repo_name
stringlengths
5
92
path
stringlengths
4
221
copies
stringclasses
19 values
size
stringlengths
4
6
content
stringlengths
766
896k
license
stringclasses
15 values
hash
int64
-9,223,277,421,539,062,000
9,223,102,107B
line_mean
float64
6.51
99.9
line_max
int64
32
997
alpha_frac
float64
0.25
0.96
autogenerated
bool
1 class
ratio
float64
1.5
13.6
config_test
bool
2 classes
has_no_keywords
bool
2 classes
few_assignments
bool
1 class
walafc0/soclib
soclib/iss/iss_profiler/bin/iss_profiler2profile.py
1
2939
#!/usr/bin/env python from dsx.util.objdumper import * import sys __id__ = "$Id: iss_profiler2profile.py 917 2009-03-12 10:10:06Z nipo $" __version__ = "$Revision: 917 $" class SymLooker: def __init__(self, arch, obj): self.__syms = {} dumper = ObjDumper(arch, obj) for section in dumper: for sym in section: self.__syms[sym.addr] = sym.name self.__addrs = self.__syms.keys() self.__addrs.sort() self.__addr2sym = {} def is_entry(self, addr): return addr in self.__syms def lookup_sym(self, addr): last_addr = None for sym_addr in self.__addrs: if sym_addr > addr: break last_addr = sym_addr if last_addr is None: print hex(addr), "not found in", self.__addrs return self.__syms[last_addr] def find_sym(self, addr): try: return self.__addr2sym[addr] except KeyError: sym = self.lookup_sym(addr) self.__addr2sym[addr] = sym return sym def per_sym(self, ctor): ret = {} for k in self.syms(): ret[k] = ctor(k) return ret def syms(self): return self.__syms.values() arch = sys.argv[1] obj = sys.argv[2] sl = SymLooker(arch, obj) class Counter: def __init__(self, sym): self.sym = sym self.total = 0 self.frozen = 0 self.running = 0 self.runs = 0 def inc(self, running, entering): if entering: self.runs += 1 if running: self.running += 1 else: self.frozen += 1 self.total += 1 def cmp_total(self, other): return cmp(self.total, other.total) def cmp_running(self, other): return cmp(self.running, other.running) def missing(self): if self.total: return float(self.frozen)/float(self.total) else: return 0 def cmp_missing(self, other): return cmp(self.missing(), other.missing()) def cmp_runs(self, other): return cmp(self.runs, other.runs) def cpr(self): if self.runs: return float(self.total)/float(self.runs) else: return 0 def cmp_cpr(self, other): return cmp(self.cpr(), other.cpr()) def __repr__(self): return "%s runs %04d total %06d, cpr: %06d, running time %06d, frz %06d, miss %f"%( self.sym.ljust(30), self.runs, self.total, self.cpr(), self.running, self.frozen, self.missing()) if sys.argv[3:]: for xaddr in sys.argv[3:]: addr = int(xaddr, 16) print hex(addr), sl.find_sym(addr) else: count = sl.per_sym(Counter) total = 0 last_func = '' for line in sys.stdin.readlines(): line = line.strip() running, asked, xaddr = line.split(' ') if asked == '+': total += 1 running = running == 'R' addr = int(xaddr, 16) sym = sl.find_sym(addr) entry = sl.is_entry(addr) count[sym].inc(running, last_func != sym and entry) last_func = sym v = count.values() v = filter(lambda x:x.runs > 15, v) v.sort(Counter.cmp_runs) v.reverse() print "Most runs" for i in v: print i v.sort(Counter.cmp_running) v.reverse() print "Most on CPU" for i in v: print i v.sort(Counter.cmp_missing) v.reverse() print "Most missing" for i in v: print i
lgpl-2.1
-5,641,330,111,067,963,000
21.960938
100
0.638653
false
2.614769
false
false
false
ayepezv/GAD_ERP
openerp/addons/test_impex/models.py
2
4918
# -*- coding: utf-8 -*- # Part of Odoo. See LICENSE file for full copyright and licensing details. from odoo import api, fields, models def selection_fn(model): return list(enumerate(["Corge", "Grault", "Wheee", "Moog"])) def compute_fn(records): for record in records: record.value = 3 def inverse_fn(records): pass MODELS = [ ('boolean', fields.Boolean()), ('integer', fields.Integer()), ('float', fields.Float()), ('decimal', fields.Float(digits=(16, 3))), ('string.bounded', fields.Char(size=16)), ('string.required', fields.Char(size=None, required=True)), ('string', fields.Char(size=None)), ('date', fields.Date()), ('datetime', fields.Datetime()), ('text', fields.Text()), ('selection', fields.Selection([(1, "Foo"), (2, "Bar"), (3, "Qux"), (4, '')])), # here use size=-1 to store the values as integers instead of strings ('selection.function', fields.Selection(selection_fn, size=-1)), # just relate to an integer ('many2one', fields.Many2one('export.integer')), ('one2many', fields.One2many('export.one2many.child', 'parent_id')), ('many2many', fields.Many2many('export.many2many.other')), ('function', fields.Integer(compute=compute_fn, inverse=inverse_fn)), # related: specialization of fields.function, should work the same way # TODO: reference ] for name, field in MODELS: class NewModel(models.Model): _name = 'export.%s' % name const = fields.Integer(default=4) value = field @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] @api.model def name_search(self, name='', args=None, operator='ilike', limit=100): if isinstance(name, basestring) and name.split(':')[0] == self._name: records = self.search([('value', operator, int(name.split(':')[1]))]) return records.name_get() else: return [] class One2ManyChild(models.Model): _name = 'export.one2many.child' # FIXME: orm.py:1161, fix to name_get on m2o field _rec_name = 'value' parent_id = fields.Many2one('export.one2many') str = fields.Char() value = fields.Integer() @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] @api.model def name_search(self, name='', args=None, operator='ilike', limit=100): if isinstance(name, basestring) and name.split(':')[0] == self._name: records = self.search([('value', operator, int(name.split(':')[1]))]) return records.name_get() else: return [] class One2ManyMultiple(models.Model): _name = 'export.one2many.multiple' parent_id = fields.Many2one('export.one2many.recursive') const = fields.Integer(default=36) child1 = fields.One2many('export.one2many.child.1', 'parent_id') child2 = fields.One2many('export.one2many.child.2', 'parent_id') class One2ManyChildMultiple(models.Model): _name = 'export.one2many.multiple.child' # FIXME: orm.py:1161, fix to name_get on m2o field _rec_name = 'value' parent_id = fields.Many2one('export.one2many.multiple') str = fields.Char() value = fields.Integer() @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] class One2ManyChild1(models.Model): _name = 'export.one2many.child.1' _inherit = 'export.one2many.multiple.child' class One2ManyChild2(models.Model): _name = 'export.one2many.child.2' _inherit = 'export.one2many.multiple.child' class Many2ManyChild(models.Model): _name = 'export.many2many.other' # FIXME: orm.py:1161, fix to name_get on m2o field _rec_name = 'value' str = fields.Char() value = fields.Integer() @api.multi def name_get(self): return [(record.id, "%s:%s" % (self._name, record.value)) for record in self] @api.model def name_search(self, name='', args=None, operator='ilike', limit=100): if isinstance(name, basestring) and name.split(':')[0] == self._name: records = self.search([('value', operator, int(name.split(':')[1]))]) return records.name_get() else: return [] class SelectionWithDefault(models.Model): _name = 'export.selection.withdefault' const = fields.Integer(default=4) value = fields.Selection([(1, "Foo"), (2, "Bar")], default=2) class RecO2M(models.Model): _name = 'export.one2many.recursive' value = fields.Integer() child = fields.One2many('export.one2many.multiple', 'parent_id') class OnlyOne(models.Model): _name = 'export.unique' value = fields.Integer() _sql_constraints = [ ('value_unique', 'unique (value)', "The value must be unique"), ]
gpl-3.0
4,212,233,521,099,419,000
30.729032
89
0.618544
false
3.417651
false
false
false
steven-martins/Marking
back/marks/migrations/0001_initial.py
1
3773
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations from django.conf import settings import datetime class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] operations = [ migrations.CreateModel( name='Mark', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('result', models.IntegerField()), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Picture', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('file', models.ImageField(max_length=150, upload_to='picture/%Y/%m/%d')), ('title', models.CharField(max_length=50)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Project', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('name', models.CharField(max_length=100)), ('description', models.TextField()), ('marks', models.ManyToManyField(to=settings.AUTH_USER_MODEL, through='marks.Mark', related_name='project_marks_student')), ('members', models.ManyToManyField(to=settings.AUTH_USER_MODEL)), ('pictures', models.ManyToManyField(to='marks.Picture', blank=True)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Question', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('title', models.CharField(max_length=200)), ('detail', models.CharField(max_length=250, blank=True)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Student', fields=[ ('login', models.CharField(serialize=False, max_length=10, primary_key=True)), ('last_connection', models.DateTimeField(blank=True, default=datetime.datetime.now)), ], options={ }, bases=(models.Model,), ), migrations.CreateModel( name='Timeslot', fields=[ ('id', models.AutoField(serialize=False, verbose_name='ID', primary_key=True, auto_created=True)), ('title', models.CharField(max_length=100)), ], options={ }, bases=(models.Model,), ), migrations.AddField( model_name='project', name='timeslot', field=models.ForeignKey(to='marks.Timeslot', blank=True), preserve_default=True, ), migrations.AddField( model_name='mark', name='project', field=models.ForeignKey(to='marks.Project'), preserve_default=True, ), migrations.AddField( model_name='mark', name='question', field=models.ForeignKey(to='marks.Question'), preserve_default=True, ), migrations.AddField( model_name='mark', name='student', field=models.ForeignKey(to=settings.AUTH_USER_MODEL), preserve_default=True, ), ]
mit
3,561,885,093,581,885,000
34.59434
139
0.51789
false
4.72807
false
false
false
googlefonts/noto-emoji
materialize_emoji_images.py
1
4076
#!/usr/bin/env python3 # # Copyright 2016 Google Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Create a copy of the emoji images that instantiates aliases, etc. as symlinks.""" from __future__ import print_function import argparse import glob import os from os import path import re import shutil from nototools import tool_utils # copied from third_party/color_emoji/add_glyphs.py EXTRA_SEQUENCES = { 'u1F46A': '1F468_200D_1F469_200D_1F466', # MWB 'u1F491': '1F469_200D_2764_FE0F_200D_1F468', # WHM 'u1F48F': '1F469_200D_2764_FE0F_200D_1F48B_200D_1F468', # WHKM } # Flag aliases - from: to FLAG_ALIASES = { 'BV': 'NO', 'CP': 'FR', 'HM': 'AU', 'SJ': 'NO', 'UM': 'US', } OMITTED_FLAGS = set( 'BL BQ DG EA EH FK GF GP GS MF MQ NC PM RE TF WF XK YT'.split()) def _flag_str(ris_pair): return '_'.join('%04x' % (ord(cp) - ord('A') + 0x1f1e6) for cp in ris_pair) def _copy_files(src, dst): """Copies files named 'emoji_u*.png' from dst to src, and return a set of the names with 'emoji_u' and the extension stripped.""" code_strings = set() tool_utils.check_dir_exists(src) dst = tool_utils.ensure_dir_exists(dst, clean=True) for f in glob.glob(path.join(src, 'emoji_u*.png')): shutil.copy(f, dst) code_strings.add(path.splitext(path.basename(f))[0][7:]) return code_strings def _alias_people(code_strings, dst): """Create aliases for people in dst, based on code_strings.""" for src, ali in sorted(EXTRA_SEQUENCES.items()): if src[1:].lower() in code_strings: src_name = 'emoji_%s.png' % src.lower() ali_name = 'emoji_u%s.png' % ali.lower() print('creating symlink %s -> %s' % (ali_name, src_name)) os.symlink(path.join(dst, src_name), path.join(dst, ali_name)) else: print('people image %s not found' % src, file=os.stderr) def _alias_flags(code_strings, dst): for ali, src in sorted(FLAG_ALIASES.items()): src_str = _flag_str(src) if src_str in code_strings: src_name = 'emoji_u%s.png' % src_str ali_name = 'emoji_u%s.png' % _flag_str(ali) print('creating symlink %s (%s) -> %s (%s)' % (ali_name, ali, src_name, src)) os.symlink(path.join(dst, src_name), path.join(dst, ali_name)) else: print('flag image %s (%s) not found' % (src_name, src), file=os.stderr) def _alias_omitted_flags(code_strings, dst): UNKNOWN_FLAG = 'fe82b' if UNKNOWN_FLAG not in code_strings: print('unknown flag missing', file=os.stderr) return dst_name = 'emoji_u%s.png' % UNKNOWN_FLAG dst_path = path.join(dst, dst_name) for ali in sorted(OMITTED_FLAGS): ali_str = _flag_str(ali) if ali_str in code_strings: print('omitted flag %s has image %s' % (ali, ali_str), file=os.stderr) continue ali_name = 'emoji_u%s.png' % ali_str print('creating symlink %s (%s) -> unknown_flag (%s)' % ( ali_str, ali, dst_name)) os.symlink(dst_path, path.join(dst, ali_name)) def materialize_images(src, dst): code_strings = _copy_files(src, dst) _alias_people(code_strings, dst) _alias_flags(code_strings, dst) _alias_omitted_flags(code_strings, dst) def main(): parser = argparse.ArgumentParser() parser.add_argument( '-s', '--srcdir', help='path to input sources', metavar='dir', default = 'build/compressed_pngs') parser.add_argument( '-d', '--dstdir', help='destination for output images', metavar='dir') args = parser.parse_args() materialize_images(args.srcdir, args.dstdir) if __name__ == '__main__': main()
apache-2.0
7,824,723,636,050,095,000
31.349206
83
0.652601
false
2.973012
false
false
false
esacosta/u-mooc
common/schema_fields.py
1
5958
# Copyright 2012 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS-IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Mapping from schema to backend properties.""" __author__ = 'Abhinav Khandelwal ([email protected])' import collections import json from models.property import Property from models.property import Registry class SchemaField(Property): """SchemaField defines a solo field in REST API.""" def get_json_schema(self): """Get the JSCON schema for this field.""" prop = {} prop['type'] = self._property_type if self._optional: prop['optional'] = self._optional if self._description: prop['description'] = self._description return prop def get_schema_dict_entry(self): """Get Schema annotation dictionary for this field.""" if self._extra_schema_dict_values: schema = self._extra_schema_dict_values else: schema = {} schema['label'] = self._label schema['_type'] = self._property_type if 'date' is self._property_type: schema['dateFormat'] = 'Y/m/d' schema['valueFormat'] = 'Y/m/d' elif 'select' is self._property_type: choices = [] for value, label in self._select_data: choices.append({'value': value, 'label': label}) schema['choices'] = choices if self._description: schema['description'] = self._description return schema class FieldRegistry(Registry): """FieldRegistry is a collection of SchemaField's for an API.""" def add_sub_registry( self, name, title=None, description=None, registry=None): """Add a sub registry to for this Registry.""" if not registry: registry = FieldRegistry(title, description) self._sub_registories[name] = registry return registry def get_json_schema_dict(self): schema_dict = dict(self._registry) schema_dict['properties'] = collections.OrderedDict() for schema_field in self._properties: schema_dict['properties'][schema_field.name] = ( schema_field.get_json_schema()) for key in self._sub_registories.keys(): schema_dict['properties'][key] = ( self._sub_registories[key].get_json_schema_dict()) return schema_dict def get_json_schema(self): """Get the json schema for this API.""" return json.dumps(self.get_json_schema_dict()) def _get_schema_dict(self, prefix_key): """Get schema dict for this API.""" title_key = list(prefix_key) title_key.append('title') schema_dict = [(title_key, self._title)] base_key = list(prefix_key) base_key.append('properties') for schema_field in self._properties: field_key = list(base_key) field_key.append(schema_field.name) field_key.append('_inputex') filed_tuple = field_key, schema_field.get_schema_dict_entry() schema_dict.append(filed_tuple) for key in self._sub_registories.keys(): sub_registry_key_prefix = list(base_key) sub_registry_key_prefix.append(key) sub_registry = self._sub_registories[key] # pylint: disable-msg=protected-access for entry in sub_registry._get_schema_dict(sub_registry_key_prefix): schema_dict.append(entry) # pylint: enable-msg=protected-access return schema_dict def get_schema_dict(self): """Get schema dict for this API.""" return self._get_schema_dict(list()) def _add_entry(self, key_part_list, value, entity): if len(key_part_list) == 1: entity[key_part_list[0]] = value return key = key_part_list.pop() if not entity.has_key(key): entity[key] = {} else: assert type(entity[key]) == type(dict()) self._add_entry(key_part_list, value, entity[key]) def convert_json_to_entity(self, json_entry, entity): assert type(json_entry) == type(dict()) for key in json_entry.keys(): if type(json_entry[key]) == type(dict()): self.convert_json_to_entity(json_entry[key], entity) else: key_parts = key.split(':') key_parts.reverse() self._add_entry(key_parts, json_entry[key], entity) def _get_field_value(self, key_part_list, entity): if len(key_part_list) == 1: if entity.has_key(key_part_list[0]): return entity[key_part_list[0]] return None key = key_part_list.pop() if entity.has_key(key): return self._get_field_value(key_part_list, entity[key]) return None def convert_entity_to_json_entity(self, entity, json_entry): for schema_field in self._properties: field_name = schema_field.name field_name_parts = field_name.split(':') field_name_parts.reverse() value = self._get_field_value(field_name_parts, entity) if type(value) != type(None): json_entry[field_name] = value for key in self._sub_registories.keys(): json_entry[key] = {} self._sub_registories[key].convert_entity_to_json_entity( entity, json_entry[key])
apache-2.0
-4,220,608,419,550,851,600
36.2375
80
0.596173
false
3.977303
false
false
false
LCBRU/reporter
reporter/uhl_reports/fast/data_quality/screening_clinic_redcap_dq.py
1
3307
#!/usr/bin/env python3 from reporter.core import Schedule from reporter.connections import RedcapInstance from reporter.emailing import ( RECIPIENT_FAST_MANAGER, RECIPIENT_FAST_ADMIN, ) from reporter.application_abstract_reports.redcap.data_quality import ( RedcapMissingDataWhen, RedcapMissingAllWhen, RedcapInvalidNhsNumber, RedcapImpliesCheck, RedcapInvalidEmailAddress, RedcapInvalidDate, RedcapInvalidHeightInCm, RedcapInvalidHeightInFeetAndInches, RedcapInvalidWeightInKg, RedcapInvalidWeightInStonesAndPounds, RedcapInvalidPostCode, ) REDCAP_SCREENING_PROJECT_ID = 48 REDCAP_INSTANCE = RedcapInstance.internal class FastRedcapInvalidEmailAddress( RedcapInvalidEmailAddress): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['email_add'], recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastScreeningRedcapInvalidDate( RedcapInvalidDate): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastScreeningRedcapInvalidNhsNumber( RedcapInvalidNhsNumber): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['nhs_no'], recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastRedcapInvalidPostCode( RedcapInvalidPostCode): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['postcode'], recipients=[RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastRedcapMissingDataWhenRecruited(RedcapMissingDataWhen): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=[ 'first_name', 'last_name', 'postcode', 'gp_practice', 'clinic_date', 'invitation_group', 'patient_attend', 'patient_agree_scan', ], indicator_field='patient_recruited', indicator_value='1', recipients=[RECIPIENT_FAST_MANAGER, RECIPIENT_FAST_ADMIN], schedule=Schedule.never, ) class FastRedcapMissingAddressWhenRecruited(RedcapMissingAllWhen): def __init__(self): super().__init__( redcap_instance=REDCAP_INSTANCE, project_id=REDCAP_SCREENING_PROJECT_ID, fields=['add_1', 'add_2', 'add_3', 'add_4'], indicator_field='patient_recruited', indicator_value='1', recipients=[RECIPIENT_FAST_MANAGER, RECIPIENT_FAST_ADMIN], schedule=Schedule.never, )
mit
8,472,242,262,794,943,000
29.198113
71
0.589054
false
4.003632
false
false
false
dholbach/snapcraft
snapcraft/_options.py
1
4962
# -*- Mode:Python; indent-tabs-mode:nil; tab-width:4 -*- # # Copyright (C) 2016 Canonical Ltd # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License version 3 as # published by the Free Software Foundation. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. import logging import multiprocessing import os import platform logger = logging.getLogger(__name__) _ARCH_TRANSLATIONS = { 'armv7l': { 'kernel': 'arm', 'deb': 'armhf', 'cross-compiler-prefix': 'arm-linux-gnueabihf-', 'cross-build-packages': ['gcc-arm-linux-gnueabihf'], 'triplet': 'arm-linux-gnueabihf', }, 'aarch64': { 'kernel': 'arm64', 'deb': 'arm64', 'cross-compiler-prefix': 'aarch64-linux-gnu-', 'cross-build-packages': ['gcc-aarch64-linux-gnu'], 'triplet': 'aarch64-linux-gnu', }, 'i686': { 'kernel': 'x86', 'deb': 'i386', 'triplet': 'i386-linux-gnu', }, 'ppc64le': { 'kernel': 'powerpc', 'deb': 'ppc64el', 'cross-compiler-prefix': 'powerpc64le-linux-gnu-', 'cross-build-packages': ['gcc-powerpc64le-linux-gnu'], 'triplet': 'powerpc64le-linux-gnu', }, 'x86_64': { 'kernel': 'x86', 'deb': 'amd64', 'triplet': 'x86_64-linux-gnu', }, 's390x': { 'kernel': 's390x', 'deb': 's390x', 'cross-compiler-prefix': 's390x-linux-gnu-', 'cross-build-packages': ['gcc-s390x-linux-gnu'], 'triplet': 's390x-linux-gnu', } } class ProjectOptions: @property def use_geoip(self): return self.__use_geoip @property def parallel_builds(self): return self.__parallel_builds @property def parallel_build_count(self): build_count = 1 if self.__parallel_builds: try: build_count = multiprocessing.cpu_count() except NotImplementedError: logger.warning( 'Unable to determine CPU count; disabling parallel builds') return build_count @property def is_cross_compiling(self): return self.__target_machine != self.__host_machine @property def cross_compiler_prefix(self): try: return self.__machine_info['cross-compiler-prefix'] except KeyError: raise EnvironmentError( 'Cross compilation not support for target arch {!}'.format( self.__machine_target)) @property def additional_build_packages(self): packages = [] if self.is_cross_compiling: packages.extend(self.__machine_info.get( 'cross-build-packages', [])) return packages @property def arch_triplet(self): return self.__machine_info['triplet'] @property def deb_arch(self): return self.__machine_info['deb'] @property def kernel_arch(self): return self.__machine_info['kernel'] @property def local_plugins_dir(self): return os.path.join(self.parts_dir, 'plugins') @property def parts_dir(self): return os.path.join(self.__project_dir, 'parts') @property def stage_dir(self): return os.path.join(self.__project_dir, 'stage') @property def snap_dir(self): return os.path.join(self.__project_dir, 'prime') @property def debug(self): return self.__debug def __init__(self, use_geoip=False, parallel_builds=True, target_deb_arch=None, debug=False): # TODO: allow setting a different project dir and check for # snapcraft.yaml self.__project_dir = os.getcwd() self.__use_geoip = use_geoip self.__parallel_builds = parallel_builds self._set_machine(target_deb_arch) self.__debug = debug def _set_machine(self, target_deb_arch): self.__host_machine = platform.machine() if not target_deb_arch: self.__target_machine = self.__host_machine else: self.__target_machine = _find_machine(target_deb_arch) logger.info('Setting target machine to {!r}'.format( target_deb_arch)) self.__machine_info = _ARCH_TRANSLATIONS[self.__target_machine] def _find_machine(deb_arch): for machine in _ARCH_TRANSLATIONS: if _ARCH_TRANSLATIONS[machine].get('deb', '') == deb_arch: return machine raise EnvironmentError( 'Cannot set machine from deb_arch {!r}'.format(deb_arch))
gpl-3.0
740,297,699,160,747,900
28.188235
79
0.592301
false
3.802299
false
false
false
ekaakurniawan/Bioinformatics-Tools
DnC_LocalAlignment/DnC_LocalAlignment.py
1
6963
# Copyright (C) 2012 by Eka A. Kurniawan # eka.a.kurniawan(ta)gmail(tod)com # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; version 2 of the License. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the # Free Software Foundation, Inc., # 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. # Local Alignment in Linear Space - Divide and Conquer # References: # - Neil C. Jones, Pavel A. Pevzner. An Introduction to Bioinformatics Algorithms. Cambridge: The MIT Press, 2004. import copy # Seq1 = "CACCC" # Seq2 = "CATC" # Seq1 = "CAC" # Seq2 = "CATC" # Seq1 = "CTTGAT" # Seq2 = "GCAT" # Seq1 = "TCAAATCAACCAAGATGGAAGCAAAACTGTTTGTAC" # Seq2 = "ATGAAGGCAATACTATTAGTCTTGCTATATACATTC" # Seq1 = "MEAKLFVLFCTFTVLKADTICVGYHANNSTDTVDTVLEKNVTVTHSVNLLEDSHNGKLCSLNGIAPLQLGKCNVAGWLLGNPECDLLLTANSWSYIIETSNSENGTCYPGEFIDYEELREQLSSVSSFEKFEIFPKANSWPNHETTKGVTAACSYSGASSFYRNLLWITKKGTSYPKLSKSYTNNKGKEVLVLWGVHHPPTTSEQQSLYQNTDAYVSVGSSKYNRRFTPEIAARPKVRGQAGRMNYYWTLLDQGDTITFEATGNLIAPWYAFALNKGSDSGIITSDAPVHNCDTRCQTPHGALNSSLPFQNVHPITIGECPKYVKSTKLRMATGLRNVPSIQSRGLFGAIAGFIEGGWTGMIDGWYGYHHQNEQGSGYAADQKSTQNAIDGITNKVNSVIEKMNTQFTAVGKEFNNLERRIENLNKKVDDGFLDVWTYNAELLVLLENERTLDFHDSNVRNLYEKVRSQLRNNAKELGNGCFEFYHKCDDECMESVKNGTYDYPKYSEESKLNREEIDGVKLESMGVYQILAIYSTVASSLVLLVSLGAISFWMCSNGSLQCRICI" # Seq2 = "MKAILVVLLYTFATANADTLCIGYHANNSTDTVDTVLEKNVTVTHSVNLLEDKHNGKLCKLRGVAPLHLGKCNIAGWILGNPECESLSTASSWSYIVETSSSDNGTCYPGDFIDYEELREQLSSVSSFERFEIFPKTSSWPNHDSNKGVTAACPHAGAKSFYKNLIWLVKKGNSYPKLSKSYINDKGKEVLVLWGIHHPSTSADQQSLYQNADAYVFVGTSRYSKKFKPEIAIRPKVRDQEGRMNYYWTLVEPGDKITFEATGNLVVPRYAFAMERNAGSGIIISDTPVHDCNTTCQTPKGAINTSLPFQNIHPITIGKCPKYVKSTKLRLATGLRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADLKSTQNAIDEITNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDIWTYNAELLVLLENERTLDYHDSNVKNLYEKVRSQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSEEAKLNREEIDGVKLESTRIYQILAIYSTVASSLVLVVSLGAISFWMCSNGSLQCRICI" # Seq1 = "TTAAG" # Seq2 = "AAGT" Seq1 = "TCAAATCAAAAGCA" Seq2 = "ATGAAGGCAATACCCTA" mu = 1 sigma = 2 # ------------------------------------ Local Alignment - Dynamic Programming --- def getScoreLocalAlignment(i, j): if V[i] == W[j]: m = S[i-1][j-1] + 1 else: m = S[i-1][j-1] - mu return max([0, S[i-1][j] - sigma, S[i][j-1] - sigma, m]) def getMaxValue(M): maxVal = float("-inf") maxIndx = [None, None] for i, r in enumerate(M): curMax = max(r) if maxVal < curMax: maxVal = curMax maxIndx = [i, r.index(maxVal)] return maxVal, maxIndx V = "0" + Seq1 W = "0" + Seq2 lenV = len(V) lenW = len(W) S = [[0 for j in xrange(lenW)] for i in xrange(lenV)] for i in xrange(1, lenV): for j in range(1, lenW): S[i][j] = getScoreLocalAlignment(i, j) val, endPoint = getMaxValue(S) endPoint = [endPoint[0] - 1, endPoint[1] - 1] V = "0" + Seq1[::-1] W = "0" + Seq2[::-1] for i in xrange(1, lenV): for j in range(1, lenW): S[i][j] = getScoreLocalAlignment(i, j) val, startPoint = getMaxValue(S) startPoint = [lenV - startPoint[0] - 1, lenW - startPoint[1] - 1] # -------------------- Global Alignment in Linear Space - Divide and Conquer --- oriSeq1 = Seq1 oriSeq2 = Seq2 Seq1 = Seq1[startPoint[0]:endPoint[0]+1] Seq2 = Seq2[startPoint[1]:endPoint[1]+1] def getScoreGlobalAlignment(i, j): if V[i] == W[j]: m = S[i-1][j-1] + 1 else: m = S[i-1][j-1] - mu scores = [S[i-1][j] - sigma, S[i][j-1] - sigma, m] return max(scores) def calculatePrefix(source, sink, i): global V, W, S V = "0" + Seq1[source[0]:i + 1] W = "0" + Seq2[source[1]:sink[1]] lenV = len(V) lenW = len(W) S = [[0 for j in xrange(lenW)] for i in xrange(lenV)] for a in range(lenV): S[a][0] = a * -sigma for b in range(lenW): S[0][b] = b * -sigma for a in xrange(1, lenV): for b in range(1, lenW): S[a][b] = getScoreGlobalAlignment(a, b) return S[lenV - 1][1:lenW + 1] def calculateSuffix(source, sink, i): global V, W, S V = "0" + Seq1[i:sink[0]][::-1] W = "0" + Seq2[source[1]:sink[1]][::-1] lenV = len(V) lenW = len(W) S = [[0 for j in xrange(lenW)] for i in xrange(lenV)] for a in range(lenV): S[a][0] = a * -sigma for b in range(lenW): S[0][b] = b * -sigma for a in xrange(1, lenV): for b in range(1, lenW): S[a][b] = getScoreGlobalAlignment(a, b) return S[lenV - 1][1:lenW + 1][::-1] def getPath(source, sink): end = False if (sink[0] - source[0]) <= 2: if D[source[0]] == None: mid_i = source[0] elif D[source[0] + 1] == None: mid_i = source[0] + 1 else: return end = True else: mid_i = source[0] + ((sink[0] - source[0]) / 2) prefix = calculatePrefix(source, sink, mid_i) suffix = calculateSuffix(source, sink, mid_i) sumScore = [prefix[b] + suffix[b] for b in xrange(sink[1] - source[1])] maxScore = max(sumScore) mid_k = source[1] + sumScore.index(maxScore) D[mid_i] = maxScore K[mid_i] = mid_k if end: return getPath(source, [mid_i + 1, mid_k + 1]) getPath([mid_i, mid_k], sink) def generateSequence(): indx = 0 k_indx = 0 for i in xrange(0, n): if i in K[k_indx:]: total = sum([1 for j in K[k_indx:] if j == i]) if total > 1: R[0] += [indx + j + 1 for j in xrange(total)] startIndx = k_indx + K[k_indx:].index(i) maxVal = max(D[startIndx:startIndx+total]) R[1] += [indx + D[startIndx:startIndx+total].index(maxVal) + 1] indx += total k_indx += total else: R[0] += [indx + 1] R[1] += [indx + 1] indx += 1 k_indx += 1 else: R[1] += [indx + 1] indx += 1 def displaySequence(): V = "0" + Seq1 W = "0" + Seq2 Vseq = "" Wseq = "" for indx in xrange(max(R[0] + R[1])): indx += 1 if indx in R[0]: Vseq += V[R[0].index(indx)] else : Vseq += "-" if indx in R[1]: Wseq += W[R[1].index(indx)] else : Wseq += "-" print Vseq print Wseq print "" m = len(Seq1) n = len(Seq2) S = [] V = "" W = "" D = [None for i in xrange(m)] K = copy.deepcopy(D) R = [[0], [0]] getPath([0,0], [m,n]) generateSequence() print R #bar displaySequence()
gpl-2.0
-8,100,298,384,511,656,000
28.629787
577
0.60922
false
2.556167
false
false
false
charman2/rsas
examples/unsteady.py
1
5254
# -*- coding: utf-8 -*- """Storage selection (SAS) functions: example with multiple fluxes out at steady state Runs the rSAS model for a synthetic dataset with one flux in and multiple fluxes out and steady state flow Theory is presented in: Harman, C. J. (2014), Time-variable transit time distributions and transport: Theory and application to storage-dependent transport of chloride in a watershed, Water Resour. Res., 51, doi:10.1002/2014WR015707. """ from __future__ import division import rsas import numpy as np import matplotlib.pyplot as plt import pandas as pd # Initializes the random number generator so we always get the same result np.random.seed(0) # ===================================== # Load the input data # ===================================== data = pd.read_csv('Q1.csv', index_col=0, parse_dates=[1]) # length of the dataset N = len(data) # The individual timeseries can be pulled out of the dataframe S = data['S'].values J = data['J'].values Q = data['Q1'].values C_J = data['C_J'].values-2 C_Q1 = data['C_Q1'].values ST_min = data['ST_min'].values ST_max = data['ST_max'].values # ========================= # Parameters needed by rsas # ========================= # The concentration of water older than the start of observations C_old = ((J*C_J)[J>0]).sum()/((J)[J>0]).sum() # ========================= # Create the rsas functions # ========================= S_dead = 10. #lam = 0. # Uniform # Parameters for the rSAS function Q_rSAS_fun_type = 'uniform' ST_min = np.zeros(N) ST_max = S + S_dead Q_rSAS_fun_parameters = np.c_[ST_min, ST_max] rSAS_fun_Q1 = rsas.create_function(Q_rSAS_fun_type, Q_rSAS_fun_parameters) rSAS_fun = [rSAS_fun_Q1] # Kumaraswami ## Parameters for the rSAS function #Q_rSAS_fun_type = 'kumaraswami' #ST_min = np.ones(N) * 0. #ST_max = S + S_dead #a = np.maximum(0.01, 2. + lam * (S - S.mean())/S.std()) #b = np.ones(N) * 5. #Q_rSAS_fun_parameters = np.c_[a, b, ST_min, ST_max] #rSAS_fun_Q1 = rsas.create_function(Q_rSAS_fun_type, Q_rSAS_fun_parameters) #rSAS_fun = [rSAS_fun_Q1] # ================= # Initial condition # ================= # Unknown initial age distribution, so just set this to zeros ST_init = np.zeros(N + 1) # ============= # Run the model # ============= # Run it outputs = rsas.solve(J, Q, rSAS_fun, ST_init=ST_init, mode='RK4', dt = 1., n_substeps=3, C_J=C_J, C_old=[C_old], verbose=False, debug=False) # Let's pull these out to make the outputs from rsas crystal clear # State variables: age-ranked storage of water and solutes # ROWS of ST, MS are T - ages # COLUMNS of ST, MS are t - times # LAYERS of MS are s - solutes ST = outputs['ST'] MS = outputs['MS'][:,:,0] # Timestep-averaged backwards TTD # ROWS of PQ are T - ages # COLUMNS of PQ are t - times # LAYERS of PQ are q - fluxes PQ1m = outputs['PQ'][:,:,0] # Timestep-averaged outflow concentration # ROWS of C_Q are t - times # COLUMNS of PQ are q - fluxes C_Q1m1 = outputs['C_Q'][:,0,0] # Timestep averaged solute load out # ROWS of MQ are T - ages # COLUMNS of MQ are t - times # LAYERS of MQ are q - fluxes # Last dimension of MS are s - solutes MQ1m = outputs['MQ'][:,:,0,0] #%% # ================================== # Plot the rSAS function # ================================== STx = np.linspace(0,S.max()+S_dead,100) Omega = np.r_[[rSAS_fun_Q1.cdf_i(STx,i) for i in range(N)]].T import matplotlib.cm as cm fig = plt.figure(0) plt.clf() for i in range(N): plt.plot(STx, Omega[:,i], lw=1, color=cm.jet((S[i]-S.min())/S.ptp())) plt.ylim((0,1)) plt.ylabel('$\Omega_Q(T)$') plt.xlabel('age-ranked storage $S_T$') plt.title('Cumulative rSAS function') #%% # ================================== # Plot the transit time distribution # ================================== fig = plt.figure(1) plt.clf() plt.plot(PQ1m, lw=1) plt.ylim((0,1)) plt.ylabel('$P_Q(T)$') plt.xlabel('age $T$') plt.title('Cumulative transit time distribution') #%% # ===================================================================== # Outflow concentration estimated using several different TTD # ===================================================================== # Lets get the instantaneous value of the TTD at the end of each timestep PQ1i = np.zeros((N+1, N+1)) PQ1i[:,0] = rSAS_fun_Q1.cdf_i(ST[:,0],0) PQ1i[:,1:] = np.r_[[rSAS_fun_Q1.cdf_i(ST[:,i+1],i) for i in range(N)]].T # Use the transit time distribution and input timeseries to estimate # the output timeseries for the instantaneous and timestep-averaged cases C_Q1i, C_Q1i_raw, Q1i_observed_fraction = rsas.transport(PQ1i, C_J, C_old) C_Q1m2, C_Q1m2_raw, Q1m2_observed_fraction = rsas.transport(PQ1m, C_J, C_old) # Plot the results fig = plt.figure(2) plt.clf() plt.step(data['datetime'], C_Q1m1, 'g', ls='--', label='mean rsas internal', lw=2, where='post') plt.step(data['datetime'], C_Q1m2, 'b', ls=':', label='mean rsas.transport', lw=2, where='post') plt.step(data['datetime'], C_Q1m2_raw, '0.5', ls=':', label='mean rsas.transport (obs part)', lw=2, where='post') plt.plot(data['datetime'], C_Q1i, 'b:o', label='inst. rsas.transport', lw=1) #plt.plot(data['datetime'], data['C_Q1'], 'r.', label='observed', lw=2) plt.ylim((-2, 0)) plt.legend(loc=0) plt.ylabel('Concentration [-]') plt.xlabel('time') plt.title('Outflow concentration') plt.show()
mit
1,715,018,500,754,261,800
35.234483
113
0.60906
false
2.793195
false
false
false
Galarzaa90/NabBot
cogs/tracking.py
1
83628
# Copyright 2019 Allan Galarza # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import asyncio import datetime as dt import logging import pickle import re import time from collections import defaultdict from typing import List, NamedTuple, Union, Optional, Dict import asyncpg import discord import tibiapy from discord.ext import commands from tibiapy import Death, Guild, OnlineCharacter, OtherCharacter, World from nabbot import NabBot from .utils import CogUtils, EMBED_LIMIT, FIELD_VALUE_LIMIT, checks, config, get_user_avatar, is_numeric, join_list, \ online_characters, safe_delete_message, split_params from .utils.context import NabCtx from .utils.database import DbChar, DbDeath, DbLevelUp, get_affected_count, get_server_property, PoolConn from .utils.errors import CannotPaginate, NetworkError from .utils.messages import death_messages_monster, death_messages_player, format_message, level_messages, \ split_message, weighed_choice, DeathMessageCondition, LevelCondition, SIMPLE_LEVEL, SIMPLE_DEATH, SIMPLE_PVP_DEATH from .utils.pages import Pages, VocationPages from .utils.tibia import HIGHSCORE_CATEGORIES, NabChar, get_character, get_current_server_save_time, get_guild, \ get_highscores, get_share_range, get_voc_abb, get_voc_emoji, get_world, tibia_worlds, normalize_vocation log = logging.getLogger("nabbot") # Storage used to keep a cache of guilds for watchlists GUILD_CACHE = defaultdict(dict) # type: defaultdict[str, Dict[str, Guild]] WATCHLIST_SEPARATOR = "·" class CharactersResult(NamedTuple): skipped: List[OtherCharacter] no_user: List[DbChar] same_owner: List[DbChar] different_user: List[DbChar] new: List[NabChar] all_skipped: bool # region Database Helper classes class Watchlist: """Represents a Watchlist from the database""" def __init__(self, **kwargs): self.server_id: int = kwargs.get("server_id") self.channel_id: int = kwargs.get("channel_id") self.message_id: int = kwargs.get("message_id") self.user_id: int = kwargs.get("user_id") self.show_count: bool = kwargs.get("show_count", True) self.created: dt.datetime = kwargs.get("created") # Not columns self.entries: List['WatchlistEntry'] = [] self.world = None self.content = "" self.online_characters: List[OnlineCharacter] = [] self.online_guilds: List[Guild] = [] self.disbanded_guilds: List[str] = [] self.description = "" @property def online_count(self) -> int: """Total number of online characters across entries.""" return len(self.online_characters) + sum(g.online_count for g in self.online_guilds) def __repr__(self): return "<{0.__class__.__name__} server_id={0.server_id} channel_id={0.channel_id} message_id={0.message_id}>"\ .format(self) async def add_entry(self, conn: PoolConn, name: str, is_guild: bool, user_id: int, reason: Optional[str]) ->\ Optional['WatchlistEntry']: """ Adds an entry to the watchlist. :param conn: Connection to the database. :param name: Name of the character or guild. :param is_guild: Whether the entry is a guild or not. :param user_id: The user that created the entry. :param reason: The reason for the entry. :return: The new created entry or None if it already exists. """ try: return await WatchlistEntry.insert(conn, self.channel_id, name, is_guild, user_id, reason) except asyncpg.UniqueViolationError: return None async def get_entries(self, conn: PoolConn) -> List['WatchlistEntry']: """Gets all entries in this watchlist. :param conn: Connection to the database. :return: List of entries if any. """ return await WatchlistEntry.get_entries_by_channel(conn, self.channel_id) async def update_message_id(self, conn: PoolConn, message_id: int): """Update's the message id. :param conn: Connection to the database. :param message_id: The new message id. """ await conn.execute("UPDATE watchlist SET message_id = $1 WHERE channel_id = $2", message_id, self.channel_id) self.message_id = message_id async def update_show_count(self, conn: PoolConn, show_count: bool): """Update's the show_count property. If the property is True, the number of online entries will be shown in the channel's name. :param conn: Connection to the database. :param show_count: The property's new value. """ await conn.execute("UPDATE watchlist SET show_count = $1 WHERE channel_id = $2", show_count, self.channel_id) self.show_count = show_count @classmethod async def insert(cls, conn: PoolConn, server_id: int, channel_id: int, user_id: int) -> 'Watchlist': """Adds a new watchlist to the database. :param conn: Connection to the database. :param server_id: The discord guild's id. :param channel_id: The channel's id. :param user_id: The user that created the watchlist. :return: The created watchlist. """ row = await conn.fetchrow("INSERT INTO watchlist(server_id, channel_id, user_id) VALUES($1,$2,$3) RETURNING *", server_id, channel_id, user_id) return cls(**row) @classmethod async def get_by_channel_id(cls, conn: PoolConn, channel_id: int) -> Optional['Watchlist']: """Gets a watchlist corresponding to the channel id. :param conn: Connection to the database. :param channel_id: The id of the channel. :return: The found watchlist, if any.""" row = await conn.fetchrow("SELECT * FROM watchlist WHERE channel_id = $1", channel_id) if row is None: return None return cls(**row) @classmethod async def get_by_world(cls, conn: PoolConn, world: str) -> List['Watchlist']: """ Gets all watchlist from a Tibia world. :param conn: Connection to the database. :param world: The name of the world. :return: A list of watchlists from the world. """ query = """SELECT t0.* FROM watchlist t0 LEFT JOIN server_property t1 ON t1.server_id = t0.server_id AND key = 'world' WHERE value ? $1""" rows = await conn.fetch(query, world) return [cls(**row) for row in rows] @classmethod def sort_by_voc_and_level(cls): """Sorting function to order by vocation and then by level.""" return lambda char: (normalize_vocation(char.vocation), -char.level) class WatchlistEntry: """Represents a watchlist entry.""" def __init__(self, **kwargs): self.channel_id: int = kwargs.get("channel_id") self.name: str = kwargs.get("name") self.is_guild: bool = kwargs.get("is_guild", False) self.reason: Optional[str] = kwargs.get("reason") self.user_id: int = kwargs.get("user_id") self.created: dt.datetime = kwargs.get("created") async def remove(self, conn: PoolConn): """Removes a watchlist entry from the database. :param conn: Connection to the database. """ await self.delete(conn, self.channel_id, self.name, self.is_guild) @classmethod async def delete(cls, conn: PoolConn, channel_id: int, name: str, is_guild: bool): """ :param conn: Connection to the databse. :param channel_id: The id of the watchlist's channel. :param name: The name of the entry. :param is_guild: Whether the entry is a guild or a character. """ await conn.execute("DELETE FROM watchlist_entry WHERE channel_id = $1 AND lower(name) = $2 AND is_guild = $3", channel_id, name.lower().strip(), is_guild) @classmethod async def get_by_name(cls, conn: PoolConn, channel_id: int, name: str, is_guild: bool) -> \ Optional['WatchlistEntry']: """Gets an entry by its name. :param conn: Connection to the database. :param channel_id: The id of the channel. :param name: Name of the entry. :param is_guild: Whether the entry is a guild or a character. :return: The entry if found. """ row = await conn.fetchrow("SELECT * FROM watchlist_entry " "WHERE channel_id = $1 AND lower(name) = $2 AND is_guild = $3", channel_id, name.lower().strip(), is_guild) if row is None: return None return cls(**row) @classmethod async def get_entries_by_channel(cls, conn, channel_id) -> List['WatchlistEntry']: """Gets entries related to a watchlist channel. :param conn: Connection to the database. :param channel_id: Id of the channel. :return: A list of entries corresponding to the channel. """ rows = await conn.fetch("SELECT * FROM watchlist_entry WHERE channel_id = $1", channel_id) return [cls(**row) for row in rows] @classmethod async def insert(cls, conn: PoolConn, channel_id: int, name: str, is_guild: bool, user_id: int, reason=None)\ -> Optional['WatchlistEntry']: """Inserts a watchlist entry into the database. :param conn: Connection to the database. :param channel_id: The id of the watchlist's channel. :param name: Name of the entry. :param is_guild: Whether the entry is a guild or a character. :param user_id: The id of the user that added the entry. :param reason: The reason for the entry. :return: The inserted entry. """ row = await conn.fetchrow("INSERT INTO watchlist_entry(channel_id, name, is_guild, reason, user_id) " "VALUES($1, $2, $3, $4, $5) RETURNING *", channel_id, name, is_guild, reason, user_id) if row is None: return None return cls(**row) # endregion class Tracking(commands.Cog, CogUtils): """Commands related to NabBot's tracking system.""" def __init__(self, bot: NabBot): self.bot = bot self.scan_online_chars_task = bot.loop.create_task(self.scan_online_chars()) self.scan_highscores_task = bot.loop.create_task(self.scan_highscores()) self.world_tasks = {} self.world_times = {} # region Tasks async def scan_deaths(self, world): """Iterates through online characters, checking if they have new deaths. This task is created for every tracked world. On every iteration, the last element is checked and reinserted at the beginning.""" ################################################# # Nezune's cave # # Do not touch anything, enter at your own risk # ################################################# tag = f"{self.tag}[{world}][scan_deaths]" await self.bot.wait_until_ready() log.info(f"{tag} Started") while not self.bot.is_closed(): try: await asyncio.sleep(config.death_scan_interval) if len(online_characters[world]) == 0: await asyncio.sleep(0.5) continue skip = False # Pop last char in queue, reinsert it at the beginning current_char = online_characters[world].pop() if hasattr(current_char, "last_check") and time.time() - current_char.last_check < 45: skip = True current_char.last_check = time.time() online_characters[world].insert(0, current_char) if not skip: # Check for new death char = await get_character(self.bot, current_char.name) await self.compare_deaths(char) else: await asyncio.sleep(0.5) except NetworkError: await asyncio.sleep(0.3) continue except asyncio.CancelledError: # Task was cancelled, so this is fine break except KeyError: continue except Exception as e: log.exception(f"{tag} Exception: {e}") continue async def scan_highscores(self): """Scans the highscores, storing the results in the database. The task checks if the last stored data is from the current server save or not.""" ################################################# # Nezune's cave # # Do not touch anything, enter at your own risk # ################################################# tag = f"{self.tag}[scan_highscores]" await self.bot.wait_until_ready() log.info(f"{tag} Started") while not self.bot.is_closed(): if len(self.bot.tracked_worlds_list) == 0: # If no worlds are tracked, just sleep, worlds might get registered later await asyncio.sleep(10*60) continue for world in self.bot.tracked_worlds_list: tag = f"{self.tag}[{world}](scan_highscores)" world_count = 0 if world not in tibia_worlds: log.warning(f"{tag} Tracked world is no longer a valid world.") await asyncio.sleep(0.1) try: for key, values in HIGHSCORE_CATEGORIES.items(): # Check the last scan time, highscores are updated every server save last_scan = await self.bot.pool.fetchval( "SELECT last_scan FROM highscores WHERE world = $1 AND category = $2", world, key) if last_scan: last_scan_ss = get_current_server_save_time(last_scan) current_ss = get_current_server_save_time() # If the saved results are from the current server save, saving is skipped if last_scan_ss >= current_ss: log.debug(f"{tag} {values[0].name} | {values[1].name} | Already saved") await asyncio.sleep(0.1) continue try: highscores = await get_highscores(world, *values) except NetworkError: continue await self.save_highscores(world, key, highscores) except asyncio.CancelledError: # Task was cancelled, so this is fine break except Exception: log.exception(f"{tag}") continue if world_count: log.info(f"{tag} {world_count:,} entries saved.") await asyncio.sleep(5) await asyncio.sleep(60*30) async def scan_online_chars(self): """Scans tibia.com's character lists to store them locally. A online list per world is created, with the online registered characters. When a character enters the online list, their deaths are checked. On every cycle, their levels are compared. When a character leaves the online list, their levels and deaths are compared.""" ################################################# # Nezune's cave # # Do not touch anything, enter at your own risk # ################################################# await self.bot.wait_until_ready() tag = f"{self.tag}[scan_online_chars]" log.info(f"{tag} Task started") try: with open("data/online_list.dat", "rb") as f: saved_list, timestamp = pickle.load(f) if (time.time() - timestamp) < config.online_list_expiration: online_characters.clear() online_characters.update(saved_list) count = len([c for v in online_characters.values() for c in v]) log.info(f"{tag} Loaded cached online list | {count:,} players") else: log.info(f"{tag} Cached online list is too old, discarding") except FileNotFoundError: pass except (ValueError, pickle.PickleError): log.info(f"{tag} Couldn't read cached online list.") while not self.bot.is_closed(): try: # Pop last server in queue, reinsert it at the beginning current_world = tibia_worlds.pop() tibia_worlds.insert(0, current_world) if current_world.capitalize() not in self.bot.tracked_worlds_list: await asyncio.sleep(0.1) continue if time.time() - self.world_times.get(current_world.capitalize(), 0) < config.online_scan_interval: await asyncio.sleep(0.2) continue tag = f"{self.tag}[{current_world}][scan_online_chars]" log.debug(f"{tag} Checking online list") # Get online list for this server try: world = await get_world(current_world) if world is None: await asyncio.sleep(0.1) continue log.debug(f"{tag} {world.online_count} players online") except NetworkError: await asyncio.sleep(0.1) continue current_world_online = world.online_players if len(current_world_online) == 0: await asyncio.sleep(0.1) continue self.world_times[world.name] = time.time() self.bot.dispatch("world_scanned", world) # Save the online list in file with open("data/online_list.dat", "wb") as f: pickle.dump((online_characters, time.time()), f, protocol=pickle.HIGHEST_PROTOCOL) if current_world not in online_characters: online_characters[current_world] = [] # List of characters that are now offline offline_list = [c for c in online_characters[current_world] if c not in current_world_online] for offline_char in offline_list: # Check if characters got level ups when they went offline log.debug(f"{tag} Character no longer online | {offline_char.name}") online_characters[current_world].remove(offline_char) try: _char = await get_character(self.bot, offline_char.name) await self.compare_levels(_char) await self.compare_deaths(_char) except NetworkError: continue # Add new online chars and announce level differences for server_char in current_world_online: db_char = await DbChar.get_by_name(self.bot.pool, server_char.name) if db_char: try: if server_char not in online_characters[current_world]: # If the character wasn't in the online list we add them # (We insert them at the beginning of the list to avoid messing with the checks order) server_char.last_check = time.time() log.debug(f"{tag} Character added to online list | {server_char.name}") online_characters[current_world].insert(0, server_char) _char = await get_character(self.bot, server_char.name) await self.compare_deaths(_char) # Only update level up, but don't count it as a level up await self.compare_levels(_char, True) else: await self.compare_levels(server_char) # Update character in the list _char_index = online_characters[current_world].index(server_char) online_characters[current_world][_char_index].level = server_char.level except NetworkError: continue except (ValueError, IndexError): continue except asyncio.CancelledError: # Task was cancelled, so this is fine break except Exception: log.exception("scan_online_chars") continue # endregion # region Custom Events @commands.Cog.listener() async def on_world_scanned(self, scanned_world: World): """Event called each time a world is checked. Updates the watchlists :param scanned_world: The scanned world's information. """ # Schedule Scan Deaths task for this world if scanned_world.name not in self.world_tasks: self.world_tasks[scanned_world.name] = self.bot.loop.create_task(self.scan_deaths(scanned_world.name)) GUILD_CACHE[scanned_world.name].clear() await self._run_watchlist(scanned_world) async def _run_watchlist(self, scanned_world: World): watchlists = await Watchlist.get_by_world(self.bot.pool, scanned_world.name) for watchlist in watchlists: watchlist.world = scanned_world.name log.debug(f"{self.tag}[{scanned_world.name}] Checking entries for watchlist | " f"Guild ID: {watchlist.server_id} | Channel ID: {watchlist.channel_id} " f"| World: {scanned_world.name}") guild: discord.Guild = self.bot.get_guild(watchlist.server_id) if guild is None: await asyncio.sleep(0.01) continue discord_channel: discord.TextChannel = guild.get_channel(watchlist.channel_id) if discord_channel is None: await asyncio.sleep(0.1) continue watchlist.entries = await watchlist.get_entries(self.bot.pool) if not watchlist.entries: await asyncio.sleep(0.1) continue await self._watchlist_scan_entries(watchlist, scanned_world) await self._watchlist_build_content(watchlist) await self._watchlist_update_content(watchlist, discord_channel) async def _watchlist_scan_entries(self, watchlist: Watchlist, scanned_world: World): for entry in watchlist.entries: if entry.is_guild: await self._watchlist_check_guild(watchlist, entry) # If it is a character, check if he's in the online list else: self._watchlist_add_characters(watchlist, entry, scanned_world) watchlist.online_characters.sort(key=Watchlist.sort_by_voc_and_level()) @classmethod async def _watchlist_check_guild(cls, watchlist, watched_guild: WatchlistEntry): try: tibia_guild = await cls.cached_get_guild(watched_guild.name, watchlist.world) except NetworkError: return # Save disbanded guilds separately if tibia_guild is None: watchlist.disbanded_guilds.append(watched_guild.name) return # If there's at least one member online, add guild to list if tibia_guild.online_count: watchlist.online_guilds.append(tibia_guild) @staticmethod def _watchlist_add_characters(watchlist, watched_char: WatchlistEntry, scanned_world: World): for online_char in scanned_world.online_players: if online_char.name == watched_char.name: # Add to online list watchlist.online_characters.append(online_char) return @staticmethod def _watchlist_get_msg_entries(characters): return [f"\t{char.name} - Level {char.level} {get_voc_emoji(char.vocation)}" for char in characters] async def _watchlist_build_content(self, watchlist): if watchlist.online_count > 0: msg_entries = self._watchlist_get_msg_entries(watchlist.online_characters) watchlist.content = "\n".join(msg_entries) self._watchlist_build_guild_content(watchlist) else: watchlist.description = "There are no watched characters online." def _watchlist_build_guild_content(self, watchlist): for guild_name in watchlist.disbanded_guilds: watchlist.content += f"\n__Guild: **{guild_name}**__\n" watchlist.content += "\t*Guild was disbanded.