultClock(); ExecutionEnvironment executionEnvironment = new DefaultExecutionEnvironment(); // The order of resources in the try-with-resources block is important: the BuckEventBus must // be the last resource, so that it is closed first and can deliver its queued events to the // other resources before they are closed. try (AbstractConsoleEventBusListener consoleListener = createConsoleEventListener(clock, console, verbosity, executionEnvironment); BuckEventBus buildEventBus = new BuckEventBus(clock, buildId)) { Optional<WebServer> webServer = getWebServerIfDaemon(context, projectFilesystem, config, console); eventListeners = addEventListeners(buildEventBus, projectFilesystem, config, webServer, consoleListener); ImmutableList<String> remainingArgs = ImmutableList.copyOf( Arrays.copyOfRange(args, 1, args.length)); Command executingCommand = commandParseResult.getCommand().get(); String commandName = executingCommand.name().toLowerCase(); CommandEvent commandEvent = CommandEvent.started(commandName, remainingArgs, isDaemon); buildEventBus.post(commandEvent); // The ArtifactCache is constructed lazily so that we do not try to connect to Cassandra when // running commands such as `buck clean`. ArtifactCacheFactory artifactCacheFactory = new LoggingArtifactCacheFactory(buildEventBus); // Create or get Parser and invalidate cached command parameters. Parser parser; KnownBuildRuleTypes buildRuleTypes = KnownBuildRuleTypes.getConfigured(config); if (isDaemon) { parser = getParserFromDaemon(context, projectFilesystem, config, console, commandEvent); } else { // Initialize logging and create new Parser for new process. JavaUtilsLoggingBuildListener.ensureLogFileIsWritten(); parser = new Parser(projectFilesystem, buildRuleTypes, console, config.getPythonInterpreter(), config.getTempFilePatterns(), createRuleKeyBuilderFactory(new DefaultFileHashCache(projectFilesystem, console))); } exitCode = executingCommand.execute(remainingArgs, config, new CommandRunnerParams( console, projectFilesystem, buildRuleTypes, artifactCacheFactory, buildEventBus, parser, platform)); // TODO(user): allocate artifactCacheFactory in the try-with-resources block to avoid leaks. artifactCacheFactory.closeCreatedArtifactCaches(ARTIFACT_CACHE_TIMEOUT_IN_SECONDS); // If the Daemon is running and serving web traffic, print the URL to the Chrome Trace. if (webServer.isPresent()) { int port = webServer.get().getPort(); buildEventBus.post(LogEvent.info( "See trace at http://localhost:%s/trace/%s", port, buildId)); } buildEventBus.post(CommandEvent.finished(commandName, remainingArgs, isDaemon, exitCode)); } finally { commandSemaphore.release(); // Allow another command to execute while outputting traces. } if (isDaemon) { context.get().in.close(); // Avoid client exit triggering client disconnection handling. context.get().exit(exitCode); // Allow nailgun client to exit while outputting traces. } for (BuckEventListener eventListener : eventListeners) { eventListener.outputTrace(buildId); } return exitCode; }
public int executeCommand( File projectRoot, Command.ParseResult commandParseResult, Optional<NGContext> context, String... args) throws IOException { // Create common command parameters. projectFilesystem initialization looks odd because it needs // ignorePaths from a BuckConfig instance, which in turn needs a ProjectFilesystem (i.e. this // solves a bootstrapping issue). ProjectFilesystem projectFilesystem = new ProjectFilesystem( projectRoot, createBuckConfig(new ProjectFilesystem(projectRoot), platform).getIgnorePaths()); BuckConfig config = createBuckConfig(projectFilesystem, platform); Verbosity verbosity = VerbosityParser.parse(args); Optional<String> color; final boolean isDaemon = context.isPresent(); if (isDaemon && (context.get().getEnv() != null)) { String colorString = context.get().getEnv().getProperty(BUCKD_COLOR_DEFAULT_ENV_VAR); color = Optional.fromNullable(colorString); } else { color = Optional.absent(); } final Console console = new Console(verbosity, stdOut, stdErr, config.createAnsi(color)); if (commandParseResult.getErrorText().isPresent()) { console.getStdErr().println(commandParseResult.getErrorText().get()); } // No more early outs: acquire the command semaphore and become the only executing command. if (!commandSemaphore.tryAcquire()) { return BUSY_EXIT_CODE; } int exitCode; ImmutableList<BuckEventListener> eventListeners; String buildId = MoreStrings.createRandomString(); Clock clock = new DefaultClock(); ExecutionEnvironment executionEnvironment = new DefaultExecutionEnvironment(); // The order of resources in the try-with-resources block is important: the BuckEventBus must // be the last resource, so that it is closed first and can deliver its queued events to the // other resources before they are closed. try (AbstractConsoleEventBusListener consoleListener = createConsoleEventListener(clock, console, verbosity, executionEnvironment); BuckEventBus buildEventBus = new BuckEventBus(clock, buildId)) { Optional<WebServer> webServer = getWebServerIfDaemon(context, projectFilesystem, config, console); eventListeners = addEventListeners(buildEventBus, projectFilesystem, config, webServer, consoleListener); ImmutableList<String> remainingArgs = ImmutableList.copyOf( Arrays.copyOfRange(args, 1, args.length)); Command executingCommand = commandParseResult.getCommand().get(); String commandName = executingCommand.name().toLowerCase(); CommandEvent commandEvent = CommandEvent.started(commandName, remainingArgs, isDaemon); buildEventBus.post(commandEvent); // The ArtifactCache is constructed lazily so that we do not try to connect to Cassandra when // running commands such as `buck clean`. ArtifactCacheFactory artifactCacheFactory = new LoggingArtifactCacheFactory(buildEventBus); // Create or get Parser and invalidate cached command parameters. Parser parser; KnownBuildRuleTypes buildRuleTypes = KnownBuildRuleTypes.getConfigured(config); if (isDaemon) { parser = getParserFromDaemon(context, projectFilesystem, config, console, commandEvent); } else { // Initialize logging and create new Parser for new process. JavaUtilsLoggingBuildListener.ensureLogFileIsWritten(); parser = new Parser(projectFilesystem, buildRuleTypes, console, config.getPythonInterpreter(), config.getTempFilePatterns(), createRuleKeyBuilderFactory(new DefaultFileHashCache(projectFilesystem, console))); } exitCode = executingCommand.execute(remainingArgs, config, new CommandRunnerParams( console, projectFilesystem, buildRuleTypes, artifactCacheFactory, buildEventBus, parser, platform)); // TODO(user): allocate artifactCacheFactory in the try-with-resources block to avoid leaks. artifactCacheFactory.closeCreatedArtifactCaches(ARTIFACT_CACHE_TIMEOUT_IN_SECONDS); // If the Daemon is running and serving web traffic, print the URL to the Chrome Trace. if (webServer.isPresent()) { int port = webServer.get().getPort(); buildEventBus.post(LogEvent.info( "See trace at http://localhost:%s/trace/%s", port, buildId)); } buildEventBus.post(CommandEvent.finished(commandName, remainingArgs, isDaemon, exitCode)); } finally { commandSemaphore.release(); // Allow another command to execute while outputting traces. } if (isDaemon) { context.get().in.close(); // Avoid client exit triggering client disconnection handling. context.get().exit(exitCode); // Allow nailgun client to exit while outputting traces. } for (BuckEventListener eventListener : eventListeners) { try { eventListener.outputTrace(buildId); } catch (RuntimeException e) { System.err.println("Skipping over non-fatal error"); e.printStackTrace(); } } return exitCode; }
