text
stringlengths 746
31k
|
|---|
This is the case of a 30 years old man. He presents with a chronic ulcer on the right internal malleolus. This lesion is very painful and productive. He has been trying local treatment for 2 years without any change. In his history, we note a bullet wound in his right leg in 2014 which was treated by external fixator, then an osteosynthesis by plate. In 2018, after an ultrasound proving there was a venous insufficiency of his right external saphenous vein, the patient benefitted from a right external saphenous vein crossectomy. After that, he developed headaches, leg swelling with pitting edema and no improvement in the wound. When we saw him for the first time, he continued to have significant pain despite first grade painkillers. We can notice a right internal malleolus wound, a swollen and indurated right leg. At first, we prescribed second level painkillers and we asked for an ultrasound for deep vein thrombosis. The ultrasound was normal. At the second consultation, we re-examined the patient and the wound is stable, but we palpated a thrill in the saphenous vein. This sign is present in the arteriovenous fistula. We requested a CT scan of the lower limbs (). This confirms our hypothesis. There is a subarticular posterior tibial arteriovenous fistula that supplies the superficial and deep venous network of the right leg. Due to the presence of osteosynthesis material obstructing clear view of the arteriovenous fistula, we decided to perform an arteriography which confirms the arteriovenous fistula coming from the right posterior tibial artery ().\nTherefore, in view of the position of the fistula, it seemed reasonable to us to carry out and embolization. We decided to discuss this patient with the interventional radiologists because in Belgium, it is these doctors who perform the embolizations. We decided to embolize the right posterior tibial artery in this young patient. The patient arrives the morning of the operation and stays over-night for monitoring. If all goes well, he can leave the hospital. The procedure is done under local or general anesthesia depending on the patient’s condition and the patient’s wishes. We used Nester® Embolization Coils 0.018 with an immediate satisfactory result (). The patient was discharged without complications. At one month, at his visit to the outpatients department, we noted the start of a healing process of the ulcer (). Thereafter, we continued to see him every three months until the wound healed completely. |
A 40-year-old primiparous female presented to a primary care clinic to establish care with a chief complaint of bilateral breast ulcers. Her symptoms started 2 months previously, as bilateral breast pain and progressive peri-areolar erythema extending laterally. At the time she was evaluated with a bilateral breast ultrasound in an emergency department, which was negative for abscess or fluid collections. She was given a 5-day course of cephalexin for presumed mastitis and provided a referral for follow-up with a breast surgeon. She was referred back to the hospital by surgery 1 week later due to persistent symptoms at which time she was started on intravenous vancomycin and was discharged 2 days later on a 14-day course of oral linezolid. Her symptoms continued to progress and included severe breast pain, bilateral subcutaneous lumps, and interval development of bilateral ulcerations, which resulted in a second hospitalization 6 weeks later. At the time, laboratory studies showed mild anemia, elevated erythrocyte sedimentation rate, and markedly elevated thyroid stimulating hormone at 74.90 µIU/mL. The left breast ulcer was selected for CNB as this lesion was open at the time. Pathology revealed dense fibrotic breast tissue with no features of malignancy (). A breast magnetic resonance imaging showed bilateral inflammatory changes and band-like focal edema at the 12 o’clock position of the right breast (). Wound cultures returned negative. The patient was monitored off antibiotics and treated with local wound care and pain control. Her levothyroxine dose was adjusted, and she was discharged with follow-up arranged for surgery and primary care. The patient established in the outpatient internal medicine clinic 2 weeks after discharge resulting in the current evaluation.\nHer past medical history was significant for papillary thyroid carcinoma status post subtotal thyroidectomy with postoperative radioiodine ablation performed in the United Kingdom 2 years prior to presentation, iatrogenic hypothyroidism, secondary amenorrhea, prior alcohol abuse with cirrhosis, and medical nonadherence. She had a prolonged hospital stay for myxedema coma occurring 3 months prior to the onset of her breast symptoms. She required intensive care unit admission for acute respiratory failure, hypothermia, metabolic acidosis, and acute renal failure. At the time her thyroid stimulating hormone was 136.00 µIU/mL and free T4 0.027 ng/dL. She required intubation and mechanical ventilation due to high metabolic demand and respiratory rate, and she was started on intravenous thyroid hormone replacement. Fortunately, the patient had a full recovery. The patient is adopted and was not aware of her family history. Her medications included levothyroxine 100 µg daily, ibuprofen 400 mg every 8 hours as needed, and lactulose 15 mL twice daily.\nIn the clinic, she complained of worsening breast pain, progressive lesions that have scabbed over, and scant discharge (). She denied any fever, chills, or trauma to the breasts. No nipple inversion or nipple discharge. She also complained of amenorrhea with her last menstrual period 8 months prior to presentation. On physical examination, the patient was afebrile and well-appearing. There was a 5 × 3 cm nonpurulent, peri-areolar ulcerative lesion of the right breast at the 9 o’clock position and a 3 × 3 cm nonpurulent, peri-areolar ulcerative lesion of the left breast at the 4 o’clock position. There was an eschar formation with macerated tissue underneath. No crepitus, erythema, or other surrounding skin changes were appreciated. Incidentally, there were 3 enlarged right posterior cervical lymph nodes found. The rest of the physical examination was unremarkable. Laboratory studies were as shown in and .\nAfter review of her disease course, bilateral involvement, negative biopsies and cultures, and lack of improvement with empiric antibiotics, she was diagnosed with presumed idiopathic granulomatous mastitis. She was started on a prolonged course of prednisone 20 mg daily in addition to wound care with zinc oxide bandages daily. Pantoprazole 40 mg daily was added for gastrointestinal protection. She was later prescribed a 10-day course of doxycycline due to worsening green-yellow discharge of the right breast and referred to rheumatology for consideration for escalation of immunosuppressive therapy. Her levothyroxine dose was increased, and thyroid function tests and elevated prolactin levels were continuously monitored to normalization ( and ). |
A 57-year-old woman presented to our clinic with a painful left breast mass (). The mass started to appear six months previously and gradually increased in size to become painful and tense, but without discharge from the nipple.\nHer past medical history revealed she had been diagnosed with esophagus carcinoma one year ago (), but she had refused any kind of treatment back then. Review of her other symptoms showed that the dysphagia associating the esophagus cancer had increased gradually during the last year until it became impossible for her to swallow any solid food during the last month, and she had lost 25 kg during the previous four months.\nThe patient was severely malnourished, her BMI was 14 kg/m2, and her vital signs were as follows: Bp: 100/55 mm/Hg; pulse: 130 beats per minute; temperature: 99.5 F; RR: 22 breath per minute; she was alert and oriented but looked tired. The examination showed a fixed 9 × 10 × 7 cm painful hard mass involving the left breast. The skin over the mass was red but not hot and the rest of the examination including the lymphatic system was unremarkable except a noticeable wheezing in the right chest.\nThe blood tests were normal except for a decrease in TP and ALB and a mild decrease in calcium. The head, chest, and abdominal CT scan showed a 4 × 6 × 7 cm lobulated mass involving the lower third of the esophagus accompanied with a large (10 × 9.5 × 8 cm) lobulated (with necrotic component) mass involving the left breast, the left chest muscles, and the pleura; this mass is compressing the anterior face of the lung and destroying the accompanied ribs (); the CT scan showed as well left and right pleural effusions without any other obvious metastasis.\nReview of her medical history revealed moderately differentiated squamous cell carcinoma of the mid-lower third of the esophagus. The breast biopsy showed solid cords, sheets, and lobules of pleomorphic malignant epithelial cells with occasional bizarre, hyperchromic nuclei with occasional keratin pearls compatible with poorly differentiated squamous cell carcinoma (Figures and ). The pleural effusion examination was negative for malignancy.\nFeeding tube gastrostomy was done to the patient; however, she passed away two months later. |
A 32-year-old, previously healthy, African American man presented to an emergency department 45 minutes after the acute onset of left facial droop and right-sided weakness (Fig. ). A thorough history confirmed an episode 1-week prior, during which he developed sudden onset of dizziness associated with nausea and vomiting that resolved within hours. He denied any past medical or surgical history and was taking no medications. He has no family history of tumors. In the emergency room, his vital signs were within normal limits. His physical examination was significant for a left facial droop and right hemiparesis. Auscultation of his chest revealed a regular rate and rhythm with no appreciable murmur. No additional significant findings were noted. Stroke protocol was initiated. A chest X-ray was normal and an electrocardiogram showed normal sinus rhythm. A head computed tomography (CT) scan was negative for signs of intracranial hemorrhage. He was subsequently started on tissue plasminogen activator (tPA) therapy. Magnetic resonance imaging (MRI) of his brain demonstrated a right basal ganglia infarct and an old left cerebral infarct. A carotid ultrasound was negative. TTE demonstrated a 1 cm by 1 cm mass on the posterior leaflet of the mitral valve with a moderate mitral regurgitation In addition, TTE revealed a questionable mass on the left coronary cusp of the aortic valve. These findings were confirmed with TEE (Fig. ), which verified no sign of endocarditis and no atrial septal defect. A complete hypercoagulable workup was negative. Stroke protocol continued with the working diagnosis of cerebrovascular accident secondary to emboli from the mitral valve mass. Within 24 hours, he regained function of the right side of his body and had complete resolution of symptoms. He was diagnosed as having transient ischemic attack (TIA) and discussion was undertaken regarding surgical excision of his mitral valve mass.\nA median sternotomy was performed and cardiopulmonary bypass was employed via aortic and bicaval cannulation with full anticoagulation. His aorta was cross-clamped and his heart arrested with retrograde cardioplegia. The aortic valve was examined through an ascending aortotomy and all three valve leaflets appeared normal. A left atriotomy was made and the mass was easily identified on the posterior mitral valve leaflet adjacent to the mitral valve annulus (Fig. ). The mass was excised and a frozen section confirmed globular myxoma cells with abundant eosinophilic cytoplasm consistent with myxoma. The valve leaflet was reconstructed with an autologous pericardium patch and the annulus was supported using a running DeVega-type suture. The valve appeared normal and was tested; no regurgitation was noted. His left atrium and aorta were closed. His aorta was unclamped, after aggressive venting and de-airing maneuvers, and his heart returned to normal sinus rhythm with successful weaning from cardiopulmonary bypass. Anticoagulation was reversed with protamine and his chest was closed after placement of drains and pacing wires. At the conclusion of the operation, TEE confirmed appropriate mitral valve function and normal aortic valve with no evidence of a mass and no regurgitation at either location. |
A 67 year old man of Greek origin attended the emergency department with a two hour history of dull central chest pain that radiated into his back. There were no other symptoms and he was normally in good health. Examination and investigations (chest radiography, ECG, full blood count, and biochemistry screen) were thought to be normal. His pain subsided apart from some discomfort on swallowing and he was discharged home. She re-attended the department six days later. He complained that he had been cycling up a hill and had developed severe chest pain radiating into his jaw together with some sweating. Moreover, the discomfort of which he had previously complained had persisted. On examination he had a pulse of 98 per minute, BP 142/72 mm Hg, SaO2 97% on air and temperature 37.5°C. There were no cardiovascular or abdominal signs. There was no surgical emphysema in the supraclavicular fossae. On examination of the chest breath sounds were equal bilaterally for the upper lung fields, but absent for the right lower lung lobe. Chest x-ray confirmed the findings of physical examination and demonstrated right pleural effusion, but no radio-opacity was detected and there was no evidence of pneumomediastinum or subcutaneous emphysema (Figure ). At this point, a small amount of free air in the right hemithorax was overlooked and the patient admitted to the hospital with the diagnosis questioned for a basal pulmonary pathology.\nBecause of an erroneous belief that pulmonary complication was the cause of this specific clinical picture, the diagnosis of esophageal perforation was not suspected. The original diagnosis of esophageal perforation was delayed because of misinterpretation of right pleural effusion as a basal pulmonary pathology. Finally, three days after admission clinical deterioration with increased respiratory distress and discomfort, fever and chest pain did arouse suspicion of an esophageal perforation. At this point with a thoroughly history taken, the patient admitted to having had eating fish 12 days ago and the pain begun a few days after (he was attending to Emergency Department three days after), although he had not knowingly swallowed a fish bone.\nThe investigations were repeated and he now had a raised white cell count (16.3 × 103/ml with a neutrophilia) (reference range, 3.9-10.7 × 103/ml), a somewhat lower haemoglobin concentration (12.8 g/dl previously 14.6 g/dl) and an increased C reactive protein concentration (46 mg/l previously <8 mg/l). The ECG was normal. By this time, the pain was pleuritic and gradually become unbearable. Accordingly, he was given analgesia and high dose intravenous antibiotics. The patient underwent a complementary evaluation, with esophagogram, chest x-ray, and contrast enhanced CT scan tomography revealing a right-sided, distal esophageal rupture, with the coexistence of ipsilateral hydropneumothorax.\nA subsequent hypaque swallow study failed to demonstrate extravasation of contrast medium (Figure ). Erect chest x-ray a few hours later demonstrated contrast medium extravasation accompanied with large pleural effusion (Figure ). Subsequent CT scan demonstrated right sided pneumothorax, extended right sided pleural effusion and a small amount of air in the mediastinum (Figure ).\nFurthermore, a confirmative esophagogastroduodenoscopy revealed a small distal esophageal perforation (Figure ). Fasting was implemented. However, fever subsequently developed (maximum temperature, 38.9°C). The white blood cell count was 19.0 × 103/ml. The patient was treated conservatively with intravenous cefuroxime (750 mg every 8 hours), ampicillin (500 mg every 8 hours), and metronidazole (500 mg every 8 hours) to cover the oral bacterial flora.\nA large thoracostomy tube (32 gauge) was immediately placed in close proximity to the rupture site for pleural effusion drainage and the patient was transferred to our surgical unit promptly. A covered self-expanding metallic stent (Ultraflex, Boston Scientific) was inserted endoscopically, across the tear site to prevent ongoing local infection (Figure ). Oral fluid intake was allowed in increasing amounts and viscosity. Fever decreased rapidly to approximately 38°C and subsided after 2 days. The patient's condition improved and 1 week later there was no leak demonstrated by contrast radiography.\nThe intravenous antibiotics treatment was discontinued after 5 days, and right-sided chest drain was removed on the 7th day. He recuperated uneventfully and was discharged home 8 days later. The metal stent was removed endoscopically 4 weeks later. Because the stent crossed the lower esophageal sphincter, for the entire treatment time, a high dose of proton pump inhibitors was administered to reduce gastroesophageal reflux. Follow up 3 months after discharge showed the patient to be recovering with no complains (Figure ). |
A 59-year old Afrocaribbean lady was recently referred to our hospital following confirmation of screen detected left breast cancer. As the lesion was only just palpable, the patient had undergone an image guided biopsy of the radiological abnormality at the host screening centre. Histological assessment of the breast biopsy confirmed invasive ductal carcinoma (IDC). The patient’s case was discussed at a multidisciplinary team (MDT) meeting with review of breast imaging which confirmed the presence of a highly suspicious density in the upper outer quadrant of the left breast (Figure ), compatible with the site of the known IDC. The agreed plan was for the patient to undergo a wide local excision of the left breast lesion and sentinel lymph node biopsy. Moreover, it was agreed that she would also require a pre-operative ultrasound-guided skin marking on the morning of surgery in order to guide the extent of the breast resection.\nShe arrived on the morning of her operation and as per hospital protocol was taken to the admissions area for routine checks and observations by the nursing staff as well as to facilitate the consenting process by the surgical team. She was the first patient on the afternoon operating list. The surgical registrar went to see the patient, confirmed the clinical history, imaging findings, histopathological results and MDT recommendations. The patient was informed of the risks and benefits of the proposed procedure as well as the need for image-guided skin marking to assist resectional surgery and it was explained that this would occur prior to her being transferred to the operating theatre. The patient appeared to understand the process, the risks and benefits and duly signed the consent form. The registrar went to the breast imaging department to ensure that the radiologists were expecting the patient for an ultrasound scan. Prior to leaving for the imaging department the registrar explained to the sister in charge of the ‘admissions unit’ that the patient needed to have a pre-operative ultrasound scan and she was not to be transferred to the anaesthetic room until the image guided-skin marking had been conducted. The responsible consultant surgeon, who was otherwise engaged in clinic communicating a new diagnosis of breast cancer to another patient, received a telephone call from the theatre staff informing him that the patient was anaesthetised and enquiring as to his likely arrival time in the operating theatre. No ultrasound skin marking had been conducted. No-one had contacted the surgical team to ask them if it was acceptable to transfer the patient to the anaesthetic room. The patient herself had not queried being transferred to the operating theatre without a pre-operative procedure that only a few minutes beforehand she was informed was an absolute necessity.\nThe consultant radiologist due to perform the pre-operative ultrasound scan was called to the operating theatre, and thankfully was able to perform the image-guided localisation ‘on-table’ without further insult. The patient subsequently underwent the planned procedure and histopathological assessment confirmed a completely excised 5.2 mm IDC (closest margin 5.5 mm). |
A 26-year-old Hispanic male presented to the emergency department with progressive weakness during the previous year. This weakness initially started in his lower extremities, when he noticed difficulty when ascending stairs; however, it progressed to involve his upper extremities in the following months. He also had complaints of joint pain, generalized fatigue, “bumps,” and “hard places” over his abdomen and thighs, as well as a rash that was more pronounced on his face, arms, and legs. Of note, he had been admitted to another hospital several months before and treated with aggressive hydration for rhabdomyolysis. He improved slightly after that admission, but the weakness subsequently progressed to the point that he was unable to ambulate on his own power. He was given a prescription for an unknown medication on discharge from his previous hospitalization but it was never filled. His past surgical history was significant for an appendectomy about 1 year prior; his family history was unremarkable.\nOn physical examination, the patient had normal vital signs. He was noted to have a diffuse hyperpigmented rash over his face, more prominent on his cheeks and other sun-exposed portions of his body. He was also noted to have taut skin and a firm, nonmobile, tender mass in his right lateral abdominal and flank area that began at the costal margin and continued into his right pelvis. This firm area extended from the posterior axillary line to almost the midline of his abdomen. He had other similar but smaller masses in his left upper and lower quadrants as well as on both thighs. On examination, the patient was unable to raise his arms above his head without assistance. His neurologic examination showed intact sensation and reflexes throughout with marked weakness in his extremities and trunk. He demonstrated 2–3/5 strength in both legs proximally with 4/5 strength in his upper extremities. He had difficulty sitting up without assistance.\nHis laboratory tests in the emergency department included a basic metabolic panel that was within normal limits, with normal calcium levels. The creatine kinase (CK) level, however, was elevated to 3,501 IU/L, while serum aldolase was 29.7 U/L (reference, 1.5–8.1 U/L) and lactate dehydrogenase (LDH) was 728 IU/L (reference, 100–240 IU/L). He had a mild transaminitis with an aspartate aminotransferase level of 207 IU/L and an alanine aminotransferase level of 148 IU/L. A computed tomography of the abdomen and pelvis was completed. The official read commented on calcifications in the right rectus abdominis muscle, external oblique, and subcutaneous fat, as well as calcifications in the left external oblique muscle and left rectus abdominis. The patient was admitted for further management.\nIn the hospital, he was aggressively hydrated and given high-dose steroids as well as methotrexate (Trexall; Teva Pharmaceuticals USA, North Wales, Pennsylvania). Rheumatology service was consulted, and a muscle biopsy confirmed the diagnosis of dermatomyositis with calcinosis cutis. The patient was then given azathioprine (Imuran; Prometheus Laboratories Inc, San Diego, California) and he showed continual improvement throughout his hospital course. His CK levels improved with hydration, and he received intensive physical therapy throughout his hospitalization. At hospital discharge, the patient had 4/5 strength globally and was able to sit in a chair unassisted. He continues to work toward ambulation through outpatient physical therapy. |
A 65-year-old man presented with severe pain, decreased sensory, and motor weakness of the left lower leg for one day. His medical history included surgery for an ipsilateral knee due to trauma several years previous, but he did not have any recent history of trauma before pain. He had been diagnosed with hypertension 3 months prior and had no history of diabetes mellitus. From physical examination, the left lower leg below the knee was pale and cold. The pulses of the dorsalis pedis artery and posterior tibial artery were not detected. The clinical diagnosis was acute occlusion of the popliteal artery, and thereupon computed tomography (CT) angiography was performed by multidetector computed tomography (MDCT) (Somatom Sensation 16, Siemens, Forchheim, Germany). From MDCT angiography, the left popliteal artery at the femoral condylar level had an eccentric nonenhancing portion, representing intraluminal thrombus (). At the tibial plateau level, instead of normal intravascular enhancement, a lobulated mass obscured the popliteal artery and insinuated into the adjacent cortex and medullary cavity of the tibia, resulting in an intraosseous mass with erosion and surrounding sclerosis (). Anteriorly, an obliquely oriented radio-dense line projecting into the intraosseous mass was seen, representing a prior screw fixation site (). The differential diagnoses of the findings of MDCT angiography were a series of popliteal mass with involvement of the popliteal artery and adjacent bone, such as a popliteal pseudoaneurysm with thrombus formation, soft tissue sarcoma, or a primary malignant bone tumor. Considering the evidence of prior transfixation of a screw, and the finding of a thin sclerotic rim of tibia representing pressure erosion, the radiologist suggested a pseudoaneurysm of popliteal artery with erosion into adjacent tibia along the tract of the screw fixation was more likely than soft tissue sarcoma or a primary malignant bone tumor.\nThe pulse of the popliteal artery of the patient became progressively weaker, and the surgeon thus decided to perform an emergency mass excision and recanalization of the popliteal artery. After spinal anesthesia, a roughly 10 cm sized longitudinal incision was made at the popliteal fossa. The gastrocnemius muscles were retracted and the popliteal artery was exposed. A vascular origin mass resembling a pseudoaneurysm was identified. The surgeon attempted to excise the mass but it showed severe adhesion with a neurovascular bundle along with luminal narrowing. The surgeon thus decided to perform a two-step operation composed of a thromboembolectomy to restore the arterial pulse as the first step and total mass excision in elective surgery time as the second step. After making a short incision in the inguinal region, the left femoral artery was exposed. The left femoral artery was intact and there was no evidence of arteriosclerosis. Heparinization was done. Catheterization of the common femoral artery was performed using a 3-Fr Forgaty catheter (Edwards Lifesciences LLC, Irvine, CA, USA). After a large amount of non-organized thrombus was removed, the popliteal arterial pulse returned. However, the catheter did not pass into the distal level of the popliteal artery and the pulse again became weaker over time. A small incision at the distal level of the popliteal artery was hence made and further embolectomy was performed. The thrombus was removed at the distal and proximal level of the popliteal artery. However, the catheter did not pass into the tibioperoneal trunk and the pulse of the posterior tibial artery was not restored. After confirmation that the pulse of the dorsalis pedis artery had been restored, the incision of the popliteal artery was closed. The wound was closed with the use of postoperative HemoVac.\nThe next day, a second operation was performed for removal of mass and bypass surgery anastomosis for the popliteal artery. After administration of spinal anesthesia, a vertical incision was made at the left popliteal fossa, exposing the popliteal artery. The mid- and distal level of the popliteal artery was displaced posteriorly by the mass with adhesion. Heparinization was done. A section of the saphenous vein about 10 cm in length was harvested. After clamping at the proximal level of the popliteal artery, the mid-level of the popliteal artery was incised. An approximately 7 × 5 mm sized oval shaped intimal defect was seen at the anterior surface of the popliteal artery, insinuating into the posterior surface of the tibia. Via the intimal defect, a thrombosed pseudoaneurysm was observed (). Curettage was performed at the organized thrombus in the pseudoaneurysmal sac. Instead of bypass anastomosis, patchy closure and angioplasty were performed at the intimal defect using the harvested lesser saphenous vein, because the native popliteal arterial lumen was relatively intact and the dimension of the harvested vein was too small. The wound was closed with the use of postoperative HemoVac.\nFollow-up CT angiographies on post-operative day one showed restored arterial flow in the left lower leg and no residual pseudoaneurysm. The patient was free of symptoms and the pulse of the dorsalis pedis was intact. The patient gradually recovered from sensory and motor deficit. After one month, his pain and sensory and motor deficit had almost disappeared and good dorsalis and posterior tibial pulses were confirmed. From follow-up CT angiographies performed after one year, mild fusiform dilatation of the popliteal artery was noted but the distal run-off arteries were still intact. |
A 23-year-old female reported with complaints of a slowly expanding swelling of right cheek and upper jaw, pain in right upper teeth, and painful watering of the right eye of 2-3 months duration.\nHer dental history revealed that she had pain in 16 about 1½ year back and got root canal treatment done for it by a local general dentist and was apparently asymptomatic for the next 6 months. There was no history of trauma. Then she had intermittent pain in the same tooth and antibiotics were given. Later she developed a swelling on right cheek and felt severe pain so the tooth 16 was extracted by the same dentist about 3 months back. As the pain and swelling did not subside even after extraction, incisional biopsy was performed twice from the region of 16 both from the socket and vestibule by oral and maxillofacial surgeons. It was histologically diagnosed as nonspecific inflammatory lesion.\nOn examination, extraorally a swelling measuring about 4 × 5 cm with diffuse borders was seen on right cheek extending from the corner of the mouth, nose, to lower eyelid. On palpation, the swelling was firm to hard in consistency with moderate tenderness []. Skin over the swelling was reddened and compromised facial nerve function on right side on smiling was also observed. Obliteration of right nasolabial fold and mild edema over right lower eyelid was noticed. Right eye showed no change in visualacquity and eyeball movements.\nThe intraoral examination revealed a purplish discoloration with expansile mass in the right upper vestibular region extending from 13 to 17 with complete obliteration of the vestibule []. Oroantral fistula resulted after the earlier biopsies in the regions of 14, 15, and 16. There was no caries in the associated teeth but were periodontally compromised: 14, 15, and 17 showed grade II mobility and 13 and 18 exhibited grade I mobility. Significant palatal expansion in the molar region was also observed. Aspiration was negative and the lesion was found to be bleeding actively on slightest provocation.\nOPG showed a radiolucent lesion with ill-defined borders in the regions of 15 to 17. CT scan revealed a soft tissue mass completely obliterating the right vestibule, cheek, and extending on to maxilla and maxillary antrum with thinning and destruction of parts of the antral walls []. The mass extended inferiorly into the body of the maxilla up to alveolus, involving the teeth. Medially, it almost obliterated the posterior and inferior third of the right maxillary antrum []. Superiorly, it extended up to the floor of the orbit and laterally into the body of the zygoma. Posteriorly, it reached the lateral and medial pterygoid plates, infratemporal fossa, and lower portion of the temporal space []. CT also showed evidence of weakness []. 3D reconstruction CT shows perforation of anterolateral surface of the maxilla and uninvolved right orbital floor [].\nKeeping in mind the clinical and radiological features, it was thought that the lesion could not be a nonspecific inflammatory one but it could be a benign tumor. Therefore, a biopsy was done to obtain more deeper tissue and to have an idea about the exact nature of the lesion, and it was histologically revealed as a giant cell granuloma [].\nWith this provisional diagnosis, an incisional biopsy was performed under general anesthesia, and the histopathological examination confirmed it as RGCG [].\nThe patient was advised routine and special blood investigations to rule out hyperparathyroidism. Complete excision of the tumor mass along with partial maxillectomy to gain access to the infratemporal region was planned. Partial maxillectomy was carried out through a Weber-Fergusson incision under general anesthesia [Figures and ]. Palatal mucosa was separated from the bony segment and greater palatine artery ligated. Entire tumor mass was removed along with portions of invaded bone and corresponding teeth. Pressure resorption of the alveolus with exposure of the roots of the teeth was observed intraoperatively.\nA careful and thorough curettage of the residual bony cavity was performed []. The defect was reconstructed with full-thickness skin graft harvested from right thigh region [Figures and ]. The graft was secured by interrupted sutures. Postoperatively nasogastric feeding was maintained for 10 days. The postoperative course was uncomplicated and the patient was discharged on postoperative day 10. The patient was regularly observed at follow-up visits and the wound healing was uneventful []. Patient recovered well and was followed up for 1 year. She is asymptomatic and no recurrence is evident till date. |
Written informed consent was obtained to report the case. A 34-year-old G2P1 pregnant woman diagnosed with AS presented at the obstetric outpatient clinic at 18 weeks of gestation. She experienced back pain when she was 25 years old; these symptoms made walking difficult during her first pregnancy at 31 years old. Following her first vaginal delivery, she was able to walk although pain persisted to a lesser degree than during pregnancy. Radiography revealed osteosclerosis of the posterior surface of cervical vertebrae and osteoarthritis of the right hip with joint space narrowing (Figure ). The initial diagnosis of AS was made at 33 years of age.\nPain was managed by the administration of nonsteroidal anti-inflammatory drugs (NSAIDs) and acetaminophen. After the present pregnancy was diagnosed, only acetaminophen continued to be administered, but pain increased during the present pregnancy. She complained of right hip pain, with a visual analog scale (VAS) score of 7/10. A dosage of 5 mg of oral prednisolone was administered daily from 18 weeks of gestation, and thereafter, the symptoms temporarily improved to 0/10 on the VAS. Unfortunately, the symptoms relapsed at 31 weeks of gestation. At 32 weeks of gestation, she complained of restricted neck mobility with difficulty gargling, restricted lumbar mobility that caused difficulties in bending her back, and restricted right hip joint mobility with a limitation of 10º of abduction, which also affected internal and external hip rotation. Peripartum management was discussed and planned by obstetricians and anesthesiologists. Given that only hip abduction and rotation, but not flexion, were limited, it was considered that an attempt of vaginal delivery would be possible when spontaneous labor occurred. However, if an emergency cesarean section (CS) was necessary during labor owing to other obstetric complications such as nonreassuring fetal status, special anesthesia management may be required because of the possible failure of spinal anesthesia due to calcified spinal ligaments and difficult tracheal intubation and airway management for general anesthesia. In such cases, the preparation of awake fiberoptic intubation or supraglottic airway device insertion should be considered.\nAt 38 weeks of gestation, the patient was admitted to our hospital because of membrane rupture. Labor analgesia was not provided. Oxytocin administration was required due to prolonged second stage of labor. Vacuum delivery with episiotomy left of the midline, which was opposite to the restricted right hip joint, was performed due to fetal bradycardia at birth. A healthy baby with a weight of 3358 g was successfully delivered. Both mother and neonate had a good postpartum course. Prednisolone and NSAIDs were started after pregnancy. |
A 43-year-old man was admitted to our hospital for intensive rehabilitation 115 days after a traffic accident. Cervical computed tomography (CT) and magnetic resonance imaging (MRI) on the day of the injury had shown a C6 vertebral body fracture as well as a cervical cord signal change on T2-weighted MRI images (). He had undergone a C5-6-7 lateral mass fusion on the day of the injury. Six days after injury, he was transferred to the rehabilitation department. A subsequent C5-6-7-T1 anterior and posterior fusion was additionally performed 35 days after injury due to spinal instability detected on follow-up cervical spine X-ray (). There was no concomitant brain injury on brain CT scans and all cognitive evaluations including cognitive score subsets of the Functional Independence Measure showed intact cognition. Other than a past history of type 2 diabetes mellitus, no other significant medical history including psychiatric history existed. The patient also had no history of drug or alcohol misuse.\nAccording to the International Standards for Neurological Classification of Spinal Cord Injury, the patient had a complete lesion (American Spinal Injury Association impairment scale A [ASIA A]) with a C6 neurologic level of injury. According to neurologic exams performed 6 days after injury, the initial upper extremity motor score was 27 and the lower extremity motor score was 0. These scores improved to 31 and 0, respectively, at 115 days after injury when he was transferred to our hospital. Total light touch scores were initially 21 for the right side and 21 for left side and improved to 28 and 29, respectively, at 115 days follow-up. Total pin prick scores were initially 23 for the right side and 24 for the left side, but improved to 27 and 27, respectively on follow-up. There was no interval change in the neurologic exam at 6 months follow-up. Electrodiagnostic studies performed 2 months after injury revealed complete myelopathy and bilateral symmetric peripheral sensorimotor polyneuropathy. Due to concurrent diabetes related peripheral polyneuropathy, sensory nerve conduction studies were done, which showed low amplitudes in bilateral ulnar, superficial peroneal, and sural nerves. However, conduction velocities of all examined nerves and bulbocavernosus reflex latencies were within normal range. Median somatosensory evoked potentials (SEP) stimulating the median nerves at the wrist bilaterally showed prolonged N20 latency in both sides. Tibial and pudendal SEPs were un-evoked with stimulations to the tibial nerves at the ankle and pudendal nerve at penile shaft.\nSPL sensations appeared 6 days after trauma onset. The patient felt the presence of an additional pair of legs that originated at the hip joints and extended medially, at equal lengths to the paralyzed legs (). The patient described the presence of both knee and ankle joints in an extended position. SPL perceptions persisted throughout the day but its intensity fluctuated with more vividness during the afternoon and evening. Body posture also altered the intensity of SPL sensations with more prominence in the supine position and waning during sitting. The patient reported that he could feel but could not see the additional limbs and was aware that this feeling was an illusion. Visualization of his legs did not diminish or alter the intensity of SPL sensations. The supernumerary legs were also associated with severe lancinating pain that measured 8 points on the numeric rating scale. The patient also complained of severe neuropathic pain of the paralyzed legs that worsened when the SPLs were in the flexed position. However, he reported that he had no voluntary control over the phantom limbs and the movements of the SPLs were unintentional. Psychiatric evaluation showed no evidence of delusion, hallucination or any other specific psychiatric abnormality, and the patient showed good insight regarding his various clinical status related to his SCI. The intensity of the SPLs was equal to his paralyzed limbs.\nCombinations of oral gabapentin, pregabalin, baclofen, tramadol, and duloxetine improved the neuropathic pain in both the real and supernumerary limbs that measured 6 points on the numeric rating scale, but failed to affect changes in the intensity of the SPLs.\nThe patient underwent visual-tactile stimulation treatment where he would first visually identify his paralyzed limbs and then gently tap his legs with a wooden stick (). Although his legs were anesthetic to both pain and light touch, tactile stimulation evoked painful tingling sensations in his paralyzed legs. Thus, he was able to receive both visual and sensory feedback and reconfirm the existence of his paralyzed legs. Wooden stick stimulation also evoked painful tingling in the SPLs but visually he was able to recognize the absence of the SPLs and thus differentiate the sense as erroneous. Visual-tactile stimulation was performed three times daily for 10-15 minutes per session with approximately one tap per second. The patient was then asked to rate the intensity of the SPLs on a 10-point numeric analog scale relative to the paralyzed real limb. The presence of the SPLs were felt at an equal intensity to the real limbs initially but improved to half the intensity of the real paralyzed limbs after 8 days of daily visual-tactile stimulation. This improvement continued over the 2 months of inpatient treatment at our hospital and the presence of the SPLs was reduced to 20% of the real paralyzed legs.\nNine months after the SCI, the patient reported persistence of the illusory limb sensations, but the sensations had improved to an extent where it no longer affected the patient's quality of life. Through a telephone interview conducted 13 months post-trauma, the patient reported a telescoping pattern of the SPL with total length shortening to levels half of the original. However, although shorter in length, the knee and ankle joints were still present and the limb continued to remain in the extended position. Although SPL sensation and subsequent total motor and sensory scores at 6 months follow-up improved, motor and sensory scores pertaining to the lower extremities as well as the ASIA A neurologically complete injury state remained unchanged. Additional lower limb SEP studies and imaging studies were not preformed due to patient refusal. However, considering the lack of change in both motor and sensory scores as well as ASIA grades, these studies did not appear to be clinically significant or essential. |
The patient was a 66-year-old male with advanced malignant prostate cancer, bone metastases, and kidney failure requiring dialysis. While an inpatient at a cancer hospital, he was transported to the intensive care unit (ICU) for catheter placement and a hemodialysis session. The professional on duty chose a left subclavian vein access, using anatomic landmarks. The blood aspirate at puncture appeared to be venous and the guidewire was advanced without difficulties, but after dilation of the tract and insertion of the catheter, retrograde pulsating flow was observed. Inadvertent positioning in the left subclavian artery (LSA) was confirmed by blood gas analysis and Doppler ultrasound ( ). The examination ruled out the possibility of injuries to the carotid or vertebral vessels, which had normal morphology and blood flow. Physical examination found 4+ brachial and radial pulses. The device was left in place and the patient was transferred to a hospital with vascular and endovascular surgery services. Inherent problems within the Brazilian National Health Service (SUS - Sistema Único de Saúde) delayed the transfer by 18 days. Since there was a risk of fatal complications, the catheter was not removed from the LSA and the patient was not given anticoagulation because of a recent history of melena. After transfer, the catheter was removed, but endovascular repair was not possible because a thrombus was seen in the arterial lumen. There was no bleeding or formation of hematoma, and left upper limb perfusion was maintained, although the brachial pulse was rated 2+ and the distal pulses were absent at that time. The patient was transferred back to the cancer hospital. Doppler vascular echography was conducted again, showing a subacute thrombus in the LSA, where flow was monophasic ( \n ), constituting subocclusion. The arterial thrombosis was in topography distal of the emergence of the vertebral artery, in which flow was laminar, anterograde and with velocities within the limits of normality ( ). At the subclavian-axillary transition, an arterial branch was observed with reversed flow that, based on topography, may have been the dorsal scapular artery ( ). The axillary ( ) and brachial arteries were patent and exhibited slow, low resistance flow, as did the radial and ulnar arteries. The conduct adopted in this case was watching and waiting since, in addition to the contraindication to anticoagulation already mentioned, the patient’s level of morbidity was elevated for an attempt at open revascularization and predictive indicators of the success of a possible bypass were unfavorable: the time elapsed since thrombus formation (22 days), the poor prognosis of the patient’s cancer, and the presence of kidney failure. The patient was observed for a further 2 weeks and did not show any sign of cyanosis, pain at rest, or trophic lesions. He was discharged from hospital for palliative home care. |