*" for tibia_guild in watchlist.online_guilds: watchlist.content += f"\n__Guild: **{tibia_guild.name}**__\n" online_members = tibia_guild.online_members[:] online_members.sort(key=Watchlist.sort_by_voc_and_level()) watchlist.content += "\n".join(self._watchlist_get_msg_entries(online_members)) async def _watchlist_update_content(self, watchlist: Watchlist, channel: discord.TextChannel): # Send new watched message or edit last one embed = discord.Embed(description=watchlist.description, timestamp=dt.datetime.utcnow()) embed.set_footer(text="Last updated") if watchlist.content: if len(watchlist.content) >= EMBED_LIMIT - 50: watchlist.content = split_message(watchlist.content, EMBED_LIMIT - 50)[0] watchlist.content += "\n*And more...*" fields = split_message(watchlist.content, FIELD_VALUE_LIMIT) for s, split_field in enumerate(fields): name = "Watchlist" if s == 0 else "\u200F" embed.add_field(name=name, value=split_field, inline=False) try: await self._watchlist_update_message(self.bot.pool, watchlist, channel, embed) await self._watchlist_update_name(watchlist, channel) except discord.HTTPException: # log.exception(f"{self.tag}[_watchlist_update_content] {watchlist}") pass @staticmethod async def _watchlist_update_name(watchlist: Watchlist, channel: discord.TextChannel): try: original_name = channel.name.split(WATCHLIST_SEPARATOR, 1)[0] if original_name != channel.name and not watchlist.show_count: await channel.edit(name=original_name, reason="Removing online count") elif watchlist.show_count: new_name = f"{original_name}{WATCHLIST_SEPARATOR}{watchlist.online_count}" # Reduce unnecessary API calls and Audit log spam if new_name != channel.name: await channel.edit(name=new_name, reason="Online count changed") except discord.Forbidden: pass @staticmethod async def _watchlist_update_message(conn, watchlist, channel, embed): # We try to get the watched message, if the bot can't find it, we just create a new one # This may be because the old message was deleted or this is the first time the list is checked try: message = await channel.fetch_message(watchlist.message_id) except discord.HTTPException: message = None if message is None: new_message = await channel.send(embed=embed) await watchlist.update_message_id(conn, new_message.id) else: await message.edit(embed=embed) # endregion # region Discord Events @commands.Cog.listener() async def on_guild_channel_delete(self, channel: discord.abc.GuildChannel): """Called when a guild channel is deleted. Deletes associated watchlist and entries.""" if not isinstance(channel, discord.TextChannel): return result = await self.bot.pool.execute("DELETE FROM watchlist_entry WHERE channel_id = $1", channel.id) deleted_entries = get_affected_count(result) result = await self.bot.pool.execute("DELETE FROM watchlist WHERE channel_id = $1", channel.id) deleted = get_affected_count(result) if deleted: # Dispatch event so ServerLog cog can handle it. log.info(f"{self.tag} Watchlist channel deleted | Channel {channel.id} | Guild {channel.guild.id}") self.bot.dispatch("watchlist_deleted", channel, deleted_entries) # endregion # region Commands @checks.server_mod_only() @checks.tracking_world_only() @commands.command(name="addchar", aliases=["registerchar"], usage="<user>,<character>") async def add_char(self, ctx: NabCtx, *, params): """Register a character and optionally all other visible characters to a discord user. This command can only be used by server moderators. If a character is hidden, only that character will be added. Characters in other worlds are skipped.""" params = params.split(",") if len(params) != 2: raise commands.BadArgument() target_name, char_name = params target_name = target_name.strip() target = self.bot.get_member(target_name, ctx.guild) if target is None: return await ctx.error(f"I couldn't find any users named `{target_name}`") if target.bot: return await ctx.error("You can't register characters to discord bots!") msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: char = await get_character(ctx.bot, char_name) if char is None: return await msg.edit(content="That character doesn't exist.") except NetworkError: return await msg.edit(content="I couldn't fetch the character, please try again.") check_other = False if len(char.other_characters) > 1: message = await ctx.send("Do you want to attempt to add the other visible characters in this account?") check_other = await ctx.react_confirm(message, timeout=60, delete_after=True) if check_other is None: await safe_delete_message(msg) return await ctx.error("You ran out of time, try again." "Remember you have to react or click on the reactions.") if check_other: await safe_delete_message(msg) msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: results = await self.check_char_availability(ctx, ctx.author.id, char, [ctx.world], check_other) except NetworkError: return await msg.edit("I'm having network issues, please try again.") if results.all_skipped: await safe_delete_message(msg) await ctx.error(f"Sorry, I couldn't find any characters in **{ctx.world}**.") return reply = await self.process_character_assignment(ctx, results, target, ctx.author) await safe_delete_message(msg) await ctx.send(reply) @commands.command() @checks.tracking_world_somewhere() async def claim(self, ctx: NabCtx, *, char_name: str = None): """Claims a character registered as yours. Claims a character as yours, even if it is already registered to someone else. In order for this to work, you have to put a special code in the character's comment. You can see this code by using the command with no parameters. The code looks like this: `/NB-23FC13AC7400000/` Once you had set the code, you can use the command with that character, if the code matches, it will be reassigned to you. Note that it may take some time for the code to be visible to NabBot because of caching. This code is unique for your discord user, so the code will only work for your discord account and no one else. No one can claim a character of yours unless you put **their** code on your character's comment. """ user = ctx.author claim_pattern = re.compile(r"/NB-([^/]+)/") user_code = hex(user.id)[2:].upper() # List of Tibia worlds tracked in the servers the user is if ctx.is_private: user_tibia_worlds = [ctx.world] else: user_tibia_worlds = ctx.bot.get_user_worlds(user.id) if not ctx.is_private and self.bot.tracked_worlds.get(ctx.guild.id) is None: return await ctx.send("This server is not tracking any tibia worlds.") if len(user_tibia_worlds) == 0: return if char_name is None: await ctx.send(f"To use this command, add `/NB-{user_code}/` to the comment of the character you want to" f"claim, and then use `/claim character_name`.") return msg = await ctx.send(f"{config.loading_emoji} Fetching character...") try: char = await get_character(ctx.bot, char_name) if char is None: return await msg.edit(content=f"{ctx.tick(False)} That character doesn't exist.") except NetworkError: return await msg.edit(content=f"{ctx.tick(False)} I couldn't fetch the character, please try again.") match = claim_pattern.search(char.comment if char.comment is not None else "") if not match: await ctx.error(f"Couldn't find verification code on character's comment.\n" f"Add `/NB-{user_code}/` to the comment to authenticate.") return code = match.group(1) if code != user_code: await ctx.error(f"The verification code on the character's comment doesn't match yours.\n" f"Use `/NB-{user_code}/` to authenticate.") return check_other = False if len(char.other_characters) > 1: message = await ctx.send("Do you want to attempt to add the other visible characters in this account?") check_other = await ctx.react_confirm(message, timeout=60, delete_after=True) if check_other is None: await safe_delete_message(msg) return await ctx.send("You ran out of time, try again." "Remember you have to react or click on the reactions.") if check_other: await safe_delete_message(msg) msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: results = await self.check_char_availability(ctx, ctx.author.id, char, user_tibia_worlds, check_other) except NetworkError: return await msg.edit("I'm having network issues, please try again.") if results.all_skipped: reply = "Sorry, I couldn't find any characters from the worlds in the context ({0})." return await msg.edit(content=reply.format(join_list(user_tibia_worlds))) reply = await self.process_character_assignment(ctx, results, ctx.author, claim=True) await safe_delete_message(msg) await ctx.send(reply) @checks.tracking_world_somewhere() @commands.command(aliases=["i'm", "iam"]) async def im(self, ctx: NabCtx, *, char_name: str): """Lets you add your tibia character(s) for the bot to track. If there are other visible characters, the bot will ask for confirmation to add them too. Characters in other worlds other than the currently tracked world are skipped. If it finds a character owned by another user, the whole process will be stopped. If a character is already registered to someone else, `claim` can be used.""" # List of Tibia worlds tracked in the servers the user is if ctx.is_private: user_tibia_worlds = [ctx.world] else: user_tibia_worlds = ctx.bot.get_user_worlds(ctx.author.id) msg = await ctx.send(f"{config.loading_emoji} Fetching character...") try: char = await get_character(ctx.bot, char_name) if char is None: return await msg.edit(content=f"{ctx.tick(False)} That character doesn't exist.") except NetworkError: return await msg.edit(content=f"{ctx.tick(False)} I couldn't fetch the character, please try again.") check_other = False if len(char.other_characters) > 1: await msg.edit(content="Do you want to attempt to add the other visible characters in this account?") check_other = await ctx.react_confirm(msg, timeout=60, delete_after=True) if check_other is None: await safe_delete_message(msg) return await ctx.send("You didn't reply in time, try again." "Remember that you have to react or click on the icons.") if check_other: await safe_delete_message(msg) msg = await ctx.send(f"{config.loading_emoji} Fetching characters...") try: results = await self.check_char_availability(ctx, ctx.author.id, char, user_tibia_worlds, check_other) except NetworkError: return await msg.edit("I'm having network issues, please try again.") if results.all_skipped: reply = "Sorry, I couldn't find any characters from the worlds in the context ({0})." return await msg.edit(content=reply.format(join_list(user_tibia_worlds))) reply = await self.process_character_assignment(ctx, results, ctx.author) await safe_delete_message(msg) await ctx.send(reply) @checks.tracking_world_somewhere() @commands.command(aliases=["i'mnot"]) async def imnot(self, ctx: NabCtx, *, name): """Removes a character assigned to you. All registered level ups and deaths will be lost forever.""" db_char = await DbChar.get_by_name(ctx.pool, name) if db_char is None or db_char.user_id == 0: return await ctx.error("There's no character registered with that name.") if db_char.user_id != ctx.author.id: return await ctx.error(f"The character **{db_char.name}** is not registered to you.") message = await ctx.send(f"Are you sure you want to unregister " f"**{db_char.name}** ({abs(db_char.level)} {db_char.vocation})?") confirm = await ctx.react_confirm(message, timeout=50) if confirm is None: return await ctx.send("I guess you changed your mind.") if not confirm: return await ctx.send("No then? Ok.") await db_char.update_user(ctx.pool, 0) await ctx.success(f"**{db_char.name}** is no longer registered to you.") self.bot.dispatch("character_change", ctx.author.id) self.bot.dispatch("character_unregistered", ctx.author, db_char) @checks.can_embed() @checks.tracking_world_only() @commands.command() async def online(self, ctx: NabCtx): """Tells you which users are online on Tibia. This list gets updated based on Tibia.com online list, so it takes a couple minutes to be updated.""" world = ctx.world per_page = 20 if await ctx.is_long() else 5 now = dt.datetime.utcnow() uptime = (now - self.bot.start_time).total_seconds() count = 0 entries = [] vocations = [] for char in online_characters.get(world, []): name = char.name db_char = await DbChar.get_by_name(ctx.pool, name) if not db_char: continue # Skip characters of members not in the server owner = ctx.guild.get_member(db_char.user_id) if owner is None: continue owner = owner.display_name emoji = get_voc_emoji(char.vocation) vocations.append(char.vocation.value) vocation = get_voc_abb(char.vocation) entries.append(f"{char.name} (Lvl {char.level} {vocation}{emoji}, **@{owner}**)") count += 1 if count == 0: if uptime < 90: await ctx.send("I just started, give me some time to check online lists...⌛") else: await ctx.send("There is no one online from Discord.") return pages = VocationPages(ctx, entries=entries, vocations=vocations, per_page=per_page) pages.embed.title = "Users online" try: await pages.paginate() except CannotPaginate as e: await ctx.send(e) @commands.command(name="searchteam", aliases=["whereteam", "findteam"], usage="<params>") @checks.tracking_world_only() @checks.can_embed() async def search_team(self, ctx: NabCtx, *, params=None): """Searches for a registered character that meets the criteria There are 3 ways to use this command: - Show characters in share range with a specific character. (`searchteam <name>`) - Show characters in share range with a specific level. (`searchteam <level>`) - Show characters in a level range. (`searchteam <min>,<max>`) Online characters are shown first on the list, they also have an icon.""" permissions = ctx.bot_permissions if not permissions.embed_links: await ctx.send("Sorry, I need `Embed Links` permission for this command.") return invalid_arguments = "Invalid arguments used, examples:\n" \ "```/searchteam charname\n" \ "/searchteam level\n" \ "/searchteam minlevel,maxlevel```" if ctx.world is None: await ctx.send("This server is not tracking any tibia worlds.") return if params is None: await ctx.send(invalid_arguments) return entries = [] vocations = [] online_entries = [] online_vocations = [] per_page = 20 if await ctx.is_long() else 5 char = None params = split_params(params) if len(params) < 1 or len(params) > 2: await ctx.send(invalid_arguments) return # params[0] could be a character's name, a character's level or one of the level ranges # If it's not a number, it should be a player's name if not is_numeric(params[0]): # We shouldn't have another parameter if a character name was specified if len(params) == 2: await ctx.send(invalid_arguments) return char = await get_character(ctx.bot, params[0]) if char is None: await ctx.send("I couldn't find a character with that name.") return low, high = get_share_range(char.level) title = f"Characters in share range with {char.name}({low}-{high}):" empty = f"I didn't find anyone in share range with **{char.name}**({low}-{high})" else: # Check if we have another parameter, meaning this is a level range if len(params) == 2: try: level1 = int(params[0]) level2 = int(params[1]) except ValueError: await ctx.send(invalid_arguments) return if level1 <= 0 or level2 <= 0: await ctx.send("You entered an invalid level.") return low = min(level1, level2) high = max(level1, level2) title = f"Characters between level {low} and {high}" empty = f"I didn't find anyone between levels **{low}** and **{high}**" # We only got a level, so we get the share range for it else: if int(params[0]) <= 0: await ctx.send("You entered an invalid level.") return low, high = get_share_range(int(params[0])) title = f"Characters in share range with level {params[0]} ({low}-{high})" empty = f"I didn't find anyone in share range with level **{params[0]}** ({low}-{high})" async with ctx.pool.acquire() as conn: count = 0 online_list = [x.name for v in online_characters.values() for x in v] async for db_char in DbChar.get_chars_in_range(conn, low, high, ctx.world): if char is not None and char.name == db_char.name: continue owner = ctx.guild.get_member(db_char.user_id) if owner is None: continue count += 1 owner = owner.display_name emoji = get_voc_emoji(db_char.vocation) voc_abb = get_voc_abb(db_char.vocation) entry = f"**{db_char.name}** - Level {abs(db_char.level)} {voc_abb}{emoji} - @**{owner}**" if db_char.name in online_list: entry = f"{config.online_emoji}{entry}" online_entries.append(entry) online_vocations.append(db_char.vocation) else: entries.append(entry) vocations.append(db_char.vocation) if count < 1: await ctx.send(empty) return pages = VocationPages(ctx, entries=online_entries + entries, per_page=per_page, vocations=online_vocations + vocations) pages.embed.title = title try: await pages.paginate() except CannotPaginate as e: await ctx.send(e) @checks.server_mod_only() @checks.tracking_world_only() @commands.command(name="removechar", aliases=["deletechar", "unregisterchar"]) async def remove_char(self, ctx: NabCtx, *, name): """Removes a registered character from someone. This can only be used by server moderators. Note that you can only remove chars if they are from users exclusively in your server. You can't remove any characters that would alter other servers NabBot is in.""" # This could be used to remove deleted chars so we don't need to check anything # Except if the char exists in the database... db_char = await DbChar.get_by_name(ctx.pool, name.strip()) if db_char is None or db_char.user_id == 0: return await ctx.error("There's no character with that name registered.") if db_char.world != ctx.world: return await ctx.error(f"The character **{db_char.name}** is in a different world.") user = self.bot.get_user(db_char.user_id) if user is not None: user_guilds = self.bot.get_user_guilds(user.id) # Iterating every world where the user is, to check if it wouldn't affect other admins. for guild in user_guilds: if guild == ctx.guild: continue if self.bot.tracked_worlds.get(guild.id, None) != ctx.world: continue author: discord.Member = guild.get_member(ctx.author.id) if author is None or not author.guild_permissions.manage_guild: await ctx.error(f"The user of this server is also in another server tracking " f"**{ctx.world}**, where you are not an admin. You can't alter other servers.") return username = "unknown" if user is None else user.display_name await db_char.update_user(ctx.pool, 0) await ctx.send("**{0}** was removed successfully from **@{1}**.".format(db_char.name, username)) self.bot.dispatch("character_unregistered", user, db_char, ctx.author) @checks.server_mod_only() @checks.tracking_world_only() @commands.group(invoke_without_command=True, case_insensitive=True, aliases=["huntedlist"]) async def watchlist(self, ctx: NabCtx): """Create or manage watchlists. Watchlists are channels where the online status of selected characters are shown. You can create multiple watchlists and characters and guilds to each one separately. Try the subcommands.""" await ctx.send("To manage watchlists, use one of the subcommands.\n" f"Try `{ctx.clean_prefix}help {ctx.invoked_with}`.") @checks.tracking_world_only() @checks.channel_mod_somewhere() @watchlist.command(name="add", aliases=["addplayer", "addchar"], usage="<channel> <name>[,reason]") async def watchlist_add(self, ctx: NabCtx, channel: discord.TextChannel, *, params): """Adds a character to a watchlist. A reason can be specified by adding it after the character's name, separated by a comma.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist channel.") if not channel.permissions_for(ctx.author).manage_channels: return await ctx.error(f"You need `Manage Channel` permissions in {channel.mention} to add entries.") params = params.split(",", 1) name = params[0] reason = None if len(params) > 1: reason = params[1] char = await get_character(ctx.bot, name) if char is None: await ctx.error("A character with that name doesn't exist.") return world = ctx.world if char.world != world: await ctx.error(f"This character is not in **{world}**.") return message = await ctx.send(f"Do you want to add **{char.name}** (Level {char.level} {char.vocation}) " f"to the watchlist {channel.mention}") confirm = await ctx.react_confirm(message, delete_after=True) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return entry = await watchlist.add_entry(ctx.pool, char.name, False, ctx.author.id, reason) if entry: await ctx.success(f"Character **{char.name}** added to the watchlist {channel.mention}.") else: await ctx.error(f"**{char.name}** is already registered in {channel.mention}") @checks.tracking_world_only() @checks.channel_mod_somewhere() @watchlist.command(name="addguild", usage="<channel> <name>[,reason]") async def watchlist_addguild(self, ctx: NabCtx, channel: discord.TextChannel, *, params): """Adds an entire guild to a watchlist. Guilds are displayed in the watchlist as a group.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist channel.") if not channel.permissions_for(ctx.author).manage_channels: return await ctx.error(f"You need `Manage Channel` permissions in {channel.mention} to add entries.") params = params.split(",", 1) name = params[0] reason = None if len(params) > 1: reason = params[1] guild = await get_guild(name) if guild is None: await ctx.error("There's no guild with that name.") return if guild.world != ctx.world: await ctx.error(f"This guild is not in **{ctx.world}**.") return message = await ctx.send(f"Do you want to add the guild **{guild.name}** to the watchlist {channel.mention}?") confirm = await ctx.react_confirm(message, delete_after=True) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return entry = await watchlist.add_entry(ctx.pool, guild.name, True, ctx.author.id, reason) if entry: await ctx.success(f"Guild **{guild.name}** added to the watchlist {channel.mention}.") else: await ctx.error(f"**{guild.name}** is already registered in {channel.mention}") @checks.tracking_world_only() @checks.channel_mod_somewhere() @watchlist.command(name="adduser", usage="<channel> <user>[,reason]") async def watchlist_adduser(self, ctx: NabCtx, channel: discord.TextChannel, *, params): """Adds the currently registered characters of a user to the watchlist. A reason can be specified by adding it after the character's name, separated by a comma.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist channel.") if not channel.permissions_for(ctx.author).manage_channels: return await ctx.error( f"You need `Manage Channel` permissions in {channel.mention} to add entries.") params = params.split(",", 1) name = params[0] reason = None if len(params) > 1: reason = params[1] user = ctx.bot.get_member(name, ctx.guild) if user is None: return await ctx.error("I don't see any users with that name or id.") characters = await DbChar.get_chars_by_user(ctx.pool, user.id, worlds=ctx.world) if not characters: await ctx.error(f"This user doesn't have any registered characters in {ctx.world}.") return char_list = "\n".join(f"• {c.name}" for c in characters) message = await ctx.send(f"Do you want to add currently registered characters of `{user}` to this watchlist?\n" f"{char_list}") confirm = await ctx.react_confirm(message) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return results = "" for char in characters: entry = await watchlist.add_entry(ctx.pool, char.name, False, ctx.author.id, reason) if entry: results += f"\n• {char.name}" if results: await ctx.success(f"I added the following characters to the list {channel.mention}, " f"duplicates where skipped:{results}") else: await ctx.error("No characters where added, as they were all duplicates.") @checks.server_mod_only() @checks.tracking_world_only() @watchlist.command(name="create") async def watchlist_create(self, ctx: NabCtx, *, name): """Creates a watchlist channel. Creates a new text channel for the watchlist to be posted. The watch list shows which characters from it are online. Entire guilds can be added too. The channel can be renamed at anytime. If the channel is deleted, all its entries are deleted too. """ if WATCHLIST_SEPARATOR in name: await ctx.error(f"Channel name cannot contain the special character **{WATCHLIST_SEPARATOR}**") return if not ctx.bot_permissions.manage_channels: return await ctx.error(f"I need `Manage Channels` permission in the server to use this command.") message = await ctx.send(f"Do you want to create a new watchlist named `{name}`?") confirm = await ctx.react_confirm(message, delete_after=True) if not confirm: return try: overwrites = { ctx.guild.default_role: discord.PermissionOverwrite(send_messages=False, read_messages=True), ctx.guild.me: discord.PermissionOverwrite(send_messages=True, read_messages=True, manage_channels=True) } channel = await ctx.guild.create_text_channel(name, overwrites=overwrites, category=ctx.channel.category) except discord.Forbidden: await ctx.error(f"Sorry, I don't have permissions to create channels.") except discord.HTTPException: await ctx.error(f"Something went wrong, the channel name you chose is probably invalid.") else: log.info(f"Watchlist created (Channel ID: {channel.id}, Guild ID: {channel.guild.id})") await ctx.success(f"Channel created successfully: {channel.mention}\n") await channel.send("This is where I will post a list of online watched characters.\n" "Edit this channel's permissions to allow the roles you want.\n" "This channel can be renamed freely.\n" "Anyone with `Manage Channel` permission here can add entries.\n" f"Example: {ctx.clean_prefix}{ctx.command.full_parent_name} add {channel.mention} " f"Galarzaa Fidera\n" "If this channel is deleted, all related entries will be lost.\n" "**It is important to not allow anyone to write in here**\n" "*This message can be deleted now.*") watchlist = await Watchlist.insert(ctx.pool, ctx.guild.id, channel.id, ctx.author.id) log.debug(f"{self.tag} Watchlist created | {watchlist}") @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="info", aliases=["details", "reason"]) async def watchlist_info(self, ctx: NabCtx, channel: discord.TextChannel, *, name: str): """Shows information about a watchlist entry. This shows who added the player, when, and if there's a reason why they were added.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, False) if not entry: return await ctx.error(f"There's no character with that name registered to {channel.mention}.") embed = discord.Embed(title=entry.name, url=tibiapy.Character.get_url(entry.name), timestamp=entry.created, description=f"**Reason:** {entry.reason}" if entry.reason else "No reason provided.") embed.set_author(name=f"In #{channel}") author = ctx.guild.get_member(entry.user_id) if author: embed.set_footer(text=f"Added by {author.name}#{author.discriminator}", icon_url=get_user_avatar(author)) await ctx.send(embed=embed) @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="infoguild", aliases=["detailsguild", "reasonguild"]) async def watchlist_infoguild(self, ctx: NabCtx, channel: discord.TextChannel, *, name: str): """"Shows details about a guild entry in a watchlist. This shows who added the player, when, and if there's a reason why they were added.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, True) if not entry: return await ctx.error(f"There's no guild with that name registered to {channel.mention}.") embed = discord.Embed(title=entry.name, timestamp=entry.created, url=tibiapy.Guild.get_url(entry.name), description=f"**Reason:** {entry.reason}" if entry.reason else "No reason provided.") embed.set_author(name=f"In #{channel}") author = ctx.guild.get_member(entry.user_id) if author: embed.set_footer(text=f"Added by {author.name}#{author.discriminator}", icon_url=get_user_avatar(author)) await ctx.send(embed=embed) @checks.tracking_world_only() @watchlist.command(name="list") async def watchlist_list(self, ctx: NabCtx, channel: discord.TextChannel): """Shows characters belonging to that watchlist. Note that this lists all characters, not just online characters.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") if not channel.permissions_for(ctx.author).read_messages: return await ctx.error("You can't see the list of a watchlist you can't see.") entries = await WatchlistEntry.get_entries_by_channel(ctx.pool, channel.id) entries = [entry for entry in entries if not entry.is_guild] if not entries: return await ctx.error(f"This watchlist has no registered characters.") pages = Pages(ctx, entries=[f"[{r.name}]({NabChar.get_url(r.name)})" for r in entries]) pages.embed.title = f"Watched Characters in #{channel.name}" try: await pages.paginate() except CannotPaginate as e: await ctx.error(e) @checks.tracking_world_only() @watchlist.command(name="listguilds", aliases=["guilds", "guildlist"]) async def watchlist_list_guild(self, ctx: NabCtx, channel: discord.TextChannel): """Shows a list of guilds in the watchlist.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entries = await WatchlistEntry.get_entries_by_channel(ctx.pool, channel.id) entries = [entry for entry in entries if entry.is_guild] if not channel.permissions_for(ctx.author).read_messages: return await ctx.error("You can't see the list of a watchlist you can't see.") if not entries: return await ctx.error(f"This watchlist has no registered characters.") pages = Pages(ctx, entries=[f"[{r.name}]({Guild.get_url(r.name)})" for r in entries]) pages.embed.title = f"Watched Guilds in #{channel.name}" try: await pages.paginate() except CannotPaginate as e: await ctx.error(e) @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="remove", aliases=["removeplayer", "removechar"]) async def watchlist_remove(self, ctx: NabCtx, channel: discord.TextChannel, *, name): """Removes a character from a watchlist.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, False) if entry is None: return await ctx.error(f"There's no character with that name registered in {channel.mention}.") message = await ctx.send(f"Do you want to remove **{name}** from this watchlist?") confirm = await ctx.react_confirm(message) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return await entry.remove(ctx.pool) await ctx.success("Character removed from the watchlist.") @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="removeguild") async def watchlist_removeguild(self, ctx: NabCtx, channel: discord.TextChannel, *, name): """Removes a guild from the watchlist.""" if not await Watchlist.get_by_channel_id(ctx.pool, channel.id): return await ctx.error(f"{channel.mention} is not a watchlist.") entry = await WatchlistEntry.get_by_name(ctx.pool, channel.id, name, True) if entry is None: return await ctx.error(f"There's no guild with that name registered in {channel.mention}.") message = await ctx.send(f"Do you want to remove **{name}** from this watchlist?") confirm = await ctx.react_confirm(message) if confirm is None: await ctx.send("You took too long!") return if not confirm: await ctx.send("Ok then, guess you changed your mind.") return await entry.remove(ctx.pool) await ctx.success("Guild removed from the watchlist.") @checks.channel_mod_somewhere() @checks.tracking_world_only() @watchlist.command(name="showcount", usage="<channel> <yes|no>") async def watchlist_showcount(self, ctx: NabCtx, channel: discord.TextChannel, yes_no): """Changes whether the online count will be displayed in the watchlist's channel's name or not.""" watchlist = await Watchlist.get_by_channel_id(ctx.pool, channel.id) if not watchlist: return await ctx.error(f"{channel.mention} is not a watchlist.") if yes_no.lower().strip() in ["yes", "true"]: await watchlist.update_show_count(ctx.pool, True) await ctx.success("Showing online count is now enabled. The name will be updated on the next cycle.") elif yes_no.lower().strip() in ["no", "false"]: await watchlist.update_show_count(ctx.pool, False) await ctx.success("Showing online count is now disabled. The name will be updated on the next cycle.") else: await ctx.error("That's not a valid option, try `yes` or `no`.") # endregion # region Methods async def announce_death(self, char: NabChar, death: Death, levels_lost=0): """Announces a level up on the corresponding servers.""" log_msg = f"{self.tag}[{char.world}] announce_death: {char.name} | {death.level} | {death.killer.name}" # Find killer article (a/an) killer_article = "" if not death.by_player: killer_article = death.killer.name.split(" ", 1) if killer_article[0] in ["a", "an"] and len(killer_article) > 1: death.killer.name = killer_article[1] killer_article = killer_article[0] + " " else: killer_article = "" if death.killer.name.lower() in ["death", "energy", "earth", "fire", "pit battler", "pit berserker", "pit blackling", "pit brawler", "pit condemned", "pit demon", "pit destroyer", "pit fiend", "pit groveller", "pit grunt", "pit lord", "pit maimer", "pit overlord", "pit reaver", "pit scourge"] and levels_lost == 0: # Skip element damage deaths unless player lost a level to avoid spam from arena deaths # This will cause a small amount of deaths to not be announced but it's probably worth the tradeoff log.debug(f"{log_msg} | Skipping arena death") return guilds = [s for s, w in self.bot.tracked_worlds.items() if w == char.world] for guild_id in guilds: guild = self.bot.get_guild(guild_id) if guild is None: continue min_level = await get_server_property(self.bot.pool, guild_id, "announce_level", config.announce_threshold) if death.level < min_level: log.debug(f"{log_msg} | Guild skipped {guild_id} | Level under limit") continue if guild.get_member(char.owner_id) is None: log.debug(f"{log_msg} | Guild skipped {guild_id} | Owner not in server") continue simple_messages = await get_server_property(self.bot.pool, guild_id, "simple_messages", False) condition = DeathMessageCondition(char=char, death=death, levels_lost=levels_lost, min_level=min_level) # Select a message if death.by_player: message = weighed_choice(death_messages_player, condition) if not simple_messages else SIMPLE_DEATH else: message = weighed_choice(death_messages_monster, condition) if not simple_messages else SIMPLE_PVP_DEATH # Format message with death information message = message.format(**{'name': char.name, 'level': death.level, 'killer': death.killer.name, 'killer_article': killer_article, 'he_she': char.he_she.lower(), 'his_her': char.his_her.lower(), 'him_her': char.him_her.lower()}) # Format extra stylization message = f"{config.pvpdeath_emoji if death.by_player else config.death_emoji} {format_message(message)}" channel_id = await get_server_property(self.bot.pool, guild.id, "levels_channel") channel = self.bot.get_channel_or_top(guild, channel_id) try: await channel.send(message[:1].upper() + message[1:]) log.debug(f"{log_msg} | Announced in {guild_id}") except discord.Forbidden: log.warning(f"{log_msg} | Forbidden error | Channel {channel.id} | Server {guild.id}") except discord.HTTPException: log.exception(f"{log_msg}") async def announce_level(self, char: NabChar, level: int): """Announces a level up on corresponding servers.""" log_msg = f"{self.tag}[{char.world}] announce_level: : {char.name} | {level}" guilds = [s for s, w in self.bot.tracked_worlds.items() if w == char.world] for guild_id in guilds: guild: discord.Guild = self.bot.get_guild(guild_id) if guild is None: continue min_level = await get_server_property(self.bot.pool, guild_id, "announce_level", config.announce_threshold) if char.level < min_level: log.debug(f"{log_msg} | Guild skipped {guild_id} | Level under limit") continue if guild.get_member(char.owner_id) is None: log.debug(f"{log_msg} | Guild skipped {guild_id} | Owner not in server") continue channel_id = await get_server_property(self.bot.pool, guild.id, "levels_channel") simple_messages = await get_server_property(self.bot.pool, guild_id, "simple_messages", False) channel = self.bot.get_channel_or_top(guild, channel_id) try: # Select a message if not simple_messages: message = weighed_choice(level_messages, LevelCondition(char=char, level=level, min_level=min_level)) else: message = SIMPLE_LEVEL # Format message with level information message = message.format(**{'name': char.name, 'level': level, 'he_she': char.he_she.lower(), 'his_her': char.his_her.lower(), 'him_her': char.him_her.lower()}) # Format extra stylization message = f"{config.levelup_emoji} {format_message(message)}" await channel.send(message) log.debug(f"{log_msg} | Announced in {guild_id}") except discord.Forbidden: log.warning(f"{log_msg} | Forbidden error | Channel {channel.id} | Server {guild.id}") except discord.HTTPException: log.exception(f"{log_msg}") @staticmethod async def cached_get_guild(guild_name: str, world: str) -> Optional[Guild]: """ Used to cache guild info, to avoid fetching the same guild multiple times if they are in multiple lists """ if guild_name in GUILD_CACHE[world]: return GUILD_CACHE[world][guild_name] guild = await get_guild(guild_name) GUILD_CACHE[world][guild_name] = guild return guild @classmethod async def check_char_availability(cls, ctx: NabCtx, user_id: int, char: NabChar, worlds: List[str], check_other=False): """Checks the availability of a character and other visible characters optionally. :param ctx: The command context where this is called. :param user_id: The id of the user against which the characters will be checked for. :param char: The character to be checked. :param worlds: The worlds to filter characters from. :param check_other: Whether other characters in the same account should be processed to or not. :return: A named tuple containing the different categories of characters found. """ skipped = [] # type: List[OtherCharacter] """Characters that were skipped due to being in another world or scheduled for deletion.""" no_user = [] # type: List[DbChar] """Characters that belong to users no longer visible to NabBot, most of the time abandoned temporal users.""" same_owner = [] # type: List[DbChar] """Characters that already belong to the user.""" different_user = [] # type: List[DbChar] """Characters belonging to a different user.""" unregistered = [] # type: List[NabChar] """Characters that have never been registered.""" if check_other and not char.hidden: chars: List[Union[OtherCharacter, NabChar]] = char.other_characters _char = next((x for x in chars if x.name == char.name)) chars[chars.index(_char)] = char else: chars = [char] for char in chars: if char.world not in worlds or char.deleted: skipped.append(char) continue db_char = await DbChar.get_by_name(ctx.pool, char.name) if db_char: owner = ctx.bot.get_user(db_char.user_id) if owner is None: no_user.append(db_char) continue elif db_char.user_id == user_id: same_owner.append(db_char) continue different_user.append(db_char) continue if isinstance(char, OtherCharacter): char = await get_character(ctx.bot, char.name) unregistered.append(char) return CharactersResult._make((skipped, no_user, same_owner, different_user, unregistered, len(skipped) == len(chars))) async def compare_deaths(self, char: NabChar): """Checks if the player has new deaths. New deaths are announced if they are not older than 30 minutes.""" if char is None: return async with self.bot.pool.acquire() as conn: db_char = await DbChar.get_by_name(conn, char.name) if db_char is None: return pending_deaths = [] for death in char.deaths: # Check if we have a death that matches the time exists = await DbDeath.exists(conn, db_char.id, death.level, death.time) if exists: # We already have this death, we're assuming we already have older deaths break pending_deaths.append(death) # Announce and save deaths from older to new for death in reversed(pending_deaths): db_death = DbDeath.from_tibiapy(death) db_death.character_id = db_char.id await db_death.save(conn) log_msg = f"{self.tag}[{char.world}] Death detected: {char.name} | {death.level} |" \ f" {death.killer.name}" if (dt.datetime.now(dt.timezone.utc)- death.time) >= dt.timedelta(minutes=30): log.info(f"{log_msg} | Too old to announce.") # Only try to announce if character has an owner elif char.owner_id: log.info(log_msg) await self.announce_death(char, death, max(death.level - char.level, 0)) async def compare_levels(self, char: Union[NabChar, OnlineCharacter], update_only=False): """Compares the character's level with the stored level in database. This should only be used on online characters or characters that just became offline.""" if char is None: return async with self.bot.pool.acquire() as conn: db_char = await DbChar.get_by_name(conn, char.name) if not db_char: return # OnlineCharacter has no sex attribute, so we get it from database and convert to NabChar if isinstance(char, OnlineCharacter): char = NabChar.from_online(char, db_char.sex, db_char.user_id) level_before = db_char.level if level_before != char.level: await db_char.update_level(conn, char.level) log.debug(f"{self.tag}[{char.world}][compare_level] {char.name}'s level updated:" f" {level_before} -> {char.level}") if not (char.level > level_before > 0) or update_only: return # Saving level up date in database await DbLevelUp.insert(conn, db_char.id, char.level) # Announce the level up log.info(f"{self.tag}[{char.world}] Level up detected: {char.name} | {char.level}") # Only try to announce level if char has an owner. if char.owner_id: await self.announce_level(char, char.level) else: log.debug(f"{self.tag}[{char.world}] Character has no owner, skipping") @classmethod async def process_character_assignment(cls, ctx: NabCtx, results: CharactersResult, user: discord.User, author: discord.User = None, claim=False): """Processes the results of a character check and applies the changes :param ctx: The command context :param results: The character results :param user: The user that will get the characters assigned. :param author: The user that did the action, None if it was the same user. :param claim: Whether the operation is a claim. :return: A summary of the applied actions. """ recipient = f"**@{user.display_name}**" if author else "you" author_log = f"| By {author}" if author else "" reply = "" if results.different_user and not claim: first = results.different_user[0].name reply = f"{ctx.tick(False)} Sorry, a character in that account ({first}) is already registered to " \ f"someone else.\n" \ f"If the character really belongs to {recipient}, `{ctx.clean_prefix}claim {first}` should be used." return reply if results.same_owner: existent_names = [e.name for e in results.same_owner] reply += f"\n⚫ The following characters were already registered to {recipient}: {join_list(existent_names)}" if results.new: added_names = [a.name for a in results.new] reply += f"\n🔵 The following characters were added to {recipient}: {join_list(added_names)}" if results.no_user: updated_names = [r.name for r in results.no_user] reply += f"\n⚪ The following characters were reassigned to {recipient}: {join_list(updated_names)}" if results.different_user: reclaimed_chars = [c.name for c in results.different_user] reply += f"\n🔴 The following characters were reclaimed by you: {join_list(reclaimed_chars)}" async with ctx.pool.acquire() as conn: for char in results.different_user: await char.update_user(conn, user.id) log.info(f"{cls.get_tag()} Character Claimed | {char.name} | {user} ({user.id}){author_log}") for char in results.no_user: await char.update_user(conn, user.id) log.info(f"{cls.get_tag()} Character Reassigned | {char.name} | {user} ({user.id}){author_log}") for char in results.new: db_char = await DbChar.insert(conn, char.name, char.level, char.vocation.value, user.id, char.world, char.guild_name) char.id = db_char.id log.info(f"{cls.get_tag()} Character Registered | {char.name} | {user} ({user.id}){author_log}") # If we are claiming, different user characters are also passed if claim: results.no_user.extend(results.different_user) ctx.bot.dispatch("characters_registered", user, results.new, results.no_user, author) ctx.bot.dispatch("character_change", user.id) return reply async def save_highscores(self, world: str, key: str, highscores: tibiapy.Highscores) -> int: """Saves the highscores of a world and category to the database.""" if highscores is None: return 0 rows = [(e.rank, key, world, e.name, e.vocation.value, e.value) for e in highscores.entries] async with self.bot.pool.acquire() as conn: # type: asyncpg.Connection async with conn.transaction(): # Delete old records await conn.execute("DELETE FROM highscores_entry WHERE category = $1 AND world = $2", key, world) # Add current entries await conn.copy_records_to_table("highscores_entry", records=rows, columns=["rank", "category", "world", "name", "vocation", "value"]) log.debug(f"{self.tag}[{world}][save_highscores] {key} | {len(rows)} entries saved") # Update scan times await conn.execute("""INSERT INTO highscores(world, category, last_scan) VALUES($1, $2, $3) ON CONFLICT (world,category) DO UPDATE SET last_scan = EXCLUDED.last_scan""", world, key, dt.datetime.now(dt.timezone.utc)) return len(rows) # endregion def cog_unload(self): log.info(f"{self.tag} Unloading cog") self.scan_highscores_task.cancel() self.scan_online_chars_task.cancel() for k, v in self.world_tasks.items(): v.cancel() def setup(bot): bot.add_cog(Tracking(bot))
apache-2.0
2,001,326,355,620,940,500
47.838201
120
0.590449
false
4.062533
false
false
false
Fiona/AreWeAlone
__main__.py
1
4157
########## # LD 22 # The theme is alone # it's a dumb theme # fiona wrote this ########## # System and Python lib imports import sys sys.path += ['.'] # Game engine imports from myrmidon.myrmidon import MyrmidonGame, MyrmidonProcess from myrmidon.consts import * from pygame.locals import * # Game imports from consts import * from media import Media from gui import GUI from galaxy import Galaxy from game_galaxy import Galaxy_background, Solar_system_star, Player_ship, Galaxy_player_ship class Game(MyrmidonProcess): # Current state game_state = 0 # Player state money = 2000000000 fuel = 0 crew = 0 current_system = "Sol" current_object = "Earth" fuel_cost = 1000000000 crew_cost = 500000000 actions_done = {} home_planet_result = [] first_time = True # Self explanitory object pointers and lists fps_text = None gui = None media = None solar_system_objects = [] player_ship = None background = None galaxy = None def execute(self): # Pre launch set-up MyrmidonGame.current_fps = 60 self.priority = PRIORITY_MAIN_GAME # Load all media self.media = Media() self.media.load_fonts() self.media.load_graphics() self.media.load_audio() # Debug display if DEBUG_SHOW_FPS: self.fps_text = MyrmidonGame.write_text(0.0, 0.0, font = self.media.fonts['basic'], text = 0) self.fps_text.colour = (1, 1, 1, 1) self.fps_text.z = -2000 # Set up starting game objects self.galaxy = Galaxy(self) self.gui = GUI(self) self.switch_game_state_to(GAME_STATE_SOLAR_SYSTEM) self.media.audio['ambient'].play(loops = -1) while True: # update debug display if DEBUG_SHOW_FPS: self.fps_text.text = "fps: " + str(MyrmidonGame.fps) yield def quit_game(self): sys.exit() def switch_game_state_to(self, state, gui_state = None): """ Pass in a state and this will switch to it. It will also clean up everying necessary to go out of the previous game state. """ # Undo and destroy everything in the current state self.gui.destroy_current_gui_state() col = (1.0, 1.0, 1.0) if self.game_state == GAME_STATE_SOLAR_SYSTEM: for x in self.solar_system_objects: x.signal(S_KILL) self.solar_system_objects = [] self.player_ship.signal(S_KILL) self.background.signal(S_KILL) elif self.game_state == GAME_STATE_GALAXY: self.player_ship.signal(S_KILL) self.background.signal(S_KILL) # Switch to new state self.game_state = state # Create everything we require if state == GAME_STATE_GALAXY: self.background = Galaxy_background(self) self.gui.fade_toggle() self.gui.switch_gui_state_to(GUI_STATE_GALAXY if gui_state is None else gui_state) self.player_ship = Galaxy_player_ship(self) elif state == GAME_STATE_SOLAR_SYSTEM: self.background = Galaxy_background(self) self.solar_system_objects = [] self.solar_system_objects.append(Solar_system_star(self, self.galaxy.solar_systems[self.current_system])) self.gui.fade_toggle() self.gui.switch_gui_state_to(GUI_STATE_SOLAR_SYSTEM if gui_state is None else gui_state) self.player_ship = Player_ship(self) def do_home_planet_results(self): if len(self.home_planet_result) > 0: result = self.home_planet_result.pop() result[0](self, *result[1]) if __name__ == '__main__': MyrmidonGame.screen_resolution = (1024, 768) MyrmidonGame.lowest_resolution = (1024, 768) MyrmidonGame.full_screen = False Game()
mit
1,547,291,332,813,934,600
27.06993
117
0.570604
false
3.624237
false
false
false
BatedUrGonnaDie/salty_bot
modules/helpers/yt_video_link.py
1
1246
#! /usr/bin/env python3.7 import re import isodate import modules.extensions.regexes as regexes import modules.commands.helpers.time_formatter as time_formatter ON_ACTION = "PRIVMSG" def call(salty_inst, c_msg, balancer, **kwargs): video_ids = re.findall(regexes.YOUTUBE_URL, c_msg["message"]) if not video_ids: return False, "No video ids" seen_ids = set() seen_add = seen_ids.add video_ids = [x for x in video_ids if not (x in seen_ids or seen_add(x))] parts = ["snippet", "statistics", "contentDetails"] final_list = [] success, response = salty_inst.youtube_api.get_videos(video_ids, parts, **kwargs) if not success: return False, \ "Error retrieving info from youtube API ({0})".format(response.status_code) if len(response["items"]) == 0: return False, "No valid ID's found." for i in response["items"]: final_list.append("[{0}] {1} uploaded by {2}. Views: {3}".format( time_formatter.format_time(isodate.parse_duration(i["contentDetails"]["duration"]).seconds), i["snippet"]["title"], i["snippet"]["channelTitle"], i["statistics"]["viewCount"] )) return True, " | ".join(final_list)
mit
-6,777,776,183,059,641,000
32.675676
104
0.623596
false
3.509859
false
false
false
google/tf_mesh_renderer
mesh_renderer/rasterize_triangles_test.py
1
7681