diff --git a/opentripplanner-graph-builder/src/main/java/org/opentripplanner/graph_builder/impl/osm/OpenStreetMapGraphBuilderImpl.java b/opentripplanner-graph-builder/src/main/java/org/opentripplanner/graph_builder/impl/osm/OpenStreetMapGraphBuilderImpl.java index 2d5bc003c..92d1cc8d1 100644 --- a/opentripplanner-graph-builder/src/main/java/org/opentripplanner/graph_builder/impl/osm/OpenStreetMapGraphBuilderImpl.java +++ b/opentripplanner-graph-builder/src/main/java/org/opentripplanner/graph_builder/impl/osm/OpenStreetMapGraphBuilderImpl.java @@ -1,324 +1,327 @@ /* This program is free software: you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. */ package org.opentripplanner.graph_builder.impl.osm; import java.util.ArrayList; import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.List; import java.util.Map; import java.util.Queue; import java.util.Set; import org.opentripplanner.common.geometry.PackedCoordinateSequence; import org.opentripplanner.common.geometry.PackedCoordinateSequence.Float; import org.opentripplanner.graph_builder.model.osm.OSMNode; import org.opentripplanner.graph_builder.model.osm.OSMRelation; import org.opentripplanner.graph_builder.model.osm.OSMWay; import org.opentripplanner.graph_builder.services.GraphBuilder; import org.opentripplanner.graph_builder.services.osm.OpenStreetMapContentHandler; import org.opentripplanner.graph_builder.services.osm.OpenStreetMapProvider; import org.opentripplanner.routing.core.Edge; import org.opentripplanner.routing.core.Graph; import org.opentripplanner.routing.core.Intersection; import org.opentripplanner.routing.core.Vertex; import org.opentripplanner.routing.edgetype.Street; import org.opentripplanner.routing.edgetype.StreetTraversalPermission; import org.opentripplanner.routing.edgetype.Turn; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import com.vividsolutions.jts.geom.Coordinate; import com.vividsolutions.jts.geom.GeometryFactory; import com.vividsolutions.jts.geom.LineString; public class OpenStreetMapGraphBuilderImpl implements GraphBuilder { private static Logger _log = LoggerFactory.getLogger(OpenStreetMapGraphBuilderImpl.class); private static final GeometryFactory _geometryFactory = new GeometryFactory(); private List<OpenStreetMapProvider> _providers = new ArrayList<OpenStreetMapProvider>(); private Map<Object, Object> _uniques = new HashMap<Object, Object>(); public void setProvider(OpenStreetMapProvider provider) { _providers.add(provider); } public void setProviders(List<OpenStreetMapProvider> providers) { _providers.addAll(providers); } @Override public void buildGraph(Graph graph) { Handler handler = new Handler(); for (OpenStreetMapProvider provider : _providers) { _log.debug("gathering osm from provider: " + provider); provider.readOSM(handler); } _log.debug("building osm street graph"); handler.buildGraph(graph); } @SuppressWarnings("unchecked") private <T> T unique(T value) { Object v = _uniques.get(value); if (v == null) { _uniques.put(value, value); v = value; } return (T) v; } private class Handler implements OpenStreetMapContentHandler { private Map<Integer, OSMNode> _nodes = new HashMap<Integer, OSMNode>(); private Map<Integer, OSMWay> _ways = new HashMap<Integer, OSMWay>(); public void buildGraph(Graph graph) { // We want to prune nodes that don't have any edges Set<Integer> nodesWithNeighbors = new HashSet<Integer>(); for (OSMWay way : _ways.values()) { List<Integer> nodes = way.getNodeRefs(); if (nodes.size() > 1) nodesWithNeighbors.addAll(nodes); } // Remove all simple islands _nodes.keySet().retainAll(nodesWithNeighbors); pruneFloatingIslands(); HashMap<Coordinate, ArrayList<Edge>> edgesByLocation = new HashMap<Coordinate, ArrayList<Edge>>(); int wayIndex = 0; for (OSMWay way : _ways.values()) { if (wayIndex % 1000 == 0) _log.debug("ways=" + wayIndex + "/" + _ways.size()); wayIndex++; StreetTraversalPermission permissions = getPermissionsForWay(way); List<Integer> nodes = way.getNodeRefs(); for (int i = 0; i < nodes.size() - 1; i++) { Integer startNode = nodes.get(i); String vFromId = getVertexIdForNodeId(startNode) + "_" + i + "_" + way.getId(); Integer endNode = nodes.get(i + 1); String vToId = getVertexIdForNodeId(endNode) + "_" + i + "_" + way.getId(); OSMNode osmStartNode = _nodes.get(startNode); OSMNode osmEndNode = _nodes.get(endNode); if (osmStartNode == null || osmEndNode == null) continue; Vertex from = addVertex(graph, vFromId, osmStartNode); Vertex to = addVertex(graph, vToId, osmEndNode); double d = from.distance(to); Street street = getEdgeForStreet(from, to, way, d, permissions); graph.addEdge(street); Street backStreet = getEdgeForStreet(to, from, way, d, permissions); graph.addEdge(backStreet); ArrayList<Edge> startEdges = edgesByLocation.get(from.getCoordinate()); if (startEdges == null) { startEdges = new ArrayList<Edge>(); edgesByLocation.put(from.getCoordinate(), startEdges); } startEdges.add(street); ArrayList<Edge> endEdges = edgesByLocation.get(to.getCoordinate()); if (endEdges == null) { endEdges = new ArrayList<Edge>(); edgesByLocation.put(to.getCoordinate(), endEdges); } endEdges.add(backStreet); } } // add turns for (ArrayList<Edge> edges : edgesByLocation.values()) { for (Edge in : edges) { Vertex tov = in.getToVertex(); Coordinate c = tov.getCoordinate(); ArrayList<Edge> outEdges = edgesByLocation.get(c); if (outEdges != null) { /* If this is not an intersection or street name change, unify the vertices */ + boolean unified = false; if (outEdges.size() == 2) { for (Edge out : outEdges) { Vertex fromVertex = out.getFromVertex(); if (tov != fromVertex && out.getName() == in.getName()) { Intersection v = (Intersection) tov; v.mergeFrom(graph, (Intersection) fromVertex); graph.removeVertex(fromVertex); + unified = true; break; } } - } else { + } + if (!unified) { for (Edge out : outEdges) { /* * Only create a turn edge if: (a) the edge is not the one we are * coming from (b) the edge is a Street (c) the edge is an outgoing * edge from this location */ if (tov != out.getFromVertex() && out instanceof Street && out.getFromVertex().getCoordinate().equals(c)) { graph.addEdge(new Turn(in, out)); } } } } } } } private Vertex addVertex(Graph graph, String vertexId, OSMNode node) { Intersection newVertex = new Intersection(vertexId, node.getLon(), node.getLat()); graph.addVertex(newVertex); return newVertex; } private void pruneFloatingIslands() { Map<Integer, HashSet<Integer>> subgraphs = new HashMap<Integer, HashSet<Integer>>(); Map<Integer, ArrayList<Integer>> neighborsForNode = new HashMap<Integer, ArrayList<Integer>>(); for (OSMWay way : _ways.values()) { List<Integer> nodes = way.getNodeRefs(); for (int node : nodes) { ArrayList<Integer> nodelist = neighborsForNode.get(node); if (nodelist == null) { nodelist = new ArrayList<Integer>(); neighborsForNode.put(node, nodelist); } nodelist.addAll(nodes); } } /* associate each node with a subgraph */ for (int node : _nodes.keySet()) { if (subgraphs.containsKey(node)) { continue; } HashSet<Integer> subgraph = computeConnectedSubgraph(neighborsForNode, node); for (int subnode : subgraph) { subgraphs.put(subnode, subgraph); } } /* find the largest subgraph */ HashSet<Integer> largestSubgraph = null; for (HashSet<Integer> subgraph : subgraphs.values()) { if (largestSubgraph == null || largestSubgraph.size() < subgraph.size()) { largestSubgraph = subgraph; } } /* delete the rest */ _nodes.keySet().retainAll(largestSubgraph); } private HashSet<Integer> computeConnectedSubgraph( Map<Integer, ArrayList<Integer>> neighborsForNode, int startNode) { HashSet<Integer> subgraph = new HashSet<Integer>(); Queue<Integer> q = new LinkedList<Integer>(); q.add(startNode); while (!q.isEmpty()) { int node = q.poll(); for (int neighbor : neighborsForNode.get(node)) { if (!subgraph.contains(neighbor)) { subgraph.add(neighbor); q.add(neighbor); } } } return subgraph; } public void addNode(OSMNode node) { if (_nodes.containsKey(node.getId())) return; _nodes.put(node.getId(), node); if (_nodes.size() % 1000 == 0) _log.debug("nodes=" + _nodes.size()); } public void addWay(OSMWay way) { if (_ways.containsKey(way.getId())) return; if (!(way.getTags().containsKey("highway") || "platform".equals(way.getTags().get( "railway")))) { return; } _ways.put(way.getId(), way); if (_ways.size() % 1000 == 0) _log.debug("ways=" + _ways.size()); } public void addRelation(OSMRelation relation) { } private String getVertexIdForNodeId(int nodeId) { return "osm node " + nodeId; } private Street getEdgeForStreet(Vertex from, Vertex to, OSMWay way, double d, StreetTraversalPermission permissions) { String id = "way " + way.getId(); id = unique(id); String name = way.getTags().get("name"); if (name == null) { name = id; } Street street = new Street(from, to, id, name, d, permissions); Coordinate[] coordinates = { from.getCoordinate(), to.getCoordinate() }; Float sequence = new PackedCoordinateSequence.Float(coordinates, 2); LineString lineString = _geometryFactory.createLineString(sequence); street.setGeometry(lineString); return street; } private StreetTraversalPermission getPermissionsForWay(OSMWay way) { // TODO : Better mapping between OSM tags and travel permissions Map<String, String> tags = way.getTags(); String value = tags.get("highway"); if (value == null || value.equals("motorway") || value.equals("motorway_link")) return StreetTraversalPermission.CAR_ONLY; if ("platform".equals(way.getTags().get("railway"))) { return StreetTraversalPermission.PEDESTRIAN_AND_BICYCLE_ONLY; } return StreetTraversalPermission.ALL; } } }
false
true