An 8-year-old boy with no significant past medical history sustained a closed supracondylar fracture of the left humerus due to falling down. The initial X-ray demonstrated a type III fracture based on Gartland classification (). He was admitted to the orthopedic ward in order to continue the treatment. Since closed reduction failed, the patient underwent surgery through posterior approach, patient being positioned in a lateral decubitus position and with the elbow held hyperflexed, in posterior aspect of elbow, a straight midline posterior incision was done, and medial and lateral skin flaps were created, elevated, and retracted. In medial aspect, ulnar nerve was isolated and protected, both medial and lateral paratricipital approach was done, and fracture site was exposed. Then, the fracture was reduced and with the first try, and 4 crossed Kirschner wires were inserted under direct visualization to achieve desired stability and rigidity. The patient was discharged the day after surgery (Figures and ). After 20 days, the patient was revisited due to pain and a large soft tissue mass-like lesion on the lateral aspect of the left elbow in site of surgery with no fever or other symptoms which was progressed gradually after being discharged. Physical examination revealed tense swollen sites of surgery with wound dehiscence and marginal necrosis with no evidence of infection or discharges. The patient was afebrile with a blood pressure of 110/70 mmHg, heart rate of 79, and a hemoglobin level of 8.3 g/dl. The neurovascular examination was normal with tenderness on a mass-like lesion without bruit. Based on preliminary assumption of hematoma formation versus pseudoaneurysm, soft tissue and duplex sonography were performed, which revealed normal arterial flow in all major arteries from the subclavian artery, brachial, and radial as well as ulnar arteries with a large collection in the posterior aspect of the elbow. However, based on the patient's history of recent trauma and physical examination, we were highly suspicious of pseudoaneurysm. Therefore, CT angiography was done, which revealed a huge pseudoaneurysm originating from the left profunda brachii artery with extravasation of contrast with the largest diameter of 54.96 mm (Figures and ).\nBased on the necrotic overlying skin, the patient was emergently transferred to the operation room in which after heparinization and proximal control by a tourniquet, and the sac of pseudoaneurysm was opened and approached through a left lateral arm incision (). The neck of pseudoaneurysm originated from the profunda brachial artery 2 cm above the line of fracture which was in close contact with the tip of Kirschner wire making an exit from the medical cortex of the bony structure. Furthermore, the punctured site of profunda brachial artery was repaired by prolene oversewing sutures, and the patient was discharged after 2 days of hospitalization with an uneventful postop course. In the patients' further follow ups, no neurovascular complications or signs of infection was reported, while also achieving full range of motion in examination. |
A 34-year-old female who has no previous clinical illness presented in 2000 with a large irregular mass, estimated clinically to be around 5 × 6 cm by physical examination, involving the right breast while she was lactating. There were no other signs or symptoms. FNA was done to rule out breast cancer, and the specimen showed few foamy macrophages and rare clusters of ductal cells, with focal secretory lactational changes. Based on that, it was determined that the specimen was negative for malignancy. The tumor continued to grow, and in June 2004, FNA of the right breast was repeated and showed large staghorn-shaped sheets of uniform ductal cells with no cytologic atypia along with myoepithelial cells. There were fragments of fibrotic stroma and bare nuclei scattered in a bloody background, and so, a diagnosis of fibroadenoma was made. Two months later, the patient underwent excision of the tumor in another healthcare facility. Examination of the slides showed an overgrowth of epithelial and stromal components in pericanalicular and intracanalicular patterns with irregular large cystic spaces showing protruding leaf-like structures (). The stromal cells showed plump elongated slightly dysmorphic nuclei with occasional prominent nucleoli. Other areas showed significant cellular growth of the stromal spindle cells which appeared to be arranged in long intersecting fascicles and growing in herringbone pattern (). Within the spindle cell growth, extracellular mucin was noted. One focus showed an exclusive spindle cell growth which was moderately atypical with plump elongated hyperchromatic nuclei. Numerous mitosis was found, up to 20 in 10 high power fields in this focus. Entrapped epithelial ductal elements were occasionally seen in other areas exhibiting ductal epithelial hyperplasia. These features were consistent with malignant phyllodes tumor with stromal fibrosarcomatous overgrowth. The patient subsequently underwent mastectomy as the margins were focally involved. During the procedure, a mass measuring around 3-4 cm was found in the most posterior aspect of the breast and there was some indication that it may have invaded the pectoralis major muscle. All the breast tissue, the tumor, and some of the muscle fibers were removed. On gross examination, there were multiple tumor masses in the inner lower and outer upper quadrants, the largest being 3 cm. On microscopy, there was proliferation of atypical spindle and elongated plump cells with pleomorphic nuclei and occasional prominent nucleoli. Extracellular mucin was also identified. The atypical stromal cells formed herringbone fascicular growth pattern reminiscent to fibrosarcoma and numerous mitosis averaging around 14 mitosis in 10 high power fields. No residual phyllodes tumor elements were identified. The tumor nodules had a well-demarcated margin with focal infiltration of surrounding breast and adipose tissue. No lymphovascular invasion, necrosis, or heterologous differentiation was seen. All surgical margins and muscle fibers were not involved by the tumor. The skin and nipple did not show any involvement either. All these histological features were identical to those identified in her previous lumpectomy except that there was more pronounced atypia and no residual epithelial component of phyllodes tumor identified. No lymph nodes were identified. A year later, the patient began to suffer from acute bouts of pancreatitis and was admitted several times for this. In March of 2006, abdominal CT was performed and showed a heterogenous low attenuation soft tissue mass involving the head and body of the pancreas and was extending upwards. The celiac vessels and its branches were going through this mass but did not show any significant narrowing. There was obvious atrophy of the pancreatic tail and dilatation of the pancreatic duct. The mass was in contact with the anterior aspect of the inferior vena cava (IVC) with no clear fat plane in between (). Biopsy of the pancreatic mass showed uniform proliferation of elongated spindly cells which had coarse chromatin and mild to moderate nuclear pleomorphism. Some cells had plump hyperchromatic nuclei. Numerous mitotic figures were identified (). The background showed variable amounts of collagen and stroma with focal areas of myxoid appearance. Immunohistochemical staining showed strong positivity for vimentin; however, the cells were negative for actin, S100, and cytokeratin (). These findings were consistent with metastatic fibrosarcoma of the pancreas secondary to her primary breast lesion. Due to the location, extent, and nature of the condition, the case was deemed unresectable. Chemotherapy was initiated; and in the little chance that the tumor shrunk enough, the possibility of resecting the metastasis would be entertained. In January 2007, the patient presented to the ER with severe epigastric pain, where she collapsed, was hypotensive, and subsequently admitted. On examination, a tender mass in the epigastric area was felt. Urgent CT of the abdomen and pelvis with and without contrast showed a pseudoaneurysm in the splenic artery measuring around 3.5 cm. There was also expansion of the retroperitoneal mass and blood in the intraperitoneal cavity. There was heterogenous enhancement in the liver most probably indicating liver infarct. In addition, there were areas of the IVC which had markedly thinned wall and areas suspicious for active bleeding, especially from the proximal splenic artery (). The pancreatic fibrosarcoma had grown and eroded branches of the celiac artery with bleeding pseudoaneurysm along with infarct of the liver, spleen, and adjacent organs. The patient continued to be hypotensive with abdominal distention due to severe intra-abdominal bleeding and developed multiorgan failure and hemorrhagic shock leading to her death. |
A 32-year-old man presented to our clinic with the following history. His family history was negative for congenital heart defects and the patient had no siblings. Immediately after birth the cardiac status with a systolic murmur along left sternal border leading to a pediatric center where is diagnosed. The growth and mental development were normal, but marked cyanosis, weakness, clubbing, and intolerance of physical activity was present. At the age of nine the patient was referred to a cardio-pediatric center abroad where was diagnosed as complete atrioventricular canal defect, pulmonary atresia, and persistent ductus arteriosus. The patient condition was improved significantly and remained stable for the next eight year. At 17 years of age he was hospitalized again at the same center because of cyanosis, palpitations, and weakness with intolerance to physical activity. The patient had several documented episodes of atrial fibrillation.\nAt the age of 32, the patient presented to our clinic with severe cyanosis, he complained of shortness of breath with minimal exertion, and chest pain. The physical examination was remarkable for a 4/6 systolic murmur heard at the left sternal border, and cardiac frequency 130 beats per minute. The patient was noted to experience severe shortness of breath with even minimal exertion and was deeply cyanotic.\nThe electrocardiogram demonstrated atrial fibrillation, with ventricular frequency 100/min, and bifascicular block. Chest radiograph indicated a small pleural effusion on the right and bilateral hilopulmonary stasis. The heart was moderately enlarged with prominence of the aorta. An echocardiogram was performed (Figure , ).\nPatient was diagnosed in his early childhood with a congenital anomaly. In the very early echocardiography findings the presence of rudimentary inter ventricular and inter atrial septum leading to a common atrioventricular canal with one atrioventricular valve was described. This is also in the context of the malformations occurring during the intrauterine development of the embryo. From a perspective of adult congenital heart disease, the enlargement and the slight modifications of the heart cavities through the age, leaded to echocardiography view of hardly seen the rudimentary part of the interventricular septum, creating a perception of a single ventricular and a single atrium heart. An atrioventricular septal defect with common atrioventricular junction guarded by a common valve was seen. Both atriums were dilated, while pulmonary atresia and patent ductus arteriosus were also diagnosed in the early childhood. The main diagnoses were: atrioventricular septal defect with common atrioventricular junction guarded by a common valve, pulmonary atresia, persistent ductus arteriosus, and congestive heart failure. |
A 42-year-old man is presented with complaints of persistent fever and left chest pain since 2 weeks. He had no remarkable medical history. Chest radiograph showed diffuse consolidation of the left lung. Chest computed tomography (CT) revealed a large abscess with an air-fluid level in the left upper lobe and extensive consolidation of the whole left lung (Fig. a). He was diagnosed with severe pneumonia with a lung abscess. Antibiotic therapy was started empirically with meropenem and vancomycin. Antibiotic therapy administered for 5 days did not demonstrate a satisfactory clinical outcome. Thereafter, he underwent CT-guided percutaneous catheter drainage of the lung abscess with a 1-Fr pigtail catheter, and 42 mL of pus fluid was evacuated. However, the catheter became clogged the next day, after which the patient developed respiratory failure and required a ventilator. Chest CT revealed pneumonia of the right lung and residual abscess content due to incomplete initial drainage (Fig. b). We suspected that pneumonia of the right lung was caused by aspiration of the abscess content due to the right lateral position of the patient at the time of the CT-guided percutaneous catheter drainage. Frequent bronchoscopies were performed to remove the endobronchial pus; however, his respiratory failure worsened further and he underwent tracheostomy. To achieve and maintain effective drainage, insertion of a larger size catheter to replace the 10-Fr catheter was planned. Since the route was expanded sufficiently without a lung trauma, large enough catheter, 28 Fr, was chosen as a new one in favor of avoiding clogging. The procedure of exchange of catheter was performed under general anesthesia and one-lung ventilation with a double-lumen tube to isolate the left lung and prevent aspiration of abscess content to the right lung due to the right lateral position of the patient. Expansion of the route reaching the abscess cavity was safely performed by utilizing the old catheter as a guide; additional skin incision of 2 cm was made at the insertion point of the old catheter, and subcutaneous tissue and muscle layers around the catheter were cut with an electric scalpel, and the route was expanded with a straight Pean forceps inserted along the catheter, confirming the tip of the forceps to be reaching to the cavity by x-ray fluoroscopy. Since the route was expanded sufficiently without a lung trauma, enough large catheter, 28 Fr, was chosen as a new one in favor of avoiding occlusion. After placing the new catheter into the cavity, the old one was removed (Fig. a, b). The new catheter was led out to a new wound through a subcutaneous tunnel.\nThe larger sized catheter enabled the maintenance of adequate drainage of a total of 650 mL for 8 days. A suction pressure was set at − 10 cmH2O. Although air leakage from the drainage catheter continued until the catheter was removed, it did not cause any clinical problems. The antibiotic therapy was de-escalated to sulbactam sodium/ampicillin sodium owing to identification of the causative bacteria from a culture of the initial evacuated pus fluid; Prevotella buccae, Streptococcus anginosus, and Fusobacterium necrophorum were detected. His respiratory condition and laboratory results immediately improved, and he was free of ventilator support on day 5 post-catheter exchange. The catheter was removed on day 18. In addition, the antibiotic therapy was switched to oral garenoxacin and discontinued on day 35. He was discharged on day 40 post-catheter exchange with no complications. Figure shows the clinical course of this case. After 7 months, his chest CT confirmed complete cure of the lung abscess, albeit with only a small residual thin wall cavity (Fig. ). |
A 56-year-old female patient presented to our clinic for left hand middle finger edema and pain of 1-year duration. Her medical history was relevant for 15 years of progressive 4th and 5th fingers malformations that were attributed to sarcoidosis, and for which she was treated with anti-inflammatory and low dose steroids therapy; she stated that the malformation started in the form of pain and edema 15 years before achieving this neglected form. One year before presentation, the patient started noticing left middle finger edema and swelling associated with severe pain and a mass-like structure over the 1st phalanx. This was preceded by few days of weakness and fatigue. She sought medical advice at multiple clinics where the new mass was first diagnosed as bone cancer. At our clinic, physical examination was consistent with a swelling at the base of the middle finger () associated with tenderness and decreased range of motion. Laboratory tests were within normal limits, except for elevated C-reactive protein, and erythrocyte sedimentation rate. Purified protein derivative test was negative. Radiographs of the hand showed a lytic lesion involving the distal half of the first phalanx, along with blurred limits of the bone surfaces involved (). An magnetic resonance imaging was ordered and showed hyper-intense signal of the first phalanx, along with subcutaneous enclosed collections on both sides of the phalanx (). The decision was made for surgical debridement and biopsy. The patient was taken to the operating room, and using a dorsal approach to the middle finger, we identified two collections on both sides of the 1st phalanx; these collections were debrided and sent for culture. Then, an osteotomy was done at the distal metaphyseal region of the first phalanx, followed by debridement of the diaphyseal marrow () that was sent for pathology. The osteotomy was reduced and fixed using 2 k-wires. Post-operative radiographs are shown in . Pathology results showed caseating granulomas (), and culture confirmed the diagnosis of TD. A computed tomography scan of the chest was done postoperatively, where few calcified nodules suggestive of healed TB were noted (). The patient had a complete union at 3 months postoperatively (), and the wires were removed. She also received a 9-months course of anti-tuberculous drugs. At 9-months follow-up, she was free of symptoms, finger swelling had decreased significantly, and she had full range of motion of the operated finger (). |
This 19-year-old female was the fifth child of first-cousin parents. One sibling passed away at 20 days of age because of pneumonia and another died at the age of 4 months due to kidney failure. There was also a full-term idiopathic stillborn. Unfortunately, none of them were seen at our institution and we did not have access to their charts. It is not possible to make any inference about the etiology of their diseases.\nThe patient was born uneventfully at 36 weeks of gestational age by caesarean section, had a birth weight of 2600 g (5th–15th percentile) and 46 cm birth length (5th percentile). Head circumference information was unavailable. There was no clinical sign or laboratory findings consistent with cholestasis at neonatal period or in her first 2 years of life. She had global developmental delay that was first recognized after 6 months of age. All domains were affected. She was not able to hold her head up and sit without support until 1 year old. She started walking with support at 6 years old and without support at 7 years old. She started speaking some words at 4 years old. She did not name colors, recognize numbers or letters, and she can only produce scribbles. She started using a spoon at 11 years old. At that moment, her functional age according to Denver II was gross motor 12–13 months, fine motor 15–16 months, language 18–19 months, and personal/social 7 months. A formal neuropsychological assessment was not conducted.\nShe had recurrent hypoglycemia associated with fasting from 6 months to 7 years of age without hyperinsulinism and was not responsive to glucagon. At the age of 10 months, she experienced a febrile seizure without hypoglycemia and at the age of 9 she started having focal motor seizures with impaired awareness and automatisms. The seizures were rare and easily controlled with carbamazepine.\nAn etiological investigation was initiated when she was admitted to our service at the age of 10 years old.\nAt this age, her weight was 14.5 kg (2.5th–10th percentile), her height was 100 cm (<2.5th percentile), and her head circumference was 52 cm (2.5th–50th percentile). She had subtle dysmorphic features, including frontal bossing, high forehead, down slanted palpebral fissures, and dental malocclusion (Figure ). She walked with an independent gait and had generalized hypotonia, as well as severe intellectual disability, being able to speak only isolated words. The laboratory investigation revealed intermittent increases of transaminases (up to AST 319 U/L, ALT 360 U/L) without liver failure or hyperbilirubinemia (total bilirubin level 0.56 mg/dL, direct bilirubin level 0.18 mg/dL). Methionine levels were elevated only once (1533 μmol/L; reference value 7–47 μmol/L) and became normal (33.96 μmol/L on her last visit) spontaneously, without any specific diet (Table ). Proline levels were also elevated (541 μmol/L; reference value 59–369 μmol/L); there were mildly elevated tyrosine and phenylalanine levels; diminished levels of L-aspartate, glutamic acid, citrulin, arginine and ornithine, and normal homocysteine levels at this age.\nBrain magnetic resonance imaging (MRI) and head and neck MR angiography (MRA) were done at the age of 10 to investigate the epilepsy. There were no brain lesions, but MRA demonstrated ectasia and tortuosity of both the internal carotid and vertebral arteries, particularly in the cervical segments (Figure ). The intracranial arteries were normal. Thoracoabdominal aorta computed tomography angiography was performed after the findings of the neck MRA and revealed normal results.\nAt the age of 12, 15 days after Achilles tendon tenotomy, she had a seizure followed by loss of language skills and strength at the right side of her body. She was admitted to another hospital and did not undergo brain imaging. At an office visit to our service 6 months later, on neurological exam she showed motor aphasia, right side hemiparesis with pyramidal signs. She could walk without assistance and with a hemiparetic gait.\nAnother ischemic stroke occurred at the age of 13, leading to a left hemiparesis, secondary to occlusion/sub occlusion of the distal intracranial right internal carotid artery, as demonstrated by brain MR/MRA (Figure ). It extended to the anterior and middle cerebral arteries, causing a large infarct in the area nourished by those vessels. Previous ischemic areas were also observed in the right internal globus pallidum and genu of the internal capsule, as well as in the left midbrain, pons, cerebellar hemisphere, and medial cerebellar peduncle. Laboratory screening for thrombophilia was normal, and her methionine plasma level was normal.\nADK deficiency was diagnosed at the age of 19 by whole exome sequencing, which revealed a homozygous missense variant in ADK [Hg19 Chr 10:76.468.145C>T, c.980C>T ENST00000372734, p.Ala327Val]. Segregation analysis was not performed.\nCurrently, at 19 years of age, she is wheelchair-bound with a profound intellectual disability. She is unable to sit unsupported and cannot reach or hold objects with her left hand. She speaks only isolated words and still wears diapers. Her current weight is 36 kg (<2.5th percentile), her height is 140 cm (<2.5th percentile), and her head circumference is 56 cm (50th–95th percentile). Neurological examination showed lack of head support due to muscular hypotonia, and bilateral pyramidal signs (mainly on the left side and lower limbs), contractures on her feet and hands, and hyperreflexia. Respiratory, cardiovascular, and gastrointestinal examinations were unremarkable. It is worth mentioning that there was no clinical, laboratory, or image signs of cholestasis or liver dysfunction. There was only mild elevation of ALT and ammonia. Methionine levels were normal. No new clinical or imaging events have been observed since the age of 13. |
A 20-year-old male patient presented with a history of pain in the left hip for the past 6 months. The pain was insidious in onset, intermittent, occurred predominantly at night, progressively increasing with time, 6/10 on a visual analog scale and was present over the anterior aspect of the left hip. It was non-radiating and there were no aggravating factors for pain. However, he got some relief with over-the-counter analgesics. There was no history of antecedent trauma and the remaining history and general examination did not reveal any significant abnormalities. Local examination revealed diffuse tenderness over the anterior aspect of the left hip. There was no palpable swelling or wasting of the leg muscles. The range of motion of the left knee and ankle joints was normal and there was no neurovascular deficit distally.\nX-ray left hip showed the small radiolucent area with sclerotic margin in the left femur neck along its superior border (). CT scan of the left hip showed, presence of osteoid osteoma in the region of the superior border of the femoral neck of diameter 0.5 cm (). After all the necessary investigations, the patient was planned for radiofrequency ablation of the tumor under CT guidance. Magnetic resonance imaging hip showed a rounded cortical based lesion with internal specs (nidus) suggestive of osteoid osteoma ().\nAfter all the necessary investigation and routine workup, the patient was taken for the procedure under the CT guidance.\nUnder all aseptic precautions, the procedure was started. CT scan was obtained to precisely localize the lesion and multiplanar reconstructions were used to plan the optimal transcutaneous approach. Close attention paid to the adjacent blood vessels and nerves, since these structures must carefully be avoided. A penetration cannula with an inner stylet was introduced through the skin and soft tissue according to the previously established access route. New CT images are then obtained to verify the correct position of the cannula (). Once ensured the distal end of the cannula is well positioned on the bone surface, the inner stylet is removed. Bone penetration is then accomplished through a cannula, once within the nidus, the ablation electrode was placed and was connected to the RF generator. When the electrode was documented to be exactly within the nidus, RFA started and the lesion was heated to 90°C for a time of 5–6 min, which are widely reported to be the optimal ablation parameters. Last CT scan was obtained to see the possible soft-tissue damage. The electrode and the cannula were removed and a sterile dressing was applied. The patient was discharged on the same day and advised follow-up in the outpatient department, At follow-up of 1 year, the patient did not complain of any pain in the hip or difficulty in walking and repeat CT scan and X-ray does not show any signs of recurrence of the tumor (). The patient is doing well. |
A 71-year-old Korean male was presented with a dark brownish to violaceous discoloration with edema on the right eyelid. He had been diagnosed with angiosarcoma on the right forehead 3 years ago and was treated with a complete excision of the lesion with a negative margin and an adjuvant radiotherapy (66 Gy in total) at another university hospital. Several months after the treatment, a dark brownish to violaceous patch with edema arose from his right upper eyelid and gradually spread out to the lower eyelid (). Clinically, an ecchymosis caused by a trauma or other hemangioma was suspected more than a recurrent angiosarcoma, because the lesion was about 3 cm away from the surgical scar from the previous operation on the right forehead, and it presented as an edematous, purpuric patch such as the black eye. A skin biopsy taken from the upper eyelid showed numerous irregular anastomosing vascular channels lined by a single layer of somewhat enlarged atypical endothelial cells dissecting collagen bundles in the dermis (). Immunohistochemically, the tumor cells showed a positive reaction for CD31 and D2-40 (). A pathologic diagnosis of well differentiated angiosarcoma was made, and it was identical to that of primary angiosarcoma of the right forehead 3 years ago.\nAll routine laboratory tests, including a complete blood count, a urinalysis, the blood glucose level, the liver and the kidney function and the chemistry profile were within normal range. Positron emission tomography-computed tomography findings showed no evidence of distant metastasis. Because the tumor involved almost the entire right eyelid diffusely, a surgical excision was not an option. As the tumor gradually spread, he was referred to the radiooncology department for a radiotherapy. He underwent a radiation therapy with a total dose 66 Gy in 33 fractions over 2 months. After the 2 months' course of treatment, a moderate clinical improvement was shown (). One and a half months later, we performed a skin biopsy to find out the histological improvement. But, the histopathologic findings revealed atypical scattered tumor cells in the dermis suggestive of the remnant of an angiosarcoma (). An immunohistochemical staining was positive for the CD31 and negative for D2-40 (). Thus, we concluded that he responded to the radiotherapy with a partial regression of the tumor. We could not perform the next sessions of radiotherapy because we believed that a periorbital edema and the induration might be worsened and he might not be able to open his eye. After a discussion with the multidisciplinary team, it was decided that he will be treated with a paclitaxel chemotherapy. Now, he is under a treatment with a weekly paclitaxel and we are following-up on the treatment response. |
A 74-year-old male patient was admitted to our hospital in March 2017 to undergo liver resection to treat a malignant hepatic lesion diagnosed with CT and PET and a fine-needle biopsy positive for squamous carcinoma. The hepatic tumour discovered during follow-up for a previous bladder cancer submitted to endoscopic surgery three years before measured 22 mm in diameter and was located in the VIII Couinaud's segment [] of the liver in association with three smaller hypodense liver lesions with a focal dilatation of peripheral biliary tree ().\nThe case is discussed with radiologists, oncologists, and pathologists of our hospital. Even if the lesion had been the single site of disease; due to the proximity/doubtful infiltration of the lesion to the biliary tree, we decided to submit the patient to an explorative staging laparotomy and possible palliative surgery.\nOur internal protocol states that during the preadmission every patient who is a candidate for a liver resection is subjected to a routine liver function test with ICG to determinate the most appropriate surgical procedures []: 0,5 mg/Kg ICG are routinely injected intravenously up to seven days before surgery to evaluate the ICG retention rate at 15 min (R15). In our case 45 mg of ICG was intravenously administrated to test hepatic function, ten days before the surgery (patient R15 = 8.9).\nThanks to the ICG property of being fluorescent with the light emitted from the photodynamic eye of the laparoscopic system in our possession, it is possible to visualize the lesion during the surgical procedure. To this target, timing of administration and dose of ICG are key points.\nSeveral studies have demonstrated that the effective dose of ICG depends on the timing of injection; in particular, if the function liver test had been performed more than 7 days before surgery it would have been necessary to administer an adjunctive dose (0,1 mg/Kg) the day before []. In this case, it was necessary to administrate an adjunctive dose of ICG the day before the surgery (9 mg of ICG injected intravenously). After laparotomy, exploration of the abdominal cavity, and exposure of the liver, we easily confirmed the superficial lesion in the VIII Couinaud's segment. The liver surface has been analysed with the fluorescent imaging system. The fluorescing tumour has been clearly identified and defined on the liver surface, as shown in . We have also identified that a large area of fluorescent parenchyma that gets from the peripheral of the lesion up to the portal pedicle such as the neoplasia would interest the right biliary tree in the form of neoplastic lymphangitis (). This datum was not preoperatively known.\nA right hepatectomy would have been the oncologically correct surgical procedure due to the infiltration of right biliary duct. Considering the probable metastatic nature of the lesion, the absence of a clearly primary lesion, the age, the comorbidities, and the small size of residual liver, we have decided to perform an atypical segmental resection of S8 associated with cholecystectomy and lymphadenectomy of the hepatic pedicle nodes, including the area of impaired biliary excretion.\nAt the histological examination, the lesion, the lymph nodes of the hepatic pedicle region, and the right biliary branch, respectively, resulted in hepatic metastases from squamous cell carcinoma and sites of metastatic location. As expected the resection margin was interested by neoplasia.\nIn particular, the histological examination showed the following:Macroscopical exam: the neoplasia, in a site, appears to be in contact with the resection margin Microscopical exam: parenchymal hepatic section that showed metastatic localization of squamous carcinoma moderately differentiated. The neoplasia interest the surgery resection margin.\nIn this case, fluorescent imaging has revealed a fluorescing ring around the hepatic metastasis (). The fluorescence of the cholestatic area was shown on the cut surface (). |
A 63 years old lady carried out a complex re-laparotomy for a postoperative small bowel occlusion after a radical cystectomy because of urothelial carcinoma. The procedure lasted 3 h because of thick adhesions that needed to be cleared. At the end of the procedure, total blood loss was 2 litres, and two Units of Packed Red Blood Cells (PRBC) were infused. During the surgical procedure, a central venous catheter was placed in the internal jugular vein by ultrasound-guided puncture of the vessel, but an inadvertent puncture and cannulation of the right subclavian artery occurred before catheter placement. Because of the ultrasound-guided procedure, the anesthesiologist thought to have cannulated the carotid artery and applied local pressure for a few minutes. Two hours later, when the patient was in the Intensive Care Unit (ICU) around midnight, a chest X-ray to check the correct position of the central venous catheter revealed a massive hemothorax (), while the patient was hypotensive and responder to crystalloids and blood infusions. A chest drain was inserted without any substantial output but a small amount of clotted blood. The patient rapidly worsened, despite appropriate resuscitation with 10 U of PRBC, 8 U of Fresh Frozen Plasma (FFP), 3 U of cryoprecipitate and 1 U of platelets from apheresis. A second chest X-Ray to check tube position revealed a tension hemothorax (). The team in charge of the patient, comprising the anesthesiologist that did the general anaesthesia for the surgical procedure, made the diagnosis of suspected subclavian artery perforation and tension hemothorax with both hypovolemic and obstructive shock. The team decided to bring the patient in the hybrid room to control the likely bleeding for the right subclavian artery. While the patient has been positioning on the angiographic table, the ECG monitor showed severe bradycardia, with a heart rate of 30 and an impending cardiac arrest with a systolic blood pressure of 30 mmHg. An emergency thoracotomy to decompress the right chest was then performed via a V space incision, and five litres of blood under pressure were drained from the right pleural space, with a rapid improvement in the vital signs. During the endovascular procedure, the general surgeon left the thoracotomy open to allow a continuing suction in the pleural space to prevent the accumulation of clots. The endovascular procedure was conducted by the vascular surgeons and lasted 40 min, confirming the massive leak from a significant defect in the subclavian artery () and consisted in a 7 x 37 mm covered stent placement in the subclavian artery at the origin of the vertebral artery. The stent was expanded with a balloon taking care of not injuring the already damaged vessel (). The patient had a transient improvement, but in the next few hours, a hemodynamic instability again occurred, even if responsive to blood infusion. A CT scan revealed a leakage from the stent, because of retrograde revascularization of the vertebral artery (). A new endovascular procedure, with more pronounced balloon dilatation of the stent, definitely controlled the bleeding. ) The patient slightly improved after an open surgical debridement of the pleural space from clots and blood, given the absence of an output from the two large drains that were in place. In the next few days, the patient went back to the ward and made a gradual full recovery with no neurological or vascular defects (). |
An 8-year old girl presented with a history of left-sided submandibular swelling of 1-week duration. There was no reported fever, loss of weight or appetite, or any other generalized symptoms. There was no throat pain or difficulty in swallowing. She was started on broad-spectrum antibiotic treatment with no improvement, and the swelling increased in size. Computed tomography (CT) scan was done outside our institution and showed a large cystic mass lesion in the submandibular area. She had an open drainage procedure as an outpatient on the assumption of an abscess. The family was told that the drainage was successful and no further information was given to the family regarding microbial culture results.\nShe then presented to our outpatient clinic for further investigation since the mass did not change in size. On examination, she had a large submandibular mass measuring 5 cm × 5 cm which was slightly tender on palpation; she had no evidence of fever or tachycardia.\nExamination of the throat revealed normal tonsils and no lesions could be found in the oral cavity. No abnormalities could be found in the nasopharynx or hypopharyngeal area.\nLaboratory examination showed leukocytosis with a white blood cell count of 24,000 with 70% neutrophils, 20% lymphocytes, and 7% monocytes. The C-reactive protein was mildly elevated at 83 mg/L. Levels of serum lactate dehydrogenase and uric acid were normal.\nNeck ultrasound and CT scan [] showed a necrotic mass lesion in the left submandibular region, measuring 5.6 cm × 5.2 cm × 5.2 cm, suggestive of an abscess with associated adjacent reactive appearing lymph nodes.\nThe patient was admitted and was started on intravenous clindamycin and oral augmentin and dexamethasone. The next day, she underwent an open drainage on the assumption of an organizing abscess. During the procedure and on opening the mass, we found an inflamed firm tissue surrounding the wall of a cystic cavity which was attached to the submandibular gland. The salivary gland appeared normal in size but with extensive adhesions to the cystic wall mass. The cystic cavity revealed a serous fluid with no obvious pus. The tissue was found to have extensive adhesions where dissection was difficult. However, multiple representative biopsies were taken on an attempt for a complete excision including the removal of the attached submandibular gland. The tissue was sent for histopathological examination and culture. She was discharged on oral antibiotics and advised to come back after 1 week as an outpatient follow-up.\nHowever, she was readmitted 3 days later with fever and serous discharge from the surgical wound. Laboratory parameters on the second admission revealed leukocytosis and increased inflammatory parameters. By ultrasound examination, there was a mass lesion at the left submandibular location measuring 4 cm × 3 cm × 5 cm with complex mixed echogenicity.\nComputerized axial tomography scan revealed a large submandibular collection and nearby multiple enlarged small lymph nodes. The right submandibular gland appeared normal. Chest X-ray was within normal limits.\nBasic immune workup for immunodeficiency was negative. The immune status screening showed mumps viral IgM, which was reported as positive IgM but with low levels of detection, Epstein–Bar virus (EBV) IgG was positive, and quantitative EBV polymerase chain reaction analysis showed 6500 copies/ml. Cytomegalovirus IgG was positive, but IgM was negative. Toxoplasma IgG and IgM were both negative. C3 and C4 serum levels were elevated. Bartonella antibodies were also negative. She was restarted on intravenous antibiotics, ceftriaxone, and clindamycin but developed allergy to the latter; therefore, it was replaced by augmentin.\nThe histological examination revealed intensely inflamed soft-tissue fragments with mixed inflammatory cell infiltrate composed of neutrophils, plasma cells, lymphocytes, and histiocytes. However, occasional large atypical cells were seen scattered in between these tissue fragments. These atypical cells were large, polygonal, and epithelioid with abundant cytoplasm and large nucleus. The cells contained large and prominent eosinophilic nucleoli in addition to occasional mitoses []. Immunohistochemical stains revealed immunoreactivity of these large cells for pan-cytokeratin (AE1/3) but negativity for CD68 and most lymphoid markers (CD3, CD5, CD20, CD8, CD23, and CD45) except strong membranous staining for CD4 []. Two different clones of CD4 were tested; the first clone is SP35, Rabbit monoclonal antibody, Ventana Medical Systems, Inc. Tucson, AZ, USA, while the second clone is 4B12 from Dako, Santa Clara, CA, USA. Both clones showed immunoreactivity; stronger on the Ventana clone. All positive and negative controls were appropriate.\nViral in situ hybridization staining for EBV by the EBER method showed strong nuclear staining [ inset]. A diagnosis of EBV-positive lymphoepithelial-like carcinoma (LELC) in the submandibular region was rendered.\nBased on the final pathologic diagnosis, the family was advised to have examination of the child under general anesthesia for endoscopy and biopsy from the nasopharynx, but they refused.\nBased on multidisciplinary team's discussion, it was recommended to have multimodality oncological treatment which is not available at our institution. Therefore, the patient was referred to the American University of Beirut Medical Center where advanced care for such cases would be available.\nPretreatment positron emission tomography scan showed large left retromandibular and parapharyngeal mass 7 cm × 6 cm with Standardized Uptake Value of 17 causing mass effect on the oropharynx with deviation from midline to the right, with ipsilateral cervical lymphadenopathy []. The decision was made to treat this patient as a case of nasopharyngeal carcinoma (NPC) Stage IIB. She received induction chemotherapy (cisplatin 80 mg/m2/dose and 5-fluorouracil 1 g/m2/day × 4 days, both repeated every 3 weeks for a total of 3 cycles) as per the Children's Oncology Group protocol ARAR0331. She demonstrated a very good response after 3 cycles, with significant decrease in the size of the flourodeoxyglucose-avid conglomerate of soft-tissue masses/lymph nodes in the left submandibular region to 2.5 cm × 2 cm and resolution of their activity.\nShe then received concurrent chemoradiation with cisplatin 100 mg/m2 every 3 weeks where two cycles were given during radiation therapy. The radiation dose was 45 Gy in 25 fractions to neck lymph nodes, followed by a boost of 16.2 Gy in 9 fractions to the tumor volume. The total tumor dose was 61.2 Gy in 34 fractions where the treatment was delivered using intensity modulated radiotherapy. At the end of treatment, imaging showed further decrease in the residual lesions []. |
A 19 year old boy presented with chief complaints of insidious onset pain in the right ankle since the last two years, swelling in the right ankle since the last six months and inability to bear weight on right side since the last six months. There was no history of fever, loss of appetite, loss of weight, similar complaints in other joints or history of similar complaints in the past. The family, occupational, recreational and drug histories were not significant. The general physical and systemic examinations were within normal limits.\nOn local examination, the attitude of the limb was neutral. There was a 5 × 4 cm swelling over dorsum of right foot and anterior aspect of ankle joint. There were no visible veins, sinus or discharge from the swelling. The local temperature was increased and the swelling was tender. All movements at the ankle joint were painfully restricted.\nSerum biochemistry studies were within normal limits. AP and lateral radiographs of the ankle showed a radiolucent lesion occupying the whole of talus with expansion and thinning of the cortex (Figure ). CT scan revealed an expansile soft tissue mass in the talus causing cortical destruction and extension into soft tissues. The joint space between calcaneum and talus was well preserved (Figure ). A Fine Needle Aspiration Cytology study of the swelling was done and a provisional diagnosis of Giant Cell Tumor was made.\nThe condition, its prognosis and various treatment modalities were discussed at length with the patient. In view of the extensive involvement of talus, total talectomy with tibio – calcaneal arthrodesis was planned. The patient was a manual laborer and therefore chose the option of a stiff but painless joint.\nTotal talectomy was performed via the standard anterior approach. Fusion was achieved by autologous iliac crest graft and stabilization with a Steinmann pin (Figure ). Histopathological examination of the talectomy material confirmed the diagnosis of Giant Cell Tumor. The patient was advised not to bear weight on the affected limb for 8 weeks and mobilized in a short leg walking cast thereafter. The Steinmann pin and cast were removed after 4 months. At 6 months of follow-up, the patient had a smooth healed scar with a painless and well arthrodesed ankle with no evidence of recurrence (Figure ). There was no evidence of recurrence at 18 months of followup. |