# Copyright 2017 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import absolute_import from __future__ import division from __future__ import print_function import os import numpy as np import tensorflow as tf import test_utils import camera_utils import rasterize_triangles class RenderTest(tf.test.TestCase): def setUp(self): self.test_data_directory = 'mesh_renderer/test_data/' tf.reset_default_graph() self.cube_vertex_positions = tf.constant( [[-1, -1, 1], [-1, -1, -1], [-1, 1, -1], [-1, 1, 1], [1, -1, 1], [1, -1, -1], [1, 1, -1], [1, 1, 1]], dtype=tf.float32) self.cube_triangles = tf.constant( [[0, 1, 2], [2, 3, 0], [3, 2, 6], [6, 7, 3], [7, 6, 5], [5, 4, 7], [4, 5, 1], [1, 0, 4], [5, 6, 2], [2, 1, 5], [7, 4, 0], [0, 3, 7]], dtype=tf.int32) self.tf_float = lambda x: tf.constant(x, dtype=tf.float32) self.image_width = 640 self.image_height = 480 self.perspective = camera_utils.perspective( self.image_width / self.image_height, self.tf_float([40.0]), self.tf_float([0.01]), self.tf_float([10.0])) def runTriangleTest(self, w_vector, target_image_name): """Directly renders a rasterized triangle's barycentric coordinates. Tests only the kernel (rasterize_triangles_module). Args: w_vector: 3 element vector of w components to scale triangle vertices. target_image_name: image file name to compare result against. """ clip_init = np.array( [[-0.5, -0.5, 0.8, 1.0], [0.0, 0.5, 0.3, 1.0], [0.5, -0.5, 0.3, 1.0]], dtype=np.float32) clip_init = clip_init * np.reshape( np.array(w_vector, dtype=np.float32), [3, 1]) clip_coordinates = tf.constant(clip_init) triangles = tf.constant([[0, 1, 2]], dtype=tf.int32) rendered_coordinates, _, _ = ( rasterize_triangles.rasterize_triangles_module.rasterize_triangles( clip_coordinates, triangles, self.image_width, self.image_height)) rendered_coordinates = tf.concat( [rendered_coordinates, tf.ones([self.image_height, self.image_width, 1])], axis=2) with self.test_session() as sess: image = rendered_coordinates.eval() baseline_image_path = os.path.join(self.test_data_directory, target_image_name) test_utils.expect_image_file_and_render_are_near( self, sess, baseline_image_path, image) def testRendersSimpleTriangle(self): self.runTriangleTest((1.0, 1.0, 1.0), 'Simple_Triangle.png') def testRendersPerspectiveCorrectTriangle(self): self.runTriangleTest((0.2, 0.5, 2.0), 'Perspective_Corrected_Triangle.png') def testRendersTwoCubesInBatch(self): """Renders a simple cube in two viewpoints to test the python wrapper.""" vertex_rgb = (self.cube_vertex_positions * 0.5 + 0.5) vertex_rgba = tf.concat([vertex_rgb, tf.ones([8, 1])], axis=1) center = self.tf_float([[0.0, 0.0, 0.0]]) world_up = self.tf_float([[0.0, 1.0, 0.0]]) look_at_1 = camera_utils.look_at(self.tf_float([[2.0, 3.0, 6.0]]), center, world_up) look_at_2 = camera_utils.look_at(self.tf_float([[-3.0, 1.0, 6.0]]), center, world_up) projection_1 = tf.matmul(self.perspective, look_at_1) projection_2 = tf.matmul(self.perspective, look_at_2) projection = tf.concat([projection_1, projection_2], axis=0) background_value = [0.0, 0.0, 0.0, 0.0] rendered = rasterize_triangles.rasterize( tf.stack([self.cube_vertex_positions, self.cube_vertex_positions]), tf.stack([vertex_rgba, vertex_rgba]), self.cube_triangles, projection, self.image_width, self.image_height, background_value) with self.test_session() as sess: images = sess.run(rendered, feed_dict={}) for i in (0, 1): image = images[i, :, :, :] baseline_image_name = 'Unlit_Cube_{}.png'.format(i) baseline_image_path = os.path.join(self.test_data_directory, baseline_image_name) test_utils.expect_image_file_and_render_are_near( self, sess, baseline_image_path, image) def testSimpleTriangleGradientComputation(self): """Verifies the Jacobian matrix for a single pixel. The pixel is in the center of a triangle facing the camera. This makes it easy to check which entries of the Jacobian might not make sense without worrying about corner cases. """ test_pixel_x = 325 test_pixel_y = 245 clip_coordinates = tf.placeholder(tf.float32, shape=[3, 4]) triangles = tf.constant([[0, 1, 2]], dtype=tf.int32) barycentric_coordinates, _, _ = ( rasterize_triangles.rasterize_triangles_module.rasterize_triangles( clip_coordinates, triangles, self.image_width, self.image_height)) pixels_to_compare = barycentric_coordinates[ test_pixel_y:test_pixel_y + 1, test_pixel_x:test_pixel_x + 1, :] with self.test_session(): ndc_init = np.array( [[-0.5, -0.5, 0.8, 1.0], [0.0, 0.5, 0.3, 1.0], [0.5, -0.5, 0.3, 1.0]], dtype=np.float32) theoretical, numerical = tf.test.compute_gradient( clip_coordinates, (3, 4), pixels_to_compare, (1, 1, 3), x_init_value=ndc_init, delta=4e-2) jacobians_match, message = ( test_utils.check_jacobians_are_nearly_equal( theoretical, numerical, 0.01, 0.0, True)) self.assertTrue(jacobians_match, message) def testInternalRenderGradientComputation(self): """Isolates and verifies the Jacobian matrix for the custom kernel.""" image_height = 21 image_width = 28 clip_coordinates = tf.placeholder(tf.float32, shape=[8, 4]) barycentric_coordinates, _, _ = ( rasterize_triangles.rasterize_triangles_module.rasterize_triangles( clip_coordinates, self.cube_triangles, image_width, image_height)) with self.test_session(): # Precomputed transformation of the simple cube to normalized device # coordinates, in order to isolate the rasterization gradient. # pyformat: disable ndc_init = np.array( [[-0.43889722, -0.53184521, 0.85293502, 1.0], [-0.37635487, 0.22206162, 0.90555805, 1.0], [-0.22849123, 0.76811147, 0.80993629, 1.0], [-0.2805393, -0.14092168, 0.71602166, 1.0], [0.18631913, -0.62634289, 0.88603103, 1.0], [0.16183566, 0.08129397, 0.93020856, 1.0], [0.44147962, 0.53497446, 0.85076219, 1.0], [0.53008741, -0.31276882, 0.77620775, 1.0]], dtype=np.float32) # pyformat: enable theoretical, numerical = tf.test.compute_gradient( clip_coordinates, (8, 4), barycentric_coordinates, (image_height, image_width, 3), x_init_value=ndc_init, delta=4e-2) jacobians_match, message = ( test_utils.check_jacobians_are_nearly_equal( theoretical, numerical, 0.01, 0.01)) self.assertTrue(jacobians_match, message) if __name__ == '__main__': tf.test.main()
apache-2.0
-5,375,903,968,414,628,000
38.188776
80
0.622836
false
3.151826
true
false
false
crask/redisproxy
test/memcache/memcache.py
1
15420
# Copyright 2012 Mixpanel, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ''' a minimal, pure python client for memcached, kestrel, etc. Usage example:: import memcache mc = memcache.Client("127.0.0.1", 11211, timeout=1, connect_timeout=5) mc.set("some_key", "Some value") value = mc.get("some_key") mc.delete("another_key") ''' import errno import re import socket class ClientException(Exception): ''' Raised when the server does something we don't expect | This does not include `socket errors <http://docs.python.org/library/socket.html#socket.error>`_ | Note that ``ValidationException`` subclasses this so, technically, this is raised on any error ''' def __init__(self, msg, item=None): if item is not None: msg = '%s: %r' % (msg, item) # use repr() to better see special chars super(ClientException, self).__init__(msg) class ValidationException(ClientException): ''' Raised when an invalid parameter is passed to a ``Client`` function ''' def __init__(self, msg, item): super(ValidationException, self).__init__(msg, item) class Client(object): def __init__(self, host, port, timeout=None, connect_timeout=None): ''' If ``connect_timeout`` is None, ``timeout`` will be used instead (for connect and everything else) ''' self._addr = (host, port) self._timeout = timeout self._connect_timeout = connect_timeout self._socket = None def __del__(self): self.close() def _get_addr(self): return self._addr address = property(_get_addr) ''' A read-only (str, int) tuple representing the host operations are performed on ''' def _get_timeout(self): return self._timeout def _set_timeout(self, timeout): # presumably this should fail rarely # set locally before on socket # b/c if socket fails, it will probably be closed/reopened # and will want to use last intended value self._timeout = timeout if self._socket: self._socket.settimeout(timeout) timeout = property(_get_timeout, _set_timeout) ''' A float representing the timeout in seconds for reads and sends on the underlying socket (``connect_timeout`` cannot be changed once init) Setting a timeout can raise a ``TypeError`` (non-float) or a ``ValueError`` (negative) ''' def _connect(self): # buffer needed since we always ask for 4096 bytes at a time # thus, might read more than the current expected response # cleared on every reconnect since old bytes are part of old session and can't be reused self._buffer = '' self._socket = socket.socket(socket.AF_INET, socket.SOCK_STREAM) connect_timeout = self._connect_timeout if self._connect_timeout is not None else self._timeout self._socket.settimeout(connect_timeout) # passing None means blocking try: self._socket.connect(self._addr) self._socket.settimeout(self._timeout) except (socket.error, socket.timeout): self._socket = None # don't want to hang on to bad socket raise def _read(self, length=None): ''' Return the next length bytes from server Or, when length is None, Read a response delimited by \r\n and return it (including \r\n) (Use latter only when \r\n is unambiguous -- aka for control responses, not data) ''' result = None while result is None: if length: # length = 0 is ambiguous, so don't use if len(self._buffer) >= length: result = self._buffer[:length] self._buffer = self._buffer[length:] else: delim_index = self._buffer.find('\r\n') if delim_index != -1: result = self._buffer[:delim_index+2] self._buffer = self._buffer[delim_index+2:] if result is None: try: tmp = self._socket.recv(4096) except (socket.error, socket.timeout) as e: self.close() raise e if not tmp: # we handle common close/retry cases in _send_command # however, this can happen if server suddenly goes away # (e.g. restarting memcache under sufficient load) raise socket.error, 'unexpected socket close on recv' else: self._buffer += tmp return result def _send_command(self, command): ''' Send command to server and return initial response line Will reopen socket if it got closed (either locally or by server) ''' if self._socket: # try to find out if the socket is still open try: self._socket.settimeout(0) self._socket.recv(0) # if recv didn't raise, then the socket was closed or there is junk # in the read buffer, either way, close self.close() except socket.error as e: if e.errno == errno.EAGAIN: # this is expected if the socket is still open self._socket.settimeout(self._timeout) else: self.close() if not self._socket: self._connect() self._socket.sendall(command) return self._read() # key supports ascii sans space and control chars # \x21 is !, right after space, and \x7e is -, right before DEL # also 1 <= len <= 250 as per the spec _valid_key_re = re.compile('^[\x21-\x7e]{1,250}$') def _validate_key(self, key): if not isinstance(key, str): # avoid bugs subtle and otherwise raise ValidationException('key must be str', key) m = self._valid_key_re.match(key) if m: # in python re, $ matches either end of line or right before # \n at end of line. We can't allow latter case, so # making sure length matches is simplest way to detect if len(m.group(0)) != len(key): raise ValidationException('trailing newline', key) else: raise ValidationException('invalid key', key) return key def close(self): ''' Closes the socket if its open | Sockets are automatically closed when the ``Client`` object is garbage collected | Sockets are opened the first time a command is run (such as ``get`` or ``set``) | Raises socket errors ''' if self._socket: self._socket.close() self._socket = None def delete(self, key): ''' Deletes a key/value pair from the server Raises ``ClientException`` and socket errors ''' # req - delete <key> [noreply]\r\n # resp - DELETED\r\n # or # NOT_FOUND\r\n key = self._validate_key(key) command = 'delete %s\r\n' % key resp = self._send_command(command) if resp != 'DELETED\r\n' and resp != 'NOT_FOUND\r\n': raise ClientException('delete failed', resp) def get(self, key): ''' Gets a single value from the server; returns None if there is no value Raises ``ValidationException``, ``ClientException``, and socket errors ''' return self.multi_get([key])[0] def multi_get(self, keys): ''' Takes a list of keys and returns a list of values Raises ``ValidationException``, ``ClientException``, and socket errors ''' if len(keys) == 0: return [] # req - get <key> [<key> ...]\r\n # resp - VALUE <key> <flags> <bytes> [<cas unique>]\r\n # <data block>\r\n (if exists) # [...] # END\r\n keys = [self._validate_key(key) for key in keys] if len(set(keys)) != len(keys): raise ClientException('duplicate keys passed to multi_get') command = 'get %s\r\n' % ' '.join(keys) received = {} resp = self._send_command(command) error = None while resp != 'END\r\n': terms = resp.split() if len(terms) == 4 and terms[0] == 'VALUE': # exists key = terms[1] flags = int(terms[2]) length = int(terms[3]) if flags != 0: error = ClientException('received non zero flags') val = self._read(length+2)[:-2] if key in received: error = ClientException('duplicate results from server') received[key] = val else: raise ClientException('get failed', resp) resp = self._read() if error is not None: # this can happen if a memcached instance contains items set by a previous client # leads to subtle bugs, so fail fast raise error if len(received) > len(keys): raise ClientException('received too many responses') # memcache client is used by other servers besides memcached. # In the case of kestrel, responses coming back to not necessarily # match the requests going out. Thus we just ignore the key name # if there is only one key and return what we received. if len(keys) == 1 and len(received) == 1: response = received.values() else: response = [received.get(key) for key in keys] return response def getex(self, key): ''' Gets a single value from the server; returns None if there is no value Raises ``ValidationException``, ``ClientException``, and socket errors ''' return self.multi_getex([key])[0] def multi_getex(self, keys): ''' Takes a list of keys and returns a list of values Raises ``ValidationException``, ``ClientException``, and socket errors ''' if len(keys) == 0: return [] # req - getex <key> [<key> ...]\r\n # resp - VALUE <key> <flags> <bytes> <cas unique> <expire time>\r\n # <data block>\r\n (if exists) # [...] # END\r\n keys = [self._validate_key(key) for key in keys] if len(set(keys)) != len(keys): raise ClientException('duplicate keys passed to multi_get') command = 'getex %s\r\n' % ' '.join(keys) received = {} resp = self._send_command(command) error = None while resp != 'END\r\n': terms = resp.split() if len(terms) == 6 and terms[0] == 'VALUE': # exists key = terms[1] flags = int(terms[2]) length = int(terms[3]) if flags != 0: error = ClientException('received non zero flags') val = self._read(length+2)[:-2] if key in received: error = ClientException('duplicate results from server') received[key] = val else: raise ClientException('get failed', resp) resp = self._read() if error is not None: # this can happen if a memcached instance contains items set by a previous client # leads to subtle bugs, so fail fast raise error if len(received) > len(keys): raise ClientException('received too many responses') # memcache client is used by other servers besides memcached. # In the case of kestrel, responses coming back to not necessarily # match the requests going out. Thus we just ignore the key name # if there is only one key and return what we received. if len(keys) == 1 and len(received) == 1: response = received.values() else: response = [received.get(key) for key in keys] return response def set(self, key, val, exptime=0): ''' Sets a key to a value on the server with an optional exptime (0 means don't auto-expire) Raises ``ValidationException``, ``ClientException``, and socket errors ''' # req - set <key> <flags> <exptime> <bytes> [noreply]\r\n # <data block>\r\n # resp - STORED\r\n (or others) key = self._validate_key(key) # the problem with supporting types is it oftens leads to uneven and confused usage # some code sites use the type support, others do manual casting to/from str # worse yet, some sites don't even know what value they are putting in and mis-cast on get # by uniformly requiring str, the end-use code is much more uniform and legible if not isinstance(val, str): raise ValidationException('value must be str', val) # typically, if val is > 1024**2 bytes server returns: # SERVER_ERROR object too large for cache\r\n # however custom-compiled memcached can have different limit # so, we'll let the server decide what's too much if not isinstance(exptime, int): raise ValidationException('exptime not int', exptime) elif exptime < 0: raise ValidationException('exptime negative', exptime) command = 'set %s 0 %d %d\r\n%s\r\n' % (key, exptime, len(val), val) resp = self._send_command(command) if resp != 'STORED\r\n': raise ClientException('set failed', resp) def stats(self, additional_args=None): ''' Runs a stats command on the server. ``additional_args`` are passed verbatim to the server. See `the memcached wiki <http://code.google.com/p/memcached/wiki/NewCommands#Statistics>`_ for details or `the spec <https://github.com/memcached/memcached/blob/master/doc/protocol.txt>`_ for even more details Raises ``ClientException`` and socket errors ''' # req - stats [additional args]\r\n # resp - STAT <name> <value>\r\n (one per result) # END\r\n if additional_args is not None: command = 'stats %s\r\n' % additional_args else: command = 'stats\r\n' resp = self._send_command(command) result = {} while resp != 'END\r\n': terms = resp.split() if len(terms) == 2 and terms[0] == 'STAT': result[terms[1]] = None elif len(terms) == 3 and terms[0] == 'STAT': result[terms[1]] = terms[2] else: raise ClientException('stats failed', resp) resp = self._read() return result
apache-2.0
-2,465,647,685,932,409,000
37.074074
114
0.569455
false
4.273836
false
false
false
sterlingbaldwin/acme_workbench
workbench-backend/index/tests.py
1
3781
import json from django.test import TestCase from django.test import Client class IndexViewTests(TestCase): fixtures = ['seed.json'] """ Tests for the Index app views """ def test_get_index(self): """ Test that the index page returns success """ client = Client() response = client.get('/') self.assertEqual(response.status_code, 200) def test_get_workbench_no_login(self): """ Test that the workbench redirects when not logged in """ client = Client() response = client.get('/workbench') self.assertEqual(response.status_code, 302) def test_get_workbench_with_login(self): """ Test that the workbench renders when logged in """ client = Client() self.assertTrue( client.login( username='test_user', password='qwertyuiop')) res = client.get('/workbench') self.assertEqual(res.status_code, 200) def test_valid_user_registration(self): """ test ability to register new users """ client = Client() res = client.get('/register') self.assertEqual(res.status_code, 200) post_data = { 'username': 'test_user1', 'password1': 'test_pass', 'password2': 'test_pass', 'firstname': 'test', 'lastname': 'test', 'email': '[email protected]' } res = client.post('/register', post_data) self.assertEqual(res.status_code, 200) def test_invalid_user_registration(self): """ test ability to register new users """ client = Client() res = client.get('/register') self.assertEqual(res.status_code, 200) post_data = { 'username': 'test_user1', 'password1': 'test_pass', 'password2': 'THIS IS NOT VALID', 'firstname': 'test', 'lastname': 'test', 'email': '[email protected]' } res = client.post('/register', post_data) self.assertNotEqual(res.status_code, 200) def test_valid_user_login(self): """ test users ability to login with valid credentials """ client = Client() post_data = { 'password': 'qwertyuiop', 'username': 'test_user' } res = client.post('/login', post_data) self.assertEqual(res.status_code, 200) def test_invalid_user_login(self): """ Test rejection of invalid credentials """ client = Client() post_data = { 'username': 'test_user', 'password': 'IM A LITTLE TEA POT' } res = client.post('/login', post_data) self.assertEqual(res.status_code, 401) def test_valid_user_logout(self): """ test users ability to logout """ client = Client() post_data = { 'password': 'qwertyuiop', 'username': 'test_user' } res = client.post('/login', post_data) self.assertEqual(res.status_code, 200) res = client.get('/logout') self.assertEqual(res.status_code, 200) self.assertFalse(res.context['request'].user.is_authenticated()) def test_get_user_list(self): """ test of the get user list view """ client = Client() url = '/get_user_list/' expected_result = ['test_user', 'baldwin32'] res = client.get(url) self.assertEqual(res.status_code, 200) data = json.loads(res.content) for user in data: self.assertTrue(user in expected_result)
bsd-2-clause
3,293,972,023,252,596,000
28.310078
72
0.530283
false
4.164097
true
false
false
lixiangning888/whole_project
lib/cuckoo/common/demux.py
1
7192
# Copyright (C) 2015 Accuvant, Inc. ([email protected]) # This file is part of Cuckoo Sandbox - http://www.cuckoosandbox.org # See the file 'docs/LICENSE' for copying permission. import os import tempfile from zipfile import ZipFile try: from rarfile import RarFile HAS_RARFILE = True except ImportError: HAS_RARFILE = False from lib.cuckoo.common.config import Config from lib.cuckoo.common.objects import File from lib.cuckoo.common.email_utils import find_attachments_in_email from lib.cuckoo.common.office.msgextract import Message def demux_zip(filename, options): retlist = [] try: # don't try to extract from office docs magic = File(filename).get_type() if "Microsoft" in magic or "Java Jar" in magic: return retlist extracted = [] password="infected" fields = options.split(",") for field in fields: try: key, value = field.split("=", 1) if key == "password": password = value break except: pass with ZipFile(filename, "r") as archive: infolist = archive.infolist() for info in infolist: # avoid obvious bombs if info.file_size > 100 * 1024 * 1024 or not info.file_size: continue # ignore directories if info.filename.endswith("/"): continue base, ext = os.path.splitext(info.filename) basename = os.path.basename(info.filename) ext = ext.lower() if ext == "" and len(basename) and basename[0] == ".": continue extensions = ["", ".exe", ".dll", ".pdf", ".doc", ".ppt", ".pptx", ".docx", ".xls", ".msi", ".bin", ".scr"] for theext in extensions: if ext == theext: extracted.append(info.filename) break options = Config() tmp_path = options.cuckoo.get("tmppath", "/tmp") target_path = os.path.join(tmp_path, "cuckoo-zip-tmp") if not os.path.exists(target_path): os.mkdir(target_path) tmp_dir = tempfile.mkdtemp(prefix='cuckoozip_',dir=target_path) for extfile in extracted: try: retlist.append(archive.extract(extfile, path=tmp_dir, pwd=password)) except: retlist.append(archive.extract(extfile, path=tmp_dir)) except: pass return retlist def demux_rar(filename, options): retlist = [] if not HAS_RARFILE: return retlist try: # don't try to auto-extract RAR SFXes magic = File(filename).get_type() if "PE32" in magic or "MS-DOS executable" in magic: return retlist extracted = [] password="infected" fields = options.split(",") for field in fields: try: key, value = field.split("=", 1) if key == "password": password = value break except: pass with RarFile(filename, "r") as archive: infolist = archive.infolist() for info in infolist: # avoid obvious bombs if info.file_size > 100 * 1024 * 1024 or not info.file_size: continue # ignore directories if info.filename.endswith("\\"): continue # add some more sanity checking since RarFile invokes an external handler if "..\\" in info.filename: continue base, ext = os.path.splitext(info.filename) basename = os.path.basename(info.filename) ext = ext.lower() if ext == "" and len(basename) and basename[0] == ".": continue extensions = ["", ".exe", ".dll", ".pdf", ".doc", ".ppt", ".pptx", ".docx", ".xls", ".msi", ".bin", ".scr"] for theext in extensions: if ext == theext: extracted.append(info.filename) break options = Config() tmp_path = options.cuckoo.get("tmppath", "/tmp") target_path = os.path.join(tmp_path, "cuckoo-rar-tmp") if not os.path.exists(target_path): os.mkdir(target_path) tmp_dir = tempfile.mkdtemp(prefix='cuckoorar_',dir=target_path) for extfile in extracted: # RarFile differs from ZipFile in that extract() doesn't return the path of the extracted file # so we have to make it up ourselves try: archive.extract(extfile, path=tmp_dir, pwd=password) retlist.append(os.path.join(tmp_dir, extfile.replace("\\", "/"))) except: archive.extract(extfile, path=tmp_dir) retlist.append(os.path.join(tmp_dir, extfile.replace("\\", "/"))) except: pass return retlist def demux_email(filename, options): retlist = [] try: with open(filename, "rb") as openfile: buf = openfile.read() atts = find_attachments_in_email(buf, True) if atts and len(atts): for att in atts: retlist.append(att[0]) except: pass return retlist def demux_msg(filename, options): retlist = [] try: retlist = Message(filename).get_extracted_attachments() except: pass return retlist def demux_sample(filename, package, options): """ If file is a ZIP, extract its included files and return their file paths If file is an email, extracts its attachments and return their file paths (later we'll also extract URLs) """ # if a package was specified, then don't do anything special # this will allow for the ZIP package to be used to analyze binaries with included DLL dependencies if package: return [ filename ] retlist = demux_zip(filename, options) if not retlist: retlist = demux_rar(filename, options) if not retlist: retlist = demux_email(filename, options) if not retlist: retlist = demux_msg(filename, options) # handle ZIPs/RARs inside extracted files if retlist: newretlist = [] for item in retlist: zipext = demux_zip(item, options) if zipext: newretlist.extend(zipext) else: rarext = demux_rar(item, options) if rarext: newretlist.extend(rarext) else: newretlist.append(item) retlist = newretlist # if it wasn't a ZIP or an email or we weren't able to obtain anything interesting from either, then just submit the # original file if not retlist: retlist.append(filename) return retlist
lgpl-3.0
-6,092,322,796,231,694,000
33.411483
123
0.535595
false
4.238067
false
false
false
jeromecc/doctoctocbot
src/customer/forms.py
1
3367
from django import forms from django.utils.translation import ugettext_lazy as _ from django_countries.fields import CountryField from crispy_forms.helper import FormHelper from crispy_forms.layout import Submit from customer.models import Customer from bootstrap_modal_forms.forms import BSModalForm, BSModalModelForm class CustomerReadOnlyForm(forms.Form): def __init__(self, *args, **kwargs): self.user = kwargs.pop('user', None) super(CustomerReadOnlyForm, self).__init__(*args, **kwargs) try: customer = Customer.objects.get(user=self.user) except Customer.DoesNotExist: return self.helper = FormHelper() self.helper.form_id = 'customer-form' self.helper.form_class = 'form-horizontal' self.helper.form_method = 'post' self.helper.form_action = '/customer/' self.helper.form_group_wrapper_class = 'row' self.helper.label_class = 'offset-md-1 col-md-1' self.helper.field_class = 'col-md-8' self.fields['country'].label = _('Country') self.helper.add_input(Submit('submit', 'Submit', css_class='btn-primary')) self.fields['id'].initial=customer.id self.fields['first_name'].initial=customer.first_name self.fields['last_name'].initial=customer.last_name self.fields['company'].initial=customer.company self.fields['address_1'].initial=customer.address_1 self.fields['address_2'].initial=customer.address_2 self.fields['country'].initial=customer.country self.fields['email'].initial=customer.email self.fields['city'].initial=customer.city #self.fields['state'].initial=customer.state self.fields['zip_code'].initial=customer.zip_code id = forms.CharField( disabled=True, widget=forms.HiddenInput(), ) first_name = forms.CharField( label=_('First name'), max_length=128, disabled=True, ) last_name = forms.CharField( label=_('Last name'), max_length=128, disabled=True, ) company = forms.CharField( label=_('Company'), max_length=128, disabled=True, ) address_1 = forms.CharField( label=_('Address'), max_length=128, disabled=True, ) address_2 = forms.CharField( label=_('Address'), max_length=128, required=False, disabled=True, ) country = CountryField( blank_label=_('(select country)') ).formfield(disabled=True,) phone = forms.CharField( label=_('Telephone'), max_length=32, required=False, disabled=True, ) email = forms.CharField( label=_('Email'), max_length=254, disabled=True, ) city = forms.CharField( label=_('City'), max_length=128, disabled=True, ) """ state = forms.CharField( label=_('State'), max_length=128, required=False, disabled=True, ) """ zip_code = forms.CharField( label=_('ZIP code'), max_length=32, disabled=True, ) class CustomerModelForm(BSModalModelForm): class Meta: model = Customer exclude = [ 'silver_id', 'user', 'state', ]
mpl-2.0
2,314,816,419,920,023,000
28.535088
82
0.591922
false
4.008333
false
false
false
rain87/pc-health
create_graph.py
1
6855
#!/usr/bin/python # coding=utf8 import rrd_config as C import os import subprocess from collections import namedtuple import gzip import sys import itertools from smart_attributes import names as smart_names DataSource = namedtuple('DataSource', 'db_fname field legend is_area color stack') DataSource.__new__.__defaults__ = (False, None, False) Graph = namedtuple('Graph', 'fname title vlabel ds') graph_colors = [ '#396AB1', '#DA7C30', '#3E9651', '#CC2529', '#535154', '#6B4C9A', '#922428', '#948B3D', '#00adb5', '#f08a5d' ] def hdd_ds(field): return [ DataSource('hdd_' + d + '.rrd', field, d, False) for d in C.drives ] def traffic_ds(units, direction): color = itertools.cycle(graph_colors[:3]) field = '_{units}_{direction}'.format(units=units, direction=direction) return [ DataSource(db_fname='traffic_{dev}.rrd'.format(dev=dev), field=proto + field, legend='{}-{}'.format(dev, proto.upper()), is_area=True, color=color.next()) for dev, proto in itertools.product(C.network_devices[:-1], ['tcp', 'udp', 'all']) ] + [ DataSource('traffic_eth0.rrd', 'tcp' + field, '', False, ''), DataSource('traffic_eth0.rrd', 'udp' + field, '', False, '', True), DataSource('traffic_eth0.rrd', 'all' + field, 'eth0', False, '#000000', True) ] def connections_ds(direction): color = itertools.cycle(graph_colors[:2]) return [ DataSource(db_fname='traffic_{dev}.rrd'.format(dev=dev), field='{proto}_new_{direction}'.format(proto=proto, direction=direction), legend='{}-{}'.format(dev, proto), is_area=True, color=color.next()) for dev, proto in itertools.product(C.network_devices, ['tcp', 'udp']) ] def smart_graph(attr, field, label=None): sattr = str(attr).zfill(3) return Graph('smart_' + sattr, '{} ({}-{})'.format(smart_names[attr], sattr, field), label, [ DataSource('smart_' + hdd + '.rrd', 'a{}_{}'.format(sattr, field), hdd, False) for hdd in C.drives ]) graphs = [ Graph('hdd_rrqm_s', 'Read requests merged per second that were queued to the device', 'rrqm/s', hdd_ds('rrqm_s')), Graph('hdd_wrqm_s', 'Write requests merged per second that were queued to the device', 'wrqm/s ', hdd_ds('wrqm_s')), Graph('hdd_r_s', 'Read requests that were issued to the device per second', 'r/s', hdd_ds('r_s')), Graph('hdd_w_s', 'Write requests that were issued to the device per second', 'w/s', hdd_ds('w_s')), Graph('hdd_rkB_s', 'Kilobytes read from the device per second', 'rkB/s ', hdd_ds('rkB_s')), Graph('hdd_wkB_s', 'Kilobytes written to the device per second', 'wkB/s ', hdd_ds('wkB_s')), Graph('hdd_avgrq_sz', 'Avg size of the requests that were issued to the device', 'sectors', hdd_ds('avgrq_sz')), Graph('hdd_avgqu_sz', 'Avg queue length of the requests that were issued to the device', 'requests', hdd_ds('avgqu_sz')), Graph('hdd_await', 'Avg time for I/O requests issued to the device to be served', 'milliseconds', hdd_ds('await')), Graph('hdd_r_await', 'Avg time for READ requests issued to the device to be served', 'milliseconds', hdd_ds('r_await')), Graph('hdd_w_await', 'Avg time for WRITE requests issued to the device to be served', 'milliseconds', hdd_ds('w_await')), Graph('hdd_svctm', '(OBSOLETE) Avg service time for I/O requests that were issued to the device', 'milliseconds', hdd_ds('svctm')), Graph('hdd_util', 'Percentage of CPU time during which I/O requests were issued to the device', '%', hdd_ds('util')), Graph('cpu_load', 'CPU loads', '%', [ DataSource('cpu.rrd', field, field, True) for field in C.CpuStat._fields if field != 'idle']), Graph('cpu_la', 'CPU load averages', None, [ DataSource('cpu_la.rrd', field, field, False) for field in C.CpuLa._fields]), Graph('traffic_in_bytes', 'Incoming bytes', 'bytes/s', traffic_ds('bytes', 'in')), Graph('traffic_out_bytes', 'Outgoing bytes', 'bytes/s', traffic_ds('bytes', 'out')), Graph('traffic_in_pckts', 'Incoming packets', 'packets/s', traffic_ds('pckts', 'in')), Graph('traffic_out_pckts', 'Outgoing packets', 'packets/s', traffic_ds('pckts', 'out')), Graph('incoming_connections', 'Incoming connections', 'count', connections_ds('in')), Graph('outgoing_connections', 'Outgoing connections', 'count', connections_ds('out')), Graph('sockets', 'Sockets', 'sockets', [ DataSource('sockets.rrd', field, field, True) for field in 'estab closed orphaned synrecv tw tw2'.split(' ') ] +\ [ DataSource('sockets.rrd', field, field, False) for field in 'total tcp ports'.split(' ') ]), Graph('ups_v', 'Voltages', 'volts', [ DataSource('ups.rrd', 'LINEV', 'AC line', False), DataSource('ups.rrd', 'BATTV', 'UPS battery', False)]), Graph('ups_load', 'Load and charge', '%', [ DataSource('ups.rrd', 'LOADPCT', 'UPS load', False), DataSource('ups.rrd', 'BCHARGE', 'Battery charge', False) ]), Graph('ups_misc', 'Misc UPS stats', None, [ DataSource('ups.rrd', 'TIMELEFT', 'Time on battery left', False), DataSource('ups.rrd', 'NUMXFERS', 'Number of transfers', False), DataSource('ups.rrd', 'TONBATT', 'Time on battery', False), DataSource('ups.rrd', 'CUMONBATT', 'CUMONBATT', False) ]), smart_graph(194, 'raw', '°C'), smart_graph(1, 'cur'), smart_graph(3, 'raw', 'msec'), smart_graph(4, 'raw'), smart_graph(7, 'cur'), smart_graph(9, 'raw'), smart_graph(11, 'raw'), smart_graph(12, 'raw'), smart_graph(195, 'cur'), ] graph_intervals = { 'hourly': 'now-1h', 'optimal': 'now-400m', 'daily': 'now-1d', 'weekly': 'now-1w', 'monthly': 'now-30d', 'yearly': 'now-1y' } def plot(graph, interval): assert interval in graph_intervals cmd = ['rrdtool', 'graph', '-' , '--start', graph_intervals[interval], '--title', graph.title, '--imgformat', 'SVG', '--lower-limit', '0' ] if graph.vlabel: cmd += ['--vertical-label', graph.vlabel] ds_list = graph.ds if isinstance(graph.ds, list) else [graph.ds] color = itertools.cycle(graph_colors) for i in range(0, len(ds_list)): ds = ds_list[i] cmd.append('DEF:v{i}={db}:{field}:AVERAGE'.format(i=i, db=os.path.join(C.rrd_path, ds.db_fname), field=ds.field)) cmd.append('{type}:v{i}{color}:{legend}{stack}'.format( type='AREA' if ds.is_area else 'LINE1', i=i, color=color.next() if ds.color is None else ds.color, legend=ds.legend, stack=':STACK' if ds.is_area or ds.stack else '')) #print(' '.join(cmd)) rrd = subprocess.Popen(cmd, stdout=subprocess.PIPE) gz = gzip.open(os.path.join(C.graph_path, graph.fname + '_' + interval + '.svgz'), 'wb') while rrd.poll() is None: gz.write(rrd.stdout.read()) gz.close() assert rrd.poll() == 0 for graph in graphs: plot(graph, sys.argv[1])
mit
-2,728,556,869,338,496,500
54.723577
162
0.626204
false
3.101357
false
false
false
dendory/chartjs
sample3.py
1
5887
# This script parses the CSV files gathered from the Canadian Weather Service and makes charts import chartjs import csv # We will cover these years startyear = 1981 endyear = 2012 # We will make charts for 3 major Canadian cities cities = [ {'name': "Montreal", 'fillColor': "rgba(100,50,200,0.25)", 'strokeColor': "rgba(100,50,200,0.75)", 'pointColor': "rgba(100,50,200,0.75)"}, {'name': "Toronto", 'fillColor': "rgba(200,100,100,0.25)", 'strokeColor': "rgba(200,100,100,0.75)", 'pointColor': "rgba(200,100,100,0.75)"}, {'name': "Vancouver", 'fillColor': "rgba(100,200,100,0.25)", 'strokeColor': "rgba(100,200,100,0.75)", 'pointColor': "rgba(100,200,100,0.75)"}, ] # 3 of the charts will cover all 12 months months = ["Jan", "Feb", "Mar", "Apr", "May", "Jun", "Jul", "Aug", "Sep", "Oct", "Nov", "Dec"] # The first chart will show median temperatures over the years global_chart = chartjs.chart("Temperature medians for 1981 - 2012 in Celsius<br><font color='#6432C8'>Montreal</font>, <font color='#B1846B'>Toronto</font>, <font color='#6CCB6C'>Vancouver</font>", "Line", 1200, 600) global_chart.set_params(JSinline = False) # Each city will have a chart showing each month's median temperature montreal_chart = chartjs.chart("Montreal temperatures for 2012 in Celsius", "Line", 390, 200) montreal_chart.canvas = "montreal" montreal_chart.set_labels(months) toronto_chart = chartjs.chart("Toronto temperatures for 2012 in Celsius", "Line", 390, 200) toronto_chart.canvas = "toronto" toronto_chart.set_labels(months) vancouver_chart = chartjs.chart("Vancouver temperatures for 2012 in Celsius", "Line", 390, 200) vancouver_chart.canvas = "vancouver" vancouver_chart.set_labels(months) _startyear = startyear # Loop one city at a time for city in cities: city_data = [] years = [] medians = [] # Loop one year at a time while startyear < endyear+1: # Open CSV file for the city and year f = open("data/" + city['name'] + "/" + str(startyear) + ".csv", 'r', newline='') next(f) csvreader = csv.reader(f, delimiter=',') totalvalues = 0 values = 0 monthly_values = 0 monthly_totalvalues = 0 current_month = '01' # Parse the CSV line by line for line in csvreader: try: # For each line, we add the value and the number of values values += float(line[9]) totalvalues += 1 except: pass try: # For year 2012, we also record monthly medians for the city charts if startyear == 2012: # If the month column changed, that means we must compute the median for last month if str(line[2]) != str(current_month): # All the added values, divided by the number of values median = "{0:.2f}".format(float(monthly_values / monthly_totalvalues)) # Append the median to the current city's list city_data.append(median) # Set the current month to the new value current_month = str(line[2]) # Reset variables to 0 monthly_values = 0 monthly_totalvalues = 0 # For each line in this month, add the value and add the number of values monthly_values += float(line[9]) monthly_totalvalues += 1 except: pass # For the last month, we need to calculate the median one last time if monthly_totalvalues > 0: median = "{0:.2f}".format(float(monthly_values / monthly_totalvalues)) city_data.append(median) # After reading all the lines in the file, calculate the median for the year if totalvalues > 0: median = "{0:.2f}".format(float(values / totalvalues)) medians.append(median) else: medians.append(0) # Append the current year to the labels years.append(startyear) # Create all of the city charts if startyear == 2012: if city['name'] == "Montreal": montreal_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) montreal_chart.add_dataset(city_data) if city['name'] == "Toronto": toronto_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) toronto_chart.add_dataset(city_data) if city['name'] == "Vancouver": vancouver_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) vancouver_chart.add_dataset(city_data) startyear += 1 # Create the global chart global_chart.set_labels(years) global_chart.set_params(fillColor = city['fillColor'], strokeColor = city['strokeColor'], pointColor = city['pointColor']) global_chart.add_dataset(medians) startyear = _startyear f.close() # Create the HTML page and the 4 charts individually f = open("sample3.html", 'w') output = """<!doctype html> <html> <head> <title>Temperature charts</title> {1} </head> <body> <div style="width: {2}px; height: {3}px; max-width: 99%" class="chartjs"> <center><h2>{0}</h2></center> """.format(global_chart.title, global_chart.js, str(global_chart.width), str(global_chart.height)) output += global_chart.make_chart_canvas() output += " <table width='99%'><tr><td><center><h4>" + montreal_chart.title + "</h4></center>" output += montreal_chart.make_chart_canvas() output += " </td><td><center><h4>" + toronto_chart.title + "</h4></center>" output += toronto_chart.make_chart_canvas() output += " </td><td><center><h4>" + vancouver_chart.title + "</h4></center>" output += vancouver_chart.make_chart_canvas() output += """ </td></tr></table> <script> window.onload = function() {""" output += global_chart.make_chart_onload() output += montreal_chart.make_chart_onload() output += toronto_chart.make_chart_onload() output += vancouver_chart.make_chart_onload() output += """ } </script> </div> </body> </html> """ f.write(output) f.close()
mit
831,402,048,602,100,100
39.167832
216
0.660608
false
2.950877
false
false
false
MSHallOpenSoft/plotter
GUI_final.py
1
59129
# -*- coding: utf-8 -*- # Form implementation generated from reading ui file 'GUI_final.ui' # # Created: Thu Mar 19 22:03:17 2015 # by: PyQt4 UI code generator 4.11.3 # # WARNING! All changes made in this file will be lost! from PyQt4 import QtCore, QtGui try: _fromUtf8 = QtCore.QString.fromUtf8 except AttributeError: def _fromUtf8(s): return s try: _encoding = QtGui.QApplication.UnicodeUTF8 def _translate(context, text, disambig): return QtGui.QApplication.translate(context, text, disambig, _encoding) except AttributeError: def _translate(context, text, disambig): return QtGui.QApplication.translate(context, text, disambig) class Ui_MainWindow(object): def setupUi(self, MainWindow): MainWindow.setObjectName(_fromUtf8("MainWindow")) MainWindow.resize(1396, 727) MainWindow.setStyleSheet(_fromUtf8("QFrame{\n" "border:none;\n" "}\n" "QStatusBar{ \n" "background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.33, stop:0 rgba(255, 255, 255, 255), stop:0.125 rgba(155, 174, 198, 255), stop:0.318182 rgba(104, 117, 133, 255), stop:0.534091 rgba(65, 73, 83, 255), stop:0.875 rgba(42, 47, 54, 255)); }\n" " QMainWindow{\n" " background-image: url(:/img/Icons/rsz_back1.jpg); border:none;\n" " background-color:qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255));\n" " text-align: center; }\n" " QGroupBox{ \n" "background-color: qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255)); }\n" " QTabWidget{\n" " background-color: qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255)); }\n" " QDockWidget{\n" " background-color:#737373;\n" " border:none;\n" " padding:0px; \n" "}\n" " QSlider::groove:horizontal {\n" " background:red;\n" " height: 15px;\n" " position: absolute; \n" "left: 4px; \n" "right: 4px; }\n" " QSlider::handle:horizontal {\n" " height:20px;\n" " width: 10px; \n" "background: qlineargradient(spread:pad, x1:0, y1:0.477, x2:0, y2:0, stop:0.125 rgba(42, 47, 54, 255), stop:0.465909 rgba(65, 73, 83, 255), stop:0.681818 rgba(104, 117, 133, 255), stop:0.875 rgba(155, 174, 198, 255), stop:1 rgba(255, 255, 255, 255));\n" " margin: -4px; }\n" " QSlider::handle:hover:horizontal { \n" "height:20px;\n" " width: 10px;\n" " background:qlineargradient(spread:pad, x1:0, y1:0.477, x2:0, y2:0, stop:0.125 rgba(91, 95, 100, 255), stop:0.465909 rgba(122, 132, 146, 255), stop:0.681818 rgba(141, 153, 167, 255), stop:0.875 rgba(181, 195, 212, 255), stop:1 rgba(255, 255, 255, 255));\n" " margin: -4px;\n" " }\n" " QSlider::add-page:horizontal { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " }\n" " QSlider::sub-page:horizontal { \n" "background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255)) ;\n" " }\n" " QToolButton{ \n" "position: relative;\n" " border: none; \n" "outline:none;\n" " color: black;\n" " padding: 0px;\n" " border-radius: 2px;\n" " font-size: 22px;\n" " }\n" " QToolButton:hover:!pressed{ \n" "position: relative;\n" " border: none; \n" "outline:none; \n" "background-color:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " color: white;\n" " padding: 0px;\n" " border-radius: 2px;\n" " font-size: 22px; \n" "}\n" " QPushButton{ \n" "position: relative;\n" " border:none;\n" " outline:none; \n" "background-color: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " color: white;\n" " padding: 6px 20px; \n" "border-radius: 2px;\n" " font-size: 20px;\n" " }\n" " QPushButton:hover:!pressed{ \n" "position: relative;\n" " border: none; \n" "outline:none;\n" " background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " color: white; \n" "padding: 6px 20px; \n" "border-radius: 2px;\n" " font-size:20px; \n" "} \n" "QComboBox { \n" "border: none; \n" "padding: 1px 18px 1px 3px; \n" "min-width: 6em;\n" " }\n" " QComboBox, QComboBox:drop-down \n" "{\n" " background:qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " }\n" " QComboBox:on, QComboBox:drop-down:on { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255)); \n" "}\n" " QComboBox:on {\n" " padding-top: 3px;\n" " padding-left: 4px; \n" "} \n" "QComboBox::drop-down{\n" " subcontrol-origin: padding; \n" "subcontrol-position: top right;\n" " width: 15px; \n" "border-left-width: 1px; \n" "border-left-color: darkgray; \n" "border-left-style: solid;\n" " }\n" " QComboBox::down-arrow { \n" "image:url(:/arrow/Icons/arrow-new.png);\n" " } \n" "QComboBox::down-arrow:on {\n" " top: 1px;\n" " left: 1px;\n" " }\n" " QMenu {\n" " background-color: qlineargradient(spread:pad, x1:1, y1:1, x2:0.483136, y2:0.466, stop:0 rgba(219, 219, 219, 255), stop:1 rgba(255, 255, 255, 255)); \n" "border: none; \n" "}\n" " QMenu::item {\n" " background-color: transparent;\n" " }\n" " QMenu::item:selected {\n" " background-color:rgb(120, 255, 13);\n" " }\n" " QMenuBar { \n" "background-color:qlineargradient(spread:pad, x1:0, y1:0, x2:1, y2:1, stop:0 #DBDBDB, stop:1 rgba(255, 255, 255, 255)) } QMenuBar::item {\n" " spacing: 3px;\n" " padding: 1px 4px; \n" "background: transparent; \n" "border-radius: 2px;\n" " }\n" " QMenuBar::item:selected {\n" " background:#737373;\n" " }\n" " QMenuBar::item:pressed \n" "{ background: #414953; \n" "} \n" "QTableWidget{ \n" "background:qlineargradient(spread:pad, x1:1, y1:1, x2:0, y2:0, stop:0 #DBDBDB, stop:1 rgba(255, 255, 255, 255));\n" " border:1px solid rgb(171, 173, 179);\n" " }\n" " QTextEdit{ \n" "background:qlineargradient(spread:pad, x1:1, y1:1, x2:0, y2:0, stop:0 #DBDBDB, stop:1 rgba(255, 255, 255, 255)); \n" "}\n" " QScrollBar:horizontal {\n" " border: none; background: #DBDBDB; height: 15px; margin: 0px 20px 0 20px; \n" "}\n" " QScrollBar::handle:horizontal { background:qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " min-width: 20px;\n" " }\n" " QScrollBar::handle:horizontal:hover { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " min-width: 20px;\n" " } \n" "QScrollBar::add-line:horizontal {\n" " border: none;\n" " background:#DBDBDB; \n" "width: 20px;\n" " subcontrol-position: right;\n" " subcontrol-origin: margin;\n" " }\n" " QScrollBar::sub-line:horizontal {\n" " border:none; \n" "background:#DBDBDB; \n" "width: 20px;\n" " subcontrol-position: left;\n" " subcontrol-origin: margin;\n" " }\n" " QScrollBar::add-line:horizontal:hover:!pressed { \n" "border: none;\n" " background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255)); \n" "width: 20px;\n" " subcontrol-position: right; \n" "subcontrol-origin: margin; \n" "}\n" " QScrollBar::sub-line:horizontal:hover:!pressed { \n" "border:none;\n" " background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " width: 20px; \n" "subcontrol-position: left;\n" " subcontrol-origin: margin; \n" "}\n" " QScrollBar::left-arrow:horizontal{\n" " image: url(:/arrow/Icons/left-arrow.png);\n" " }\n" " QScrollBar::right-arrow:horizontal{\n" " image: url(:/arrow/Icons/right-arrow.png);\n" " }\n" " QScrollBar:vertical {\n" " border: none;\n" " background: #DBDBDB;\n" " width: 15px; \n" "margin: 0px 20px 0 20px; \n" "} \n" "QScrollBar::handle:vertical { background:qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " min-height: 20px; }\n" " QScrollBar::handle:vertical:hover { background:qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0.0802727, stop:0 rgba(255, 255, 255, 255), stop:0.0397727 rgba(222, 255, 196, 255), stop:0.176136 rgba(168, 255, 99, 255), stop:0.642045 rgba(127, 200, 70, 255));\n" " min-height: 15px;\n" " }\n" " QScrollBar::add-line:vertical {\n" " border: none;\n" " background:#DBDBDB; \n" "height: 20px;\n" " subcontrol-position: bottom; \n" "subcontrol-origin: margin; \n" "}\n" " QScrollBar::sub-line:vertical {\n" " border:none; \n" "background:#DBDBDB; \n" "height: 20px;\n" " subcontrol-position: top;\n" " subcontrol-origin: margin;\n" " } \n" "QScrollBar::add-line:vertical:hover:!pressed { \n" "border: none; \n" "background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " height: 20px;\n" " subcontrol-position:bottom; \n" "subcontrol-origin: margin;\n" " }\n" " QScrollBar::sub-line:vertical:hover:!pressed { b\n" "order:none; \n" "background: qlineargradient(spread:pad, x1:0, y1:0.664, x2:0, y2:0, stop:0.357955 rgba(89, 189, 9, 255), stop:0.801136 rgba(120, 255, 13, 255), stop:0.9375 rgba(175, 255, 111, 255), stop:1 rgba(255, 255, 255, 255));\n" " height: 20px; \n" "subcontrol-position:top;\n" " subcontrol-origin: margin;\n" " }\n" " QScrollBar::up-arrow:vertical{ \n" "image: url(:/arrow/Icons/up-arrow.png); \n" "} \n" "QScrollBar::down-arrow:vertical{\n" " image: url(:/arrow/Icons/down-arrow.png);\n" " }")) self.centralwidget = QtGui.QWidget(MainWindow) self.centralwidget.setObjectName(_fromUtf8("centralwidget")) self.horizontalLayout_3 = QtGui.QHBoxLayout(self.centralwidget) self.horizontalLayout_3.setObjectName(_fromUtf8("horizontalLayout_3")) self.frame_2 = QtGui.QFrame(self.centralwidget) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Preferred) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.frame_2.sizePolicy().hasHeightForWidth()) self.frame_2.setSizePolicy(sizePolicy) self.frame_2.setMinimumSize(QtCore.QSize(20, 0)) self.frame_2.setStyleSheet(_fromUtf8("")) self.frame_2.setFrameShape(QtGui.QFrame.StyledPanel) self.frame_2.setFrameShadow(QtGui.QFrame.Raised) self.frame_2.setObjectName(_fromUtf8("frame_2")) self.horizontalLayout_4 = QtGui.QHBoxLayout(self.frame_2) self.horizontalLayout_4.setObjectName(_fromUtf8("horizontalLayout_4")) self.verticalLayout_5 = QtGui.QVBoxLayout() self.verticalLayout_5.setObjectName(_fromUtf8("verticalLayout_5")) self.pushButton = QtGui.QPushButton(self.frame_2) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.pushButton.sizePolicy().hasHeightForWidth()) self.pushButton.setSizePolicy(sizePolicy) self.pushButton.setMaximumSize(QtCore.QSize(20, 50)) self.pushButton.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton.setText(_fromUtf8("")) icon = QtGui.QIcon() icon.addPixmap(QtGui.QPixmap(_fromUtf8(":/arrow/Icons/double-right.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.pushButton.setIcon(icon) self.pushButton.setObjectName(_fromUtf8("pushButton")) self.verticalLayout_5.addWidget(self.pushButton) self.horizontalLayout_4.addLayout(self.verticalLayout_5) self.horizontalLayout_3.addWidget(self.frame_2) self.frame = QtGui.QFrame(self.centralwidget) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Preferred) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.frame.sizePolicy().hasHeightForWidth()) self.frame.setSizePolicy(sizePolicy) self.frame.setMaximumSize(QtCore.QSize(320, 16777215)) self.frame.setFrameShape(QtGui.QFrame.StyledPanel) self.frame.setFrameShadow(QtGui.QFrame.Raised) self.frame.setObjectName(_fromUtf8("frame")) self.verticalLayout_3 = QtGui.QVBoxLayout(self.frame) self.verticalLayout_3.setObjectName(_fromUtf8("verticalLayout_3")) self.horizontalLayout_5 = QtGui.QHBoxLayout() self.horizontalLayout_5.setSpacing(6) self.horizontalLayout_5.setObjectName(_fromUtf8("horizontalLayout_5")) self.pushButton_3 = QtGui.QPushButton(self.frame) self.pushButton_3.setEnabled(True) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.pushButton_3.sizePolicy().hasHeightForWidth()) self.pushButton_3.setSizePolicy(sizePolicy) self.pushButton_3.setMinimumSize(QtCore.QSize(50, 0)) self.pushButton_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton_3.setStyleSheet(_fromUtf8("")) self.pushButton_3.setObjectName(_fromUtf8("pushButton_3")) self.horizontalLayout_5.addWidget(self.pushButton_3) self.toolButton_7 = QtGui.QToolButton(self.frame) self.toolButton_7.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_7.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_7.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_7.setStyleSheet(_fromUtf8("")) icon1 = QtGui.QIcon() icon1.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Add-New-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_7.setIcon(icon1) self.toolButton_7.setIconSize(QtCore.QSize(40, 30)) self.toolButton_7.setObjectName(_fromUtf8("toolButton_7")) self.horizontalLayout_5.addWidget(self.toolButton_7) self.toolButton_9 = QtGui.QToolButton(self.frame) self.toolButton_9.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_9.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_9.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_9.setStyleSheet(_fromUtf8("")) icon2 = QtGui.QIcon() icon2.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Minus-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_9.setIcon(icon2) self.toolButton_9.setIconSize(QtCore.QSize(40, 30)) self.toolButton_9.setObjectName(_fromUtf8("toolButton_9")) self.horizontalLayout_5.addWidget(self.toolButton_9) self.toolButton_8 = QtGui.QToolButton(self.frame) self.toolButton_8.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_8.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_8.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_8.setStyleSheet(_fromUtf8("")) icon3 = QtGui.QIcon() icon3.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Folder-Open-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_8.setIcon(icon3) self.toolButton_8.setIconSize(QtCore.QSize(40, 30)) self.toolButton_8.setObjectName(_fromUtf8("toolButton_8")) self.horizontalLayout_5.addWidget(self.toolButton_8) self.toolButton_5 = QtGui.QToolButton(self.frame) self.toolButton_5.setMinimumSize(QtCore.QSize(10, 0)) self.toolButton_5.setMaximumSize(QtCore.QSize(35, 16777215)) self.toolButton_5.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_5.setStyleSheet(_fromUtf8("")) icon4 = QtGui.QIcon() icon4.