public void buildGraph(Graph graph) { // We want to prune nodes that don't have any edges Set<Integer> nodesWithNeighbors = new HashSet<Integer>(); for (OSMWay way : _ways.values()) { List<Integer> nodes = way.getNodeRefs(); if (nodes.size() > 1) nodesWithNeighbors.addAll(nodes); } // Remove all simple islands _nodes.keySet().retainAll(nodesWithNeighbors); pruneFloatingIslands(); HashMap<Coordinate, ArrayList<Edge>> edgesByLocation = new HashMap<Coordinate, ArrayList<Edge>>(); int wayIndex = 0; for (OSMWay way : _ways.values()) { if (wayIndex % 1000 == 0) _log.debug("ways=" + wayIndex + "/" + _ways.size()); wayIndex++; StreetTraversalPermission permissions = getPermissionsForWay(way); List<Integer> nodes = way.getNodeRefs(); for (int i = 0; i < nodes.size() - 1; i++) { Integer startNode = nodes.get(i); String vFromId = getVertexIdForNodeId(startNode) + "_" + i + "_" + way.getId(); Integer endNode = nodes.get(i + 1); String vToId = getVertexIdForNodeId(endNode) + "_" + i + "_" + way.getId(); OSMNode osmStartNode = _nodes.get(startNode); OSMNode osmEndNode = _nodes.get(endNode); if (osmStartNode == null || osmEndNode == null) continue; Vertex from = addVertex(graph, vFromId, osmStartNode); Vertex to = addVertex(graph, vToId, osmEndNode); double d = from.distance(to); Street street = getEdgeForStreet(from, to, way, d, permissions); graph.addEdge(street); Street backStreet = getEdgeForStreet(to, from, way, d, permissions); graph.addEdge(backStreet); ArrayList<Edge> startEdges = edgesByLocation.get(from.getCoordinate()); if (startEdges == null) { startEdges = new ArrayList<Edge>(); edgesByLocation.put(from.getCoordinate(), startEdges); } startEdges.add(street); ArrayList<Edge> endEdges = edgesByLocation.get(to.getCoordinate()); if (endEdges == null) { endEdges = new ArrayList<Edge>(); edgesByLocation.put(to.getCoordinate(), endEdges); } endEdges.add(backStreet); } } // add turns for (ArrayList<Edge> edges : edgesByLocation.values()) { for (Edge in : edges) { Vertex tov = in.getToVertex(); Coordinate c = tov.getCoordinate(); ArrayList<Edge> outEdges = edgesByLocation.get(c); if (outEdges != null) { /* If this is not an intersection or street name change, unify the vertices */ if (outEdges.size() == 2) { for (Edge out : outEdges) { Vertex fromVertex = out.getFromVertex(); if (tov != fromVertex && out.getName() == in.getName()) { Intersection v = (Intersection) tov; v.mergeFrom(graph, (Intersection) fromVertex); graph.removeVertex(fromVertex); break; } } } else { for (Edge out : outEdges) { /* * Only create a turn edge if: (a) the edge is not the one we are * coming from (b) the edge is a Street (c) the edge is an outgoing * edge from this location */ if (tov != out.getFromVertex() && out instanceof Street && out.getFromVertex().getCoordinate().equals(c)) { graph.addEdge(new Turn(in, out)); } } } } } } }
public void buildGraph(Graph graph) { // We want to prune nodes that don't have any edges Set<Integer> nodesWithNeighbors = new HashSet<Integer>(); for (OSMWay way : _ways.values()) { List<Integer> nodes = way.getNodeRefs(); if (nodes.size() > 1) nodesWithNeighbors.addAll(nodes); } // Remove all simple islands _nodes.keySet().retainAll(nodesWithNeighbors); pruneFloatingIslands(); HashMap<Coordinate, ArrayList<Edge>> edgesByLocation = new HashMap<Coordinate, ArrayList<Edge>>(); int wayIndex = 0; for (OSMWay way : _ways.values()) { if (wayIndex % 1000 == 0) _log.debug("ways=" + wayIndex + "/" + _ways.size()); wayIndex++; StreetTraversalPermission permissions = getPermissionsForWay(way); List<Integer> nodes = way.getNodeRefs(); for (int i = 0; i < nodes.size() - 1; i++) { Integer startNode = nodes.get(i); String vFromId = getVertexIdForNodeId(startNode) + "_" + i + "_" + way.getId(); Integer endNode = nodes.get(i + 1); String vToId = getVertexIdForNodeId(endNode) + "_" + i + "_" + way.getId(); OSMNode osmStartNode = _nodes.get(startNode); OSMNode osmEndNode = _nodes.get(endNode); if (osmStartNode == null || osmEndNode == null) continue; Vertex from = addVertex(graph, vFromId, osmStartNode); Vertex to = addVertex(graph, vToId, osmEndNode); double d = from.distance(to); Street street = getEdgeForStreet(from, to, way, d, permissions); graph.addEdge(street); Street backStreet = getEdgeForStreet(to, from, way, d, permissions); graph.addEdge(backStreet); ArrayList<Edge> startEdges = edgesByLocation.get(from.getCoordinate()); if (startEdges == null) { startEdges = new ArrayList<Edge>(); edgesByLocation.put(from.getCoordinate(), startEdges); } startEdges.add(street); ArrayList<Edge> endEdges = edgesByLocation.get(to.getCoordinate()); if (endEdges == null) { endEdges = new ArrayList<Edge>(); edgesByLocation.put(to.getCoordinate(), endEdges); } endEdges.add(backStreet); } } // add turns for (ArrayList<Edge> edges : edgesByLocation.values()) { for (Edge in : edges) { Vertex tov = in.getToVertex(); Coordinate c = tov.getCoordinate(); ArrayList<Edge> outEdges = edgesByLocation.get(c); if (outEdges != null) { /* If this is not an intersection or street name change, unify the vertices */ boolean unified = false; if (outEdges.size() == 2) { for (Edge out : outEdges) { Vertex fromVertex = out.getFromVertex(); if (tov != fromVertex && out.getName() == in.getName()) { Intersection v = (Intersection) tov; v.mergeFrom(graph, (Intersection) fromVertex); graph.removeVertex(fromVertex); unified = true; break; } } } if (!unified) { for (Edge out : outEdges) { /* * Only create a turn edge if: (a) the edge is not the one we are * coming from (b) the edge is a Street (c) the edge is an outgoing * edge from this location */ if (tov != out.getFromVertex() && out instanceof Street && out.getFromVertex().getCoordinate().equals(c)) { graph.addEdge(new Turn(in, out)); } } } } } } }
diff --git a/org.eclipse.gmf.runtime/tests/org.eclipse.gmf.tests.runtime.common.core/src/org/eclipse/gmf/tests/runtime/common/core/internal/util/StringUtilTest.java b/org.eclipse.gmf.runtime/tests/org.eclipse.gmf.tests.runtime.common.core/src/org/eclipse/gmf/tests/runtime/common/core/internal/util/StringUtilTest.java index 36bbebe6..e679bc22 100644 --- a/org.eclipse.gmf.runtime/tests/org.eclipse.gmf.tests.runtime.common.core/src/org/eclipse/gmf/tests/runtime/common/core/internal/util/StringUtilTest.java +++ b/org.eclipse.gmf.runtime/tests/org.eclipse.gmf.tests.runtime.common.core/src/org/eclipse/gmf/tests/runtime/common/core/internal/util/StringUtilTest.java @@ -1,81 +1,81 @@ /****************************************************************************** * Copyright (c) 2002, 2005 IBM Corporation and others. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/epl-v10.html * * Contributors: * IBM Corporation - initial API and implementation ****************************************************************************/ package org.eclipse.gmf.tests.runtime.common.core.internal.util; import junit.framework.Test; import junit.framework.TestCase; import junit.framework.TestSuite; import junit.textui.TestRunner; import org.eclipse.gmf.runtime.common.core.util.Proxy; import org.eclipse.gmf.runtime.common.core.util.StringUtil; /** * Tests org.eclipse.gmf.runtime.common.core.internal.util.StringUtil * @author Wayne Diu, wdiu */ public class StringUtilTest extends TestCase { private final String src = "I am writing a test case with the word a.\nThe word a is a very important word because I want to replace all instances of it. It is a word. And I must test case sensitive replaces too, okay?"; //$NON-NLS-1$ protected static class Fixture extends Proxy { protected Fixture(Object realObject) { super(realObject); } } public static void main(String[] args) { TestRunner.run(suite()); } public static Test suite() { return new TestSuite(StringUtilTest.class); } public StringUtilTest(String name) { super(name); } /* * The test cases replace a with a a because that could result in * infinite recursion if I did not write the replace methods correctly. */ public void test_Replace() { assertTrue(StringUtil.replace(src, "a", "a a", false).equals("I a am writing a test case with the word a.\nThe word a is a very important word because I want to replace all instances of it. It is a word. And I must test case sensitive replaces too, okay?")); //$NON-NLS-1$ //$NON-NLS-2$ //$NON-NLS-3$ assertTrue(StringUtil.replaceAll(src, "a", "a a", true).equals("I a am writing a a test ca ase with the word a a.\nThe word a a is a a very importa ant word beca ause I wa ant to repla ace a all insta ances of it. It is a a word. And I must test ca ase sensitive repla aces too, oka ay?")); //$NON-NLS-1$ //$NON-NLS-2$ //$NON-NLS-3$ } public void test_ReplaceWholeWords() { assertTrue(StringUtil.replaceWholeWords(src, "a", "a a", true).equals("I am writing a a test case with the word a.