The patient was a 52-year-old female with a history of bipolar disorder and smoking who presented with idiopathic stocking-glove neuropathy. Prior to the onset of her symptoms she had undergone a C5-C6 anterior fusion for cervical radiculopathy. A complete rheumatologic workup to determine the cause of her neuropathy was negative. An electromyogram showed no evidence of radiculopathy or neuropathy. A cervical MRI revealed chronic flattening of the spinal cord, but the patient had no clinical evidence of myelopathy such as sensory or motor deficits on physical exam. Previous treatment strategies included unsuccessful carpel tunnel and trigger thumb release. On initial presentation her medications included methadone 10 mg twice daily and oxycodone 60 mg four times daily as needed; however, she continued to rate her pain as a 9 out of 10 in severity.\nThe patient was originally treated with a right stellate ganglion block containing ropivacaine and clonidine. This was performed under fluoroscopic guidance by injecting local anesthetic at the junction of the C6 uncinate process and vertebral body [], creating a sympathectomy to the head, neck, and upper extremities. This intervention resulted in complete symptom relief in her right upper extremity for two weeks. The patient then underwent left stellate ganglion block with similar results in her left-upper extremity.\nGiven the successful treatment of her upper extremity peripheral neuropathy with sympathetic blockade, a trial of lumbar sympathetic blockade was initiated in her lower extremities. Lumbar sympathetic blockade was performed by injection at the anterolateral surface of L2-L3 vertebral bodies []. Each side of the sympathetic blockade was separated by a time frame of approximately two weeks. Both lumbar sympathetic blocks produced symptom relief for approximately two weeks similar to the upper extremity blockade. These procedures were repeated after a two-month interval. At that time, she was still experiencing partial relief from the first series. She again remained completely pain free for several weeks following the injections.\nAs the pain partially returned, pregabalin was added to her medication regimen. However, she experienced sedation and dizziness which required discontinuation. Twice daily oral clonidine 0.1 mg was then initiated and resulted in almost complete cessation of her symptoms of peripheral neuropathy. |
Our team described a 64-year-old female with a past medical history significant for a remote history of recurrent lymphangiomatosis, recently diagnosed cervical adenocarcinoma, and presumed metastatic pancreatic cancer that presented with worsening weakness and significant gastrointestinal distress. In the past, the patient underwent repeated drainage of effusions secondary to lymphangiomatosis. The lymphangiomatosis continued to worsen and resulted in pulmonary and cardiac involvement leading to cardiac tamponade requiring a pericardial window in 2004. Ultimately, the patient underwent video-assisted thorascopic surgery and partial thoracic duct embolization. Prior to the described admission, the patient had a recent admission for abdominal discomfort and was found to have a non-bleeding gastric ulcer. The biopsy report was negative for signs of malignancy; however, she did have a progressively growing pancreatic mass resulting in obstructive jaundice. At the time the patient was treated with pancreatic duct dilation and stent placement. A pancreatic biopsy was not done at that time due to an unacceptably high risk of bleeding given the pattern of vascularity. Additionally, the patient was diagnosed with cervical adenocarcinoma shortly prior to the current admission. She did not receive any treatment prior to being hospitalized.\nAt the time of this admission, the patient presented with diffuse weakness, nausea associated with non-bloody and non-bilious vomiting, worsening swelling of the upper and lower extremities for 2 months and a decrease in appetite. Vital signs on admission were a heart rate of 90 beats per minute, respiratory rate of 18 breaths per minute, temperature of 98 °F measured orally and oxygen saturation of 98% on room air. Physical examination was significant for scleral icterus, abdominal distension with a fluid wave, extensive edema in the upper and lower extremities as well as diffuse jaundice. Cardiopulmonary examination did not reveal any acute findings. Of note, there was a chronic sacral lesion with peripheral erythema and edema. Laboratory workup including complete metabolic panel (CMP), complete blood counts (CBCs), and additional testing, as summarized in , were significant for a mild leukocytosis, severe anemia and acute kidney injury. Additionally, the creatinine on admission was 2.70 mg/dL but was as low as 0.68 mg/dL within the past year. There was also an elevated anion gap metabolic acidosis but a lactic acid that was within the normal range. The extent of biliary disease was also evident by the hyperbilirubinemia (18.1 mg/dL) and hypoalbuminemia (1.1 g/dL).\nGiven the underlying abdominal distension, a computed tomography (CT) scan of the abdomen was significant for a 72 mm pelvic mass in addition to diffuse anasarca, severe intrahepatic and extrahepatic biliary duct dilatation with pneumobilia and a previously placed stent. Reflex CA19 and CA125 levels were significantly elevated to 56,560 and 166.7 U/mL, respectively. Carcinoembryonic antigen (CEA) levels were non-elevated. Given the findings on CT imaging and the tumor markers, it is likely that the patient had a primary pancreatic cancer with metastasis to the liver.\nGiven the underlying abdominal findings on imaging, the patient underwent further intervention by gastroenterology and surgery. In order to rule out cardiac causes of peripheral edema, a transthoracic echocardiogram was performed. Imaging results were significant for an ejection fraction of 65-70% with no signs of diastolic dysfunction. Valvular evaluation was significant for moderate tricuspid regurgitation. Severe pulmonary hypertension was present as well. Most concerning, as seen in , there was coronary sinus dilation with overlying thrombus present.\nThe patient underwent evaluation by multiple specialties given the extensive number of active medical problems on admission. The patient was treated with serial transfusions for the severe anemia. The leukocytosis was approached with initial administration of broad-spectrum antibiotics followed by serial blood cultures and body fluid cultures. Patient underwent a paracentesis due to severe ascites and cultures resulted positive for Klebsiella pneumonia. Blood cultures were also positive for Klebsiella pneumonia in two vials, each of which was drawn from a different site. Initially, patient was treated with broad spectrum antibiotics with repeat sets of blood cultures to monitor for resolution. Once the bacteremia had cleared and cultures had speciated, the patient completed a 2-week course of piperacillin-tazobactam 3.0 - 0.375 g.\nUnfortunately, after an extensive discussion with the patient and their next of kin, the patient had decided to abandon all aggressive measures and proceed with comfort care. The nature of the disease as well as diagnosis of CST had been thoroughly explained yet they refused to commit to anticoagulation or invasive intervention. |
Patient 2 is a 78-year-old male who was experiencing persistent lower urinary tract symptoms despite combined medical therapy with alpha blockade and 5-alpha reductase inhibitors. His medical history included coronary artery disease status post-coronary artery bypass grafting and percutaneous coronary intervention, and a history of pneumonia. Preoperative cystoscopy revealed enlarged median and lateral lobes, as well as severe trabeculations of the bladder with a TRUS measuring a 41 cc prostate. HoLEP was carried out utilizing a two-incision technique. Upon completion of morcellation, it was noted that the patient's abdomen was distended, but his peak airway pressures were normal, the abdomen was soft, and the catheter drainage was noted to be clear. In addition, there was no suspicion for a significant mismatch between irrigation used and fluid output collected in the drainage system.\nGiven the previous similar presentation in Case 1 with no suspicion of bladder injury, we suspected that the patient had extraperitoneal extravasation of the saline irrigation through a capsular perforation as occurred in Case 1. The decision was made for the patient to be awakened, extubated, and transferred to the recovery room where he was further monitored. A stat noncontrast abdominal CT scan was performed that revealed a moderate amount of free fluid in the pelvis and upper abdomen; the fluid in the pelvis and lower abdomen was distributed in the extraperitoneal region with no evidence of hematoma (). The patient remained hemodynamically stable and was transferred to the floor with continuous bladder irrigation. The patient was given a 40 mg dose of Lasix ∼8 hours after the operation was completed. Overnight, there were no acute events. On POD 1, the patient's abdomen was soft and significantly less distended. The Foley catheter drained 3950 cc of urine overnight without evidence of hematuria. The patient was discharged with a catheter on POD 1. The patient had his catheter removed on POD 9. A postoperative CT cystogram revealed no evidence of leak with resolution of the pelvic and perivesical fluid (). Thirty grams of benign prostate tissue was removed on final pathology analysis. The patient was noted to have a bladder neck contracture seen on cystoscopy 4 months after his procedure for which he underwent cystourethroscopy and laser incision of bladder neck contracture. |
A 46-year old male patient was admitted to our hospital via the emergency room due to neck pain that occurred after falling from a height of 2 m. At the time of admission, level of consciousness and vital signs were normal without particular underlying diseases in the past.\nFracture in the 1st cervical vertebra was found without malformations such as basilar invagination in the relevant tests including blood test, urine test, radiography, computed tomography (CT), magnetic resonance imaging (MRI) of cervical spine, and brain CT, all of which were performed for the purpose of differential diagnosis and to detect comorbidity (). Physical and neurological examinations revealed decreased gag reflex in the left and deviation of the tongue to the left on protrusion.\nAt day 2 of admission, posterior fixation was performed from the occiput through C3 (). At day 15 of admission, the patient complained of dysphagia and aspiration symptoms such as cough and choking during food swallowing. Thus, a videofluoroscopic swallowing study (VFSS) was performed. In the swallowing study, only the thick barium (thick liquid) study was possible, and further study could not be performed due to the risk of aspiration. It showed retention of food in the oral cavity after swallowing and delayed oral transit time. In addition, it was found that pharyngeal reflex was weak in the pharyngeal phase and movement of the pharyngeal wall was decreased. Test food rarely went below the pharyngoesophageal junction due to the poor relaxation of the upper esophageal sphincter () and most of them remained in the vallecula and pyriformis sinus, showing aspiration into the airway ().\nAfter the study, oral feeding was stopped and nasogastric tube feeding was initiated. The patient was transferred to the department of rehabilitation at day 17 of admission for rehabilitation treatment of dysphasia. Physical examination performed after the transfer showed decreased muscular strength of fair grade (grade III) in the flexors, extensors, abductors, and adductors of both shoulders. Other than that no particular finding were recorded, and the sensory function was normal. Atrophy of the left trapezius muscle and winged scapula in the left were observed ().\nNeurological examination still showed limited laryngeal elevation, decreased gag reflex and deviation of tongue to the left on protrusion (). A follow-up videofluoroscopic swallowing study performed at day 29 of admission showed similar results to that of the previous examinations.\nAn electrodiagnostic study was performed at day 31 of admission to assess the degree of damage of the lower cranial nerves. Needle electromyography showed abnormal spontaneous activities such as positive sharp waves and fibrillation potentials in the cricothyroid muscle, trapezius muscle and sternocleidomastoideus. In addition, although polyphasic motor unit was not observed during muscular contraction, decreased recruitment patterns were observed, which led to the diagnosis of cranial neuropathy in the 9th, 10th and 12th in the left (). No paralysis of glottis was observed in the laryngeal endoscopic examination which was performed at day 32 of admission to assess the degree of paralysis of glottis due to damage of cranial nerves.\nSwallowing rehabilitation treatments such as oral and pharyngolaryngeal muscle reinforcement exercise, swallowing refl ex exercise, functional electric stimulation therapy and ice cube swallowing were performed during the hospitalization in the department of rehabilitation. At day 40 of admission, laryngeal elevation improved and at day 50 deviation of tongue to the left on protrusion was improved (). Follow-up VFSS performed at day 57 of admission showed normal pharyngeal reflex, improved, but a decreased movement of pharyngeal wall and the poor relaxation of upper esophageal sphincter. Also, there was massive aspiration finding, so the nasogastric tube feeding was preserved. |
A 50-year-old Mediterranean woman presented with 1-year history of involuntary movement of the toes of her right foot. Our patient was not known to have diabetes or hypertension. Initially, the patient started to have an odd but painless feeling in her foot; she described the feeling as something moving inside her foot. This had gradually progressed to visible movement of the toes of her right foot; she did not describe any aggravating or relieving factors to the movement. However, the severity of movement varied during the day. There was no history of lower limb trauma or psychological problems. There was no history of neuroleptics use or symptoms of thyroid disease [, ]. Our patient reported that she had a history of low back pain 15 years ago. She had been told that surgery was required for her lower back pain but she did not recall the reason for the surgery; unfortunately, her previous MRI scan was not available.\nOn clinical examination, our patient appeared healthy with no signs of anxiety or psychological problems. She had a normal gait with normal tandem gait and a negative Romberg’s sign. The movement did not affect her gait and she could walk on her toes and her heels . Her upper and lower limb power and reflexes were normal. There was normal coordination of the upper and lower limbs with no evidence of cerebellar signs, nystagmus or ophthalmoplegia. Her peripheral pulses were intact but there was mild swelling of her feet and legs due to mild varicose veins.\nThe movement was a continuous semirhythmic movement involving the right first, second, third and fourth toes. It was a constant, flexion/relaxation movement with a variable frequency between 0.5 and 1 Hz. There was no associated visible movement of her ankle or calf muscles. The patient was able to temporarily suppress the movement by powerful extension of her toes and dorsiflexion of her ankle.\nLaboratory investigations did not show any remarkable abnormalities. Her vitamin B12 level was normal and she was already on vitamin D3 treatment. A nerve conduction study of her right lower limb showed no evidence of demyelination or axonal loss. There was no neurophysiological evidence of peroneal nerve compression at the fibular head or tarsal tunnel syndrome. F wave examination and electromyography (EMG) did not show any evidence of denervation.\nA lumbar MRI scan demonstrated a mild disc protrusion between L4 and L5. There was a much smaller disc protrusion between L5 and S1. Both discs did not show spinal cord or nerve root compression on axial view. A Tarlov cyst was seen at the sacral area (Fig. ). |
An eighteen-year old female was referred to Saint John of Jerusalem Eye Hospital Group uveitis ophthalmology clinic for a specialist consultation regarding bilateral recurrent iridocyclitis. Her long medical history dated back to when she was just 1 year of age when she developed diffuse polyarthritis, mainly targeting both wrists and ankles. Her parents took her to the pediatric rheumatologist who diagnosed her with juvenile idiopathic arthritis (JIA) and treated her mainly with prednisone and methotrexate. During the following years, and because of the lack of compliance to her medications, her arthritis was not well controlled. Therefore, she suffered from intermittent arthritis mainly affecting her wrists and hand joints which were associated with pain and swelling with spontaneous remissions. At the age of 7 years, she started having problems with her eyes; however, she had poor follow up for her condition. She presented multiple times to her local ophthalmologist with recurrent attacks of redness in her eyes and until just 1 year prior to presenting to us, when she was 16 years of age, she was diagnosed with bilateral anterior uveitis.\nThe ophthalmologist who referred the patient reported her complaint of redness and blurred vision in both eyes since 2 months and on slit lamp examination she had right eye vitreous snowballs and a hazy view along with the presence of anterior chamber inflammatory cells in both eyes but more in the right eye. She also had a history of dry eyes and was on lubricating eye drops.\nOn presentation to our clinic the patient was on oral prednisolone 5 mg/day, hydroxychloroquine 200 mg/day and omega 3 since 1 month. On slit lamp examination, keratic precipitates and inflammatory cells in the anterior chambers of eyes (+ 3 in the right eye and + 2 in the left eye) were found. Her fundus exam showed vitritis and snowballs bilaterally as well. In addition to the ocular findings, she had painless fixed flexion deformity of the proximal interphalangeal joints of the fourth and fifth fingers in both hands, known as camptodactyly (Fig. ). Moreover, the patient’s sister, aged 19 years old, had bilateral intermediate uvietis and camptodactyly of hands and feet (Fig. ). Also both eyes of their father had signs of old posterior uveitis; his left eye showed posterior synechiae 360°, a mature cataract, and old KPs, and he also had camptodactyly of both hands and feet (Fig. ).\nBased on the findings, the patient was diagnosed with recurrent bilateral intermediate uveitis and continued treatment with an increased dose of oral prednisolone (10 mg/day) as well as methorexate and she was given atropine eye drops for 1 week and steroid eye drops which was tapered gradually on each following visit. Subcutaneous Adalimumab (40 mg every 2 weeks) was added shortly after that. Moreover, she was advised to follow up with her pediatric rheumatologist for better control of her arthritis.\nMultiple lab tests were ordered and the results were as follows: her complete blood count, kidney and liver function tests, erythrocyte sedimentation rate and C- reactive protein were within normal range. Anti-nuclear antibodies (ANAs) were negative and titers for rheumatoid factor (RF) were within normal range. Serologic testing for Hepatitis B surface antigen (HBsAG) and anti-hepatitis C virus (Anti- HCV) antibodies were negative. She also did the mantoux test (PPD) which was nonreactive. A chest x-ray and a CT scan showed scattered bronchiectasis in both lungs. Pulmonary function test and angiotensin-converting enzyme (ACE) blood levels were also ordered to rule out sarcoidosis and both of them were normal.\nIn view of the rheumatological presentation and the ophthalmological findings of intermediate uveitis, along with all of the mentioned laboratory tests being normal, it was clear that this patient may in fact not have JIA. The diagnosis was leaning more toward some sort of syndrome. Moreover, due to the fact that not only our patient had these clinical manifestations but also other members of her family, this made us think of a genetic entity. Therefore the next step was to do genetic analysis for the patient and her family via whole exome sequencing which revealed a heterozygous gain-of-function missense mutation in the NOD2 gene (p.R334Q), and therefore Blau syndrome was diagnosed (Fig. ).\nAfter that, an echocardiogram was done to rule out any cardiac involvement (pericarditis) which was free. Also an ocular optical coherence tomograpghy (OCT) was performed which only showed vitreous changes (Fig. ). She continued on the same medications with oral prednisolone (10 mg/day) and subcutaneous Adalimumab (40 mg every 2 weeks) as maintenance drugs. She responded good to the treatment and is currently doing well except for mild flare ups which were controlled with steroid eye drops. |
The patient was a 66-year-old male with advanced malignant prostate cancer, bone metastases, and kidney failure requiring dialysis. While an inpatient at a cancer hospital, he was transported to the intensive care unit (ICU) for catheter placement and a hemodialysis session. The professional on duty chose a left subclavian vein access, using anatomic landmarks. The blood aspirate at puncture appeared to be venous and the guidewire was advanced without difficulties, but after dilation of the tract and insertion of the catheter, retrograde pulsating flow was observed. Inadvertent positioning in the left subclavian artery (LSA) was confirmed by blood gas analysis and Doppler ultrasound ( ). The examination ruled out the possibility of injuries to the carotid or vertebral vessels, which had normal morphology and blood flow. Physical examination found 4+ brachial and radial pulses. The device was left in place and the patient was transferred to a hospital with vascular and endovascular surgery services. Inherent problems within the Brazilian National Health Service (SUS - Sistema Único de Saúde) delayed the transfer by 18 days. Since there was a risk of fatal complications, the catheter was not removed from the LSA and the patient was not given anticoagulation because of a recent history of melena. After transfer, the catheter was removed, but endovascular repair was not possible because a thrombus was seen in the arterial lumen. There was no bleeding or formation of hematoma, and left upper limb perfusion was maintained, although the brachial pulse was rated 2+ and the distal pulses were absent at that time. The patient was transferred back to the cancer hospital. Doppler vascular echography was conducted again, showing a subacute thrombus in the LSA, where flow was monophasic ( \n ), constituting subocclusion. The arterial thrombosis was in topography distal of the emergence of the vertebral artery, in which flow was laminar, anterograde and with velocities within the limits of normality ( ). At the subclavian-axillary transition, an arterial branch was observed with reversed flow that, based on topography, may have been the dorsal scapular artery ( ). The axillary ( ) and brachial arteries were patent and exhibited slow, low resistance flow, as did the radial and ulnar arteries. The conduct adopted in this case was watching and waiting since, in addition to the contraindication to anticoagulation already mentioned, the patient’s level of morbidity was elevated for an attempt at open revascularization and predictive indicators of the success of a possible bypass were unfavorable: the time elapsed since thrombus formation (22 days), the poor prognosis of the patient’s cancer, and the presence of kidney failure. The patient was observed for a further 2 weeks and did not show any sign of cyanosis, pain at rest, or trophic lesions. He was discharged from hospital for palliative home care. |
A 52-year-old man was found to have pulmonary adenocarcinoma of the right upper lobe with invasion to upper thoracic vertebral bodies. Complete tumor resection was planned via right upper lobectomy and total vertebrectomy (Th2–4) with corresponding costectomy. Prior to surgery, catheter embolization was tried to prevent massive bleeding from the tumor and around the vertebrae, but it failed. Accordingly, total vertebrectomy following bilateral video-assisted thoracoscopic surgery was scheduled for ligation of feeding intercostal arteries and exfoliation of the tumor.\nAfter administration of 100% oxygen, general anesthesia was induced with propofol, fentanyl, remifentanil, and rocuronium. For maintenance of anesthesia, we used propofol and remifentanil in consideration of motor evoked potential monitoring. An arterial line was placed in the left radial artery and a pulse oximeter attached to his left hand.\nThe intrathoracic procedure in the right and left lateral decubitus positions was completed uneventfully. Then, the patient was turned to the prone position for total vertebrectomy approached via a posterior midline incision. When the surgical procedure reached the area around the vertebral bodies, arterial systolic blood pressure suddenly dropped from 90 to 43 mmHg. Because we suspected massive hemorrhage from vessels around the vertebrae, we asked the surgeons to interrupt the operation. At the same time, we performed rapid infusion and transfusion and administered phenylephrine. Then, his blood pressure was restored to the previous value and the operation was resumed. After a short time, his blood pressure dropped again (Fig. ) without any sign of bleeding at the surgical site, so we considered other reasons for the low blood pressure. Despite extremely low pulse pressure in the left radial artery, we could palpate the right radial artery, so we started to monitor the pressure of the right radial artery. We found an interarm pressure difference and the possibility of reduced blood flow in the left upper limb. We suspected left subclavian artery malperfusion due to the surgical procedure at that time. We were also afraid of malperfusion of an unmonitored aortic arch branch, the left common carotid artery, because we thought that resection of intercostal arteries and exfoliation between the upper thoracic vertebral bodies and posterior mediastinum tissues caused impaired fixation of the descending aorta and aortic arch, which might easily result in ventral displacement under the influence of pressure from the dorsal side. We considered whether to add a cerebral regional oxygenation (rSO2) monitoring, but attachment of rSO2 sensors to his forehead was difficult in the prone position. The bispectral index and motor evoked potentials of the upper extremities were unchanged. Therefore, the operation continued with intermittent malperfusion of the left arm, and when it was prolonged, we asked the surgeons to release the compression. The malperfusion was observed over 10 h until closure of the thoracic cavity and never observed after that. The total time of operation was 23 h (the prone position lasted over 17 h) and intraoperative blood loss was 4220 ml.\nThe patient was transported to our ICU under mechanical ventilation and extubated 30 h after his ICU admission. He did not have any signs of cerebral ischemia or left arm neurological or ischemic damage.\nPostoperatively, we reviewed enhanced computed tomography scans of the patient, and a slightly compressed left subclavian artery between the first rib and anterior scalene muscle was pointed out (Fig. ). However, he had never felt any clinical symptoms previously. His condition was finally diagnosed as accidental arterial TOS resulting from the surgical procedure and his position during the operation. Further diagnostic test such as CT angiography was not performed because of its little value for his postoperative treatment.\nTOS is a disorder with signs and symptoms produced by compression of nerves or vessels, or both, at the thoracic outlet. The most common type is neurogenic TOS, and vascular types (arterial or venous) are relatively rare []. For anesthetized patients, TOS is a very critical condition because they cannot complain about their symptoms. Vascular types of TOS may be recognized as an interarm blood pressure difference, loss of the plethysmographic waveform, edema, and obstruction of IV lines in the affected limb, but neurogenic TOS cannot be noticed during general anesthesia.\nThere may be two major causes for the intraoperative occurrence of TOS, the position of the patient and compression of the thorax mainly due to surgical maneuvers. Mouton et al. [] reported a case of positional arterial TOS in the left lateral park bench position for neurosurgery, and they continued the operation after repositioning of the patient. Kim et al. [] reported a case of arterial TOS that occurred due to pressure applied to the surgical site during spine surgery in the prone position. In that position, the thorax tends to be compressed by the patient’s own weight and TOS symptoms seem likely to appear with compressive force from the dorsal side.\nIn our case, in addition to the prone position, the patient’s upper limb positioning might have affected the occurrence of TOS. Our patient’s upper limbs were fixed with shoulders in the 90° abducted position and elbows flexed to 90°, as for the Roos test, a diagnostic stress test for TOS []. This arm positioning stretches the neurovascular bundle and can provoke TOS symptoms. If we had noticed TOS and its mechanism, we could reposition his upper limbs to avoid malperfusion. The compression from the surgical site, together with positional risk factors, was considered to be the cause of the left subclavian artery malperfusion. We assumed that the ascending aorta and aortic arch were pressed and displaced ventrally during resection of the vertebrae and contributed to malperfusion in the current case. This is because the left radial artery pressure decreased even while surgeons did not compress his thorax during exfoliation between the upper thoracic vertebral bodies and posterior mediastinum tissues.\nBecause the arterial TOS in our case was not continuous but intermittent, we continued the operation after we noticed the malperfusion of the left subclavian artery. However, even if arterial compression is intermittent, there is a risk of intimal damage, aneurysm formation, and thrombosis due to repeated compression of the artery. If arterial TOS is accompanied by neurogenic TOS, severe peripheral nerve injuries may arise silently during the long period of general anesthesia. Accordingly, preoperative risk assessment based on the patient’s anatomical factors, positional risk during the operation, and surgical confounding is very important, not to mention early detection once it happens. For prevention of intraoperative TOS, it might be better to fix patient’s upper limbs along the trunk, if the patient has some risk factors of intraoperative TOS. For early detection of pulselessness in one side of an upper limb, it might be useful to monitor pulse waveform of bilateral upper limbs using pulse oximeters and/or arterial lines. Once TOS is suspected, careful repositioning of the patient may be effective to reduce compression of the neurovascular bundle. |
An otherwise healthy 44-year-old female nurse presented with a painful left arm and hand, 2 weeks after she had fallen onto the outstretched left arm while hiking. She sought medical attention when she developed Raynaud’s phenomenon and was unable to feel pulses at the wrist, and clinical evaluation suggested thrombosis of the left brachial, radial and ulnar arteries. Contrast-enhanced computed tomography (Figs and ) and catheter-based arteriography (Fig. ) confirmed the diagnosis and showed that while there was no cervical rib or other bony abnormality, there was focal stenosis of the left subclavian artery at the level of the first rib with mild post-stenotic dilatation. These findings indicated that the subclavian artery was the source of thromboembolism and the patient was successfully treated with catheter-based thrombolysis to resolve the acute obstruction. She was discharged on a direct oral anticoagulant but returned within several weeks after recurrence of symptoms. She was found to have rethrombosis and again underwent thrombolysis, followed by anticoagulation with an alternative agent, and was then referred to our specialized TOS center for surgical treatment.\nClinical evaluation revealed an absence of palpable pulses at the left wrist but adequate arterial circulation to the hand at rest, with brisk capillary refill in the fingers and no signs of digital embolism. Upper extremity strength, sensation and range of motion were normal and there were no signs of swelling, edema or cyanosis to suggest venous obstruction. The patient was brought to the operating room for thoracic outlet decompression using a left supraclavicular approach. After mobilizing and rotating the scalene fat pad on a lateral pedicle, the phrenic nerve was identified in its expected position on the surface of the anterior scalene muscle; however, the subclavian artery was not found within the scalene triangle adjacent to the brachial plexus, but in front of the anterior scalene muscle insertion on the first rib, in the costoclavicular space directly posterior to the phrenic nerve (Figs and ). Thoracic outlet decompression was performed with anterior and middle scalenectomy, brachial plexus neurolysis and first rib resection []. Direct inspection and intraoperative left upper extremity arteriography demonstrated post-stenotic dilatation of the subclavian artery and chronic occlusion of the brachial artery with abundant collaterals. The affected segment of the subclavian artery was resected and found to contain an ulcerated lesion with thrombus (Fig. ), and the artery was reconstructed with a 6-mm diameter cryopreserved femoral artery interposition graft (Fig. ). The patient was discharged on postoperative Day 3 taking a direct oral anticoagulant and she was clinically stable during subsequent follow-up. |
A 30-year-old nulliparous Caucasian woman had a normal vaginal delivery in hospital at 38-week gestation. She had a spontaneous rupture of membranes and onset of labour 10 hours later. First stage of labour was 4.5 hours and second stage 1.5 hours. Although she did not have a prolonged second stage of labour she had been crying out loudly during the labour, as she had declined an epidural anaesthetic and all other forms of analgesia. She delivered a healthy boy weighing 3500 g.\nHer husband noted that she had a swollen neck on the first postpartum day, and relatives who had been speaking with her over the telephone had commented that her voice was altered. The patient reported that when she first stood up after the delivery she had felt a tight sensation in her neck and upper chest which worsened with deep inspiration. However, she denied any shortness of breath. She did have some difficulty swallowing initially and a sore throat but felt that this had improved and was tolerating a normal diet.\nOn examination she was not in respiratory distress, and oxygen saturation was 98% on room air. She did not appear pale or cyanosed. Blood pressure was 110/70 mmHg and heart rate 90 bpm. She was afebrile. There was palpable crepitus over both sides of her neck up to the level of the preauricular region on the right.\nThere was isolated T wave inversion in lead III of the electrocardiogram which is not unusual in pregnancy. Chest X-ray revealed extensive subcutaneous emphysema in the neck and over the right chest wall with a small pneumothorax on the right and minor pneumomediastinum []. Arterial blood gas analysis was normal.\nShe was transferred to a tertiary centre where she underwent a gastrografin swallow fluoroscopy to exclude oesophageal perforation. The swallow was normal, and she requested discharge from the hospital the next day. However, home reviews by the midwife reported that the subcutaneous emphysema had resolved by day 5 postpartum. |
The second case is a 75-year-old Irish woman with a psychiatric history of bipolar affective disorder, stable for several years on olanzapine and valproate, enabling her to lead an independent lifestyle. There was no history of cognitive impairment. She suffered from multiple medical conditions including: atrial fibrillation, type 2 diabetes mellitus, obstructive sleep apnea, and a recent mitral valve repair complicated by postoperative delirium.\nShe was admitted medically to a rural Irish hospital in November 2015 for management of a raised INR. During the admission she developed sudden onset left-sided weakness and altered levels of consciousness, as well as rigidity and one isolated temperature spike. The concern was raised that she may be or might have been suffering from neuroleptic malignant syndrome and her neuroleptics were stopped as a precaution (Table ). She was transferred to the intensive care unit (ICU) in the MMUH in Dublin with a suspicion of neuroleptic malignant syndrome or encephalopathy. Computed tomography (CT) brain imaging was normal at the time. As neuroleptic malignant syndrome was suspected, olanzapine was stopped. However, her creatinine kinase levels were normal as was her body temperature. Hence, neuroleptic malignant syndrome was deemed to be unlikely. An electroencephalogram during admission showed changes suspicious of encephalopathy and MRI imaging showed no acute abnormality. A working diagnosis of metabolic encephalopathy was established but extensive investigations yielded no cause for the encephalopathy.\nDue to prolonged altered levels of consciousness and unexplained altered mental state, the Liaison Psychiatry service was consulted in January 2016.\nOn examination, she responded with a mouthed single word greeting, but made no other attempt at verbal interactions. She inconsistently followed the examiner with her gaze, but stared out of the window for most of the examination. On physical examination she presented with waxy resistance to passive movement and psychomotor retardation. The impression was that these features were most likely related to a catatonic exacerbation of her bipolar affective disorder, in the absence of an organic explanation. She was diagnosed as having bipolar I disorder with catatonia as per DSM-5 (Table ).\nDelirium was raised as a differential diagnosis (Table ), but she had been reviewed in September 2015 by the Liaison service, when she was delirious after her valve replacement and her presentation was distinctly different on that occasion.\nShe was initially treated with intravenously administered lorazepam, but became drowsy, with a significant drop in Glasgow Coma Scale (GCS). As such the treatment was abandoned. Instead, olanzapine was cautiously reintroduced, which led to a significant improvement in her mental state within days. On follow-up review, she was mildly confused but engaged well at interview, and was euthymic with no evidence of thought disorder or movement disturbance. Subsequently she was discharged back to her own home. She was not reviewed at 6-month follow-up as she was living in a rural area and was followed up in her local service.\nOf note, in 2017, the same patient was readmitted to the MMUH ICU, from the same peripheral hospital, in a very similar state to the presentation in November 2015. Again her neuroleptics had been stopped when she was acutely unwell and she developed typical traits of acute catatonia. She was trialled on lorazepam, which she did not tolerate and reinstitution of her neuroleptics brought no improvement. The therapy was then escalated to electroconvulsive therapy (ECT), to which she had a dramatic response and significant improvement of her mental state. |
A 65-year-old man presented to the surgical department with left inguinal hernia found in medical examinations and he had no significant medical history. Laparoscopic transabdominal preperitoneal inguinal hernia was performed. When we inserted a trocar into the peritoneal cavity, the trocar directly entered the bowel because of the presence of adhesions. We then repaired the injured small intestine and identified a fibrotic membrane covering the small intestine. He was diagnosed with ACS. Hernia repair was completed by converting to laparoscopic totally extraperitoneal repair with mesh. On the third postoperative day he was discharged without complications.\nTwo weeks later after discharge, he presented to the emergency department with abdominal pain, nausea, vomiting and inability to defecate or pass gas. On examination he was afebrile and his vitals were stable. Only distension of the abdomen was observed. The laboratory examinations were normal, except high CRP level (4.27 mg/dL). Plain abdominal X-rays showed air–fluid levels and abdominal CT showed adhesions at the periumbilical area with dilated small bowel (). He was initially managed conservatively with bowel rest, nasogastric decompression and nutritional support.\nConservative treatment had no effect on the patient and exploratory laparotomy was performed. On exploration, there were a dense fibrous sac encasing the entire small intestine and dense adhesions between intestinal loops. We performed excision of the membrane off the intestinal surface, complete enterolysis with release of the bowel loops, and resection and anastomosis of small bowel that caused obstruction ( and ).\nThe patient manifested clinical signs of ileus on postoperative day 10 and was managed conservatively. Postoperative day 14, he complained of abdominal pain and fever, after which greenish discharge drained through the operation wound. He was suspected of bowel leakage and urgently taken into operation. On laparotomy, there was 200–300 ml greenish fluid in the peritoneal cavity and peritoneal lavage was done. We could not explore the leakage site because of the very severe adhesion after surgery. Multiple drainage tube was inserted under suspicion of anastomotic leakage. We planned to treat the patient conservatively with abdominal drainage, nasogastric decompression, antibiotics, and nutritional support. After 4 weeks of conservative treatment, he recovered well and started diet. Then, he recovered gradually and was discharged on postoperative day 48. He is being followed up without any symptoms for 6 months.\nThe Institutional Review Board of Pusan National University Hospital approved this study and waived the informed consent requirement. |
A 68-year-old man was admitted to our hospital in March 2012 complaining of a big mass which he reported had begun to grow 2 years previously. Written informed consent was obtained from the patient for publication of this case report and accompanying images.\nThis neoformation was developing progressively on both the dorsal and the volar sides of the right wrist. The subject did not report spontaneous pain, and there was no history of trauma. At physical examination, we highlighted the alteration of the anatomical profile of the right wrist which was swollen and showed no signs of cutaneous suffering. On palpation, the tumor revealed a tense-elastic consistency and the patient complained of pain during this examination. The active and passive range of motions of the wrist were possible up to the maximum degrees without any pain. We did not detect any neurovascular deficit.\nThe blood test excluded rheumatoid and infectious diseases. On the basis of these clinical elements, we performed ultrasound and magnetic resonance imaging (MRI) examinations. Both examinations showed an important synovial reaction with a pseudo cyst of about 43 mm in diameter involving the radiocarpal and intercarpal joints as well as the sheath of the flexor, the extensor tendons and abductor of the thumb ().\nThe clinical results led us to hypothesize a case of extra-articular chondromatosis requiring surgical excision in order to complete the histopathologic evaluation.\nAfter the excision of the dorsal wrist plane, we observed various gelatin-like foreign bodies originating from the tendon sheaths. The latter showed hyperplasia of the synovial tissue. Because of the difficulty in carrying out a complete excision of the numerous nodules, we performed a second surgical step using the volar access to complete the excision and radical synovectomy ().\nThe histopathologic examination confirmed the diagnosis of extra-articular chondromatosis highlighting macroscopically various gray-white neoformations composed of hyaline cartilage of 5–0.6 cm in diameter. As far as the microscopic picture was concerned, we found hypertrophic-hyperplastic process and regressive phenomena on synovial membranes as well as the presence of chondrocytes of various dimensions with round, increased volume to double size nuclei. Furthermore, the histologic evaluation showed nodules surrounded by the tenosynovial membrane. These lesions composed of cellular and lobular growth characterized by tissue islands of hyaline cartilage metaplasia in synovium. Microscopically, we observed both mature and immature cartilaginous tissue apposition in foci surrounded by fibrous tissue and linked to synovial tissue ().\nTwo years of follow-up did not reveal any post-surgery complications, reoccurrence of pathology without pain or main functional limitation of wrist (). The patient was given the Disability of the Arm, Shoulder and Hand questionnaire (DASH) test. The score was 36. |
