Spaces:
Sleeping
Sleeping
| import argparse | |
| import os | |
| import gzip | |
| import pickle | |
| import numpy as np | |
| import pandas as pd | |
| import tensorflow as tf | |
| from Bio import SeqIO | |
| # column names | |
| ID_COL = 'Transcript ID' | |
| SEQ_COL = 'Transcript Sequence' | |
| TARGET_COL = 'Target Sequence' | |
| GUIDE_COL = 'Guide Sequence' | |
| MM_COL = 'Number of Mismatches' | |
| SCORE_COL = 'Guide Score' | |
| # nucleotide tokens | |
| NUCLEOTIDE_TOKENS = dict(zip(['A', 'C', 'G', 'T', 'N'], [0, 1, 2, 3, 255])) | |
| NUCLEOTIDE_COMPLEMENT = dict(zip(['A', 'C', 'G', 'T'], ['T', 'G', 'C', 'A'])) | |
| # model hyper-parameters | |
| GUIDE_LEN = 23 | |
| CONTEXT_5P = 3 | |
| CONTEXT_3P = 0 | |
| TARGET_LEN = CONTEXT_5P + GUIDE_LEN + CONTEXT_3P | |
| UNIT_INTERVAL_MAP = 'sigmoid' | |
| # reference transcript files | |
| REFERENCE_TRANSCRIPTS = ( | |
| 'gencode_v47_basic_protein_coding_transcripts.fa.gz', | |
| 'gencode_v47_basic_lncRNA_transcripts.fa.gz' | |
| ) | |
| # application configuration | |
| BATCH_SIZE_COMPUTE = 500 | |
| BATCH_SIZE_SCAN = 20 | |
| BATCH_SIZE_TRANSCRIPTS = 50 | |
| NUM_TOP_GUIDES = 10 | |
| NUM_MISMATCHES = 3 | |
| RUN_MODES = dict( | |
| all='All on-target guides per transcript', | |
| top_guides='Top {:d} guides per transcript'.format(NUM_TOP_GUIDES), | |
| titration='Top {:d} guides per transcript & their titration candidates'.format(NUM_TOP_GUIDES) | |
| ) | |
| # configure GPUs | |
| for gpu in tf.config.list_physical_devices('GPU'): | |
| tf.config.experimental.set_memory_growth(gpu, enable=True) | |
| if len(tf.config.list_physical_devices('GPU')) > 0: | |
| tf.config.experimental.set_visible_devices(tf.config.list_physical_devices('GPU')[0], 'GPU') | |
| def load_transcripts(fasta_files: list, enforce_unique_ids: bool = True): | |
| # load all transcripts from fasta files into a DataFrame | |
| transcripts = pd.DataFrame() | |
| for file in fasta_files: | |
| try: | |
| if os.path.splitext(file)[1] == '.gz': | |
| with gzip.open(file, 'rt') as f: | |
| df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(f, 'fasta')], columns=[ID_COL, SEQ_COL]) | |
| else: | |
| df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(file, 'fasta')], columns=[ID_COL, SEQ_COL]) | |
| except Exception as e: | |
| print(e, 'while loading', file) | |
| continue | |
| transcripts = pd.concat([transcripts, df]) | |
| # set index | |
| transcripts[ID_COL] = transcripts[ID_COL].apply(lambda s: s.split('|')[0]) | |
| transcripts.set_index(ID_COL, inplace=True) | |
| if enforce_unique_ids: | |
| assert not transcripts.index.has_duplicates, "duplicate transcript ID's detected in fasta file" | |
| return transcripts | |
| def sequence_complement(sequence: list): | |
| return [''.join([NUCLEOTIDE_COMPLEMENT[nt] for nt in list(seq)]) for seq in sequence] | |
| def one_hot_encode_sequence(sequence: list, add_context_padding: bool = False): | |
| # stack list of sequences into a tensor | |
| sequence = tf.ragged.stack([tf.constant(list(seq)) for seq in sequence], axis=0) | |
| # tokenize sequence | |
| nucleotide_table = tf.lookup.StaticVocabularyTable( | |
| initializer=tf.lookup.KeyValueTensorInitializer( | |
| keys=tf.constant(list(NUCLEOTIDE_TOKENS.keys()), dtype=tf.string), | |
| values=tf.constant(list(NUCLEOTIDE_TOKENS.values()), dtype=tf.int64)), | |
| num_oov_buckets=1) | |