\nThe word a is a very important word because I want to replace all instances of it. It is a word. And I must test case sensitive replaces too, okay?")); //$NON-NLS-1$ //$NON-NLS-2$ //$NON-NLS-3$ assertTrue(StringUtil.replaceAllWholeWords(src, "a", "a a", false).equals("I am writing a a test case with the word a a.\nThe word a a is a a very important word because I want to replace all instances of it. It is a a word. And I must test case sensitive replaces too, okay?")); //$NON-NLS-1$ //$NON-NLS-2$ //$NON-NLS-3$ } public void test_dgdEncodeURL() { //These should not change after encoding assertTrue(StringUtil.encodeURL("http://www.ibm.ca/").equals("http://www.ibm.ca/")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.ca").equals("http://www.ibm.ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("C:\\dir\\sub").equals("C:\\dir\\sub")); //$NON-NLS-1$ //$NON-NLS-2$ - assertTrue(StringUtil.encodeURL("Fil�name with spaces.doc").equals("Fil�name with spaces.doc")); //$NON-NLS-1$ //$NON-NLS-2$ + assertTrue(StringUtil.encodeURL("Fil\u00E9name with spaces.doc").equals("Fil\u00E9name with spaces.doc")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=rational&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=rational&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ //These should change after encoding - assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ - assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%3d&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%3d&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ - assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ - assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%fg%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25fg%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ - assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ - assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ + assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ + assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%3d&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%3d&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ + assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ + assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%fg%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25fg%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ + assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ + assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ } }
false
true
public void test_dgdEncodeURL() { //These should not change after encoding assertTrue(StringUtil.encodeURL("http://www.ibm.ca/").equals("http://www.ibm.ca/")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.ca").equals("http://www.ibm.ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("C:\\dir\\sub").equals("C:\\dir\\sub")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("Fil�name with spaces.doc").equals("Fil�name with spaces.doc")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=rational&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=rational&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ //These should change after encoding assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%3d&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%3d&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%fg%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25fg%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=�����%&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ }
public void test_dgdEncodeURL() { //These should not change after encoding assertTrue(StringUtil.encodeURL("http://www.ibm.ca/").equals("http://www.ibm.ca/")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.ca").equals("http://www.ibm.ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("C:\\dir\\sub").equals("C:\\dir\\sub")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("Fil\u00E9name with spaces.doc").equals("Fil\u00E9name with spaces.doc")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=rational&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=rational&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ //These should change after encoding assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%3d&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%3d&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%fg%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25fg%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%%a&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25%25a&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ assertTrue(StringUtil.encodeURL("http://www.ibm.com/Search/?q=\u00E9\u00E7\u00E5\u00E2\u00E8%&v=14&lang=en&cc=ca").equals("http://www.ibm.com/Search/?q=%C3%A9%C3%A7%C3%A5%C3%A2%C3%A8%25&v=14&lang=en&cc=ca")); //$NON-NLS-1$ //$NON-NLS-2$ }
diff --git a/test/src/com/rabbitmq/client/test/functional/FanoutTest.java b/test/src/com/rabbitmq/client/test/functional/FanoutTest.java index 5c2012441..34d119bf5 100644 --- a/test/src/com/rabbitmq/client/test/functional/FanoutTest.java +++ b/test/src/com/rabbitmq/client/test/functional/FanoutTest.java @@ -1,51 +1,51 @@ package com.rabbitmq.client.test.functional; import com.rabbitmq.client.MessageProperties; import com.rabbitmq.client.GetResponse; import java.util.List; import java.util.ArrayList; /** * Functional test to verify fanout behaviour */ public class FanoutTest extends BrokerTestCase { private static final int N = 10; protected static final String X = "amq.fanout"; protected static final String K = ""; protected static final byte[] payload = (""+ System.currentTimeMillis()).getBytes(); // TODO: This setup code is copy and paste - maybe this should wander up to the super class? protected void setUp() throws Exception { openConnection(); openChannel(); } protected void tearDown() throws Exception { closeChannel(); closeConnection(); } public void testFanout() throws Exception { List<String> queues = new ArrayList<String>(); for (int i = 0; i < N; i++) { String q = "Q-" + System.nanoTime(); channel.queueDeclare(ticket, q); channel.queueBind(ticket, q, X, K); queues.add(q); } - channel.basicPublish(ticket, X, K, MessageProperties.BASIC, payload); + channel.basicPublish(ticket, X, System.nanoTime() + "", MessageProperties.BASIC, payload); for (String q : queues) { GetResponse response = channel.basicGet(ticket, q, true); assertNotNull("The response should not be null", response); } } }
true
true
public void testFanout() throws Exception { List<String> queues = new ArrayList<String>(); for (int i = 0; i < N; i++) { String q = "Q-" + System.nanoTime(); channel.queueDeclare(ticket, q); channel.queueBind(ticket, q, X, K); queues.add(q); } channel.basicPublish(ticket, X, K, MessageProperties.BASIC, payload); for (String q : queues) { GetResponse response = channel.basicGet(ticket, q, true); assertNotNull("The response should not be null", response); } }
public void testFanout() throws Exception { List<String> queues = new ArrayList<String>(); for (int i = 0; i < N; i++) { String q = "Q-" + System.nanoTime(); channel.queueDeclare(ticket, q); channel.queueBind(ticket, q, X, K); queues.add(q); } channel.basicPublish(ticket, X, System.nanoTime() + "", MessageProperties.BASIC, payload); for (String q : queues) { GetResponse response = channel.basicGet(ticket, q, true); assertNotNull("The response should not be null", response); } }