A 6 year-old male child, sustained injury to right knee and foot while stepping down from bus and bus suddenly picked speed, injuring his right knee and foot. He fell down from the bus and subsequently his foot was run over by the bus. He presented to the emergency in a primary health center with a fracture calcaneus and a grossly swollen and bruised knee. A plaster of paris boot cast was given for fracture calcaneus and the knee injury was managed as a soft tissue injury. The patient continued to have persistent pain in right knee swelling and difficulty in walking, hence reported to us 2 months after initial injury. Physical examination of the right knee revealed tenting of skin anterolaterally, notable lateral fullness, and the patella was slightly tender, immobile, and locked. The patella was immobile even in extended knee. The knee could not be flexed because of pain and tautness of soft tissue around the patella, though overlying skin was mobile and normal. The patient was able to walk with a limp. There was no joint effusion. There was no history of previous dislocations or pathology or joint laxity. The soft tissues medial to the patella were tender. There was no palpable gap in the extensor mechanism. Radiological examination revealed a laterally wedged patella in AP view with no patellar shadow in lateral view [].\nSince closed reduction was not feasible hence, under general anesthesia, an open reduction was planned. Through midline incision, the knee was exposed and patella was found to be wedged lateral to lateral femoral condyle. There was a continuous sheet of fibrous tissue from patella to medial extensor retinaculum, giving no indication of rotational element of patella. Suspecting a clockwise rotation on its vertical axis due to its lack of mobility, an initial small incision was made on the surface of patella, which confirmed that the articular surface of patella was facing antero-laterally []. As a result, the fibrous tissue medial to patella was incised by a longitudinal incision and patella derotated in an anticlockwise direction to bring it to its normal position. There were no osteochondral fragments. The articular surfaces of the patella and the lateral femoral condyle were not damaged. The medial extensor retinaculum was repaired and plicated. The lateral extensor retinaculum being lax stretched over the articular surface of patella and did not require any release. Instead, a plication was done to take care of the laxity on lateral aspect. The knee was placed through a full range of motion and normal patellar tracking was noted.\nPostoperatively, the knee was kept in full extension with a knee immobilizer, but was allowed full weight bearing and perform isometric quadriceps strengthening exercises. After 6 weeks, he was allowed to begin active flexion and extension exercises. He had returned to his normal activities at 6 months. He had no symptoms of patellar instability, normal muscle strength, and exhibited full range of motion [Figures and ]. |
We discuss the case of a 46-year-old female who presented with a history of a recurrent lump in her right breast with no known comorbid conditions. Three years prior to the presentation, the patient had been examined at another healthcare facility for the presence of a tumor in the right breast. The physicians at this facility had performed breast conservation surgery to excise the tumor. However, the patient had experienced a subsequent recurrence. A core biopsy had been then performed, but the histopathology had turned out negative for an underlying malignancy. A modified radical mastectomy (MRM) had been then performed for her recurrent tumor, divulging positive margins on biopsy.\nThereafter, the patient presented to us with a residual mass in the right breast (Figure ).\nA core needle biopsy of the mass was subsequently performed; the histopathology report revealed a herringbone and short fascicular pattern with the cells appearing to be spindle-shaped with eosinophilic cytoplasm demonstrating vesicular to hyperchromatic nuclei and the presence of inconspicuous nucleoli. The immunohistochemical analysis further divulged the absence of cytokeratin markers and p63 and the presence of desmin. These findings are delineated in Table .\nThese immunohistochemical findings insinuated a final diagnosis of a spindle cell sarcoma. Owing to the extensive scarring from the previously performed MRM, the feasible option for treatment was a wide local excision along with an LD flap reconstruction surgery. The flap reconstruction surgery was planned in order to cover up the large wound postoperatively. However, the patient refused the surgery, citing her financial constraints. Instead, a wide local excision with a negative margin resection was performed, allowing the excision of the major/minor pectoralis muscle and exposing the ribs beneath. Interestingly, no flap construction surgery was performed. A postoperative image on the sixth day of the surgery revealed the presence of granulation tissue at the base, facilitating the healing of the wound by secondary intention despite a surgical operation with deep margins (Figure ).\nThe patient continues to do well to date, with no recurrence or complications. |
A 33-year-old primigravid African woman who had been pregnant for 40 weeks and three days dated from the first day of her last normal menstrual period presented to our unit with a three-day history of continuous pain around the umbilical area. She did not have any other complaints.\nA review of her antenatal records revealed that she had sought medical attention at her local clinic for lower abdominal pain at eight weeks and four days and once again at 14 weeks and two days of gestation. Both episodes of lower abdominal pain were managed conservatively.\nThroughout the pregnancy the patient continued to experience on and off abdominal pain which became better as the pregnancy progressed.\nShe denied any per vaginal bleeding during her pregnancy.\nOf note, the patient said that her mother had developed hypertension when she was pregnant.\nThe results of her serologic tests for human immunodeficiency virus as well as rapid plasma reagin were negative at the antenatal clinic. Her hemoglobin concentration at 22 weeks of pregnancy was 10.7g/dL. Methyldopa and nifedipine were commenced for pregnancy-induced hypertension from 22 weeks of gestation. During antenatal care visits at 26 weeks and three days, 30 weeks and three days, 34 weeks and four days, and 37 weeks and three days she was normotensive. At 38 weeks and four days her blood pressure was 150/100mmHg.\nThe patient had an ultrasound scan done at 33 weeks and three days at a local clinic which showed a single viable breech intrauterine pregnancy with a left lateral upper segment placenta, slightly reduced liquor volume and some small free fluid in the hepatorenal area. The estimated gestational age by scan was 34 weeks and two days. From the time of this ultrasound scan, the presentation by clinical examination which had previously been documented as cephalic was then documented as breech.\nBesides the on and off abdominal pain, her pregnancy had been uneventful until she developed periumbilical pain prompting her to present to our unit.\nOn examination her blood pressure was 140/90mmHg and other vital signs were within normal limits. Her body mass index (her weight in kilograms divided by the square of her height in meters) was 27. A breech presentation was the remarkable finding on obstetric examination. Admission and urgent delivery by cesarean section was advised because of the breech presentation and suspected pre-eclampsia; the patient agreed and she gave her informed consent.\nShe continued taking antihypertensives. During her admission, several of her blood pressure readings were in the severe range (≥160/110mmHg). At 40 weeks and five days of pregnancy our patient had a cesarean section performed via a Pfannenstiel incision by a junior member of the obstetric team. On entering the ‘parietal peritoneum’ a sudden gush of meconium-stained liquor issued forth. The fetal back was visualized. Delivery of the baby was done, the umbilical cord was clamped and cut and part of the placenta was removed. On recognition of the unusual circumstances, artery forceps were used to arrest bleeding from the remaining placenta and then senior help was sought. The cesarean section which was being done under spinal anesthesia was continued under general anesthesia (the patient was intubated) because severe hemorrhage was anticipated and also to minimize patient anxiety.\nAAP was diagnosed by the next most senior doctor who in turn sought assistance from the consultant.\nWhen the consultant arrived, the patient’s placenta was noted to be predominantly attached to her small bowel (Figures and ), large bowel and the superior surface of her urinary bladder. After assessment of the placental attachment site, a decision was made to remove the remaining placenta. There were large bleeders on the placental bed which was thick enough to allow figure of eight sutures to be used without compromising nearby organs.\nThe meconium-stained bowel was cleaned with normal saline; no obvious bowel defects were noted. Part of the membranes attached to the small and large bowel and bladder were left in situ. The uterus was palpable and about the size of a uterus at 10 weeks of pregnancy beneath the sac. Estimated blood loss was 1.5liters. Our patient received three units of packed red blood cells.\nThe baby girl delivered weighed 2850g and had Apgar scores of eight and 10 at one minute and five minutes respectively. Besides slight cranial asymmetry the examination of the newborn baby was unremarkable. The baby’s head circumference was 32cm (5th centile). By day 5 post-laparotomy the mother could mobilize fully, eat, drink and had normal bowel motions and micturition. The baby was breast feeding and eliminating well. Of note, the mother’s blood pressure normalized post-delivery; however, the results of a urine dipstick test showed that she had proteinuria (3+ = 3g/L).\nOn day 5 post-delivery, an ultrasound scan showed a slightly bulky uterus measuring nine cm in length not consistent with a post-delivery uterus. Notably, the scan showed ascites with fibrinous strands and internal echoes.\nThe patient requested discharge and she was discharged on day 5 after delivery on iron and folate tablets. During her stay, she was counseled on AAP and future care.\nOn day 9 after her laparotomy our patient was re-admitted with a three-day history of vomiting after meals, abdominal pain and distension; she was passing stool and flatus normally.\nA physical examination revealed a grossly distended abdomen. A repeat ultrasound scan showed gross ascites. Functional intestinal obstruction secondary to increased intra-abdominal pressure from the gross ascites was diagnosed. Serial abdominal ascitic tapping for symptomatic relief, intravenous crystalloid and antibiotics as well as low molecular weight heparin were commenced.\nOn day 15 post-surgery, 5700mL of a dark brown fluid was drained at one go from the urinary catheter and her abdominal distension subsided. Over the following days, her condition was monitored.\nThe patient and her baby were discharged from hospital on hematinics with no complaints 26 days after the birth of her baby.\nFive weeks following surgery, the patient and her baby were apparently doing well.\nAt about six months of age, the infant’s growth and development were seemingly normal. The infant’s head circumference was 40cm (5th centile); the cranial asymmetry was barely noticeable.\nAt about six months after delivery, the mother had no complaints and her physical examination was unremarkable. Her blood pressure was 160/93mmHg; she had hypokalemia (3.3mmol/L, reference range (RR) 3.6 to 5.0mmol/L) and hyponatremia (124mmol/L, RR 135 to 145mmol/L). Her chloride was 101mmol/L, RR 101 to 111mmol/L and bicarbonate, 15mmol/L, RR 21 to 31mmol/L.\nThe mother’s laboratory blood investigations are shown in Table . |
In July 2006, a 50-year-old female presented to the dermatology clinic with a complaint of painful skin changes in her bilateral lower extremities. She was employed as a dog groomer, and her past medical history was significant for type 2 diabetes mellitus with insulin requirements, gastritis, and severe valvular heart disease affecting the tricuspid, mitral, and aortic valves with surgical repair of the aortic valve. On physical examination, the patient was found to have linear, hyperpigmented macules on the bilateral lower legs with foci of scarring and ulceration. Two biopsies of the proximal and distal left lower leg suggested livedoid vasculopathy pending clinical correlation. She was additionally found to have an elevated antithrombin 3 activity of 124 (reference range 70.0–120.0), which is strongly suggestive of an underlying prothrombotic component to her condition []. At this time, therapeutic options for livedoid vasculopathy were considered and offered to the patient.\nThe patient's preferences and past medical history presented several obstacles to treatment of her LV. She repeatedly refused anticoagulant therapy because her husband had previously had issues with the diet restrictions and INR monitoring mandated by the use of warfarin. Antiplatelet agents were avoided due to her history of severe gastritis that was onset prior to our management of her LV. Intravenous immunoglobulin was considered; however, the patient could not afford the co-pay and her cardiologist recommended against IVIG due to the risk of these hyperosmolar preparations causing fluid overload in this patient with severe valvular heart disease. The patient was eventually started on an acceptable treatment regimen consisting of oral dapsone 100 mg once daily and prednisone 10 mg once daily, with the addition of doxepin or tramadol for intermittent pain control. With these medications, she achieved intermittent remission of her LV for several years.\nIn 2015, she began having intermittent, painful flares of her LV which were managed by increasing her dapsone to 150 mg once daily and increasing her prednisone to 20 mg. She sometimes required burst doses of 60 mg once daily. Attempts to wean her prednisone back down to 10 mg were rarely successful, and this dosing became an ongoing concern in 2018 when she began having severe hyperglycemic episodes which resulted in a brief hospitalization. Her insulin delivery was also switched to a pump system.\nIn the fall of 2018, she presented to dermatology during an acute LV pain flare and was coincidentally found to have an erythematous papule at the right dorsal forearm, which she attributed to a possible insect bite or a scratch from her dog. Three weeks later, she reported worsening of this right forearm lesion as well as new onset of two painful, ulcerative lesions on her right thigh and right forearm. On examination, the right dorsal forearm was now found to have two firm, tender erythematous papulonodules, one with central ulceration (). The right lateral thigh was found to have a single purpuric patch with central ulceration and necrosis (). The bilateral forearms additionally had a few scattered linear superficial abrasions consistent with animal scratches. No other new lesions were found on examination. She perceived these lesions as dissimilar from her typical LV, but at this time mycophenolate mofetil 500 mg twice daily was added for her ongoing LV flares. A 4 mm punch biopsy of a right dorsal forearm lesion revealed suppurative, granulomatous inflammation in the deep reticular dermis with demonstration of acid-fast organisms on AFB stain ().\nThe patient was subsequently evaluated for systemic mycobacterial disease. A chest X-ray showed no evidence of pulmonary mycobacterial disease. Laboratory testing was negative for HIV, AFB blood culture, and Tb QuantiFERON. Her CRP was elevated at 13.3, and the CBC revealed a mild leukocytosis of 13.00 with mild neutrophilia of 79.4%, elevated absolute neutrophils (10.3), and absolute immature granulocytes (0.4).\nThe state Department of Health identified rapidly growing Mycobacterium abscessus/chelonae on her right forearm tissue culture. Susceptibility testing and treatment guidance was subsequently provided by a national center specializing in mycobacterial consultation. Susceptibility results revealed resistance to cefoxitin, doxycycline, sulfamethoxazole-trimethoprim, and amoxicillin-clavulanic acid and sensitivity to clarithromycin, azithromycin, linezolid, imipenem, and amikacin. There was also intermediate sensitivity to ciprofloxacin and moxifloxacin.\nThe physicians of the Dermatology and Infectious Disease departments then coordinated management of her simultaneously flaring livedoid vasculopathy and disseminated cutaneous mycobacterial infection. The patient had a PICC line placed for her antimycobacterial regimen which consisted of oral azithromycin 250 mg once daily, intravenous imipenem 500 mg every 12 hours, and finally intravenous amikacin 12–15 mg/kg on Mondays, Wednesdays, and Fridays. Additional treatment with fluoroquinolones was not considered because she had a previously documented allergic reaction of a blistering skin eruption. This regimen was initially to be continued for a total of 8–12 weeks depending on her response, followed by oral azithromycin monotherapy for at least an additional 6 months. Lifelong suppression with oral monotherapy is also being considered pending her clinical response and tolerance to azithromycin.\nAt 10 weeks of treatment her physical exam revealed improvement of the ulcers of the right forearm, right thigh, and left foot. However, she also developed three new left knee ulcers consistent in appearance with her other mycobacterial lesions. For this reason, her current regimen is to be continued until her follow-up appointment for PICC line removal at 17 weeks of treatment. At that time, she will transition to daily maintenance therapy of oral azithromycin if she demonstrates adequate improvement in the existing lesions.\nMeanwhile, the treatment of her livedoid vasculopathy was optimized by the dermatology team. Her prednisone was tapered down to 10 mg once daily, and both the dapsone and mycophenolate mofetil were discontinued. She has since been started on warfarin 1 mg once daily. This low dose was chosen due to reports of supratherapeutic INR from interaction of warfarin and azithromycin []. Her LV was found to be stable at her follow-up appointment 9 weeks after initiating and continuing the same dose of warfarin. |
A 24-year-old primigravida with a singleton pregnancy was referred to our center because of the finding of an oral cyst diagnosed during a routine ultrasound at 26 weeks of gestation.\nThe medical history of the parents was unremarkable and they were nonconsanguineous.\nThe first and second trimester scans performed at 12 and 20 weeks of gestation in another center were normal.\nUltrasounds were performed using a GE Voluson 730 Expert.\nThe initial examination performed at 28 weeks of gestation showed a single male fetus with an oral cystic lesion of 18 × 10 mm, located under the tongue. The tumor appeared to be fluid and homogeneous, without solid components, with well-defined limits and it moved with the tongue movements. The most likely diagnosis with that ultrasound appearance was a congenital ranula or a thyroglossal duct cyst.\nThe fetal anatomic study found no other abnormalities, except a left renal pelvic dilatation of 7.3 mm; fetal biometric parameters and amniotic fluid index were normal ().\nFollow-up ultrasound scans performed every 2 weeks always showed appropriate fetal growth (75–90 percentile) and a normal amniotic fluid index. There were no changes in the measurements of the oral cyst and the most striking finding was that the fetus kept his mouth open during all examinations ().\nFetal magnetic resonance imaging was performed at 31 weeks and revealed a moderate left renal pelvic dilatation and an orofacial lesion of 18 × 14 mm located before the free edge of the tongue and above the lower lip, with cystic characteristics and the same echogenicity as the amniotic liquid, without evidence of fat or signal diffusion restriction. That image could correspond with a cyst probably dependent on the salivary glands ().\nAt term, the oral tumor did not show any changes in measurements and characteristics, there was no evidence of polyhydramnios, and the stomach was visible; we also could see complete tongue movements and we occasionally observed that the fetus was able to close his mouth.\nWe discussed the mode of delivery in this case with a multidisciplinary team of pediatrics, anesthesiologists, and obstetricians and we decided to try a vaginal delivery in the first place, as the tumor did not seem to compromise the fetal airway.\nLabor was induced at 40 weeks and a normal 4300 g male was born by caesarean section performed by failure to progress in labor. The Apgar score was 10/10 at 1 and 5 minutes of life.\nThe neonatal examination showed that the oral tumor was under the tongue with the same measurement seen at the intrauterine scans, without airway or digestive compromise, and the newborn did not require immediate admission to neonatal care unit ().\n72 hours after birth, the infant was admitted to the neonatal care unit due to a decrease of 600 g of weight and for excision of the cyst with a suspected diagnosis of congenital tongue mucocele. This procedure was performed without any complications and pathological definitive diagnosis was persistent thyroglossal duct of the tongue. Postoperative course was normal.\nAt the first medical examination when the infant was one month old, he had an adequate growth, uncomplicated breastfeeding and he was able to close his mouth completely.\nThe follow-up by endocrinologists at 4 and 8 months of life was normal. It included an ultrasound of the neck and thyroid gland and thyroid hormone determinations to rule out any aberrant thyroid tissue in other locations. |
A 56 years old lady from Afghanistan presented in the surgical outpatient department of our hospital with a history of laprotomy and necrosectomy for necrotizing pancreatitis in Afghanistan 10 days back. Her chief complaints were epigastric pain since surgery and fluid draining through the abdominal drain soon after drinking any liquid. This drain was on the left side of the upper abdomen. The color and consistency of fluid in drain was very similar to the fluid she would drink. On clinical examination she had no signs of septicemia and generalized peritonitis. She was afebrile with a regular pulse of 84 per minute and blood pressure of 115/75mmHg. The laprotomy wound dressing was dry and clean. There were two abdominal drains on either side of abdomen. She was admitted in ward and was investigated. Blood tests revealed WBC=1210 and shift to the left, rest of the blood count, serum electrolytes, liver function tests and renal function tests were in normal limit. Her hepatitis serology for HBS and HCV was negative. Her gastrograffin study of upper gastrointestinal tract showed external drainage of the contrast from the stomach through a drainage tube in her left upper abdominal area with suspicion of malposition of drainage tube with its tip in the stomach. CT scan showed abdominal collections in lesser sac and peri pancreatic region approximately about 60ml and 65ml respectively. Drainage tube was noticed entering through the left hemi abdominal wall entering the greater curvature and ending up in the gastric lumen. Upper gastrointestinal endoscopy revealed multiple small gastric ulcers and tip of the abdominal drain inside the stomach along the greater curvature. Patient was re-explored. Per operative findings were:\nLeft sided abdominal drain was seen, piercing the greater curvature of the stomach. About 2cm, from the tip of the drain, was found inside the stomach. Omental mass in the area of the pancreatic bed, adherent to loops of small bowel. Rest of the bowel was normal and no other abnormality was seen.\nThe abdominal drain from the stomach was removed. The edges of the gastric perforation were refreshed. Primary repair of the gastric perforation with omentopexy was done. Oral fluids were commenced on 4th post operative day. Her post operative recovery was uneventful. She was discharged home on 6th post operative day. Her first follow up was planned two weeks after the surgery. She had no active complaints and was taking normal diet, tolerating well and had normal bowel habits. |
A fifty-two-year old right-handed female with past medical history significant for type two diabetes, hypertension, and hyperlipidemia was brought to the emergency room by a friend with new onset of dizziness and unsteadiness when walking that had developed suddenly approximately one month earlier. She also reported new onset of double vision and an occipital headache both of which had developed acutely three days prior to presentation and visual and auditory hallucinations that developed one day prior to presentation.\nOn presentation to the emergency room, the patient was obtunded but able to be aroused and she could answer questions and follow simple commands when aroused. The patient was noted to be grabbing at unseen objects by the nursing staff. The patient was alert and oriented to self, location, and date. Cranial nerve examination showed fixed dilated pupils bilaterally that were not reactive to light, bilateral exotropia of the eyes at rest, and complete paresis of ocular movements. The corneal and gag reflexes were present. The patient had purposeful movement in all extremities but was noted to have more spontaneous movement of the left side limbs than the right side. Sensation for light touch and pin-prick were normal in the upper and lower extremities bilaterally. Deep tendon reflexes were also normal and symmetrical throughout.\nThe patient's visual hallucinations were formed and consisted of seeing a deceased uncle. The patient's auditory hallucinations consisted of intermittently hearing the deceased uncle's voice saying indistinct words and sentences. The patient demonstrated preserved insight: she was aware that the hallucinations were not real and that her uncle was deceased and therefore could not be present and talk to her. The patient received a single dose of haloperidol in the emergency room due to agitation, which temporarily resolved the auditory and visual hallucinations for the remainder of that night. The patient's hallucinations were initially worse at night but then gradually decreased on scheduled haloperidol.\nThe initial laboratory assessment for this patient showed a normal serum chemistry panel, normal complete blood cell count, normal urinalysis, and negative urine toxicology screen for illicit substances.\nA 1.5 Tesla magnetic resonance imaging of the brain without contrast showed areas of restricted diffusion on DWI sequences located bilaterally in the thalami, left cerebral peduncle, the mid-brain, and right external capsule consistent with acute infarcts. Additional small, scattered white matter hyperintensities were present in the periventricular regions bilaterally on the FLAIR sequence, consistent with small vessel vascular disease. The ventricles, cisterns, and sulci were normal in appearance and there was no significant atrophy. There were no intra-axial or extra-axial fluid collections, no mass, and no midline shift (). |
This report presents the case of a 49-year-old Caucasian female with a past medical and surgical history significant for acute cholecystitis, for which she underwent a laparoscopic cholecystectomy in 2009, and symptomatic uterine fibroids, for which she underwent a laparoscopic supracervical hysterectomy and bilateral salpingectomy in 2012. At that time, evidence was noted of endometriosis at the left pelvic sidewall and posterior cul-de-sac. The patient also underwent colonoscopy in 2010, where a prominent appendiceal orifice was described. No additional medical conditions are reported.\nThe patient presented to the emergency department complaining of a 5-day history of intermittent throbbing abdominal pain, initially periumbilical, but migrating to the right lower quadrant on initial presentation, which was associated with nausea and increased stool frequency. Physical exam was significant for moderate tenderness to palpation in the right lower quadrant and positive Rovsing sign. Laboratory studies were all within normal limits. Contrast CT identified lobulated tubular soft tissue and inflammation adjacent to the terminal ileum/ileocecal valve did not identify an appendix () and questioned whether the patient had previously undergone appendectomy. Without prior history of appendectomy, acute appendicitis was suggested as a highly likely diagnosis.\nFor this diagnosis, the patient was started on broad-spectrum antibiotics and underwent diagnostic laparoscopy. Mild inflammatory changes of the terminal ileum and adhesions involving the cecum, right ovary, and abdominal wall were observed without evidence of Crohn’s disease, but no appendix was identified despite full mobilization of the cecum and a thorough running of the small bowel. A biopsy of the inflamed areas was taken and revealed acute inflammatory changes surrounding the fallopian tubes as well as focuses of endometriosis. Intraoperative consultation with the colorectal surgery team was performed, and it was decided at that time to avoid further surgical interventions and continue course with intravenous antibiotics. Postoperatively, the patient began to tolerate a solid diet and was discharged on postoperative day 2, with plans for interval diagnostic colonoscopy. The patient returned to the emergency department within two hours of discharge, complaining of sharp right lower quadrant pain, nausea and vomiting. Repeat labs were significant for a white blood cell count of 13.23. Repeat CT of the abdomen and pelvis was consistent with small bowel obstruction focused at the level of the terminal ileum, likely secondary to an adjacent pericecal soft tissue mass (). Differential diagnosis of the mass was inverted appendix versus neoplasm.\nGiven the negative findings on prior diagnostic laparoscopy, a laparoscopic ileocecectomy with primary anastomosis was performed. Intraoperative inspection on the back table revealed a large inverted appendix. Gross pathologic examination identified an area of induration and fibrosis having a dark brown nodular appearance and located between the cecum and the terminal ileum. Within the bowel, an intussuscepted portion of appendix measuring 2.2 cm in length and up to 1.4 cm in diameter was identified; the appendix was not inflamed (). Cut section through this projection showed fibrous cystic spaces filled with brown-tinged fluid. The remainder of the mucosal surface was tan with irregular, prominent, tightly spaced mucosal folds. Palpation revealed an area of induration that on cut section showed a thickened bowel wall measuring up to 0.7 cm in greatest dimension. Palpation of the underlying mesentery revealed palpable lymph nodes that were found to be negative for malignancy. Final pathologic diagnosis identified that the colonic wall was extensively involved by endometriosis, endosalpingiosis and endocervicosis ().\nThe patient recovered after a short ileus and was successfully discharged home on a regular diet and having normal bowel function on postoperative day 7 from the second surgery. |
The patient was a 20-month-old girl, who was admitted due to pneumonia in the right lung. The result of a term normal delivery from a nondiabetic mother, she was the 1st child of the family. The birth weight was 2300 g and the weight at the time of admission was 7500 g. The parents were 3rd-degree relatives, but there was no history of familial diseases or abortion in the family. The patient was initially admitted at the age of 20 days due to imperforated anus with vaginal fistula, which was surgically corrected successfully at the age of 2 months. She was admitted again at 8 months and treated for pneumonia and gastroenteritis. The next admissions were at the age of 11, 14, 16, and 18 months, which were all due to pneumonia in the right lung. She was under treatment for bronchiolitis asthma and gastroesophageal reflux disease (GERD) within this period but had minimal response to these treatments. All the workups for GERD, immunodeficiency conditions, cystic fibrosis, and metabolic diseases were negative. Echocardiography at the age of 2 months revealed a patent foramen ovale (PFO) and a small VSD. Echocardiography at the age of 6 months was reported to be normal. In this admission, the parents revealed that the existence of a single kidney was reported in the gestational ultrasonography and that the patient had suffered 1 episode of urinary tract infection. In physical examination, failure to thrive and rales in the right side were prominent. A barium meal imaging was requested and it demonstrated a pressure effect on the anterior wall of the esophagus (). The following echocardiography, performed with suspicion of the VACTERL syndrome, showed no VSD or PFO but a left superior vena cava was observed. Computed scan angiography revealed a pulmonary artery sling and the origination of the left vertebral artery from the aortic arch ( and ). As the patient had a history of imperforated anus, single kidney (), and cardiovascular involvement, the VACTERL syndrome was diagnosed for her. |
A 26 year-old man attended our ophthalmic ward in April 2017 with intermittent bleeding of the right eye, from which there was also strong odor. The patient was a heavy smoker but had no other underlying conditions. He had no history of drug-use. From his medical history it was noted that the patient had undergone a right ophthalmectomy 24 years previously due to retinoblastoma, and implantation of an artificial right eyeball in 2014 (timeline shown in Additional file ).\nOn admission, his pulse rate was between 80 and 100 beats/min. His body temperature and respiratory rate were both normal. Physical examination showed narrow conjunctival sac in right eye and the exposure of ocular prosthesis, which was discharging a yellow-green secretion along with a strong odor. The visual acuity of left eye was 0.3, and the intraocular pressure was 15 mmHg. All other characteristics of the left eye were normal. A auscultation did not show any abnormality in the lungs, and no signs of carotid murmur were found. Interestingly, laboratory investigations did not reveal abnormal inflammatory markers such as leukocytosis or any increase in neutrophils or C-reaction protein. According to clinical and laboratory investigations, infectious endocarditis was not suspected. The patient had no history of other immunosuppressive conditions, except smoking and a retinoblastoma 24 years previously. The patient did not report any direct contact with animals; however, he did work in a clothing factory so would have been contact with wool and cowhide for one month of the year. Three months had elapsed between the patient last coming into contact with wool and cowhide and the appearance of clinical symptoms. Considering the results of these investigations, partial artificial eye infection, especially anaerobic organism infection, was suspected.\nImaging workups were completed, which included chest x-ray, transthoracic echocardiography and eye magnetic resonance imaging. As shown in Fig. , eye magnetic resonance imaging revealed that the tissue surrounding the right eye prosthesis as well as the soft tissue of the lacrimal gland area were swollen, whereas the left eye appeared normal. Inflammatory disease in the right eye was therefore suspected. According to chest x-ray and transthoracic echocardiography, no obvious abnormalities in the lungs or heart were observed.\nBefore surgery, a few specimens of the right eye secretions were collected to be cultured, but no bacteria were isolated, possibly because most of the secretions had been absorbed by the artifical eye making it yellow-green in appearance. After removal of the right artificial eye with debridement (5 days after admission), both the artificial eye and specimens of the eye secretions were sent for bacterial culture under aerobic and anaerobic conditions. No bacterial growth was detected from the ophthalmic secretions, but cultures were obtained from the artificial eye. Sparse growth of β-hemolytic cocci and heavy growth of small, non-hemolytic, translucent colonies were observed on Columbia agar plates supplemented with 5% sheep blood (BioMérieux, Marcy l’Etoile, France) under aerobic conditions after 48 h. And the latter colonies only grow close to the hemolysis zone of the former one. Under anaerobic conditions, only the small, translucent colonies were detected from the artificial eye (as shown in Fig. ). Of the two colony types, the β-hemolytic cocci were confirmed as Staphylococcus aureus, whereas the small, translucent colonies stained positive in a Gram stain and occurred singly, in pairs, or in short chains (Fig. ). Catalase and oxidase reactions of the unknown colonies were negative and phenotypic characterization using the Vitek2 GP system (BioMérieux) was inconclusive. However, Matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry revealed a match with Helcococcus ovis DSM 21504 T DSM (log score: 1.637) according to the Brucker Maldi-Biotyper database. Identification of this organism was confirmed by 16S rRNA gene sequencing. BLAST analysis of the partial 16S rRNA gene sequence derived from our isolate (1492 nucleotides, deposited in the GeneBank database under accession number MG188744) showed 98.9% identity (15 nucleotide differences) with the 16S rRNA gene sequence of H. ovis s840–96-2 deposited in the GenBank database under accession number NR027228 by Collins and coworkers [] in 1999 when this species was first described.\nAntimicrobial susceptibility testing (AST) of both strains was performed. The disk diffusion method was carried out and with the exception of penicillin, erythromycin and clindamycin, S. aureus isolated from this case was susceptible to all other drugs including cephalosporins and fluoroquinolones. AST for Helcococcus was performed using the CLSI broth microdilution method on Mueller-Hinton II broth (BD Diagnostics, Heidelberg, Germany) supplemented with 3% (vol/vol) lysed horse blood (Oxoid, Wesel, Germany) and 0.001% (wt/vol) pyridoxal HCl (Sigma–Aldrich, Munich, Germany) incubated at 37 °C in 5% CO2 for 24 h [, ]. Streptococcus pneumoniae ATCC 49619 served as a quality control. Then, we changed the method and performed an E-test on blood agar, with S. aureus ATCC 29213 as the quality control (for reference only). The MICs (μg/L) of the drugs for this strain are reported in Table . Since no antimicrobial testing guidelines are currently available from the Clinical and Laboratory Standards Institute (CLSI) for Helcococcus, the MICs were determined in reference to the CLSI guidelines for S. aureus []. According to the CLSI [, ], this strain was susceptible to penicillin, ampicillin, teicoplanin, ceftriaxone, vancomycin, and linezolid.\nAfter admission, the patient received levofloxacin eye drops 4 times per day until being discharged from hospital. After surgery, the patient was initially treated with intra-venous cefotaxime (2.25 g/250 ml NaCl, 1/day) and ornidazole (500 mg/day) for 1 week. Two weeks after admission, the patient recovered and was discharged from hospital. Six months later, the patient returned to the hospital to finish implantation of the artificial right eyeball and no signs of infection were detected. With the patient’s consent, we collected samples from the skin around both eyes for aerobic and anaerobic culture, but only normal skin flora were detected, such as coagulase-negative Staphylococcus. After surgery, the patient was in good health and was discharged from the hospital. |
A 30-year-old woman visited the hospital due to right lower quadrant pain over the period of 1 week. A laparoscopic myomectomy was performed 4 years ago because of a broad ligament leiomyoma, which was about 10 cm in size. Laboratory findings included a routine blood examination, and a C-Reactive Protein (CRP) test, with tumor markers all found to be within normal ranges. The pelvic Magnetic Resonance Imaging (MRI) scan showed some nodules at the posterior margin of the bladder that were considered to be endometriosis, and some pelvic effusion that was significant on the right side. It was also noted that there was a mass shadow at the lower right ureter (medial to the iliopsoas muscle), with distention of the lower right ureter (Fig. ). The patient also underwent computed tomography (CT) scans to enable the practitioners to observe the size of the abdominal mass and its surroundings. The CT images revealed a region occupying the middle right ureter that was considered to be a retroperitoneal aggressive fibroma, which led to severe hydronephrosis on the right kidney and upper ureter, and a right pelvic effusion (Fig. ). After more detailed examinations were conducted, there were no obvious abnormalities detected in the brain, heart, liver, gallbladder, spleen, pancreas or blood. The color Doppler ultrasound demonstrated that there was a hypoechoic mass next to the right iliac vessels that was closely related to the adjacent ureter. This resulted in severe hydronephrosis of the right kidney and a right upper ureteral dilatation (Fig. ). Ndzengue et al. [] reported a case of a pelvic desmoid tumor simulating a uterine leiomyoma recurrence. The patient that presented at our hospital had a history of uterine leiomyoma. We subsequently organized a multidisciplinary consultation to determine the next stage of her treatment plan. According to the patient’s surgical history, the next step would be determined after reviewing the results of the last surgical pathological wax, because the pathological nature of the retroperitoneal mass was uncertain.\nConsequently, a laparoscopic pelvic tumor resection with assistance from a Da Vinci robot was successfully conducted. A local peritoneal protuberance was observed in the right iliac vascular area. The parietal peritoneum was incised above the mass and it was carefully freed along the edge of the mass. The size of the tumor was about 6.0 cm × 5.0 cm × 3.0 cm. It had invasively grown and it was wrapped around the right ureter and the right ovarian arteries and veins. It was stuck to the psoas muscle and the iliac vessels. According to preoperative preparations and intraoperative conditions, a decision was made to cut off the right ureter, the right ovarian arteries and veins, and completely remove the tumor and the two masses that were located in front of the broad ligament on the right hand side of the uterus. The sizes of the masses were approximately 1.5 cm × 1.0 cm × 1.0 cm. The right ureter was anastomosed and put into a double J tube. A pathological diagnosis of an intraoperative frozen sample determined that it was a spindle cell soft tissue tumor, and the two masses were leiomyomas. Postoperative pathology tests of the pelvic mass determined that it was aggressive fibromatosis that had invaded the ureteral wall (Fig. ). The uterine surface nodules were also leiomyomas. Microscopically, the tumor cells were arranged sparsely in a spindle shape with blood vessels of different sizes found in the interstitial tissue. Immunohistochemical findings were found to be partially positive for smooth muscle actin (SMA) and desmin, and less than 5% ki-67 of positive cells were seen in the lesion. A detailed re-examination was performed 3 months after the initial surgery, to determine the structure and function of the ovaries. The transvaginal color Doppler ultrasonography was able to determine that the ovaries were normal in size with several follicular echoes. The blood supply to the right ovary was good. There were no obvious abnormalities in the uterus or pelvic cavity (Fig. ). The pelvic MRI and the CT scan of the whole abdomen determined that there were no abnormal lesions in the pelvis. Simultaneously, the endocrine function of the patient’s ovaries was found to be normal, and she was able to self-maturate after removing the double J tube. |
An 89-year-old fit female with a history of chronic back pain and an appendectomy during her youth completed using a McBurney incision presented with a one-day history of spontaneous pain in her right flank without any fever, chills, or other symptoms. At the time of her admission, she was not in distress, she was not febrile, and her vital signs were within normal values. On clinical examination, there was swelling with a red area measuring 12 cm × 4 cm and tenderness of the right flank around her appendectomy scar. Crepitus could be felt diffusely on her right and left flanks and the periumbilical and epigastric regions upon palpation. Blood test showed the presence of mild inflammation, with a CRP value of 7 mg/l (within normal values) and an elevated white blood cell count of 18 G/l. The rest of the laboratory results were normal. Emergency ultrasonography was unhelpful because of air interference. An abdominal CT scan () showed diffuse subcutaneous abdominal emphysema extending to the pelvis on the left side that was more pronounced on the right inguinal fossa with a bowel loop in contact with the abdominal wall. An emergency laparotomy centered on the McBurney incision showed feces and pus within the subcutaneous compartment. Furthermore, at the level of the aponeurosis of the external oblique muscle, an inflammatory diverticulum could be seen fistulizing between the lumen of the sigmoid colon loop and the necrotic subcutaneous tissue. We subsequently diagnosed intraoperatively a subcutaneous abscess and emphysema with an enteroparietal fistula caused by a ruptured sigmoid diverticulum in an incisional hernia. The necrotic tissues were excised, and the punctiform sigmoid colon fistula was closed. Revision of the rest of the sigmoid showed important adhesions between the sigmoid colon and the parietal peritoneum of the right flank and between the caecum and the sigmoid colon, respectively. The sigmoid colon also showed diffused diverticulosis with no inflammation. The cutaneous and subcutaneous tissues were left open and dressed with a negative pressure-assisted closure device on postoperative day 1. The patient received intravenous antibiotherapy for two weeks with quinolones and a third-generation cephalosporin at first which was then switched to aztreonam due to an allergic reaction. Bacteriological studies showed polymicrobial digestive bacteria (i.e., Escherichia coli, Streptococcus equinus, and Enterococcus). Subsequently, there was good clinical and biological evolution. At two weeks postoperation, she was reoperated on for closure of the wound. She was discharged from the hospital three weeks after her initial surgical intervention with the indication to continue antibiotics for a total of four weeks. |