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Save-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_5.setIcon(icon4) self.toolButton_5.setIconSize(QtCore.QSize(40, 30)) self.toolButton_5.setObjectName(_fromUtf8("toolButton_5")) self.horizontalLayout_5.addWidget(self.toolButton_5) spacerItem = QtGui.QSpacerItem(20, 20, QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Minimum) self.horizontalLayout_5.addItem(spacerItem) self.verticalLayout_3.addLayout(self.horizontalLayout_5) self.tableWidget = QtGui.QTableWidget(self.frame) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Expanding) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.tableWidget.sizePolicy().hasHeightForWidth()) self.tableWidget.setSizePolicy(sizePolicy) self.tableWidget.setMinimumSize(QtCore.QSize(300, 0)) self.tableWidget.setStyleSheet(_fromUtf8("")) self.tableWidget.setObjectName(_fromUtf8("tableWidget")) self.tableWidget.setColumnCount(3) self.tableWidget.setRowCount(0) item = QtGui.QTableWidgetItem() self.tableWidget.setHorizontalHeaderItem(0, item) item = QtGui.QTableWidgetItem() self.tableWidget.setHorizontalHeaderItem(1, item) item = QtGui.QTableWidgetItem() self.tableWidget.setHorizontalHeaderItem(2, item) self.verticalLayout_3.addWidget(self.tableWidget) self.pushButton_21 = QtGui.QPushButton(self.frame) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.pushButton_21.sizePolicy().hasHeightForWidth()) self.pushButton_21.setSizePolicy(sizePolicy) self.pushButton_21.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton_21.setStyleSheet(_fromUtf8("")) self.pushButton_21.setObjectName(_fromUtf8("pushButton_21")) self.verticalLayout_3.addWidget(self.pushButton_21) self.horizontalLayout_3.addWidget(self.frame) self.verticalLayout_6 = QtGui.QVBoxLayout() self.verticalLayout_6.setObjectName(_fromUtf8("verticalLayout_6")) self.widget = QtGui.QWidget(self.centralwidget) self.widget.setStyleSheet(_fromUtf8("")) self.widget.setObjectName(_fromUtf8("widget")) self.verticalLayout_6.addWidget(self.widget) self.horizontalLayout_3.addLayout(self.verticalLayout_6) MainWindow.setCentralWidget(self.centralwidget) self.menubar = QtGui.QMenuBar(MainWindow) self.menubar.setGeometry(QtCore.QRect(0, 0, 1396, 21)) self.menubar.setObjectName(_fromUtf8("menubar")) self.menuFile = QtGui.QMenu(self.menubar) self.menuFile.setObjectName(_fromUtf8("menuFile")) self.menuEdit = QtGui.QMenu(self.menubar) self.menuEdit.setObjectName(_fromUtf8("menuEdit")) self.menuView = QtGui.QMenu(self.menubar) self.menuView.setObjectName(_fromUtf8("menuView")) self.menuAbout = QtGui.QMenu(self.menubar) self.menuAbout.setObjectName(_fromUtf8("menuAbout")) MainWindow.setMenuBar(self.menubar) self.statusbar = QtGui.QStatusBar(MainWindow) self.statusbar.setObjectName(_fromUtf8("statusbar")) MainWindow.setStatusBar(self.statusbar) self.dockWidget = QtGui.QDockWidget(MainWindow) self.dockWidget.setMinimumSize(QtCore.QSize(320, 91)) self.dockWidget.setObjectName(_fromUtf8("dockWidget")) self.dockWidgetContents = QtGui.QWidget() self.dockWidgetContents.setObjectName(_fromUtf8("dockWidgetContents")) self.gridLayout = QtGui.QGridLayout(self.dockWidgetContents) self.gridLayout.setObjectName(_fromUtf8("gridLayout")) self.comboBox_5 = QtGui.QComboBox(self.dockWidgetContents) self.comboBox_5.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_5.setObjectName(_fromUtf8("comboBox_5")) self.comboBox_5.addItem(_fromUtf8("")) self.comboBox_5.addItem(_fromUtf8("")) self.comboBox_5.addItem(_fromUtf8("")) self.gridLayout.addWidget(self.comboBox_5, 0, 0, 1, 1) self.textEdit = QtGui.QTextEdit(self.dockWidgetContents) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.textEdit.sizePolicy().hasHeightForWidth()) self.textEdit.setSizePolicy(sizePolicy) self.textEdit.setMinimumSize(QtCore.QSize(0, 20)) self.textEdit.setObjectName(_fromUtf8("textEdit")) self.gridLayout.addWidget(self.textEdit, 0, 1, 1, 1) self.comboBox_6 = QtGui.QComboBox(self.dockWidgetContents) self.comboBox_6.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_6.setObjectName(_fromUtf8("comboBox_6")) self.comboBox_6.addItem(_fromUtf8("")) self.comboBox_6.addItem(_fromUtf8("")) self.comboBox_6.addItem(_fromUtf8("")) self.gridLayout.addWidget(self.comboBox_6, 1, 0, 1, 1) self.textEdit_2 = QtGui.QTextEdit(self.dockWidgetContents) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Expanding, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.textEdit_2.sizePolicy().hasHeightForWidth()) self.textEdit_2.setSizePolicy(sizePolicy) self.textEdit_2.setMinimumSize(QtCore.QSize(0, 20)) self.textEdit_2.setObjectName(_fromUtf8("textEdit_2")) self.gridLayout.addWidget(self.textEdit_2, 1, 1, 1, 1) self.dockWidget.setWidget(self.dockWidgetContents) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(1), self.dockWidget) self.dockWidget_2 = QtGui.QDockWidget(MainWindow) self.dockWidget_2.setMinimumSize(QtCore.QSize(427, 324)) self.dockWidget_2.setStyleSheet(_fromUtf8("")) self.dockWidget_2.setObjectName(_fromUtf8("dockWidget_2")) self.dockWidgetContents_2 = QtGui.QWidget() self.dockWidgetContents_2.setObjectName(_fromUtf8("dockWidgetContents_2")) self.verticalLayout_4 = QtGui.QVBoxLayout(self.dockWidgetContents_2) self.verticalLayout_4.setObjectName(_fromUtf8("verticalLayout_4")) self.groupBox_2 = QtGui.QGroupBox(self.dockWidgetContents_2) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.groupBox_2.sizePolicy().hasHeightForWidth()) self.groupBox_2.setSizePolicy(sizePolicy) self.groupBox_2.setMinimumSize(QtCore.QSize(0, 50)) self.groupBox_2.setObjectName(_fromUtf8("groupBox_2")) self.horizontalLayout_12 = QtGui.QHBoxLayout(self.groupBox_2) self.horizontalLayout_12.setObjectName(_fromUtf8("horizontalLayout_12")) self.horizontalLayout_7 = QtGui.QHBoxLayout() self.horizontalLayout_7.setObjectName(_fromUtf8("horizontalLayout_7")) self.comboBox = QtGui.QComboBox(self.groupBox_2) self.comboBox.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox.setStyleSheet(_fromUtf8("")) self.comboBox.setObjectName(_fromUtf8("comboBox")) self.comboBox.addItem(_fromUtf8("")) self.comboBox.addItem(_fromUtf8("")) self.horizontalLayout_7.addWidget(self.comboBox) self.comboBox_3 = QtGui.QComboBox(self.groupBox_2) self.comboBox_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_3.setObjectName(_fromUtf8("comboBox_3")) self.comboBox_3.addItem(_fromUtf8("")) self.comboBox_3.addItem(_fromUtf8("")) self.comboBox_3.addItem(_fromUtf8("")) self.horizontalLayout_7.addWidget(self.comboBox_3) self.comboBox_2 = QtGui.QComboBox(self.groupBox_2) self.comboBox_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_2.setLayoutDirection(QtCore.Qt.LeftToRight) self.comboBox_2.setAutoFillBackground(False) self.comboBox_2.setFrame(True) self.comboBox_2.setObjectName(_fromUtf8("comboBox_2")) self.comboBox_2.addItem(_fromUtf8("")) self.comboBox_2.addItem(_fromUtf8("")) self.comboBox_2.addItem(_fromUtf8("")) self.horizontalLayout_7.addWidget(self.comboBox_2) self.horizontalLayout_12.addLayout(self.horizontalLayout_7) self.verticalLayout_4.addWidget(self.groupBox_2) self.verticalLayout_2 = QtGui.QVBoxLayout() self.verticalLayout_2.setObjectName(_fromUtf8("verticalLayout_2")) self.tabWidget_2 = QtGui.QTabWidget(self.dockWidgetContents_2) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Minimum, QtGui.QSizePolicy.Expanding) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.tabWidget_2.sizePolicy().hasHeightForWidth()) self.tabWidget_2.setSizePolicy(sizePolicy) self.tabWidget_2.setMinimumSize(QtCore.QSize(310, 0)) self.tabWidget_2.setCursor(QtGui.QCursor(QtCore.Qt.ArrowCursor)) self.tabWidget_2.setAutoFillBackground(False) self.tabWidget_2.setStyleSheet(_fromUtf8("")) self.tabWidget_2.setTabPosition(QtGui.QTabWidget.South) self.tabWidget_2.setTabShape(QtGui.QTabWidget.Rounded) self.tabWidget_2.setIconSize(QtCore.QSize(16, 25)) self.tabWidget_2.setElideMode(QtCore.Qt.ElideNone) self.tabWidget_2.setTabsClosable(False) self.tabWidget_2.setMovable(True) self.tabWidget_2.setObjectName(_fromUtf8("tabWidget_2")) self.tab_3 = QtGui.QWidget() self.tab_3.setObjectName(_fromUtf8("tab_3")) self.verticalLayout_8 = QtGui.QVBoxLayout(self.tab_3) self.verticalLayout_8.setObjectName(_fromUtf8("verticalLayout_8")) self.groupBox = QtGui.QGroupBox(self.tab_3) self.groupBox.setObjectName(_fromUtf8("groupBox")) self.verticalLayout_7 = QtGui.QVBoxLayout(self.groupBox) self.verticalLayout_7.setObjectName(_fromUtf8("verticalLayout_7")) self.horizontalLayout_8 = QtGui.QHBoxLayout() self.horizontalLayout_8.setObjectName(_fromUtf8("horizontalLayout_8")) self.label = QtGui.QLabel(self.groupBox) self.label.setObjectName(_fromUtf8("label")) self.horizontalLayout_8.amenuddWidget(self.label) self.horizontalSlider = QtGui.QSlider(self.groupBox) self.horizontalSlider.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.horizontalSlider.setStyleSheet(_fromUtf8("")) self.horizontalSlider.setOrientation(QtCore.Qt.Horizontal) self.horizontalSlider.setObjectName(_fromUtf8("horizontalSlider")) self.horizontalLayout_8.addWidget(self.horizontalSlider) self.verticalLayout_7.addLayout(self.horizontalLayout_8) self.horizontalLayout_9 = QtGui.QHBoxLayout() self.horizontalLayout_9.setSizeConstraint(QtGui.QLayout.SetNoConstraint) self.horizontalLayout_9.setObjectName(_fromUtf8("horizontalLayout_9")) self.label_2 = QtGui.QLabel(self.groupBox) self.label_2.setObjectName(_fromUtf8("label_2")) self.horizontalLayout_9.addWidget(self.label_2) self.label_3 = QtGui.QLabel(self.groupBox) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.label_3.sizePolicy().hasHeightForWidth()) self.label_3.setSizePolicy(sizePolicy) self.label_3.setMinimumSize(QtCore.QSize(20, 20)) self.label_3.setObjectName(_fromUtf8("label_3")) self.horizontalLayout_9.addWidget(self.label_3) self.label_4 = QtGui.QLabel(self.groupBox) self.label_4.setObjectName(_fromUtf8("label_4")) self.horizontalLayout_9.addWidget(self.label_4) self.radioButton = QtGui.QRadioButton(self.groupBox) self.radioButton.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.radioButton.setObjectName(_fromUtf8("radioButton")) self.horizontalLayout_9.addWidget(self.radioButton) self.radioButton_3 = QtGui.QRadioButton(self.groupBox) self.radioButton_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.radioButton_3.setObjectName(_fromUtf8("radioButton_3")) self.horizontalLayout_9.addWidget(self.radioButton_3) self.radioButton_2 = QtGui.QRadioButton(self.groupBox) self.radioButton_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.radioButton_2.setObjectName(_fromUtf8("radioButton_2")) self.horizontalLayout_9.addWidget(self.radioButton_2) self.verticalLayout_7.addLayout(self.horizontalLayout_9) self.horizontalLayout_10 = QtGui.QHBoxLayout() self.horizontalLayout_10.setObjectName(_fromUtf8("horizontalLayout_10")) self.label_5 = QtGui.QLabel(self.groupBox) self.label_5.setObjectName(_fromUtf8("label_5")) self.horizontalLayout_10.addWidget(self.label_5) self.comboBox_4 = QtGui.QComboBox(self.groupBox) self.comboBox_4.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.comboBox_4.setObjectName(_fromUtf8("comboBox_4")) self.horizontalLayout_10.addWidget(self.comboBox_4) self.label_6 = QtGui.QLabel(self.groupBox) self.label_6.setObjectName(_fromUtf8("label_6")) self.horizontalLayout_10.addWidget(self.label_6) self.horizontalSlider_2 = QtGui.QSlider(self.groupBox) self.horizontalSlider_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.horizontalSlider_2.setOrientation(QtCore.Qt.Horizontal) self.horizontalSlider_2.setObjectName(_fromUtf8("horizontalSlider_2")) self.horizontalLayout_10.addWidget(self.horizontalSlider_2) self.verticalLayout_7.addLayout(self.horizontalLayout_10) self.horizontalLayout_11 = QtGui.QHBoxLayout() self.horizontalLayout_11.setObjectName(_fromUtf8("horizontalLayout_11")) self.label_7 = QtGui.QLabel(self.groupBox) self.label_7.setObjectName(_fromUtf8("label_7")) self.horizontalLayout_11.addWidget(self.label_7) self.horizontalSlider_3 = QtGui.QSlider(self.groupBox) self.horizontalSlider_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.horizontalSlider_3.setOrientation(QtCore.Qt.Horizontal) self.horizontalSlider_3.setObjectName(_fromUtf8("horizontalSlider_3")) self.horizontalLayout_11.addWidget(self.horizontalSlider_3) self.verticalLayout_7.addLayout(self.horizontalLayout_11) self.verticalLayout_8.addWidget(self.groupBox) self.tabWidget_2.addTab(self.tab_3, _fromUtf8("")) self.tab_4 = QtGui.QWidget() self.tab_4.setObjectName(_fromUtf8("tab_4")) self.horizontalLayout_13 = QtGui.QHBoxLayout(self.tab_4) self.horizontalLayout_13.setObjectName(_fromUtf8("horizontalLayout_13")) self.tabWidget_3 = QtGui.QTabWidget(self.tab_4) self.tabWidget_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.tabWidget_3.setStyleSheet(_fromUtf8("")) self.tabWidget_3.setUsesScrollButtons(False) self.tabWidget_3.setMovable(True) self.tabWidget_3.setObjectName(_fromUtf8("tabWidget_3")) self.tab_5 = QtGui.QWidget() self.tab_5.setObjectName(_fromUtf8("tab_5")) self.tabWidget_3.addTab(self.tab_5, _fromUtf8("")) self.tab_6 = QtGui.QWidget() self.tab_6.setObjectName(_fromUtf8("tab_6")) self.tabWidget_3.addTab(self.tab_6, _fromUtf8("")) self.horizontalLayout_13.addWidget(self.tabWidget_3) self.tabWidget_2.addTab(self.tab_4, _fromUtf8("")) self.verticalLayout_2.addWidget(self.tabWidget_2) self.verticalLayout_4.addLayout(self.verticalLayout_2) self.dockWidget_2.setWidget(self.dockWidgetContents_2) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(1), self.dockWidget_2) self.dockWidget_3 = QtGui.QDockWidget(MainWindow) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.dockWidget_3.sizePolicy().hasHeightForWidth()) self.dockWidget_3.setSizePolicy(sizePolicy) self.dockWidget_3.setMinimumSize(QtCore.QSize(489, 70)) self.dockWidget_3.setMaximumSize(QtCore.QSize(524287, 524287)) self.dockWidget_3.setObjectName(_fromUtf8("dockWidget_3")) self.dockWidgetContents_3 = QtGui.QWidget() self.dockWidgetContents_3.setObjectName(_fromUtf8("dockWidgetContents_3")) self.horizontalLayout = QtGui.QHBoxLayout(self.dockWidgetContents_3) self.horizontalLayout.setObjectName(_fromUtf8("horizontalLayout")) self.toolButton_17 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_17.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_17.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_17.setStyleSheet(_fromUtf8("")) icon5 = QtGui.QIcon() icon5.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Item-New-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_17.setIcon(icon5) self.toolButton_17.setIconSize(QtCore.QSize(30, 30)) self.toolButton_17.setObjectName(_fromUtf8("toolButton_17")) self.horizontalLayout.addWidget(self.toolButton_17) self.toolButton_10 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_10.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_10.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_10.setStyleSheet(_fromUtf8("")) self.toolButton_10.setIcon(icon3) self.toolButton_10.setIconSize(QtCore.QSize(30, 30)) self.toolButton_10.setObjectName(_fromUtf8("toolButton_10")) self.horizontalLayout.addWidget(self.toolButton_10) self.toolButton_20 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_20.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_20.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_20.setStyleSheet(_fromUtf8("")) self.toolButton_20.setIcon(icon4) self.toolButton_20.setIconSize(QtCore.QSize(30, 30)) self.toolButton_20.setObjectName(_fromUtf8("toolButton_20")) self.horizontalLayout.addWidget(self.toolButton_20) self.toolButton_18 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_18.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_18.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_18.setStyleSheet(_fromUtf8("")) icon6 = QtGui.QIcon() icon6.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Open-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_18.setIcon(icon6) self.toolButton_18.setIconSize(QtCore.QSize(30, 30)) self.toolButton_18.setObjectName(_fromUtf8("toolButton_18")) self.horizontalLayout.addWidget(self.toolButton_18) self.line_4 = QtGui.QFrame(self.dockWidgetContents_3) self.line_4.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_4.setFrameShape(QtGui.QFrame.VLine) self.line_4.setFrameShadow(QtGui.QFrame.Sunken) self.line_4.setObjectName(_fromUtf8("line_4")) self.horizontalLayout.addWidget(self.line_4) self.toolButton_4 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_4.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_4.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_4.setStyleSheet(_fromUtf8("")) self.toolButton_4.setIcon(icon1) self.toolButton_4.setIconSize(QtCore.QSize(30, 30)) self.toolButton_4.setObjectName(_fromUtf8("toolButton_4")) self.horizontalLayout.addWidget(self.toolButton_4) self.toolButton_3 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_3.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_3.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_3.setStyleSheet(_fromUtf8("")) self.toolButton_3.setIcon(icon2) self.toolButton_3.setIconSize(QtCore.QSize(30, 30)) self.toolButton_3.setObjectName(_fromUtf8("toolButton_3")) self.horizontalLayout.addWidget(self.toolButton_3) self.line_5 = QtGui.QFrame(self.dockWidgetContents_3) self.line_5.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_5.setFrameShape(QtGui.QFrame.VLine) self.line_5.setFrameShadow(QtGui.QFrame.Sunken) self.line_5.setObjectName(_fromUtf8("line_5")) self.horizontalLayout.addWidget(self.line_5) self.checkBox = QtGui.QCheckBox(self.dockWidgetContents_3) self.checkBox.setMaximumSize(QtCore.QSize(20, 25)) self.checkBox.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.checkBox.setLayoutDirection(QtCore.Qt.LeftToRight) self.checkBox.setText(_fromUtf8("")) self.checkBox.setObjectName(_fromUtf8("checkBox")) self.horizontalLayout.addWidget(self.checkBox) self.Example = QtGui.QToolButton(self.dockWidgetContents_3) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.Example.sizePolicy().hasHeightForWidth()) self.Example.setSizePolicy(sizePolicy) self.Example.setMaximumSize(QtCore.QSize(16777215, 25)) self.Example.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.Example.setStyleSheet(_fromUtf8("QToolButton{\n" "font-size: 15px;\n" "color:rgb(255, 255, 255);\n" "}")) self.Example.setIconSize(QtCore.QSize(24, 24)) self.Example.setObjectName(_fromUtf8("Example")) self.horizontalLayout.addWidget(self.Example) self.line_6 = QtGui.QFrame(self.dockWidgetContents_3) self.line_6.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_6.setFrameShape(QtGui.QFrame.VLine) self.line_6.setFrameShadow(QtGui.QFrame.Sunken) self.line_6.setObjectName(_fromUtf8("line_6")) self.horizontalLayout.addWidget(self.line_6) self.toolButton = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton.setStyleSheet(_fromUtf8("")) icon7 = QtGui.QIcon() icon7.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Board-Pin-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton.setIcon(icon7) self.toolButton.setIconSize(QtCore.QSize(30, 30)) self.toolButton.setObjectName(_fromUtf8("toolButton")) self.horizontalLayout.addWidget(self.toolButton) self.toolButton_25 = QtGui.QToolButton(self.dockWidgetContents_3) self.toolButton_25.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_25.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_25.setStyleSheet(_fromUtf8("")) icon8 = QtGui.QIcon() icon8.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Table-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_25.setIcon(icon8) self.toolButton_25.setIconSize(QtCore.QSize(30, 30)) self.toolButton_25.setObjectName(_fromUtf8("toolButton_25")) self.horizontalLayout.addWidget(self.toolButton_25) self.line_8 = QtGui.QFrame(self.dockWidgetContents_3) self.line_8.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_8.setFrameShape(QtGui.QFrame.VLine) self.line_8.setFrameShadow(QtGui.QFrame.Sunken) self.line_8.setObjectName(_fromUtf8("line_8")) self.horizontalLayout.addWidget(self.line_8) self.dockWidget_3.setWidget(self.dockWidgetContents_3) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(4), self.dockWidget_3) self.dockWidget_4 = QtGui.QDockWidget(MainWindow) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Preferred, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.dockWidget_4.sizePolicy().hasHeightForWidth()) self.dockWidget_4.setSizePolicy(sizePolicy) self.dockWidget_4.setMinimumSize(QtCore.QSize(624, 70)) self.dockWidget_4.setMaximumSize(QtCore.QSize(524287, 70)) self.dockWidget_4.setObjectName(_fromUtf8("dockWidget_4")) self.dockWidgetContents_4 = QtGui.QWidget() self.dockWidgetContents_4.setObjectName(_fromUtf8("dockWidgetContents_4")) self.horizontalLayout_2 = QtGui.QHBoxLayout(self.dockWidgetContents_4) self.horizontalLayout_2.setObjectName(_fromUtf8("horizontalLayout_2")) self.line_7 = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line_7.sizePolicy().hasHeightForWidth()) self.line_7.setSizePolicy(sizePolicy) self.line_7.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_7.setLineWidth(1) self.line_7.setMidLineWidth(1) self.line_7.setFrameShape(QtGui.QFrame.VLine) self.line_7.setFrameShadow(QtGui.QFrame.Sunken) self.line_7.setObjectName(_fromUtf8("line_7")) self.horizontalLayout_2.addWidget(self.line_7) self.toolButton_19 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_19.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_19.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_19.setStyleSheet(_fromUtf8("")) icon9 = QtGui.QIcon() icon9.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Keyboard-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_19.setIcon(icon9) self.toolButton_19.setIconSize(QtCore.QSize(35, 35)) self.toolButton_19.setObjectName(_fromUtf8("toolButton_19")) self.horizontalLayout_2.addWidget(self.toolButton_19) self.toolButton_23 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_23.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_23.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_23.setStyleSheet(_fromUtf8("")) icon10 = QtGui.QIcon() icon10.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Printer-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_23.setIcon(icon10) self.toolButton_23.setIconSize(QtCore.QSize(35, 35)) self.toolButton_23.setObjectName(_fromUtf8("toolButton_23")) self.horizontalLayout_2.addWidget(self.toolButton_23) self.toolButton_2 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_2.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_2.setIcon(icon4) self.toolButton_2.setIconSize(QtCore.QSize(35, 35)) self.toolButton_2.setObjectName(_fromUtf8("toolButton_2")) self.horizontalLayout_2.addWidget(self.toolButton_2) self.toolButton_24 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_24.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_24.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_24.setStyleSheet(_fromUtf8("")) icon11 = QtGui.QIcon() icon11.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Camera-02-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_24.setIcon(icon11) self.toolButton_24.setIconSize(QtCore.QSize(35, 35)) self.toolButton_24.setObjectName(_fromUtf8("toolButton_24")) self.horizontalLayout_2.addWidget(self.toolButton_24) self.toolButton_22 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_22.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_22.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_22.setStyleSheet(_fromUtf8("")) icon12 = QtGui.QIcon() icon12.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Facebook-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_22.setIcon(icon12) self.toolButton_22.setIconSize(QtCore.QSize(35, 35)) self.toolButton_22.setObjectName(_fromUtf8("toolButton_22")) self.horizontalLayout_2.addWidget(self.toolButton_22) self.line_3 = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line_3.sizePolicy().hasHeightForWidth()) self.line_3.setSizePolicy(sizePolicy) self.line_3.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_3.setFrameShape(QtGui.QFrame.VLine) self.line_3.setFrameShadow(QtGui.QFrame.Sunken) self.line_3.setObjectName(_fromUtf8("line_3")) self.horizontalLayout_2.addWidget(self.line_3) self.toolButton_21 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_21.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_21.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_21.setStyleSheet(_fromUtf8("")) icon13 = QtGui.QIcon() icon13.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Media-Play-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_21.setIcon(icon13) self.toolButton_21.setIconSize(QtCore.QSize(35, 35)) self.toolButton_21.setObjectName(_fromUtf8("toolButton_21")) self.horizontalLayout_2.addWidget(self.toolButton_21) self.toolButton_16 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_16.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_16.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_16.setStyleSheet(_fromUtf8("")) icon14 = QtGui.QIcon() icon14.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Stop-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_16.setIcon(icon14) self.toolButton_16.setIconSize(QtCore.QSize(35, 35)) self.toolButton_16.setObjectName(_fromUtf8("toolButton_16")) self.horizontalLayout_2.addWidget(self.toolButton_16) self.line_2 = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line_2.sizePolicy().hasHeightForWidth()) self.line_2.setSizePolicy(sizePolicy) self.line_2.setMaximumSize(QtCore.QSize(16777215, 20)) self.line_2.setFrameShape(QtGui.QFrame.VLine) self.line_2.setFrameShadow(QtGui.QFrame.Sunken) self.line_2.setObjectName(_fromUtf8("line_2")) self.horizontalLayout_2.addWidget(self.line_2) self.toolButton_15 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_15.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_15.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_15.setStyleSheet(_fromUtf8("")) icon15 = QtGui.QIcon() icon15.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Column-Selection-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_15.setIcon(icon15) self.toolButton_15.setIconSize(QtCore.QSize(35, 35)) self.toolButton_15.setObjectName(_fromUtf8("toolButton_15")) self.horizontalLayout_2.addWidget(self.toolButton_15) self.toolButton_14 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_14.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_14.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_14.setStyleSheet(_fromUtf8("")) icon16 = QtGui.QIcon() icon16.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Slash-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_14.setIcon(icon16) self.toolButton_14.setIconSize(QtCore.QSize(35, 35)) self.toolButton_14.setObjectName(_fromUtf8("toolButton_14")) self.horizontalLayout_2.addWidget(self.toolButton_14) self.line = QtGui.QFrame(self.dockWidgetContents_4) sizePolicy = QtGui.QSizePolicy(QtGui.QSizePolicy.Fixed, QtGui.QSizePolicy.Fixed) sizePolicy.setHorizontalStretch(0) sizePolicy.setVerticalStretch(0) sizePolicy.setHeightForWidth(self.line.sizePolicy().hasHeightForWidth()) self.line.setSizePolicy(sizePolicy) self.line.setMaximumSize(QtCore.QSize(16777215, 20)) self.line.setFrameShape(QtGui.QFrame.VLine) self.line.setFrameShadow(QtGui.QFrame.Sunken) self.line.setObjectName(_fromUtf8("line")) self.horizontalLayout_2.addWidget(self.line) self.toolButton_13 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_13.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_13.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_13.setStyleSheet(_fromUtf8("")) icon17 = QtGui.QIcon() icon17.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Magnifying-Glass-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_13.setIcon(icon17) self.toolButton_13.setIconSize(QtCore.QSize(35, 35)) self.toolButton_13.setObjectName(_fromUtf8("toolButton_13")) self.horizontalLayout_2.addWidget(self.toolButton_13) self.toolButton_12 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_12.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_12.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_12.setStyleSheet(_fromUtf8("")) icon18 = QtGui.QIcon() icon18.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Zoom-In-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_12.setIcon(icon18) self.toolButton_12.setIconSize(QtCore.QSize(35, 35)) self.toolButton_12.setObjectName(_fromUtf8("toolButton_12")) self.horizontalLayout_2.addWidget(self.toolButton_12) self.toolButton_11 = QtGui.QToolButton(self.dockWidgetContents_4) self.toolButton_11.setMaximumSize(QtCore.QSize(16777215, 25)) self.toolButton_11.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.toolButton_11.setAutoFillBackground(False) self.toolButton_11.setStyleSheet(_fromUtf8("")) icon19 = QtGui.QIcon() icon19.addPixmap(QtGui.QPixmap(_fromUtf8("Icons/Zoom-Out-48.png")), QtGui.QIcon.Normal, QtGui.QIcon.Off) self.toolButton_11.setIcon(icon19) self.toolButton_11.setIconSize(QtCore.QSize(35, 35)) self.toolButton_11.setObjectName(_fromUtf8("toolButton_11")) self.horizontalLayout_2.addWidget(self.toolButton_11) self.dockWidget_4.setWidget(self.dockWidgetContents_4) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(4), self.dockWidget_4) self.dockWidget_5 = QtGui.QDockWidget(MainWindow) self.dockWidget_5.setObjectName(_fromUtf8("dockWidget_5")) self.dockWidgetContents_5 = QtGui.QWidget() self.dockWidgetContents_5.setObjectName(_fromUtf8("dockWidgetContents_5")) self.verticalLayout = QtGui.QVBoxLayout(self.dockWidgetContents_5) self.verticalLayout.setObjectName(_fromUtf8("verticalLayout")) self.pushButton_2 = QtGui.QPushButton(self.dockWidgetContents_5) self.pushButton_2.setMinimumSize(QtCore.QSize(0, 0)) self.pushButton_2.setCursor(QtGui.QCursor(QtCore.Qt.PointingHandCursor)) self.pushButton_2.setObjectName(_fromUtf8("pushButton_2")) self.verticalLayout.addWidget(self.pushButton_2) self.dockWidget_5.setWidget(self.dockWidgetContents_5) MainWindow.addDockWidget(QtCore.Qt.DockWidgetArea(1), self.dockWidget_5) self.retranslateUi(MainWindow) self.tabWidget_2.setCurrentIndex(1) self.tabWidget_3.setCurrentIndex(1) QtCore.QMetaObject.connectSlotsByName(MainWindow) def retranslateUi(self, MainWindow): MainWindow.setWindowTitle(_translate("MainWindow", "MainWindow", None)) self.pushButton_3.setText(_translate("MainWindow", "Hide", None)) self.toolButton_7.setToolTip(_translate("MainWindow", "Add", None)) self.toolButton_7.setText(_translate("MainWindow", "...", None)) self.toolButton_9.setToolTip(_translate("MainWindow", "Remove", None)) self.toolButton_9.setText(_translate("MainWindow", "...", None)) self.toolButton_8.setToolTip(_translate("MainWindow", "Import Coordinates", None)) self.toolButton_8.setText(_translate("MainWindow", "...", None)) self.toolButton_5.setToolTip(_translate("MainWindow", "Export Coordinates", None)) self.toolButton_5.setText(_translate("MainWindow", "...", None)) item = self.tableWidget.horizontalHeaderItem(0) item.setText(_translate("MainWindow", "x", None)) item = self.tableWidget.horizontalHeaderItem(1) item.setText(_translate("MainWindow", "y", None)) item = self.tableWidget.horizontalHeaderItem(2) item.setText(_translate("MainWindow", "z", None)) self.pushButton_21.setText(_translate("MainWindow", "Redraw", None)) self.toolButton_17.setToolTip(_translate("MainWindow", "Create New", None)) self.toolButton_17.setText(_translate("MainWindow", "...", None)) self.toolButton_10.setToolTip(_translate("MainWindow", "Open Existing", None)) self.toolButton_10.setText(_translate("MainWindow", "...", None)) self.toolButton_20.setToolTip(_translate("MainWindow", "Save to Drive", None)) self.toolButton_20.setText(_translate("MainWindow", "...", None)) self.toolButton_18.setToolTip(_translate("MainWindow", "Load New", None)) self.toolButton_18.setText(_translate("MainWindow", "...", None)) self.toolButton_4.setToolTip(_translate("MainWindow", "Add new Equation", None)) self.toolButton_4.setText(_translate("MainWindow", "...", None)) self.toolButton_3.setToolTip(_translate("MainWindow", "Remove this Equation", None)) self.toolButton_3.setText(_translate("MainWindow", "...", None)) self.checkBox.setToolTip(_translate("MainWindow", "Show on Graph", None)) self.Example.setToolTip(_translate("MainWindow", "Illustrate with an Example", None)) self.Example.setWhatsThis(_translate("MainWindow", "Example", None)) self.Example.setText(_translate("MainWindow", "Example", None)) self.toolButton.setToolTip(_translate("MainWindow", "Always on Top", None)) self.toolButton.setText(_translate("MainWindow", "...", None)) self.toolButton_25.setToolTip(_translate("MainWindow", "Show/Hide Table", None)) self.toolButton_25.setText(_translate("MainWindow", "...", None)) self.toolButton_19.setToolTip(_translate("MainWindow", "Keyboard", None)) self.toolButton_19.setText(_translate("MainWindow", "...", None)) self.toolButton_23.setToolTip(_translate("MainWindow", "Print graph", None)) self.toolButton_23.setText(_translate("MainWindow", "...", None)) self.toolButton_2.setToolTip(_translate("MainWindow", "Save Graph", None)) self.toolButton_2.setText(_translate("MainWindow", "...", None)) self.toolButton_24.setToolTip(_translate("MainWindow", "Take a screenshot", None)) self.toolButton_24.setText(_translate("MainWindow", "...", None)) self.toolButton_22.setToolTip(_translate("MainWindow", "Go to our FaceBook page", None)) self.toolButton_22.setText(_translate("MainWindow", "...", None)) self.toolButton_21.setToolTip(_translate("MainWindow", "Play", None)) self.toolButton_21.setText(_translate("MainWindow", "...", None)) self.toolButton_16.setToolTip(_translate("MainWindow", "Stop", None)) self.toolButton_16.setText(_translate("MainWindow", "...", None)) self.toolButton_15.setToolTip(_translate("MainWindow", "Disable Anti-Aliasing", None)) self.toolButton_15.setText(_translate("MainWindow", "...", None)) self.toolButton_14.setToolTip(_translate("MainWindow", "Enable Anti-Aliasing", None)) self.toolButton_14.setText(_translate("MainWindow", "...", None)) self.toolButton_13.setToolTip(_translate("MainWindow", "Zoom All", None)) self.toolButton_13.setText(_translate("MainWindow", "...", None)) self.toolButton_12.setToolTip(_translate("MainWindow", "Zoom in", None)) self.toolButton_12.setText(_translate("MainWindow", "...", None)) self.toolButton_11.setToolTip(_translate("MainWindow", "Zoom out", None)) self.toolButton_11.setText(_translate("MainWindow", "...", None)) self.pushButton_2.setText(_translate("MainWindow", "PushButton", None))
gpl-2.0
-4,134,462,761,231,112,000
56.969608
268
0.698557
false
3.313477
false
false
false
ifp-uiuc/do-neural-networks-learn-faus-iccvw-2015
ck_plus/cnn_ad/train.py
1
3697
import argparse import os import sys sys.path.append('..') import numpy from anna import util from anna.datasets import supervised_dataset #from anna.datasets.supervised_data_loader import SupervisedDataLoaderCrossVal import data_fold_loader import data_paths from model import SupervisedModel parser = argparse.ArgumentParser(prog='train_cnn_with_dropout_\ data_augmentation', description='Script to train convolutional \ network from random initialization with \ dropout and data augmentation.') parser.add_argument("-s", "--split", default='0', help='Testing split of CK+ \ to use. (0-9)') parser.add_argument("--checkpoint_dir", default='./', help='Location to save \ model checkpoint files.') args = parser.parse_args() print('Start') test_split = int(args.split) if test_split < 0 or test_split > 9: raise Exception("Testing Split must be in range 0-9.") print('Using CK+ testing split: {}'.format(test_split)) checkpoint_dir = os.path.join(args.checkpoint_dir, 'checkpoints_'+str(test_split)) print 'Checkpoint dir: ', checkpoint_dir pid = os.getpid() print('PID: {}'.format(pid)) f = open('pid_'+str(test_split), 'wb') f.write(str(pid)+'\n') f.close() # Load model model = SupervisedModel('experiment', './', learning_rate=1e-2) monitor = util.Monitor(model, checkpoint_directory=checkpoint_dir, save_steps=1000) # Add dropout to fully-connected layer model.fc4.dropout = 0.5 model._compile() # Loading CK+ dataset print('Loading Data') #supervised_data_loader = SupervisedDataLoaderCrossVal( # data_paths.ck_plus_data_path) #train_data_container = supervised_data_loader.load('train', train_split) #test_data_container = supervised_data_loader.load('test', train_split) train_folds, val_fold, _ = data_fold_loader.load_fold_assignment(test_fold=test_split) X_train, y_train = data_fold_loader.load_folds(data_paths.ck_plus_data_path, train_folds) X_val, y_val = data_fold_loader.load_folds(data_paths.ck_plus_data_path, [val_fold]) X_test, y_test = data_fold_loader.load_folds(data_paths.ck_plus_data_path, [test_split]) X_train = numpy.float32(X_train) X_train /= 255.0 X_train *= 2.0 X_val = numpy.float32(X_val) X_val /= 255.0 X_val *= 2.0 X_test = numpy.float32(X_test) X_test /= 255.0 X_test *= 2.0 train_dataset = supervised_dataset.SupervisedDataset(X_train, y_train) val_dataset = supervised_dataset.SupervisedDataset(X_val, y_val) train_iterator = train_dataset.iterator( mode='random_uniform', batch_size=64, num_batches=31000) val_iterator = val_dataset.iterator( mode='random_uniform', batch_size=64, num_batches=31000) # Do data augmentation (crops, flips, rotations, scales, intensity) data_augmenter = util.DataAugmenter2(crop_shape=(96, 96), flip=True, gray_on=True) normer = util.Normer3(filter_size=5, num_channels=1) module_list_train = [data_augmenter, normer] module_list_val = [normer] preprocessor_train = util.Preprocessor(module_list_train) preprocessor_val = util.Preprocessor(module_list_val) print('Training Model') for x_batch, y_batch in train_iterator: x_batch = preprocessor_train.run(x_batch) monitor.start() log_prob, accuracy = model.train(x_batch, y_batch) monitor.stop(1-accuracy) if monitor.test: monitor.start() x_val_batch, y_val_batch = val_iterator.next() x_val_batch = preprocessor_val.run(x_val_batch) val_accuracy = model.eval(x_val_batch, y_val_batch) monitor.stop_test(1-val_accuracy)
bsd-3-clause
-8,914,378,663,641,386,000
33.551402
89
0.675683
false
3.242982
true
false
false
radjkarl/imgProcessor
imgProcessor/imgSignal.py
1
10847
from __future__ import division from __future__ import print_function import numpy as np import cv2 from imgProcessor.imgIO import imread from imgProcessor.measure.FitHistogramPeaks import FitHistogramPeaks from fancytools.math.findXAt import findXAt # from scipy.optimize.minpack import curve_fit MAX_SIZE = 700 def scaleSignalCut(img, ratio, nbins=100): ''' scaling img cutting x percent of top and bottom part of histogram ''' start, stop = scaleSignalCutParams(img, ratio, nbins) img = img - start img /= (stop - start) return img def _toSize(img): fac = MAX_SIZE / max(img.shape) if fac < 1: try: return cv2.resize(img, (0, 0), fx=fac, fy=fac, interpolation=cv2.INTER_AREA) except cv2.error: # cv2.error: ..\..\..\modules\imgproc\src\imgwarp.cpp:3235: error: # (-215) dsize.area() > 0 in function cv::resize return cv2.resize(img.T, (0, 0), fx=fac, fy=fac, interpolation=cv2.INTER_AREA).T return img def _histogramAndCorrBinPos(img, nbins=100): try: h, bins = np.histogram(img, nbins) except ValueError: # img contains NaN h, bins = np.histogram(img[np.isfinite(img)], nbins) b0 = bins[0] bins = bins[1:] bins += 0.5 * (bins[0] - b0) return h, bins def scaleSignalCutParams(img, ratio=0.01, nbins=100, return_img=False): img = _toSize(img) h, bins = _histogramAndCorrBinPos(img, nbins) h = np.cumsum(h).astype(float) h -= h.min() h /= h[-1] try: start = findXAt(bins, h, ratio) except IndexError: start = bins[0] try: stop = findXAt(bins, h, 1 - ratio) except IndexError: stop = bins[-1] if return_img: return start, stop, img return start, stop def scaleSignal(img, fitParams=None, backgroundToZero=False, reference=None): ''' scale the image between... backgroundToZero=True -> 0 (average background) and 1 (maximum signal) backgroundToZero=False -> signal+-3std reference -> reference image -- scale image to fit this one returns: scaled image ''' img = imread(img) if reference is not None: # def fn(ii, m,n): # return ii*m+n # curve_fit(fn, img[::10,::10], ref[::10,::10]) low, high = signalRange(img, fitParams) low2, high2 = signalRange(reference) img = np.asfarray(img) ampl = (high2 - low2) / (high - low) img -= low img *= ampl img += low2 return img else: offs, div = scaleParams(img, fitParams, backgroundToZero) img = np.asfarray(img) - offs img /= div print('offset: %s, divident: %s' % (offs, div)) return img def getBackgroundRange(fitParams): ''' return minimum, average, maximum of the background peak ''' smn, _, _ = getSignalParameters(fitParams) bg = fitParams[0] _, avg, std = bg bgmn = max(0, avg - 3 * std) if avg + 4 * std < smn: bgmx = avg + 4 * std if avg + 3 * std < smn: bgmx = avg + 3 * std if avg + 2 * std < smn: bgmx = avg + 2 * std else: bgmx = avg + std return bgmn, avg, bgmx def hasBackground(fitParams): ''' compare the height of putative bg and signal peak if ratio if too height assume there is no background ''' signal = getSignalPeak(fitParams) bg = getBackgroundPeak(fitParams) if signal == bg: return False r = signal[0] / bg[0] if r < 1: r = 1 / r return r < 100 def backgroundPeakValue(img, bins=500): f = FitHistogramPeaks(img, bins=bins, bins2=300) bgp = getBackgroundPeak(f.fitParams) ind = int(bgp[1]) if ind < 0: ind = 0 # y = f.yvals[ind:] # i = np.argmax(np.diff(y) > 0) # bgmaxpos = ind # + i # print(f.xvals[bgmaxpos], bgmaxpos) # import pylab as plt # plt.plot(f.xvals, f.yvals) # plt.show() return f.xvals[ind] def signalMinimum2(img, bins=None): ''' minimum position between signal and background peak ''' f = FitHistogramPeaks(img, bins=bins) i = signalPeakIndex(f.fitParams) spos = f.fitParams[i][1] # spos = getSignalPeak(f.fitParams)[1] # bpos = getBackgroundPeak(f.fitParams)[1] bpos = f.fitParams[i - 1][1] ind = np.logical_and(f.xvals > bpos, f.xvals < spos) try: i = np.argmin(f.yvals[ind]) return f.xvals[ind][i] except ValueError as e: if bins is None: return signalMinimum2(img, bins=400) else: raise e def signalMinimum(img, fitParams=None, n_std=3): ''' intersection between signal and background peak ''' if fitParams is None: fitParams = FitHistogramPeaks(img).fitParams assert len(fitParams) > 1, 'need 2 peaks so get minimum signal' i = signalPeakIndex(fitParams) signal = fitParams[i] bg = getBackgroundPeak(fitParams) smn = signal[1] - n_std * signal[2] bmx = bg[1] + n_std * bg[2] if smn > bmx: return smn # peaks are overlapping # define signal min. as intersection between both Gaussians def solve(p1, p2): s1, m1, std1 = p1 s2, m2, std2 = p2 a = (1 / (2 * std1**2)) - (1 / (2 * std2**2)) b = (m2 / (std2**2)) - (m1 / (std1**2)) c = (m1**2 / (2 * std1**2)) - (m2**2 / (2 * std2**2)) - \ np.log(((std2 * s1) / (std1 * s2))) return np.roots([a, b, c]) i = solve(bg, signal) try: return i[np.logical_and(i > bg[1], i < signal[1])][0] except IndexError: # this error shouldn't occur... well return max(smn, bmx) def getSignalMinimum(fitParams, n_std=3): assert len(fitParams) > 0, 'need min. 1 peak so get minimum signal' if len(fitParams) == 1: signal = fitParams[0] return signal[1] - n_std * signal[2] i = signalPeakIndex(fitParams) signal = fitParams[i] bg = fitParams[i - 1] #bg = getBackgroundPeak(fitParams) smn = signal[1] - n_std * signal[2] bmx = bg[1] + n_std * bg[2] if smn > bmx: return smn # peaks are overlapping # define signal min. as intersection between both Gaussians def solve(p1, p2): s1, m1, std1 = p1 s2, m2, std2 = p2 a = (1 / (2 * std1**2)) - (1 / (2 * std2**2)) b = (m2 / (std2**2)) - (m1 / (std1**2)) c = (m1**2 / (2 * std1**2)) - (m2**2 / (2 * std2**2)) - \ np.log(((std2 * s1) / (std1 * s2))) return np.roots([a, b, c]) i = solve(bg, signal) try: return i[np.logical_and(i > bg[1], i < signal[1])][0] except IndexError: # something didnt work out - fallback return smn def getSignalParameters(fitParams, n_std=3): ''' return minimum, average, maximum of the signal peak ''' signal = getSignalPeak(fitParams) mx = signal[1] + n_std * signal[2] mn = signal[1] - n_std * signal[2] if mn < fitParams[0][1]: mn = fitParams[0][1] # set to bg return mn, signal[1], mx def signalStd(img): fitParams = FitHistogramPeaks(img).fitParams signal = getSignalPeak(fitParams) return signal[2] def backgroundMean(img, fitParams=None): try: if fitParams is None: fitParams = FitHistogramPeaks(img).fitParams bg = getBackgroundPeak(fitParams) return bg[1] except Exception as e: print(e) # in case peaks were not found: return img.mean() def signalRange(img, fitParams=None, nSigma=3): try: if fitParams is None: fitParams = FitHistogramPeaks(img).fitParams signPeak = getSignalPeak(fitParams) return (signalMinimum(img, fitParams, nSigma), signPeak[1] + nSigma * signPeak[2]) # return (signPeak[1] - nSigma*signPeak[2],signPeak[1] + # nSigma*signPeak[2]) except Exception as e: print(e) # in case peaks were not found: s = img.std() m = img.mean() return m - nSigma * s, m + nSigma * s def scaleParamsFromReference(img, reference): # saving startup time: from scipy.optimize import curve_fit def ff(arr): arr = imread(arr, 'gray') if arr.size > 300000: arr = arr[::10, ::10] m = np.nanmean(arr) s = np.nanstd(arr) r = m - 3 * s, m + 3 * s b = (r[1] - r[0]) / 5 return arr, r, b img, imgr, imgb = ff(img) reference, refr, refb = ff(reference) nbins = np.clip(15, max(imgb, refb), 50) refh = np.histogram(reference, bins=nbins, range=refr)[ 0].astype(np.float32) imgh = np.histogram(img, bins=nbins, range=imgr)[0].astype(np.float32) import pylab as plt plt.figure(1) plt.plot(refh) plt.figure(2) plt.plot(imgh) plt.show() def fn(x, offs, div): return (x - offs) / div params, fitCovariances = curve_fit(fn, refh, imgh, p0=(0, 1)) perr = np.sqrt(np.diag(fitCovariances)) print('error scaling to reference image: %s' % perr[0]) # if perr[0] < 0.1: return params[0], params[1] def scaleParams(img, fitParams=None): low, high = signalRange(img, fitParams) offs = low div = high - low return offs, div def getBackgroundPeak(fitParams): return fitParams[0] def getSignalPeak(fitParams): i = signalPeakIndex(fitParams) return fitParams[i] def signalPeakIndex(fitParams): if len(fitParams) == 1: i = 0 else: # find categorical signal peak as max(peak height*standard deviation): sizes = [pi[0] * pi[2] for pi in fitParams[1:]] # signal peak has to have positive avg: for n, p in enumerate(fitParams[1:]): if p[1] < 0: sizes[n] = 0 i = np.argmax(sizes) + 1 return i if __name__ == '__main__': import sys import pylab as plt from fancytools.os.PathStr import PathStr import imgProcessor img = imread(PathStr(imgProcessor.__file__).dirname().join( 'media', 'electroluminescence', 'EL_module_orig.PNG'), 'gray') print('EL signal within range of %s' % str(signalRange(img))) print('EL signal minimum = %s' % signalMinimum(img)) if 'no_window' not in sys.argv: plt.imshow(img) plt.colorbar() plt.show()
gpl-3.0
7,949,265,973,686,205,000
26.028424
78
0.553425
false
3.283984
false
false
false
Osmose/normandy
recipe-server/normandy/recipes/migrations/0021_migrate_to_single_actions.py
1
1111
# -*- coding: utf-8 -*- # Generated by Django 1.9 on 2016-03-16 19:55 # flake8: noqa from __future__ import unicode_literals from django.db import migrations def multiple_to_single(apps, schema_editor): """ Take the first action in a recipe and set it as the single action. """ Recipe = apps.get_model('recipes', 'Recipe') for recipe in Recipe.objects.all(): if recipe.recipeaction_set.count() < 1: raise ValueError('Cannot migrate recipe pk={0} as it has no actions. Delete it manually' ' or add an action and re-run this migration.'.format(recipe.pk)) recipe_action = recipe.recipeaction_set.order_by('order')[0] recipe.action = recipe_action.action recipe.arguments_json = recipe_action.arguments_json recipe.save() def noop(apps, schema_editor): pass # Not too concerned about going backwards here. class Migration(migrations.Migration): dependencies = [ ('recipes', '0020_auto_20160316_1947'), ] operations = [ migrations.RunPython(multiple_to_single, noop) ]
mpl-2.0
-8,590,091,028,667,492,000
30.742857
100
0.647165
false
3.844291
false
false
false
HoussemCharf/FunUtils
pythonMergeSort.py
1
2025
""" This is a pure python implementation of the merge sort algorithm For doctests run following command: python -m doctest -v merge_sort.py or python3 -m doctest -v merge_sort.py For manual testing run: python merge_sort.py """ from __future__ import print_function def merge_sort(collection): """Pure implementation of the merge sort algorithm in Python :param collection: some mutable ordered collection with heterogeneous comparable items inside :return: the same collection ordered by ascending Examples: >>> merge_sort([0, 5, 3, 2, 2]) [0, 2, 2, 3, 5] >>> merge_sort([]) [] >>> merge_sort([-2, -5, -45]) [-45, -5, -2] """ length = len(collection) if length > 1: midpoint = length // 2 left_half = merge_sort(collection[:midpoint]) right_half = merge_sort(collection[midpoint:]) i = 0 j = 0 k = 0 left_length = len(left_half) right_length = len(right_half) while i < left_length and j < right_length: if left_half[i] < right_half[j]: collection[k] = left_half[i] i += 1 else: collection[k] = right_half[j] j += 1 k += 1 while i < left_length: collection[k] = left_half[i] i += 1 k += 1 while j < right_length: collection[k] = right_half[j] j += 1 k += 1 return collection if __name__ == '__main__': import sys # For python 2.x and 3.x compatibility: 3.x has no raw_input builtin # otherwise 2.x's input builtin function is too "smart" if sys.version_info.major < 3: input_function = raw_input else: input_function = input user_input = input_function('Enter numbers separated by a comma:\n') unsorted = [int(item) for item in user_input.split(',')] print(merge_sort(unsorted))
mit
-4,175,166,591,996,086,300
26.957143
73
0.545185
false
3.835227
false
false
false
walterbender/locosugar
toolbar_utils.py
1
5547
# -*- coding: utf-8 -*- # Copyright (c) 2011, Walter Bender # Copyright (c) 2012, Ignacio Rodriguez # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 3 of the License, or # (at your option) any later version. # # You should have received a copy of the GNU General Public License # along with this library; if not, write to the Free Software # Foundation, 51 Franklin Street, Suite 500 Boston, MA 02110-1335 USA from gi.repository import Gtk from sugar3.graphics.radiotoolbutton import RadioToolButton from sugar3.graphics.toolbutton import ToolButton from sugar3.graphics.combobox import ComboBox def combo_factory(combo_array, toolbar, callback, cb_arg=None, tooltip=None, default=None): '''Factory for making a toolbar combo box''' combo = ComboBox() if tooltip is not None and hasattr(combo, 'set_tooltip_text'): combo.set_tooltip_text(tooltip) if cb_arg is not None: combo.connect('changed', callback, cb_arg) else: combo.connect('changed', callback) for i, selection in enumerate(combo_array): combo.append_item(i, selection, None) combo.show() toolitem = Gtk.ToolItem() toolitem.add(combo) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: # or a secondary toolbar toolbar.props.page.insert(toolitem, -1) toolitem.show() if default is not None: combo.set_active(combo_array.index(default)) return combo def entry_factory(default_string, toolbar, tooltip=None, max=3): ''' Factory for adding a text box to a toolbar ''' entry = Gtk.Entry() entry.set_text(default_string) if tooltip is not None and hasattr(entry, 'set_tooltip_text'): entry.set_tooltip_text(tooltip) entry.set_width_chars(max) entry.show() toolitem = Gtk.ToolItem() toolitem.add(entry) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: # or a secondary toolbar toolbar.props.page.insert(toolitem, -1) toolitem.show() return entry def button_factory(icon_name, toolbar, callback, cb_arg=None, tooltip=None, accelerator=None): '''Factory for making tooplbar buttons''' button = ToolButton(icon_name) if tooltip is not None: button.set_tooltip(tooltip) button.props.sensitive = True if accelerator is not None: button.props.accelerator = accelerator if cb_arg is not None: button.connect('clicked', callback, cb_arg) else: button.connect('clicked', callback) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(button, -1) else: # or a secondary toolbar toolbar.props.page.insert(button, -1) button.show() return button def radio_factory(name, toolbar, callback, cb_arg=None, tooltip=None, group=None): ''' Add a radio button to a toolbar ''' button = RadioToolButton(group=group) button.set_icon_name(name) if callback is not None: if cb_arg is None: button.connect('clicked', callback) else: button.connect('clicked', callback, cb_arg) if hasattr(toolbar, 'insert'): # Add button to the main toolbar... toolbar.insert(button, -1) else: # ...or a secondary toolbar. toolbar.props.page.insert(button, -1) button.show() if tooltip is not None: button.set_tooltip(tooltip) return button def label_factory(toolbar, label_text, width=None): ''' Factory for adding a label to a toolbar ''' label = Gtk.Label(label_text) label.set_line_wrap(True) if width is not None: label.set_size_request(width, -1) # doesn't work on XOs label.show() toolitem = Gtk.ToolItem() toolitem.add(label) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: # or a secondary toolbar toolbar.props.page.insert(toolitem, -1) toolitem.show() return label def separator_factory(toolbar, expand=False, visible=True): ''' add a separator to a toolbar ''' separator = Gtk.SeparatorToolItem() separator.props.draw = visible separator.set_expand(expand) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(separator, -1) else: # or a secondary toolbar toolbar.props.page.insert(separator, -1) separator.show() def image_factory(image, toolbar, tooltip=None): ''' Add an image to the toolbar ''' img = Gtk.Image() img.set_from_pixbuf(image) img_tool = Gtk.ToolItem() img_tool.add(img) if tooltip is not None: img.set_tooltip_text(tooltip) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(img_tool, -1) else: # or a secondary toolbar toolbar.props.page.insert(img_tool, -1) img_tool.show() return img def spin_factory(default, min, max, callback, toolbar): spin_adj = Gtk.Adjustment(default, min, max, 1, 32, 0) spin = Gtk.SpinButton(spin_adj, 0, 0) spin_id = spin.connect('value-changed', callback) spin.set_numeric(True) spin.show() toolitem = Gtk.ToolItem() toolitem.add(spin) if hasattr(toolbar, 'insert'): # the main toolbar toolbar.insert(toolitem, -1) else: toolbar.props.page.insert(toolitem, -1) toolitem.show() return spin
gpl-3.0