diff --git a/src/rules/model/BackwardChaining.java b/src/rules/model/BackwardChaining.java index 0ad56e6..3d627fd 100644 --- a/src/rules/model/BackwardChaining.java +++ b/src/rules/model/BackwardChaining.java @@ -1,118 +1,118 @@ /* * To change this template, choose Tools | Templates * and open the template in the editor. */ package rules.model; import java.util.Vector; /** * * @author Martynas */ public class BackwardChaining extends AbstractAlgo { private Vector<Fact> previouslyDeducted; protected Vector<Production> productionsInUse; // recursion level - only used for logging private int rLevel = 0; public BackwardChaining(Vector<Production> productions, Vector<Fact> gdb, Fact target, LogModel logger) { super(productions, gdb, target, logger); System.err.println(this); previouslyDeducted = new Vector<Fact>(); productionsInUse = new Vector<Production>(); } public boolean iterate() { logger.log("Tikslas yra: %s.\n", target); boolean result = get(target); finished = true; return result; } public boolean get(Fact f) { // check if fact is in primary facts {1} if (gdb.contains(f)) { logger.log(" %s yra pradinis faktas.\n", f); return true; } // check if the fact was previously deducted if (previouslyDeducted.contains(f)) { logger.log(" %s yra jau išvestas.\n", f); return true; } rLevel++; // check if the fact can be derived from the used productions for (Production p: productionsInUse) { if (p.getOutput().contains(f)) { - trace("Ciklas su %s.\n", p); + trace("Ciklas dėl %s.\n", f); rLevel--; return false; } } boolean factCanBeDerived = false; for (int i = 0; i < productions.size(); i++) { Production currentProduction = productions.elementAt(i); if (currentProduction.getOutput().contains(f) && !usedProductions.contains(currentProduction)) { // {2} factCanBeDerived = true; boolean allInputsFound = true; // mark the production, so it is not used from this point productionsInUse.add(currentProduction); // get all needed facts for this production. // Stop after the first production which could not be found. for (int j = 0; j < currentProduction.getInput().size() && allInputsFound; j++) { // {3} trace("Naujas tikslas %s, nes %s galima išvesti iš %s.", currentProduction.getInput().elementAt(j), f, currentProduction); boolean result = get(currentProduction.getInput().elementAt(j)); allInputsFound = allInputsFound && result; if (result) { previouslyDeducted.add(currentProduction.getInput().elementAt(j)); // {4} } } if (allInputsFound) { usedProductions.add(currentProduction); // {5} rLevel--; return true; } // not all inputs were found for this production, // unmark this production as used productionsInUse.remove(currentProduction); } } if (!factCanBeDerived) { trace("%s nerastas. Aklavietė.\n", f); } rLevel--; return false; // {6} } public void trace(String s, Object... args) { actionNum++; logger.log("\n"+actionNum+". "); for (int i = 0; i < rLevel; i++) { logger.log(" "); } logger.log(String.format(s, args)); } }
true
true
public boolean get(Fact f) { // check if fact is in primary facts {1} if (gdb.contains(f)) { logger.log(" %s yra pradinis faktas.\n", f); return true; } // check if the fact was previously deducted if (previouslyDeducted.contains(f)) { logger.log(" %s yra jau išvestas.\n", f); return true; } rLevel++; // check if the fact can be derived from the used productions for (Production p: productionsInUse) { if (p.getOutput().contains(f)) { trace("Ciklas su %s.\n", p); rLevel--; return false; } } boolean factCanBeDerived = false; for (int i = 0; i < productions.size(); i++) { Production currentProduction = productions.elementAt(i); if (currentProduction.getOutput().contains(f) && !usedProductions.contains(currentProduction)) { // {2} factCanBeDerived = true; boolean allInputsFound = true; // mark the production, so it is not used from this point productionsInUse.add(currentProduction); // get all needed facts for this production. // Stop after the first production which could not be found. for (int j = 0; j < currentProduction.getInput().size() && allInputsFound; j++) { // {3} trace("Naujas tikslas %s, nes %s galima išvesti iš %s.", currentProduction.getInput().elementAt(j), f, currentProduction); boolean result = get(currentProduction.getInput().elementAt(j)); allInputsFound = allInputsFound && result; if (result) { previouslyDeducted.add(currentProduction.getInput().elementAt(j)); // {4} } } if (allInputsFound) { usedProductions.add(currentProduction); // {5} rLevel--; return true; } // not all inputs were found for this production, // unmark this production as used productionsInUse.remove(currentProduction); } } if (!factCanBeDerived) { trace("%s nerastas. Aklavietė.\n", f); } rLevel--; return false; // {6} }
public boolean get(Fact f) { // check if fact is in primary facts {1} if (gdb.contains(f)) { logger.log(" %s yra pradinis faktas.\n", f); return true; } // check if the fact was previously deducted if (previouslyDeducted.contains(f)) { logger.log(" %s yra jau išvestas.\n", f); return true; } rLevel++; // check if the fact can be derived from the used productions for (Production p: productionsInUse) { if (p.getOutput().contains(f)) { trace("Ciklas dėl %s.\n", f); rLevel--; return false; } } boolean factCanBeDerived = false; for (int i = 0; i < productions.size(); i++) { Production currentProduction = productions.elementAt(i); if (currentProduction.getOutput().contains(f) && !usedProductions.contains(currentProduction)) { // {2} factCanBeDerived = true; boolean allInputsFound = true; // mark the production, so it is not used from this point productionsInUse.add(currentProduction); // get all needed facts for this production. // Stop after the first production which could not be found. for (int j = 0; j < currentProduction.getInput().size() && allInputsFound; j++) { // {3} trace("Naujas tikslas %s, nes %s galima išvesti iš %s.", currentProduction.getInput().elementAt(j), f, currentProduction); boolean result = get(currentProduction.getInput().elementAt(j)); allInputsFound = allInputsFound && result; if (result) { previouslyDeducted.add(currentProduction.getInput().elementAt(j)); // {4} } } if (allInputsFound) { usedProductions.add(currentProduction); // {5} rLevel--; return true; } // not all inputs were found for this production, // unmark this production as used productionsInUse.remove(currentProduction); } } if (!factCanBeDerived) { trace("%s nerastas. Aklavietė.\n", f); } rLevel--; return false; // {6} }
diff --git a/target_explorer/plugins/org.eclipse.tcf.te.ui.terminals.process/src/org/eclipse/tcf/te/ui/terminals/process/ProcessConnector.java b/target_explorer/plugins/org.eclipse.tcf.te.ui.terminals.process/src/org/eclipse/tcf/te/ui/terminals/process/ProcessConnector.java index 233d940b8..7b8bff3f6 100644 --- a/target_explorer/plugins/org.eclipse.tcf.te.ui.terminals.process/src/org/eclipse/tcf/te/ui/terminals/process/ProcessConnector.java +++ b/target_explorer/plugins/org.eclipse.tcf.te.ui.terminals.process/src/org/eclipse/tcf/te/ui/terminals/process/ProcessConnector.java @@ -1,278 +1,278 @@ /******************************************************************************* * Copyright (c) 2011, 2014 Wind River Systems, Inc. and others. All rights reserved. * This program and the accompanying materials are made available under the terms * of the Eclipse Public License v1.0 which accompanies this distribution, and is * available at http://www.eclipse.org/legal/epl-v10.html * * Contributors: * Wind River Systems - initial API and implementation *******************************************************************************/ package org.eclipse.tcf.te.ui.terminals.process; import java.io.File; import java.io.IOException; import java.io.StreamTokenizer; import java.io.StringReader; import java.util.ArrayList; import java.util.List; import org.eclipse.cdt.utils.pty.PTY; import org.eclipse.cdt.utils.spawner.ProcessFactory; import org.eclipse.core.runtime.Assert; import org.eclipse.core.runtime.IStatus; import org.eclipse.core.runtime.Status; import org.eclipse.osgi.util.NLS; import org.eclipse.swt.custom.CTabItem; import org.eclipse.tcf.te.runtime.services.interfaces.constants.ILineSeparatorConstants; import org.eclipse.tcf.te.runtime.statushandler.StatusHandlerUtil; import org.eclipse.tcf.te.runtime.utils.Env; import org.eclipse.tcf.te.ui.terminals.manager.ConsoleManager; import org.eclipse.tcf.te.ui.terminals.process.activator.UIPlugin; import org.eclipse.tcf.te.ui.terminals.process.help.IContextHelpIds; import org.eclipse.tcf.te.ui.terminals.process.nls.Messages; import org.eclipse.tcf.te.ui.terminals.streams.AbstractStreamsConnector; import org.eclipse.tm.internal.terminal.provisional.api.ISettingsPage; import org.eclipse.tm.internal.terminal.provisional.api.ISettingsStore; import org.eclipse.tm.internal.terminal.provisional.api.ITerminalControl; import org.eclipse.tm.internal.terminal.provisional.api.TerminalState; /** * Process connector implementation. */ @SuppressWarnings("restriction") public class ProcessConnector extends AbstractStreamsConnector { // Reference to the process settings private final ProcessSettings settings; // Reference to the PTY instance. private PTY pty; // Reference to the launched process instance. private Process process; // Reference to the process monitor private ProcessMonitor monitor; // The terminal width and height. Initially unknown. private int width = -1; private int height = -1; /** * Constructor. */ public ProcessConnector() { this(new ProcessSettings()); } /** * Constructor. * * @param settings The process settings. Must not be <code>null</code> */ public ProcessConnector(ProcessSettings settings) { super(); Assert.isNotNull(settings); this.settings = settings; } /** * Returns the process object or <code>null</code> if the * connector is connector. * * @return The process object or <code>null</code>. */ public Process getProcess() { return process; } /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#connect(org.eclipse.tcf.internal.terminal.provisional.api.ITerminalControl) */ @Override public void connect(ITerminalControl control) { Assert.isNotNull(control); super.connect(control); pty = null; width = -1; height = -1; try { // Try to determine process and PTY instance from the process settings process = settings.getProcess(); pty = settings.getPTY(); // No process -> create PTY on supported platforms and execute // process image. if (process == null) { if (PTY.isSupported(PTY.Mode.TERMINAL)) { try { pty = new PTY(PTY.Mode.TERMINAL); } catch (IOException e) { // PTY not supported } } // Build up the command StringBuilder command = new StringBuilder(settings.getImage()); String arguments = settings.getArguments(); if (arguments != null && !"".equals(arguments.trim())) { //$NON-NLS-1$ // Append to the command now command.append(" "); //$NON-NLS-1$ command.append(arguments.trim()); } File workingDir =null; if (settings.getWorkingDir()!