Model Card for Mistral-DNA-v1-1M-hg38 (Mistral for DNA)

The Mistral-DNA-v1-1M-hg38 Large Language Model (LLM) is a pretrained generative DNA sequence model with 1M parameters. It is derived from Mixtral-8x7B-v0.1 model, which was simplified for DNA: the number of layers and the hidden size were reduced. The model was pretrained using 10kb DNA sequences from the hg38 human genome assembly.

Model Architecture

Like Mixtral-8x7B-v0.1, it is a transformer model, with the following architecture choices:

  • Grouped-Query Attention
  • Sliding-Window Attention
  • Byte-fallback BPE tokenizer
  • Mixture of Experts

Load the model from huggingface:

import torch
from transformers import AutoTokenizer, AutoModel

tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-1M-hg38", trust_remote_code=True) 
model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-1M-hg38", trust_remote_code=True)

Calculate the embedding of a protein sequence

dna = "TGATGATTGGCGCGGCTAGGATCGGCT"
inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"]
hidden_states = model(inputs)[0] # [1, sequence_length, 256]

# embedding with max pooling
embedding_max = torch.max(hidden_states[0], dim=0)[0]
print(embedding_max.shape) # expect to be 256

Troubleshooting

Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer.

Notice

Mistral-DNA-v1-1M-hg38 is a pretrained base model for DNA.

Contact

Raphaël Mourad. [email protected]

Downloads last month
21
Safetensors
Model size
986k params
Tensor type
BF16
·
Inference Providers NEW
This model is not currently available via any of the supported Inference Providers.
The model cannot be deployed to the HF Inference API: The model has no library tag.