-9,041,999,313,022,829,000
33.240741
75
0.658194
false
3.601948
false
false
false
ionux/bitforge
tests/unit.py
1
1117
from bitforge.unit import Unit class TestUnit: def test_btc_accessors(self): u = Unit(btc = 1.2) assert u.btc == 1.2 assert u.mbtc == 1200 assert u.bits == 1200000 assert u.satoshis == 120000000 def test_btc_conversion(self): u = Unit(btc = 1.3) assert u.mbtc == 1300 assert u.bits == 1300000 assert u.satoshis == 130000000 u = Unit(mbtc = 1.3) assert u.btc == 0.0013 assert u.bits == 1300 assert u.satoshis == 130000 u = Unit(bits = 1.3) assert u.btc == 0.0000013 assert u.mbtc == 0.0013 assert u.satoshis == 130 u = Unit(satoshis = 3) assert u.btc == 0.00000003 assert u.mbtc == 0.00003 assert u.bits == 0.03 # TODO: Review presition # def test_unit_rates(self): # u = Unit.from_fiat(1.3, 350) # assert u.at_rate(350) == 1.3 # u = Unit(btc = 0.0123) # assert u.at_rate(10) == 0.12 def test_repr(self): u = Unit(btc = 1.3) assert repr(u) == '<Unit: 130000000 satoshis>'
mit
5,227,069,257,949,842,000
24.386364
54
0.522829
false
3.002688
false
false
false
markbenvenuto/buildbaron
bfg_analyzer.py
1
24487
#!/usr/bin/env python3 """ Script to analyze the Jira Build Baron Queue """ import argparse import binascii import datetime import dateutil import dateutil.relativedelta import hashlib import json import os import pprint import re import requests import stat import sys if __name__ == "__main__" and __package__ is None: sys.path.append(os.path.dirname(os.path.dirname(os.path.abspath(os.path.realpath(__file__))))) import buildbaron.analyzer.analyzer_config import buildbaron.analyzer.evergreen import buildbaron.analyzer.evg_log_file_analyzer import buildbaron.analyzer.faultinfo import buildbaron.analyzer.jira_client import buildbaron.analyzer.log_file_analyzer import buildbaron.analyzer.logkeeper import buildbaron.analyzer.mongo_client import buildbaron.analyzer.parallel_failure_analyzer import buildbaron.analyzer.timeout_file_analyzer # URL of the default Jira server. # If you use .com, it breaks horribly def ParseJiraTicket(issue, summary, description): # Parse summary if "System Failure:" in summary: type = "system_failure" elif "Timed Out:" in summary: type = "timed_out" elif "Failures" in summary: type = "test_failure" elif "Failure" in summary: type = "test_failure" elif "Failed" in summary: type = "task_failure" else: raise ValueError("Unknown summary " + str(summary)) suite, build_variant, project, githash = ("unknown", "unknown", "unknown", "unknown") summary_match = re.match(".*?: (.*) on (.*) \[(.*) @ ([a-zA-Z0-9]+)\]", summary) if summary_match: suite, build_variant, project, githash = summary_match.groups() # Parse Body of description lines = description.split("\n") tests = [] for line in lines: if line.startswith('h2.'): url_match = re.search("\|(.*)\]", line) task_url = url_match.group(1) elif "[Logs|" in line: log_line_match = re.match("\*(.*)\* - \[Logs\|(.*?)\]", line) if log_line_match: test_name = log_line_match.group(1) log_file = log_line_match.group(2) tests.append({'name': test_name, 'log_file': log_file}) else: pass return bfg_fault_description(issue, summary, type, project, githash, task_url, suite, build_variant, tests) class bfg_fault_description: """Parse a fault description into type""" def __init__(self, issue, summary, type, project, githash, task_url, suite, build_variant, tests): self.issue = issue self.summary = summary self.type = type self.project = project self.githash = githash self.task_url = task_url self.suite = suite self.build_variant = build_variant self.tests = tests def to_json(self): return json.dumps(self, cls=BFGCustomEncoder) class BFGCustomEncoder(json.JSONEncoder): def default(self, obj): if isinstance(obj, bfg_fault_description): return { "issue": obj.issue, "summary": obj.summary, "type": obj.type, "task_url": obj.task_url, "project": obj.project, "githash": obj.githash, "suite": obj.suite, "build_variant": obj.build_variant, "tests": obj.tests } # Let the base class default method raise the TypeError return json.JSONEncoder.default(self, obj) class BFGCustomDecoder(json.JSONDecoder): def __init__(self, *args, **kwargs): json.JSONDecoder.__init__(self, object_hook=self.object_hook, *args, **kwargs) def object_hook(self, obj): if 'task_url' not in obj and "project" not in obj: return obj return bfg_fault_description(obj['issue'], obj['summary'], obj['type'], obj['project'], obj['task_url'], obj['suite'], obj['build_variant'], obj['tests']) class bfg_analyzer(object): """description of class""" __STACK_FRAME_EXTRACTING_REGEX = re.compile( "([a-zA-Z0-9\./]*)@((?:[a-zA-Z0-9_()]+/?)+\.js):(\d+)(?::\d+)?$") def __init__(self, jira_client): self.jira_client = jira_client self.evg_client = buildbaron.analyzer.evergreen.client() self.pp = pprint.PrettyPrinter() def query(self, query_str): results = self.jira_client.search_issues(query_str, maxResults=100) print("Result Count %d" % len(results)) bfs = [] for result in results: bfs.append(ParseJiraTicket( result.key, result.fields.summary, result.fields.description )) # Save to disk to help investigation of bad results bfs_str = json.dumps(bfs, cls=BFGCustomEncoder, indent="\t") with open("bfs.json", "wb") as sjh: sjh.write(bfs_str.encode()) # Return a list of dictionaries instead of a list of bfg_fault_description return json.loads(bfs_str) def check_logs(self, bfs): summaries = [] for bf in bfs: summaries.append(self.process_bf(bf)) jira_issue = self.jira_client.get_bfg_issue(bf["issue"]) jira_issue.fields.labels.append("bot-analyzed") jira_issue.add_field_value("labels", "bot-analyzed") return summaries # TODO: parallelize the check_logs function with this since we are network bound # builds = thread_map( lambda item : process_bf(base_url, item), commits) def thread_map(func, items): # We can use a with statement to ensure threads are cleaned up promptly with concurrent.futures.ThreadPoolExecutor(max_workers=cpu_count() * 2) as executor: # Start the load operations and mark each future with its URL future_to_item = {executor.submit(func, item): item for item in items} results = [] for future in concurrent.futures.as_completed(future_to_item): item = future_to_item[future] try: nf = future.result() if nf: results += nf except Exception as exc: print('%r generated an exception: %s' % (item, exc)) return results def create_bf_cache(self, bf): """Create a directory to cache the log file in""" if not os.path.exists("cache"): os.mkdir("cache") if not os.path.exists(os.path.join("cache", "bf")): os.mkdir(os.path.join("cache", "bf")) m = hashlib.sha1() m.update(bf["task_url"].encode()) digest = m.digest() digest64 = binascii.b2a_hex(digest).decode() bf["hash"] = digest64 path = os.path.join("cache", "bf", digest64) bf["bf_cache"] = path if not os.path.exists(path): os.mkdir(path) def create_test_cache(self, bf, test): """Create a directory to cache the log file in""" m = hashlib.sha1() m.update(test["name"].encode()) digest = m.digest() digest64 = binascii.b2a_hex(digest).decode() test["hash"] = digest64 path = os.path.join(bf['bf_cache'], digest64) test["cache"] = path if not os.path.exists(path): os.mkdir(path) def process_bf(self, bf): """ Process a log through the log file analyzer Saves analysis information in cache\XXX\summary.json """ self.create_bf_cache(bf) print("BF: " + str(bf)) summary_json_file = os.path.join(bf["bf_cache"], "summary.json") # If we've already analyzed this failure, don't do it again. if os.path.exists(summary_json_file): with open(summary_json_file, "rb") as summary_file: return json.loads(summary_file.read().decode('utf-8')) system_log_url = buildbaron.analyzer.evergreen.task_get_system_raw_log(bf['task_url']) task_log_file_url = buildbaron.analyzer.evergreen.task_get_task_raw_log(bf["task_url"]) bf['system_log_url'] = system_log_url bf['task_log_file_url'] = task_log_file_url # Will be populated with objects like {"test": <test name>, "faults": [...]} tests_fault_info = [] # Will be populated with fault objects. extracted_faults = self.process_task_failure(bf) if bf['type'] == 'test_failure': # Go through each test for test in bf['tests']: tests_fault_info.append({ "test": test["name"], "faults": self.process_test(bf, test) }) elif bf['type'] == 'system_failure': extracted_faults.extend(self.process_system_failure(bf)) elif bf['type'] == 'timed_out': task_faults, test_faults = self.process_time_out(bf) extracted_faults.extend(task_faults) tests_fault_info.extend(test_faults) try: summary_obj = { "bfg_info": bf, "faults": [fault.to_json() for fault in extracted_faults], "test_faults": [ {"test": info["test"], "faults": [fault.to_json() for fault in info["faults"]]} for info in tests_fault_info ], "backtraces": [], } except TypeError: summary_obj = { "bfg_info": bf, "faults": [fault.to_json() for fault in extracted_faults], "backtraces": [], } summary_str = json.dumps(summary_obj) def flatten(a): flattened = [] for elem in a: if type(elem) == list: flattened.extend(elem) else: flattened.append(elem) return flattened # Update jira tickets to include new information. try: all_faults = (extracted_faults + flatten([testinfo["faults"] for testinfo in tests_fault_info])) except: all_faults = extracted_faults for fault in all_faults: self.jira_client.add_fault_comment(bf["issue"], fault) if fault.category == "js backtrace": backtrace = self.build_backtrace(fault, bf["githash"]) self.jira_client.add_github_backtrace_context(bf["issue"], backtrace) summary_obj["backtraces"].append(backtrace) with open(summary_json_file, "wb") as sjh: sjh.write(summary_str.encode()) return summary_obj def build_backtrace(self, fault, githash): """ returns a list of strings representing a backtrace, as well as a parsed version represented as a list of objects of the form { "github_url": "https://github.com/mongodb/mongo/blob/deadbeef/jstests/core/test.js#L42", "first_line_number": 37, "line_number": 42, "frame_number": 0, "file_path": "jstests/core/test.js", "file_name": "test.js", "lines": ["line 37", "line 38", ..., "line 47"] } """ trace = [] # Also populate a plain-text style backtrace, with github links to frames. n_lines_of_context = 5 stack_lines = fault.context.splitlines() # Traverse the stack frames in reverse. for i in range(len(stack_lines) - 1, -1, -1): line = stack_lines[i].replace("\\", "/") # Normalize separators. stack_match = bfg_analyzer.__STACK_FRAME_EXTRACTING_REGEX.search(line) if stack_match is None: if re.search("failed to load", line) is not None: continue # skip that line, it's expected. break # any other line should be the end of the backtrace (func_name, file_path, line_number) = stack_match.groups() gui_github_url = ( "https://github.com/mongodb/mongo/blob/{githash}/{file_path}#L{line_number}".format( githash=githash, file_path=file_path, line_number=line_number)) line_number = int(line_number) # add a {code} frame to the comment, showing the line involved in the stack trace, with # some context of surrounding lines. Don't do this for the stack frames within # src/mongo/shell, since they tend not to be as interesting. if "src/mongo/shell" in file_path: continue raw_github_url = ( "https://raw.githubusercontent.com/mongodb/mongo/{githash}/{file_path}".format( githash=githash, file_path=file_path)) raw_code = requests.get(raw_github_url).text start_line = max(0, line_number - n_lines_of_context) end_line = line_number + n_lines_of_context code_context = raw_code.splitlines()[start_line:end_line] file_name = file_path[file_path.rfind("/") + 1:] trace.append({ "github_url": gui_github_url, "first_line_number": start_line, "line_number": line_number, "frame_number": i, "file_path": file_path, "file_name": file_name, "lines": code_context }) return trace def process_system_failure(self, bf): cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") bf['log_file_url'] = bf['task_log_file_url'] bf['name'] = 'task' if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['task_log_file_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') analyzer = buildbaron.analyzer.evg_log_file_analyzer.EvgLogFileAnalyzer(log_file_str) analyzer.analyze() faults = analyzer.get_faults() if len(faults) == 0: print("===========================") print("No system failure faults detected: " + self.pp.pformat(bf)) print("To Debug: python analyzer" + os.path.sep + "log_file_analyzer.py " + log_file) print("===========================") return faults def process_task_failure(self, bf): cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") bf['log_file_url'] = bf['task_log_file_url'] bf['name'] = 'task' if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['task_log_file_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') extracted_faults = [] analyzer = buildbaron.analyzer.evg_log_file_analyzer.EvgLogFileAnalyzer(log_file_str) analyzer.analyze() extracted_faults.extend(analyzer.get_faults()) oom_analyzer = self.check_for_oom_killer(bf) if oom_analyzer is not None: extracted_faults.extend(oom_analyzer.get_faults()) return extracted_faults def process_time_out(self, bf): """ Returns a list of faults at the task level, and also a list of faults at the test level, which is populated with test faults if any are determined to have timed out. """ cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") bf['log_file_url'] = bf['task_log_file_url'] bf['name'] = 'task' if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['task_log_file_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') task_faults = [] test_faults = [] print("Checking " + log_file) analyzer = buildbaron.analyzer.timeout_file_analyzer.TimeOutAnalyzer(log_file_str) analyzer.analyze() task_faults.extend(analyzer.get_faults()) incomplete_tests = analyzer.get_incomplete_tests() if len(incomplete_tests) == 0: if len(task_faults) == 0: print("===========================") print("No faults found for task: " + self.pp.pformat(bf)) print("To Debug: python analyzer" + os.path.sep + "timeout_file_analyzer.py " + log_file) print("===========================") for incomplete_test in incomplete_tests: jira_issue = self.jira_client.get_bfg_issue(bf["issue"]) timeout_comment = ( "*" + incomplete_test["name"] + " timed out* - [Logs|" + incomplete_test["log_file"] + "]" ) try: if "bot-analyzed" not in jira_issue.fields.labels: jira_issue.update( description=jira_issue.fields.description + "\n{0}\n".format(timeout_comment)) except buildbaron.analyzer.jira_client.JIRAError as e: print("Error updating jira: " + str(e)) test_faults.extend(self.process_test(bf, incomplete_test)) return task_faults, test_faults def process_test(self, bf, test): self.create_test_cache(bf, test) cache_dir = test["cache"] log_file = os.path.join(cache_dir, "test.log") # TODO(CWS) what is this? nested_test = test for key in bf.keys(): if key != 'tests' and key != 'name': nested_test[key] = bf[key] faults = [] # If logkeeper is down, we will not have a log file :-( if test["log_file"] is not None and test["log_file"] != "" and "test/None" not in test[ "log_file"] and "log url not available" not in test["log_file"]: if not os.path.exists(log_file): buildbaron.analyzer.logkeeper.retieve_raw_log(test["log_file"], log_file) test["log_file_url"] = buildbaron.analyzer.logkeeper.get_raw_log_url( test["log_file"]) log_file_stat = os.stat(log_file) if log_file_stat[stat.ST_SIZE] > 50 * 1024 * 1024: print("Skipping Large File : " + str(log_file_stat[stat.ST_SIZE])) return [] else: test["log_file_url"] = "none" with open(log_file, "wb") as lfh: lfh.write("Logkeeper was down\n".encode()) log_file_stat = os.stat(log_file) if log_file_stat[stat.ST_SIZE] > 50 * 1024 * 1024: print("Skipping Large File : " + str(log_file_stat[stat.ST_SIZE]) + " at " + str( log_file)) return [] with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') print("Checking Log File") LFS = buildbaron.analyzer.log_file_analyzer.LogFileSplitter(log_file_str) analyzer = buildbaron.analyzer.log_file_analyzer.LogFileAnalyzer(LFS.get_streams()) analyzer.analyze() faults.extend(analyzer.get_faults()) if test["name"].startswith("basic") and test["name"].endswith(".js"): print("Anlyzing basic.js or basicPlus.js failure") parallel_analyzer = \ buildbaron.analyzer.parallel_failure_analyzer.ParallelTestFailureAnalyzer( log_file_str) parallel_analyzer.analyze() faults.extend(parallel_analyzer.get_faults()) if len(faults) == 0: print("===========================") print("No faults found for test: " + self.pp.pformat(bf)) print("To Debug: python analyzer" + os.path.sep + "log_file_analyzer.py " + log_file) print("===========================") return faults def check_for_oom_killer(self, bf): cache_dir = bf["bf_cache"] log_file = os.path.join(cache_dir, "test.log") if not os.path.exists(log_file): self.evg_client.retrieve_file(bf['system_log_url'], log_file) with open(log_file, "rb") as lfh: log_file_str = lfh.read().decode('utf-8') analyzer = buildbaron.analyzer.evg_log_file_analyzer.EvgLogFileAnalyzer(log_file_str) analyzer.analyze_oom() if len(analyzer.get_faults()) > 0: return analyzer return None def query_bfg_str(start, end): # Dates should be formatted as 2017-01-25 return ('project = bfg' ' AND resolution is EMPTY' ' AND created > {createdStart}' ' AND created <= {createdEnd}' ' AND summary !~ "System Failure:"' ' ORDER BY created DESC'.format( createdStart=start.strftime("%Y-%m-%d"), createdEnd=end.strftime("%Y-%m-%d"))) def get_last_week_query(): today = datetime.date.today() # The start of build baron - if today is Wednesday, returns prior Wednesday otherwise return # prior x2 Wednesday last_wednesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(-2)) # The end of build baron last_tuesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(-1)) return query_bfg_str(last_wednesday, last_tuesday) def get_this_week_query(): today = datetime.date.today() # The start of build baron - last Wednesday (or today if today is Wednesday) next_wednesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(-1)) # The end of build baron - this Wednesday this_tuesday = today + dateutil.relativedelta.relativedelta( weekday=dateutil.relativedelta.WE(2)) return query_bfg_str(next_wednesday, this_tuesday) def main(): parser = argparse.ArgumentParser(description='Analyze test failure in jira.') group = parser.add_argument_group("Jira options") group.add_argument( '--jira_server', type=str, help="Jira Server to query", default=buildbaron.analyzer.analyzer_config.jira_server()) group.add_argument( '--jira_user', type=str, help="Jira user name", default=buildbaron.analyzer.analyzer_config.jira_user()) group = parser.add_mutually_exclusive_group() group.add_argument( '--last_week', action='store_true', help="Query of Last week's build baron queue") group.add_argument( '--this_week', action='store_true', help="Query of This week's build baron queue") group.add_argument('--query_str', type=str, help="Any query against implicitly the BFG project") args = parser.parse_args() if args.query_str: query_str = "(PROJECT = BFG) AND (%s)" % args.query_str elif args.last_week: query_str = get_last_week_query() else: query_str = get_this_week_query() print("Query: %s" % query_str) # Connect to mongod print("Initializing local MongoDB server...") buildbaron.analyzer.mongo_client.reinit_db() # Connect to jira jira_client = buildbaron.analyzer.jira_client.jira_client(args.jira_server, args.jira_user) # Create our analyzer bfa = bfg_analyzer(jira_client) # Fetch desired BFG tickets bfs = bfa.query(query_str) # Analyze for failure failed_bfs = bfa.check_logs(bfs) print("Total BFs to investigate %d\n" % len(failed_bfs)) failed_bfs_root = { 'query': query_str, 'date': datetime.datetime.now().isoformat(' '), 'bfs': failed_bfs } with open("failed_bfs.json", "w", encoding="utf8") as sjh: json.dump(failed_bfs_root, sjh, indent="\t") buildbaron.analyzer.mongo_client.load_bfs(failed_bfs) if __name__ == '__main__': main()
apache-2.0
-1,692,208,233,766,159,000
34.283862
100
0.556663
false
3.79879
true
false
false
jjscarafia/CUPS-Cloud-Print
reportissues.py
2
2412
#! /bin/sh "true" '''\' if command -v python2 > /dev/null; then exec python2 "$0" "$@" else exec python "$0" "$@" fi exit $? ''' # CUPS Cloudprint - Print via Google Cloud Print # Copyright (C) 2013 Simon Cadman # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. if __name__ == '__main__': # pragma: no cover import sys import os import subprocess libpath = "/usr/local/share/cloudprint-cups/" if not os.path.exists(libpath): libpath = "/usr/share/cloudprint-cups" sys.path.insert(0, libpath) from auth import Auth from printermanager import PrinterManager from ccputils import Utils Utils.SetupLogging() # line below is replaced on commit CCPVersion = "20140814.2 000000" Utils.ShowVersion(CCPVersion) requestors, storage = Auth.SetupAuth(True) printer_manager = PrinterManager(requestors) printers = printer_manager.getPrinters() if printers is None: print "ERROR: No Printers Found" sys.exit(1) for printer in printers: print printer.getCUPSDriverDescription() print "" print printer.getFields() print printer['capabilities'] print "\n" ppdname = printer.getPPDName() p1 = subprocess.Popen( (os.path.join(libpath, 'dynamicppd.py'), 'cat', ppdname.lstrip('-')), stdout=subprocess.PIPE) ppddata = p1.communicate()[0] p = subprocess.Popen(['cupstestppd', '-'], stdout=subprocess.PIPE, stdin=subprocess.PIPE) testdata = p.communicate(ppddata)[0] result = p.returncode print "Result of cupstestppd was " + str(result) print "".join(testdata) if result != 0: print "cupstestppd errored: " print ppddata print "\n"
gpl-3.0
-9,007,118,623,980,421,000
32.5
97
0.648425
false
3.716487
false
false
false
gzamboni/sdnResilience
loxi/of14/queue_stats_prop.py
1
3603
# Copyright (c) 2008 The Board of Trustees of The Leland Stanford Junior University # Copyright (c) 2011, 2012 Open Networking Foundation # Copyright (c) 2012, 2013 Big Switch Networks, Inc. # See the file LICENSE.pyloxi which should have been included in the source distribution # Automatically generated by LOXI from template module.py # Do not modify import struct import loxi import util import loxi.generic_util import sys ofp = sys.modules['loxi.of14'] class queue_stats_prop(loxi.OFObject): subtypes = {} def __init__(self, type=None): if type != None: self.type = type else: self.type = 0 return def pack(self): packed = [] packed.append(struct.pack("!H", self.type)) packed.append(struct.pack("!H", 0)) # placeholder for length at index 1 length = sum([len(x) for x in packed]) packed[1] = struct.pack("!H", length) return ''.join(packed) @staticmethod def unpack(reader): subtype, = reader.peek('!H', 0) subclass = queue_stats_prop.subtypes.get(subtype) if subclass: return subclass.unpack(reader) obj = queue_stats_prop() obj.type = reader.read("!H")[0] _length = reader.read("!H")[0] orig_reader = reader reader = orig_reader.slice(_length, 4) return obj def __eq__(self, other): if type(self) != type(other): return False if self.type != other.type: return False return True def pretty_print(self, q): q.text("queue_stats_prop {") with q.group(): with q.indent(2): q.breakable() q.breakable() q.text('}') class experimenter(queue_stats_prop): subtypes = {} type = 65535 def __init__(self, experimenter=None, exp_type=None): if experimenter != None: self.experimenter = experimenter else: self.experimenter = 0 if exp_type != None: self.exp_type = exp_type else: self.exp_type = 0 return def pack(self): packed = [] packed.append(struct.pack("!H", self.type)) packed.append(struct.pack("!H", 0)) # placeholder for length at index 1 packed.append(struct.pack("!L", self.experimenter)) packed.append(struct.pack("!L", self.exp_type)) length = sum([len(x) for x in packed]) packed[1] = struct.pack("!H", length) return ''.join(packed) @staticmethod def unpack(reader): subtype, = reader.peek('!L', 4) subclass = experimenter.subtypes.get(subtype) if subclass: return subclass.unpack(reader) obj = experimenter() _type = reader.read("!H")[0] assert(_type == 65535) _length = reader.read("!H")[0] orig_reader = reader reader = orig_reader.slice(_length, 4) obj.experimenter = reader.read("!L")[0] obj.exp_type = reader.read("!L")[0] return obj def __eq__(self, other): if type(self) != type(other): return False if self.experimenter != other.experimenter: return False if self.exp_type != other.exp_type: return False return True def pretty_print(self, q): q.text("experimenter {") with q.group(): with q.indent(2): q.breakable() q.text("exp_type = "); q.text("%#x" % self.exp_type) q.breakable() q.text('}') queue_stats_prop.subtypes[65535] = experimenter
gpl-2.0
4,146,537,638,850,166,000
27.824
88
0.566472
false
3.800633
false
false
false
virtualopensystems/nova
nova/virt/hyperv/driver.py
1
9838
# Copyright (c) 2010 Cloud.com, Inc # Copyright (c) 2012 Cloudbase Solutions Srl # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ A Hyper-V Nova Compute driver. """ from nova.i18n import _ from nova.openstack.common import log as logging from nova.virt import driver from nova.virt.hyperv import hostops from nova.virt.hyperv import livemigrationops from nova.virt.hyperv import migrationops from nova.virt.hyperv import rdpconsoleops from nova.virt.hyperv import snapshotops from nova.virt.hyperv import vmops from nova.virt.hyperv import volumeops LOG = logging.getLogger(__name__) class HyperVDriver(driver.ComputeDriver): def __init__(self, virtapi): super(HyperVDriver, self).__init__(virtapi) self._hostops = hostops.HostOps() self._volumeops = volumeops.VolumeOps() self._vmops = vmops.VMOps() self._snapshotops = snapshotops.SnapshotOps() self._livemigrationops = livemigrationops.LiveMigrationOps() self._migrationops = migrationops.MigrationOps() self._rdpconsoleops = rdpconsoleops.RDPConsoleOps() def init_host(self, host): pass def list_instances(self): return self._vmops.list_instances() def spawn(self, context, instance, image_meta, injected_files, admin_password, network_info=None, block_device_info=None): self._vmops.spawn(context, instance, image_meta, injected_files, admin_password, network_info, block_device_info) def reboot(self, context, instance, network_info, reboot_type, block_device_info=None, bad_volumes_callback=None): self._vmops.reboot(instance, network_info, reboot_type) def destroy(self, context, instance, network_info, block_device_info=None, destroy_disks=True, migrate_data=None): self._vmops.destroy(instance, network_info, block_device_info, destroy_disks) def cleanup(self, context, instance, network_info, block_device_info=None, destroy_disks=True, migrate_data=None, destroy_vifs=True): """Cleanup after instance being destroyed by Hypervisor.""" pass def get_info(self, instance): return self._vmops.get_info(instance) def attach_volume(self, context, connection_info, instance, mountpoint, disk_bus=None, device_type=None, encryption=None): return self._volumeops.attach_volume(connection_info, instance['name']) def detach_volume(self, connection_info, instance, mountpoint, encryption=None): return self._volumeops.detach_volume(connection_info, instance['name']) def get_volume_connector(self, instance): return self._volumeops.get_volume_connector(instance) def get_available_resource(self, nodename): return self._hostops.get_available_resource() def get_host_stats(self, refresh=False): return self._hostops.get_host_stats(refresh) def host_power_action(self, host, action): return self._hostops.host_power_action(host, action) def snapshot(self, context, instance, image_id, update_task_state): self._snapshotops.snapshot(context, instance, image_id, update_task_state) def pause(self, instance): self._vmops.pause(instance) def unpause(self, instance): self._vmops.unpause(instance) def suspend(self, instance): self._vmops.suspend(instance) def resume(self, context, instance, network_info, block_device_info=None): self._vmops.resume(instance) def power_off(self, instance, timeout=0, retry_interval=0): # TODO(PhilDay): Add support for timeout (clean shutdown) self._vmops.power_off(instance) def power_on(self, context, instance, network_info, block_device_info=None): self._vmops.power_on(instance) def live_migration(self, context, instance, dest, post_method, recover_method, block_migration=False, migrate_data=None): self._livemigrationops.live_migration(context, instance, dest, post_method, recover_method, block_migration, migrate_data) def rollback_live_migration_at_destination(self, context, instance, network_info, block_device_info, destroy_disks=True, migrate_data=None): self.destroy(context, instance, network_info, block_device_info) def pre_live_migration(self, context, instance, block_device_info, network_info, disk_info, migrate_data=None): self._livemigrationops.pre_live_migration(context, instance, block_device_info, network_info) def post_live_migration_at_destination(self, context, instance, network_info, block_migration=False, block_device_info=None): self._livemigrationops.post_live_migration_at_destination( context, instance, network_info, block_migration) def check_can_live_migrate_destination(self, context, instance, src_compute_info, dst_compute_info, block_migration=False, disk_over_commit=False): return self._livemigrationops.check_can_live_migrate_destination( context, instance, src_compute_info, dst_compute_info, block_migration, disk_over_commit) def check_can_live_migrate_destination_cleanup(self, context, dest_check_data): self._livemigrationops.check_can_live_migrate_destination_cleanup( context, dest_check_data) def check_can_live_migrate_source(self, context, instance, dest_check_data): return self._livemigrationops.check_can_live_migrate_source( context, instance, dest_check_data) def get_instance_disk_info(self, instance_name, block_device_info=None): pass def plug_vifs(self, instance, network_info): """Plug VIFs into networks.""" msg = _("VIF plugging is not supported by the Hyper-V driver.") raise NotImplementedError(msg) def unplug_vifs(self, instance, network_info): """Unplug VIFs from networks.""" msg = _("VIF unplugging is not supported by the Hyper-V driver.") raise NotImplementedError(msg) def ensure_filtering_rules_for_instance(self, instance, network_info): LOG.debug("ensure_filtering_rules_for_instance called", instance=instance) def unfilter_instance(self, instance, network_info): LOG.debug("unfilter_instance called", instance=instance) def migrate_disk_and_power_off(self, context, instance, dest, flavor, network_info, block_device_info=None, timeout=0, retry_interval=0): # TODO(PhilDay): Add support for timeout (clean shutdown) return self._migrationops.migrate_disk_and_power_off(context, instance, dest, flavor, network_info, block_device_info) def confirm_migration(self, migration, instance, network_info): self._migrationops.confirm_migration(migration, instance, network_info) def finish_revert_migration(self, context, instance, network_info, block_device_info=None, power_on=True): self._migrationops.finish_revert_migration(context, instance, network_info, block_device_info, power_on) def finish_migration(self, context, migration, instance, disk_info, network_info, image_meta, resize_instance, block_device_info=None, power_on=True): self._migrationops.finish_migration(context, migration, instance, disk_info, network_info, image_meta, resize_instance, block_device_info, power_on) def get_host_ip_addr(self): return self._hostops.get_host_ip_addr() def get_host_uptime(self, host): return self._hostops.get_host_uptime() def get_rdp_console(self, context, instance): return self._rdpconsoleops.get_rdp_console(instance)
apache-2.0
4,809,147,517,281,367,000
43.116592
79
0.582639
false
4.523218
false
false
false
MediaMath/qasino
lib/zmq_requestor.py
1
2310
# Copyright (C) 2014 MediaMath, Inc. <http://www.mediamath.com> # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from txzmq import ZmqFactory, ZmqEndpoint, ZmqEndpointType, ZmqREQConnection import logging import json from util import Identity class ZmqRequestor(ZmqREQConnection): def __init__(self, remote_host, port, zmq_factory, data_manager=None): self.data_manager = data_manager self.remote_host = remote_host endpoint = ZmqEndpoint(ZmqEndpointType.connect, "tcp://%s:%d" % (remote_host, port)) ZmqREQConnection.__init__(self, zmq_factory, endpoint) def request_metadata(self): msg = { "op" : "get_table_list", "identity" : Identity.get_identity() } #logging.info("ZmqRequestor: Requesting table list from %s.", self.remote_host) deferred = self.sendMsg(json.dumps(msg)) deferred.callback = self.message_received def send_table(self, table): deferred = self.sendMsg(table.get_json(op="add_table_data", identity=Identity.get_identity())) deferred.callback = self.message_received def message_received(self, msg): response_meta = json.loads(msg[0]) if response_meta == None or response_meta["response_op"] == None: logging.error("ZmqRequestor: bad message response received") elif response_meta["response_op"] == "tables_list": logging.info("ZmqRequestor: Table list response: %s", json.loads(msg[1])) elif response_meta["response_op"] == "ok": logging.info("ZmqRequestor: request OK") elif response_meta["response_op"] == "error": logging.info("ZmqRequestor: request ERROR: " + response_meta["error_message"]) else: logging.error("ZmqRequestor: unknown response: ", response_meta)
apache-2.0
5,312,493,586,066,515,000
38.827586
102
0.679654
false
3.799342
false
false
false
scionrep/scioncc
src/pyon/util/containers.py
1
14330
""" General purpose util classes and functions """ __author__ = 'Adam R. Smith, Michael Meisinger' import collections import datetime import importlib import string import time import simplejson import base64 import uuid import os import re from types import NoneType from copy import deepcopy DICT_LOCKING_ATTR = "__locked__" class DotNotationGetItem(object): """ Drive the behavior for DotList and DotDict lookups by dot notation, JSON-style. """ def _convert(self, val): """ Convert the type if necessary and return if a conversion happened. """ if isinstance(val, dict) and not isinstance(val, DotDict): return DotDict(val), True elif isinstance(val, list) and not isinstance(val, DotList): return DotList(val), True return val, False def __getitem__(self, key): val = super(DotNotationGetItem, self).__getitem__(key) val, converted = self._convert(val) if converted: self[key] = val return val def __contains__(self, item): return hasattr(self, item) class DotList(DotNotationGetItem, list): """ Partner class for DotDict; see that for docs. Both are needed to fully support JSON/YAML blocks. """ #def DotListIterator(list.) def __iter__(self): """ Monkey-patch the "next" iterator method to return modified versions. This will be slow. """ #it = super(DotList, self).__iter__() #it_next = getattr(it, 'next') #setattr(it, 'next', lambda: it_next(it)) #return it for val in super(DotList, self).__iter__(): val, converted = self._convert(val) yield val class DotDict(DotNotationGetItem, dict): """ Subclass of dict that will recursively look up attributes with dot notation. This is primarily for working with JSON-style data in a cleaner way like javascript. Note that this will instantiate a number of child DotDicts when you first access attributes; do not use in performance-critical parts of your code. """ def __dir__(self): return [k for k in self.__dict__.keys() + self.keys() if k != DICT_LOCKING_ATTR] def __getattr__(self, key): """ Make attempts to lookup by nonexistent attributes also attempt key lookups. """ if self.has_key(key): return self[key] if not self.__dict__.has_key(DICT_LOCKING_ATTR): import sys import dis frame = sys._getframe(1) if '\x00%c' % dis.opmap['STORE_ATTR'] in frame.f_code.co_code: self[key] = DotDict() return self[key] raise AttributeError(key) def __setattr__(self, key, value): if key in dir(dict): raise AttributeError('%s conflicts with builtin.' % key) if self.__dict__.has_key(DICT_LOCKING_ATTR): raise AttributeError('Setting %s on a locked DotDict' % key) if isinstance(value, dict): self[key] = DotDict(value) else: self[key] = value def copy(self): return deepcopy(self) def get_safe(self, qual_key, default=None): """ @brief Returns value of qualified key, such as "system.name" or None if not exists. If default is given, returns the default. No exception thrown. """ value = get_safe(self, qual_key) if value is None: value = default return value def lock(self): self.__dict__[DICT_LOCKING_ATTR] = True def clear(self): if self.__dict__.has_key(DICT_LOCKING_ATTR): del self.__dict__[DICT_LOCKING_ATTR] super(DotDict, self).clear() def pop(self, *args, **kwargs): if self.__dict__.has_key(DICT_LOCKING_ATTR): raise AttributeError('Cannot pop on a locked DotDict') return super(DotDict, self).pop(*args, **kwargs) def popitem(self): if self.__dict__.has_key(DICT_LOCKING_ATTR): raise AttributeError('Cannot popitem on a locked DotDict') return super(DotDict, self).popitem() def as_dict(self): return simple_deepcopy(self) @classmethod def fromkeys(cls, seq, value=None): return DotDict(dict.fromkeys(seq, value)) class DictDiffer(object): """ Calculate the difference between two dictionaries as: (1) items added (2) items removed (3) keys same in both but changed values (4) keys same in both and unchanged values """ def __init__(self, current_dict, past_dict): self.current_dict, self.past_dict = current_dict, past_dict self.set_current, self.set_past = set(current_dict.keys()), set(past_dict.keys()) self.intersect = self.set_current.intersection(self.set_past) def added(self): return self.set_current - self.intersect def removed(self): return self.set_past - self.intersect def changed(self): return set(o for o in self.intersect if self.past_dict[o] != self.current_dict[o]) def unchanged(self): return set(o for o in self.intersect if self.past_dict[o] == self.current_dict[o]) def simple_deepcopy(coll): """ Performs a recursive deep copy on given collection, only using dict, list and set collection types and not checking for cycles. """ if isinstance(coll, dict): return {k: simple_deepcopy(v) for k, v in coll.iteritems()} elif isinstance(coll, set): return {simple_deepcopy(v) for v in coll} elif hasattr(coll, "__iter__"): return [simple_deepcopy(v) for v in coll] else: return coll # dict_merge from: http://appdelegateinc.com/blog/2011/01/12/merge-deeply-nested-dicts-in-python/ def quacks_like_dict(object): """ Check if object is dict-like """ return isinstance(object, collections.Mapping) def dict_merge(base, upd, inplace=False): """ Merge two deep dicts non-destructively. Uses a stack to avoid maximum recursion depth exceptions. @param base the dict to merge into @param upd the content to merge @param inplace change base if True, otherwise deepcopy base @retval the merged dict (base if inplace else a merged deepcopy) """ assert quacks_like_dict(base), quacks_like_dict(upd) dst = base if inplace else deepcopy(base) stack = [(dst, upd)] while stack: current_dst, current_src = stack.pop() for key in current_src: if key not in current_dst: current_dst[key] = current_src[key] else: if quacks_like_dict(current_src[key]) and quacks_like_dict(current_dst[key]) : stack.append((current_dst[key], current_src[key])) else: current_dst[key] = current_src[key] return dst def get_safe(dict_instance, keypath, default=None): """ Returns a value with in a nested dict structure from a dot separated path expression such as "system.server.host" or a list of key entries @retval Value if found or None """ try: obj = dict_instance keylist = keypath if type(keypath) is list else keypath.split('.') for key in keylist: obj = obj[key] return obj except Exception as ex: return default def named_any(name): """ Retrieve a Python object by its fully qualified name from the global Python module namespace. The first part of the name, that describes a module, will be discovered and imported. Each subsequent part of the name is treated as the name of an attribute of the object specified by all of the name which came before it. @param name: The name of the object to return. @return: the Python object identified by 'name'. """ if not name: raise Exception("Empty module name") names = name.split('.') module = None mod_mames = names[:] obj_names = [] while not module: if mod_mames: trialname = '.'.join(mod_mames) try: module = importlib.import_module(trialname) except Exception as ex: obj_names.append(mod_mames.pop()) else: if len(names) == 1: raise Exception("No module named %r" % (name,)) else: raise Exception('%r does not name an object' % (name,)) obj = module for n in reversed(obj_names): obj = getattr(obj, n) return obj def for_name(modpath, classname): """ Returns a class of "classname" from module "modname". """ module = __import__(modpath, fromlist=[classname]) classobj = getattr(module, classname) return classobj() def current_time_millis(): return int(round(time.time() * 1000)) get_ion_ts_millis = current_time_millis def get_ion_ts(): """ Returns standard ION representation of a global timestamp. It is defined as a str representing an integer number, the millis in UNIX epoch, which started 1970-01-01 midnight UTC """ return str(current_time_millis()) def get_datetime(ts, local_time=True): """ Returns a naive datetime object in either local time or UTC time based on the given ION timestamp @param ts ION timestamp (str with millis in epoch) @param local_time if True, returns local time (default), otherwise UTC @retval datetime instance, naive """ tsf = float(ts) / 1000 return datetime.datetime.fromtimestamp(tsf) if local_time else datetime.datetime.utcfromtimestamp(tsf) def get_datetime_str(ts, show_millis=False, local_time=True): """ Returns a string with date and time representation from an ION timestamp @param ts ION timestamp (str with millis in epoch) @param show_millis If True, appends the milli seconds @param local_time if True, returns local time (default), otherwise UTC @retval str with ION standard date and time representation """ dt = get_datetime(ts, local_time) dts = str(dt) period_idx = dts.rfind(".") if period_idx != -1: dts = dts[:period_idx+4] if show_millis else dts[:period_idx] return dts def parse_ion_ts(ts): """ Returns a Python timestamp from an ION ts """ return float(ts) / 1000 def is_valid_ts(ts): """ Check if given ts is string with only digits and length of 13 """ # We assume no timestamps before 2001-09 return isinstance(ts, basestring) and len(ts) == 13 and ts.isdigit() and ts[0] != "0" def itersubclasses(cls, _seen=None): """ itersubclasses(cls) http://code.activestate.com/recipes/576949-find-all-subclasses-of-a-given-class/ Generator over all subclasses of a given class, in depth first order. """ if not isinstance(cls, type): raise TypeError('itersubclasses must be called with ' 'new-style classes, not %.100r' % cls) if _seen is None: _seen = set() try: subs = cls.__subclasses__() except TypeError: # fails only when cls is type subs = cls.__subclasses__(cls) for sub in subs: if sub not in _seen: _seen.add(sub) yield sub for sub in itersubclasses(sub, _seen): yield sub def getleafsubclasses(cls): """ Returns all subclasses that have no further subclasses, for the given class """ scls = itersubclasses(cls) return [s for s in scls if not s.__subclasses__()] # _abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789 BASIC_VALID = "_%s%s" % (string.ascii_letters, string.digits) # -_.()abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789 NORMAL_VALID = "-_.() %s%s" % (string.ascii_letters, string.digits) def create_valid_identifier(name, valid_chars=BASIC_VALID, dot_sub=None, ws_sub=None): if dot_sub: name = name.replace('.', dot_sub) if ws_sub: name = name.replace(' ', ws_sub) return str(''.join(c for c in name if c in valid_chars)) def create_basic_identifier(name): return create_valid_identifier(name, dot_sub='_', ws_sub='_') def is_basic_identifier(name): return name == create_basic_identifier(name) def is_valid_identifier(name, valid_chars=BASIC_VALID, dot_sub=None, ws_sub=None): return name == create_valid_identifier(name, valid_chars=valid_chars, dot_sub=dot_sub, ws_sub=ws_sub) #Used by json encoder def ion_object_encoder(obj): return obj.__dict__ def make_json(data): result = simplejson.dumps(data, default=ion_object_encoder, indent=2) return result #Global utility functions for generating unique names and UUIDs # get a UUID - URL safe, Base64 def get_a_Uuid(): r_uuid = base64.urlsafe_b64encode(uuid.uuid4().bytes) return r_uuid.replace('=', '') # generate a unique identifier based on a UUID and optional information def create_unique_identifier(prefix=''): return prefix + '_' + get_a_Uuid() def get_default_sysname(): return 'ion_%s' % os.uname()[1].replace('.', '_') def get_default_container_id(): return string.replace('%s_%d' % (os.uname()[1], os.getpid()), ".", "_") BASIC_TYPE_SET = {str, bool, int, float, long, NoneType} def recursive_encode(obj, encoding="utf8"): """Recursively walks a dict/list collection and in-place encodes any unicode keys and values in dicts and lists to UTF-8 encoded str""" if isinstance(obj, dict): fix_list = None for k, v in obj.iteritems(): if type(k) is unicode: if fix_list is None: fix_list = [] fix_list.append(k) if type(v) in BASIC_TYPE_SET: continue if type(v) is unicode: obj[k] = v.encode(encoding) continue recursive_encode(v, encoding=encoding) if fix_list: for k in fix_list: v = obj.pop(k) newk = k.encode(encoding) obj[newk] = v elif isinstance(obj, list): for i, v in enumerate(obj): if type(v) in BASIC_TYPE_SET: continue if type(v) is unicode: obj[i] = v.encode(encoding) continue recursive_encode(v, encoding=encoding) else: raise RuntimeError("unknown type: %s" % type(obj)) return obj
bsd-2-clause
2,506,083,733,855,044,600
33.200477
108
0.625611
false
3.858374
false
false
false
uweschmitt/emzed
libms/WebserviceClients/Metlin.py
1
3159
import pdb #encoding:latin-1 import requests import urllib2 import userConfig from collections import OrderedDict from ..DataStructures.Table import Table class MetlinMatcher(object): ws_col_names = [ "formula", "mass", "name", "molid"] ws_col_types = [ str, float, str, int] ws_col_formats = [ "%s", "%.5f", "%s", "%d" ] url = "http://metlin.scripps.edu/REST/search/index.php" info_url = "http://metlin.scripps.edu/metabo_info.php?molid=%d" batch_size = 90 # should be 500 as metlin promises, but this is false # the REST webserive of METLIN returns a result set which does not explain # which combination of theoretical mass and adduct results in a match, # which is not what we want. eg one gets the same result set for # masses=[195.0877, 194.07904], adducts=["M"] and for masses=[195.0877], # adducts = ["M", "M+H"] # so we start a separate query for mass and each adduct ! @staticmethod def _query(masses, adduct, ppm): token = userConfig.getMetlinToken() if not token: raise Exception("need metlin token in user config file") params = OrderedDict() params["token"] = token # "DqeN7qBNEAzVNm9n" params["mass[]"] = masses params["adduct[]"] = [adduct] params["tolunits"] = "ppm" params["tolerance"] = ppm r = requests.get(MetlinMatcher.url, params=params) if r.status_code != 200: raise Exception("matlin query %s failed: %s" % (urllib2.unquote(r.url), r.text)) try: j = r.json() except: raise Exception("invalid answer from %s" % r.url) ws_col_names = MetlinMatcher.ws_col_names ws_col_types = MetlinMatcher.ws_col_types ws_col_formats = MetlinMatcher.ws_col_formats info_url = MetlinMatcher.info_url tables = [] for m_z, ji in zip(masses, j): rows = [] if isinstance(ji, dict): ji = ji.values() for jii in ji: if jii: rows.append([t(jii[n])\ for t, n in zip(ws_col_types, ws_col_names)]) if rows: ti = Table(ws_col_names, ws_col_types, ws_col_formats, rows[:]) ti.addColumn("m_z", m_z, insertBefore=0) ti.addColumn("adduct", adduct, insertBefore=1) ti.addColumn("link", ti.molid.apply(lambda d: info_url % d)) tables.append(ti) return tables @staticmethod def query(masses, adducts, ppm): all_tables = [] for adduct in adducts: for i0 in range(0, len(masses), MetlinMatcher.batch_size): mass_slice = masses[i0:i0 + MetlinMatcher.batch_size] tables = MetlinMatcher._query(mass_slice, adduct, ppm) all_tables.extend(tables) result_table = all_tables[0] result_table.append(all_tables[1:]) return result_table if 0: t = MetlinMatcher.query(["282.222813", "292.229272"], 50, "-") t.info() t._print()
gpl-3.0
-3,001,720,266,134,262,300
32.967742
79
0.566318
false
3.467618
false
false
false
KatiRG/flyingpigeon
flyingpigeon/processes/wps_subset_continents.py
1
5476
import os import tarfile from flyingpigeon.subset import clipping from flyingpigeon.subset import _CONTINENTS_ from pywps.Process import WPSProcess from flyingpigeon.log import init_process_logger import logging logger = logging.getLogger(__name__) class subset_continentsProcess(WPSProcess): def __init__(self): WPSProcess.__init__( self, identifier="subset_continents", title="Subset continents", version="0.9", abstract="Returns only the selected polygon for each input dataset", metadata=[ {"title": "LSCE", "href": "http://www.lsce.ipsl.fr/en/index.php"}, {"title": "Documentation", "href": "http://flyingpigeon.readthedocs.io/en/latest/"}, ], statusSupported=True, storeSupported=True ) self.resource = self.addComplexInput( identifier="resource", title="Resource", abstract="NetCDF Files or archive (tar/zip) containing netCDF files", minOccurs=1, maxOccurs=1000, maxmegabites=5000, formats=[{"mimeType": "application/x-netcdf"}, {"mimeType": "application/x-tar"}, {"mimeType": "application/zip"}], ) self.region = self.addLiteralInput( identifier="region", title="Region", default='Africa', type=type(''), minOccurs=1, maxOccurs=len(_CONTINENTS_), allowedValues=_CONTINENTS_ # REGION_EUROPE #COUNTRIES # ) # self.dimension_map = self.addLiteralInput( # identifier="dimension_map", # title="Dimension Map", # abstract= 'if not ordered in lon/lat a dimension map has to be provided', # type=type(''), # minOccurs=0, # maxOccurs=1 # ) self.mosaic = self.addLiteralInput( identifier="mosaic", title="Mosaic", abstract="If Mosaic is checked, selected polygons will be merged to one Mosaic for each input file", default=False, type=type(False), minOccurs=0, maxOccurs=1, ) # self.variable = self.addLiteralInput( # identifier="variable", # title="Variable", # abstract="Variable to be expected in the input files (Variable will be detected if not set)", # default=None, # type=type(''), # minOccurs=0, # maxOccurs=1, # ) self.output = self.addComplexOutput( title="Subsets", abstract="Tar archive containing the netCDF files", formats=[{"mimeType": "application/x-tar"}], asReference=True, identifier="output", ) self.output_netcdf = self.addComplexOutput( title="Subsets for one dataset", abstract="NetCDF file with subsets of one dataset.", formats=[{"mimeType": "application/x-netcdf"}], asReference=True, identifier="ncout", ) self.output_log = self.addComplexOutput( identifier="output_log", title="Logging information", abstract="Collected logs during process run.", formats=[{"mimeType": "text/plain"}], asReference=True, ) def execute(self): from ast import literal_eval from flyingpigeon.utils import archive, archiveextract init_process_logger('log.txt') self.output_log.setValue('log.txt') ncs = archiveextract(self.getInputValues(identifier='resource')) mosaic = self.mosaic.getValue() regions = self.region.getValue() # variable = self.variable.getValue() # logger.info('regions: %s' % regions) # dimension_map = self.dimension_map.getValue() # if dimension_map != None: # dimension_map = literal_eval(dimension_map) logger.info('ncs = %s', ncs) logger.info('regions = %s', regions) logger.info('mosaic = %s', mosaic) # logger.info('dimension_map = %s', dimension_map) self.status.set('Arguments set for subset process', 10) logger.debug('starting: regions=%s, num_files=%s' % (len(regions), len(ncs))) try: results = clipping( resource=ncs, polygons=regions, # self.region.getValue(), mosaic=mosaic, spatial_wrapping='wrap', # variable=variable, dir_output=os.path.abspath(os.curdir), # dimension_map=dimension_map, ) except Exception as e: msg = 'clipping failed' logger.exception(msg) raise Exception(msg) if not results: raise Exception('no results produced.') # prepare tar file try: tarf = archive(results) logger.info('Tar file prepared') except Exception as e: msg = 'Tar file preparation failed' logger.exception(msg) raise Exception(msg) self.output.setValue(tarf) i = next((i for i, x in enumerate(results) if x), None) self.output_netcdf.setValue(results[i]) self.status.set('done', 100)
apache-2.0
-3,787,420,159,431,396,400
33.658228
112
0.546567
false
4.23839
false
false
false
dthain/cctools
chirp/src/bindings/python3/chirp.binding.py
1
22700