=null){ workingDir = new File(settings.getWorkingDir()); } String[] envp = null; if (settings.getEnvironment()!=null){ envp = settings.getEnvironment(); } if (pty != null) { // A PTY is available -> can use the ProcessFactory. // Tokenize the command (ProcessFactory takes an array) StreamTokenizer st = new StreamTokenizer(new StringReader(command.toString())); st.resetSyntax(); st.whitespaceChars(0, 32); st.whitespaceChars(0xa0, 0xa0); st.wordChars(33, 255); st.quoteChar('"'); st.quoteChar('\''); List<String> argv = new ArrayList<String>(); int ttype = st.nextToken(); while (ttype != StreamTokenizer.TT_EOF) { argv.add(st.sval); ttype = st.nextToken(); } // Execute the process process = ProcessFactory.getFactory().exec(argv.toArray(new String[argv.size()]), Env.getEnvironment(envp, true), workingDir, pty); } else { // No PTY -> just execute via the standard Java Runtime implementation. - process = Runtime.getRuntime().exec(command.toString(), Env.getEnvironment(envp, false), workingDir); + process = Runtime.getRuntime().exec(command.toString(), Env.getEnvironment(envp, true), workingDir); } } String lineSeparator = settings.getLineSeparator(); if (lineSeparator == null) { lineSeparator = System.getProperty("line.separator"); //$NON-NLS-1$ if ("\r".equals(lineSeparator)) { //$NON-NLS-1$ lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_CR; } else if ("\n".equals(lineSeparator)) { //$NON-NLS-1$ lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_LF; } else { lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_CRLF; } } // Setup the listeners setStdoutListeners(settings.getStdOutListeners()); setStderrListeners(settings.getStdErrListeners()); // connect the streams connectStreams(control, process.getOutputStream(), process.getInputStream(), (pty == null ? process.getErrorStream() : null), settings.isLocalEcho(), lineSeparator); // Set the terminal control state to CONNECTED control.setState(TerminalState.CONNECTED); // Create the process monitor monitor = new ProcessMonitor(this); monitor.startMonitoring(); } catch (IOException e) { // Disconnect right away disconnect(); // Lookup the tab item CTabItem item = ConsoleManager.getInstance().findConsole(control); if (item != null) item.dispose(); // Get the error message from the exception String msg = e.getLocalizedMessage() != null ? e.getLocalizedMessage() : ""; //$NON-NLS-1$ Assert.isNotNull(msg); // Strip away "Exec_tty error:" msg = msg.replace("Exec_tty error:", "").trim(); //$NON-NLS-1$ //$NON-NLS-2$ // Repackage into a more user friendly error msg = NLS.bind(Messages.ProcessConnector_error_creatingProcess, settings.getImage(), msg); // Create the status object IStatus status = new Status(IStatus.ERROR, UIPlugin.getUniqueIdentifier(), msg, e); StatusHandlerUtil.handleStatus(status, this, msg, Messages.ProcessConnector_error_title, IContextHelpIds.MESSAGE_CREATE_PROCESS_FAILED, this, null); } } /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#isLocalEcho() */ @Override public boolean isLocalEcho() { return settings.isLocalEcho(); } /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#doDisconnect() */ @Override public void doDisconnect() { // Dispose the process if (process != null) { process.destroy(); process = null; } // Dispose the streams super.doDisconnect(); // Set the terminal control state to CLOSED. fControl.setState(TerminalState.CLOSED); } // ***** Process Connector settings handling ***** /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#makeSettingsPage() */ @Override public ISettingsPage makeSettingsPage() { return new ProcessSettingsPage(settings); } /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#getSettingsSummary() */ @Override public String getSettingsSummary() { return settings.getImage() != null ? settings.getImage() : ""; //$NON-NLS-1$ } /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#load(org.eclipse.tcf.internal.terminal.provisional.api.ISettingsStore) */ @Override public void load(ISettingsStore store) { settings.load(store); } /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#save(org.eclipse.tcf.internal.terminal.provisional.api.ISettingsStore) */ @Override public void save(ISettingsStore store) { settings.save(store); } /* (non-Javadoc) * @see org.eclipse.tcf.internal.terminal.provisional.api.provider.TerminalConnectorImpl#setTerminalSize(int, int) */ @Override public void setTerminalSize(int newWidth, int newHeight) { if (width != newWidth || height != newHeight) { width = newWidth; height = newHeight; if (pty != null) { pty.setTerminalSize(newWidth, newHeight); } } } }
true
true
public void connect(ITerminalControl control) { Assert.isNotNull(control); super.connect(control); pty = null; width = -1; height = -1; try { // Try to determine process and PTY instance from the process settings process = settings.getProcess(); pty = settings.getPTY(); // No process -> create PTY on supported platforms and execute // process image. if (process == null) { if (PTY.isSupported(PTY.Mode.TERMINAL)) { try { pty = new PTY(PTY.Mode.TERMINAL); } catch (IOException e) { // PTY not supported } } // Build up the command StringBuilder command = new StringBuilder(settings.getImage()); String arguments = settings.getArguments(); if (arguments != null && !"".equals(arguments.trim())) { //$NON-NLS-1$ // Append to the command now command.append(" "); //$NON-NLS-1$ command.append(arguments.trim()); } File workingDir =null; if (settings.getWorkingDir()!=null){ workingDir = new File(settings.getWorkingDir()); } String[] envp = null; if (settings.getEnvironment()!=null){ envp = settings.getEnvironment(); } if (pty != null) { // A PTY is available -> can use the ProcessFactory. // Tokenize the command (ProcessFactory takes an array) StreamTokenizer st = new StreamTokenizer(new StringReader(command.toString())); st.resetSyntax(); st.whitespaceChars(0, 32); st.whitespaceChars(0xa0, 0xa0); st.wordChars(33, 255); st.quoteChar('"'); st.quoteChar('\''); List<String> argv = new ArrayList<String>(); int ttype = st.nextToken(); while (ttype != StreamTokenizer.TT_EOF) { argv.add(st.sval); ttype = st.nextToken(); } // Execute the process process = ProcessFactory.getFactory().exec(argv.toArray(new String[argv.size()]), Env.getEnvironment(envp, true), workingDir, pty); } else { // No PTY -> just execute via the standard Java Runtime implementation. process = Runtime.getRuntime().exec(command.toString(), Env.getEnvironment(envp, false), workingDir); } } String lineSeparator = settings.getLineSeparator(); if (lineSeparator == null) { lineSeparator = System.getProperty("line.separator"); //$NON-NLS-1$ if ("\r".equals(lineSeparator)) { //$NON-NLS-1$ lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_CR; } else if ("\n".equals(lineSeparator)) { //$NON-NLS-1$ lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_LF; } else { lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_CRLF; } } // Setup the listeners setStdoutListeners(settings.getStdOutListeners()); setStderrListeners(settings.getStdErrListeners()); // connect the streams connectStreams(control, process.getOutputStream(), process.getInputStream(), (pty == null ? process.getErrorStream() : null), settings.isLocalEcho(), lineSeparator); // Set the terminal control state to CONNECTED control.setState(TerminalState.CONNECTED); // Create the process monitor monitor = new ProcessMonitor(this); monitor.startMonitoring(); } catch (IOException e) { // Disconnect right away disconnect(); // Lookup the tab item CTabItem item = ConsoleManager.getInstance().findConsole(control); if (item != null) item.dispose(); // Get the error message from the exception String msg = e.getLocalizedMessage() != null ? e.getLocalizedMessage() : ""; //$NON-NLS-1$ Assert.isNotNull(msg); // Strip away "Exec_tty error:" msg = msg.replace("Exec_tty error:", "").trim(); //$NON-NLS-1$ //$NON-NLS-2$ // Repackage into a more user friendly error msg = NLS.bind(Messages.ProcessConnector_error_creatingProcess, settings.getImage(), msg); // Create the status object IStatus status = new Status(IStatus.ERROR, UIPlugin.getUniqueIdentifier(), msg, e); StatusHandlerUtil.handleStatus(status, this, msg, Messages.ProcessConnector_error_title, IContextHelpIds.MESSAGE_CREATE_PROCESS_FAILED, this, null); } }