Patient 2 is a 78-year-old male who was experiencing persistent lower urinary tract symptoms despite combined medical therapy with alpha blockade and 5-alpha reductase inhibitors. His medical history included coronary artery disease status post-coronary artery bypass grafting and percutaneous coronary intervention, and a history of pneumonia. Preoperative cystoscopy revealed enlarged median and lateral lobes, as well as severe trabeculations of the bladder with a TRUS measuring a 41 cc prostate. HoLEP was carried out utilizing a two-incision technique. Upon completion of morcellation, it was noted that the patient's abdomen was distended, but his peak airway pressures were normal, the abdomen was soft, and the catheter drainage was noted to be clear. In addition, there was no suspicion for a significant mismatch between irrigation used and fluid output collected in the drainage system.\nGiven the previous similar presentation in Case 1 with no suspicion of bladder injury, we suspected that the patient had extraperitoneal extravasation of the saline irrigation through a capsular perforation as occurred in Case 1. The decision was made for the patient to be awakened, extubated, and transferred to the recovery room where he was further monitored. A stat noncontrast abdominal CT scan was performed that revealed a moderate amount of free fluid in the pelvis and upper abdomen; the fluid in the pelvis and lower abdomen was distributed in the extraperitoneal region with no evidence of hematoma (). The patient remained hemodynamically stable and was transferred to the floor with continuous bladder irrigation. The patient was given a 40 mg dose of Lasix ∼8 hours after the operation was completed. Overnight, there were no acute events. On POD 1, the patient's abdomen was soft and significantly less distended. The Foley catheter drained 3950 cc of urine overnight without evidence of hematuria. The patient was discharged with a catheter on POD 1. The patient had his catheter removed on POD 9. A postoperative CT cystogram revealed no evidence of leak with resolution of the pelvic and perivesical fluid (). Thirty grams of benign prostate tissue was removed on final pathology analysis. The patient was noted to have a bladder neck contracture seen on cystoscopy 4 months after his procedure for which he underwent cystourethroscopy and laser incision of bladder neck contracture. |
An 18-year-old male patient reported to the Department of Conservative Dentistry and Endodontics with the complaint of pain in the left upper posterior region of the mouth since 1 week. Intraoral clinical examination of the patient revealed the presence of retained primary second molar in first and second quadrant of the oral cavity and absence of maxillary second premolars; however, there was no retained primary tooth in the mandibular arch. Remaining teeth except third molars were present in the oral cavity in their usual anatomic position. The left side primary second molar was deeply carious. The primary tooth had similar cusp-fossa relationship alike adjacent permanent teeth and infraocclusion was not clearly visible. Patient had Angle's Class I molar relationship. Furthermore, there was the absence of any obvious crowding or spacing in the permanent dentition. Radiographic examination of the left primary second molar showed the presence of deep caries involving pulp space. Furthermore, the presence of extra root in the primary left second molar and congenital absence of the second premolar tooth bud was noted, also occlusal height of primary tooth was at similar level as compared to adjacent permanent teeth in intraoral periapical radiograph []. Patient was recommended following treatment options: (1) Extraction of primary tooth followed by space closure using either crown and bridge placement or implant placement. (2) Extraction of primary tooth followed by orthodontic space closure. (3) Root canal treatment for the same tooth alike permanent tooth and follow-up. Also, in third treatment option patient was informed about the possibility of root resorption or ankylosis leading to tooth loss, which again had to be treated with implant or prosthodontic crown or bridge or orthodontic treatment. Patient insisted on saving the tooth rather than immediate extraction; hence, root canal treatment was planned. After, obtaining patient's consent root canal treatment was initiated under local anesthesia and strict rubber dam isolation. Adequate access preparation revealed four root canal orifices. Working length was measured using electronic apex locator (Root ZX™, Morrita, Tokyo, Japan) and radiographic technique using Ingle's method. Working length radiograph confirmed the presence of four separate roots and canals []. Biomechanical preparation was done using NiTi rotary endodontic instruments (Protaper™, Dentsply, New Delhi, India) in a crown down manner. 17% ethylenediaminetetraacetic acid (EDTA) and urea peroxide paste (Glyde™, Dentsply, New Delhi, India) was used as canal lubricant along with 3% sodium hypochlorite as irrigating solution. Apical canal size was prepared until size F3 for all the canals. After complete instrumentation, all canals were flushed with 17% EDTA solution to remove the smear layer followed by final flush with 5% sodium hypochlorite solution. Later on canals were completely dried using absorbent paper points (Dentsply, New Delhi, India) and all the root canals were obturated using resin based sealer (AH Plus™, New Delhi, India) and Gutta-percha points (Protaper Gutta Percha™, Dentsply, New Delhi, India) [] and the access was restored with dental composite (Ceramax Mono™, Dentsply, New Delhi, India). Post-treatment radiograph showed adequate obturation [] and the patient was asymptomatic. |
The patient, a 45-year-old woman was admitted to hospital 2 h after she suffered flame burns to the face and left upper limb after syncope in December 2018. She referred to using shampoo that she had previously used numerous times at home, then fainting for unknown reasons. This resulted in her falling into a fire basin and she was taken to hospital by her family.\nThe patient had been in good health.\nThe patient was conscious, but mentally incapacitated with generally stable vital signs and no abnormalities detected in the heart and lungs. The patient's body temperature fluctuated within the normal range after admission. The total burn area of the patient was up to 4% total body surface area (TBSA). The left temporal burn wound was about 1% of the TBSA and had formed black eschar which felt hard to touch. The burn wound on the left part of face was about 1% of the TBSA, and the base of the wound was porcelain white. Branches of blood vessels could be seen in the wound and the patient lacked sensation in the area. The left eye was slightly swollen and unable to open. Although the patient could not see, she did have a sense of light. The left external ear was dry with necrotic skin. The burn wounds in the neck, shoulder and the left upper limb were 2% of the TBSA. The skin on these wounds was avulsed. There were several blisters of different sizes which felt tender. The blood supply in the extremities was normal and peripheral circulation was good. The oral and nasal mucosa were also normal (Figure ).\nEmergency computed tomography showed symmetrical speckled calcification of bilateral basal ganglia, swelling of the soft tissue in her left eyelid, left part of her face, left temporal forehead and ear. Radiography revealed a small amount of inflammation in bilateral maxillary sinuses.\nCranial magnetic resonance imaging scan + diffusion weighted imaging showed that there was no obvious abnormality on plain scan, but bilateral inferior turbinate hypertrophy and bilateral maxillary sinus submucosal cyst were observed. Vertebral artery ultrasound showed no obvious abnormality in bilateral vertebral arteries. An electrocardiogram showed that the axis of sinus arrhythmia was unbiased. Cardiac ultrasound showed that left ventricular diastolic function had decreased to grade I. Also, mitral valve and tricuspid regurgitation were observed. Ultrasound also showed a gallbladder polyp while a chest orthopedic film of the lung, heart, and diaphragm did not show obvious abnormalities.\nUrgent routine blood examination was carried out after admission. The patient’s neutrophil count was 13.97 × 109. Red blood cell count, hemoglobin and platelet count were normal. Blood glucose was 9.2 mmol/L. Potassium ion, sodium ion and chloride ion were all in the normal range. Blood bacterial culture was observed to be negative after admission. The patient was treated with oxygen inhalation, anti-inflammatory drugs, detumescence, rehydration, and debridement. Hyperbaric oxygen therapy was administered 10 times. |
The 78-year-old female patient presented initially with one-year history of gradually progressing left facial numbness involving the upper lip, cheek, and forehead accompanied by electric shock-like sensations. Her past medical history was significant for a lentigo maligna melanoma removed 5 years before this initial presentation. An MRI revealed an enhancing mass lesion of the left trigeminal nerve with an appearance consistent with trigeminal schwannoma. The lesion extended from the preganglionic segment into the cavernous sinus. Two months later, another MRI revealed a slight increase in size of the lesion (). Three months after her initial presentation, the patient received her first Gamma Knife treatment of 13 Gy at the 50% isodose line (). This dose was determined based on standard treatment doses for vestibular schwannoma, a lesion also routinely treated with Gamma Knife. An MRI three months after treatment showed a decrease in size of the mass, and the patient reported a modest decrease in symptoms.\nOne year later, an MRI showed interval enlargement of the treated lesion. The tumor had developed a cystic appearance with definite growth at the edges. At this time, the patient reported a worsening of her symptoms to include left oculomotor paresis and diplopia, increased facial weakness and numbness over all three divisions of the trigeminal nerve, and atrophy of the left masseter. Since such aggressive progression would be inconsistent with schwannoma, a PET/CT was ordered to determine if the tumor was of a more malignant variety. PET/CT showed intense glucose uptake by the lesion in question. To determine the specific histologic origin of the tumor and thus optimize treatment, a temporal craniotomy and biopsy were performed. Microscopic examination and immunohistochemical staining of the biopsy indicated that it was metastatic malignant melanoma.\nBased on this revised diagnosis, the patient received a 5-part fractionated Gamma Knife treatment of 6 Gy to the 50% isodose line each time for a total of 30 Gy (). The treatments were well tolerated, and during planning of the fifth treatment, it was noted that the tumor appeared smaller than it did at the first of these five treatments. In the four months following, the patient experienced slightly increased sensation in her left face, and MRI showed significant shrinkage of the treated tumor. However, the same MRI also revealed new thickening of the proximal trigeminal nerve adjacent to the brainstem. Due to the excellent response of the tumor to previous radiosurgery, an additional Gamma Knife treatment of 20 Gy to the 50% isodose line was performed.\nThe lesion and resulting symptoms remained controlled for approximately 9 months until PET/CT and MRI showed further enhancement at the origin of the trigeminal nerve that had begun to penetrate the left lateral pons as well as further growth distally in the roof of the maxillary sinus. Based on the response to previous radiosurgeries as well as the high quality of the life maintained by the patient, it was determined that another Gamma Knife surgery would be appropriate. Treatment of the pontine lesion was fractionated into three parts of 7 Gy at the 50% isodose line each for a total of 21 Gy. Frame placement allowed only a single treatment of the maxillary lesion at 7 Gy to the 25% isodose line.\nTo manage the distal maxillary growth, two options were considered. The mass could be removed surgically by an ENT or treated with stereotactic body radiation therapy (SBRT). After discussion of these options with the patient, it was decided that SBRT would be better tolerated than surgery given the patient's advanced age.\nAt the time of this report, the patient was undergoing the planned SBRT to her left maxillary sinus. She has no sensation over her entire left face, and her facial droop is quite significant. To date, she has reported no acute adverse effects from GKRS. |
A 57 y/o Caucasian male patient was referred to our hospital with pronounced motor aphasia and unilateral right sensorimotor performance deficits after having been found unconscious at home. In the ER the patient was awake and oriented to person, place and time. Due to the severe dynamic aphasia and agitation it was not possible to obtain a sufficient patient history. According to the patient’s relatives the onset of neurological symptoms was the evening before, however less pronounced and progressed to an unconscious state the next morning. Initially the patient and his family denied any history of chest pain, orthopnea, and lower extremities edema, however eventually the patient recalled an episode of chest pain and lightheadedness as angina pectoris equivalent two years before. Coronary angiography revealed a three vessel disease with a total occlusion of the first marginal branch of circumflex artery which apparently lead to transmural infarction and subsequent aneurysm formation. His past medical history was otherwise remarkable for essential hypertension and intermittent atrial fibrillation. On physical exam his pupils were equal round and reactive to light and accommodation. He manifested a unilateral faciobrachial weakness as well as a unilateral faciobrachial sensory loss. His cardiac risk factors were significant for tabacco abuse (50 pack years), essential hypertension, unhealthy diet and physical inactivity.\nThe electrocardiogram showed atrial fibrillation at 120 beats/min and pathologic Q-waves in leads I and aVL consistent with a non-recent lateral myocardial infarction. The tachycardic supraventricular arrhythmia was successfully converted with 300 mg of amiodarone. Cranial computed tomography was immediately initiated and revealed a large left frontotemporal and right parietal hypoattenuation consistent with cerebral infarction. The patient was started on high molecular weight heparin. Chest X-rays showed a massive cardiomegaly with a bulging protrusion along the left ventricular shadow (Figure ). Comparison to prior X-ray studies raised the suspicion of a giant ventricular aneurysm. There was associated pulmonary venous congestion due to heart failure.\nThe preoperative echocardiographic evaluation and magnetic resonance imaging confirmed the diagnosis of a 15×10×8cm left ventricular aneurysm along the left ventricular wall (Figure and Additional file : Video 1). Spontaneous echo contrast was clearly visible as a dynamic sign of blood stasis in the aneurysmal sac. Despite the huge size of the aneurysm the mitral valve was competent due to the fact that the neck of the aneurysm which extended from the base of the heart to the apex and was located exactly in-between the anterolateral und posteromedial papillary muscles. This way the submitral apparatus was spared from any tethering and necrosis. Again the neck was only 2 cm wide but 8 cm long, stretching in length from the apex up to 1 cm below the mitral valve annulus with the aneurysmal sac bulging to the thoracic wall (Figure ). The left ventricular (LV) ejection fraction was estimated at 10-15% with an akinetic lateral wall and a grade one LV diastolic dysfunction. No intracardiac thrombus was appreciated, however a sponatanous contrast was visible in the aneurysmal sac. All four valves were competent and the estimated pulmonary artery systolic pressure was 24 mm Hg.\nCardiac catheterization showed 3-vessel disease with 60% stenosis of the proximal right coronary artery (RCA) as well as a 60% stenosis of the proximal posterior descending artery, a 30% stenosis of the left anterior descending artery (LAD), a 75% stenosis of the first diagonal branch and a proximal total occlusion of the first obtuse marginal branch the circumflex artery (OM).\nThe patient was in NYHA class III. He was diagnosed with a giant ventricular aneurysm 2 years after his myocardial infarction and underwent surgical lateral ventricular restoration 2 months after the initial neurologic presentation. The patient was put on pump via a standard bicaval cannulation and aortic cannulation. A left ventricular vent was installed via the right superior pulmonary vein. There were extensive adhesions between the heart and entire pericardium that could only be detached after aortic cross-clamping. Care was taken to keep the 2 mm thin aneurysm wall intact for later hemostasis. After liberating the heart from the pericardial sac the aneurysm was incised and the situs inspected. The entry of the aneurysm had a neck between the papillary muscles and extended from the apex to within 1 cm of the posterior mitral valve leaflets (Figure A). Ventricular restoration was done using the Dor procedure with a Dacron patch tailored from a 34 mm tube graft in order to mimick the geometry of the heart (Figure B). The thin wall of the giant aneurysm was partially resected and the limbus was sown together buttressed with a felt strip with 3/0 prolene for hemostatic purposes (Figure C). Thereafter coronary revascularization was performed with a saphenous vein graft to the first diagonal branch and the right coronary artery, respectively. Myocardial protection was achieved with antegrade aortic and vein graft blood cardioplegia, as well as retrograde blood cardioplegia via the coronary sinus.\nThe patient was off all inotropes and pressors on postoperative day two and transferred to an outside neurology department on post-operative day ten. He was eventually discharged home in good clinical condition and with almost normal ejection fraction. Of note, the neurological situation improved dramatically with only minor sequelae. The patient was followed 9 months upon surgery, his neurological sequelae continued to improve with no residual cardiac impairment. |
Three consecutive patients (two men aged 51 and 56 years and one woman aged 46 years), of Caucasian ethnicity, were treated with BAE in a tertiary academic reference center for spontaneous acute massive hemoptysis. All three were active smokers with a mean smoking habit of 50 ± 29 pack years. None had any history of chronic illness, pulmonary or otherwise. All three patients exhibited severe hemoptysis, ranging from 300 to 700 mL/day, with multiple episodes. They also had hypoxemia, anemia and low blood pressure. They were admitted to the intensive care unit for close monitoring and treatment.\nTwo of our patients received blood transfusions because of a rapid fall in hemoglobin levels (e.g. patient 1 had a hemoglobin level of 15.2% on admission, which had dropped to 8.7% two days later) and fear of severe hemodynamic instability,. All three of our patients were managed according to a standard hemoptysis protocol. They underwent emergency bronchoscopy and computed tomography (CT) of the thorax to identify the site of bleeding. The bronchoscopy did not allow identification of the bleeding lobe or any other significant abnormality in any of our patients. Blood trails and clots were seen in both the left and right bronchial systems, but provided no conclusive evidence as to the origin of bleeding. A tuberculin skin test and Ziehl-Neelsen examination of sputum indicated that our patients were negative for tuberculosis, and bronchial lavage cytology was negative for malignancy. The CT scan of one patient showed some degree of centrilobular emphysema. In all three cases, 'ground glass' attenuation consistent with hemorrhagic debris was found in both lungs, with predominance of one side or the other in each case. At that point, surgical management was not deemed feasible because the exact bleeding lobe could not be identified.\nThe next step was bronchial angiography followed by embolization. Under local anesthesia, the common femoral artery was percutaneously punctured, and a 5F introduction sheath was inserted. A flush catheter was advanced into the upper part of the descending thoracic aorta, and a diagnostic anteroposterior angiogram was performed, which in all three cases revealed the hypertrophic bronchial arteries. The hypertrophic bronchial arteries were then selectively catheterized with a 5F cobra-shaped curved catheter. The angiogram showed minimal to moderate hypervascularity in the right upper lobe in two cases (Figure ), whereas in the third case, no hypervascularity or other obvious vascular abnormality was detected. Transcatheter embolization of the hypertrophic bronchial arteries of the right upper lobe was subsequently performed through the catheter after stabilization of the catheter tip was confirmed (Figure ). A microcatheter was not used, as there was no opacification of the important spinal branches in any of our three patients. Tris-acryl gelatin microspheres (Embosphere®; BioSphere Medical Inc, Marlborough, MA, USA) 500-700 μm in diameter, were used as the embolization material, and were injected slowly through 1 ml syringes. The embolic particles were dispersed in contrast medium to allow visualization of any backflow and to monitor for progressive slowing of flow. Throughout the procedure, regular angiograms were performed to detect previously invisible connections to side branches supplying the spinal cord. Embolization was terminated when the antegrade flow ceased.\nAfter the embolization treatment, all three patients were stable, and none exhibited recurrent hemoptysis. They expectorated minor amounts of blood-stained sputum, which gradually disappeared within one to three days. No complications developed in any of the cases as a result of this intervention. All three patients were discharged three to four days after embolization. Follow up CT scans at six and 12 months did not show any additional abnormality except for the aforementioned emphysema in one of the cases. |
A 50-year-old male patient presented to our Trauma Center after being struck by a train. Per Emergency Medical Services (EMS), he was attempting to cross the railroad tracks when he was struck. The patient had a significant past medical history of schizophrenia and did not recall the events leading to his accident but stated he was not suicidal. On initial examination, the patient had a GCS of 15 and noted to have a large open right shoulder/thoracic soft tissue wound exposing a transected pectoral major muscle along with palpable dislocation of the right shoulder (). Initial examination and confirmatory Doppler ultrasound exhibited an absent pulse signal in the right hand. He was unable to move his right arm entirely.\nHe was hemodynamically stable upon presentation and was able to undergo cross sectional imaging. CTA neck and right upper extremity showed an injury to the mid-right subclavian artery near the vertebral, thyrocervical, and internal thoracic arterial origins (A & B). There was traumatic occlusion of the subclavian artery beyond that point with a 6 cm flow gap. However, there was reconstitution of the axillary artery distal to the occlusion just proximal to the superior thoracic origin, which remained patent through the brachial artery in the right upper arm. The patient was also found to have multiple displaced fractures of the left hand, a right sternoclavicular dislocation, non-displaced right distal clavicular fracture, acromial clavicular joint ligamentous injury, segmental fractures of the mid and distal radial shaft, left anterior iliac wing displaced fracture, mildly displaced fractures of the C2, 3, and 7 transverse processes and significant pulmonary contusions, all further illustrating the severity of his traumatic accident.\nAfter the completion of initial imaging, the patient was emergently taken to the operating room in an attempt to repair the right subclavian vasculature. A preliminary angiogram performed in the operating room revealed the defect suggested by CTA. Subsequent attempts to pass a guide wire through the subclavian occlusion proved futile (A & B). Based on the proximal position of the right subclavian defect, a surgical approach consisting of median sternotomy with supraclavicular transverse incision was performed for adequate right subclavian artery exposure (A). Initial sternotomy localized the innominate artery and proximal subclavian artery. The proximal subclavian evaluation revealed a transected and thrombosed subclavian artery distal to the takeoff of the vertebral and mammary arteries and thyrocervical trunk. Three brachial plexus cords were also found to be injured along with a fractured 1st rib. The proximal and distal ends of the transected subclavian vessel were controlled to ensure hemostasis and subsequently debrided to eliminate any remaining damaged tissue. After debridement, an approximately 6 cm space remained creating unsuitable tension parameters for primary repair. Instead, a 6mm-diameter ringed PTFE graft was placed to adequately repair the defect. Perfusion of the vessel was confirmed by intra-operative doppler distal to the site of repair and over the brachial and radial arteries. A distal palpable pulse was also noted. Due to the severity of his right upper extremity injury, a fasciotomy was performed at that time. Overall, his estimated blood loss was approximately 1.5 L.\nThe remainder of his injuries were managed with various surgeries performed by the orthopedics, trauma, and plastic teams. His post-operative course was associated with a significant ICU stay and acute respiratory failure secondary to pulmonary contusions. This resulted in a period of ventilator dependence with eventual requirement of a temporary tracheostomy. Overall, the patient had a total of 10 surgeries throughout his hospital course. He stayed in the ICU for approximately one month prior to being weaned off ventilator support. He was then transferred to the floor where he stayed for an additional month prior to discharge to a rehabilitation facility. On follow up in the trauma clinic, the patient was ambulating well and working with PT/OT at his rehabilitation facility. His tracheostomy was removed and he was able to speak in full sentences and tolerate an oral diet. The remainder of his clinical recovery was unremarkable. |
A 52-year-old male presented to the ambulatory surgery center for a scheduled right sided C6 - C7 interlaminar epidural steroid injection. The patient had been dealing with neck pain for the last few years, with decreased range of motion predominantly on extension, positive Spurling’s sign on the right side, decreased sensation to light touch in the C6 - C7 nerve distribution, and normal reflexes that were elicited on physical examination. He had minimal relief with medication, including NSAIDs and tramadol, and physical therapy. MRI of the cervical spine showed a posterior disc osteophyte complex that was causing mild to moderate spinal canal stenosis with severe right and moderate to severe left neural foraminal narrowing. The radiologic findings along with the positive physical exam findings were evidence that the patient could potentially benefit from a cervical epidural block.\nAfter informed consent was obtained, the patient was placed on the fluoroscopy table in the prone position with the neck in the neutral position. The right C6 - C7 epidural space was identified using fluoroscopy and a 22-gauge, 3.5 inch Tuohy was advanced to the epidural space using loss of resistance technique. Isovue contrast was used for needle localization and after confirmation of the presence of the contrast in the epidural space (), 10 mg of dexamethasone and 2 mL of preservative free 1% lidocaine were injected.\nThe patient was then taken from the OR to the post anesthesia care unit (PACU) for observation. About five minutes after arrival into the PACU, the patient was noted to be anxious and hypertensive, with the systolic pressure running in the 180s mmHg and the diastolic pressure in the 100s mmHg. The patient was normotensive prior to the procedure with a blood pressure of 134/82 mmHg. In addition to the elevated blood pressure, the patient reported that he was unable to swallow and was having a subjective sensation of dizziness, and concurrent horizontal nystagmus. All other vital signs, including pulse oximetry, heart rate, respiratory rate, and temperature were all within normal limits.\nThe patient was reassured and after thirty minutes from the initial presentation the symptoms resolved. The patient was observed in the PACU for another thirty minutes and then was transferred to phase two of PACU and from there was discharged home with no further issues or complications. Prior to discharge, the patient did report that his neck pain felt much better at this time than before the procedure. |
The second case is a 75-year-old Irish woman with a psychiatric history of bipolar affective disorder, stable for several years on olanzapine and valproate, enabling her to lead an independent lifestyle. There was no history of cognitive impairment. She suffered from multiple medical conditions including: atrial fibrillation, type 2 diabetes mellitus, obstructive sleep apnea, and a recent mitral valve repair complicated by postoperative delirium.\nShe was admitted medically to a rural Irish hospital in November 2015 for management of a raised INR. During the admission she developed sudden onset left-sided weakness and altered levels of consciousness, as well as rigidity and one isolated temperature spike. The concern was raised that she may be or might have been suffering from neuroleptic malignant syndrome and her neuroleptics were stopped as a precaution (Table ). She was transferred to the intensive care unit (ICU) in the MMUH in Dublin with a suspicion of neuroleptic malignant syndrome or encephalopathy. Computed tomography (CT) brain imaging was normal at the time. As neuroleptic malignant syndrome was suspected, olanzapine was stopped. However, her creatinine kinase levels were normal as was her body temperature. Hence, neuroleptic malignant syndrome was deemed to be unlikely. An electroencephalogram during admission showed changes suspicious of encephalopathy and MRI imaging showed no acute abnormality. A working diagnosis of metabolic encephalopathy was established but extensive investigations yielded no cause for the encephalopathy.\nDue to prolonged altered levels of consciousness and unexplained altered mental state, the Liaison Psychiatry service was consulted in January 2016.\nOn examination, she responded with a mouthed single word greeting, but made no other attempt at verbal interactions. She inconsistently followed the examiner with her gaze, but stared out of the window for most of the examination. On physical examination she presented with waxy resistance to passive movement and psychomotor retardation. The impression was that these features were most likely related to a catatonic exacerbation of her bipolar affective disorder, in the absence of an organic explanation. She was diagnosed as having bipolar I disorder with catatonia as per DSM-5 (Table ).\nDelirium was raised as a differential diagnosis (Table ), but she had been reviewed in September 2015 by the Liaison service, when she was delirious after her valve replacement and her presentation was distinctly different on that occasion.\nShe was initially treated with intravenously administered lorazepam, but became drowsy, with a significant drop in Glasgow Coma Scale (GCS). As such the treatment was abandoned. Instead, olanzapine was cautiously reintroduced, which led to a significant improvement in her mental state within days. On follow-up review, she was mildly confused but engaged well at interview, and was euthymic with no evidence of thought disorder or movement disturbance. Subsequently she was discharged back to her own home. She was not reviewed at 6-month follow-up as she was living in a rural area and was followed up in her local service.\nOf note, in 2017, the same patient was readmitted to the MMUH ICU, from the same peripheral hospital, in a very similar state to the presentation in November 2015. Again her neuroleptics had been stopped when she was acutely unwell and she developed typical traits of acute catatonia. She was trialled on lorazepam, which she did not tolerate and reinstitution of her neuroleptics brought no improvement. The therapy was then escalated to electroconvulsive therapy (ECT), to which she had a dramatic response and significant improvement of her mental state. |
A 14-year-old boy with morbid obesity and no known prior psychiatric history underwent sleeve gastrectomy. Prior to the surgery, he weighed 167 kilograms with a body mass index (BMI) of 54.5. Within a few months postoperatively, he weighed 70 kilograms with a BMI of 22.8. The patient’s substance use disorder started at the age of 15, one year after the bariatric surgery. Of note, the patient's parents were separated and he lived with his mother and siblings. None of his family members or relatives had a history of substance use disorder. He initially started using fenethylline (marketed under the brand name Captagon), as it was a common substance used by his peers at school. He started with two tablets daily and increased his use gradually up to 15 tablets daily. He started smoking cannabis a year later, at the age of 16, starting with one cigarette per day and increasing his use gradually until reaching a peak of 20 cigarettes per day. The patient started drinking alcohol occasionally at the age of 16 as well, and it soon became an issue of excessive use on a daily basis. The patient drank different types of alcoholic beverages. He reported incidents of fainting in relation to alcohol use but had never experienced withdrawal. He mentioned that he started using alcohol as a way to reduce his use of other substances. Two years later, at the age of 18, the patient started using methamphetamine, which caused him to develop paranoid ideation, auditory hallucinations, severe insomnia, and aggressive behavior. The patient was admitted to an inpatient psychiatric unit for a few days and was started on haloperidol 3 mg orally twice daily, benztropine 2 mg orally twice daily, and quetiapine 50 mg orally as needed for insomnia. His psychotic disorder improved with the cessation of substance use and the treatments initiated on the inpatient side. After his discharge, he unfortunately relapsed and continued to use the aforementioned substances.\nAfter arranging for close follow-up, the patient voluntarily presented to the rehabilitation center, motivated to stop using all substances, as he was legally and financially burdened by this disorder. He was incarcerated twice for substance use-related criminal charges. He was also motivated to start a new life and to enroll again in higher education, as he dropped out of school previously due to his polysubstance use disorder. The patient has thereafter been involved in a rehabilitation and relapse prevention program, which included inpatient admissions as needed to the rehabilitation center, involvement in individual and group therapy, occupational therapy, and addiction counseling. |
A 26 year-old man attended our ophthalmic ward in April 2017 with intermittent bleeding of the right eye, from which there was also strong odor. The patient was a heavy smoker but had no other underlying conditions. He had no history of drug-use. From his medical history it was noted that the patient had undergone a right ophthalmectomy 24 years previously due to retinoblastoma, and implantation of an artificial right eyeball in 2014 (timeline shown in Additional file ).\nOn admission, his pulse rate was between 80 and 100 beats/min. His body temperature and respiratory rate were both normal. Physical examination showed narrow conjunctival sac in right eye and the exposure of ocular prosthesis, which was discharging a yellow-green secretion along with a strong odor. The visual acuity of left eye was 0.3, and the intraocular pressure was 15 mmHg. All other characteristics of the left eye were normal. A auscultation did not show any abnormality in the lungs, and no signs of carotid murmur were found. Interestingly, laboratory investigations did not reveal abnormal inflammatory markers such as leukocytosis or any increase in neutrophils or C-reaction protein. According to clinical and laboratory investigations, infectious endocarditis was not suspected. The patient had no history of other immunosuppressive conditions, except smoking and a retinoblastoma 24 years previously. The patient did not report any direct contact with animals; however, he did work in a clothing factory so would have been contact with wool and cowhide for one month of the year. Three months had elapsed between the patient last coming into contact with wool and cowhide and the appearance of clinical symptoms. Considering the results of these investigations, partial artificial eye infection, especially anaerobic organism infection, was suspected.\nImaging workups were completed, which included chest x-ray, transthoracic echocardiography and eye magnetic resonance imaging. As shown in Fig. , eye magnetic resonance imaging revealed that the tissue surrounding the right eye prosthesis as well as the soft tissue of the lacrimal gland area were swollen, whereas the left eye appeared normal. Inflammatory disease in the right eye was therefore suspected. According to chest x-ray and transthoracic echocardiography, no obvious abnormalities in the lungs or heart were observed.\nBefore surgery, a few specimens of the right eye secretions were collected to be cultured, but no bacteria were isolated, possibly because most of the secretions had been absorbed by the artifical eye making it yellow-green in appearance. After removal of the right artificial eye with debridement (5 days after admission), both the artificial eye and specimens of the eye secretions were sent for bacterial culture under aerobic and anaerobic conditions. No bacterial growth was detected from the ophthalmic secretions, but cultures were obtained from the artificial eye. Sparse growth of β-hemolytic cocci and heavy growth of small, non-hemolytic, translucent colonies were observed on Columbia agar plates supplemented with 5% sheep blood (BioMérieux, Marcy l’Etoile, France) under aerobic conditions after 48 h. And the latter colonies only grow close to the hemolysis zone of the former one. Under anaerobic conditions, only the small, translucent colonies were detected from the artificial eye (as shown in Fig. ). Of the two colony types, the β-hemolytic cocci were confirmed as Staphylococcus aureus, whereas the small, translucent colonies stained positive in a Gram stain and occurred singly, in pairs, or in short chains (Fig. ). Catalase and oxidase reactions of the unknown colonies were negative and phenotypic characterization using the Vitek2 GP system (BioMérieux) was inconclusive. However, Matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry revealed a match with Helcococcus ovis DSM 21504 T DSM (log score: 1.637) according to the Brucker Maldi-Biotyper database. Identification of this organism was confirmed by 16S rRNA gene sequencing. BLAST analysis of the partial 16S rRNA gene sequence derived from our isolate (1492 nucleotides, deposited in the GeneBank database under accession number MG188744) showed 98.9% identity (15 nucleotide differences) with the 16S rRNA gene sequence of H. ovis s840–96-2 deposited in the GenBank database under accession number NR027228 by Collins and coworkers [] in 1999 when this species was first described.\nAntimicrobial susceptibility testing (AST) of both strains was performed. The disk diffusion method was carried out and with the exception of penicillin, erythromycin and clindamycin, S. aureus isolated from this case was susceptible to all other drugs including cephalosporins and fluoroquinolones. AST for Helcococcus was performed using the CLSI broth microdilution method on Mueller-Hinton II broth (BD Diagnostics, Heidelberg, Germany) supplemented with 3% (vol/vol) lysed horse blood (Oxoid, Wesel, Germany) and 0.001% (wt/vol) pyridoxal HCl (Sigma–Aldrich, Munich, Germany) incubated at 37 °C in 5% CO2 for 24 h [, ]. Streptococcus pneumoniae ATCC 49619 served as a quality control. Then, we changed the method and performed an E-test on blood agar, with S. aureus ATCC 29213 as the quality control (for reference only). The MICs (μg/L) of the drugs for this strain are reported in Table . Since no antimicrobial testing guidelines are currently available from the Clinical and Laboratory Standards Institute (CLSI) for Helcococcus, the MICs were determined in reference to the CLSI guidelines for S. aureus []. According to the CLSI [, ], this strain was susceptible to penicillin, ampicillin, teicoplanin, ceftriaxone, vancomycin, and linezolid.\nAfter admission, the patient received levofloxacin eye drops 4 times per day until being discharged from hospital. After surgery, the patient was initially treated with intra-venous cefotaxime (2.25 g/250 ml NaCl, 1/day) and ornidazole (500 mg/day) for 1 week. Two weeks after admission, the patient recovered and was discharged from hospital. Six months later, the patient returned to the hospital to finish implantation of the artificial right eyeball and no signs of infection were detected. With the patient’s consent, we collected samples from the skin around both eyes for aerobic and anaerobic culture, but only normal skin flora were detected, such as coagulase-negative Staphylococcus. After surgery, the patient was in good health and was discharged from the hospital. |
The patient was a 66-year-old male with advanced malignant prostate cancer, bone metastases, and kidney failure requiring dialysis. While an inpatient at a cancer hospital, he was transported to the intensive care unit (ICU) for catheter placement and a hemodialysis session. The professional on duty chose a left subclavian vein access, using anatomic landmarks. The blood aspirate at puncture appeared to be venous and the guidewire was advanced without difficulties, but after dilation of the tract and insertion of the catheter, retrograde pulsating flow was observed. Inadvertent positioning in the left subclavian artery (LSA) was confirmed by blood gas analysis and Doppler ultrasound ( ). The examination ruled out the possibility of injuries to the carotid or vertebral vessels, which had normal morphology and blood flow. Physical examination found 4+ brachial and radial pulses. The device was left in place and the patient was transferred to a hospital with vascular and endovascular surgery services. Inherent problems within the Brazilian National Health Service (SUS - Sistema Único de Saúde) delayed the transfer by 18 days. Since there was a risk of fatal complications, the catheter was not removed from the LSA and the patient was not given anticoagulation because of a recent history of melena. After transfer, the catheter was removed, but endovascular repair was not possible because a thrombus was seen in the arterial lumen. There was no bleeding or formation of hematoma, and left upper limb perfusion was maintained, although the brachial pulse was rated 2+ and the distal pulses were absent at that time. The patient was transferred back to the cancer hospital. Doppler vascular echography was conducted again, showing a subacute thrombus in the LSA, where flow was monophasic ( \n ), constituting subocclusion. The arterial thrombosis was in topography distal of the emergence of the vertebral artery, in which flow was laminar, anterograde and with velocities within the limits of normality ( ). At the subclavian-axillary transition, an arterial branch was observed with reversed flow that, based on topography, may have been the dorsal scapular artery ( ). The axillary ( ) and brachial arteries were patent and exhibited slow, low resistance flow, as did the radial and ulnar arteries. The conduct adopted in this case was watching and waiting since, in addition to the contraindication to anticoagulation already mentioned, the patient’s level of morbidity was elevated for an attempt at open revascularization and predictive indicators of the success of a possible bypass were unfavorable: the time elapsed since thrombus formation (22 days), the poor prognosis of the patient’s cancer, and the presence of kidney failure. The patient was observed for a further 2 weeks and did not show any sign of cyanosis, pain at rest, or trophic lesions. He was discharged from hospital for palliative home care. |
A 61-year-old lady first presented initially in February 2013 with abdominal pain and then developed obstructive jaundice. The data of biochemical tests are shown in . Radiographic imaging at that time revealed a mass in the head of her pancreas (). A metallic biliary stent was inserted to relieve obstructive jaundice (). Unfortunately, she became septic following the procedure delaying her stay in hospital for several weeks.\nIn order to clarify her diagnosis, she was referred to a specialist center for an endoscopic ultrasound scan (EUS) and fine needle aspiration (FNA). This was performed on three or four occasions, however the cytology did not reveal any malignancy but inflammatory cells were identified on each occasion. In view of the uncertainty of the diagnosis and lack of progression on repeated CT scans, she went onto having a PET CT scan which revealed FDG-avid mediastinal and cervical lymph nodes. These nodes were biopsied for further analysis. Lymph node biopsy showed non-caseating granuloma ().\nGiven the patient’s history and initial findings it was suggested to be pancreatic cancer without being formally diagnosed. However, the histology of the lymph nodes was reported to be consistent with sarcoidosis and therefore it was presumed she also had sarcoidosis of the pancreas (). Her family history revealed her mother had bowel cancer and father had stomach cancer. Her past surgical history entailed that this lady underwent a hemithyroidectomy for a thyroid nodule performed some years earlier and histology was benign. Infectious causes and lymphoma are possible differentials.\nIn January 2014, she became unwell again and was admitted to hospital with pleurisy and sepsis. Subsequently, a further biliary stent change was performed. In March 2014, she was readmitted with another episode of sepsis possibly due to cholangitis. She was in hospital for 5 weeks during which her plastic biliary stent was changed for a self-expanding metal stent in April 2014. She was treated with enoxaparin for a deep vein thrombosis (DVT) she developed in her left leg.\nOnce pancreatic sarcoidosis was confirmed on biopsy, she was started with systemic corticosteroids which provided symptomatic relief. Her medication included a proton pump inhibitor, diarrhea was managed with pan-creatin 10,000 units increased to 25,000 units for snacks and 50,000 units for meals, analgesics for intermittent abdominal pain and recently commenced ursodeoxy-cholic acid to try and prevent her stent from silting up in the future. After a course of steroids and conservative therapy, the patient became well and managed to go home in April 2014.\nHowever, on a routine outpatient clinic follow-up in August 2014, she was found to be lethargic with weight loss, anemic and signs of obstructive jaundice. At this stage, immediate hospital admission was deemed necessary and symptomatic treatment with blood transfusion, nourishment and recommencement of systemic steroids was initiated. A repeat CT of the chest, abdomen and pelvis showed total distortion of the pancreatic tissue with irregular margin along with multiple cystic deposits were at this stage consistent with metastatic disease (). The patient was not willing to undergo a further biopsy, and in view of her continuing deterioration of her general condition was referred to palliative care. |