## @package ChirpPython # # Python Chirp bindings. # # The objects and methods provided by this package correspond to the native # C API in @ref chirp_reli.h and chirp_swig_wrap.h # # The SWIG-based Python bindings provide a higher-level interface that # revolves around: # # - @ref Chirp.Client # - @ref Chirp.Stat import os import time import json ## # \class Chirp.Client # Python Client object # # This class is used to create a chirp client class Client(object): ## # Create a new chirp client # # @param self Reference to the current task object. # @param hostport The host:port of the server. # @param timeout The time to wait for a server response on every request. # @param authentication A list of prefered authentications. E.g., ['tickets', 'unix'] # @param tickets A list of ticket filenames. # @param debug Generate client debug output. def __init__(self, hostport, timeout=60, authentication=None, tickets=None, debug=False): self.hostport = hostport self.timeout = timeout if debug: cctools_debug_config('chirp_python_client') cctools_debug_flags_set('chirp') if tickets and (authentication is None): authentication = ['ticket'] self.__set_tickets(tickets) if authentication is None: auth_register_all() else: for auth in authentication: auth_register_byname(auth) self.identity = self.whoami() if self.identity == '': raise AuthenticationFailure(authentication) def __exit__(self, exception_type, exception_value, traceback): chirp_reli_disconnect(self.hostport) def __del__(self): chirp_reli_disconnect(self.hostport) def __stoptime(self, absolute_stop_time=None, timeout=None): if timeout is None: timeout = self.timeout if absolute_stop_time is None: absolute_stop_time = time.time() + timeout return absolute_stop_time def __set_tickets(self, tickets): tickets_str = None if tickets is None: try: tickets_str = os.environ['CHIRP_CLIENT_TICKETS'] except KeyError: tickets_str = None else: tickets_str = ','.join(tickets) if tickets_str is not None: auth_ticket_load(tickets_str) ## # Returns a string with identity of the client according to the server. # # @param self Reference to the current task object. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def whoami(self, absolute_stop_time=None, timeout=None): return chirp_wrap_whoami(self.hostport, self.__stoptime(absolute_stop_time, timeout)) ## # Returns a string with the ACL of the given directory. # Throws an IOError on error (no such directory). # # @param self Reference to the current task object. # @param path Target directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def listacl(self, path='/', absolute_stop_time=None, timeout=None): acls = chirp_wrap_listacl(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) if acls is None: raise IOError(path) return acls.split('\n') ## # Returns a string with the ACL of the given directory. # Throws a GeneralError on error. # # @param self Reference to the current task object. # @param path Target directory. # @param subject Target subject. # @param rights Permissions to be granted. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def setacl(self, path, subject, rights, absolute_stop_time=None, timeout=None): result = chirp_reli_setacl(self.hostport, path, subject, rights, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise GeneralFailure('setacl', result, [path, subject, rights]) return result ## # Set the ACL for the given directory to be only for the rights to the calling user. # Throws a GeneralError on error. # # @param self Reference to the current task object. # @param path Target directory. # @param rights Permissions to be granted. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def resetacl(self, path, rights, absolute_stop_time=None, timeout=None): result = chirp_wrap_resetacl(self.hostport, path, rights, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise GeneralFailure('resetacl', result, [path, rights]) return result ## # Returns a list with the names of the files in the path. # Throws an IOError on error (no such directory). # # @param self Reference to the current task object. # @param path Target file/directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def ls(self, path, absolute_stop_time=None, timeout=None): dr = chirp_reli_opendir(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) files = [] if dir is None: raise IOError(path) while True: d = chirp_reli_readdir(dr) if d is None: break files.append(Stat(d.name, d.info)) return files ## # Returns a Chirp.Stat object with information on path. # Throws an IOError on error (e.g., no such path or insufficient permissions). # # @param self Reference to the current task object. # @param path Target file/directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def stat(self, path, absolute_stop_time=None, timeout=None): info = chirp_wrap_stat(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) if info is None: raise IOError(path) return Stat(path, info) ## # Changes permissions on path. # Throws a GeneralFailure on error (e.g., no such path or insufficient permissions). # # @param self Reference to the current task object. # @param path Target file/directory. # @param mode Desired permissions (e.g., 0755) # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def chmod(self, path, mode, absolute_stop_time=None, timeout=None): result = chirp_reli_chmod(self.hostport, path, mode, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise GeneralFailure('chmod', result, [path, mode]) return result ## # Copies local file/directory source to the chirp server as file/directory destination. # If destination is not given, source name is used. # Raises Chirp.TransferFailure on error. # # @param self Reference to the current task object. # @param source A local file or directory. # @param destination File or directory name to use in the server (defaults to source). # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def put(self, source, destination=None, absolute_stop_time=None, timeout=None): if destination is None: destination = source result = chirp_recursive_put(self.hostport, source, destination, self.__stoptime(absolute_stop_time, timeout)) if result > -1: return result raise TransferFailure('put', result, source, destination) ## # Copies server file/directory source to the local file/directory destination. # If destination is not given, source name is used. # Raises Chirp.TransferFailure on error. # # @param self Reference to the current task object. # @param source A server file or directory. # @param destination File or directory name to be used locally (defaults to source). # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def get(self, source, destination=None, absolute_stop_time=None, timeout=None): if destination is None: destination = source result = chirp_recursive_get(self.hostport, source, destination, self.__stoptime(absolute_stop_time, timeout)) if result > -1: return result raise TransferFailure('get', result, source, destination) ## # Removes the given file or directory from the server. # Raises OSError on error. # # @param self Reference to the current task object. # @param path Target file/directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def rm(self, path, absolute_stop_time=None, timeout=None): status = chirp_reli_rmall(self.hostport, path, self.__stoptime(absolute_stop_time, timeout)) if status < 0: raise OSError ## # Recursively create the directories in path. # Raises OSError on error. # # @param self Reference to the current task object. # @param path Target file/directory. # @param mode Unix permissions for the created directory. # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def mkdir(self, path, mode=493, absolute_stop_time=None, timeout=None): result = chirp_reli_mkdir_recursive(self.hostport, path, mode, self.__stoptime(absolute_stop_time, timeout)) if result < 0: raise OSError return result ## # Computes the checksum of path. # Raises IOError on error. # # @param self Reference to the current task object. # @param path Target file. # @param algorithm One of 'md5' or 'sha1' (default). # @param absolute_stop_time If given, maximum number of seconds since # epoch to wait for a server response. # (Overrides any timeout.) # @param timeout If given, maximum number of seconds to # wait for a server response. def hash(self, path, algorithm='sha1', absolute_stop_time=None, timeout=None): hash_hex = chirp_wrap_hash(self.hostport, path, algorithm, self.__stoptime(absolute_stop_time, timeout)) if hash_hex is None: raise IOError return hash_hex ## # Creates a chirp job. See http://ccl.cse.nd.edu/software/manuals/chirp.html for details. # # @param job_description A dictionary with a job chirp description. # # @code # job_description = { # 'executable': "/bin/tar", # 'arguments': [ 'tar', '-cf', 'archive.tar', 'a', 'b' ], # 'files': { 'task_path': 'a', # 'serv_path': '/users/magrat/a.txt' # 'type': 'INPUT' }, # { 'task_path': 'b', # 'serv_path': '/users/magrat/b.txt' # 'type': 'INPUT' }, # { 'task_path': 'archive.tar', # 'serv_path': '/users/magrat/archive.tar' # 'type': 'OUTPUT' } # } # job_id = client.job_create(job_description); # @endcode def job_create(self, job_description): job_json = json.dumps(job_description) job_id = chirp_wrap_job_create(self.hostport, job_json, self.__stoptime()) if job_id < 0: raise ChirpJobError('create', job_id, job_json) return job_id ## # Kills the jobs identified with the different job ids. # # @param job_ids Job ids of the chirp jobs to be killed. # def job_kill(self, *job_ids): ids_str = json.dumps(job_ids) result = chirp_wrap_job_kill(self.hostport, ids_str, self.__stoptime()) if result < 0: raise ChirpJobError('kill', result, ids_str) return result ## # Commits (starts running) the jobs identified with the different job ids. # # @param job_ids Job ids of the chirp jobs to be committed. # def job_commit(self, *job_ids): ids_str = json.dumps(job_ids) result = chirp_wrap_job_commit(self.hostport, ids_str, self.__stoptime()) if result < 0: raise ChirpJobError('commit', result, ids_str) return result ## # Reaps the jobs identified with the different job ids. # # @param job_ids Job ids of the chirp jobs to be reaped. # def job_reap(self, *job_ids): ids_str = json.dumps(job_ids) result = chirp_wrap_job_reap(self.hostport, ids_str, self.__stoptime()) if result < 0: raise ChirpJobError('reap', result, ids_str) return result ## # Obtains the current status for each job id. The value returned is a # list which contains a dictionary reference per job id. # # @param job_ids Job ids of the chirp jobs to be reaped. # def job_status(self, *job_ids): ids_str = json.dumps(job_ids) status = chirp_wrap_job_status(self.hostport, ids_str, self.__stoptime()) if status is None: raise ChirpJobError('status', None, ids_str) return json.loads(status) ## # Waits waiting_time seconds for the job_id to terminate. Return value is # the same as job_status. If the call timesout, an empty string is # returned. If job_id is missing, `<job_wait>` waits for any of the user's job. # # @param waiting_time maximum number of seconds to wait for a job to finish. # @param job_id id of the job to wait. def job_wait(self, waiting_time, job_id=0): status = chirp_wrap_job_wait(self.hostport, job_id, waiting_time, self.__stoptime()) if status is None: raise ChirpJobError('status', None, job_id) return json.loads(status) ## # Python Stat object # # This class is used to record stat information for files/directories of a chirp server. class Stat(object): def __init__(self, path, cstat): self._path = path self._info = cstat ## # Target path. # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.path # @endcode @property def path(self): return self._path ## # ID of device containing file. # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.device # @endcode @property def device(self): return self._info.cst_dev ## # inode number # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.inode # @endcode @property def inode(self): return self._info.cst_ino ## # file mode permissions # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.mode # @endcode @property def mode(self): return self._info.cst_mode ## # number of hard links # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.nlink # @endcode @property def nlink(self): return self._info.cst_nlink ## # user ID of owner # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.uid # @endcode @property def uid(self): return self._info.cst_uid ## # group ID of owner # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.gid # @endcode @property def gid(self): return self._info.cst_gid ## # device ID if special file # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.rdev # @endcode @property def rdev(self): return self._info.cst_rdev ## # total size, in bytes # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.size # @endcode @property def size(self): return self._info.cst_size ## # block size for file system I/O # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.block_size # @endcode @property def block_size(self): return self._info.cst_blksize ## # number of 512B blocks allocated # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.blocks # @endcode @property def blocks(self): return self._info.cst_blocks ## # number of seconds since epoch since last access # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.atime # @endcode @property def atime(self): return self._info.cst_atime ## # number of seconds since epoch since last modification # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.mtime # @endcode @property def mtime(self): return self._info.cst_mtime ## # number of seconds since epoch since last status change # # @a Note: This is defined using property decorator. So it must be called without parentheses # (). For example: # @code # >>> print s.ctime # @endcode @property def ctime(self): return self._info.cst_ctime def __repr__(self): return "%s uid:%d gid:%d size:%d" % (self.path, self.uid, self.gid, self.size) class AuthenticationFailure(Exception): pass class GeneralFailure(Exception): def __init__(self, action, status, value): message = "Error with %s(%s) %s" % (action, status, value) super(GeneralFailure, self).__init__(message) self.action = action self.status = status self.value = value class TransferFailure(Exception): def __init__(self, action, status, source, dest): message = "Error with %s(%s) %s %s" % (action, status, source, dest) super(TransferFailure, self).__init__(message) self.action = action self.status = status self.source = source self.dest = dest class ChirpJobError(Exception): def __init__(self, action, status, value): message = "Error with %s(%s) %s" % (action, status, value) super(ChirpJobError, self).__init__(message) self.action = action self.status = status self.value = value # @endcode
gpl-2.0
-854,934,521,074,259,500
33.869432
118
0.574758
false
4.145362
false
false
false
RudolfCardinal/crate
crate_anon/nlp_manager/cloud_request_sender.py
1
12012
#!/usr/bin/env python """ crate_anon/nlp_manager/cloud_request_sender.py =============================================================================== Copyright (C) 2015-2021 Rudolf Cardinal ([email protected]). This file is part of CRATE. CRATE is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. CRATE is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with CRATE. If not, see <http://www.gnu.org/licenses/>. =============================================================================== **CloudRequestSender class.** """ # ============================================================================= # Imports # ============================================================================= from enum import auto, Enum import logging from typing import ( Any, Dict, List, Optional, Tuple, Generator, TYPE_CHECKING, ) from crate_anon.nlp_manager.constants import ( DEFAULT_REPORT_EVERY_NLP, ) from crate_anon.nlp_manager.input_field_config import ( InputFieldConfig, FN_SRCDB, FN_SRCTABLE, FN_SRCPKFIELD, FN_SRCPKVAL, FN_SRCPKSTR, FN_SRCFIELD, ) from crate_anon.nlp_manager.models import FN_SRCHASH from crate_anon.nlp_manager.cloud_request import ( CloudRequestProcess, RecordNotPrintable, RecordsPerRequestExceeded, RequestTooLong, ) from crate_anon.nlp_manager.cloud_run_info import CloudRunInfo if TYPE_CHECKING: from http.cookiejar import CookieJar log = logging.getLogger(__name__) # ============================================================================= # CloudRequestSender # ============================================================================= class CloudRequestSender(object): """ Class to encapsulate a NLP request outbound to a cloud NLP server. """ class State(Enum): """ Request state. """ BUILDING_REQUEST = auto() SENDING_REQUEST = auto() FINISHED = auto() def __init__( self, text_generator: Generator[Tuple[str, Dict[str, Any]], None, None], crinfo: CloudRunInfo, ifconfig: InputFieldConfig, report_every: int = DEFAULT_REPORT_EVERY_NLP, incremental: bool = False, queue: bool = True) -> None: """ Args: text_generator: Generator that generates text strings from the source database. See :meth:`crate_anon.nlp_manager.input_field_config.InputFieldConfig.gen_text`. crinfo: A :class:`crate_anon.nlp_manager.cloud_run_info.CloudRunInfo` object. ifconfig: An :class:`crate_anon.nlp_manager.input_field_config.InputFieldConfig` object. report_every: Report to the log every *n* requests. incremental: Process in incremental mode (ignoring source records that have not changed since last time)? queue: Queue the requests for back-end processing (rather than waiting for an immediate reply)? """ self._text_generator = text_generator self._crinfo = crinfo self._ifconfig = ifconfig self._report_every = report_every self._incremental = incremental self._queue = queue self._global_recnum = -1 self._requests = [] # type: List[CloudRequestProcess] self._cookies = None # type: Optional[CookieJar] self._request_count = 0 # number of requests sent self._text = None # type: Optional[str] self._other_values = None # type: Optional[Dict[str, Any]] self._request_is_empty = True self._need_new_record = True self._need_new_request = True self._num_recs_processed = 0 self._state = self.State.BUILDING_REQUEST self._request = None # type: Optional[CloudRequestProcess] def send_requests( self, global_recnum: int) -> Tuple[List[CloudRequestProcess], bool, int]: """ Sends off a series of cloud requests and returns them as a list. ``self._queue`` determines whether these are queued requests or not. Also returns whether the generator for the text is empty. Return tuple is: ``requests, some_records_processed, global_recnum``. """ self._global_recnum = global_recnum self._requests = [] self._cookies = None self._request_count = 1 self._text = None self._other_values = None self._request_is_empty = True self._need_new_record = True self._need_new_request = True # Check processors are available available_procs = self._crinfo.get_remote_processors() if not available_procs: return [], False, self._global_recnum self._num_recs_processed = 0 self._state = self.State.BUILDING_REQUEST # If we've reached the limit of records before commit, return to # outer function in order to process and commit (or write to file if # it's a queued request) while self._state != self.State.FINISHED: if self._state == self.State.BUILDING_REQUEST: self._build_request() if self._state == self.State.SENDING_REQUEST: self._send_request() return self._requests, self._num_recs_processed > 0, self._global_recnum # noqa def _build_request(self) -> None: """ Adds another record to the outbound request, until the request is fully built. Updates our state to reflect what needs to happen next. """ if self._need_new_record: try: self._get_next_record() except StopIteration: self._update_state_for_no_more_records() return hasher = self._crinfo.nlpdef.hash srchash = hasher(self._text) if self._incremental and self._record_already_processed(srchash): return self._num_recs_processed += 1 self._other_values[FN_SRCHASH] = srchash if self._need_new_request: self._request = self._get_new_cloud_request() self._request_is_empty = True self._need_new_request = False self._need_new_record = True # Add the text to the cloud request with the appropriate metadata try: self._request.add_text( self._text, self._other_values ) # added OK, request now has some text self._request_is_empty = False except RecordNotPrintable: # Text contained no printable characters. Skip it. pass except (RecordsPerRequestExceeded, RequestTooLong) as e: if isinstance(e, RequestTooLong) and self._request_is_empty: # Get some new text next time log.warning("Skipping text that's too long to send") else: # Try same text again with a fresh request self._need_new_record = False self._state = self.State.SENDING_REQUEST if self._record_limit_reached(): self._state = self.State.SENDING_REQUEST def _get_new_cloud_request(self) -> CloudRequestProcess: """ Creates and returns a new :class:`crate_anon.nlp_manager.cloud_request.CloudRequestProcess` object. """ return CloudRequestProcess(self._crinfo) def _update_state_for_no_more_records(self) -> None: """ No more input records are available. This means either (a) we've sent all our requests and have finished, or (b) we're building our last request and we need to send it. Set the state accordingly. """ if self._request_is_empty or self._need_new_request: # Nothing more to send self._state = self.State.FINISHED return # Send last request self._state = self.State.SENDING_REQUEST def _record_already_processed(self, srchash: str) -> bool: """ Has this source record (identified by its PK and its hash) already been processed? (If so, then in incremental mode, we can skip it.) """ pkval = self._other_values[FN_SRCPKVAL] pkstr = self._other_values[FN_SRCPKSTR] progrec = self._ifconfig.get_progress_record(pkval, pkstr) if progrec is not None: if progrec.srchash == srchash: log.debug("Record previously processed; skipping") return True log.debug("Record has changed") else: log.debug("Record is new") return False def _record_limit_reached(self) -> bool: """ Have we processed as many records as we're allowed before we should COMMIT to the database? """ limit_before_commit = self._crinfo.cloudcfg.limit_before_commit return self._num_recs_processed >= limit_before_commit def _get_next_record(self) -> None: """ Reads the next text record and metadata into ``self._text`` and ``self._other_values``. Raises: :exc:`StopIteration` if there are no more records """ self._text, self._other_values = next(self._text_generator) self._global_recnum += 1 pkval = self._other_values[FN_SRCPKVAL] pkstr = self._other_values[FN_SRCPKSTR] # 'ifconfig.get_progress_record' expects pkstr to be None if it's # empty if not pkstr: pkstr = None if self._report_every and self._global_recnum % self._report_every == 0: # noqa # total number of records in table totalcount = self._ifconfig.get_count() log.info( "Processing {db}.{t}.{c}, PK: {pkf}={pkv} " "(record {g_recnum}/{totalcount})".format( db=self._other_values[FN_SRCDB], t=self._other_values[FN_SRCTABLE], c=self._other_values[FN_SRCFIELD], pkf=self._other_values[FN_SRCPKFIELD], pkv=pkstr if pkstr else pkval, g_recnum=self._global_recnum, totalcount=totalcount ) ) def _send_request(self) -> None: """ Send a pending request to the remote NLP server. Update the state afterwards. """ self._request.send_process_request( queue=self._queue, cookies=self._cookies, include_text_in_reply=self._crinfo.cloudcfg.has_gate_processors ) # If there's a connection error, we only get this far if we # didn't choose to stop at failure if self._request.request_failed: log.warning("Continuing after failed request.") else: if self._request.cookies: self._cookies = self._request.cookies log.info(f"Sent request to be processed: #{self._request_count} " f"of this block") self._request_count += 1 self._requests.append(self._request) if self._record_limit_reached(): self._state = self.State.FINISHED return self._state = self.State.BUILDING_REQUEST self._need_new_request = True
gpl-3.0
-5,249,729,148,744,573,000
34.75
93
0.565851
false
4.297674
true
false
false
tchellomello/home-assistant
homeassistant/components/vesync/switch.py
1
3309
"""Support for VeSync switches.""" import logging from homeassistant.components.switch import SwitchEntity from homeassistant.core import callback from homeassistant.helpers.dispatcher import async_dispatcher_connect from .common import VeSyncDevice from .const import DOMAIN, VS_DISCOVERY, VS_DISPATCHERS, VS_SWITCHES _LOGGER = logging.getLogger(__name__) DEV_TYPE_TO_HA = { "wifi-switch-1.3": "outlet", "ESW03-USA": "outlet", "ESW01-EU": "outlet", "ESW15-USA": "outlet", "ESWL01": "switch", "ESWL03": "switch", "ESO15-TB": "outlet", } async def async_setup_entry(hass, config_entry, async_add_entities): """Set up switches.""" async def async_discover(devices): """Add new devices to platform.""" _async_setup_entities(devices, async_add_entities) disp = async_dispatcher_connect( hass, VS_DISCOVERY.format(VS_SWITCHES), async_discover ) hass.data[DOMAIN][VS_DISPATCHERS].append(disp) _async_setup_entities(hass.data[DOMAIN][VS_SWITCHES], async_add_entities) return True @callback def _async_setup_entities(devices, async_add_entities): """Check if device is online and add entity.""" dev_list = [] for dev in devices: if DEV_TYPE_TO_HA.get(dev.device_type) == "outlet": dev_list.append(VeSyncSwitchHA(dev)) elif DEV_TYPE_TO_HA.get(dev.device_type) == "switch": dev_list.append(VeSyncLightSwitch(dev)) else: _LOGGER.warning( "%s - Unknown device type - %s", dev.device_name, dev.device_type ) continue async_add_entities(dev_list, update_before_add=True) class VeSyncBaseSwitch(VeSyncDevice, SwitchEntity): """Base class for VeSync switch Device Representations.""" def turn_on(self, **kwargs): """Turn the device on.""" self.device.turn_on() class VeSyncSwitchHA(VeSyncBaseSwitch, SwitchEntity): """Representation of a VeSync switch.""" def __init__(self, plug): """Initialize the VeSync switch device.""" super().__init__(plug) self.smartplug = plug @property def device_state_attributes(self): """Return the state attributes of the device.""" attr = {} if hasattr(self.smartplug, "weekly_energy_total"): attr["voltage"] = self.smartplug.voltage attr["weekly_energy_total"] = self.smartplug.weekly_energy_total attr["monthly_energy_total"] = self.smartplug.monthly_energy_total attr["yearly_energy_total"] = self.smartplug.yearly_energy_total return attr @property def current_power_w(self): """Return the current power usage in W.""" return self.smartplug.power @property def today_energy_kwh(self): """Return the today total energy usage in kWh.""" return self.smartplug.energy_today def update(self): """Update outlet details and energy usage.""" self.smartplug.update() self.smartplug.update_energy() class VeSyncLightSwitch(VeSyncBaseSwitch, SwitchEntity): """Handle representation of VeSync Light Switch.""" def __init__(self, switch): """Initialize Light Switch device class.""" super().__init__(switch) self.switch = switch
apache-2.0
-3,332,572,542,167,740,000
29.925234
81
0.642188
false
3.768793
false
false
false
FreeOpcUa/python-opcua
opcua/common/instantiate.py
1
5606
""" Instantiate a new node and its child nodes from a node type. """ import logging from opcua import Node from opcua import ua from opcua.common import ua_utils from opcua.common.copy_node import _rdesc_from_node, _read_and_copy_attrs logger = logging.getLogger(__name__) def instantiate(parent, node_type, nodeid=None, bname=None, dname=None, idx=0, instantiate_optional=True): """ instantiate a node type under a parent node. nodeid and browse name of new node can be specified, or just namespace index If they exists children of the node type, such as components, variables and properties are also instantiated """ rdesc = _rdesc_from_node(parent, node_type) rdesc.TypeDefinition = node_type.nodeid if nodeid is None: nodeid = ua.NodeId(namespaceidx=idx) # will trigger automatic node generation in namespace idx if bname is None: bname = rdesc.BrowseName elif isinstance(bname, str): bname = ua.QualifiedName.from_string(bname) nodeids = _instantiate_node( parent.server, Node(parent.server, rdesc.NodeId), parent.nodeid, rdesc, nodeid, bname, dname=dname, instantiate_optional=instantiate_optional) return [Node(parent.server, nid) for nid in nodeids] def _instantiate_node(server, node_type, parentid, rdesc, nodeid, bname, dname=None, recursive=True, instantiate_optional=True): """ instantiate a node type under parent """ addnode = ua.AddNodesItem() addnode.RequestedNewNodeId = nodeid addnode.BrowseName = bname addnode.ParentNodeId = parentid addnode.ReferenceTypeId = rdesc.ReferenceTypeId addnode.TypeDefinition = rdesc.TypeDefinition if rdesc.NodeClass in (ua.NodeClass.Object, ua.NodeClass.ObjectType): addnode.NodeClass = ua.NodeClass.Object _read_and_copy_attrs(node_type, ua.ObjectAttributes(), addnode) elif rdesc.NodeClass in (ua.NodeClass.Variable, ua.NodeClass.VariableType): addnode.NodeClass = ua.NodeClass.Variable _read_and_copy_attrs(node_type, ua.VariableAttributes(), addnode) elif rdesc.NodeClass in (ua.NodeClass.Method, ): addnode.NodeClass = ua.NodeClass.Method _read_and_copy_attrs(node_type, ua.MethodAttributes(), addnode) elif rdesc.NodeClass in (ua.NodeClass.DataType, ): addnode.NodeClass = ua.NodeClass.DataType _read_and_copy_attrs(node_type, ua.DataTypeAttributes(), addnode) else: logger.error("Instantiate: Node class not supported: %s", rdesc.NodeClass) raise RuntimeError("Instantiate: Node class not supported") return if dname is not None: addnode.NodeAttributes.DisplayName = dname res = server.add_nodes([addnode])[0] res.StatusCode.check() added_nodes = [res.AddedNodeId] if recursive: parents = ua_utils.get_node_supertypes(node_type, includeitself=True) node = Node(server, res.AddedNodeId) for parent in parents: descs = parent.get_children_descriptions(includesubtypes=False) for c_rdesc in descs: # skip items that already exists, prefer the 'lowest' one in object hierarchy if not ua_utils.is_child_present(node, c_rdesc.BrowseName): c_node_type = Node(server, c_rdesc.NodeId) refs = c_node_type.get_referenced_nodes(refs=ua.ObjectIds.HasModellingRule) if not refs: # spec says to ignore nodes without modelling rules logger.info("Instantiate: Skip node without modelling rule %s as part of %s", c_rdesc.BrowseName, addnode.BrowseName) continue # exclude nodes with optional ModellingRule if requested if not instantiate_optional and refs[0].nodeid in (ua.NodeId(ua.ObjectIds.ModellingRule_Optional), ua.NodeId(ua.ObjectIds.ModellingRule_OptionalPlaceholder)): logger.info("Instantiate: Skip optional node %s as part of %s", c_rdesc.BrowseName, addnode.BrowseName) continue # if root node being instantiated has a String NodeId, create the children with a String NodeId if res.AddedNodeId.NodeIdType is ua.NodeIdType.String: inst_nodeid = res.AddedNodeId.Identifier + "." + c_rdesc.BrowseName.Name nodeids = _instantiate_node( server, c_node_type, res.AddedNodeId, c_rdesc, nodeid=ua.NodeId(identifier=inst_nodeid, namespaceidx=res.AddedNodeId.NamespaceIndex), bname=c_rdesc.BrowseName, instantiate_optional=instantiate_optional) else: nodeids = _instantiate_node( server, c_node_type, res.AddedNodeId, c_rdesc, nodeid=ua.NodeId(namespaceidx=res.AddedNodeId.NamespaceIndex), bname=c_rdesc.BrowseName, instantiate_optional=instantiate_optional) added_nodes.extend(nodeids) return added_nodes
lgpl-3.0
-3,443,361,974,097,699,300
42.457364
178
0.600428
false
4.224567
false
false
false
anselmobd/fo2
src/estoque/models.py
1
3782
import datetime from pprint import pprint from django.contrib.auth.models import User from django.db import models from produto.models import ProdutoItem class EstoquePermissions(models.Model): class Meta: verbose_name = 'Permissões de estoque' managed = False permissions = ( ("can_transferencia", "Pode fazer transferência entre depósitos"), ) class TipoMovStq(models.Model): codigo = models.CharField( 'Código', max_length=100, unique=True, default="-") descricao = models.CharField( 'Descrição', max_length=100) trans_saida = models.IntegerField( 'Transação de saída', default=0) trans_entrada = models.IntegerField( 'Transação de entrada', default=0) menu = models.BooleanField( 'Aparece no menu', default=False) ordem = models.IntegerField( default=0) renomeia = models.BooleanField( 'Renomeia', default=False) CHOICES = ( ('1', '1 para 1'), ('M', 'Monta Kit'), ('D', 'Desmonta Kit'), ) unidade = models.CharField( max_length=1, choices = CHOICES, default='1') def __str__(self): return self.descricao class Meta: db_table = "fo2_est_tipo_mov" verbose_name = "Tipo de movimento de estoque" verbose_name_plural = "Tipos de movimentos de estoque" _doc_mov_stq_start_range = 802000000 class DocMovStqManager(models.Manager): def get_queryset(self): return super( DocMovStqManager, self).get_queryset().annotate( num_doc=models.F('id') + _doc_mov_stq_start_range).all() class DocMovStq(models.Model): descricao = models.CharField( 'Descrição', max_length=100) data = models.DateField() usuario = models.ForeignKey( User, models.PROTECT, verbose_name='usuário') objects = DocMovStqManager() @property def get_num_doc(self): return self.id + _doc_mov_stq_start_range def __str__(self): return f'{self.num_doc} - {self.descricao}' def save(self, *args, **kwargs): if not self.id: self.data = datetime.date.today() super(DocMovStq, self).save(*args, **kwargs) class Meta: db_table = "fo2_est_doc_mov" verbose_name = "Documento de movimento de estoque" verbose_name_plural = "Documentos de movimentos de estoque" class MovStq(models.Model): tipo_mov = models.ForeignKey( TipoMovStq, models.PROTECT, verbose_name='Tipo de movimento') item = models.ForeignKey( ProdutoItem, models.PROTECT) quantidade = models.IntegerField( default=0) deposito_origem = models.IntegerField( 'Depósito de origem') deposito_destino = models.IntegerField( 'Depósito de destino') novo_item = models.ForeignKey( ProdutoItem, models.PROTECT, related_name='movstqdest', null=True) documento = models.ForeignKey( DocMovStq, models.PROTECT, verbose_name='Documento de movimento de estoque') usuario = models.ForeignKey( User, models.PROTECT, verbose_name='usuário') obs = models.CharField( 'Observação', default='', max_length=100) hora = models.DateTimeField( null=True, auto_now_add=True) itens_extras = models.CharField( default='', max_length=200) def __str__(self): return (f'{self.documento.get_num_doc}, {self.item} ' f'{self.deposito_origem}->{self.deposito_destino}') class Meta: db_table = "fo2_est_mov" verbose_name = "Movimento de estoque" verbose_name_plural = "Movimentos de estoque"
mit
4,410,419,019,604,873,000
27.293233
78
0.612809
false
3.341918
false
false
false
maas/maas
src/maasserver/models/space.py
1
6013
# Copyright 2015-2016 Canonical Ltd. This software is licensed under the # GNU Affero General Public License version 3 (see the file LICENSE). """Space objects.""" import datetime import re from django.core.exceptions import PermissionDenied, ValidationError from django.db.models import CharField, Manager, TextField from django.db.models.query import QuerySet from maasserver import DefaultMeta from maasserver.models.cleansave import CleanSave from maasserver.models.timestampedmodel import TimestampedModel from maasserver.utils.orm import MAASQueriesMixin def validate_space_name(value): """Django validator: `value` must be either `None`, or valid.""" if value is None: return namespec = re.compile(r"^[\w-]+$") if not namespec.search(value): raise ValidationError("Invalid space name: %s." % value) # Name of the special, default space. This space cannot be deleted. DEFAULT_SPACE_NAME = "space-0" class SpaceQueriesMixin(MAASQueriesMixin): def get_specifiers_q(self, specifiers, separator=":", **kwargs): # Circular imports. from maasserver.models import Subnet # This dict is used by the constraints code to identify objects # with particular properties. Please note that changing the keys here # can impact backward compatibility, so use caution. specifier_types = { None: self._add_default_query, "name": "__name", "subnet": (Subnet.objects, "vlan__space"), } return super().get_specifiers_q( specifiers, specifier_types=specifier_types, separator=separator, **kwargs ) class SpaceQuerySet(QuerySet, SpaceQueriesMixin): """Custom QuerySet which mixes in some additional queries specific to this object. This needs to be a mixin because an identical method is needed on both the Manager and all QuerySets which result from calling the manager. """ class SpaceManager(Manager, SpaceQueriesMixin): """Manager for :class:`Space` model.""" def get_queryset(self): queryset = SpaceQuerySet(self.model, using=self._db) return queryset def get_default_space(self): """Return the default space.""" now = datetime.datetime.now() space, _ = self.get_or_create( id=0, defaults={"id": 0, "name": None, "created": now, "updated": now}, ) return space def get_space_or_404(self, specifiers, user, perm): """Fetch a `Space` by its id. Raise exceptions if no `Space` with this id exists or if the provided user has not the required permission to access this `Space`. :param specifiers: The space specifiers. :type specifiers: string :param user: The user that should be used in the permission check. :type user: django.contrib.auth.models.User :param perm: The permission to assert that the user has on the node. :type perm: unicode :raises: django.http.Http404_, :class:`maasserver.exceptions.PermissionDenied`. .. _django.http.Http404: https:// docs.djangoproject.com/en/dev/topics/http/views/ #the-http404-exception """ space = self.get_object_by_specifiers_or_raise(specifiers) if user.has_perm(perm, space): return space else: raise PermissionDenied() class Space(CleanSave, TimestampedModel): """A `Space`. :ivar name: The short-human-identifiable name for this space. :ivar objects: An instance of the class :class:`SpaceManager`. """ # Name of the undefined space. UNDEFINED = "undefined" class Meta(DefaultMeta): """Needed for South to recognize this model.""" verbose_name = "Space" verbose_name_plural = "Spaces" objects = SpaceManager() # We don't actually allow blank or null name, but that is enforced in # clean() and save(). name = CharField( max_length=256, editable=True, null=True, blank=True, unique=True, validators=[validate_space_name], ) description = TextField(null=False, blank=True) def __str__(self): return "name=%s" % self.get_name() def is_default(self): """Is this the default space?""" return self.id == 0 def get_name(self): """Return the name of the space.""" if self.name: return self.name else: return "space-%s" % self.id def clean_name(self): reserved = re.compile(r"^space-\d+$") if self.name is not None and self.name != "": if self.name == Space.UNDEFINED: raise ValidationError({"name": ["Reserved space name."]}) if reserved.search(self.name): if self.id is None or self.name != "space-%d" % self.id: raise ValidationError({"name": ["Reserved space name."]}) elif self.id is not None: # Since we are not creating the space, force the (null or empty) # name to be the default name. self.name = "space-%d" % self.id def save(self, *args, **kwargs): # Name will get set by clean_name() if None or empty, and there is an # id. We just need to handle names here for creation. super().save(*args, **kwargs) if self.name is None or self.name == "": # If we got here, then we have a newly created space that needs a # default name. self.name = "space-%d" % self.id self.save() def clean(self, *args, **kwargs): super().clean(*args, **kwargs) self.clean_name() @property def subnet_set(self): """Backward compatibility shim to get the subnets on this space.""" # Circular imports. from maasserver.models import Subnet return Subnet.objects.filter(vlan__space=self)
agpl-3.0
-8,030,477,149,762,342,000
32.220994
79
0.620323
false
4.204895
false
false
false
vmware/pyvmomi-community-samples
samples/getvmsbycluster.py
1
4534
#!/usr/bin/env python """ Written by Chris Hupman Github: https://github.com/chupman/ Example: Get guest info with folder and host placement """ import json from tools import cli, service_instance data = {} def get_nics(guest): nics = {} for nic in guest.net: if nic.network: # Only return adapter backed interfaces if nic.ipConfig is not None and nic.ipConfig.ipAddress is not None: nics[nic.macAddress] = {} # Use mac as uniq ID for nic nics[nic.macAddress]['netlabel'] = nic.network ipconf = nic.ipConfig.ipAddress i = 0 nics[nic.macAddress]['ipv4'] = {} for ip in ipconf: if ":" not in ip.ipAddress: # Only grab ipv4 addresses nics[nic.macAddress]['ipv4'][i] = ip.ipAddress nics[nic.macAddress]['prefix'] = ip.prefixLength nics[nic.macAddress]['connected'] = nic.connected i = i+1 return nics def vmsummary(summary, guest): vmsum = {} config = summary.config net = get_nics(guest) vmsum['mem'] = str(config.memorySizeMB / 1024) vmsum['diskGB'] = str("%.2f" % (summary.storage.committed / 1024**3)) vmsum['cpu'] = str(config.numCpu) vmsum['path'] = config.vmPathName vmsum['ostype'] = config.guestFullName vmsum['state'] = summary.runtime.powerState vmsum['annotation'] = config.annotation if config.annotation else '' vmsum['net'] = net return vmsum def vm2dict(datacenter, cluster, host, vm, summary): # If nested folder path is required, split into a separate function vmname = vm.summary.config.name data[datacenter][cluster][host][vmname]['folder'] = vm.parent.name data[datacenter][cluster][host][vmname]['mem'] = summary['mem'] data[datacenter][cluster][host][vmname]['diskGB'] = summary['diskGB'] data[datacenter][cluster][host][vmname]['cpu'] = summary['cpu'] data[datacenter][cluster][host][vmname]['path'] = summary['path'] data[datacenter][cluster][host][vmname]['net'] = summary['net'] data[datacenter][cluster][host][vmname]['ostype'] = summary['ostype'] data[datacenter][cluster][host][vmname]['state'] = summary['state'] data[datacenter][cluster][host][vmname]['annotation'] = summary['annotation'] def data2json(raw_data, args): with open(args.jsonfile, 'w') as json_file: json.dump(raw_data, json_file) def main(): """ Iterate through all datacenters and list VM info. """ parser = cli.Parser() parser.add_custom_argument('--json', required=False, action='store_true', help='Write out to json file') parser.add_custom_argument('--jsonfile', required=False, action='store', default='getvmsbycluster.json', help='Filename and path of json file') parser.add_custom_argument('--silent', required=False, action='store_true', help='supress output to screen') args = parser.get_args() si = service_instance.connect(args) outputjson = True if args.json else False content = si.RetrieveContent() children = content.rootFolder.childEntity for child in children: # Iterate though DataCenters datacenter = child data[datacenter.name] = {} # Add data Centers to data dict clusters = datacenter.hostFolder.childEntity for cluster in clusters: # Iterate through the clusters in the DC # Add Clusters to data dict data[datacenter.name][cluster.name] = {} hosts = cluster.host # Variable to make pep8 compliance for host in hosts: # Iterate through Hosts in the Cluster hostname = host.summary.config.name # Add VMs to data dict by config name data[datacenter.name][cluster.name][hostname] = {} vms = host.vm for vm in vms: # Iterate through each VM on the host vmname = vm.summary.config.name data[datacenter.name][cluster.name][hostname][vmname] = {} summary = vmsummary(vm.summary, vm.guest) vm2dict(datacenter.name, cluster.name, hostname, vm, summary) if not args.silent: print(json.dumps(data, sort_keys=True, indent=4)) if outputjson: data2json(data, args) # Start program if __name__ == "__main__": main()
apache-2.0
2,445,535,360,479,337,000
38.426087
81
0.60322
false
3.970228
true
false
false
ASoftTech/Scons-Tools-Grbd
scons_tools_grbd/Tools/MSBuild/VC/Dll2Lib.py
1
3979
""" Dll2Lib This tool will generate a .lib file under windows for a given .dll file This uses dumpfile to export a list of symbols dumpbin /exports C:\yourpath\yourlib.dll The list of symbols is then written to a .def file The lib command is then used to generate the .lib file from the .def file lib /def:C:\mypath\mylib.def /OUT:C:\mypath\mylib.lib A side affect of this is an .exp file which also requires cleanup We can then use the .lib file for linking with the compiler under Windows """ import os, sys, os.path as path, subprocess import SCons.Script from SCons.Environment import Environment from SCons.Script import Builder from SCons.Tool.MSCommon import msvc_exists, msvc_setup_env_once def exists(env): return msvc_exists() def generate(env): """Called when the tool is loaded into the environment at startup of script""" assert(exists(env)) # Set-up ms tools paths msvc_setup_env_once(env) env.SetDefault( # Location of the dumpbin executable DUMPBIN = 'dumpbin', ) # Register the builder bld = Builder(action = __Dll2Lib_func, emitter = __Dll2Lib_emitter) env.Append(BUILDERS = {'Dll2Lib' : bld}) def __Dll2Lib_emitter(target, source, env): """Add the generated .def and .exp files to the list of targerts for cleanup""" addfiles = [] for item in target: libfile = item.abspath deffile = path.splitext(libfile)[0] + '.def' expfile = path.splitext(libfile)[0] + '.exp' addfiles.append(File(deffile)) addfiles.append(File(expfile)) target = target + addfiles return target, source def __Dll2Lib_func(target, source, env): """Actual builder that does the work after the Sconscript file is parsed""" index = 0 for srcitem in source: srcfile = str(srcitem) filename = str(target[index]) libfile = path.splitext(filename)[0] + '.lib' deffile = path.splitext(filename)[0] + '.def' if path.splitext(srcfile)[1] != '.dll': continue dumpbin_exp = __dumpbin_run_exports(env, srcfile) exportlist = __dumpbin_parse_exports(dumpbin_exp) __write_deffile(deffile, exportlist) __generate_lib(env, deffile, libfile) index = index + 1 def __dumpbin_run_exports(env, dllfile): """Run dumpbin /exports against the input dll""" cmdopts = [env['DUMPBIN'], '/exports', str(dllfile)] print("Calling '%s'" % env['DUMPBIN']) stdout, stderr = __runcmd_mbcs(env, cmdopts) return stdout def __dumpbin_parse_exports(input): """Parse thr output from dumpbin as a list of symbols""" ret = [] lines = input.split('\n') for line in lines: arr1 = line.split() if len(arr1) == 4 and arr1[1] != 'number' and arr1[1] != 'hint': ret.append(arr1[3]) return ret def __write_deffile(outfile, lines): """Write the list of symbols to a .def file""" with open(outfile, 'w') as f: f.write('EXPORTS\n') for line in lines: f.write(line + '\n') def __generate_lib(env, deffile, libfile): """Generate the .lib file""" cmdopts = [env['AR'], '/def:' + deffile, '/OUT:' + libfile] stdout, stderr = __runcmd_mbcs(env, cmdopts) return stdout def __runcmd_mbcs(env, cmdopts): """Run command while capturing the output""" popen = SCons.Action._subproc(env, cmdopts, stdin='devnull', stdout=subprocess.PIPE, stderr=subprocess.PIPE) stdout = popen.stdout.read() stderr = popen.stderr.read() if not isinstance(stderr, str): stderr = stderr.decode("mbcs") if not isinstance(stdout, str): stdout = stdout.decode("mbcs") if stderr: import sys sys.stderr.write(stderr) if popen.wait() != 0: raise IOError(stderr) return stdout, stderr
mit
-6,572,437,492,332,772,000
30.614754
83
0.617994
false
3.63379
false
false
false
liliasapurina/python_training
test/test_contacts.py
1
2349
__author__ = '1' import re def test_contacts_on_home_page(app): address_from_home_page = app.address.get_address_list()[0] address_from_edit_page = app.address.get_address_info_from_edit_page(0) assert address_from_home_page.all_phones_from_home_page == merge_phones_like_on_home_page(address_from_edit_page) assert address_from_home_page.name == address_from_edit_page.name assert address_from_home_page.lastname == address_from_edit_page.lastname assert address_from_home_page.address == address_from_edit_page.address assert address_from_home_page.all_emails_from_home_page == merge_emails_like_on_home_page(address_from_edit_page) def test_contacts_on_address_view_page(app): address_from_view_page = app.address.get_address_from_view_page(0) address_from_edit_page = app.address.get_address_info_from_edit_page(0) assert address_from_view_page.all_fields == merge_fields_like_on_view_page(address_from_edit_page) def clear(s): return re.sub("[() -]","",s) def merge_phones_like_on_home_page(address): return "\n".join(filter(lambda x: x != "", map(lambda x: clear(x), filter(lambda x: x is not None, [address.phone, address.mobilephone, address.workphone, address.secondaryphone])))) def merge_emails_like_on_home_page(address): return "\n".join(filter(lambda x: x != "", filter(lambda x: x is not None, [address.email, address.email2, address.email3]))) def merge_fields_like_on_view_page(address): return str(address.name)+" "+str(address.middlename)\ +" "+str(address.lastname)+"\n"+str(address.nickname)\ +"\n"+str(address.company)+"\n"+str(address.address)\ +"\nH: "+str(address.phone)\ +"\nM: "+str(address.mobilephone)+"\nW: "+str(address.workphone)\ +"\n"+"\n"\ +create_view_for_email(str(address.email))\ +create_view_for_email(str(address.email2))\ +create_view_for_email(str(address.email3))+'\n'\ +"\nP: "+str(address.secondaryphone) def create_view_for_email(email): if email != "": dog_index = email.find("@") return email+" (www."+email[dog_index+1:len(email)]+")" else: return "\n"
apache-2.0
-2,452,055,065,751,226,400
46.959184
121
0.62069
false
3.271588
false
false
false
robozman/pymumblegui
pymumble/pymumble_py3/mumble.py
1
24841