| sequence = tf.RaggedTensor.from_row_splits(values=nucleotide_table.lookup(sequence.values), | |
| row_splits=sequence.row_splits).to_tensor(255) | |
| # add context padding if requested | |
| if add_context_padding: | |
| pad_5p = 255 * tf.ones([sequence.shape[0], CONTEXT_5P], dtype=sequence.dtype) | |
| pad_3p = 255 * tf.ones([sequence.shape[0], CONTEXT_3P], dtype=sequence.dtype) | |
| sequence = tf.concat([pad_5p, sequence, pad_3p], axis=1) | |
| # one-hot encode | |
| sequence = tf.one_hot(sequence, depth=4, dtype=tf.float16) | |
| return sequence | |
| def process_data(transcript_seq: str): | |
| # convert to upper case | |
| transcript_seq = transcript_seq.upper() | |
| # get all target sites | |
| target_seq = [transcript_seq[i: i + TARGET_LEN] for i in range(len(transcript_seq) - TARGET_LEN + 1)] | |
| # prepare guide sequences | |
| guide_seq = sequence_complement([seq[CONTEXT_5P:len(seq) - CONTEXT_3P] for seq in target_seq]) | |
| # model inputs | |
| model_inputs = tf.concat([ | |
| tf.reshape(one_hot_encode_sequence(target_seq, add_context_padding=False), [len(target_seq), -1]), | |
| tf.reshape(one_hot_encode_sequence(guide_seq, add_context_padding=True), [len(guide_seq), -1]), | |
| ], axis=-1) | |
| return target_seq, guide_seq, model_inputs | |
| def calibrate_predictions(predictions: np.array, num_mismatches: np.array, params: pd.DataFrame = None): | |
| if params is None: | |
| params = pd.read_pickle('calibration_params.pkl') | |
| correction = np.squeeze(params.set_index('num_mismatches').loc[num_mismatches, 'slope'].to_numpy()) | |
| return correction * predictions | |
| def score_predictions(predictions: np.array, params: pd.DataFrame = None): | |
| if params is None: | |
| params = pd.read_pickle('scoring_params.pkl') | |
| if UNIT_INTERVAL_MAP == 'sigmoid': | |
| params = params.iloc[0] | |
| return 1 - 1 / (1 + np.exp(params['a'] * predictions + params['b'])) | |
| elif UNIT_INTERVAL_MAP == 'min-max': | |
| return 1 - (predictions - params['a']) / (params['b'] - params['a']) | |
| elif UNIT_INTERVAL_MAP == 'exp-lin-exp': | |
| # regime indices | |
| active_saturation = predictions < params['a'] | |
| linear_regime = (params['a'] <= predictions) & (predictions <= params['c']) | |
| inactive_saturation = params['c'] < predictions | |
| # linear regime | |
| slope = (params['d'] - params['b']) / (params['c'] - params['a']) | |
| intercept = -params['a'] * slope + params['b'] | |
| predictions[linear_regime] = slope * predictions[linear_regime] + intercept | |
| # active saturation regime | |
| alpha = slope / params['b'] | |
| beta = alpha * params['a'] - np.log(params['b']) | |
| predictions[active_saturation] = np.exp(alpha * predictions[active_saturation] - beta) | |
| # inactive saturation regime | |
| alpha = slope / (1 - params['d']) | |
| beta = -alpha * params['c'] - np.log(1 - params['d']) | |
| predictions[inactive_saturation] = 1 - np.exp(-alpha * predictions[inactive_saturation] - beta) | |
| return 1 - predictions | |
| else: | |
| raise NotImplementedError | |
| def get_on_target_predictions(transcripts: pd.DataFrame, model: tf.keras.Model, status_update_fn=None): | |
| # loop over transcripts | |
| predictions = pd.DataFrame() | |
| for i, (index, row) in enumerate(transcripts.iterrows()): | |
| # parse transcript sequence | |
| target_seq, guide_seq, model_inputs = process_data(row[SEQ_COL]) | |