A 13-year-old Ugandan boy of Bantu ethnicity was referred to our hospital for vascular and orthopedic surgical attention. He had a history of bleeding from the right thigh and an inability to use his right lower limb for three weeks.\nHe had been well until three months prior to referral when he developed a high-grade fever associated with severe pain and progressive swelling of his right thigh for about 11 days, but with no history of trauma. He was taken to a local hospital where a considerable amount of pus was drained from his right thigh. A diagnosis of chronic osteomyelitis of the right femur was made, since it was noticed at surgery that the periosteum had been stripped off the bone. He was put on a six-week course of cloxacillin, the pain reduced significantly and the fever eventually disappeared; however, pus discharge from a sinus on the antero-medial aspect of his right thigh persisted. Three weeks prior to referral to our hospital he slipped on a wet floor, fell, and fractured his right femur. He was taken to a traditional bone setter who started manipulating and massaging his right thigh. After four days of traditional treatment he started to bleed profusely and lost consciousness in the process. He was then rushed to the regional referral hospital where he was transfused with two units of blood, the right lower limb was splinted with a long leg plaster of Paris (POP) back slab and compression dressings applied to the thigh. A radiograph taken at the time showed a pathological fracture with a long sequestrum of the right distal half of the femur and minimal involucrum formation. However, no attempt was made to ascertain the source of the bleeding. He spent three weeks in this hospital, where the staff repeatedly transfused him and applied compressive dressings because he kept on bleeding (though not profusely), in the hope that the bleeding would stop. However this never happened, and our patient had to be referred to our national referral hospital. He had no family history of sickle cell disease or any bleeding disorders, and was human immunodeficiency virus (HIV) negative.\nOn physical examination, he was toxic, wasted and had a foul smell around him. He had severe pallor of the mucous membranes, was febrile (39°C) and had pedal pitting edema. The right lower limb was splinted in a POP back slab with a bulky blood-soaked compressive padding of the mid-thigh. The right foot was swollen and pale, capillary refill was more than two seconds, the dorsalis pedis and posterior tibial pulses were palpable but very weak.\nFull hemogram results were: hemoglobin 5.2g/dL, neutrophils 89 percent, platelets 187×103 cells/mL, erythrocyte sedimentation rate 115mm/hour. Blood culture results were positive for Staphylococcus aureus sensitive to ceftriaxone. Radiography results showed a diaphyseal fracture of the femur.\nHe was immediately resuscitated and prepared for emergency surgery. In surgery, the POP slab and multiple layers of foul-smelling gauze and cotton were removed. Upon removal of the compressive dressing he started bleeding profusely, therefore pressure was applied to the bleeding area and a pneumatic tourniquet applied. There were numerous maggots, a huge hematoma and necrotic tissue on the antero-medial aspect of the distal right thigh. All necrotic tissue was removed and the wound extended for better exploration. A fracture of the distal femoral shaft was found, with the periosteum having been stripped from more than two-thirds of the bone. The femoral artery was friable, and had a ruptured 4cm dilatation (aneurysm) at the level of the fracture.\nThe femoral artery was ligated and an above-knee amputation of the right lower limb performed. The amputation stump was left open; delayed primary closure was performed three days later. Post-operatively he was transfused and given intravenous ceftriaxone and gentamycin. He did well post-operatively and his wounds healed well, and he was discharged on crutches after 10 days of hospitalization. He was very grateful for our intervention because we alleviated his pain and saved his life. He is currently undergoing rehabilitation in preparation for fitting with a prosthesis. The aneurysmal tissue was sent for histological examination, with the resulting report stating ‘wall of artery with areas of hyaline degeneration and congested vessels’. |
Case #1. A 15-year-old male participant with multiple pain complaints, including headaches and myofascial pain, was able to learn and practice the meditation techniques and use them to cope with stressors associated with his medical conditions. Although his awareness of pain was slightly increased during the initial sessions, after approximately three weeks of practicing the techniques he became aware that the pain increased his distress and that he could use mindful awareness to reduce his experience of stress, feel more relaxed, and attenuate his experience of pain. He attended all six sessions. He continued to improve after the conclusion of the intervention, by self-report and clinical assessment in follow-up medical visits.\nCase #2. A 14-year-old female with fibromyalgia and depression reported improvements in both physical and emotional symptoms after participating in the full six-week program. She reported that this intervention was helpful and described through the program evaluation questionnaires that she learned a new method for coping with her symptoms. Peer support seemed to be of particular benefit to this participant, as she was able to normalize the experience of chronic pain. She especially liked the practice of cue word repetition during periods of sitting meditation and in her daily life, as she reportedly found that it decreased her worry and rumination and reduced her experience of pain. At the midpoint of the intervention, she reported that mindfulness allowed her to address the emotional impact of chronic pain, particularly anxiety, resulting in self-reported reduction in usual pain level. This improvement increased her ability to begin and maintain a daily exercise program and led to full symptom resolution three months after completion of the intervention.\nCase #3. A 16-year-old female participant with functional abdominal pain and a longstanding history of participation in pain management treatments (e.g., interventional blocks, multiple medication trials and psychological interventions) reported that she utilized distraction as her primary method of coping with chronic pain. Although she reported successful use of the techniques for coping with anxiety, such as when trying to fall asleep or prior to a music competition, she found the concurrent use of mindfulness and distraction to cope with pain to be confusing and ineffective, resulting in exacerbation of pain symptoms. Due to the focus on body awareness with mindfulness practice, she reported that she became more aware of pain sensations and increasingly distressed. With support of the study team, she was withdrawn from the mindfulness program after two sessions. She continued to participate in outpatient pain management, including psychological services. There were no long-term sequelae and her pain level returned to baseline upon termination of the intervention. |
An 11-year-old male was unconstrained in a motor vehicle collision. No loss of consciousness was reported. He presented to the emergency room with significant left shoulder pain. There was tenderness to palpation at the left shoulder and clavicle with minor overlying abrasion, erythema, and prominent posterior bony mass over his posterior shoulder. He was neurovascularly intact but was unable to move the shoulder due to significant pain. Radiography and CT revealed an oblique fracture of the distal third of the left clavicle with posterior displacement of the distal end of the proximal (medial) fragment (). The fracture was in the metaphyseal portion of the distal clavicle. He was discharged from the emergency department with instructions to follow up with an orthopedic surgeon. He was subsequently evaluated in the orthopedic clinic. Because of the marked deformity of the posteriorly displaced fracture (), an operative repair was advised, and the family agreed to proceed to surgery.\nPatient underwent surgery one week following the initial injury. A small transverse incision was made over the distal clavicle. The periosteal sleeve around the distal end of the clavicle was disrupted; however, the attachment of the coracoclavicular ligament into the inferior part of the periosteal sleeve surrounding the clavicle was still intact. The distal end of the proximal (medial) fragment was observed to have disrupted the periosteal sleeve with significant posterior displacement into the trapezius muscle. Multiple attempts were required to free the distal end of the medial segment of the fracture from the trapezius muscle. Then, the fracture ends were reduced together. Once good reduction was achieved, three K-wires were inserted percutaneously from the lateral end of the acromion to the clavicle traversing both ends of the fracture (). The patient's shoulder was immobilized in an arm sling. Four weeks after surgery, radiographs showed complete healing of the fracture in a good alignment. The wires were removed in the clinic and the patient was allowed to move his shoulder. At the time of final follow-up, eight weeks after surgery, patient had regained his full shoulder function and returned to full activity. |
A 13-year-old male presented to us with fever (acute in onset, mild to moderate grade and associated with mild chills) since last 10 days followed by gradually progressive sensory motor paraparesis with urinary incontinence since last 4 days. He was then hospitalized with weakness remaining static for one day and then progressed and involved both upper limbs within 24 hours. Examination showed LMN type sensory motor quadriparesis with only flickering of contraction present in all the limbs; planter was downgoing bilaterally. The patient was febrile with other systemic and general examinations showing no significant abnormality. After one day of quadriparesis, patient developed acute onset altered sensorium preceded by drowsiness and headache which was diffuse and bursting in nature. No significant past and family history and similar episode were previous noted.\nNow examination showed a Glasgow Coma Scale of E1M1V1 and patient was deeply comatose. On the basis of this history and examination we put the diagnosis of ascending myelitis of viral origin and did investigation accordingly. As the patient belongs to an endemic region, differential diagnosis of JE was kept too. All routine investigations were within normal limit. We did CSF which revealed total leucocyte count of 42 cells/cmm with lymphocytic predominance and slight elevation of protein and normal sugar along with elevated IgM titres against JE virus. Brain MRI showed bilateral basal ganglia that were grossly swollen with vasogenic edema tracking along internal capsule and midbrain. Adjacent ventrolateral thalamus and internal capsule also show mild abnormal intensities (Figures , , and ). Spinal screening shows abnormal cord intensities in entire cord with gross edema in cervical and conus region (Figures and ). Electrophysiological study was suggestive of preganglionic axonal involvement of upper limb and lower limb. Diagnosis of ascending myelitis and encephalitis due to JE virus was established. We started the patient on conservative treatment with intravenous methyl prednisolone for 5 days and rest treatment was symptomatic. Patient started to show improvement in the form of moving limbs and staring. Patient regained full consciousness after 2 week and was discharged and asked to be followed up in OPD. He regained near normal power at 3 months in followup but hesitancy, dysarthria, and slowness of movement persisted. This is one of the rare cases of JE which causes ascending myelitis (ATM). |
A 40-yr-old, Malaysian male was diagnosed with schizophrenia at the age of 25 years old. During that time, he presented with headache, vomiting, and auditory hallucinations for two years. He received oral risperidone 4 mg once daily together with intramuscular depot injection of fluphenazine 25 mg monthly. Despite the current regime of treatment, he was still experiencing residual mild psychiatric symptoms such as auditory hallucination. However, he is able to tolerate it and does not affect his basic daily functioning. He can sleep at night and his appetite remains good. For the past medical history, he had a short duration of admission history in a psychiatric ward which was about 6 years ago. He had no history of major surgical procedure. However, he had histories involved in minor motor vehicle accidents, which he sustained, minor wound for 6 times in the past 10 years.\nHe is single and currently stays with his mother. They live in an urban area and came from a middle-income family. He had a basic primary level of education. None of his family had a history of psychiatric illness. He previously worked as a cafe helper but remains unemployed for the past year due to lack of interest. He had no history of travel or petting cats. He is a heavy smoker and casual alcohol drinker. He had a history of using a psychoactive substance such as ecstasy 10 years ago.\nUpon physical examination, he was comfortable, calm and able to give full cooperation. His speech was coherent and relevant. His mood was euthymic, while his affect was appropriate to his thought. There was a minimal auditory hallucination in which he could not elaborate further. Otherwise, central nervous system examinations were normal. No lymph nodes were palpable and other systemic examination was unremarkable. He was recruited from the Psychiatric Clinic for research on toxoplasmosis among psychiatric patients in the year 2018.\nThe study was approved by the Research Ethics Committee, the National University of Malaysia (UKM PPI/111/8/JEP-2018–281). He fully understood the research and consented for participation.\nHe denied having any symptoms of toxoplasmosis such as fever, headache, vomiting, seizures, or body weakness. Laboratory investigation of his plasma samples was analyzed for T. gondii IgG and IgM antibodies using commercial ELISA kits, PLATELIA™ TOXO (Bio-Rad, France). The result of anti-Toxoplasma IgM antibody screening was negative. On the other hand, the measurement for anti-Toxoplasma IgG antibody level was positive at a very high titer of 135.9 IU/ml (positive cut-off value is above 9 IU/ml). Further investigation revealed positive detection of T. gondii DNA by nested-polymerase chain reactive (PCR) analysis. shows the result of nested-PCR amplification of T. gondii DNA from the patient’s blood sample. Genotyping was done and revealed the T. gondii DNA of the Type I strain. Based on these findings, the diagnosis of toxoplasmosis reactivation was suggestive. Since the patient is immunocompetent and showed no symptom, the infectious disease team continue current psychiatric follow-up, medications and plan to treat the patient if symptomatic. |
A 35-year-old female patient was presented to our center for TV replacement due to stenosis. At the age of 11 years, the patient suffered from endocarditis supported by a small ventricular septal defect. At that time, the ventricular septal defect was closed and a mechanical tricuspid valve (SJM, 28 mm) implantation and epicardial single chamber pacemaker implantation due to concomitant third degree AV block without escape rhythm were performed. At the age of 17 years, the abdominal pacemaker was replaced, due to battery depletion (Biotronik). Six months later, a second surgery followed with replacement of the dysfunctional mechanical valve for a 27 mm Porcin-Baxter biological TV. Another PM replacement (Medtronic) was performed at the age of 27 years, again, due to battery depletion. At the age of 30 years, the abdominal pacemaker was explanted and a two chamber transvenous ICD (Medtronic Egida DR) was introduced, as the patient suffered a syncope during documented sustained ventricular tachycardia. The ICD lead was implanted passing the tricuspid valve into the right ventricle. Six years later, severe TV stenosis developed, caused by an ICD lead, that stuck to the posterior leaflet of the biological valve and ventricular myocardium, and the TV had to be replaced a third time. To avoid future TV dysfunction due to lead related complications, we discussed several options with the patient. These included first TV replacement in combination with epicardial pacemaker leads and a subcutaneous ICD (S- ICD, EMBLEM™ Boston Scientific) or alternatively placing a pacing lead in the coronary sinus in combination with an S- ICD. As the patient disagreed on both options, despite a higher risk of TV dysfunction by placing another transvenous ICD lead through the TV, we discussed another option and opted for a lead sparing replacement of the TV. The TV ring was cut open on both sides beneath the original ICD lead, and the TV prosthesis was excised. A new bioprosthetic valve was implanted, leaving the ICD lead outside the ring of the new TV prosthesis. As the lead was stuck to the former TV annulus and posterior ventricular wall, no further fixation of the lead was needed. The new valve (SJM biological 28 mm) was implanted using 14 Coreknots (Figures , , ).\nThe postoperative course was unremarkable, and the patient was dismissed on the 11th postoperative day/postoperative day 11. Follow-up after 4 months showed a well functioning TV prosthesis without stenosis or regurgitation and no deterioration in pacing or sensing parameters. No artifacts or other hints to a lead dysfunction were recorded (Table ). |
The authors report a case of a 29-year-old Saudi woman who was G4T2P0A1L2 at 21 weeks of gestation. She was free from medical illness and she had had no previous surgical procedures. She is a housewife; she never smoked tobacco or drank alcohol, and she had no history of recent travel to endemic or pandemic areas. She was referred based on an antenatal ultrasound finding that showed multiple fetal anomalies. This ultrasound had been conducted at another hospital for evaluation and management. Her past obstetrical history was uneventful with two normal term vaginal deliveries and a history of first trimester unexplained miscarriages. She is married to a first-degree cousin working in a governmental institute; there is no history of genetic or congenital anomaly in either of their families.\nHer current pregnancy was spontaneous with no history of illicit drug use or exposure to infection or radiation. Her initial early antenatal scan diagnosis showed suspicion of possible fetal diaphragmatic hernia and required further validation which was not possible at the maternal–fetal medicine (MFM) unit at the hospital which also did not have available sonographic specialists. During her first antenatal visit at 21 weeks + 0 day of gestation, the results of her anatomy scan revealed a single viable fetus with estimated fetal weight (EFW) on 50th percentile with normal biometry measurements.\nFurther detailed anatomy scan findings revealed a male fetus with both kidneys appearing small in size, hyperechoic dysplastic, both ureters were dilated, urinary bladder looked abnormal in shape with thickened bladder wall, and umbilical cord at fetal insertion side appeared thickened. In addition, the diaphragm was seen clearly separating the chest from the abdominal compartments with no evidence of diaphragmatic hernia. Both feet were clubbed and open hands were seen with no other anomalies or any soft marker seen (see Fig. .) Based on the multiple fetal structural anomalies discovered, the couple was counseled about the scan findings and advised for further workup, such as: perinatal invasive testing; toxoplasmosis, other (syphilis, varicella-zoster, parvovirus B19), rubella, cytomegalovirus, and herpes (TORCH) screening; and fetal echocardiogram to exclude syndromic or chromosomal causes. This would support reaching a better diagnosis and allow for further discussion on the options available such as the continuity of the pregnancy or termination based on the severity of the fetal condition (see Table ).\nOur patient had some social issues and was also following her condition in another institute and only revisited our center at 32 weeks and 4 days of gestation. At our center another follow-up scan revealed a single viable fetus, cephalic in presentation, anhydramnios with normal head and femoral length biometry. Unfortunately, the abdominal circumference (AC) was not taken due to the extremely distended abdominal wall that prevented any further visualization by ultrasound. The right kidney measured 3.4 × 1.1 cm with a small cyst, the left kidney measured 2.9 × 1.3 cm with bilateral hugely dilated ureter and urinary bladder (mega cyst) (see Fig. ).\nTORCH screen test results were non-reactive. Amniocentesis was performed and showed normal chromosomal results. A fetal echocardiogram allowed for limited examination due to anhydramnios; however, no obvious cardiac anomalies were noted. Lungs appeared compressed due to severely distended abdomen from the progressively enlarged urinary system, otherwise no other abnormal findings noted. The couple was counseled by the MFM team about the worsening condition from the recent scan findings and were told about the poor fetal prognosis and the high mortality rate, secondary to severe lung compression with the presence of anhydramnios which would lead to lung hypoplasia and cause fetal demise.\nIt was explained that the entire urinary system was affected with severe dilatation causing severe abdominal wall dilatation and for this reason measuring fetal AC had been difficult antenatally. Options were discussed with the couple:Termination of pregnancy to avoid obstetrical complication during labor which is fetal abdominal dystocia as it was difficult to measure the abdominal wall antenatally with the severe progressive renal system dilation with advancing gestational age versus To wait until term pregnancy while knowing the poor fetal prognosis\nFurthermore, antenatal interventions were offered to the couple including tapping of the fetal bladder and ureters prior to induction of labor and to then send the amniotic fluid sample for further genetic testing. Our patient’s case was initially discussed by a multidisciplinary team which included a perinatologist and a neonatologist before finally making a combined agreement and alignment with the couple who decided to terminate the pregnancy; a caesarian section would be preserved for maternal indication and comfort care post-delivery to born infant were also explained.\nAt 32 weeks and 5 days of gestation, tapping of the fetal bladder and ureter was performed and samples of amniotic fluid were sent for whole exome sequencing (WES) test; however, unfortunately, after waiting a few weeks for the results, no results could be determined due to a laboratory error.\nOur patient underwent induction of labor to terminate the pregnancy and delivered vaginally a male neonate with Apgar score of 2 in 1 minute and 5 in 5 minutes, weighing 1800 grams without any complications. The vital signs revealed blood pressure of 90/60, pulse 100 beats /minute, and temperature of 36 °C. Clinical examination of the newborn revealed distended abdomen and thin wrinkled skin, retracted chest, cryptorchidism, and clubbed feet; no facial anomalies were noted and the features were most likely to be suggestive of PBS (see Fig. ). The newborn died 2 hours post-delivery.\nThe placenta was sent for a histopathology examination as a part of the workup and the result revealed normal findings.\nA postmortem examination was not offered to the couple since this is not conducted in the center. The couple was counseled prior to discharge regarding future pregnancy plans, despite low reoccurrence. It was also highlighted to them the importance of having early prenatal testing in a center in which there were well-trained sonographers and a high risk in pregnancy unit available. They were also informed about the lack of result of WES test due to laboratory error and they were fine. |
A 16-year old girl, known to have homozygous sickle cell disease (HBSS) presented to the SCU after having vomited twice that day. This was non-bilious and there was no history of haematemisis. However she reported 5 episodes of watery stool, which was said to be normal in color but there was no associated abdominal pain. She also complained of frontal headache associated with nasal congestion with a bloody nasal discharge. She had experienced one episode of nosebleed and but there was no history of fever or cough. Of note, she had not yet attained menarche.\nIn her past medical history it was noted that she had defaulted from follow up at the Sickle Cell Clinic for 13 years and had only one visit the month prior to this presentation. She had been diagnosed at 21 months of age following an episode of dactylitis. There were no recorded admissions to the day hospital at the SCU, neither was there a history of serious life threatening complications such as acute chest syndrome and stroke. She reported no recent admissions to hospital the last being 15 years prior. However she experienced pain mainly to lower back and knees and ankles once every 4 months and had not had any episodes in the previous 4 months.\nShe was treated at the SCU with codeine 40 mg orally and maintained nil by mouth. She was started on intravenous fluids at 100 mL/hour, and then referred to the Accident and Emergency Unit of the University Hospital of the West Indies. While at the emergency room she reported having pain to the left shin. Of note this patient has had no previous history of thrombosis neither is there is a family history of thrombosis.\nOn physical examination she had a normal mental state. Her pulse was regular and apex was not displaced. A systolic murmur was auscultated at the apex. Her chest was clear with adequate air entry on auscultation. Abdominal examination revealed hepatomegaly with a liver span of 15 cm and the edge of the liver was smooth. Her left shin was found to be tender on palpation. She was assessed then as having acute gastroenteritis and HBSS with a vaso-occlusive crisis.\nAfter being treated in accident and emergency with oral rehydration fluid, diclofenac 75 mg, ranitidine 50 mg and dimenhydinate 50 mg, all given via the intramuscular route, she was allowed home on oral dimenhydinate.\nThe patient returned to accident and emergency less than 24 h later complaining of sudden onset of pain to her right foot since early that morning. This was associated with swelling and discoloration of the first, second and third toes on her right foot. Examination revealed a swelling to the dorsum of her right foot; this was warm, tender and erythematous. The area was noted to be cold and there was decreased sensation to the area. However, all pulses to the limb were palpable and strong.\nShe was diagnosed with digital arterial occlusion and admitted for medical management which included heparin i.v. 3500 units given stat then i.v. heparin 700 U/h followed by warfarin for 3 months duration, with the aim to keep her international normalized ratio between 2-3. A referral was also made to surgery. The decision was however taken that there was no role for surgical embolectomy. Amputation of her right first and second toes was done approximately 4 months after her initial presentation. Her immediate post-operative period was complicated by a wound infection and anemia that required transfusion.\nApproximately 9 months later the patient was investigated with colonoscopy due to a 4-month history of bloody diarrhea. She was found to have a pancolitis and was diagnosed with ulcerative colitis. Presently, she is maintained on sulfasalazine 1 gram orally twice daily, prednisone 40 mg once daily and pantoprazole 40 mg once daily.\nIt should be noted that relevant investigations were performed sequentially as her symptoms unfolded. Total evaluation took place over a one-year period. Regrettably an arterial Doppler was not done at the time of the ischaemic event. This was done 2 months later during follow up at the Sickle Cell clinic.\nResults of laboratory tests and investigations are summarized in and . |
A 73-year-old female patient came to our clinic for evaluation of hearing loss. The patient had a previous history of chronic otitis media mesotympanalis with cholesteatoma formation in the right ear. Due to this reason, the subject was operated four times in an external hospital. In the first surgery, the cholesteatoma was removed and a mastoid open cavity was created. The following surgeries were aimed at a second look and hearing improvement. Unfortunately, an improvement of the hearing could not be obtained. The patient has been wearing a hearing aid (Phonak Naida V) in the right ear since then with decreasing satisfaction and did not want any revision surgery but a definitive solution for the hearing loss. In 2010, the patient received a cochlear implant (Nucleus CI-512) in the left ear due to a progressive hearing loss with functional deafness. The patient was very satisfied with the results in the left ear; therefore, the subject showed up at our department with the question whether one device could improve her symptoms in the right ear.\nThe neurotologic physical examination was normal. An audiogram was performed, which demonstrated a combined hearing loss with a diagonal decay from 30 dB and an air-bone gap from approximately 65 dB in the right ear (). The Freiburger monosyllabic speech test in a quiet environment at 65 dB was performed in the right ear with the hearing aid and in the left ear with the cochlear implant. The subject scored 10% in the ear to be implanted and 75% in the contralateral ear. The computerized tomography of the right temporal bone and the magnetic resonance imaging of the right inner ear were normal. On the basis of the audiogram, speech perception results, and demographic factors, the subject fitted the criteria for a cochlear implant in the right ear. According to the audiogram, the subject had still an aidable low-frequency hearing; therefore, it was decided that an electroacoustic stimulation would benefit her the most. The Nucleus slim straight electrode (CI-522) was chosen.\nThe surgery was performed in a standard fashion: a retroauricular skin incision was made on the right side, the planum mastoideum was presented, and the epithelium to the tympanic cavity was lifted. In the tympanic cavity, a PORP with granulations was seen. The round window was located, and the implant bed was then created. The round window was carefully opened and the slim straight electrode was inserted until the first marker was seen in the round window. The electrode was fixed in the mastoid cavity using fibrin glue and bone-meal. Prednisolon (1gr) and Ceftriaxone (2gr) were systemically administered intraoperatively. The final measurements of the impedances and NRT-potentials yielded favorable results. The patient tolerated the procedure well and without complications. A computerized tomography of the temporal bone was made to verify the position of the electrode after surgery. The CT showed an insertion depth of about 290° (). Two days after surgery, the patient was discharged.\nThe subject returned one month after surgery for her device activation. The four-week unaided audiogram revealed good preservation of residual hearing (). The electrical stimulation was initiated. Five months after surgery, the patient returned to us with poor speech understanding and sound quality in the implanted ear. According to the patient, the hearing had remained the same as before the surgery. The Freiburger monosyllabic speech test in a quiet environment in the right ear with the cochlear implant was once again performed. This time, the subject scored 0%. There were no signs of device failure. There was no history of infection or head trauma in the past months. To discard a displaced implant, a CT-scan was performed and indicated that the cochlear implant was in a normal position in the basal turn of the cochlea. Due to the unfavorable results, a revision surgery was proposed. The patient agreed.\nFor the revision surgery, an endaural approach was performed. A tympanomeatal flap was made, and the cartilage covering the open cavity was lifted. The electrode was visualized, and the scar-tissue around it was removed. The first marker of the slim straight electrode was once again seen in the round window. The electrode was inserted approximately 4 mm deeper into the cochlea until just before the second marker was seen in the round window. The electrode was fixed again, and the NRT-potentials showed normal results. The surgery and the hospital stay were without complications. A CT-scan of the temporal bone was performed, and an insertion depth was reported from approximately 380° ().\nThree months after the revision surgery, the subject described a subjective hearing improvement. Once again, the audiogram showed good preservation of residual hearing (). The Freiburger monosyllabic speech test in a quiet environment was repeated and showed an improvement up to 25%. After six and twelve months, the results were 25% and 45%, respectively. This case report is unique in the literature because it demonstrated that, after introducing the electrode more deeply into the cochlea, the residual hearing was preserved and the speech perception improved significantly, contrary to what has been published. |
A 41-year-old female first visited our clinic for a feeling of strangeness in the left upper molar region in August 2000. The left mandibular third molar was transplanted to the left maxillary second molar part (Fig. ).\nDue to severe periodontal disease, upper left #7 could not be preserved and we explained to the patient that they would require tooth extraction. We explained that they would be managed with dentures and oral implant treatments or tooth transplantation after extraction (Fig. ). The patient requested tooth transplantation, so we performed a transplant of left maxillary second molar using lower left #8 as a donor tooth. During the transplant surgery, local infiltration anesthesia was administered to left maxillary second molar and left mandibular third molar, and then, left mandibular third molar was extracted with the utmost care to avoid injury to the periodontal ligament. Next, we performed drilling to create the transplant bed and created the space to insert a round bur and the implant. We then elevated the maxillary sinus floor using an osteotome. In order to conduct tooth transplantation, the shape of the tooth removed for transplantation and attachment condition of the periodontal membrane was measured using a probe. Based on the length and shape of the root of the transplanting tooth, a three-dimensional transplant socket, which was slightly bigger than the root of the transplanting tooth, was created. Finally, the transplanting tooth was placed into the transplant socket, and fitting was adjusted by grinding the constricted part based on the pulling out resistance of the transplanting tooth. The left mandibular third molar was transplanted into the transplant socket and secured using sutures (Fig. ). The patient was administered antibiotics and analgesics after surgery. The postoperative course was favorable.\nAbout 3 weeks after transplantation, endodontic treatment was started for the transplanted tooth, and abutment construction was performed with a metal core after root canal obturation. Prosthesis treatment was performed for the defective left maxillary first molar, using the left maxillary second premolar and maxillary second molar as abutment teeth for bridging (Fig. ). |
This 17-year-old boy presented to us with intermittent and severe nocturnal nuchal pain and few episodes of vomiting for last 2 months. He also had occasional difficulty in swallowing and recent change in his voice. On examination, he had weakness (grade IV) and wasting in the left upper limb flexors, while power in the rest of the muscle groups was normal. The reflexes in the lower limbs were brisk and the gag reflex was depressed on the left side. There was some hypesthesia in the left C8 dermatome and the gait was normal with no other signs of myelopathy (McCormick grade I). The sagittal magnetic resonance imaging (MRI) revealed a cervicomedullary lesion with an exophytic portion in the lower half, lying ventral to the cord []. The axial images showed its eccentricity to the left []. There were cystic areas within and it showed patchy peripheral contrast enhancement. Although in the upper half, the lesion was completely intramedullary which could be accessed via the posterior midline myelotomy, the case proved to be technically demanding as the lower half of the tumor was completely ventral to the cord and significant neural tissue needed to be transgressed before reaching the tumor. We thus modified our approach and used the DREZ approach from the left side for this particular case. Midline durotomy was made and the cord was seen rotated to the opposite side which was further helped by cutting the dentate ligaments and rotating it further. The tumor removal was started from below where the exophytic portion was tackled first between the roots [], and as we moved up the cord the left DREZ [] was incised to approach the upper intramedullary component. Piecemeal excision was done with the help of ultrasonic surgical aspirator and tumor forceps [] and gross total excision was possible. The histopathology was pilocytic astrocytoma (grade I). The postoperative MRI revealed complete excision without any contrast-enhancing areas []. The patient had a good recovery with grade III power in the left upper limb which gradually improved with time.\nThis 8-year-old boy presented with pain in the neck for 6 months. He had weakness in right-hand grip since 15-20 days along with difficulty in walking which was progressively worsening. On examination, he had grade I power at right shoulder joint while grade II in right elbow flexors. There was hypoesthesia in right upper limb with no sphincteric involvement. The MRI showed an intramedullary tumor enhancing sharply after contrast extending from C2 to D1 region []. The axial sections revealed the lesion to be eccentrically placed []. C2 to D2 laminotomy was done. Intraoperatively, the midline was difficult to identify and the tumor was seen surfacing near right DREZ. Hence, it was approached from the right DREZ and gross total excision was achieved []. The patient was electively ventilated for 48 hours and gradually weaned off later. He had no fresh postoperative deficits apart from increase in weakness of right hand. He recovered well later and was ambulatory at the time of discharge. |
A 42-year-old female was found to have masses in both kidneys four years ago and was transferred to Asan Medical Center. Her family history included VHL disease in her father and her older sister. She also had hemangioblastoma in the cerebellum, which was removed 16 years ago. Abdominal computed tomography (CT) scan performed at this hospital showed masses in both kidneys which were suspected to be RCC; thus, the patient underwent partial nephrectomy of the left kidney. Two months later, the patient underwent radical nephrectomy of the right kidney. Pathology of the samples revealed clear cell RCC in both kidneys. The patient developed local recurrent RCC in the left kidney two years after nephrectomy and was subsequently treated by radiofrequency ablation. The patient then developed multiple metastases in the lungs and was transferred to the oncology department.\nChest CT subsequently confirmed multiple metastases in both lung fields and the patient was diagnosed with lung metastases of RCC and started treatment of sunitinib (50 mg for two weeks, followed by a one-week rest period). The metastatic tumors were found to have regressed following sunitinib administration and reached partial response according to the Response Evaluation Criteria in Solid Tumors (RECIST) criteria (). After administration of sunitinib for 16 months, the patient suffered hand and foot neuropathy (grade 2), and wanted a dose reduction; we decided on a dose reduction of sunitinib (25 mg for two weeks, followed by a one-week rest period). After that, this patient became tolerable to treatment. This partial response has been maintained at a steady state for three years and three months with sunitinib administration. No changes in pancreatic mass lesions or hemangioblastoma of the cerebellum during administration of sunitinib were observed during that period of time (). After that, a chest CT scan showed disease progression in the lung; therefore, the patient's treatment was changed to everolimus (Afinitor, Novartis, Basel, Switzerland). Chest CT at two months of treatment with everolimus showed progression of the disease, therefore, the medication was changed again to sorafenib (Nexavar, Bayer, Leverkusen, Germany). The patient also achieved partial response to sorafenib and is currently receiving treatment with sorafenib for five months. |
A 55 years old man presented as an emergency with a week history of worsening right hypocondrium pain in keeping with a biliary colic pain. He was also complaining of anorexia and some weight loss.\nHis past medical history included hypertension, asthma, symptomatic hiatus hernia and diverticular disease. On his routine blood test, including full blood count, CRP, amylase and urea & electrolytes and liver function test, the only abnormal value was the bilirubin level which was raised at 44 umol/l.\nAn ultrasound scan of his abdomen demonstrated a small amount of echogenic sludge within the gallbladder but no calculi. The gallbladder wall was not thickened and there was no evidence of intra or extra hepatic biliary tree dilatation. The second gallbladder was not visualised, a this time, however the radiographer commented on the poor quality of the images due to overlying bowel gas. The patient was discharged home as he was in good clinical condition and brought back a month later for an elective laparoscopic cholecystectomy (not by the authors).\nThe intraoperative findings, as commented in the operative notes, were a distended gallbladder with some omental adhesion to its wall. The histology report confirmed the specimen to be a chronically mild inflamed gallbladder containing stones.\nThe patient had a quick and uneventful post operative recovery.\nThe same patient was readmitted to hospital eight times following his operation.\nHis symptoms represented few months later with recurrent attacks (every two to three weeks) of persistent, sharp pain in the right hypocondrium, periumbelical and epigastric region, very rarely radiated to the back. The pain lasted for about thirty minutes and was exacerbated by movement such as bending and stretching and in some occasions, but not always, was triggered by eating. However there was no significant association with eating fatty food. He was also experiencing a spasmodic type of pain of few seconds in duration, associated with severe nausea and occasional vomiting, this pain being different from the biliary type of pain experienced previously.\nDuring each admission routine blood tests were performed (full blood count, amylase, urea & electrolytes, liver function test) and resulted within normal limits except from his ALT, whose value had been fluctuating from normal level up to 70 um/l; and his bilirubin which had only one high reading of 23 umol/l.\nClinical examination had repeatedly shown a soft abdomen, tender in the right upper quadrant with no signs of peritonism and negative Murphy's sign. The patient was pyrexial only in one occasion, with a CRP of 46.5 but persistently normal white cell count.\nExtensive radiological investigations were carried out in attempt to find a cause for our patient's recurrent pain (table ).\nThe HIDA scan was normal but the MRCP and CT cholangiogram raised the possibility of an incomplete cholecystectomy or a collection in the gallbladder bed communicating with the cystic duct stump. In view of the ambiguous radiological findings and persistent symptomatology a diagnostic laparoscopy was carried out, one year after his first laparoscopic cholecystectomy. The intraoperative findings were extensive intraabdominal adhesions and thick omental adhesions to the previous gallbladder bed; the second gallbladder was totally hidden to our own eyes, it was wrapped in omentum (figure ) and laying on the transverse colon. Its cystic duct (figure ) entered the common bile duct at lower level then usual and there were several small inflamed lymph nodes along its cystic artery (figure ).\nLaparoscopic cholecystectomy was then performed by the authors. The histology report, apart from confirming the specimen to be a gallbladder, interestingly reported the presence of a traumatic neuroma within the gallbladder wall possibly relating to previous surgery. There was no evidence of dysplasia or malignancy. The patient was discharged home two days after the operation having made a full recovery.\nHe was reviewed in our outpatient clinic three weeks following his discharge from hospital and was finally pain free and in excellent clinical condition. |