# -*- coding: utf-8 -*- import threading import logging import time import select import socket import ssl import struct from .errors import * from .constants import * from . import users from . import channels from . import blobs from . import commands from . import callbacks from . import tools from . import soundoutput from . import mumble_pb2 class Mumble(threading.Thread): """ Mumble client library main object. basically a thread """ def __init__(self, host, user, port=64738, password='', certfile=None, keyfile=None, reconnect=False, tokens=[], debug=False): """ host=mumble server hostname or address port=mumble server port user=user to use for the connection password=password for the connection certfile=client certificate to authenticate the connection keyfile=private key comming with client certificate reconnect=if True, try to reconnect if disconnected tokens=channel access tokens as a list of strings debug=if True, send debugging messages (lot of...) to the stdout """ # TODO: use UDP audio threading.Thread.__init__(self) self.Log = logging.getLogger("PyMumble") # logging object for errors and debugging if debug: self.Log.setLevel(logging.DEBUG) else: self.Log.setLevel(logging.ERROR) ch = logging.StreamHandler() ch.setLevel(logging.DEBUG) formatter = logging.Formatter('%(asctime)s-%(name)s-%(levelname)s-%(message)s') ch.setFormatter(formatter) self.Log.addHandler(ch) self.parent_thread = threading.current_thread() # main thread of the calling application self.mumble_thread = None # thread of the mumble client library self.host = host self.port = port self.user = user self.password = password self.certfile = certfile self.keyfile = keyfile self.reconnect = reconnect self.ping_stats = {"last_rcv": 0, "time_send": 0, "nb": 0, "avg": 40.0, "var": 0.0} self.tokens = tokens self.__opus_profile = PYMUMBLE_AUDIO_TYPE_OPUS_PROFILE self.receive_sound = False # set to True to treat incoming audio, otherwise it is simply ignored self.loop_rate = PYMUMBLE_LOOP_RATE self.application = PYMUMBLE_VERSION_STRING self.callbacks = callbacks.CallBacks() # callbacks management self.ready_lock = threading.Lock() # released when the connection is fully established with the server self.ready_lock.acquire() def init_connection(self): """Initialize variables that are local to a connection, (needed if the client automatically reconnect)""" self.ready_lock.acquire(False) # reacquire the ready-lock in case of reconnection self.connected = PYMUMBLE_CONN_STATE_NOT_CONNECTED self.control_socket = None self.media_socket = None # Not implemented - for UDP media self.bandwidth = PYMUMBLE_BANDWIDTH # reset the outgoing bandwidth to it's default before connectiong self.server_max_bandwidth = None self.udp_active = False self.users = users.Users(self, self.callbacks) # contain the server's connected users informations self.channels = channels.Channels(self, self.callbacks) # contain the server's channels informations self.blobs = blobs.Blobs(self) # manage the blob objects self.sound_output = soundoutput.SoundOutput(self, PYMUMBLE_AUDIO_PER_PACKET, self.bandwidth, opus_profile=self.__opus_profile) # manage the outgoing sounds self.commands = commands.Commands() # manage commands sent between the main and the mumble threads self.receive_buffer = bytes() # initialize the control connection input buffer def run(self): """Connect to the server and start the loop in its thread. Retry if requested""" self.mumble_thread = threading.current_thread() # loop if auto-reconnect is requested while True: self.init_connection() # reset the connection-specific object members if self.connect() >= PYMUMBLE_CONN_STATE_FAILED: # some error occured, exit here self.ready_lock.release() break try: self.loop() except socket.error: self.connected = PYMUMBLE_CONN_STATE_NOT_CONNECTED if not self.reconnect or not self.parent_thread.is_alive(): break time.sleep(PYMUMBLE_CONNECTION_RETRY_INTERVAL) def connect(self): """Connect to the server""" # Connect the SSL tunnel self.Log.debug("connecting to %s on port %i.", self.host, self.port) std_sock = socket.socket(socket.AF_INET, socket.SOCK_STREAM) try: self.control_socket = ssl.wrap_socket(std_sock, certfile=self.certfile, keyfile=self.keyfile, ssl_version=ssl.PROTOCOL_TLS) self.control_socket.connect((self.host, self.port)) self.control_socket.setblocking(0) # Perform the Mumble authentication version = mumble_pb2.Version() version.version = (PYMUMBLE_PROTOCOL_VERSION[0] << 16) + (PYMUMBLE_PROTOCOL_VERSION[1] << 8) + PYMUMBLE_PROTOCOL_VERSION[2] version.release = self.application version.os = PYMUMBLE_OS_STRING version.os_version = PYMUMBLE_OS_VERSION_STRING self.Log.debug("sending: version: %s", version) self.send_message(PYMUMBLE_MSG_TYPES_VERSION, version) authenticate = mumble_pb2.Authenticate() authenticate.username = self.user authenticate.password = self.password authenticate.tokens.extend(self.tokens) authenticate.opus = True self.Log.debug("sending: authenticate: %s", authenticate) self.send_message(PYMUMBLE_MSG_TYPES_AUTHENTICATE, authenticate) except socket.error: self.connected = PYMUMBLE_CONN_STATE_FAILED return self.connected self.connected = PYMUMBLE_CONN_STATE_AUTHENTICATING return self.connected def loop(self): """ Main loop waiting for a message from the server for maximum self.loop_rate time take care of sending the ping take care of sending the queued commands to the server check on every iteration for outgoing sound check for disconnection """ self.Log.debug("entering loop") last_ping = time.time() # keep track of the last ping time # loop as long as the connection and the parent thread are alive while self.connected not in (PYMUMBLE_CONN_STATE_NOT_CONNECTED, PYMUMBLE_CONN_STATE_FAILED) and self.parent_thread.is_alive(): if last_ping + PYMUMBLE_PING_DELAY <= time.time(): # when it is time, send the ping self.ping() last_ping = time.time() if self.connected == PYMUMBLE_CONN_STATE_CONNECTED: while self.commands.is_cmd(): self.treat_command(self.commands.pop_cmd()) # send the commands coming from the application to the server self.sound_output.send_audio() # send outgoing audio if available (rlist, wlist, xlist) = select.select([self.control_socket], [], [self.control_socket], self.loop_rate) # wait for a socket activity if self.control_socket in rlist: # something to be read on the control socket self.read_control_messages() elif self.control_socket in xlist: # socket was closed self.control_socket.close() self.connected = PYMUMBLE_CONN_STATE_NOT_CONNECTED def ping(self): """Send the keepalive through available channels""" ping = mumble_pb2.Ping() ping.timestamp = int(time.time()) ping.tcp_ping_avg = self.ping_stats['avg'] ping.tcp_ping_var = self.ping_stats['var'] ping.tcp_packets = self.ping_stats['nb'] self.Log.debug("sending: ping: %s", ping) self.send_message(PYMUMBLE_MSG_TYPES_PING, ping) self.ping_stats['time_send'] = int(time.time() * 1000) self.Log.debug(self.ping_stats['last_rcv']) if self.ping_stats['last_rcv'] != 0 and int(time.time() * 1000) > self.ping_stats['last_rcv'] + (60 * 1000): self.Log.debug("Ping too long ! Disconnected ?") self.connected = PYMUMBLE_CONN_STATE_NOT_CONNECTED def ping_response(self, mess): self.ping_stats['last_rcv'] = int(time.time() * 1000) ping = int(time.time() * 1000) - self.ping_stats['time_send'] old_avg = self.ping_stats['avg'] nb = self.ping_stats['nb'] new_avg = ((self.ping_stats['avg'] * nb) + ping) / (nb + 1) try: self.ping_stats['var'] = self.ping_stats['var'] + pow(old_avg - new_avg, 2) + (1 / nb) * pow(ping - new_avg, 2) except ZeroDivisionError: pass self.ping_stats['avg'] = new_avg self.ping_stats['nb'] += 1 def send_message(self, type, message): """Send a control message to the server""" packet = struct.pack("!HL", type, message.ByteSize()) + message.SerializeToString() while len(packet) > 0: self.Log.debug("sending message") sent = self.control_socket.send(packet) if sent < 0: raise socket.error("Server socket error") packet = packet[sent:] def read_control_messages(self): """Read control messages coming from the server""" # from tools import tohex # for debugging try: buffer = self.control_socket.recv(PYMUMBLE_READ_BUFFER_SIZE) self.receive_buffer += buffer except socket.error: pass while len(self.receive_buffer) >= 6: # header is present (type + length) self.Log.debug("read control connection") header = self.receive_buffer[0:6] if len(header) < 6: break (type, size) = struct.unpack("!HL", header) # decode header if len(self.receive_buffer) < size+6: # if not length data, read further break # self.Log.debug("message received : " + tohex(self.receive_buffer[0:size+6])) # for debugging message = self.receive_buffer[6:size+6] # get the control message self.receive_buffer = self.receive_buffer[size+6:] # remove from the buffer the read part self.dispatch_control_message(type, message) def dispatch_control_message(self, type, message): """Dispatch control messages based on their type""" self.Log.debug("dispatch control message") if type == PYMUMBLE_MSG_TYPES_UDPTUNNEL: # audio encapsulated in control message self.sound_received(message) elif type == PYMUMBLE_MSG_TYPES_VERSION: mess = mumble_pb2.Version() mess.ParseFromString(message) self.Log.debug("message: Version : %s", mess) elif type == PYMUMBLE_MSG_TYPES_AUTHENTICATE: mess = mumble_pb2.Authenticate() mess.ParseFromString(message) self.Log.debug("message: Authenticate : %s", mess) elif type == PYMUMBLE_MSG_TYPES_PING: mess = mumble_pb2.Ping() mess.ParseFromString(message) self.Log.debug("message: Ping : %s", mess) self.ping_response(mess) elif type == PYMUMBLE_MSG_TYPES_REJECT: mess = mumble_pb2.Reject() mess.ParseFromString(message) self.Log.debug("message: reject : %s", mess) self.connected = PYMUMBLE_CONN_STATE_FAILED self.ready_lock.release() raise ConnectionRejectedError(mess.reason) elif type == PYMUMBLE_MSG_TYPES_SERVERSYNC: # this message finish the connection process mess = mumble_pb2.ServerSync() mess.ParseFromString(message) self.Log.debug("message: serversync : %s", mess) self.users.set_myself(mess.session) self.server_max_bandwidth = mess.max_bandwidth self.set_bandwidth(mess.max_bandwidth) if self.connected == PYMUMBLE_CONN_STATE_AUTHENTICATING: self.connected = PYMUMBLE_CONN_STATE_CONNECTED self.callbacks(PYMUMBLE_CLBK_CONNECTED) self.ready_lock.release() # release the ready-lock elif type == PYMUMBLE_MSG_TYPES_CHANNELREMOVE: mess = mumble_pb2.ChannelRemove() mess.ParseFromString(message) self.Log.debug("message: ChannelRemove : %s", mess) self.channels.remove(mess.channel_id) elif type == PYMUMBLE_MSG_TYPES_CHANNELSTATE: mess = mumble_pb2.ChannelState() mess.ParseFromString(message) self.Log.debug("message: channelstate : %s", mess) self.channels.update(mess) elif type == PYMUMBLE_MSG_TYPES_USERREMOVE: mess = mumble_pb2.UserRemove() mess.ParseFromString(message) self.Log.debug("message: UserRemove : %s", mess) self.users.remove(mess) elif type == PYMUMBLE_MSG_TYPES_USERSTATE: mess = mumble_pb2.UserState() mess.ParseFromString(message) self.Log.debug("message: userstate : %s", mess) self.users.update(mess) elif type == PYMUMBLE_MSG_TYPES_BANLIST: mess = mumble_pb2.BanList() mess.ParseFromString(message) self.Log.debug("message: BanList : %s", mess) elif type == PYMUMBLE_MSG_TYPES_TEXTMESSAGE: mess = mumble_pb2.TextMessage() mess.ParseFromString(message) self.Log.debug("message: TextMessage : %s", mess) self.callbacks(PYMUMBLE_CLBK_TEXTMESSAGERECEIVED, mess) elif type == PYMUMBLE_MSG_TYPES_PERMISSIONDENIED: mess = mumble_pb2.PermissionDenied() mess.ParseFromString(message) self.Log.debug("message: PermissionDenied : %s", mess) elif type == PYMUMBLE_MSG_TYPES_ACL: mess = mumble_pb2.ACL() mess.ParseFromString(message) self.Log.debug("message: ACL : %s", mess) elif type == PYMUMBLE_MSG_TYPES_QUERYUSERS: mess = mumble_pb2.QueryUsers() mess.ParseFromString(message) self.Log.debug("message: QueryUsers : %s", mess) elif type == PYMUMBLE_MSG_TYPES_CRYPTSETUP: mess = mumble_pb2.CryptSetup() mess.ParseFromString(message) self.Log.debug("message: CryptSetup : %s", mess) self.ping() elif type == PYMUMBLE_MSG_TYPES_CONTEXTACTIONMODIFY: mess = mumble_pb2.ContextActionModify() mess.ParseFromString(message) self.Log.debug("message: ContextActionModify : %s", mess) self.callbacks(PYMUMBLE_CLBK_CONTEXTACTIONRECEIVED, mess) elif type == PYMUMBLE_MSG_TYPES_CONTEXTACTION: mess = mumble_pb2.ContextAction() mess.ParseFromString(message) self.Log.debug("message: ContextAction : %s", mess) elif type == PYMUMBLE_MSG_TYPES_USERLIST: mess = mumble_pb2.UserList() mess.ParseFromString(message) self.Log.debug("message: UserList : %s", mess) elif type == PYMUMBLE_MSG_TYPES_VOICETARGET: mess = mumble_pb2.VoiceTarget() mess.ParseFromString(message) self.Log.debug("message: VoiceTarget : %s", mess) elif type == PYMUMBLE_MSG_TYPES_PERMISSIONQUERY: mess = mumble_pb2.PermissionQuery() mess.ParseFromString(message) self.Log.debug("message: PermissionQuery : %s", mess) elif type == PYMUMBLE_MSG_TYPES_CODECVERSION: mess = mumble_pb2.CodecVersion() mess.ParseFromString(message) self.Log.debug("message: CodecVersion : %s", mess) self.sound_output.set_default_codec(mess) elif type == PYMUMBLE_MSG_TYPES_USERSTATS: mess = mumble_pb2.UserStats() mess.ParseFromString(message) self.Log.debug("message: UserStats : %s", mess) elif type == PYMUMBLE_MSG_TYPES_REQUESTBLOB: mess = mumble_pb2.RequestBlob() mess.ParseFromString(message) self.Log.debug("message: RequestBlob : %s", mess) elif type == PYMUMBLE_MSG_TYPES_SERVERCONFIG: mess = mumble_pb2.ServerConfig() mess.ParseFromString(message) self.Log.debug("message: ServerConfig : %s", mess) def set_bandwidth(self, bandwidth): """Set the total allowed outgoing bandwidth""" if self.server_max_bandwidth is not None and bandwidth > self.server_max_bandwidth: self.bandwidth = self.server_max_bandwidth else: self.bandwidth = bandwidth self.sound_output.set_bandwidth(self.bandwidth) # communicate the update to the outgoing audio manager def sound_received(self, message): """Manage a received sound message""" # from tools import tohex # for debugging pos = 0 # self.Log.debug("sound packet : " + tohex(message)) # for debugging (header, ) = struct.unpack("!B", bytes([message[pos]])) # extract the header type = (header & 0b11100000) >> 5 target = header & 0b00011111 pos += 1 if type == PYMUMBLE_AUDIO_TYPE_PING: return session = tools.VarInt() # decode session id pos += session.decode(message[pos:pos+10]) sequence = tools.VarInt() # decode sequence number pos += sequence.decode(message[pos:pos+10]) self.Log.debug("audio packet received from %i, sequence %i, type:%i, target:%i, lenght:%i", session.value, sequence.value, type, target, len(message)) terminator = False # set to true if it's the last 10 ms audio frame for the packet (used with CELT codec) while (pos < len(message)) and not terminator: # get the audio frames one by one if type == PYMUMBLE_AUDIO_TYPE_OPUS: size = tools.VarInt() # OPUS use varint for the frame length pos += size.decode(message[pos:pos+10]) size = size.value if not (size & 0x2000): # terminator is 0x2000 in the resulting int. terminator = True # should actually always be 0 as OPUS can use variable length audio frames size &= 0x1fff # isolate the size from the terminator else: (header, ) = struct.unpack("!B", message[pos]) # CELT length and terminator is encoded in a 1 byte int if not (header & 0b10000000): terminator = True size = header & 0b01111111 pos += 1 self.Log.debug("Audio frame : time:%f, last:%s, size:%i, type:%i, target:%i, pos:%i", time.time(), str(terminator), size, type, target, pos-1) if size > 0 and self.receive_sound: # if audio must be treated try: newsound = self.users[session.value].sound.add(message[pos:pos+size], sequence.value, type, target) # add the sound to the user's sound queue self.callbacks(PYMUMBLE_CLBK_SOUNDRECEIVED, self.users[session.value], newsound) sequence.value += int(round(newsound.duration / 1000 * 10)) # add 1 sequence per 10ms of audio self.Log.debug("Audio frame : time:%f last:%s, size:%i, uncompressed:%i, type:%i, target:%i", time.time(), str(terminator), size, newsound.size, type, target) except CodecNotSupportedError as msg: print(msg) except KeyError: # sound received after user removed pass # if len(message) - pos < size: # raise InvalidFormatError("Invalid audio frame size") pos += size # go further in the packet, after the audio frame # TODO: get position info def set_application_string(self, string): """Set the application name, that can be viewed by other clients on the server""" self.application = string def set_loop_rate(self, rate): """Set the current main loop rate (pause per iteration)""" self.loop_rate = rate def get_loop_rate(self): """Get the current main loop rate (pause per iteration)""" return self.loop_rate def set_codec_profile(self, profile): """set the audio profile""" if profile in ["audio", "voip"]: self.__opus_profile = profile else: raise ValueError("Unknown profile: " + str(profile)) def get_codec_profile(self): """return the audio profile string""" return self.__opus_profile def set_receive_sound(self, value): """Enable or disable the management of incoming sounds""" if value: self.receive_sound = True else: self.receive_sound = False def is_ready(self): """Wait for the connection to be fully completed. To be used in the main thread""" self.ready_lock.acquire() self.ready_lock.release() def execute_command(self, cmd, blocking=True): """Create a command to be sent to the server. To be used in the main thread""" self.is_ready() lock = self.commands.new_cmd(cmd) if blocking and self.mumble_thread is not threading.current_thread(): lock.acquire() lock.release() return lock # TODO: manage a timeout for blocking commands. Currently, no command actually waits for the server to execute # The result of these commands should actually be checked against incoming server updates def treat_command(self, cmd): """Send the awaiting commands to the server. Used in the pymumble thread.""" if cmd.cmd == PYMUMBLE_CMD_MOVE: userstate = mumble_pb2.UserState() userstate.session = cmd.parameters["session"] userstate.channel_id = cmd.parameters["channel_id"] self.Log.debug("Moving to channel") self.send_message(PYMUMBLE_MSG_TYPES_USERSTATE, userstate) cmd.response = True self.commands.answer(cmd) elif cmd.cmd == PYMUMBLE_CMD_TEXTMESSAGE: textmessage = mumble_pb2.TextMessage() textmessage.session.append(cmd.parameters["session"]) textmessage.channel_id.append(cmd.parameters["channel_id"]) textmessage.message = cmd.parameters["message"] self.send_message(PYMUMBLE_MSG_TYPES_TEXTMESSAGE, textmessage) cmd.response = True self.commands.answer(cmd) elif cmd.cmd == PYMUMBLE_CMD_TEXTPRIVATEMESSAGE: textprivatemessage = mumble_pb2.TextMessage() textprivatemessage.session.append(cmd.parameters["session"]) textprivatemessage.message = cmd.parameters["message"] self.send_message(PYMUMBLE_MSG_TYPES_TEXTMESSAGE, textprivatemessage) cmd.response = True self.commands.answer(cmd) elif cmd.cmd == PYMUMBLE_CMD_MODUSERSTATE: userstate = mumble_pb2.UserState() userstate.session = cmd.parameters["session"] if "mute" in cmd.parameters: userstate.mute = cmd.parameters["mute"] if "self_mute" in cmd.parameters: userstate.self_mute = cmd.parameters["self_mute"] if "deaf" in cmd.parameters: userstate.deaf = cmd.parameters["deaf"] if "self_deaf" in cmd.parameters: userstate.self_deaf = cmd.parameters["self_deaf"] if "suppress" in cmd.parameters: userstate.suppress = cmd.parameters["suppress"] if "recording" in cmd.parameters: userstate.recording = cmd.parameters["recording"] if "comment" in cmd.parameters: userstate.comment = cmd.parameters["comment"] if "texture" in cmd.parameters: userstate.texture = cmd.parameters["texture"] self.send_message(PYMUMBLE_MSG_TYPES_USERSTATE, userstate) cmd.response = True self.commands.answer(cmd)
gpl-3.0
-3,118,328,671,455,202,300
41.318569
178
0.605088
false
4.005321
false
false
false
evgenybf/pyXLWriter
pyXLWriter/utilites.py
1
4897
# pyXLWriter: A library for generating Excel Spreadsheets # Copyright (c) 2004 Evgeny Filatov <[email protected]> # Copyright (c) 2002-2004 John McNamara (Perl Spreadsheet::WriteExcel) # # This library is free software; you can redistribute it and/or modify it # under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation; either version 2.1 of the License, or # (at your option) any later version. # # This library is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser # General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with this library; if not, write to the Free Software Foundation, # Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA #---------------------------------------------------------------------------- # This module was written/ported from PERL Spreadsheet::WriteExcel module # The author of the PERL Spreadsheet::WriteExcel module is John McNamara # <[email protected]> #---------------------------------------------------------------------------- # See the README.txt distributed with pyXLWriter for more details. """pyXLWriter.utilites Utilities for work with reference to cells """ __revision__ = """$Id: utilites.py,v 1.23 2004/08/20 05:16:17 fufff Exp $""" # # TODO: Optimazation - I must use re.compale everywhere. # import re __all__ = ["cell_to_rowcol", "cell_to_rowcol2", "rowcol_to_cell", "cellrange_to_rowcol_pair"] _re_cell_ex = re.compile(r"(\$?)([A-I]?[A-Z])(\$?)(\d+)") _re_row_range = re.compile(r"\$?(\d+):\$?(\d+)") _re_col_range = re.compile(r"\$?([A-I]?[A-Z]):\$?([A-I]?[A-Z])") _re_cell_range = re.compile(r"\$?([A-I]?[A-Z]\$?\d+):\$?([A-I]?[A-Z]\$?\d+)") _re_cell_ref = re.compile(r"\$?([A-I]?[A-Z]\$?\d+)") def _col_by_name(colname): """ """ col = 0 pow = 1 for i in xrange(len(colname)-1, -1, -1): ch = colname[i] col += (ord(ch) - ord('A') + 1) * pow pow *= 26 return col - 1 def cell_to_rowcol(cell): """Convert an Excel cell reference string in A1 notation to numeric row/col notation. Returns: row, col, row_abs, col_abs """ m = _re_cell_ex.match(cell) if not m: raise Exception("Error in cell format") col_abs, col, row_abs, row = m.groups() row_abs = bool(row_abs) col_abs = bool(col_abs) row = int(row) - 1 col = _col_by_name(col) return row, col, row_abs, col_abs def cell_to_rowcol2(cell): """Convert an Excel cell reference string in A1 notation to numeric row/col notation. Returns: row, col """ m = _re_cell_ex.match(cell) if not m: raise Exception("Error in cell format") col_abs, col, row_abs, row = m.groups() # Convert base26 column string to number # All your Base are belong to us. row = int(row) - 1 col = _col_by_name(col) return row, col def rowcol_to_cell(row, col, row_abs=False, col_abs=False): """Convert numeric row/col notation to an Excel cell reference string in A1 notation. """ d = col // 26 m = col % 26 chr1 = "" # Most significant character in AA1 if row_abs: row_abs = '$' else: row_abs = '' if col_abs: col_abs = '$' else: col_abs = '' if d > 0: chr1 = chr(ord('A') + d - 1) chr2 = chr(ord('A') + m) # Zero index to 1-index return col_abs + chr1 + chr2 + row_abs + str(row + 1) def cellrange_to_rowcol_pair(cellrange): """Convert cell range string in A1 notation to numeric row/col pair. Returns: row1, col1, row2, col2 """ cellrange = cellrange.upper() # Convert a row range: '1:3' res = _re_row_range.match(cellrange) if res: row1 = int(res.group(1)) - 1 col1 = 0 row2 = int(res.group(2)) - 1 col2 = -1 return row1, col1, row2, col2 # Convert a column range: 'A:A' or 'B:G'. # A range such as A:A is equivalent to A1:A16384, so add rows as required res = _re_col_range.match(cellrange) if res: col1 = _col_by_name(res.group(1)) row1 = 0 col2 = _col_by_name(res.group(2)) row2 = -1 return row1, col1, row2, col2 # Convert a cell range: 'A1:B7' res = _re_cell_range.match(cellrange) if res: row1, col1 = cell_to_rowcol2(res.group(1)) row2, col2 = cell_to_rowcol2(res.group(2)) return row1, col1, row2, col2 # Convert a cell reference: 'A1' or 'AD2000' res = _re_cell_ref.match(cellrange) if res: row1, col1 = cell_to_rowcol2(res.group(1)) return row1, col1, row1, col1 raise Exception("Unknown cell reference %s" % (cell))
lgpl-2.1
-7,616,251,451,061,417,000
30.391026
77
0.590157
false
3.09154
false
false
false
ngokevin/zamboni
settings_test.py
1
2958
import atexit import os import tempfile from mkt.settings import ROOT _tmpdirs = set() def _cleanup(): try: import sys import shutil except ImportError: return tmp = None try: for tmp in _tmpdirs: shutil.rmtree(tmp) except Exception, exc: sys.stderr.write("\n** shutil.rmtree(%r): %s\n" % (tmp, exc)) atexit.register(_cleanup) def _polite_tmpdir(): tmp = tempfile.mkdtemp() _tmpdirs.add(tmp) return tmp # See settings.py for documentation: IN_TEST_SUITE = True NETAPP_STORAGE = _polite_tmpdir() ADDONS_PATH = _polite_tmpdir() GUARDED_ADDONS_PATH = _polite_tmpdir() SIGNED_APPS_PATH = _polite_tmpdir() SIGNED_APPS_REVIEWER_PATH = _polite_tmpdir() UPLOADS_PATH = _polite_tmpdir() TMP_PATH = _polite_tmpdir() COLLECTIONS_ICON_PATH = _polite_tmpdir() REVIEWER_ATTACHMENTS_PATH = _polite_tmpdir() DUMPED_APPS_PATH = _polite_tmpdir() AUTHENTICATION_BACKENDS = ( 'django_browserid.auth.BrowserIDBackend', ) # We won't actually send an email. SEND_REAL_EMAIL = True # Turn off search engine indexing. USE_ELASTIC = False # Ensure all validation code runs in tests: VALIDATE_ADDONS = True PAYPAL_PERMISSIONS_URL = '' ENABLE_API_ERROR_SERVICE = False SITE_URL = 'http://testserver' BROWSERID_AUDIENCES = [SITE_URL] STATIC_URL = SITE_URL + '/' MEDIA_URL = '/media/' CACHES = { 'default': { 'BACKEND': 'caching.backends.locmem.LocMemCache', } } # COUNT() caching can't be invalidated, it just expires after x seconds. This # is just too annoying for tests, so disable it. CACHE_COUNT_TIMEOUT = -1 # Overrides whatever storage you might have put in local settings. DEFAULT_FILE_STORAGE = 'amo.utils.LocalFileStorage' VIDEO_LIBRARIES = ['lib.video.dummy'] ALLOW_SELF_REVIEWS = True # Make sure debug toolbar output is disabled so it doesn't interfere with any # html tests. DEBUG_TOOLBAR_CONFIG = { 'INTERCEPT_REDIRECTS': False, 'SHOW_TOOLBAR_CALLBACK': lambda r: False, 'HIDE_DJANGO_SQL': True, 'TAG': 'div', 'ENABLE_STACKTRACES': False, } MOZMARKET_VENDOR_EXCLUDE = [] TASK_USER_ID = '4043307' PASSWORD_HASHERS = ( 'django.contrib.auth.hashers.MD5PasswordHasher', ) SQL_RESET_SEQUENCES = False GEOIP_URL = '' GEOIP_DEFAULT_VAL = 'restofworld' GEOIP_DEFAULT_TIMEOUT = .2 ES_DEFAULT_NUM_REPLICAS = 0 ES_DEFAULT_NUM_SHARDS = 3 IARC_MOCK = True # Ensure that exceptions aren't re-raised. DEBUG_PROPAGATE_EXCEPTIONS = False PAYMENT_PROVIDERS = ['bango'] # When not testing this specific feature, make sure it's off. PRE_GENERATE_APKS = False # This is a precaution in case something isn't mocked right. PRE_GENERATE_APK_URL = 'http://you-should-never-load-this.com/' # A sample key for signing receipts. WEBAPPS_RECEIPT_KEY = os.path.join(ROOT, 'mkt/webapps/tests/sample.key') # A sample key for signing preverified-account assertions. PREVERIFIED_ACCOUNT_KEY = os.path.join(ROOT, 'mkt/account/tests/sample.key')
bsd-3-clause
2,432,286,399,915,075,000
22.291339
77
0.701826
false
3.065285
true
false
false
yfpeng/pengyifan-leetcode
src/main/python/pyleetcode/next_greater_element.py
1
1874
""" You are given two arrays (without duplicates) nums1 and nums2 where nums1's elements are subset of nums2. Find all the next greater numbers for nums1's elements in the corresponding places of nums2. The Next Greater Number of a number x in nums1 is the first greater number to its right in nums2. If it does not exist, output -1 for this number. Example 1: Input: nums1 = [4,1,2], nums2 = [1,3,4,2]. Output: [-1,3,-1] Explanation: For number 4 in the first array, you cannot find the next greater number for it in the second array, so output -1. For number 1 in the first array, the next greater number for it in the second array is 3. For number 2 in the first array, there is no next greater number for it in the second array, so output -1. Example 2: Input: nums1 = [2,4], nums2 = [1,2,3,4]. Output: [3,-1] Explanation: For number 2 in the first array, the next greater number for it in the second array is 3. For number 4 in the first array, there is no next greater number for it in the second array, so output -1. Note: - All elements in nums1 and nums2 are unique. - The length of both nums1 and nums2 would not exceed 1000. """ def next_greater_element(findNums, nums): """ :type findNums: List[int] :type nums: List[int] :rtype: List[int] """ output = [] for num1 in findNums: index = nums.index(num1) + 1 o = -1 while index < len(nums): if num1 < nums[index]: o = nums[index] break index += 1 output.append(o) return output def test_next_greater_element(): assert next_greater_element([4, 1, 2], [1, 3, 4, 2]) == [-1, 3, -1] assert next_greater_element([2, 4], [1, 2, 3, 4]) == [3, -1] if __name__ == '__main__': test_next_greater_element()
bsd-3-clause
-2,137,404,932,578,816,800
30.25
122
0.623799
false
3.476809
false
false
false
ProgrammingRobotsStudyGroup/robo_magellan
scripts/kill_switch.py
1
3880
#!/usr/bin/env python # # Copyright 2017 Robot Garden, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # #------------------------------------------------------------------------------ # Monitors state of the kill switch by monitoring an UP GPIO input, which # is connected to a contact closure from the kill switch module. # # Topics subscribed: None # Topics published: # kill_sw_enabled: std_msgs/Bool #------------------------------------------------------------------------------ # import RPi.GPIO as GPIO import time import rospy from std_msgs.msg import Bool from std_msgs.msg import String def kill_sw_mon(): rospy.init_node('kill_sw_mon', anonymous=True) pub = rospy.Publisher('kill_sw_enabled', Bool, queue_size=10) # first push of kill switch is going to start the state machine global pub_exec_simple pub_exec_simple = rospy.Publisher("exec_cmd_simple", String, queue_size = 10) global once once = False rate = rospy.Rate(20) gpio_pin = 7 GPIO.setmode(GPIO.BOARD) # assumes the pin is pulled up be external resistor GPIO.setup(gpio_pin, GPIO.IN) # find the starting state of the input pin n_qual = 5 # number of successive readings that must match to qualify count = 0 last_val = False start = time.time() while count < n_qual: if (time.time() - start) > 10: break val = GPIO.input(gpio_pin) == 0 if val == last_val: count += 1 last_val = val else: count = 0 # reset last_val = val time.sleep(0.1) # pause between reads if count >= n_qual: kill_sw_ok = val # the value of n_qual consecutive reads # print "Initial value is: %s" % val else: kill_sw_ok = False; print "Initial value not found; count = %s" % count # TODO need better error handling? if not rospy.is_shutdown(): time.sleep(0.2) pub.publish(kill_sw_ok) # publish initial state rospy.loginfo(kill_sw_ok) while not rospy.is_shutdown(): try: if not kill_sw_ok: # Use falling edge detection to see if pin is pulled # low to avoid repeated polling GPIO.wait_for_edge(gpio_pin, GPIO.FALLING) time.sleep(0.1) # wait for sw bounce if not GPIO.input(gpio_pin): # re-read to confirm kill_sw_ok = True pub.publish(kill_sw_ok) rospy.loginfo(kill_sw_ok) pub_exec_simple.publish("START_EXEC") rospy.loginfo("kill_sw_mon: Pubishing START_EXEC") else: GPIO.wait_for_edge(gpio_pin, GPIO.RISING) time.sleep(0.1) # wait for sw bounce if GPIO.input(gpio_pin): kill_sw_ok = False pub.publish(kill_sw_ok) rospy.loginfo(kill_sw_ok) rate.sleep() except Exception, e: #Revert all GPIO pins to their normal states (i.e. input = safe) GPIO.cleanup() if __name__ == '__main__': try: kill_sw_mon() except rospy.ROSInterruptException: #Revert all GPIO pins to their normal states (i.e. input = safe) GPIO.cleanup() pass
apache-2.0
8,239,543,852,723,142,000
33.954955
81
0.569072
false
3.923155
false
false
false
fossfreedom/coverart-browser
coverart_controllers.py
1
28816
# -*- Mode: python; coding: utf-8; tab-width: 4; indent-tabs-mode: nil; -*- # # Copyright (C) 2012 - fossfreedom # Copyright (C) 2012 - Agustin Carrasco # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2, or (at your option) # any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA. from datetime import date from collections import OrderedDict from collections import namedtuple from gi.repository import GObject from gi.repository import Gdk from gi.repository import RB from gi.repository import Gio from gi.repository import GLib from coverart_browser_prefs import CoverLocale from coverart_browser_prefs import GSetting from coverart_utils import create_pixbuf_from_file_at_size from coverart_utils import GenreConfiguredSpriteSheet from coverart_utils import ConfiguredSpriteSheet from coverart_utils import get_stock_size from coverart_utils import CaseInsensitiveDict from coverart_utils import Theme import rb MenuNodeT = namedtuple('MenuNode', 'label menutype typevalue') def MenuNode(label, menutype=None, typevalue=None): return MenuNodeT(label, menutype, typevalue) class OptionsController(GObject.Object): # properties options = GObject.property(type=object, default=None) current_key = GObject.property(type=str, default=None) update_image = GObject.property(type=bool, default=False) enabled = GObject.property(type=bool, default=True) def __init__(self): super(OptionsController, self).__init__() # connect the variations on the current key to the controllers action self.connect('notify::current-key', self._do_action) def get_current_key_index(self): return self.options.index(self.current_key) def option_selected(self, key): if key != self.current_key: # update the current value self.current_key = key def _do_action(self, *args): self.do_action() def do_action(self): pass def get_current_image(self): return None def get_current_description(self): return self.current_key def update_images(self, *args): pass def create_spritesheet(self, plugin, sheet, typestr): ''' helper function to create a specific spritesheet ''' if sheet: del sheet return ConfiguredSpriteSheet(plugin, typestr, get_stock_size()) def create_button_image(self, plugin, image, icon_name): ''' helper function to create a button image ''' if image: del image path = 'img/' + Theme(self.plugin).current + '/' return create_pixbuf_from_file_at_size( rb.find_plugin_file(self.plugin, path + icon_name), *get_stock_size()) class PlaylistPopupController(OptionsController): def __init__(self, plugin, album_model): super(PlaylistPopupController, self).__init__() self._album_model = album_model shell = plugin.shell self.plugin = plugin # get the library name and initialize the superclass with it self._library_name = shell.props.library_source.props.name # get the queue name self._queue_name = shell.props.queue_source.props.name if " (" in self._queue_name: self._queue_name = self._queue_name[0:self._queue_name.find(" (")] self._spritesheet = None self._update_options(shell) # get the playlist model so we can monitor changes playlist_model = shell.props.display_page_model # connect signals to update playlists playlist_model.connect('row-inserted', self._update_options, shell) playlist_model.connect('row-deleted', self._update_options, shell) playlist_model.connect('row-changed', self._update_options, shell) def update_images(self, *args): self._spritesheet = self.create_spritesheet(self.plugin, self._spritesheet, 'playlist') if args[-1]: self.update_image = True def _update_options(self, *args): shell = args[-1] self.update_images(False) playlist_manager = shell.props.playlist_manager still_exists = self.current_key == self._library_name or \ self.current_key == self._queue_name # retrieve the options values = OrderedDict() # library and play queue sources values[self._library_name] = None values[self._queue_name] = shell.props.queue_source # playlists playlists_entries = playlist_manager.get_playlists() for playlist in playlists_entries: if playlist.props.is_local: name = playlist.props.name values[name] = playlist still_exists = still_exists or name == self.current_key self.values = values self.options = list(values.keys()) self.current_key = self.current_key if still_exists else \ self._library_name def do_action(self): playlist = self.values[self.current_key] if not playlist: self._album_model.remove_filter('model') else: self._album_model.replace_filter('model', playlist.get_query_model()) def get_current_image(self): playlist = self.values[self.current_key] if self.current_key == self._library_name: image = self._spritesheet['music'] elif self._queue_name in self.current_key: image = self._spritesheet['queue'] elif isinstance(playlist, RB.StaticPlaylistSource): image = self._spritesheet['playlist'] else: image = self._spritesheet['smart'] return image class GenrePopupController(OptionsController): # properties new_genre_icon = GObject.property(type=bool, default=False) def __init__(self, plugin, album_model): super(GenrePopupController, self).__init__() cl = CoverLocale() cl.switch_locale(cl.Locale.LOCALE_DOMAIN) self._album_model = album_model shell = plugin.shell self.plugin = plugin # create a new property model for the genres genres_model = RB.RhythmDBPropertyModel.new(shell.props.db, RB.RhythmDBPropType.GENRE) query = shell.props.library_source.props.base_query_model genres_model.props.query_model = query # initial genre self._initial_genre = _('All Genres') self._spritesheet = None self._default_image = None self._unrecognised_image = None self._connect_properties() self._connect_signals(query, genres_model) # generate initial popup self._update_options(genres_model) def update_images(self, *args): if self._spritesheet: del self._spritesheet self._spritesheet = GenreConfiguredSpriteSheet(self.plugin, 'genre', get_stock_size()) self._default_image = self.create_button_image(self.plugin, self._default_image, 'default_genre.png') self._unrecognised_image = self.create_button_image(self.plugin, self._unrecognised_image, 'unrecognised_genre.png') if args[-1]: self.update_image = True def _connect_signals(self, query, genres_model): # connect signals to update genres self.connect('notify::new-genre-icon', self._update_options, genres_model) query.connect('row-inserted', self._update_options, genres_model) query.connect('row-deleted', self._update_options, genres_model) query.connect('row-changed', self._update_options, genres_model) def _connect_properties(self): gs = GSetting() setting = gs.get_setting(gs.Path.PLUGIN) setting.bind(gs.PluginKey.NEW_GENRE_ICON, self, 'new_genre_icon', Gio.SettingsBindFlags.GET) def _update_options(self, *args): genres_model = args[-1] self.update_images(False) still_exists = False # retrieve the options options = [] row_num = 0 for row in genres_model: if row_num == 0: cl = CoverLocale() cl.switch_locale(cl.Locale.LOCALE_DOMAIN) genre = _('All Genres') row_num = row_num + 1 else: genre = row[0] options.append(genre) still_exists = still_exists or genre == self.current_key self.options = options self.current_key = self.current_key if still_exists else \ self._initial_genre def do_action(self): ''' called when genre popup menu item chosen return None if the first entry in popup returned ''' if self.current_key == self._initial_genre: self._album_model.remove_filter('genre') else: self._album_model.replace_filter('genre', self.current_key) def get_current_image(self): test_genre = self.current_key.lower() if test_genre == self._initial_genre.lower(): image = self._default_image else: image = self._find_alternates(test_genre) if image == self._unrecognised_image and \ test_genre in self._spritesheet: image = self._spritesheet[test_genre] return image def _find_alternates(self, test_genre): # the following genre checks are required # 1. if we have user defined genres # 2. then check locale specific system genres # 3. then check local specific alternates # 4. then check if we system genres # where necessary check if any of the genres are a substring # of test_genre - check in reverse order so that we # test largest strings first (prevents spurious matches with # short strings) # N.B. we use RB.search_fold since the strings can be # in a mixture of cases, both unicode (normalized or not) and str # and as usual python cannot mix and match these types. test_genre = RB.search_fold(test_genre) ret, sprite = self._match_genres(test_genre, self._spritesheet.GENRE_USER) if ret: return sprite for genre in sorted(self._spritesheet.locale_names, key=lambda b: (-len(b), b)): if RB.search_fold(genre) in test_genre: return self._spritesheet[self._spritesheet.locale_names[genre]] # next check locale alternates ret, sprite = self._match_genres(test_genre, self._spritesheet.GENRE_LOCALE) if ret: return sprite ret, sprite = self._match_genres(test_genre, self._spritesheet.GENRE_SYSTEM) if ret: return sprite # check if any of the default genres are a substring # of test_genre - check in reverse order so that we # test largest strings first (prevents spurious matches with # short strings) for genre in sorted(self._spritesheet.names, key=lambda b: (-len(b), b)): if RB.search_fold(genre) in test_genre: return self._spritesheet[genre] # if no matches then default to unrecognised image return self._unrecognised_image def _match_genres(self, test_genre, genre_type): case_search = CaseInsensitiveDict( dict((k.name, v) for k, v in self._spritesheet.genre_alternate.items() if k.genre_type == genre_type)) if test_genre in case_search: return (True, self._spritesheet[case_search[test_genre]]) else: return (False, None) def get_current_description(self): cl = CoverLocale() cl.switch_locale(cl.Locale.LOCALE_DOMAIN) if self.current_key == self._initial_genre: return _('All Genres') else: return self.current_key class SortPopupController(OptionsController): def __init__(self, plugin, viewmgr): super(SortPopupController, self).__init__() self._viewmgr = viewmgr self.plugin = plugin # sorts dictionary cl = CoverLocale() cl.switch_locale(cl.Locale.LOCALE_DOMAIN) self.values = OrderedDict([(_('Sort by album name'), 'name'), (_('Sort by album artist'), 'artist'), (_('Sort by year'), 'year'), (_('Sort by rating'), 'rating')]) self.options = list(self.values.keys()) # get the current sort key and initialise the superclass gs = GSetting() source_settings = gs.get_setting(gs.Path.PLUGIN) value = source_settings[gs.PluginKey.SORT_BY] self._spritesheet = None self.update_images(False) self.current_key = list(self.values.keys())[ list(self.values.values()).index(value)] def update_images(self, *args): self._spritesheet = self.create_spritesheet(self.plugin, self._spritesheet, 'sort') if args[-1]: self.update_image = True def do_action(self): sort = self.values[self.current_key] gs = GSetting() settings = gs.get_setting(gs.Path.PLUGIN) settings[gs.PluginKey.SORT_BY] = sort self._viewmgr.current_view.get_default_manager().emit('sort', "album") def get_current_image(self): sort = self.values[self.current_key] return self._spritesheet[sort] class ArtistSortPopupController(OptionsController): def __init__(self, plugin, viewmgr): super(ArtistSortPopupController, self).__init__() self._viewmgr = viewmgr self.plugin = plugin # sorts dictionary cl = CoverLocale() cl.switch_locale(cl.Locale.LOCALE_DOMAIN) self.values = OrderedDict([(_('Sort by album name'), 'name_artist'), (_('Sort by year'), 'year_artist'), (_('Sort by rating'), 'rating_artist')]) self.options = list(self.values.keys()) # get the current sort key and initialise the superclass gs = GSetting() source_settings = gs.get_setting(gs.Path.PLUGIN) value = source_settings[gs.PluginKey.SORT_BY_ARTIST] if value not in list(self.values.values()): print("here") value = 'name_artist' source_settings[gs.PluginKey.SORT_BY_ARTIST] = value self._spritesheet = None self.update_images(False) self.current_key = list(self.values.keys())[ list(self.values.values()).index(value)] print(self.current_key) def update_images(self, *args): self._spritesheet = self.create_spritesheet(self.plugin, self._spritesheet, 'sort_artist') if args[-1]: self.update_image = True def do_action(self): sort = self.values[self.current_key] gs = GSetting() settings = gs.get_setting(gs.Path.PLUGIN) settings[gs.PluginKey.SORT_BY_ARTIST] = sort self._viewmgr.current_view.get_default_manager().emit('sort', "artist") def get_current_image(self): sort = self.values[self.current_key] return self._spritesheet[sort] class PropertiesMenuController(OptionsController): favourites = GObject.property(type=bool, default=False) follow = GObject.property(type=bool, default=False) def __init__(self, plugin, source): super(PropertiesMenuController, self).__init__() self._source = source self.plugin = plugin self._connect_properties() # sorts dictionary cl = CoverLocale() cl.switch_locale(cl.Locale.LOCALE_DOMAIN) # options self.values = OrderedDict() self.values[MenuNode(_('Download all covers'))] = 'download' self.values[MenuNode(_('Play random album'))] = 'random' self.values[MenuNode(_('Follow playing song'), 'check', (True if self.follow else False))] = 'follow' self.values[MenuNode('separator1', 'separator')] = '' self.values[MenuNode(_('Use favourites only'), 'check', (True if self.favourites else False))] = 'favourite' self.values[MenuNode('separator2', 'separator')] = '' self.values[MenuNode(_('Browser Preferences'))] = 'browser prefs' self.values[MenuNode(_('Search Preferences'))] = 'search prefs' self.options = list(self.values.keys()) self.update_images(False) if self.favourites: self._source.propertiesbutton_callback('favourite') if self.follow: self._source.propertiesbutton_callback('follow') self.current_key = None def _connect_properties(self): gs = GSetting() setting = gs.get_setting(gs.Path.PLUGIN) setting.bind( gs.PluginKey.USE_FAVOURITES, self, 'favourites', Gio.SettingsBindFlags.DEFAULT) setting.bind( gs.PluginKey.FOLLOWING, self, 'follow', Gio.SettingsBindFlags.DEFAULT) def _change_key(self, dict, old, new): for i in range(len(dict)): k, v = dict.popitem(False) dict[new if old == k else k] = v def update_images(self, *args): self._image = self.create_button_image(self.plugin, None, 'properties.png') if args[-1]: self.update_image = True def do_action(self): if self.current_key: key = [node for node in self.values if node.label == self.current_key] if self.current_key == _('Use favourites only'): self.favourites = not self.favourites if self.current_key == _('Follow playing song'): self.follow = not self.follow self._source.propertiesbutton_callback(self.values[key[0]]) self.current_key = None def get_current_image(self): return self._image def get_current_description(self): return _('Properties') class DecadePopupController(OptionsController): def __init__(self, plugin, album_model): super(DecadePopupController, self).__init__() self._album_model = album_model self.plugin = plugin self._spritesheet = None # decade options cl = CoverLocale() cl.switch_locale(cl.Locale.LOCALE_DOMAIN) self.values = OrderedDict() self.values[_('All Decades')] = [-1, 'All Decades'] # '20s' as in the decade 2010 self.values[_('20s')] = [2020, '20s'] #'10s' as in the decade 2010 self.values[_('10s')] = [2010, '10s'] #'00s' as in the decade 2000 self.values[_('00s')] = [2000, '00s'] #'90s' as in the decade 1990 self.values[_('90s')] = [1990, '90s'] #'80s' as in the decade 1980 self.values[_('80s')] = [1980, '80s'] #'70s' as in the decade 1970 self.values[_('70s')] = [1970, '70s'] #'60s' as in the decade 1960 self.values[_('60s')] = [1960, '60s'] #'50s' as in the decade 1950 self.values[_('50s')] = [1950, '50s'] #'40s' as in the decade 1940 self.values[_('40s')] = [1940, '40s'] #'30s' as in the decade 1930 self.values[_('30s')] = [1930, '30s'] #'Older' as in 'older than the year 1930' self.values[_('Older')] = [-1, 'Older'] self.options = list(self.values.keys()) # if we aren't on the 20s yet, remove it if date.today().year < 2020: self.options.remove(_('20s')) # define a initial decade an set the initial key self._initial_decade = self.options[0] self.update_images(False) self.current_key = self._initial_decade def update_images(self, *args): self._spritesheet = self.create_spritesheet(self.plugin, self._spritesheet, 'decade') if args[-1]: self.update_image = True def do_action(self): if self.current_key == self._initial_decade: self._album_model.remove_filter('decade') else: self._album_model.replace_filter('decade', self.values[self.current_key][0]) def get_current_image(self): decade = self.values[self.current_key][1] return self._spritesheet[decade] def get_current_description(self): return self.current_key class SortOrderToggleController(OptionsController): toolbar_type = "album" def __init__(self, plugin, viewmgr): super(SortOrderToggleController, self).__init__() self._viewmgr = viewmgr self.plugin = plugin # options self.values = OrderedDict([(_('Sort in descending order'), False), (_('Sort in ascending order'), True)]) self.options = list(self.values.keys()) self._images = [] # set the current key self.gs = GSetting() self.settings = self.gs.get_setting(self.gs.Path.PLUGIN) self.key = self.get_key() sort_order = self.settings[self.key] self.current_key = list(self.values.keys())[ list(self.values.values()).index(sort_order)] self.update_images(False) def get_key(self): return self.gs.PluginKey.SORT_ORDER def update_images(self, *args): # initialize images if len(self._images) > 0: del self._images[:] self._images.append(self.create_button_image(self.plugin, None, 'arrow_down.png')) self._images.append(self.create_button_image(self.plugin, None, 'arrow_up.png')) if args[-1]: self.update_image = True def do_action(self): sort_order = self.values[self.current_key] self.settings[self.key] = sort_order self._viewmgr.current_view.get_default_manager().emit('sort', self.toolbar_type) def get_current_image(self): return self._images[self.get_current_key_index()] class ArtistSortOrderToggleController(SortOrderToggleController): toolbar_type = "artist" def __init__(self, plugin, model): super(ArtistSortOrderToggleController, self).__init__(plugin, model) def get_key(self): return self.gs.PluginKey.SORT_ORDER_ARTIST class AlbumSearchEntryController(OptionsController): # properties search_text = GObject.property(type=str, default='') def __init__(self, album_model): super(AlbumSearchEntryController, self).__init__() self._album_model = album_model self._filter_type = 'all' # options self.values = OrderedDict() self.values[_('Search all fields')] = 'all' self.values[_('Search album artists')] = 'album_artist' self.values[_('Search track artists')] = 'artist' self.values[_('Search composers')] = 'composers' self.values[_('Search albums')] = 'album_name' self.values[_('Search titles')] = 'track' self.options = list(self.values.keys()) self.current_key = list(self.values.keys())[0] self._typing = False self._typing_counter = 0 self._current_search_text = "" def do_action(self): # remove old filter self._album_model.remove_filter(self._filter_type, False) # assign the new filter self._filter_type = self.values[self.current_key] self.do_search(self.search_text, True) def _search_typing(self, *args): self._typing_counter = self._typing_counter + 1 if self._typing_counter >= 4 and self._typing: self._typing = False self._change_filter(self._current_search_text, False) return self._typing def _change_filter(self, search_text, force): # self.search_text = search_text self._current_search_text = search_text if search_text: self._album_model.replace_filter(self._filter_type, search_text) elif not force: self._album_model.remove_filter(self._filter_type) def do_search(self, search_text, force=False): ''' if self.search_text != search_text or force: self.search_text = search_text if search_text: self._album_model.replace_filter(self._filter_type, search_text) elif not force: self._album_model.remove_filter(self._filter_type) ''' # self.search_text = search_text if force: self._typing_counter = 99 self._typing = False self._change_filter(search_text, force) return if self._current_search_text != search_text: #self.search_text = search_text self._current_search_text = search_text self._typing_counter = 0 if not self._typing: self._typing = True Gdk.threads_add_timeout(GLib.PRIORITY_DEFAULT_IDLE, 100, self._search_typing) class AlbumQuickSearchController(object): def __init__(self, album_manager): self._album_manager = album_manager def connect_quick_search(self, quick_search): quick_search.connect('quick-search', self._on_quick_search) quick_search.connect('arrow-pressed', self._on_arrow_pressed) quick_search.connect('hide', self._on_hide) def _on_quick_search(self, quick_search, search_text, *args): album = self._album_manager.model.find_first_visible('album_name', search_text) if album: path = self._album_manager.model.get_path(album) self._album_manager.current_view.select_and_scroll_to_path(path) def _on_arrow_pressed(self, quick_search, key, *args): current = self._album_manager.current_view.get_selected_objects()[0] search_text = quick_search.get_text() album = None if key == Gdk.KEY_Up: album = self._album_manager.model.find_first_visible( 'album_name', search_text, current, True) elif key == Gdk.KEY_Down: album = self._album_manager.model.find_first_visible( 'album_name', search_text, current) if album: path = self._album_manager.model.get_path(album) self._album_manager.current_view.select_and_scroll_to_path(path) def _on_hide(self, quick_search, *args): self._album_manager.current_view.grab_focus() class ViewController(OptionsController): def __init__(self, shell, viewmgr): super(ViewController, self).__init__() self._viewmgr = viewmgr from coverart_browser_source import Views views = Views(shell) self.values = OrderedDict() for view_name in views.get_view_names(): self.values[views.get_menu_name(view_name)] = view_name print(view_name) self.options = list(self.values.keys()) viewmgr.connect('new-view', self.on_notify_view_name) def on_notify_view_name(self, *args): for key in self.options: if self.values[key] == self._viewmgr.view_name: self.current_key = key def do_action(self): if self._viewmgr.view_name != self.values[self.current_key]: self._viewmgr.view_name = self.values[self.current_key]
gpl-3.0
-712,676,144,686,856,600
32.941107
111
0.58877
false
4.040381
true
false
false
neo900/skyline
src/horizon/listen.py
1
4999
import socket from os import kill, getpid from Queue import Full from multiprocessing import Process from struct import Struct, unpack from msgpack import unpackb from cPickle import loads import logging import settings logger = logging.getLogger("HorizonLog") class Listen(Process): """ The listener is responsible for listening on a port. """ def __init__(self, port, queue, parent_pid, type="pickle"): super(Listen, self).__init__() try: self.ip = settings.HORIZON_IP except AttributeError: # Default for backwards compatibility self.ip = socket.gethostname() self.port = port self.q = queue self.daemon = True self.parent_pid = parent_pid self.current_pid = getpid() self.type = type def gen_unpickle(self, infile): """ Generate a pickle from a stream """ try: bunch = loads(infile) yield bunch except EOFError: return def read_all(self, sock, n): """ Read n bytes from a stream """ data = '' while n > 0: buf = sock.recv(n) n -= len(buf) data += buf return data def check_if_parent_is_alive(self): """ Self explanatory """ try: kill(self.current_pid, 0) kill(self.parent_pid, 0) except: exit(0) def listen_pickle(self): """ Listen for pickles over tcp """ while 1: try: # Set up the TCP listening socket s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) s.bind((self.ip, self.port)) s.setblocking(1) s.listen(5) logger.info('listening over tcp for pickles on %s' % self.port) (conn, address) = s.accept() logger.info('connection from %s:%s' % (address[0], self.port)) chunk = [] while 1: self.check_if_parent_is_alive() try: length = Struct('!I').unpack(self.read_all(conn, 4)) body = self.read_all(conn, length[0]) # Iterate and chunk each individual datapoint for bunch in self.gen_unpickle(body): for metric in bunch: chunk.append(metric) # Queue the chunk and empty the variable if len(chunk) > settings.CHUNK_SIZE: try: self.q.put(list(chunk), block=False) chunk[:] = [] # Drop chunk if queue is full except Full: logger.info('queue is full, dropping datapoints') chunk[:] = [] except Exception as e: logger.info(e) logger.info('incoming connection dropped, attempting to reconnect') break except Exception as e: logger.info('can\'t connect to socket: ' + str(e)) break def listen_udp(self): """ Listen over udp for MessagePack strings """ while 1: try: s = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) s.bind((self.ip, self.port)) logger.info('listening over udp for messagepack on %s' % self.port) chunk = [] while 1: self.check_if_parent_is_alive() data, addr = s.recvfrom(1024) metric = unpackb(data) chunk.append(metric) # Queue the chunk and empty the variable if len(chunk) > settings.CHUNK_SIZE: try: self.q.put(list(chunk), block=False) chunk[:] = [] # Drop chunk if queue is full except Full: logger.info('queue is full, dropping datapoints') chunk[:] = [] except Exception as e: logger.info('can\'t connect to socket: ' + str(e)) break def run(self): """ Called when process intializes. """ logger.info('started listener') if self.type == 'pickle': self.listen_pickle() elif self.type == 'udp': self.listen_udp() else: logging.error('unknown listener format')