public void connect(ITerminalControl control) { Assert.isNotNull(control); super.connect(control); pty = null; width = -1; height = -1; try { // Try to determine process and PTY instance from the process settings process = settings.getProcess(); pty = settings.getPTY(); // No process -> create PTY on supported platforms and execute // process image. if (process == null) { if (PTY.isSupported(PTY.Mode.TERMINAL)) { try { pty = new PTY(PTY.Mode.TERMINAL); } catch (IOException e) { // PTY not supported } } // Build up the command StringBuilder command = new StringBuilder(settings.getImage()); String arguments = settings.getArguments(); if (arguments != null && !"".equals(arguments.trim())) { //$NON-NLS-1$ // Append to the command now command.append(" "); //$NON-NLS-1$ command.append(arguments.trim()); } File workingDir =null; if (settings.getWorkingDir()!=null){ workingDir = new File(settings.getWorkingDir()); } String[] envp = null; if (settings.getEnvironment()!=null){ envp = settings.getEnvironment(); } if (pty != null) { // A PTY is available -> can use the ProcessFactory. // Tokenize the command (ProcessFactory takes an array) StreamTokenizer st = new StreamTokenizer(new StringReader(command.toString())); st.resetSyntax(); st.whitespaceChars(0, 32); st.whitespaceChars(0xa0, 0xa0); st.wordChars(33, 255); st.quoteChar('"'); st.quoteChar('\''); List<String> argv = new ArrayList<String>(); int ttype = st.nextToken(); while (ttype != StreamTokenizer.TT_EOF) { argv.add(st.sval); ttype = st.nextToken(); } // Execute the process process = ProcessFactory.getFactory().exec(argv.toArray(new String[argv.size()]), Env.getEnvironment(envp, true), workingDir, pty); } else { // No PTY -> just execute via the standard Java Runtime implementation. process = Runtime.getRuntime().exec(command.toString(), Env.getEnvironment(envp, true), workingDir); } } String lineSeparator = settings.getLineSeparator(); if (lineSeparator == null) { lineSeparator = System.getProperty("line.separator"); //$NON-NLS-1$ if ("\r".equals(lineSeparator)) { //$NON-NLS-1$ lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_CR; } else if ("\n".equals(lineSeparator)) { //$NON-NLS-1$ lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_LF; } else { lineSeparator = ILineSeparatorConstants.LINE_SEPARATOR_CRLF; } } // Setup the listeners setStdoutListeners(settings.getStdOutListeners()); setStderrListeners(settings.getStdErrListeners()); // connect the streams connectStreams(control, process.getOutputStream(), process.getInputStream(), (pty == null ? process.getErrorStream() : null), settings.isLocalEcho(), lineSeparator); // Set the terminal control state to CONNECTED control.setState(TerminalState.CONNECTED); // Create the process monitor monitor = new ProcessMonitor(this); monitor.startMonitoring(); } catch (IOException e) { // Disconnect right away disconnect(); // Lookup the tab item CTabItem item = ConsoleManager.getInstance().findConsole(control); if (item != null) item.dispose(); // Get the error message from the exception String msg = e.getLocalizedMessage() != null ? e.getLocalizedMessage() : ""; //$NON-NLS-1$ Assert.isNotNull(msg); // Strip away "Exec_tty error:" msg = msg.replace("Exec_tty error:", "").trim(); //$NON-NLS-1$ //$NON-NLS-2$ // Repackage into a more user friendly error msg = NLS.bind(Messages.ProcessConnector_error_creatingProcess, settings.getImage(), msg); // Create the status object IStatus status = new Status(IStatus.ERROR, UIPlugin.getUniqueIdentifier(), msg, e); StatusHandlerUtil.handleStatus(status, this, msg, Messages.ProcessConnector_error_title, IContextHelpIds.MESSAGE_CREATE_PROCESS_FAILED, this, null); } }
diff --git a/org.eclipse.scout.rt.ui.rap/src/org/eclipse/scout/rt/ui/rap/ext/browser/BrowserExtension.java b/org.eclipse.scout.rt.ui.rap/src/org/eclipse/scout/rt/ui/rap/ext/browser/BrowserExtension.java index 5661808fcd..feabf9c7c7 100644 --- a/org.eclipse.scout.rt.ui.rap/src/org/eclipse/scout/rt/ui/rap/ext/browser/BrowserExtension.java +++ b/org.eclipse.scout.rt.ui.rap/src/org/eclipse/scout/rt/ui/rap/ext/browser/BrowserExtension.java @@ -1,254 +1,256 @@ /******************************************************************************* * Copyright (c) 2011 BSI Business Systems Integration AG. * All rights reserved. This program and the accompanying materials * are made available under the terms of the Eclipse Public License v1.0 * which accompanies this distribution, and is available at * http://www.eclipse.org/legal/epl-v10.html * * Contributors: * BSI Business Systems Integration AG - initial API and implementation *******************************************************************************/ package org.eclipse.scout.rt.ui.rap.ext.browser; import java.io.IOException; import java.io.InputStream; import java.lang.reflect.Constructor; import java.util.HashMap; import java.util.HashSet; import java.util.Map; import java.util.UUID; import java.util.regex.Matcher; import java.util.regex.Pattern; import javax.servlet.ServletException; import org.eclipse.rwt.RWT; import org.eclipse.rwt.lifecycle.UICallBack; import org.eclipse.rwt.resources.IResourceManager; import org.eclipse.rwt.resources.IResourceManager.RegisterOptions; import org.eclipse.rwt.service.IServiceHandler; import org.eclipse.scout.commons.logger.IScoutLogger; import org.eclipse.scout.commons.logger.ScoutLogManager; import org.eclipse.swt.browser.Browser; import org.eclipse.swt.browser.LocationEvent; /** * <h3>BrowserSupport</h3> adding hyperlink callback support as in normal swt to the rwt browser * <p> * Adding support for registering/unregistering (publishing) local resources. * * @author imo * @since 3.8.0 */ public class BrowserExtension { private static final IScoutLogger LOG = ScoutLogManager.getLogger(BrowserExtension.class); private static final Pattern LOCAL_URL_PATTERN = Pattern.compile("(['\"])(http://local[?/][^'\"]*)(['\"])", Pattern.CASE_INSENSITIVE | Pattern.DOTALL); private final Browser m_browser; private final HashMap<String, String> m_hyperlinkMap; private final String m_serviceHandlerId; private IServiceHandler m_serviceHandler; // private HashSet<String> m_tempFileNames = new HashSet<String>(); public BrowserExtension(Browser b) { m_browser = b; m_hyperlinkMap = new HashMap<String, String>(); m_serviceHandlerId = UUID.randomUUID().toString(); } /** * @return the unique {@link UUID} serviceHandlerId */ public String getServiceHandlerId() { return m_serviceHandlerId; } private String getUiCallbackId() { return getClass().getName() + "" + hashCode(); } public void attach() { if (m_serviceHandler == null) { UICallBack.activate(getUiCallbackId()); m_serviceHandler = new IServiceHandler() { @Override public void service() throws IOException, ServletException { String localUrl = m_hyperlinkMap.get(RWT.getRequest().getParameter("p")); if (localUrl == null) { return; } fireLocationChangedEvent(localUrl); } }; RWT.getServiceManager().registerServiceHandler(m_serviceHandlerId, m_serviceHandler); } } public void detach() { UICallBack.deactivate(getUiCallbackId()); clearLocalHyperlinkCache(); clearResourceCache(); if (m_serviceHandler != null) { m_serviceHandler = null; RWT.getServiceManager().unregisterServiceHandler(m_serviceHandlerId); } } /** * @return the web url of the resource valid for calls from outside */ public String addResource(String name, InputStream content) { return addResource(name, content, null, null); } /** * Adds a text resource that is encoded with the given <code>charset</code>. * <p> * By specifying an <code>option</code> other than <code>NONE</code> the resource will be versioned and/or compressed. * As compressing is only intended for resources that contain JavaScript, versioning might be useful for other * resources as well. When versioning is enabled a version number is appended to the resources' name which is derived * from its