| # get predictions | |
| lfc_estimate = model.predict(model_inputs, batch_size=BATCH_SIZE_COMPUTE, verbose=False)[:, 0] | |
| lfc_estimate = calibrate_predictions(lfc_estimate, num_mismatches=np.zeros_like(lfc_estimate)) | |
| scores = score_predictions(lfc_estimate) | |
| predictions = pd.concat([predictions, pd.DataFrame({ | |
| ID_COL: [index] * len(scores), | |
| TARGET_COL: target_seq, | |
| GUIDE_COL: guide_seq, | |
| SCORE_COL: scores})]) | |
| # progress update | |
| percent_complete = 100 * min((i + 1) / len(transcripts), 1) | |
| update_text = 'Evaluating on-target guides for each transcript: {:.2f}%'.format(percent_complete) | |
| print('\r' + update_text, end='') | |
| if status_update_fn is not None: | |
| status_update_fn(update_text, percent_complete) | |
| print('') | |
| return predictions | |
| def top_guides_per_transcript(predictions: pd.DataFrame): | |
| # select and sort top guides for each transcript | |
| top_guides = pd.DataFrame() | |
| for transcript in predictions[ID_COL].unique(): | |
| df = predictions.loc[predictions[ID_COL] == transcript] | |
| df = df.sort_values(SCORE_COL, ascending=False).reset_index(drop=True).iloc[:NUM_TOP_GUIDES] | |
| top_guides = pd.concat([top_guides, df]) | |
| return top_guides.reset_index(drop=True) | |
| def get_titration_candidates(top_guide_predictions: pd.DataFrame): | |
| # generate a table of all titration candidates | |
| titration_candidates = pd.DataFrame() | |
| for _, row in top_guide_predictions.iterrows(): | |
| for i in range(len(row[GUIDE_COL])): | |
| nt = row[GUIDE_COL][i] | |
| for mutation in set(NUCLEOTIDE_TOKENS.keys()) - {nt, 'N'}: | |
| sm_guide = list(row[GUIDE_COL]) | |
| sm_guide[i] = mutation | |
| sm_guide = ''.join(sm_guide) | |
| assert row[GUIDE_COL] != sm_guide | |
| titration_candidates = pd.concat([titration_candidates, pd.DataFrame({ | |
| ID_COL: [row[ID_COL]], | |
| TARGET_COL: [row[TARGET_COL]], | |
| GUIDE_COL: [sm_guide], | |
| MM_COL: [1] | |
| })]) | |
| return titration_candidates | |
| def find_off_targets(top_guides: pd.DataFrame, status_update_fn=None): | |
| # load reference transcripts | |
| reference_transcripts = load_transcripts([os.path.join('transcripts', f) for f in REFERENCE_TRANSCRIPTS]) | |
| # one-hot encode guides to form a filter | |
| guide_filter = one_hot_encode_sequence(sequence_complement(top_guides[GUIDE_COL]), add_context_padding=False) | |
| guide_filter = tf.transpose(guide_filter, [1, 2, 0]) | |
| # loop over transcripts in batches | |
| i = 0 | |
| off_targets = pd.DataFrame() | |
| while i < len(reference_transcripts): | |
| # select batch | |
| df_batch = reference_transcripts.iloc[i:min(i + BATCH_SIZE_SCAN, len(reference_transcripts))] | |
| i += BATCH_SIZE_SCAN | |
| # find locations of off-targets | |
| transcripts = one_hot_encode_sequence(df_batch[SEQ_COL].values.tolist(), add_context_padding=False) | |
| num_mismatches = GUIDE_LEN - tf.nn.conv1d(transcripts, guide_filter, stride=1, padding='SAME') | |
| loc_off_targets = tf.where(tf.round(num_mismatches) <= NUM_MISMATCHES).numpy() | |
| # off-targets discovered | |
| if len(loc_off_targets) > 0: | |
| # log off-targets | |
| dict_off_targets = pd.DataFrame({ | |
| 'On-target ' + ID_COL: top_guides.iloc[loc_off_targets[:, 2]][ID_COL], | |
| GUIDE_COL: top_guides.iloc[loc_off_targets[:, 2]][GUIDE_COL], | |