The patient was a 77-year-old man who fell from the loading platform of a truck (height 1.5 m) and landed on the back of his head. He could initially walk without weakness or other symptoms. However, he gradually developed dyspnea and right hemiplegia and presented to the emergency department of another hospital. The physician found it difficult to diagnose and treat the patient, and he was immediately transferred to our emergency department by ambulance.\nOn arrival, his consciousness was alert and his vital signs were stable. He felt occipital and posterior cervical pain. There was no dyspnea or right hemiplegia. His medical history included paroxysmal atrial fibrillation, for which warfarin was prescribed. On physical examination, there was no external wound, with only spontaneous pain and tenderness at the back of his head and neck. A motor and sensory examination of the extremities and trunk was normal. After primary and secondary trauma surveys and X-rays of the chest and pelvis, whole body computed tomography (CT) was performed.\nHead CT showed traumatic subarachnoid hemorrhage in the right frontal area and basilar skull fracture of the occipital bone (Fig. ). Whole body CT showed pneumocephalus and air in the jugular vein and right ventricle. To prevent vascular air embolism, the patient was placed in the supine position in a state of absolute rest after admission and was treated conservatively.\nOn hospital day 3, head, neck, and chest CT were reperformed, revealing the disappearance of air in the right ventricle and decreased air in the head and neck veins. The patient’s activity level was gradually increased. On hospital day 4, CT was reperformed, revealing the complete disappearance of air in the veins. There were no signs of vascular air embolism, despite an increase in the patient’s activity level, including raising his head on hospital day 3 and standing up and walking alone on hospital day 5. He developed cerebral salt wasting syndrome (CSWS) on hospital day 6. We therefore administered adrenocortical steroids and the patient gradually recovered from hyponatremia. A long period was required to treat hyponatremia. He was discharged on hospital day 34 without sequelae. |
We describe a 32-year old female with a retrospective diagnosis of PFIC type 3 that was made fifteen years after receiving liver transplantation for end-stage cryptogenic liver disease (see ).\nThe patient was first found to have hepato-splenomegaly at 18 months of age. The proband was otherwise healthy and had no family history of liver disease. No records could be found of investigations performed at the time. The patient then presented at age 14 with jaundice and fatigue and was found to have liver cirrhosis of unknown etiology. An abdominal ultrasound revealed evidence of cirrhosis, portal hypertension and incidental cholelithiasis. Liver biopsy showed micronodular cirrhosis with significant bile stasis in the hepatocytes. There was no significant iron staining, nor typical alpha-1 antitrypsin inclusions identified, but there was increased copper staining, consistent with cholestasis without other evidence of Wilson disease. A viral etiology was also excluded as the patient was confirmed to be immune to hepatitis B virus, and the hepatitis C serology was negative.\nOver the following 3 years, a hepatic diagnosis was not found and the patient progressed to end-stage liver disease. The proband suffered from delayed growth and puberty as well as multiple complications of liver failure. These included jaundice, edema, ascites, two episodes of spontaneous bacterial peritonitis, splenomegaly, esophageal varices, coagulopathy, and hepatic encephalopathy. The patient was referred to the University of Alberta Liver Transplant program for a workup. At the time, her laboratory tests revealed an elevated serum AST of 174 (normal < 40 U/L), ALT of 64 (normal < 50 U/L), and total bilirubin levels of 491 (normal < 20 μmol/L), whereas serum GGT was not measured prior to transplantation. At age 17, the patient underwent a cadaveric liver transplantation and splenectomy for end stage liver disease. The histological evaluation of the native liver demonstrated biliary cirrhosis with moderate portal inflammation, ductular reaction, minimal loss of small bile ducts and chronic cholestasis. There was no biopsy evidence suggestive of sclerosing cholangitis such as a concentric “onion like” fibrosis nor fibro-obliterative scar of the bile ducts (Fig. a and b).\nPost-operative course was complicated by obstructive jaundice due to a stricture within the common bile duct, which required stenting. One month after transplant, the patient experience elevated hepatic biochemistry tests and the liver biopsy was consistent with a mild acute cellular rejection, which was successfully treated with a steroid taper. The patient remained on immunosuppressive therapy post-transplant with tacrolimus to achieve levels of 10–12 μg/L (median tacrolimus level, 11.3 μg/L) as well as low dose mycophenolate. The latter was discontinued at 1 year following transplantation, due to bone marrow suppression.\nTwo years after liver transplantation, at age 19, the patient presented with a new thyroid nodule. A fine needle aspiration revealed papillary thyroid carcinoma, which was successfully treated with thyroidectomy and iodine ablation. The patient had no further complications from immunosuppression.\nThe proband’s clinical status and liver enzymes were stable until eleven years after liver transplant, at age 29, when routine follow-up labs revealed rising liver enzymes and bilirubin. The patient was asymptomatic at that time. Liver biopsy revealed pathological findings consistent with late cellular ductopenic rejection. Low-dose prednisone (20 mg daily) and azathioprine 100 mg daily were subsequently added to the tacrolimus (2.5 mg BID, median tacrolimus level of 9.1 μg/L). The patient complained of increasing fatigue and xerostomia. The liver enzymes continued to rise despite high dose immunosuppressive therapy and then improved following a trial of ursodeoxycholic acid (500 mg BID).\nFifteen years post-transplant, further biopsies revealed the patient has ongoing severe ductopenia (80%) with a component of plasma cell rich rejection. Serum markers for autoimmune hepatitis and primary biliary cholangitis were repeatedly negative.\nAt that point, the patient’s pretransplant hepatic diagnosis was still unknown. The initial histology had revealed biliary cirrhosis but no classical features or serum markers diagnostic of an immune mediated cholangiopathy such as primary sclerosing cholangitis or primary biliary cholangitis. We therefore hypothesized that the patient’s original disease was due to a congenital deficiency of a biliary transporter protein. This hypothesis raised the possibility that the ductopenia observed in the allograft could be due to an autoimmune response to the same biliary protein acting as a neoantigen not previously encountered by the immune system. This phenomenon has been demonstrated in some patients undergoing liver transplantation for PFIC, who subsequently develop alloimmune responses to canalicular proteins []. We therefore investigated whether the proband harbored a genetic defect to account for the biliary cirrhosis and sought evidence of alloimmune serum reactivity to the allograft.\nA DNA sample from the patient was sent to Eurofins Clinical Diagnostics for evaluated for variants within 76 genes within the Genetic Cholestasis panel []. The patient was found to have variants in the ABCB4 gene and both were described as variants of unknown significance (VOUS).\nThe first was c.3227G > A (p.S1076N) that was previously reported in neonatal cholestasis and intrahepatic cholestasis of pregnancy []. The second variant, c.3431 T > C (p.I1144T), has not been described to date.\nTo analyse the presence and position of these mutations, we employed nested PCR to clone and sequence product from both alleles. This was performed using outer primers (Forward: TCTCTCACCTTCATTTCACACC; Reverse: CTGAAGTATGGTGGTTTTGAGC) and inner primers (Forward: TTCAACTATCCCACCCGAGC; Reverse: TGAAAGGATGTATGTTGGCAGC). We confirmed that these mutations are found on alternate alleles by PCR amplification of the ABCB4 region encompassing both variants. These data indicated that the patient was indeed a compound heterozygote.\nWe performed immunohistochemistry to determine the expression of the MDR3 protein and the bile salt export pump (BSEP) in the patient’s explanted native liver as compared to a healthy liver sample. BSEP is localized in the hepatic canaliculi and is encoded by the ABCB11 gene, which is mutated in patients with PFIC2 []. A canalicular expression of BSEP was observed in the explanted patients’ native liver and this was comparable to the pattern observed in the healthy liver control (Fig. c and e). In contrast, the MDR3 expression in the explanted native liver differed from the healthy liver control with a mixed signal of regular and dispersed canalicular pattern associated with a granular signal from within the hepatocytes (Fig. d and f).\nGiven the mixed targeting of MDR3 to the canalicular membrane, the patient was probably not immunologically naïve to MDR3 protein. Nevertheless, we performed further studies using the patient’s serum to assess for alloimmunization. An immunofluorescence study was performed using the patient’s post liver transplant serum on normal human liver that revealed no reactivity to MDR3. While alloimmunization against MDR3 causing disease recurrence in allografts is theoretically possible, it has only been reported to occur in patients undergoing liver transplantation for PFIC2 associated with development of antibody reactivity to BSEP [].\nTaken together, the clinical presentation, the genetic testing, and the MDR3 distribution on both the canalicular membrane and within hepatocytes, were consistent with a diagnosis of PFIC3 disease. However, the patient has developed progressive ductopenic rejection with liver failure and is currently re-listed for a second liver transplantation. By clarifying the original hepatic diagnosis, we can conclude that the ductopenia in the allograft is due to chronic rejection rather than autoimmune in the allograft. |
A 25-year-old software engineer came to emergency department (ED), with a request to get himself tested for HIV infection, even though he did not have any previous episodes of unprotected sexual intercourse or any illicit drug use. However, he said that he has subjected himself willfully to repeated snake bite over a period of 6 months with an interval of 30-45 days between each exposure. Patient was questioned on the awareness of toxic effects of snake venom and he had optimal knowledge. Incidentally, he said that he was stressed very much and had insomnia, due to immense work pressure. As some of his colleagues exposed to snake bite willfully felt relieved of his stress and experienced euphoria, patient accepted for willful snake bite and felt relaxed and had good sleep also. With patient's consent, he was investigated for HIV and his serology was negative. After this episode another friend of primary case, who is also a software engineer of 23 years old, came to ED with same request, as he has subjected himself to willful snake bite. He experienced sound sleep for 20-24 h and had relaxed mind after snake bite without any hang over/head ache, tremor, and sense of crawling. He also felt that his sexual desire has increased. Both of them did not experience any withdrawal symptoms. General and systemic examination including psychological assessment did not reveal any abnormalities in both. Their basic hematological and biochemical profile were within acceptable levels.\nInterestingly, these two cases informed that there are different dens in different cities wherein people who want to have snake bite are allowed to sit in chairs. The person in charge of snakes holds the snake near the head end of snake just distal to lip margin. Initially, he makes the snake to inject minimal bite in little toe or index finger for minimal envenomation, and then, he makes the snake to bite in lip or tongue of individuals according to their wish. The most commonly used snakes were krait, cobra, and green snake. Persons who were bitten, showed jerky movement and left the room within few minutes. From the reports provided orally, six persons lost their life due to such procedure. Many people who use such dens were from high socioeconomic status and well educated. Some of them were youth and college students. |
A 70 year-old male presented to the emergency department of our institution after being involved in a motor vehicle accident. He had sustained a minor injury of the head (Glasgow Coma Scale 15/15), the chest (seat belt burn) and lower extremities (bruises). His major complaint was severe pain of the right ankle. His past medical history was significant for diabetes mellitus controlled with an oral hypoglycemic (metformin) for 6 years with satisfying control of blood glucose levels. The patient's medical history did not reveal any previous high-energy damage of the right ankle and clinical examination of other joints was negative for hypermobility. No other medical or surgical history was reported.\nUpon initial inspection, there was moderate edema of the right ankle region and obvious anterior-lateral dislocation of the talus with the forefoot in line. The right foot had normal skin temperature, pedal pulses were palpable and there was slight hypoesthesia of the dorsal aspect in comparison to the contralateral foot. Further clinical examination was impossible due to the patient's level of discomfort. The initial plain radiographs (anteroposterior and lateral views of the ankle joint) confirmed the diagnosis of talar dislocation, but also the absence of any fracture (). Owing that there was no fracture and major neurovascular trauma, an attempt of closed reduction was performed at the emergency department at approximately 1½ hours after the injury.\nThe closed reduction was achieved by axial traction of the calcaneus with one hand while the other hand was placed at the dorsal aspect of the midfoot with the foot held in slight plantarflexion for a couple of minutes, followed by lateral compression and external rotation of the talus and, finally, dorsiflexion of the foot in a way to redirect the articular line of the ankle joint. The attempt was successful and confirmed with radiographic imaging after the closed reduction (). Maintenance of reduction was accomplished with a posterior ankle splint while the patient remained at the hospital for observation. General measures for pain and edema of the closed reduction included elevation of the right lower extremity, ice therapy, oral analgesic and non-weight bearing status to the right foot. After 3 days of hospitalization, the patient was discharged without any complications. Ten days later, the edema had subsided significantly, the splint was changed to a cast and partial weight-bearing was allowed for 5 weeks followed by full weight bearing for the next 3 weeks.\nAfter 8 weeks, the lower extremity cast was removed and the patient was followed with standard and stress radiographic views. At that time, there were no signs of instability and the range of motion of the right ankle was satisfactory and painless. The American Orthopedic Foot and Ankle Society (AOFAS) score was 77/100. The patient was then allowed to full weight-bearing status without the use of additional cast applications. One year after the initial injury, the radiological findings were negative for any signs of osteonecrosis or early signs of ankle arthritis (). The right ankle was pain-free with similar range of plantarflexion and dorsiflexion as compared to the left ankle [plantarflexion: 0–44° (right), 0–46° (left)/dorsiflexion: 0–15° (right), 0–16° (left)]. The AOFAS score at the 1 year follow-up was increased to 90/100. |
An 86-year-old man with chronic heart failure and atrial fibrillation was followed by a cardiologist as an outpatient and subsequently admitted to the ICU at our hospital because of septic shock associated with a urinary tract infection. His Charlson morbidity score was 7 []. After admission, he suffered from respiratory distress and required intubation for mechanical ventilation. Initially, his cardiologist, who was the attending doctor, preferred to use advanced care for the patient. However, the patient was unable to agree to this option because of his impaired level of consciousness and therefore the doctor obtained consent from the patient's family to initiate life-sustaining therapy. As a consequence of this intensive care that included antibiotic therapy and management of mechanical ventilation, the physical status of the patient recovered temporarily. However, on the 36th hospital day, the doctor confirmed a further reduction in his level of consciousness, and magnetic resonance imaging showed that a brain infarction had occurred. The patient's family was therefore informed of his poor prognosis. On the 48th hospital day, the patient developed acute panperitonitis caused by a gastrointestinal perforation. A surgeon proposed either an operation or conservative care for this condition to the family who subsequently selected conservative management.\nAfter 49 hospital days, the patient's physical condition worsened, with the development of oliguria and progression of renal insufficiency. The attending doctor consulted us to discuss renal replacement therapy. After a careful diagnosis of the patient, we concluded that hemodialysis (HD) should be started immediately. However, his systolic blood pressure was barely maintained at approximately 80 mm Hg by the administration of a continuous intravenous vasopressor. Moreover, sepsis became uncontrollable, associated with multiple organ failure, indicating that the patient was in the final stage of a life-limiting illness. A marked thrombocytopenia due to sepsis was also detected. As a consequence, it was considered that the insertion of the dialysis catheter for the initiation of HD may have resulted in uncontrollable bleeding. We therefore discussed with other cardiologists, nephrologists, and nurses in the ICU whether or not HD was a suitable care. We concluded that dialytic therapy would not be effective and that we could not practice HD safely because of the patient's poor condition. We also recognized that conservative or palliative care was more acceptable as end-of-life care for the patient.\nUnder such circumstances, we explained to the patient's family that HD would not contribute directly to the recovery of sepsis and that it may also be a further burden for him. In addition, we had also referred him to comfort or palliative care (i.e. NTD) as an optional end-of-life treatment. However, the family became disturbed and withheld their decision from the first meeting, although one day later they agreed to NTD. We found that the preference for end-of-life care of the family changed considerably during this difficult period for the patient.\nTwo days after obtaining consensus for this treatment, the patient died peacefully surrounded by his family in the ICU. Fortunately, the family confirmed that they were satisfied with our care. |
A 34-year-old female who has no previous clinical illness presented in 2000 with a large irregular mass, estimated clinically to be around 5 × 6 cm by physical examination, involving the right breast while she was lactating. There were no other signs or symptoms. FNA was done to rule out breast cancer, and the specimen showed few foamy macrophages and rare clusters of ductal cells, with focal secretory lactational changes. Based on that, it was determined that the specimen was negative for malignancy. The tumor continued to grow, and in June 2004, FNA of the right breast was repeated and showed large staghorn-shaped sheets of uniform ductal cells with no cytologic atypia along with myoepithelial cells. There were fragments of fibrotic stroma and bare nuclei scattered in a bloody background, and so, a diagnosis of fibroadenoma was made. Two months later, the patient underwent excision of the tumor in another healthcare facility. Examination of the slides showed an overgrowth of epithelial and stromal components in pericanalicular and intracanalicular patterns with irregular large cystic spaces showing protruding leaf-like structures (). The stromal cells showed plump elongated slightly dysmorphic nuclei with occasional prominent nucleoli. Other areas showed significant cellular growth of the stromal spindle cells which appeared to be arranged in long intersecting fascicles and growing in herringbone pattern (). Within the spindle cell growth, extracellular mucin was noted. One focus showed an exclusive spindle cell growth which was moderately atypical with plump elongated hyperchromatic nuclei. Numerous mitosis was found, up to 20 in 10 high power fields in this focus. Entrapped epithelial ductal elements were occasionally seen in other areas exhibiting ductal epithelial hyperplasia. These features were consistent with malignant phyllodes tumor with stromal fibrosarcomatous overgrowth. The patient subsequently underwent mastectomy as the margins were focally involved. During the procedure, a mass measuring around 3-4 cm was found in the most posterior aspect of the breast and there was some indication that it may have invaded the pectoralis major muscle. All the breast tissue, the tumor, and some of the muscle fibers were removed. On gross examination, there were multiple tumor masses in the inner lower and outer upper quadrants, the largest being 3 cm. On microscopy, there was proliferation of atypical spindle and elongated plump cells with pleomorphic nuclei and occasional prominent nucleoli. Extracellular mucin was also identified. The atypical stromal cells formed herringbone fascicular growth pattern reminiscent to fibrosarcoma and numerous mitosis averaging around 14 mitosis in 10 high power fields. No residual phyllodes tumor elements were identified. The tumor nodules had a well-demarcated margin with focal infiltration of surrounding breast and adipose tissue. No lymphovascular invasion, necrosis, or heterologous differentiation was seen. All surgical margins and muscle fibers were not involved by the tumor. The skin and nipple did not show any involvement either. All these histological features were identical to those identified in her previous lumpectomy except that there was more pronounced atypia and no residual epithelial component of phyllodes tumor identified. No lymph nodes were identified. A year later, the patient began to suffer from acute bouts of pancreatitis and was admitted several times for this. In March of 2006, abdominal CT was performed and showed a heterogenous low attenuation soft tissue mass involving the head and body of the pancreas and was extending upwards. The celiac vessels and its branches were going through this mass but did not show any significant narrowing. There was obvious atrophy of the pancreatic tail and dilatation of the pancreatic duct. The mass was in contact with the anterior aspect of the inferior vena cava (IVC) with no clear fat plane in between (). Biopsy of the pancreatic mass showed uniform proliferation of elongated spindly cells which had coarse chromatin and mild to moderate nuclear pleomorphism. Some cells had plump hyperchromatic nuclei. Numerous mitotic figures were identified (). The background showed variable amounts of collagen and stroma with focal areas of myxoid appearance. Immunohistochemical staining showed strong positivity for vimentin; however, the cells were negative for actin, S100, and cytokeratin (). These findings were consistent with metastatic fibrosarcoma of the pancreas secondary to her primary breast lesion. Due to the location, extent, and nature of the condition, the case was deemed unresectable. Chemotherapy was initiated; and in the little chance that the tumor shrunk enough, the possibility of resecting the metastasis would be entertained. In January 2007, the patient presented to the ER with severe epigastric pain, where she collapsed, was hypotensive, and subsequently admitted. On examination, a tender mass in the epigastric area was felt. Urgent CT of the abdomen and pelvis with and without contrast showed a pseudoaneurysm in the splenic artery measuring around 3.5 cm. There was also expansion of the retroperitoneal mass and blood in the intraperitoneal cavity. There was heterogenous enhancement in the liver most probably indicating liver infarct. In addition, there were areas of the IVC which had markedly thinned wall and areas suspicious for active bleeding, especially from the proximal splenic artery (). The pancreatic fibrosarcoma had grown and eroded branches of the celiac artery with bleeding pseudoaneurysm along with infarct of the liver, spleen, and adjacent organs. The patient continued to be hypotensive with abdominal distention due to severe intra-abdominal bleeding and developed multiorgan failure and hemorrhagic shock leading to her death. |
A 13-year-old male athlete presented to the emergency department with an injured left tibia. The patient reported a left knee forced hyperflexion during a football match, which caused the injury. The described mechanism of injury was violent contraction of the quadriceps muscle against a fixed tibia.\nThe left knee was held in 100° of flexion with complete inability to extend the knee or bear weight. On examination, there was obvious swelling over the proximal tibia and on palpation there was tenderness on the anterolateral part of the proximal end of the tibia. No neurovascular impairment was identified. The patient was able to actively move his ankle, as well as his toes, and both posterior tibialis artery and dorsalis pedis artery were palpable.\nFrom the plain radiographs, a displaced flexion type Salter-Harris type II fracture of the proximal tibia epiphysis was identified ().\nFew hours after admission, the patient was led to the theatre and, under general anesthesia, a closed reduction of the fracture was performed by extending the knee and putting strong pressure over the tibial tubercle. Reduction was confirmed using image intensifier () and stability of the fracture was verified, as there was no displacement at 80° of knee flexion. After reduction, the dorsalis pedis artery and the posterior tibial artery were palpable. Since there was no displacement with that degree of flexion, percutaneous pinning of the fracture was not performed and only a circumferential cast with the knee in full extension was applied.\nPatient was hospitalized in the Orthopaedic Department under close observation of limb neurovascular status. On the same night after reduction, the patient developed severe pain, which subsided after splitting the cast. The next few days, the patient developed severe swelling over the anterior tibia compartment, but there were no clinical signs of compartment syndrome. Posterior tibialis remained easily palpable, whereas the dorsalis pedis became weak but easily identifiable with the Doppler ultrasound scan. Fracture remained in a satisfactory position one week after reduction () and a full femur-tibia-ankle cast in 5° of knee flexion was applied. 2 weeks after injury, radiographs of the fracture were still satisfactory. 6 weeks after injury, fracture position was satisfactory with radiographic evidence of healing () and the cast was removed, encouraging active range of motion of the knee []. At the same time, the anterior tibialis artery was easily palpable and a triplex ultrasound scan of the lower limb was normal. 8 weeks after injury, the patient achieved full range of motion, and full weight bearing was allowed. MRI scan was performed at this point; as occasionally, these fractures are associated with ligamentous injuries around the knee. MRI scan was normal regarding the cruciate and the collateral ligaments as well as the menisci. Patient's follow-up will continue with serial radiographs at 4 months, 8 months, and 12 months in order to detect early signs of growth arrest or angular deformity and genu recurvatum. |
A 4-year-old Caucasian boy was referred from a private office to our pediatric dentistry clinic with a complaint of swelling in left anterior maxillary canine and lateral incisor teeth area. It was started about five months previously bilaterally in a smaller dimension. The right lesion subsided without any intervention but the left lesion has been enlarging with parents and child manipulation. The central and lateral primary incisors were extracted 3 months ago by a general dentist with the diagnosis of periapical abscess but the lesion did not heal and has been progressively growing. The lesion was painless and with no associated spontaneous bleeding except for occasional interference of the swelling with mastication. His medical history includes no complication.\nOn clinical examination, he had slight extraoral facial swelling of his left anterior maxilla, without any palpable regional lymph nodes. An intraoral examination showed a 20 × 15 × 12 mm pedunculated, lobular soft tissue mass of his left anterior maxillary gingiva related to his incisors (). On palpation, the lesion had a firm consistency. The mucosal covering of the lesion exhibited surface tan, red, and bluish areas with a focal area of ulceration. A periapical radiograph of this area revealed superficial erosion of the alveolar bone with no other significant findings ().\nThese clinical and radiographic findings indicated a benign lesion, and the following differential diagnoses were considered: parulis, pyogenic granuloma, peripheral ossifying fibroma, PGCG, and peripheral odontogenic fibroma. Malignant entities such as squamous cell carcinoma, other primary malignant lesions, and metastatic lesions, although thought to be unlikely, were also considered.\nThe patient was scheduled for surgical excision. Under local anaesthesia, the lesion was excised down to the periosteum (). After complete excision of the lesion, the exposed surface was cauterized to control the bleeding and the entire specimen submitted for histopathologic examination.\nMicroscopic examination shows multinucleated giant cell proliferation within a background of spindle-shaped and ovoid mesenchymal cells. Areas of haemorrhage and acute and chronic inflammatory cells are frequently present. A zone of dense fibrous connective tissue separates giant cell proliferation from mucosal surface. Areas of dystrophic calcifications and reactive bone formation are seen around (). This histopathology confirmed the entity of PGCG.\nFollow-up visits were scheduled at three week intervals. No signs of recurrence of the lesion have been observed during nine months after the excision. |
A 63 years old lady carried out a complex re-laparotomy for a postoperative small bowel occlusion after a radical cystectomy because of urothelial carcinoma. The procedure lasted 3 h because of thick adhesions that needed to be cleared. At the end of the procedure, total blood loss was 2 litres, and two Units of Packed Red Blood Cells (PRBC) were infused. During the surgical procedure, a central venous catheter was placed in the internal jugular vein by ultrasound-guided puncture of the vessel, but an inadvertent puncture and cannulation of the right subclavian artery occurred before catheter placement. Because of the ultrasound-guided procedure, the anesthesiologist thought to have cannulated the carotid artery and applied local pressure for a few minutes. Two hours later, when the patient was in the Intensive Care Unit (ICU) around midnight, a chest X-ray to check the correct position of the central venous catheter revealed a massive hemothorax (), while the patient was hypotensive and responder to crystalloids and blood infusions. A chest drain was inserted without any substantial output but a small amount of clotted blood. The patient rapidly worsened, despite appropriate resuscitation with 10 U of PRBC, 8 U of Fresh Frozen Plasma (FFP), 3 U of cryoprecipitate and 1 U of platelets from apheresis. A second chest X-Ray to check tube position revealed a tension hemothorax (). The team in charge of the patient, comprising the anesthesiologist that did the general anaesthesia for the surgical procedure, made the diagnosis of suspected subclavian artery perforation and tension hemothorax with both hypovolemic and obstructive shock. The team decided to bring the patient in the hybrid room to control the likely bleeding for the right subclavian artery. While the patient has been positioning on the angiographic table, the ECG monitor showed severe bradycardia, with a heart rate of 30 and an impending cardiac arrest with a systolic blood pressure of 30 mmHg. An emergency thoracotomy to decompress the right chest was then performed via a V space incision, and five litres of blood under pressure were drained from the right pleural space, with a rapid improvement in the vital signs. During the endovascular procedure, the general surgeon left the thoracotomy open to allow a continuing suction in the pleural space to prevent the accumulation of clots. The endovascular procedure was conducted by the vascular surgeons and lasted 40 min, confirming the massive leak from a significant defect in the subclavian artery () and consisted in a 7 x 37 mm covered stent placement in the subclavian artery at the origin of the vertebral artery. The stent was expanded with a balloon taking care of not injuring the already damaged vessel (). The patient had a transient improvement, but in the next few hours, a hemodynamic instability again occurred, even if responsive to blood infusion. A CT scan revealed a leakage from the stent, because of retrograde revascularization of the vertebral artery (). A new endovascular procedure, with more pronounced balloon dilatation of the stent, definitely controlled the bleeding. ) The patient slightly improved after an open surgical debridement of the pleural space from clots and blood, given the absence of an output from the two large drains that were in place. In the next few days, the patient went back to the ward and made a gradual full recovery with no neurological or vascular defects (). |
A 56-year-old male was found to have a 4 cm exophytic right lower pole lesion upon work-up for complaints of back pain. The CT scan performed demonstrated enhancement (>20 HU) of the lesion and was suspicious for renal cell carcinoma as seen in Figures and .\nHis comorbidities included a history of Autosomal Dominant Hyper IgE (Job's) Syndrome, sickle cell trait, alcoholic liver disease, avascular necrosis of the hip, polysubstance abuse, and depression. The patient described a history of recurrent skin infections with formation of multiple abscesses since he was a young child. These skin infections were managed both medically with the use of antibiotics and surgically with incision and drainage. He also had a history of respiratory infections consistent with his Hyper Ig E Syndrome. The patient continues to suffer from recurrent dental abscesses for which he requires tooth extractions and receives topical treatment for his HIES dermatitis. Serum IgE levels at the time of his malignancy work-up were found to be within normal limits. It had been over 10 years since the patient had engaged in any drug or alcohol abuse; however, given his alcoholic liver disease and HIES, he was at high risk for immunodeficiency. Appropriate work-up further revealed that the patient did not have human immunodeficiency virus and hepatitis B or C.\nTreatment options were discussed with the patient including biopsy of the lesion, surgical intervention with partial/radical nephrectomy, and ablative procedures. The patient elected to undergo partial nephrectomy for treatment and diagnosis of the lesion. His preoperative work-up included medical as well as infectious disease clearance due to his immunocompromised state. Infectious disease consultation recommended standard preoperative surgical prophylaxis as the patient had no ongoing infection at the time of surgical planning.\nOpen partial nephrectomy was performed without any intraoperative complications and pathology of the specimen revealed pT1bNxMx clear cell renal carcinoma with Fuhrman Grade 2. The tumor was 4.1 cm in size and did not exhibit any sarcomatoid features and the tumor margins were negative. |
The authors report a case of a 29-year-old Saudi woman who was G4T2P0A1L2 at 21 weeks of gestation. She was free from medical illness and she had had no previous surgical procedures. She is a housewife; she never smoked tobacco or drank alcohol, and she had no history of recent travel to endemic or pandemic areas. She was referred based on an antenatal ultrasound finding that showed multiple fetal anomalies. This ultrasound had been conducted at another hospital for evaluation and management. Her past obstetrical history was uneventful with two normal term vaginal deliveries and a history of first trimester unexplained miscarriages. She is married to a first-degree cousin working in a governmental institute; there is no history of genetic or congenital anomaly in either of their families.\nHer current pregnancy was spontaneous with no history of illicit drug use or exposure to infection or radiation. Her initial early antenatal scan diagnosis showed suspicion of possible fetal diaphragmatic hernia and required further validation which was not possible at the maternal–fetal medicine (MFM) unit at the hospital which also did not have available sonographic specialists. During her first antenatal visit at 21 weeks + 0 day of gestation, the results of her anatomy scan revealed a single viable fetus with estimated fetal weight (EFW) on 50th percentile with normal biometry measurements.\nFurther detailed anatomy scan findings revealed a male fetus with both kidneys appearing small in size, hyperechoic dysplastic, both ureters were dilated, urinary bladder looked abnormal in shape with thickened bladder wall, and umbilical cord at fetal insertion side appeared thickened. In addition, the diaphragm was seen clearly separating the chest from the abdominal compartments with no evidence of diaphragmatic hernia. Both feet were clubbed and open hands were seen with no other anomalies or any soft marker seen (see Fig. .) Based on the multiple fetal structural anomalies discovered, the couple was counseled about the scan findings and advised for further workup, such as: perinatal invasive testing; toxoplasmosis, other (syphilis, varicella-zoster, parvovirus B19), rubella, cytomegalovirus, and herpes (TORCH) screening; and fetal echocardiogram to exclude syndromic or chromosomal causes. This would support reaching a better diagnosis and allow for further discussion on the options available such as the continuity of the pregnancy or termination based on the severity of the fetal condition (see Table ).\nOur patient had some social issues and was also following her condition in another institute and only revisited our center at 32 weeks and 4 days of gestation. At our center another follow-up scan revealed a single viable fetus, cephalic in presentation, anhydramnios with normal head and femoral length biometry. Unfortunately, the abdominal circumference (AC) was not taken due to the extremely distended abdominal wall that prevented any further visualization by ultrasound. The right kidney measured 3.4 × 1.1 cm with a small cyst, the left kidney measured 2.9 × 1.3 cm with bilateral hugely dilated ureter and urinary bladder (mega cyst) (see Fig. ).\nTORCH screen test results were non-reactive. Amniocentesis was performed and showed normal chromosomal results. A fetal echocardiogram allowed for limited examination due to anhydramnios; however, no obvious cardiac anomalies were noted. Lungs appeared compressed due to severely distended abdomen from the progressively enlarged urinary system, otherwise no other abnormal findings noted. The couple was counseled by the MFM team about the worsening condition from the recent scan findings and were told about the poor fetal prognosis and the high mortality rate, secondary to severe lung compression with the presence of anhydramnios which would lead to lung hypoplasia and cause fetal demise.\nIt was explained that the entire urinary system was affected with severe dilatation causing severe abdominal wall dilatation and for this reason measuring fetal AC had been difficult antenatally. Options were discussed with the couple:Termination of pregnancy to avoid obstetrical complication during labor which is fetal abdominal dystocia as it was difficult to measure the abdominal wall antenatally with the severe progressive renal system dilation with advancing gestational age versus To wait until term pregnancy while knowing the poor fetal prognosis\nFurthermore, antenatal interventions were offered to the couple including tapping of the fetal bladder and ureters prior to induction of labor and to then send the amniotic fluid sample for further genetic testing. Our patient’s case was initially discussed by a multidisciplinary team which included a perinatologist and a neonatologist before finally making a combined agreement and alignment with the couple who decided to terminate the pregnancy; a caesarian section would be preserved for maternal indication and comfort care post-delivery to born infant were also explained.\nAt 32 weeks and 5 days of gestation, tapping of the fetal bladder and ureter was performed and samples of amniotic fluid were sent for whole exome sequencing (WES) test; however, unfortunately, after waiting a few weeks for the results, no results could be determined due to a laboratory error.\nOur patient underwent induction of labor to terminate the pregnancy and delivered vaginally a male neonate with Apgar score of 2 in 1 minute and 5 in 5 minutes, weighing 1800 grams without any complications. The vital signs revealed blood pressure of 90/60, pulse 100 beats /minute, and temperature of 36 °C. Clinical examination of the newborn revealed distended abdomen and thin wrinkled skin, retracted chest, cryptorchidism, and clubbed feet; no facial anomalies were noted and the features were most likely to be suggestive of PBS (see Fig. ). The newborn died 2 hours post-delivery.\nThe placenta was sent for a histopathology examination as a part of the workup and the result revealed normal findings.\nA postmortem examination was not offered to the couple since this is not conducted in the center. The couple was counseled prior to discharge regarding future pregnancy plans, despite low reoccurrence. It was also highlighted to them the importance of having early prenatal testing in a center in which there were well-trained sonographers and a high risk in pregnancy unit available. They were also informed about the lack of result of WES test due to laboratory error and they were fine. |
The 30-year-old woman was admitted to our intensive care unit after being endotracheal intubated in emergency setting due to possible battery ingestion. The patient was suffering from a severe borderline personality disorder with a long medical history of recurrent suicide attempts and numerous incidents of nonsuicidal self-injury (NSSI) causing deep scarves on her arms and breasts. She was living in a residence specialized on giving care that ensures the surveillance of members with refractory psychiatric disorders who were unable to get integrated into community. Approximately one hour before her admission the patient called social servers for help and confessed having swallowed an uncertain number of different types of batteries while being unattended. Although relief of sudden emotional stress with no suicidal attention was her given motive, the patient refused to follow emergency physician to the hospital and became violent, which led to application of sedative-hypnotic drugs and subsequently to prehospital endotracheal intubation.\nThe general physical examination on the board revealed signs of acute abdomen and laboratory tests were unremarkable. An immediate upper intestinoscopy was undertaken in order to exclude esophageal impaction and two button batteries were removed from the stomach of the patient. Preparation for colonoscopy was initiated. As the total number of digested foreign bodies remained uncertain an X-ray of abdomen was performed 12 hours after starting colon prep. As shown in two more button batteries and two cylindrical ones were found to form a cluster in Right Lower Quadrant (RLQ) of abdomen. Having concerns that the batteries were already oxidated or even stuck in terminal ileum, we proceeded immediately with lower intestinal endoscopy.\nUnder the implementation of endoscopic loops and Dormia basket, three of overall four batteries were removed from cecum as they have already passed into colon. Having captured the third one, we could see the last cylindrical battery in the background of endoscopic field deep in cecum (). Surprisingly after inserting colon again in order to remove it, the foreign body was not detectable anymore. The examination was unsuccessfully repeated over three sessions with careful inspection of the colonic loops from cecum to rectum. We supposed subsequently that the battery could have moved retrograde into small bowel. We negotiated colonoscope through the ileocecal valve, detected the foreign body in terminal ileum, grasped it with an endoscopic loop, pulled it through the valve, and removed it per anus (). The length of the battery was more than 4 cm () with a diameter of 15 mm. |