content. * </p> * <p> * * @param content * the content of the resource to add. * @param charset * the name of the charset which was used when the resource * was stored. If set to <code>null</code> neither charset nor options will be set. * @param options * an enumeration which specifies whether the resource will * be versioned and/or compressed. If set to <code>null</code> neither charset nor options will be set. * @return the web url of the resource valid for calls from outside */ public String addResource(String name, InputStream content, String charset, RegisterOptions options) { name = name.replaceAll("\\\\", "/"); if (name == null || name.length() == 0) { return null; } if (!name.startsWith("/")) { name = "/" + name; } String uniqueName = m_serviceHandlerId + name; m_tempFileNames.add(uniqueName); IResourceManager resourceManager = RWT.getResourceManager(); if (charset != null && options != null) { resourceManager.register(uniqueName, content, charset, options); } else { resourceManager.register(uniqueName, content); } return resourceManager.getLocation(uniqueName); } public void clearResourceCache() { IResourceManager resourceManager = RWT.getResourceManager(); try { for (String name : m_tempFileNames) { resourceManager.unregister(name); } } finally { m_tempFileNames.clear(); } } /** * @param html * replaces all http://local/... urls by a ajax callback with a {@link LocationEvent} in html text * @param childDepth * when the document is inside a iframe or thelike, then childDepth is 1, if it is in addition inside an * embed tag (such as svg), then childDepth is 2. */ public String adaptLocalHyperlinks(String html, int childDepth) { String p; if (childDepth <= 0) { p = "this"; } else { p = "parent"; for (int i = 1; i < childDepth; i++) { p = "parent." + p; } } return rewriteLocalHyperlinks(html, p, m_serviceHandlerId, m_hyperlinkMap); } public void clearLocalHyperlinkCache() { m_hyperlinkMap.clear(); } private void fireLocationChangedEvent(final String location) { m_browser.getDisplay().asyncExec(new Runnable() { @Override public void run() { try { Constructor<?> c = LocationEvent.class.getDeclaredConstructor(Object.class, int.class, String.class); c.setAccessible(true); //send changing LocationEvent event = (LocationEvent) c.newInstance(m_browser, LocationEvent.CHANGING, location); event.top = true; event.processEvent(); //send changed event = (LocationEvent) c.newInstance(m_browser, LocationEvent.CHANGED, location); event.top = true; event.processEvent(); } catch (Throwable t) { //nop } } }); } /** * Replace all href="http://local/... references in the html file and replace by an ajax call. * * @param html * @param rwtServiceHandler * is called with the parameter "p" containing the local url key to the generatedMapping * @param generatedMappings * is being filled up with the generated mappings * @return the rewritten html */ private static String rewriteLocalHyperlinks(String html, String ajaxParentContext, String rwtServiceHandler, Map<String /*externalKey*/, String /*url*/> generatedMappings) { if (html == null) { return html; } StringBuilder buf = new StringBuilder(); Matcher m = LOCAL_URL_PATTERN.matcher(html); int nextFind = 0; while (m.find(nextFind)) { String localUrl = m.group(2); String externalKey = "" + generatedMappings.size(); StringBuilder urlBuf = new StringBuilder(); urlBuf.append("?"); + urlBuf.append("nocache='+new Date().getTime()+'"); + urlBuf.append("&amp;"); urlBuf.append(IServiceHandler.REQUEST_PARAM); urlBuf.append("="); urlBuf.append(rwtServiceHandler); urlBuf.append("&amp;"); urlBuf.append("p"); urlBuf.append("="); urlBuf.append(externalKey); String encodedURL = RWT.getResponse().encodeURL(urlBuf.toString()); String callableURL = "javascript:a=" + ajaxParentContext + ".qx.net.HttpRequest.create();a.open('GET','" + encodedURL + "',true);a.send(null);"; buf.append(html.substring(nextFind, m.start())); buf.append(m.group(1)); buf.append(callableURL); buf.append(m.group(3)); //register generatedMappings.put(externalKey, localUrl); //next nextFind = m.end(); } if (nextFind == 0) { return html; } if (nextFind < html.length()) { buf.append(html.substring(nextFind)); } return buf.toString(); } }
true
true
private static String rewriteLocalHyperlinks(String html, String ajaxParentContext, String rwtServiceHandler, Map<String /*externalKey*/, String /*url*/> generatedMappings) { if (html == null) { return html; } StringBuilder buf = new StringBuilder(); Matcher m = LOCAL_URL_PATTERN.matcher(html); int nextFind = 0; while (m.find(nextFind)) { String localUrl = m.group(2); String externalKey = "" + generatedMappings.size(); StringBuilder urlBuf = new StringBuilder(); urlBuf.append("?"); urlBuf.append(IServiceHandler.REQUEST_PARAM); urlBuf.append("="); urlBuf.append(rwtServiceHandler); urlBuf.append("&amp;"); urlBuf.append("p"); urlBuf.append("="); urlBuf.append(externalKey); String encodedURL = RWT.getResponse().encodeURL(urlBuf.toString()); String callableURL = "javascript:a=" + ajaxParentContext + ".qx.net.HttpRequest.create();a.open('GET','" + encodedURL + "',true);a.send(null);"; buf.append(html.substring(nextFind, m.start())); buf.append(m.group(1)); buf.append(callableURL); buf.append(m.group(3)); //register generatedMappings.put(externalKey, localUrl); //next nextFind = m.end(); } if (nextFind == 0) { return html; } if (nextFind < html.length()) { buf.append(html.substring(nextFind)); } return buf.toString(); }
private static String rewriteLocalHyperlinks(String html, String ajaxParentContext, String rwtServiceHandler, Map<String /*externalKey*/, String /*url*/> generatedMappings) { if (html == null) { return html; } StringBuilder buf = new StringBuilder(); Matcher m = LOCAL_URL_PATTERN.matcher(html); int nextFind = 0; while (m.find(nextFind)) { String localUrl = m.group(2); String externalKey = "" + generatedMappings.size(); StringBuilder urlBuf = new StringBuilder(); urlBuf.append("?"); urlBuf.append("nocache='+new Date().getTime()+'"); urlBuf.append("&amp;"); urlBuf.append(IServiceHandler.REQUEST_PARAM); urlBuf.append("="); urlBuf.append(rwtServiceHandler); urlBuf.append("&amp;"); urlBuf.append("p"); urlBuf.append("="); urlBuf.append(externalKey); String encodedURL = RWT.getResponse().encodeURL(urlBuf.toString()); String callableURL = "javascript:a=" + ajaxParentContext + ".qx.net.HttpRequest.create();a.open('GET','" + encodedURL + "',true);a.send(null);"; buf.append(html.substring(nextFind, m.start())); buf.append(m.group(1)); buf.append(callableURL); buf.append(m.group(3)); //register generatedMappings.put(externalKey, localUrl); //next nextFind = m.end(); } if (nextFind == 0) { return html; } if (nextFind < html.length()) { buf.append(html.substring(nextFind)); } return buf.toString(); }
diff --git a/nuxeo-platform-categorization-service/src/main/java/org/nuxeo/ecm/platform/categorization/categorizer/tfidf/TfIdfCategorizerFactory.java b/nuxeo-platform-categorization-service/src/main/java/org/nuxeo/ecm/platform/categorization/categorizer/tfidf/TfIdfCategorizerFactory.java index 5ef0d9a..845a2cb 100644 --- a/nuxeo-platform-categorization-service/src/main/java/org/nuxeo/ecm/platform/categorization/categorizer/tfidf/TfIdfCategorizerFactory.java +++ b/nuxeo-platform-categorization-service/src/main/java/org/nuxeo/ecm/platform/categorization/categorizer/tfidf/TfIdfCategorizerFactory.java @@ -1,23 +1,23 @@ package org.nuxeo.ecm.platform.categorization.categorizer.tfidf; import java.io.IOException; import org.nuxeo.ecm.platform.categorization.service.Categorizer; import org.nuxeo.ecm.platform.categorization.service.CategorizerFactory; public class TfIdfCategorizerFactory implements CategorizerFactory { public Categorizer loadInstance(String modelFile, boolean readonly) throws IOException { try { TfIdfCategorizer categorizer = TfIdfCategorizer.load(modelFile); if (readonly) { categorizer.disableUpdate(); } return categorizer; } catch (ClassNotFoundException e) { - throw new IOException(e); + throw new IOException(e.getMessage()); } } }
true
true
public Categorizer loadInstance(String modelFile, boolean readonly) throws IOException { try { TfIdfCategorizer categorizer = TfIdfCategorizer.load(modelFile); if (readonly) { categorizer.disableUpdate(); } return categorizer; } catch (ClassNotFoundException e) { throw new IOException(e); } }
public Categorizer loadInstance(String modelFile, boolean readonly) throws IOException { try { TfIdfCategorizer categorizer = TfIdfCategorizer.load(modelFile); if (readonly) { categorizer.disableUpdate(); } return categorizer; } catch (ClassNotFoundException e) { throw new IOException(e.getMessage()); } }