| 'Off-target ' + ID_COL: df_batch.index.values[loc_off_targets[:, 0]], | |
| 'Guide Midpoint': loc_off_targets[:, 1], | |
| SEQ_COL: df_batch[SEQ_COL].values[loc_off_targets[:, 0]], | |
| MM_COL: tf.gather_nd(num_mismatches, loc_off_targets).numpy().astype(int), | |
| }).to_dict('records') | |
| # trim transcripts to targets | |
| for row in dict_off_targets: | |
| start_location = row['Guide Midpoint'] - (GUIDE_LEN // 2) | |
| del row['Guide Midpoint'] | |
| target = row[SEQ_COL] | |
| del row[SEQ_COL] | |
| if start_location < CONTEXT_5P: | |
| target = target[0:GUIDE_LEN + CONTEXT_3P] | |
| target = 'N' * (TARGET_LEN - len(target)) + target | |
| elif start_location + GUIDE_LEN + CONTEXT_3P > len(target): | |
| target = target[start_location - CONTEXT_5P:] | |
| target = target + 'N' * (TARGET_LEN - len(target)) | |
| else: | |
| target = target[start_location - CONTEXT_5P:start_location + GUIDE_LEN + CONTEXT_3P] | |
| if row[MM_COL] == 0 and 'N' not in target: | |
| assert row[GUIDE_COL] == sequence_complement([target[CONTEXT_5P:TARGET_LEN - CONTEXT_3P]])[0] | |
| row[TARGET_COL] = target | |
| # append new off-targets | |
| off_targets = pd.concat([off_targets, pd.DataFrame(dict_off_targets)]) | |
| # progress update | |
| percent_complete = 100 * min((i + 1) / len(reference_transcripts), 1) | |
| update_text = 'Scanning for off-targets: {:.2f}%'.format(percent_complete) | |
| print('\r' + update_text, end='') | |
| if status_update_fn is not None: | |
| status_update_fn(update_text, percent_complete) | |
| print('') | |
| return off_targets | |
| def predict_off_target(off_targets: pd.DataFrame, model: tf.keras.Model): | |
| if len(off_targets) == 0: | |
| return pd.DataFrame() | |
| # compute off-target predictions | |
| model_inputs = tf.concat([ | |
| tf.reshape(one_hot_encode_sequence(off_targets[TARGET_COL], add_context_padding=False), [len(off_targets), -1]), | |
| tf.reshape(one_hot_encode_sequence(off_targets[GUIDE_COL], add_context_padding=True), [len(off_targets), -1]), | |
| ], axis=-1) | |
| lfc_estimate = model.predict(model_inputs, batch_size=BATCH_SIZE_COMPUTE, verbose=False)[:, 0] | |
| lfc_estimate = calibrate_predictions(lfc_estimate, off_targets['Number of Mismatches'].to_numpy()) | |
| off_targets[SCORE_COL] = score_predictions(lfc_estimate) | |
| return off_targets.reset_index(drop=True) | |
| def tiger_exhibit(transcripts: pd.DataFrame, mode: str, check_off_targets: bool, status_update_fn=None): | |
| # load model | |
| if os.path.exists('model'): | |
| tiger = tf.keras.models.load_model('model') | |
| else: | |
| print('no saved model!') | |
| exit() | |
| # evaluate all on-target guides per transcript | |
| on_target_predictions = get_on_target_predictions(transcripts, tiger, status_update_fn) | |
| # initialize other outputs | |
| titration_predictions = off_target_predictions = None | |
| if mode == 'all' and not check_off_targets: | |
| off_target_candidates = None | |
| elif mode == 'top_guides': | |
| on_target_predictions = top_guides_per_transcript(on_target_predictions) | |
| off_target_candidates = on_target_predictions | |
| elif mode == 'titration': | |
| on_target_predictions = top_guides_per_transcript(on_target_predictions) | |
| titration_candidates = get_titration_candidates(on_target_predictions) | |
| titration_predictions = predict_off_target(titration_candidates, model=tiger) | |