A 48 year old lady was brought to the hospital with alleged history of road traffic accident. There was associated loss of consciousness but no bleeding from the ear, nose or throat. Primary and secondary survey revealed fracture lower one third of left femur along with fracture of shaft of left tibia. There was associated fracture of the pelvis (Left). The ultrasound of the abdomen and NCCT head did not reveal any abnormality. She was adequately resuscitated and planned for open reduction and internal fixation of the femur and tibia on the following day.\nOn the day of the surgery two 16G IV cannulas were secured and in view of her associated fracture pelvis she was given general anaesthesia. Intra operatively blood loss was about 700ml which was replaced with Ringer lactate, blood and blood products. Her heart rate ranged between 120 to 146 beats per minute with a blood pressure of 70/ 40 mm of Hg to 128/76 mm of Hg and her SpO2 was between 78 to 95%. In view of her unstable hemodynamics and an intraoperative ABG suggesting moderate hypoxaemia, it was decided to electively ventilate the patient postoperatively. She was put on assist control mode of ventilation with a tidal volume of 400ml ,RR of 16bpm, fiO2 of 0.6, PEEP of 8 with an I:E ratio of 1:2. On the first post operative day her hematocrit dropped and she developed thrombocytopenia with an INR of 1.97.\nX- ray chest showed diffuse bilateral infiltrates with right sided pleural effusion; ECG revealed right ventricular strain pattern with tachycardia. ABG showed pH of 7.40 with pCO2 of 42 mm of Hg and pO2 of 71 mm of Hg. The fundoscopy was normal. Accordingly as per Gurds classification she was diagnosed as a case of Fat embolism syndrome. She was subjected to invasive hemodynamic monitoring maintaining a CVP of 10 - 12 cm of water with a mean arterial pressure of > 65 mm of Hg. She showed dramatic improvement with ventilatory support and could be weaned off and extubated on the second post operative day.\nShe however continued to have episodes of mild hypoxemia (SpO2 between 80 to 90%) which could be managed with non invasive ventilation in BIPAP mode. We used the ST mode with an initial IPAP of 14 cm H2O and an EPAP of 7 cm H2O. She had an uneventful recovery thereafter. |
A 13 year old female competitive figure skater presented to the physical therapy clinic with right calf pain that began two months earlier. Prior to her injury the patient was competing in the singles discipline of figure skating. She trained 2-3 hours per day on the ice year-round. The patient additionally performed daily off-ice training for one hour that included strength and conditioning sessions, pilates and ballet. The patient initially received two months of physical therapy at another facility. Previous therapy included initially wearing a walking boot for three weeks with no figure skating training, progression back to figure skating, manual therapy, modalities and exercise. The patient reported that her pain never fully resolved and further intensified approximately one month post initial injury after she increased the number of off-ice jumps performed during training. The patient was again instructed to wear the walking boot for three weeks and to stop figure skating training for the time being.\nInitial evaluation\nThe initial physical therapy examination at our facility was performed two months after the initial onset of pain. The patient received a prescription for physical therapy with a diagnosis of a right lateral calf strain. The patient presented to the clinic wearing a walking boot and having not skated for the past three weeks per previous instructions. At the initial evaluation the patient’s lower extremity functional scale (LEFS) score was 63 and her pain level on the numeric pain rating scale (NPRS) was 4/10. The patient reported that she was currently not participating in any figure skating or off-ice training per previous instructions and reported difficulty performing housework, ambulating stairs, squatting, standing for prolonged periods and ambulating as required for daily activities. Measures taken at the initial examination are shown in Tables , . Major deficits included weakness in bilateral hip extension and abduction strength, decreased right ankle inversion, eversion and plantar flexion strength that were all painful when tested, decreased core strength when performing the quadruped rotary stability test, pain when testing the right gastrocnemius and soleus flexibility; moderate pain with palpation of the right mid gastrocnemius, right lateral soleus and right peroneus longus and brevis, inability to perform single leg stance testing on the right secondary to pain, and decreased pelvic stability with knee valgus, measured via observation, when performing single leg squats on the left. A presence of bilateral tibia bowing was noted during postural observation and no significant gait deviations were present. The patient’s goal for physical therapy was to return to full figure skating training, to participate in a jump technique camp one month later and to compete in a local competition three months later. Long term activities and participation goals included being able to ambulate greater than one mile, run and ambulate stairs without difficulty, return to modified figure skating training, to be independent with a proper progression back to full figure skating training and a LEFS score of at least 75. Long term structures and function goals included bilateral hip abduction and extension strength 5/5, core strength 4+/5, right ankle strength 5/5 all planes, single leg squat test (Appendix A) level 3 bilaterally, Y balance test (Appendix A) measures on the right within one inch of those on the left in all directions and right gastrocnemius and soleus muscle length within normal limits. All of the long term goals were initially set to be met within 12 visits.\nInterventions\nTherapeutic exercises and neuromuscular re-education exercises for the first fifteen physical therapy visits consisted of dynamic stretches and yoga poses to improve gastrocnemius and soleus muscle length, various plank exercises with multi-plane movements to improve core strength, various closed kinetic chain multi-plane exercises to improve gluteus medius and maximus strength and small multi-directional plyometric exercises. Manual therapy interventions for the first fifteen physical therapy visits consisted of soft tissue massage and instrument assisted soft tissue massage of the right gastrocnemius and soleus.\nFirst re-evaluation\nThe patient was re-evaluated two months following the initial evaluation. The patient’s LEFS score improved to 70, however pain remained a 4/10 on the NPRS. Re-examination measures are shown in Tables , . The patient demonstrated improvements in all areas initially tested and had returned to modified skating that included some jumping.\nInterventions\nPrevious interventions from the first fifteen physical therapy visits were continued and progressed over visits sixteen through twenty. Additional therapeutic exercises to improve eccentric gastrocnemius and soleus control on jump landings were added. Sports specific exercises were added during visits sixteen through twenty as well as exercises performed on unstable surfaces.\nSecond re-evaluation\nThe patient received a second re-examination three and a half months after the initial evaluation. Re-examination measures are shown in Tables , . Although most objective measures had improved, the patient’s pain level had increased to 6/10 on the NPRS and her LEFS score had decreased to 63. The patient continued to present with decreased right ankle plantar flexion strength and additionally presented with decreased right ankle eccentric control on jump landings upon observation and decreased jump height on the right when compared to the left. The patient was not improving as expected and was therefore referred back to her physician. The patient’s physician ordered an MRI, which came back negative and the patient was instructed to continue with physical therapy. Secondary to the patient’s continued symptoms the authors decided to re-visit the differential diagnosis. Based on the patient’s daily subjective reports the authors decided to include exertional compartment syndrome in the new differential diagnosis. The authors asked the patient to record exactly when symptoms began to increase and when they would decrease with details of her skating times included. Additionally, the patient was asked to take pre-skating and post-skating circumferential measurements of the bilateral lower legs. The patient was instructed on the methods for taking lower leg circumferential measurements.\nInterventions\nTherapeutic exercises and neuromuscular re-education exercises from previous physical therapy visits were continued and progressed over visits twenty-one through twenty-five. However, secondary to increased calf pain, the higher intensity weight bearing and plyometric exercises were not tolerated at each visit. Manual therapy continued to consist of soft tissue massage and instrument assisted soft tissue massage of the right gastrocnemius and soleus.\nOutcomes\nThe data received from the patient is presented in Tables , . Secondary to the data showing a consistent increase in symptoms at approximately the same time after beginning figure skating training and improved symptoms occurring at approximately the same time post skating, the authors now suspected exertional compartment syndrome. Additionally, circumferential measurements of the bilateral lower legs revealed a difference in lower leg expansion between the right and left lower legs with training (Table , Figure ). On average the right lower leg expanded less than the left with training and in many instances actually decreased in circumference with training. The patient was encouraged to follow-up with her physician and to take her recorded data with her to her appointment. The patient’s physician agreed with the author’s suspicion and referred the patient for intra-compartmental pressure testing. The patient tested positive for compartment syndrome in all four compartments of the right lower extremity with the anterior and lateral compartments testing the highest. The patient’s diagnosis of CECS was officially made 8 months after her symptoms initially began. The patient had a total of 25 physical therapy visits during this episode of care in addition to approximately three months of physical therapy prior. The patient was referred by her physician to an orthopedic surgeon for a fasciotomy. |
A 47-year-old female patient referred to us because of a history of a nonimmediate type HR to radio contrast media that occurred 3 years previously and immediate type HRs to clarithromycin at 2 different times in order to identify safe alternative antibiotics. We started drug allergy work-up with the confirmation of the clarithromycin hypersensitivity which is relatively rare []. The prick test performed with clarithromycin was positive []. Because claritromycin can lead to false positive result due to irritation effect we offered drug provocation test but the patient refused. Then in order to identify safe alternative antibiotics we performed the skin prick and intradermal tests with moxifloxacin as previously suggested which were negative []. Delayed reading of intradermal tests were negative as well. She was then challenged in a single blind placebo controlled manner with moxifloxacin orally. It was planned to give the drug with incremental doses of 5-50-100-100-150 mg with 30 minutes intervals. After the second dose of 50 mg, pruritus and mild erythema on her body occurred in minutes and followed by dizziness. Patient's pulse was very weakly palpable, tachycardic and the blood pressure was very low that could not be measured. She was treated immediately with 0.5 mg of epinephrine, fluid replacement, 40 mg of methylprednisolone (intravenous) and 45.5 mg of pheniramine (intravenous). On the following day she returned with macular eruptions on the trunk and on the proximal extremities which had started with pruritus approximately 20 hours after the drug ingestion (). Her biochemical tests and differential blood counts were normal. She did not consume any other drugs concomitantly and she had no signs or symptoms of infections. She was treated with methylprednisolone and approximately in 10 days eruptions resolved. A patch test performed with moxifloxacin diluted in petrolatum to obtain the drug concentration of 30% was applied on the upper back approximately 2 months later, after the resolution of signs and symptoms, was found positive (), confirming nonimmediate type HR reaction to moxifloxacin []. To check the possible irritation effect of the drug, we performed patch test with the drug in 5 patients who were known to tolerate moxifloxacin and all they were negative. In order to support the diagnosis of immediate and nonimmediate type reactions, lymphocyte transformation test (LTT) and intracellular interleukin (IL)-4 and interferon-gamma (IFN-γ) levels and basophil activation test (BAT) were performed as described in the literature []. A stimulation index for LTT was defined as proliferation ratio of moxifloxacin-specific CD4+ T cell to unstimulated cells and result of BAT was interpreted as positive when the percentage of CD63 was 5% above the negative control []. BAT was negative while the CD4+ T-cell proliferation stimulation indexes were found 1.75 and 1.65 in doses of 5- and 10-μg/mL moxifloxacin, respectively. Moreover, intracellular IL-4 level was high and IFN-γ level was low in CD4+ T cells when compared with a healthy subject (). She was subsequently able to tolerate clindamycin. |
A 14-year-old boy with morbid obesity and no known prior psychiatric history underwent sleeve gastrectomy. Prior to the surgery, he weighed 167 kilograms with a body mass index (BMI) of 54.5. Within a few months postoperatively, he weighed 70 kilograms with a BMI of 22.8. The patient’s substance use disorder started at the age of 15, one year after the bariatric surgery. Of note, the patient's parents were separated and he lived with his mother and siblings. None of his family members or relatives had a history of substance use disorder. He initially started using fenethylline (marketed under the brand name Captagon), as it was a common substance used by his peers at school. He started with two tablets daily and increased his use gradually up to 15 tablets daily. He started smoking cannabis a year later, at the age of 16, starting with one cigarette per day and increasing his use gradually until reaching a peak of 20 cigarettes per day. The patient started drinking alcohol occasionally at the age of 16 as well, and it soon became an issue of excessive use on a daily basis. The patient drank different types of alcoholic beverages. He reported incidents of fainting in relation to alcohol use but had never experienced withdrawal. He mentioned that he started using alcohol as a way to reduce his use of other substances. Two years later, at the age of 18, the patient started using methamphetamine, which caused him to develop paranoid ideation, auditory hallucinations, severe insomnia, and aggressive behavior. The patient was admitted to an inpatient psychiatric unit for a few days and was started on haloperidol 3 mg orally twice daily, benztropine 2 mg orally twice daily, and quetiapine 50 mg orally as needed for insomnia. His psychotic disorder improved with the cessation of substance use and the treatments initiated on the inpatient side. After his discharge, he unfortunately relapsed and continued to use the aforementioned substances.\nAfter arranging for close follow-up, the patient voluntarily presented to the rehabilitation center, motivated to stop using all substances, as he was legally and financially burdened by this disorder. He was incarcerated twice for substance use-related criminal charges. He was also motivated to start a new life and to enroll again in higher education, as he dropped out of school previously due to his polysubstance use disorder. The patient has thereafter been involved in a rehabilitation and relapse prevention program, which included inpatient admissions as needed to the rehabilitation center, involvement in individual and group therapy, occupational therapy, and addiction counseling. |
A previously healthy 19-year-old male was shot on his left neck incidentally by his friend during recreational air rifle game from the range of approximately 2 m. He was taken to the nearest local hospital immediately to get his wounded neck treated by a surgeon and was admitted in the hospital ward for 3 days. Subsequently, the patient was referred to our hospital for his left hemiparesis complaint, which he recalled that happened shortly after the incident. The patient's previous drug history, familial history and psychosocial history were unremarkable. On physical examination at our hospital, the patient was fully alert and hemodinamically stable. General examination of the neck discovered sutured post-operative wound sized 5 cm as well as the entry point of the pellet sized 0.5 cm on the anterolateral of the neck at the level of thyroid cartilage (). Neurological examination revealed total loss of motoric function on his left side of the body together with sensoric function on the contralateral side from the level of C5 and below, with an intact bulbocavernosus reflex and perianal sensation. There was also facial lateralization characterized by ptosis and eyebrow as well as lip drooping on the left side.\nInitial imaging study of cervical plain radiograph revealed scattered pellet fragments at the level of C5-6 (). Therefore, we conducted CT scan for further ancillary study and revealed that foreign bodies with metallic density found at the left side of C5-6 level and suspicion of right laminar fracture of C5. In addition, the metallic foreign bodies were discovered both within the spinal canal of C5 and in close proximity to the vertebral artery foramen (). Thus, the surgery comprising of pellet fragments removal, decompression and posterior stabilization of the cervical spine was planned immediately.\nThe surgery, conducted by first author who is an orthopaedic spine surgeon, was brought by using posterior midline approach of the cervical region to expose the posterior column of the vertebrae. Lateral mass screws and rods were installed at the level of C4-7 followed by decompression, only to reveal that a pellet fragment was embedded at the posterior epidural space at the level of C5 with dural laceration (). Afterwards, the fragment sized 0.5 cm was delivered and the exploration by using the image intensifier (C-arm) was proceeded in order to search the other fragments. The other fragments were discovered at the vertebral artery foramen with concomitant vertebral artery transection. Then, the transected artery was packed with bone wax. During this further exploration, we succeeded to deliver 2 other fragments sized 0.5 and 0.4 cm (). Post-operatively, plain cervical radiograph () and CT angiography were commenced. The latter revealed that the left vertebral artery was completely transected at the level of C4 (). Consequently, incomplete spinal cord injury (SCI) because of the left VAI due to penetrating injury caused by air rifle pellet was marked as the working diagnosis. |
A 26-year-old male patient who has been imprisoned for two years and has no systemic disease is treated by the psychiatry department with diagnoses of antisocial personality disorder and depressive adjustment disorder. On the 5th day of September 2019, he consulted with the complaint of AA battery ingestion for suicidal purpose three hours before applying to the hospital. Having ingested an AA battery and razor blade for suicidal purpose one year ago, the patient was subjected to emergency surgical intervention at another hospital, and the foreign bodies were removed from the digestive tract with laparotomy. Psychiatry consultation ended with the result that the patient has no Pica associated symptoms/conditions, he does not have anemia and that with the aim of getting away of prison conditions for a temporary period of time, with his depressive mood he ingested the only foreign object he could find, the batteries. At the time of his examination at the emergency room, his general condition was good, his vital findings were stable, and his laboratory findings were normal. Direct radiological examination in the emergency room revealed that the AA battery crossed the first continent of the pylorus and duodenum and stopped transversely in the third continent (X-ray: ). Abdominal tomography was performed in order to determine the exact intestinal location of the battery and it was confirmed that it passed to the distal of the pylorus (CT: ).\nThe patient who was kept under observation at the emergency room was per orally administered 45ml/30 g lactulose as a single dose per day for three days. The patient was hydrated with 100 ml h-1 Ringer’s lactate solution and his pro-kinetic (lactulose) treatment was continued. The battery was visualized in the ileocecal junction in the abdominal x-ray taken on the 2nd day.\nThe battery was visualized in the rectum in the abdominal x-ray taken early on the 3rd day (). In the evening on the 3rd day, the battery was removed from the body by rectal defecation (). The patient was discharged as no abnormal findings were observed in his general condition and abdominal examination. No deformation of the cylinder AA battery was observed. |
A 21-year-old female diagnosed with DM in 2008, on treatment with prednisone and cyclosporine with moderate disease activity until December 2012, presented to our Emergency Department (ED) with a three day history of diffuse, acute abdominal pain, no bowel movement and biliary vomit. She underwent laparoscopic cholecystectomy in 2010 for symptomatic calculosis. The patient was admitted to our Department with a bowel perforation suspect. An oral follow-through was negative but a CT scan with oral contrast demonstrated a small leakage from the posterior aspect of the third duodenal portion (Figure ). An emergency laparotomy was performed, with intraoperative finding of multiple ischemic vasculitic lesions of the small bowel, retroperitoneal perforation of the third duodenal portion and a minimum local biliary contamination. The lesion was sutured with omentopexy and an abdominal drainage was placed. After surgery, the patient was transferred to Intensive Care Unit (ICU) for post-operative monitoring. Her clinical course, in the following two days, was complicated by acute hemorrhage. She underwent, therefore, a second operation due to the bleeding from a small branch of the anterior pancreaticoduodenal artery. A new ischemic perforation in the same duodenal region was recognized and multiple small ischemic areas involving the entire small bowel were observed. A gastroenteric anastomosis was performed, excluding the duodenum. Two drainages were placed near the perforated site to drain any possible biliary fistula. A nasoenteral feeding tube was then positioned. To manage the potential perforation risk of the duodenal and ileal ulcerations caused by acute vasculitis, to preserve the abdominal cavity from intraperitoneal collections and to create a guided biliary fistula, an open abdomen treatment with negative pressure system was placed; we positioned a temporary fascial mesh to preserve the fascia and prevent its retraction. Two weeks after the second surgical procedure a percutaneous transhepatic biliary drainage (PTBD) was placed to reduce the flow of the peritoneal biliary fistula.\nWe changed the negative pressure dressing every 3–4 days, washing the peritoneal cavity and tightening the fascial mesh. The negative pressure system was very useful and effective because of the large amount of biliary leakage and bowel contamination caused by multiple ischemic ulcers in the second and third portion of the duodenum, otherwise this condition was not manageable with the use of simple drains. After two months, the open abdomen treatment was suspended, the fascial mesh was removed and the fascia was primarily closed. Afterward, we removed the PTBD and the abdominal drain following the execution of abdominal X-ray with oral contrast, demonstrating absence of residual duodenal biliary leakage after four months.\nDuring her ICU stay, the patient presented signs of renal vasculitis, therefore she underwent cycles of continuous veno-venous hemodialysis (CCVHD), plasmapheresis and intravenous immunoglobulin (IVIG), showing clear improvement of her renal function and negative immunological test. Low molecular weight heparin (LMWH) treatment was complicated by heparin induced thrombocytopenia (HIT) with low platelet (PLT) count (99.000/μm3). Argatroban was administered obtaining progressive increase in PLT count (354.000/μm3). Three months after surgery she had seizures with MRI scan positive for vasculitic diffuse encephalic lesions, treated with levetiracetam and metilprendisone. During hospitalization we observed nasal regurgitation of fluids, nasal speech and hoarseness probably due to loss of pharyngoesophageal muscle tone and increase and reduction in hepatic stasis values of unknown origin. After 8 months of follow-up, no signs or symptoms of abdominal disease were reported.\nDM is an autoimmune disease characterized by cutaneous heliotropic rash, Gottron papules and proximal myopathy associated to dysphagia, dysphonia, Raynaud phenomenon, fatigue and non-erosive inflammatory polyarthritis []. Vasculitis of the gastrointestinal tract is a life threatening complication, more frequently observed in children than in adults []. It may vary from segmental bowel edema to ulcerations, gangrene and perforation []. The classic clinical findings may be masked by corticosteroids therapy and the radiographic investigations may be negative even in presence of bowel perforation, as the lesion may be very small, retroperitoneal, self sealed or well contained by the adjacent structures. Extraluminal air can be observed in 50–70% of patients []. Many cases involve the duodenum and particularly the third portion and its retroperitoneal aspect [-,,,,,]. Other typical sites of perforation are the esophagus [,-], the cecum, and the right and left colon in their retroperitoneal portion [,-,]. Histopathological findings are related to acute arteriopathy, with arterial and venous intimal hyperplasia and occlusion of vessels by fibrin thrombi. Chronic vasculopathy is characterized by reduction or complete occlusion of multiple small and medium arteries, subintimal foam cells, fibromixoid neointimal expansion and significant luminal compromise and infiltration of macrophages through the muscle layers into the intima [,]. In younger patients systemic vasculitis with specific involvement of renal and encephalic system can be observed. Radiological features of vasculitis include widespread thickening of mucosal fold and irregularity of small intestine, giving rise to a “stacked coin” appearance []. When clinical findings and symptoms suggest possible abdominal vasculitis in a young subject known for DM, it is very important to consider bowel and particularly retroperitoneal perforation. In order to manage this difficult clinical and surgical condition it is mandatory to consider the medical complexity of this disease and the necessity to treat the patient with a specific therapy to control the acute vasculitic process conditioning damage to multiple organs such as respiratory, renal and encephalic system, causing septic shock, renal failure and encephalitis. In this case, during the recovery, we had to manage gastroenteric, renal and encephalic vasculitic complications. The patient underwent three cycles of CCVHD, plasmapheresis and IVIG, multiple antibiotic coverage and careful steroid management. Her course was also complicated by heparin-induced thrombocytopenia during treatment with LMWH to prevent thromboembolism; treatment with argatroban permitted a progressive platelet count improvement. Her recovery was also complicated by dysphagia for both solids and liquids, caused by loss of pharyngoesophageal muscle tone and encephalic vasculitis, which started with seizures and was treated with levetiracetam and metilprednisolone.\nSurgical treatment is not standardized because of the rarity and variety of the gastrointestinal DM presentations that can affect the entire gastrointestinal tract. In literature we found few descriptions of ischemic gastrointestinal perforation in DM. Surgical treatments and outcomes reported were anecdotic and varied, including resection of the affected tract or sutures of the lesions (Table ). High recurrence of reintervention for anastomotic dehiscence or new perforations was observed. The use of negative pressure treatment was never reported. Open abdomen treatment allows the reduction of contamination by gastrointestinal contents decreasing the risk of abdominal collections, favors rapid evidence of hemorrhage permitting a prompt control of the bleeding source, offers temporary abdominal closure, helps ICU care and delays definitive surgery [,]. In this case we performed an open abdomen treatment to better remove the losses and control possible sources of new perforations, without needing of bowel resection. The mesh-mediated fascial traction technique combined with negative pressure treatment allowed to preserve the fascia, and to obtain the fascial primarily closure. As reported in literature, achievement of fascial closure has significant implications for the recovery of the patients, reducing ICU and hospital length of stay, and need for surgical reconstruction of the abdominal wall []. We had to perform a bowel deviation because of the critical ischemic vasculitis of the duodenum. To reduce the amount of biliary leakage and to obtain a faster outcome, we positioned a PTBD. Using this composite technique progressive fistula flow reduction was obtained, allowing abdominal closure after two months and PTBD removal after four months. |
This case describes a 40-year-old man with epilepsy who sustained 15% total body surface area scald burns to his back, buttocks and arms after suffering a seizure while in the bath. He was transferred to the regional burns unit where both forearms were found to have developed compartment syndrome and required fasciotomies (Figure ).\nSuch was the extent of his injury that after surgical debridement he was left with significant soft tissue defects to his right upper limb (Figure ) requiring complex soft tissue coverage. Exposure of his right elbow joint was managed with a medial arm flap. A large soft tissue defect over his ulnar wrist and hand required coverage with a pedicled groin flap (Figure ).\nPedicled groin flaps are less commonly used since the development of microsurgical techniques for free tissue transfer; however, in this case the thermal injury made the vascular supply unreliable and therefore precluded free tissue transfer.\nThe interest in this case centres three years later, when the patient noticed an unusual appearance to the ulnar border of his hand overlying the previously formed flap, for which the patient attended his local accident and emergency.\nOn examination, the patient was noted to have a small raw area on the ulnar border of his hand, which was otherwise asymptomatic (Figure ). The patient was systemically well. The diagnosis was initially a mystery to the emergency department staff; however, the possibility of a burn was considered and a referral made to the regional Burns Unit. Assessment at the Burns Unit confirmed the diagnosis of a mostly deep partial thickness burn.\nOn reflection, the patient recalled that whilst removing potatoes from the oven a day prior, the ulnar border of his reconstructed right hand made contact with the hot glass door. He thought little of this initially, having no cutaneous sensation over the flap reconstruction, and thus experiencing no pain.\nDebridement of the burn by tangential excision was undertaken on the next scheduled operating list (Figure ), and the defect covered with a split thickness skin graft (Figure ), which healed well (Figure ). |
Patient 2 is a 78-year-old male who was experiencing persistent lower urinary tract symptoms despite combined medical therapy with alpha blockade and 5-alpha reductase inhibitors. His medical history included coronary artery disease status post-coronary artery bypass grafting and percutaneous coronary intervention, and a history of pneumonia. Preoperative cystoscopy revealed enlarged median and lateral lobes, as well as severe trabeculations of the bladder with a TRUS measuring a 41 cc prostate. HoLEP was carried out utilizing a two-incision technique. Upon completion of morcellation, it was noted that the patient's abdomen was distended, but his peak airway pressures were normal, the abdomen was soft, and the catheter drainage was noted to be clear. In addition, there was no suspicion for a significant mismatch between irrigation used and fluid output collected in the drainage system.\nGiven the previous similar presentation in Case 1 with no suspicion of bladder injury, we suspected that the patient had extraperitoneal extravasation of the saline irrigation through a capsular perforation as occurred in Case 1. The decision was made for the patient to be awakened, extubated, and transferred to the recovery room where he was further monitored. A stat noncontrast abdominal CT scan was performed that revealed a moderate amount of free fluid in the pelvis and upper abdomen; the fluid in the pelvis and lower abdomen was distributed in the extraperitoneal region with no evidence of hematoma (). The patient remained hemodynamically stable and was transferred to the floor with continuous bladder irrigation. The patient was given a 40 mg dose of Lasix ∼8 hours after the operation was completed. Overnight, there were no acute events. On POD 1, the patient's abdomen was soft and significantly less distended. The Foley catheter drained 3950 cc of urine overnight without evidence of hematuria. The patient was discharged with a catheter on POD 1. The patient had his catheter removed on POD 9. A postoperative CT cystogram revealed no evidence of leak with resolution of the pelvic and perivesical fluid (). Thirty grams of benign prostate tissue was removed on final pathology analysis. The patient was noted to have a bladder neck contracture seen on cystoscopy 4 months after his procedure for which he underwent cystourethroscopy and laser incision of bladder neck contracture. |
A 7-year-old boy initially presented with transient left-side motor weakness and then visited the pediatric department of a local hospital. He was diagnosed with moyamoya disease based on magnetic resonance angiography (MRA) results [] and was then referred to the neurosurgical department of our hospital. Repeat TIA did not occur, and the patient was then followed up in the outpatient department. Right middle cerebral artery (MCA) stenosis progressed during the 1-year follow-up []. Hence, the risk for TIA gradually increased. Single-photon emission computed tomography with iodine-123 iodoamphetamine (123I-IMP SPECT) revealed preserved cerebral blood flow (CBF) and a significant decrease in vascular reserve in the right hemisphere [ and ]. The patient underwent direct and indirect revascularization surgery on the right cerebral hemisphere. The symptoms disappeared after surgery, and the patient was followed up again in the outpatient department. He presented with transient right side motor weakness 6 months after surgery. MRA revealed good angiogenesis from the external carotid system to the right cerebral hemisphere and progression of stenosis in the left MCA []. 123I-IMP SPECT showed preserved CBF and a significant decrease in vascular reserve in the left hemisphere [ and ]. T2*WI and SWI revealed the absence of CMBs in the left hemisphere [ and ]. However, three de novo CMBs were identified after 3 months [ and ]. No cerebral aneurysm was detected on digital subtraction angiography of the left internal carotid and left vertebral arteries [ and ]. The abnormal collaterals from the anterior choroidal artery form periventricular anastomosis, which continued to the MCA through the medullary artery [-]. The CMBs occurred on the peripheral side of the abnormal collaterals. In addition to the exacerbation of ischemic symptoms due to left MCA stenosis, the patient was considered at risk for hemorrhagic stroke. Thus, he underwent direct and indirect revascularization surgery on the left side. The symptom disappeared completely after surgery, and magnetic resonance imaging showed good angiogenesis from the external carotid system to the left cerebral hemisphere []. No additional de novo CMBs were identified 1 year after surgery [ and ]. Further, MRA revealed shrinkage of the anterior choroidal artery and disappearance of abnormal collaterals [ and ]. |
A 45-year-old man presented to our department in December 2010 with proptosis of the left eye lasting about one month (). He complained of diplopia but no pain or redness. His right eye was unremarkable. His best corrected visual acuity was 20/20 in both eyes. On examination, he had a 6 mm proptosis in the left eye, and an inferior displacement of the eye with superior sulcus fullness. A solid mass was palpable in the superior part of the orbit, not separable from the superior orbital rim. The left eye motility was restricted in the upward and leftward gaze.\nHis past medical history was positive for HIV and HBV infection since 1986 and consequent cirrhosis and hepatocellular carcinoma (HCC). In July 2006, he had undergone a liver transplant for ESLD with concomitant HCC, with a marginal organ. Histologic evaluation of the native liver pointed out the presence of a cancer thrombus within the right branch of the portal vein.\nIn December 2008, he was subjected to a partial surgical resection of the transplanted liver for a recurrence of HCC. He started therapy with sorafenib in 2009, but took the drug irregularly and reduced the dosage for the concomitant occurrence of diarrhea.\nHe presented a new liver and pulmonary recurrence in December 2009. The liver recurrence was treated with selective transarterial chemoembolization, while the pulmonary metastases were treated by local resection of the middle lobe of the left lung. After histological examination of the pulmonary lesions confirmed the HCC recurrence, the patient started systemic chemotherapy with liposomial doxorubicin. In July 2010, the patient presented a new HCC recurrence to the lungs and liver and therefore underwent level II chemotherapy with 5-FU and subsequently with capecitabine. In December 2010, he presented with proptosis and diplopia of the left eye, and AFP was high: 3750 ng/mL. On the suspicion of an orbital metastasis of HCC, the patient underwent computed tomography (CT) scans of the orbit that showed an extraconal mass involving the superior and lateral wall of the left orbit with destruction of the orbital bone, incorporating the lateral rectus, with calcifications (Figures , , and ). Percutaneous incisional biopsy of the lesion was performed. |
A 43-year-old male was referred to our pain clinic for disabling pain and a tingling sensation in his right foot and calf. Three months earlier, the patient had undergone open reduction and internal fixation with nail pinning of the right femur head and mid-shaft fracture (Pipkin Type I) from a traffic accident. His right foot pain continued after the surgery due to concomitant sciatic nerve injury and indeed progressed.\nOn the day, the patient was referred to our pain clinic and his pain was at the dorsum, lateral sole, and toes of his right foot and the posterior side of the calf. This pain was of a continuous nature and the severity ranged from 6 to 7 on a visual analog scale (VAS) with the intermittent breakthrough pain of VAS 9. He also complained of severe allodynia in the affected limb, especially in his sole, toes, and heel. The severe pain with allodynia made the patient unable to bear his body weight and walk with the affected limb. He could not even walk on the healthy left leg with crutches because the severe allodynia caused him to drag his right foot on the ground. His motor power-ankle plantar flexion and dorsiflexion were assessed as grade 0/5, and his sensory function was impaired in a neurological examination. Other associated features including changes in temperature, sweating abnormalities, edema, trophic changes, and skin color changes were found in a physical examination.\nA nerve conduction study and electromyography revealed an absence of sciatic nerve responses in the right leg below the knee area. Integrating the clinical, physical, three-phase bone scintigraphy, digital infrared thermal imaging test, and laboratory findings above, the patient was diagnosed with CRPS Type II according to the diagnostic criteria of the International Association for the Study of Pain.\nThe patient did not respond to conventional treatments including medications, sciatic nerve blocks, and sympathetic blocks. The dynamic allodynia was so severe that the patient could not receive physical therapy. Thus, we decided to apply PRF to the affected sciatic nerve with ultrasound guidance. Informed consent was obtained from the patient before the procedure.\nThe sciatic nerve was identified under ultrasonographic guidance just above the bifurcation of the nerve at the popliteal fossa [] and the final location of the needle tip was close to the sciatic nerve in the popliteal fossa []. A sensory stimulation test was performed. PRF was applied at a temperature of 42°C for 120 s and repeated 4 times. After the procedure, 0.3% ropivacaine (10 mL, mixed with triamcinolone, 8 mg) was injected to prevent peri-neural inflammation.\nAfter the US-guided PRF, the patient's spontaneous pain was decreased to a VAS score of 3. The allodynia and breakthrough pain were also significantly improved after the procedure. The other symptoms and signs were not changed immediately. The patient was able to drag his affected foot on the ground and load his weight on the affected limb temporarily. He was able to walk with crutches and to participate in a rehabilitation program. The effects of PRF were maintained for 8 months after the first application. In the follow-up interval, the VAS score increased to six again. Thus, we applied PRF to the sciatic nerve in the same manner as before, and the VAS score was again reduced to 2–3. |
The patient was a 57-year-old female who presented to the trauma bay of a university trauma center via intrafacility transfer after a motor vehicle collision in which her vehicle rolled down an embankment. She was hemodynamically stable and with a Glascow Coma Score of 15. Computed tomography of her chest abdomen and pelvis revealed an aortic injury consistent with transection and left hemothorax with associated atelectasis. Her blood pressure was stable, and her hemoglobin and hematocrit were within normal limits. She had several comorbidities which included chronic obstructive pulmonary disease, diabetes mellitus, hepatitis C, hypertension, history of thyroid cancer status post thyroidectomy, and asthma.\nShe was admitted to the surgical critical care unit for strict blood pressure control and went to the endovascular suite with vascular surgery the following morning for a thoracic endovascular graft repair of the aortic injury. The case resulted in a midline laparotomy after deployment of the graft, lengthy lysis of adhesions, injury to the left gonadal vein resulting in one liter of blood loss, and finally retroperitoneal dissection and exposure of the infrarenal aorta and iliac arteries. Due to the extensive calcifications of the iliac vessels, the aorta was cannulated and the stent graft was deployed. Her abdomen was closed, and she was returned to the critical care unit.\nThe patient's course in the critical care unit was long and complicated to include acute respiratory distress syndrome and prolonged mechanical ventilation. Due to high oxygen and positive end-expiratory pressure requirements, patient did not undergo a tracheostomy until hospital day number twenty-four. She subsequently had a PEG tube inserted a few weeks later. We continued to attempt to wean the patient from mechanical ventilation. Her Glasgow Coma Score improved significantly over the following weeks to the point she was alert and able to follow commands, attempting to verbalize. However, when patient was placed on tracheostomy collar trials, she became very anxious and tachypneic. This was felt initially to be due to anxiety. After several days of similar symptoms despite anxiolytics, patient developed a wheeze. She had no changes in her chest radiograph. We decided at that time to perform a flexible bronchoscopy and found tracheal collapse distal to the tracheostomy tube.\nWe ordered a dynamic computed tomography scan of the chest to evaluate the extent of the tracheomalacia. Imaging revealed significant collapse of the distal trachea and main stem bronchi. It was decided to take her for video bronchoscope, rigid bronchoscopy, Dynamic Y-stent placement, and exchange of tracheostomy tube with a regular Shiley size 8 tracheotomy tube ().\nVideobronchoscopy was performed through the distal XLT (Extended Length) tracheostomy tube, and severe tracheobronchomalacia was noticed. The patient had almost complete collapse of the trachea distal to the tracheostomy tube and almost complete collapse of the left mainstem bronchus. Distal XLT tracheostomy tube was exchanged to regular Shiley size 8 tracheostomy tube. Videobronchoscopy was performed through the newly placed Shiley tracheostomy and measurements for the Y-stent taken. Rigid bronchoscopy was then done to ascertain that patient was rigidly intubatable for the deployment of dynamic Y-stent (). After successful rigid bronchoscopy Y-stent was deployed under fluoroscopic guidance. The Y-stent limbs were well seated in the trachea left main stem bronchus and right main stem bronchus.\nPostoperatively patient did well and was able to be weaned from mechanical ventilation. At three-month followup, patient is doing well with tracheostomy and stent in place. The plan is to follow the patient for stent and/or tracheostomy removal or replacement. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.