| off_target_candidates = pd.concat([on_target_predictions, titration_predictions]) | |
| else: | |
| raise NotImplementedError | |
| # check off-target effects for top guides | |
| if check_off_targets and off_target_candidates is not None: | |
| off_target_candidates = find_off_targets(off_target_candidates, status_update_fn) | |
| off_target_predictions = predict_off_target(off_target_candidates, model=tiger) | |
| if len(off_target_predictions) > 0: | |
| off_target_predictions = off_target_predictions.sort_values(SCORE_COL, ascending=False) | |
| off_target_predictions = off_target_predictions.reset_index(drop=True) | |
| # finalize tables | |
| for df in [on_target_predictions, titration_predictions, off_target_predictions]: | |
| if df is not None and len(df) > 0: | |
| for col in df.columns: | |
| if ID_COL in col and set(df[col].unique()) == {'ManualEntry'}: | |
| del df[col] | |
| df[GUIDE_COL] = df[GUIDE_COL].apply(lambda s: s[::-1]) # reverse guide sequences | |
| df[TARGET_COL] = df[TARGET_COL].apply(lambda seq: seq[CONTEXT_5P:len(seq) - CONTEXT_3P]) # remove context | |
| return on_target_predictions, titration_predictions, off_target_predictions | |
| if __name__ == '__main__': | |
| # common arguments | |
| parser = argparse.ArgumentParser() | |
| parser.add_argument('--mode', type=str, default='titration') | |
| parser.add_argument('--check_off_targets', action='store_true', default=False) | |
| parser.add_argument('--fasta_path', type=str, default=None) | |
| args = parser.parse_args() | |
| # check for any existing results | |
| if os.path.exists('on_target.csv') or os.path.exists('titration.csv') or os.path.exists('off_target.csv'): | |
| raise FileExistsError('please rename or delete existing results') | |
| # load transcripts from a directory of fasta files | |
| if args.fasta_path is not None and os.path.exists(args.fasta_path): | |
| df_transcripts = load_transcripts([os.path.join(args.fasta_path, f) for f in os.listdir(args.fasta_path)]) | |
| # otherwise consider simple test case with first 50 nucleotides from EIF3B-003's CDS | |
| else: | |
| df_transcripts = pd.DataFrame({ | |
| ID_COL: ['ManualEntry'], | |
| SEQ_COL: ['ATGCAGGACGCGGAGAACGTGGCGGTGCCCGAGGCGGCCGAGGAGCGCGC']}) | |
| df_transcripts.set_index(ID_COL, inplace=True) | |
| # process in batches | |
| batch = 0 | |
| num_batches = len(df_transcripts) // BATCH_SIZE_TRANSCRIPTS | |
| num_batches += (len(df_transcripts) % BATCH_SIZE_TRANSCRIPTS > 0) | |
| for idx in range(0, len(df_transcripts), BATCH_SIZE_TRANSCRIPTS): | |
| batch += 1 | |
| print('Batch {:d} of {:d}'.format(batch, num_batches)) | |
| # run batch | |
| idx_stop = min(idx + BATCH_SIZE_TRANSCRIPTS, len(df_transcripts)) | |
| df_on_target, df_titration, df_off_target = tiger_exhibit( | |
| transcripts=df_transcripts[idx:idx_stop], | |
| mode=args.mode, | |
| check_off_targets=args.check_off_targets | |
| ) | |
| # save batch results | |
| df_on_target.to_csv('on_target.csv', header=batch == 1, index=False, mode='a') | |
| if df_titration is not None: | |
| df_titration.to_csv('titration.csv', header=batch == 1, index=False, mode='a') | |
| if df_off_target is not None: | |
| df_off_target.to_csv('off_target.csv', header=batch == 1, index=False, mode='a') | |
| # clear session to prevent memory blow up | |
| tf.keras.backend.clear_session() | |