mit
-8,091,358,596,528,935,000
31.044872
91
0.455091
false
4.891389
false
false
false
bavla/Graph
PsCoresTQ.py
1
2315
gdir = 'c:/users/batagelj/work/python/graph/graph' # wdir = 'c:/users/batagelj/work/python/graph/JSON/test' wdir = 'c:/users/batagelj/work/python/graph/JSON/SN5' import sys, os, datetime, json sys.path = [gdir]+sys.path; os.chdir(wdir) import GraphNew as Graph import TQ # fJSON = 'ConnectivityWeighted.json' # fJSON = "violenceE.json" # fJSON = 'stem.json' # fJSON = 'CcCtest.json' # fJSON = 'Terror news 50.json' fJSON = 'CcCSN5.json' # S = Graph.Graph.loadNetJSON(fJSON); G = S.pairs2edges() G = Graph.Graph.loadNetJSON(fJSON) # G.saveNetJSON(file="Terror50E",indent=1) # fJSON = 'ConnectivityTest.json' # fJSON = 'ExampleB.json' # fJSON = 'PathfinderTest.json' # G = Graph.Graph.loadNetJSON(fJSON) G.delLoops() print("Temporal Ps cores in: ",fJSON) t1 = datetime.datetime.now() print("started: ",t1.ctime(),"\n") Tmin,Tmax = G._graph['time'] D = { u: G.TQnetSum(u) for u in G._nodes } # print("Sum =",D,"\n") Core = { u: [d for d in D[u] if d[2]==0] for u in G.nodes() } # core number = 0 D = { u: [d for d in D[u] if d[2]>0] for u in G.nodes() } D = { u: d for u,d in D.items() if d!=[] } Dmin = { u: min([e[2] for e in d]) for u,d in D.items() } step = 0 while len(D)>0: step += 1 dmin,u = min( (v,k) for k,v in Dmin.items() ) if step % 100 == 1: print("{0:3d}. dmin={1:10.4f} node={2:4d}".format(step,dmin,u)) cCore = TQ.TQ.complement(Core[u],Tmin,Tmax+1) core = TQ.TQ.extract(cCore,[d for d in D[u] if d[2] == dmin]) if core!=[]: Core[u] = TQ.TQ.sum(Core[u],core) D[u] = TQ.TQ.cutGE(TQ.TQ.sum(D[u],TQ.TQ.minus(core)),dmin) for link in G.star(u): v = G.twin(u,link) if not(v in D): continue chLink = TQ.TQ.minus(TQ.TQ.extract(core,G.getLink(link,'tq'))) if chLink==[]: continue diff = TQ.TQ.cutGE(TQ.TQ.sum(D[v],chLink),0) D[v] = [ (sd,fd,max(vd,dmin)) for sd,fd,vd in diff ] if len(D[v])==0: del D[v]; del Dmin[v] else: Dmin[v] = min([e[2] for e in D[v]]) if len(D[u])==0: del D[u]; del Dmin[u] else: Dmin[u] = min([e[2] for e in D[u]]) print("{0:3d}. dmin={1:10.4f} node={2:4d}".format(step,dmin,u)) # print("\n-----\nCore =",Core) t2 = datetime.datetime.now() print("\nfinished: ",t2.ctime(),"\ntime used: ", t2-t1)
gpl-3.0
3,479,323,956,564,014,600
36.583333
71
0.577538
false
2.232401
false
false
false
HarmonyEnterpriseSolutions/harmony-platform
src/gnue/common/datasources/drivers/ldap/Connection.py
1
5525
# GNU Enterprise Common Library - Generic DBSIG2 database driver - Connection # # Copyright 2000-2007 Free Software Foundation # # This file is part of GNU Enterprise. # # GNU Enterprise is free software; you can redistribute it # and/or modify it under the terms of the GNU General Public # License as published by the Free Software Foundation; either # version 2, or (at your option) any later version. # # GNU Enterprise is distributed in the hope that it will be # useful, but WITHOUT ANY WARRANTY; without even the implied # warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR # PURPOSE. See the GNU General Public License for more details. # # You should have received a copy of the GNU General Public # License along with program; see the file COPYING. If not, # write to the Free Software Foundation, Inc., 59 Temple Place # - Suite 330, Boston, MA 02111-1307, USA. # # $Id: Connection.py,v 1.2 2008/11/04 20:14:03 oleg Exp $ """ Generic Connection class for DBSIG2 based database driver plugins. """ from src.gnue.common.datasources.drivers.ldap import ResultSet __all__ = ['Connection'] import ldap from gnue.common.datasources import Exceptions from gnue.common.datasources.drivers import Base # ============================================================================= # Connection class # ============================================================================= class Connection (Base.Connection): """ """ _resultSetClass_ = ResultSet # --------------------------------------------------------------------------- # Constructor # --------------------------------------------------------------------------- def __init__ (self, connections, name, parameters): Base.Connection.__init__ (self, connections, name, parameters) # --------------------------------------------------------------------------- # Implementations of virtual methods # --------------------------------------------------------------------------- def _getLoginFields_ (self): return [(u_('User Name'), '_username', 'string', None, None, []), (u_('Password'), '_password', 'password', None, None, [])] # --------------------------------------------------------------------------- def _connect_ (self, connectData): print "_connect_", connectData try: self._ldapObject = ldap.open(connectData['host'], int(connectData.get('port', 389))) self._ldapObject.simple_bind_s(connectData['_username'], connectData['_password']) except ldap.LDAPError, e: raise self.decorateError( Exceptions.LoginError("%s: %s" % tuple(errors.getException()[1:3])) ) # --------------------------------------------------------------------------- def _insert_ (self, table, newfields): raise NotImplementedError # --------------------------------------------------------------------------- def _update_ (self, table, oldfields, newfields): raise NotImplementedError # --------------------------------------------------------------------------- def _delete_ (self, table, oldfields): raise NotImplementedError # --------------------------------------------------------------------------- def _requery_ (self, table, oldfields, fields, parameters): raise NotImplementedError # --------------------------------------------------------------------------- def _commit_ (self): pass # --------------------------------------------------------------------------- def _rollback_ (self): pass # --------------------------------------------------------------------------- def _close_ (self): pass # --------------------------------------------------------------------------- # Virtual methods to be implemented by descendants # --------------------------------------------------------------------------- def _getConnectParams_ (self, connectData): """ Return a tuple with a list and a dictionary, being the parameters and keyword arguments to be passed to the connection function of the DBSIG2 driver. This method must be overwritten by all descendants. """ return ([], {}) # --------------------------------------------------------------------------- def _createTimestamp_ (self, year, month, day, hour, minute, secs, msec = 0): """ Create a timestamp object for the given point in time. This function doesn't have to be overwritten unless the handling of time values is weird. @param year: Year number @param month: Month number (1 - 12) @param day: Day of the month (1 - 31) @param hour: Hour (0 - 23) @param minute: Minute (0 - 59) @param secs: Whole seconds (integer) @param msec: Microseconds (integer) returns: a timestamp object created by the driver's Timestamp constructor """ raise NotImplementedError # --------------------------------------------------------------------------- # Create an apropriate time object for the given values # --------------------------------------------------------------------------- def _createTime_ (self, hour, minute, second, msec = 0): """ Create a time object for the given point in time. This function doesn't have to be overwritten unless the handling of time values is weird. @param hour: Hour (0 - 23) @param minute: Minute (0 - 59) @param second: Whole seconds (integer) @param msec: Microseconds (integer) returns: a time object created by the driver's Time constructor """ raise NotImplementedError def decorateError(self, error): """ This function used to make database related error user frielndly """ return error
gpl-2.0
5,706,516,712,830,585,000
31.122093
87
0.520543
false
4.638959
false
false
false
doraemonext/wechat-platform
wechat_platform/system/response/models.py
1
7805
# -*- coding: utf-8 -*- import logging from time import time from django.db import models from wechat_sdk.messages import EventMessage from system.official_account.models import OfficialAccount logger_response = logging.getLogger(__name__) class ResponseManager(models.Manager): """ 微信服务器响应消息记录表 Manager """ def get(self, official_account, msgid): return super(ResponseManager, self).get_queryset().filter( official_account=official_account ).filter( msgid=msgid ).exclude( type=Response.TYPE_WAITING ) def get_latest(self, official_account, wechat_instance): """ 获取指定公众号指定OpenID下最新一条回复 :param official_account: 微信公众号实例 (OfficialAccount) :param wechat_instance: 微信请求实例 (WechatBasic) :return: 响应实例 (Response) """ message = wechat_instance.get_message() return super(ResponseManager, self).get_queryset().filter( official_account=official_account ).filter( target=message.source ).exclude( type=Response.TYPE_WAITING ).order_by( '-time' )[:1] def add(self, official_account, wechat_instance, type, pattern, raw, plugin_dict): """ 添加一条新的响应消息记录 :param official_account: 微信公众号实例 (OfficialAccount) :param wechat_instance: 微信请求实例 (WechatBasic) :param type: 信息类型 :param pattern: 响应方式 :param raw: 原始信息内容 :param plugin_dict: 所使用的插件字典, exp: {'iden': 'text', 'reply_id': 54} """ message = wechat_instance.get_message() if isinstance(message, EventMessage): msgid = message.target + str(message.time) else: msgid = message.id # 先在数据库中查找等待中的消息回复 response = super(ResponseManager, self).get_queryset().filter( official_account=official_account ).filter( msgid=msgid ).filter( type=Response.TYPE_WAITING ) if response: response = response[0] response.time = int(time()) response.type = type response.pattern = pattern response.raw = raw response.plugin_iden = plugin_dict['iden'] response.reply_id = plugin_dict['reply_id'] response.save() logger_response.debug('Response has been updated [Detail: %s]' % response.__dict__) else: response = super(ResponseManager, self).create( official_account=official_account, msgid=msgid, target=message.source, source=message.target, time=int(time()), type=type, pattern=pattern, raw=raw, plugin_iden=plugin_dict['iden'], reply_id=plugin_dict['reply_id'], ) logger_response.debug('New response created [Detail: %s]' % response.__dict__) return response def is_waiting(self, official_account, wechat_instance): """ 判断该回复是否正在等待中 :param official_account: 微信公众号实例 (OfficialAccount) :param wechat_instance: 微信请求实例 (WechatBasic) :return: 如果正在等待中, 返回 True """ message = wechat_instance.get_message() if isinstance(message, EventMessage): msgid = message.target + str(message.time) else: msgid = message.id # 在数据库中查找等待中的消息回复 response = super(ResponseManager, self).get_queryset().filter( official_account=official_account ).filter( msgid=msgid ).filter( type=Response.TYPE_WAITING ) if response: return True else: return False def add_waiting(self, official_account, wechat_instance): """ 添加一条新的响应消息记录 (说明该请求正在被执行中) :param official_account: 微信公众号实例 (OfficialAccount) :param wechat_instance: 微信请求实例 (WechatBasic) """ message = wechat_instance.get_message() if isinstance(message, EventMessage): msgid = message.target + str(message.time) else: msgid = message.id response = super(ResponseManager, self).create( official_account=official_account, msgid=msgid, target=message.source, source=message.target, time=int(time()), type=Response.TYPE_WAITING, pattern=Response.PATTERN_WAITING, raw='' ) logger_response.debug('New response created [Detail: %s]' % response.__dict__) return response def end_waiting(self, official_account, wechat_instance): """ 结束一条正在等待的响应消息记录 :param official_account: 微信公众号实例 (OfficialAccount) :param wechat_instance: 微信请求实例 (WechatBasic) """ message = wechat_instance.get_message() if isinstance(message, EventMessage): msgid = message.target + str(message.time) else: msgid = message.id # 在数据库中查找等待中的消息回复 response = super(ResponseManager, self).get_queryset().filter( official_account=official_account ).filter( msgid=msgid ).filter( type=Response.TYPE_WAITING ) if response: response[0].delete() class Response(models.Model): """ 微信服务器响应消息记录表 """ TYPE_TEXT = 'text' TYPE_IMAGE = 'image' TYPE_VIDEO = 'video' TYPE_VOICE = 'voice' TYPE_NEWS = 'news' TYPE_MUSIC = 'music' TYPE_WAITING = 'waiting' TYPE = ( (TYPE_TEXT, u'文本消息'), (TYPE_IMAGE, u'图片消息'), (TYPE_VIDEO, u'视频消息'), (TYPE_VOICE, u'语音消息'), (TYPE_NEWS, u'图文消息'), (TYPE_MUSIC, u'音乐消息'), (TYPE_WAITING, u'执行中消息'), ) PATTERN_NORMAL = 0 PATTERN_SERVICE = 1 PATTERN_SIMULATION = 2 PATTERN_WAITING = 3 PATTERN = ( (PATTERN_NORMAL, u'正常XML返回模式'), (PATTERN_SERVICE, u'多客服返回模式'), (PATTERN_SIMULATION, u'模拟登陆返回模式'), (PATTERN_WAITING, u'执行中消息'), ) official_account = models.ForeignKey(OfficialAccount, verbose_name=u'所属公众号') msgid = models.CharField(u'MsgID或FromUserName+CreateTime', max_length=50) target = models.CharField(u'目标用户OpenID', max_length=50) source = models.CharField(u'来源用户OpenID', max_length=50) time = models.IntegerField(u'信息发送时间') type = models.CharField(u'信息类型', choices=TYPE, max_length=15) pattern = models.IntegerField(u'响应方式', choices=PATTERN) raw = models.TextField(u'响应信息原始内容') plugin_iden = models.CharField(u'插件标识符', max_length=50, null=True, blank=True) reply_id = models.IntegerField(u'插件回复ID', null=True, blank=True) objects = models.Manager() manager = ResponseManager() class Meta: verbose_name = u'微信服务器响应信息' verbose_name_plural = u'微信服务器响应信息' db_table = 'response' def __unicode__(self): return self.raw
bsd-2-clause
8,729,925,608,646,641,000
30.864865
95
0.579952
false
3.201901
false
false
false
blab/antibody-response-pulse
bcell-array/code/Virus_Bcell_IgM_IgG_Landscape.py
1
11385
# coding: utf-8 # # Antibody Response Pulse # https://github.com/blab/antibody-response-pulse # # ### B-cells evolution --- cross-reactive antibody response after influenza virus infection or vaccination # ### Adaptive immune response for repeated infection # In[1]: ''' author: Alvason Zhenhua Li date: 04/09/2015 ''' get_ipython().magic(u'matplotlib inline') import numpy as np import matplotlib.pyplot as plt import os import alva_machinery_event_OAS_new as alva AlvaFontSize = 23 AlvaFigSize = (15, 5) numberingFig = 0 # equation plotting dir_path = '/Users/al/Desktop/GitHub/antibody-response-pulse/bcell-array/figure' file_name = 'Virus-Bcell-IgM-IgG' figure_name = '-equation' file_suffix = '.png' save_figure = os.path.join(dir_path, file_name + figure_name + file_suffix) numberingFig = numberingFig + 1 plt.figure(numberingFig, figsize=(12, 5)) plt.axis('off') plt.title(r'$ Virus-Bcell-IgM-IgG \ equations \ (antibody-response \ for \ repeated-infection) $' , fontsize = AlvaFontSize) plt.text(0, 7.0/9, r'$ \frac{\partial V_n(t)}{\partial t} = +\mu_{v} V_{n}(t)(1 - \frac{V_n(t)}{V_{max}}) - \phi_{m} M_{n}(t) V_{n}(t) - \phi_{g} G_{n}(t) V_{n}(t) $' , fontsize = 1.2*AlvaFontSize) plt.text(0, 5.0/9, r'$ \frac{\partial B_n(t)}{\partial t} = +\mu_{b}V_{n}(t)(1 - \frac{V_n(t)}{V_{max}}) + (\beta_{m} + \beta_{g}) V_{n}(t) B_{n}(t) - \mu_{b} B_{n}(t) + m_b V_{n}(t)\frac{B_{i-1}(t) - 2B_i(t) + B_{i+1}(t)}{(\Delta i)^2} $' , fontsize = 1.2*AlvaFontSize) plt.text(0, 3.0/9,r'$ \frac{\partial M_n(t)}{\partial t} = +\xi_{m} B_{n}(t) - \phi_{m} M_{n}(t) V_{n}(t) - \mu_{m} M_{n}(t) $' , fontsize = 1.2*AlvaFontSize) plt.text(0, 1.0/9,r'$ \frac{\partial G_n(t)}{\partial t} = +\xi_{g} B_{n}(t) - \phi_{g} G_{n}(t) V_{n}(t) - \mu_{g} G_{n}(t) + m_a V_{n}(t)\frac{G_{i-1}(t) - 2G_i(t) + G_{i+1}(t)}{(\Delta i)^2} $' , fontsize = 1.2*AlvaFontSize) plt.savefig(save_figure, dpi = 100) plt.show() # define the V-M-G partial differential equations def dVdt_array(VBMGxt = [], *args): # naming V = VBMGxt[0] B = VBMGxt[1] M = VBMGxt[2] G = VBMGxt[3] x_totalPoint = VBMGxt.shape[1] # there are n dSdt dV_dt_array = np.zeros(x_totalPoint) # each dSdt with the same equation form dV_dt_array[:] = +inRateV*V[:]*(1 - V[:]/maxV) - killRateVm*M[:]*V[:] - killRateVg*G[:]*V[:] return(dV_dt_array) def dBdt_array(VBMGxt = [], *args): # naming V = VBMGxt[0] B = VBMGxt[1] M = VBMGxt[2] G = VBMGxt[3] x_totalPoint = VBMGxt.shape[1] # there are n dSdt dB_dt_array = np.zeros(x_totalPoint) # each dSdt with the same equation form Bcopy = np.copy(B) centerX = Bcopy[:] leftX = np.roll(Bcopy[:], 1) rightX = np.roll(Bcopy[:], -1) leftX[0] = centerX[0] rightX[-1] = centerX[-1] dB_dt_array[:] = +inRateB*V[:]*(1 - V[:]/maxV) + (actRateBm + alva.event_active + alva.event_OAS_B)*V[:]*B[:] - outRateB*B[:] + mutatRateB*V[:]*(leftX[:] - 2*centerX[:] + rightX[:])/(dx**2) return(dB_dt_array) def dMdt_array(VBMGxt = [], *args): # naming V = VBMGxt[0] B = VBMGxt[1] M = VBMGxt[2] G = VBMGxt[3] x_totalPoint = VBMGxt.shape[1] # there are n dSdt dM_dt_array = np.zeros(x_totalPoint) # each dSdt with the same equation form dM_dt_array[:] = +inRateM*B[:] - consumeRateM*M[:]*V[:] - outRateM*M[:] return(dM_dt_array) def dGdt_array(VBMGxt = [], *args): # naming V = VBMGxt[0] B = VBMGxt[1] M = VBMGxt[2] G = VBMGxt[3] x_totalPoint = VBMGxt.shape[1] # there are n dSdt dG_dt_array = np.zeros(x_totalPoint) # each dSdt with the same equation form Gcopy = np.copy(G) centerX = Gcopy[:] leftX = np.roll(Gcopy[:], 1) rightX = np.roll(Gcopy[:], -1) leftX[0] = centerX[0] rightX[-1] = centerX[-1] dG_dt_array[:] = +(inRateG + alva.event_OAS)*B[:] - consumeRateG*G[:]*V[:] - outRateG*G[:] + mutatRateA*(leftX[:] - 2*centerX[:] + rightX[:])/(dx**2) return(dG_dt_array) # In[2]: # setting parameter timeUnit = 'year' if timeUnit == 'hour': hour = float(1) day = float(24) elif timeUnit == 'day': day = float(1) hour = float(1)/24 elif timeUnit == 'year': year = float(1) day = float(1)/365 hour = float(1)/24/365 maxV = float(50) # max virus/micro-liter inRateV = 0.2/hour # in-rate of virus killRateVm = 0.0003/hour # kill-rate of virus by antibody-IgM killRateVg = killRateVm # kill-rate of virus by antibody-IgG inRateB = 0.06/hour # in-rate of B-cell outRateB = inRateB/8 # out-rate of B-cell actRateBm = killRateVm # activation rate of naive B-cell inRateM = 0.16/hour # in-rate of antibody-IgM from naive B-cell outRateM = inRateM/1 # out-rate of antibody-IgM from naive B-cell consumeRateM = killRateVm # consume-rate of antibody-IgM by cleaning virus inRateG = inRateM/10 # in-rate of antibody-IgG from memory B-cell outRateG = outRateM/250 # out-rate of antibody-IgG from memory B-cell consumeRateG = killRateVg # consume-rate of antibody-IgG by cleaning virus mutatRateB = 0.00002/hour # B-cell mutation rate mutatRateA = 0.0002/hour # mutation rate # time boundary and griding condition minT = float(0) maxT = float(10*12*30*day) totalPoint_T = int(6*10**3 + 1) gT = np.linspace(minT, maxT, totalPoint_T) spacingT = np.linspace(minT, maxT, num = totalPoint_T, retstep = True) gT = spacingT[0] dt = spacingT[1] # space boundary and griding condition minX = float(0) maxX = float(9) totalPoint_X = int(maxX - minX + 1) gX = np.linspace(minX, maxX, totalPoint_X) gridingX = np.linspace(minX, maxX, num = totalPoint_X, retstep = True) gX = gridingX[0] dx = gridingX[1] gV_array = np.zeros([totalPoint_X, totalPoint_T]) gB_array = np.zeros([totalPoint_X, totalPoint_T]) gM_array = np.zeros([totalPoint_X, totalPoint_T]) gG_array = np.zeros([totalPoint_X, totalPoint_T]) # initial output condition #gV_array[1, 0] = float(2) #[pre-parameter, post-parameter, recovered-day, OAS+, OSA-, origin_virus] actRateBg_1st = 0.0002/hour # activation rate of memory B-cell at 1st time (pre-) actRateBg_2nd = actRateBg_1st*10 # activation rate of memory B-cell at 2nd time (post-) origin_virus = int(2) current_virus = int(6) event_parameter = np.array([[actRateBg_1st, actRateBg_2nd, 14*day, +5/hour, -actRateBm - actRateBg_1st + (actRateBm + actRateBg_1st)/1.3, origin_virus, current_virus]]) # [viral population, starting time] ---first infection_period = 12*30*day viral_population = np.zeros(int(maxX + 1)) viral_population[origin_virus:current_virus + 1] = 3 infection_starting_time = np.arange(int(maxX + 1))*infection_period event_1st = np.zeros([int(maxX + 1), 2]) event_1st[:, 0] = viral_population event_1st[:, 1] = infection_starting_time print ('event_1st = {:}'.format(event_1st)) # [viral population, starting time] ---2nd] viral_population = np.zeros(int(maxX + 1)) viral_population[origin_virus:current_virus + 1] = 0 infection_starting_time = np.arange(int(maxX + 1))*0 event_2nd = np.zeros([int(maxX + 1), 2]) event_2nd[:, 0] = viral_population event_2nd[:, 1] = infection_starting_time print ('event_2nd = {:}'.format(event_2nd)) event_table = np.array([event_parameter, event_1st, event_2nd]) # Runge Kutta numerical solution pde_array = np.array([dVdt_array, dBdt_array, dMdt_array, dGdt_array]) initial_Out = np.array([gV_array, gB_array, gM_array, gG_array]) gOut_array = alva.AlvaRungeKutta4XT(pde_array, initial_Out, minX, maxX, totalPoint_X, minT, maxT, totalPoint_T, event_table) # plotting gV = gOut_array[0] gB = gOut_array[1] gM = gOut_array[2] gG = gOut_array[3] numberingFig = numberingFig + 1 for i in range(totalPoint_X): figure_name = '-response-%i'%(i) figure_suffix = '.png' save_figure = os.path.join(dir_path, file_name + figure_name + file_suffix) plt.figure(numberingFig, figsize = AlvaFigSize) plt.plot(gT, gV[i], color = 'red', label = r'$ V_{%i}(t) $'%(i), linewidth = 3.0, alpha = 0.5) plt.plot(gT, gM[i], color = 'blue', label = r'$ IgM_{%i}(t) $'%(i), linewidth = 3.0, alpha = 0.5) plt.plot(gT, gG[i], color = 'green', label = r'$ IgG_{%i}(t) $'%(i), linewidth = 3.0, alpha = 0.5) plt.plot(gT, gM[i] + gG[i], color = 'gray', linewidth = 5.0, alpha = 0.5, linestyle = 'dashed' , label = r'$ IgM_{%i}(t) + IgG_{%i}(t) $'%(i, i)) plt.grid(True, which = 'both') plt.title(r'$ Antibody \ from \ Virus-{%i} $'%(i), fontsize = AlvaFontSize) plt.xlabel(r'$time \ (%s)$'%(timeUnit), fontsize = AlvaFontSize) plt.ylabel(r'$ Neutralization \ \ titer $', fontsize = AlvaFontSize) plt.xlim([minT, maxT]) plt.xticks(fontsize = AlvaFontSize*0.6) plt.yticks(fontsize = AlvaFontSize*0.6) plt.ylim([2**0, 2**12]) plt.yscale('log', basey = 2) plt.legend(loc = (1,0), fontsize = AlvaFontSize) plt.savefig(save_figure, dpi = 100, bbox_inches='tight') plt.show() # In[3]: # Normalization stacked graph numberingFig = numberingFig + 1 plt.figure(numberingFig, figsize = AlvaFigSize) plt.stackplot(gT, gM + gG, alpha = 0.3) plt.title(r'$ Stacked-graph \ of \ Antibody $', fontsize = AlvaFontSize) plt.xlabel(r'$time \ (%s)$'%(timeUnit), fontsize = AlvaFontSize) plt.ylabel(r'$ Neutralization \ \ titer $', fontsize = AlvaFontSize) plt.xticks(fontsize = AlvaFontSize*0.6) plt.yticks(fontsize = AlvaFontSize*0.6) plt.ylim([2**0, 2**12]) plt.yscale('log', basey = 2) plt.grid(True) plt.show() # In[4]: # expected peak of the antibody response totalColor = current_virus - origin_virus + 1 AlvaColor = [plt.get_cmap('rainbow')(float(i)/(totalColor)) for i in range(1, totalColor + 1)] sample_time = 90*day # plotting figure_name = '-landscape' figure_suffix = '.png' save_figure = os.path.join(dir_path, file_name + figure_name + file_suffix) numberingFig = numberingFig + 1 plt.figure(numberingFig, figsize = (12, 9)) for i in range(origin_virus, current_virus + 1): detect_xn = current_virus + 2 - i if detect_xn == origin_virus: virus_label = '$ origin-virus $' elif detect_xn == current_virus: virus_label = '$ current-virus $' else: virus_label = '$ {:}th-virus $'.format(detect_xn - origin_virus + 1) detect_time = int(totalPoint_T/(maxT - minT)*(detect_xn*infection_period + sample_time)) plt.plot(gX, gM[:, detect_time] + gG[:, detect_time], marker = 'o', markersize = 20 , color = AlvaColor[detect_xn - origin_virus], label = virus_label) plt.fill_between(gX, gM[:, detect_time] + gG[:, detect_time], facecolor = AlvaColor[detect_xn - origin_virus] , alpha = 0.5) plt.grid(True, which = 'both') plt.title(r'$ Antibody \ Landscape $', fontsize = AlvaFontSize) plt.xlabel(r'$ Virus \ space \ (Antigenic-distance) $', fontsize = AlvaFontSize) plt.ylabel(r'$ Neutralization \ \ titer $', fontsize = AlvaFontSize) plt.xlim([minX, maxX]) plt.xticks(fontsize = AlvaFontSize) plt.yticks(fontsize = AlvaFontSize) plt.ylim([2**0, 2**9]) plt.yscale('log', basey = 2) plt.legend(loc = (1,0), fontsize = AlvaFontSize) plt.savefig(save_figure, dpi = 100, bbox_inches='tight') plt.show() # In[ ]:
gpl-2.0
5,572,586,783,299,461,000
36.084691
257
0.622047
false
2.538462
false
false
false
moyogo/ufo2ft
Lib/ufo2ft/outlineCompiler.py
1
55408
import logging import math from collections import Counter, namedtuple from io import BytesIO from types import SimpleNamespace from fontTools.cffLib import ( CharStrings, GlobalSubrsIndex, IndexedStrings, PrivateDict, SubrsIndex, TopDict, TopDictIndex, ) from fontTools.misc.arrayTools import unionRect from fontTools.misc.fixedTools import otRound from fontTools.pens.boundsPen import ControlBoundsPen from fontTools.pens.reverseContourPen import ReverseContourPen from fontTools.pens.t2CharStringPen import T2CharStringPen from fontTools.pens.ttGlyphPen import TTGlyphPen from fontTools.ttLib import TTFont, newTable from fontTools.ttLib.tables._g_l_y_f import USE_MY_METRICS, Glyph from fontTools.ttLib.tables._h_e_a_d import mac_epoch_diff from fontTools.ttLib.tables.O_S_2f_2 import Panose from ufo2ft.constants import COLOR_LAYERS_KEY, COLOR_PALETTES_KEY from ufo2ft.errors import InvalidFontData from ufo2ft.fontInfoData import ( dateStringForNow, dateStringToTimeValue, getAttrWithFallback, intListToNum, normalizeStringForPostscript, ) from ufo2ft.util import ( _copyGlyph, calcCodePageRanges, makeOfficialGlyphOrder, makeUnicodeToGlyphNameMapping, ) logger = logging.getLogger(__name__) BoundingBox = namedtuple("BoundingBox", ["xMin", "yMin", "xMax", "yMax"]) EMPTY_BOUNDING_BOX = BoundingBox(0, 0, 0, 0) def _isNonBMP(s): for c in s: if ord(c) > 65535: return True return False def _getVerticalOrigin(font, glyph): if hasattr(glyph, "verticalOrigin") and glyph.verticalOrigin is not None: verticalOrigin = glyph.verticalOrigin else: os2 = font.get("OS/2") typo_ascender = os2.sTypoAscender if os2 is not None else 0 verticalOrigin = typo_ascender return otRound(verticalOrigin) class BaseOutlineCompiler: """Create a feature-less outline binary.""" sfntVersion = None tables = frozenset( [ "head", "hmtx", "hhea", "name", "maxp", "cmap", "OS/2", "post", "vmtx", "vhea", "COLR", "CPAL", ] ) def __init__( self, font, glyphSet=None, glyphOrder=None, tables=None, notdefGlyph=None, ): self.ufo = font # use the previously filtered glyphSet, if any if glyphSet is None: glyphSet = {g.name: g for g in font} self.makeMissingRequiredGlyphs(font, glyphSet, self.sfntVersion, notdefGlyph) self.allGlyphs = glyphSet # store the glyph order if glyphOrder is None: glyphOrder = font.glyphOrder self.glyphOrder = self.makeOfficialGlyphOrder(glyphOrder) # make a reusable character mapping self.unicodeToGlyphNameMapping = self.makeUnicodeToGlyphNameMapping() if tables is not None: self.tables = tables # cached values defined later on self._glyphBoundingBoxes = None self._fontBoundingBox = None self._compiledGlyphs = None def compile(self): """ Compile the OpenType binary. """ self.otf = TTFont(sfntVersion=self.sfntVersion) # only compile vertical metrics tables if vhea metrics are defined vertical_metrics = [ "openTypeVheaVertTypoAscender", "openTypeVheaVertTypoDescender", "openTypeVheaVertTypoLineGap", ] self.vertical = all( getAttrWithFallback(self.ufo.info, metric) is not None for metric in vertical_metrics ) self.colorLayers = ( COLOR_LAYERS_KEY in self.ufo.lib and COLOR_PALETTES_KEY in self.ufo.lib ) # write the glyph order self.otf.setGlyphOrder(self.glyphOrder) # populate basic tables self.setupTable_head() self.setupTable_hmtx() self.setupTable_hhea() self.setupTable_name() self.setupTable_maxp() self.setupTable_cmap() self.setupTable_OS2() self.setupTable_post() if self.vertical: self.setupTable_vmtx() self.setupTable_vhea() if self.colorLayers: self.setupTable_COLR() self.setupTable_CPAL() self.setupOtherTables() self.importTTX() return self.otf def compileGlyphs(self): """Compile glyphs and return dict keyed by glyph name. **This should not be called externally.** Subclasses must override this method to handle compilation of glyphs. """ raise NotImplementedError def getCompiledGlyphs(self): if self._compiledGlyphs is None: self._compiledGlyphs = self.compileGlyphs() return self._compiledGlyphs def makeGlyphsBoundingBoxes(self): """ Make bounding boxes for all the glyphs, and return a dictionary of BoundingBox(xMin, xMax, yMin, yMax) namedtuples keyed by glyph names. The bounding box of empty glyphs (without contours or components) is set to None. The bbox values are integers. **This should not be called externally.** Subclasses must override this method to handle the bounds creation for their specific glyph type. """ raise NotImplementedError @property def glyphBoundingBoxes(self): if self._glyphBoundingBoxes is None: self._glyphBoundingBoxes = self.makeGlyphsBoundingBoxes() return self._glyphBoundingBoxes def makeFontBoundingBox(self): """ Make a bounding box for the font. **This should not be called externally.** Subclasses may override this method to handle the bounds creation in a different way if desired. """ fontBox = None for glyphBox in self.glyphBoundingBoxes.values(): if glyphBox is None: continue if fontBox is None: fontBox = glyphBox else: fontBox = unionRect(fontBox, glyphBox) if fontBox is None: # unlikely fontBox = EMPTY_BOUNDING_BOX return fontBox @property def fontBoundingBox(self): if self._fontBoundingBox is None: self._fontBoundingBox = self.makeFontBoundingBox() return self._fontBoundingBox def makeUnicodeToGlyphNameMapping(self): """ Make a ``unicode : glyph name`` mapping for the font. **This should not be called externally.** Subclasses may override this method to handle the mapping creation in a different way if desired. """ return makeUnicodeToGlyphNameMapping(self.allGlyphs, self.glyphOrder) @staticmethod def makeMissingRequiredGlyphs(font, glyphSet, sfntVersion, notdefGlyph=None): """ Add .notdef to the glyph set if it is not present. **This should not be called externally.** Subclasses may override this method to handle the glyph creation in a different way if desired. """ if ".notdef" in glyphSet: return reverseContour = sfntVersion == "\000\001\000\000" if notdefGlyph: notdefGlyph = _copyGlyph(notdefGlyph, reverseContour=reverseContour) else: unitsPerEm = otRound(getAttrWithFallback(font.info, "unitsPerEm")) ascender = otRound(getAttrWithFallback(font.info, "ascender")) descender = otRound(getAttrWithFallback(font.info, "descender")) defaultWidth = otRound(unitsPerEm * 0.5) notdefGlyph = StubGlyph( name=".notdef", width=defaultWidth, unitsPerEm=unitsPerEm, ascender=ascender, descender=descender, reverseContour=reverseContour, ) glyphSet[".notdef"] = notdefGlyph def makeOfficialGlyphOrder(self, glyphOrder): """ Make the final glyph order. **This should not be called externally.** Subclasses may override this method to handle the order creation in a different way if desired. """ return makeOfficialGlyphOrder(self.allGlyphs, glyphOrder) # -------------- # Table Builders # -------------- def setupTable_gasp(self): if "gasp" not in self.tables: return self.otf["gasp"] = gasp = newTable("gasp") gasp_ranges = dict() for record in self.ufo.info.openTypeGaspRangeRecords: rangeMaxPPEM = record["rangeMaxPPEM"] behavior_bits = record["rangeGaspBehavior"] rangeGaspBehavior = intListToNum(behavior_bits, 0, 4) gasp_ranges[rangeMaxPPEM] = rangeGaspBehavior gasp.gaspRange = gasp_ranges def setupTable_head(self): """ Make the head table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "head" not in self.tables: return self.otf["head"] = head = newTable("head") font = self.ufo head.checkSumAdjustment = 0 head.tableVersion = 1.0 head.magicNumber = 0x5F0F3CF5 # version numbers # limit minor version to 3 digits as recommended in OpenType spec: # https://www.microsoft.com/typography/otspec/recom.htm versionMajor = getAttrWithFallback(font.info, "versionMajor") versionMinor = getAttrWithFallback(font.info, "versionMinor") fullFontRevision = float("%d.%03d" % (versionMajor, versionMinor)) head.fontRevision = round(fullFontRevision, 3) if head.fontRevision != fullFontRevision: logger.warning( "Minor version in %s has too many digits and won't fit into " "the head table's fontRevision field; rounded to %s.", fullFontRevision, head.fontRevision, ) # upm head.unitsPerEm = otRound(getAttrWithFallback(font.info, "unitsPerEm")) # times head.created = ( dateStringToTimeValue(getAttrWithFallback(font.info, "openTypeHeadCreated")) - mac_epoch_diff ) head.modified = dateStringToTimeValue(dateStringForNow()) - mac_epoch_diff # bounding box xMin, yMin, xMax, yMax = self.fontBoundingBox head.xMin = otRound(xMin) head.yMin = otRound(yMin) head.xMax = otRound(xMax) head.yMax = otRound(yMax) # style mapping styleMapStyleName = getAttrWithFallback(font.info, "styleMapStyleName") macStyle = [] if styleMapStyleName == "bold": macStyle = [0] elif styleMapStyleName == "bold italic": macStyle = [0, 1] elif styleMapStyleName == "italic": macStyle = [1] head.macStyle = intListToNum(macStyle, 0, 16) # misc head.flags = intListToNum( getAttrWithFallback(font.info, "openTypeHeadFlags"), 0, 16 ) head.lowestRecPPEM = otRound( getAttrWithFallback(font.info, "openTypeHeadLowestRecPPEM") ) head.fontDirectionHint = 2 head.indexToLocFormat = 0 head.glyphDataFormat = 0 def setupTable_name(self): """ Make the name table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "name" not in self.tables: return font = self.ufo self.otf["name"] = name = newTable("name") name.names = [] # Set name records from font.info.openTypeNameRecords for nameRecord in getAttrWithFallback(font.info, "openTypeNameRecords"): nameId = nameRecord["nameID"] platformId = nameRecord["platformID"] platEncId = nameRecord["encodingID"] langId = nameRecord["languageID"] # on Python 2, plistLib (used by ufoLib) returns unicode strings # only when plist data contain non-ascii characters, and returns # ascii-encoded bytes when it can. On the other hand, fontTools's # name table `setName` method wants unicode strings, so we must # decode them first nameVal = nameRecord["string"] name.setName(nameVal, nameId, platformId, platEncId, langId) # Build name records familyName = getAttrWithFallback(font.info, "styleMapFamilyName") styleName = getAttrWithFallback(font.info, "styleMapStyleName").title() preferredFamilyName = getAttrWithFallback( font.info, "openTypeNamePreferredFamilyName" ) preferredSubfamilyName = getAttrWithFallback( font.info, "openTypeNamePreferredSubfamilyName" ) fullName = f"{preferredFamilyName} {preferredSubfamilyName}" nameVals = { 0: getAttrWithFallback(font.info, "copyright"), 1: familyName, 2: styleName, 3: getAttrWithFallback(font.info, "openTypeNameUniqueID"), 4: fullName, 5: getAttrWithFallback(font.info, "openTypeNameVersion"), 6: getAttrWithFallback(font.info, "postscriptFontName"), 7: getAttrWithFallback(font.info, "trademark"), 8: getAttrWithFallback(font.info, "openTypeNameManufacturer"), 9: getAttrWithFallback(font.info, "openTypeNameDesigner"), 10: getAttrWithFallback(font.info, "openTypeNameDescription"), 11: getAttrWithFallback(font.info, "openTypeNameManufacturerURL"), 12: getAttrWithFallback(font.info, "openTypeNameDesignerURL"), 13: getAttrWithFallback(font.info, "openTypeNameLicense"), 14: getAttrWithFallback(font.info, "openTypeNameLicenseURL"), 16: preferredFamilyName, 17: preferredSubfamilyName, 18: getAttrWithFallback(font.info, "openTypeNameCompatibleFullName"), 19: getAttrWithFallback(font.info, "openTypeNameSampleText"), 21: getAttrWithFallback(font.info, "openTypeNameWWSFamilyName"), 22: getAttrWithFallback(font.info, "openTypeNameWWSSubfamilyName"), } # don't add typographic names if they are the same as the legacy ones if nameVals[1] == nameVals[16]: del nameVals[16] if nameVals[2] == nameVals[17]: del nameVals[17] # postscript font name if nameVals[6]: nameVals[6] = normalizeStringForPostscript(nameVals[6]) for nameId in sorted(nameVals.keys()): nameVal = nameVals[nameId] if not nameVal: continue platformId = 3 platEncId = 10 if _isNonBMP(nameVal) else 1 langId = 0x409 # Set built name record if not set yet if name.getName(nameId, platformId, platEncId, langId): continue name.setName(nameVal, nameId, platformId, platEncId, langId) def setupTable_maxp(self): """ Make the maxp table. **This should not be called externally.** Subclasses must override or supplement this method to handle the table creation for either CFF or TT data. """ raise NotImplementedError def setupTable_cmap(self): """ Make the cmap table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "cmap" not in self.tables: return from fontTools.ttLib.tables._c_m_a_p import cmap_format_4 nonBMP = {k: v for k, v in self.unicodeToGlyphNameMapping.items() if k > 65535} if nonBMP: mapping = { k: v for k, v in self.unicodeToGlyphNameMapping.items() if k <= 65535 } else: mapping = dict(self.unicodeToGlyphNameMapping) # mac cmap4_0_3 = cmap_format_4(4) cmap4_0_3.platformID = 0 cmap4_0_3.platEncID = 3 cmap4_0_3.language = 0 cmap4_0_3.cmap = mapping # windows cmap4_3_1 = cmap_format_4(4) cmap4_3_1.platformID = 3 cmap4_3_1.platEncID = 1 cmap4_3_1.language = 0 cmap4_3_1.cmap = mapping # store self.otf["cmap"] = cmap = newTable("cmap") cmap.tableVersion = 0 cmap.tables = [cmap4_0_3, cmap4_3_1] # If we have glyphs outside Unicode BMP, we must set another # subtable that can hold longer codepoints for them. if nonBMP: from fontTools.ttLib.tables._c_m_a_p import cmap_format_12 nonBMP.update(mapping) # mac cmap12_0_4 = cmap_format_12(12) cmap12_0_4.platformID = 0 cmap12_0_4.platEncID = 4 cmap12_0_4.language = 0 cmap12_0_4.cmap = nonBMP # windows cmap12_3_10 = cmap_format_12(12) cmap12_3_10.platformID = 3 cmap12_3_10.platEncID = 10 cmap12_3_10.language = 0 cmap12_3_10.cmap = nonBMP # update tables registry cmap.tables = [cmap4_0_3, cmap4_3_1, cmap12_0_4, cmap12_3_10] def setupTable_OS2(self): """ Make the OS/2 table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "OS/2" not in self.tables: return self.otf["OS/2"] = os2 = newTable("OS/2") font = self.ufo os2.version = 0x0004 # average glyph width os2.xAvgCharWidth = 0 hmtx = self.otf.get("hmtx") if hmtx is not None: widths = [width for width, _ in hmtx.metrics.values() if width > 0] if widths: os2.xAvgCharWidth = otRound(sum(widths) / len(widths)) # weight and width classes os2.usWeightClass = getAttrWithFallback(font.info, "openTypeOS2WeightClass") os2.usWidthClass = getAttrWithFallback(font.info, "openTypeOS2WidthClass") # embedding os2.fsType = intListToNum( getAttrWithFallback(font.info, "openTypeOS2Type"), 0, 16 ) # subscript, superscript, strikeout values, taken from AFDKO: # FDK/Tools/Programs/makeotf/makeotf_lib/source/hotconv/hot.c unitsPerEm = getAttrWithFallback(font.info, "unitsPerEm") italicAngle = getAttrWithFallback(font.info, "italicAngle") xHeight = getAttrWithFallback(font.info, "xHeight") def adjustOffset(offset, angle): """Adjust Y offset based on italic angle, to get X offset.""" return offset * math.tan(math.radians(-angle)) if angle else 0 v = getAttrWithFallback(font.info, "openTypeOS2SubscriptXSize") if v is None: v = unitsPerEm * 0.65 os2.ySubscriptXSize = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2SubscriptYSize") if v is None: v = unitsPerEm * 0.6 os2.ySubscriptYSize = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2SubscriptYOffset") if v is None: v = unitsPerEm * 0.075 os2.ySubscriptYOffset = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2SubscriptXOffset") if v is None: v = adjustOffset(-os2.ySubscriptYOffset, italicAngle) os2.ySubscriptXOffset = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2SuperscriptXSize") if v is None: v = os2.ySubscriptXSize os2.ySuperscriptXSize = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2SuperscriptYSize") if v is None: v = os2.ySubscriptYSize os2.ySuperscriptYSize = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2SuperscriptYOffset") if v is None: v = unitsPerEm * 0.35 os2.ySuperscriptYOffset = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2SuperscriptXOffset") if v is None: v = adjustOffset(os2.ySuperscriptYOffset, italicAngle) os2.ySuperscriptXOffset = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2StrikeoutSize") if v is None: v = getAttrWithFallback(font.info, "postscriptUnderlineThickness") os2.yStrikeoutSize = otRound(v) v = getAttrWithFallback(font.info, "openTypeOS2StrikeoutPosition") if v is None: v = xHeight * 0.6 if xHeight else unitsPerEm * 0.22 os2.yStrikeoutPosition = otRound(v) # family class ibmFontClass, ibmFontSubclass = getAttrWithFallback( font.info, "openTypeOS2FamilyClass" ) os2.sFamilyClass = (ibmFontClass << 8) + ibmFontSubclass # panose data = getAttrWithFallback(font.info, "openTypeOS2Panose") panose = Panose() panose.bFamilyType = data[0] panose.bSerifStyle = data[1] panose.bWeight = data[2] panose.bProportion = data[3] panose.bContrast = data[4] panose.bStrokeVariation = data[5] panose.bArmStyle = data[6] panose.bLetterForm = data[7] panose.bMidline = data[8] panose.bXHeight = data[9] os2.panose = panose # Unicode ranges uniRanges = getAttrWithFallback(font.info, "openTypeOS2UnicodeRanges") if uniRanges is not None: os2.ulUnicodeRange1 = intListToNum(uniRanges, 0, 32) os2.ulUnicodeRange2 = intListToNum(uniRanges, 32, 32) os2.ulUnicodeRange3 = intListToNum(uniRanges, 64, 32) os2.ulUnicodeRange4 = intListToNum(uniRanges, 96, 32) else: os2.recalcUnicodeRanges(self.otf) # codepage ranges codepageRanges = getAttrWithFallback(font.info, "openTypeOS2CodePageRanges") if codepageRanges is None: unicodes = self.unicodeToGlyphNameMapping.keys() codepageRanges = calcCodePageRanges(unicodes) os2.ulCodePageRange1 = intListToNum(codepageRanges, 0, 32) os2.ulCodePageRange2 = intListToNum(codepageRanges, 32, 32) # vendor id os2.achVendID = getAttrWithFallback(font.info, "openTypeOS2VendorID") # vertical metrics os2.sxHeight = otRound(getAttrWithFallback(font.info, "xHeight")) os2.sCapHeight = otRound(getAttrWithFallback(font.info, "capHeight")) os2.sTypoAscender = otRound( getAttrWithFallback(font.info, "openTypeOS2TypoAscender") ) os2.sTypoDescender = otRound( getAttrWithFallback(font.info, "openTypeOS2TypoDescender") ) os2.sTypoLineGap = otRound( getAttrWithFallback(font.info, "openTypeOS2TypoLineGap") ) os2.usWinAscent = otRound( getAttrWithFallback(font.info, "openTypeOS2WinAscent") ) os2.usWinDescent = otRound( getAttrWithFallback(font.info, "openTypeOS2WinDescent") ) # style mapping selection = list(getAttrWithFallback(font.info, "openTypeOS2Selection")) styleMapStyleName = getAttrWithFallback(font.info, "styleMapStyleName") if styleMapStyleName == "regular": selection.append(6) elif styleMapStyleName == "bold": selection.append(5) elif styleMapStyleName == "italic": selection.append(0) elif styleMapStyleName == "bold italic": selection += [0, 5] os2.fsSelection = intListToNum(selection, 0, 16) # characetr indexes unicodes = [i for i in self.unicodeToGlyphNameMapping.keys() if i is not None] if unicodes: minIndex = min(unicodes) maxIndex = max(unicodes) else: # the font may have *no* unicode values (it really happens!) so # there needs to be a fallback. use 0xFFFF, as AFDKO does: # FDK/Tools/Programs/makeotf/makeotf_lib/source/hotconv/map.c minIndex = 0xFFFF maxIndex = 0xFFFF if maxIndex > 0xFFFF: # the spec says that 0xFFFF should be used # as the max if the max exceeds 0xFFFF maxIndex = 0xFFFF os2.fsFirstCharIndex = minIndex os2.fsLastCharIndex = maxIndex os2.usBreakChar = 32 os2.usDefaultChar = 0 # maximum contextual lookup length os2.usMaxContex = 0 def setupTable_hmtx(self): """ Make the hmtx table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "hmtx" not in self.tables: return self.otf["hmtx"] = hmtx = newTable("hmtx") hmtx.metrics = {} for glyphName, glyph in self.allGlyphs.items(): width = otRound(glyph.width) if width < 0: raise ValueError("The width should not be negative: '%s'" % (glyphName)) bounds = self.glyphBoundingBoxes[glyphName] left = bounds.xMin if bounds else 0 hmtx[glyphName] = (width, left) def _setupTable_hhea_or_vhea(self, tag): """ Make the hhea table or the vhea table. This assume the hmtx or the vmtx were respectively made first. """ if tag not in self.tables: return if tag == "hhea": isHhea = True else: isHhea = False self.otf[tag] = table = newTable(tag) mtxTable = self.otf.get(tag[0] + "mtx") font = self.ufo if isHhea: table.tableVersion = 0x00010000 else: table.tableVersion = 0x00011000 # Vertical metrics in hhea, horizontal metrics in vhea # and caret info. # The hhea metrics names are formed as: # "openType" + tag.title() + "Ascender", etc. # While vhea metrics names are formed as: # "openType" + tag.title() + "VertTypo" + "Ascender", etc. # Caret info names only differ by tag.title(). commonPrefix = "openType%s" % tag.title() if isHhea: metricsPrefix = commonPrefix else: metricsPrefix = "openType%sVertTypo" % tag.title() metricsDict = { "ascent": "%sAscender" % metricsPrefix, "descent": "%sDescender" % metricsPrefix, "lineGap": "%sLineGap" % metricsPrefix, "caretSlopeRise": "%sCaretSlopeRise" % commonPrefix, "caretSlopeRun": "%sCaretSlopeRun" % commonPrefix, "caretOffset": "%sCaretOffset" % commonPrefix, } for otfName, ufoName in metricsDict.items(): setattr(table, otfName, otRound(getAttrWithFallback(font.info, ufoName))) # Horizontal metrics in hhea, vertical metrics in vhea advances = [] # width in hhea, height in vhea firstSideBearings = [] # left in hhea, top in vhea secondSideBearings = [] # right in hhea, bottom in vhea extents = [] if mtxTable is not None: for glyphName in self.allGlyphs: advance, firstSideBearing = mtxTable[glyphName] advances.append(advance) bounds = self.glyphBoundingBoxes[glyphName] if bounds is None: continue if isHhea: boundsAdvance = bounds.xMax - bounds.xMin # equation from the hhea spec for calculating xMaxExtent: # Max(lsb + (xMax - xMin)) extent = firstSideBearing + boundsAdvance else: boundsAdvance = bounds.yMax - bounds.yMin # equation from the vhea spec for calculating yMaxExtent: # Max(tsb + (yMax - yMin)). extent = firstSideBearing + boundsAdvance secondSideBearing = advance - firstSideBearing - boundsAdvance firstSideBearings.append(firstSideBearing) secondSideBearings.append(secondSideBearing) extents.append(extent) setattr( table, "advance%sMax" % ("Width" if isHhea else "Height"), max(advances) if advances else 0, ) setattr( table, "min%sSideBearing" % ("Left" if isHhea else "Top"), min(firstSideBearings) if firstSideBearings else 0, ) setattr( table, "min%sSideBearing" % ("Right" if isHhea else "Bottom"), min(secondSideBearings) if secondSideBearings else 0, ) setattr( table, "%sMaxExtent" % ("x" if isHhea else "y"), max(extents) if extents else 0, ) if isHhea: reserved = range(4) else: # vhea.reserved0 is caretOffset for legacy reasons reserved = range(1, 5) for i in reserved: setattr(table, "reserved%i" % i, 0) table.metricDataFormat = 0 # glyph count setattr( table, "numberOf%sMetrics" % ("H" if isHhea else "V"), len(self.allGlyphs) ) def setupTable_hhea(self): """ Make the hhea table. This assumes that the hmtx table was made first. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ self._setupTable_hhea_or_vhea("hhea") def setupTable_vmtx(self): """ Make the vmtx table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "vmtx" not in self.tables: return self.otf["vmtx"] = vmtx = newTable("vmtx") vmtx.metrics = {} for glyphName, glyph in self.allGlyphs.items(): height = otRound(glyph.height) if height < 0: raise ValueError( "The height should not be negative: '%s'" % (glyphName) ) verticalOrigin = _getVerticalOrigin(self.otf, glyph) bounds = self.glyphBoundingBoxes[glyphName] top = bounds.yMax if bounds else 0 vmtx[glyphName] = (height, verticalOrigin - top) def setupTable_VORG(self): """ Make the VORG table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "VORG" not in self.tables: return self.otf["VORG"] = vorg = newTable("VORG") vorg.majorVersion = 1 vorg.minorVersion = 0 vorg.VOriginRecords = {} # Find the most frequent verticalOrigin vorg_count = Counter( _getVerticalOrigin(self.otf, glyph) for glyph in self.allGlyphs.values() ) vorg.defaultVertOriginY = vorg_count.most_common(1)[0][0] if len(vorg_count) > 1: for glyphName, glyph in self.allGlyphs.items(): vertOriginY = _getVerticalOrigin(self.otf, glyph) if vertOriginY == vorg.defaultVertOriginY: continue vorg.VOriginRecords[glyphName] = vertOriginY vorg.numVertOriginYMetrics = len(vorg.VOriginRecords) def setupTable_vhea(self): """ Make the vhea table. This assumes that the head and vmtx tables were made first. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ self._setupTable_hhea_or_vhea("vhea") def setupTable_post(self): """ Make the post table. **This should not be called externally.** Subclasses may override or supplement this method to handle the table creation in a different way if desired. """ if "post" not in self.tables: return self.otf["post"] = post = newTable("post") font = self.ufo post.formatType = 3.0 # italic angle italicAngle = getAttrWithFallback(font.info, "italicAngle") post.italicAngle = italicAngle # underline underlinePosition = getAttrWithFallback( font.info, "postscriptUnderlinePosition" ) post.underlinePosition = otRound(underlinePosition) underlineThickness = getAttrWithFallback( font.info, "postscriptUnderlineThickness" ) post.underlineThickness = otRound(underlineThickness) post.isFixedPitch = getAttrWithFallback(font.info, "postscriptIsFixedPitch") # misc post.minMemType42 = 0 post.maxMemType42 = 0 post.minMemType1 = 0 post.maxMemType1 = 0 def setupTable_COLR(self): """ Compile the COLR table. **This should not be called externally.** """ if "COLR" not in self.tables: return from fontTools.colorLib.builder import buildCOLR layerInfo = self.ufo.lib[COLOR_LAYERS_KEY] glyphMap = self.otf.getReverseGlyphMap() if layerInfo: self.otf["COLR"] = buildCOLR(layerInfo, glyphMap=glyphMap) def setupTable_CPAL(self): """ Compile the CPAL table. **This should not be called externally.** """ if "CPAL" not in self.tables: return from fontTools.colorLib.builder import buildCPAL from fontTools.colorLib.errors import ColorLibError # colorLib wants colors as tuples, plistlib gives us lists palettes = [ [tuple(color) for color in palette] for palette in self.ufo.lib[COLOR_PALETTES_KEY] ] try: self.otf["CPAL"] = buildCPAL(palettes) except ColorLibError as e: raise InvalidFontData("Failed to build CPAL table") from e def setupOtherTables(self): """ Make the other tables. The default implementation does nothing. **This should not be called externally.** Subclasses may override this method to add other tables to the font if desired. """ pass def importTTX(self): """ Merge TTX files from data directory "com.github.fonttools.ttx" **This should not be called externally.** Subclasses may override this method to handle the bounds creation in a different way if desired. """ import os prefix = "com.github.fonttools.ttx" if not hasattr(self.ufo, "data"): return if not self.ufo.data.fileNames: return for path in self.ufo.data.fileNames: foldername, filename = os.path.split(path) if foldername == prefix and filename.endswith(".ttx"): ttx = self.ufo.data[path].decode("utf-8") fp = BytesIO(ttx.encode("utf-8")) # Preserve the original SFNT version when loading a TTX dump. sfntVersion = self.otf.sfntVersion try: self.otf.importXML(fp) finally: self.otf.sfntVersion = sfntVersion class OutlineOTFCompiler(BaseOutlineCompiler): """Compile a .otf font with CFF outlines.""" sfntVersion = "OTTO" tables = BaseOutlineCompiler.tables | {"CFF", "VORG"} def __init__( self, font, glyphSet=None, glyphOrder=None, tables=None, notdefGlyph=None, roundTolerance=None, optimizeCFF=True, ): if roundTolerance is not None: self.roundTolerance = float(roundTolerance) else: # round all coordinates to integers by default self.roundTolerance = 0.5 super().__init__( font, glyphSet=glyphSet, glyphOrder=glyphOrder, tables=tables, notdefGlyph=notdefGlyph, ) self.optimizeCFF = optimizeCFF self._defaultAndNominalWidths = None def getDefaultAndNominalWidths(self): """Return (defaultWidthX, nominalWidthX). If fontinfo.plist doesn't define these explicitly, compute optimal values from the glyphs' advance widths. """ if self._defaultAndNominalWidths is None: info = self.ufo.info # populate the width values if all( getattr(info, attr, None) is None for attr in ("postscriptDefaultWidthX", "postscriptNominalWidthX") ): # no custom values set in fontinfo.plist; compute optimal ones from fontTools.cffLib.width import optimizeWidths widths = [otRound(glyph.width) for glyph in self.allGlyphs.values()] defaultWidthX, nominalWidthX = optimizeWidths(widths) else: defaultWidthX = otRound( getAttrWithFallback(info, "postscriptDefaultWidthX") ) nominalWidthX = otRound( getAttrWithFallback(info, "postscriptNominalWidthX") ) self._defaultAndNominalWidths = (defaultWidthX, nominalWidthX) return self._defaultAndNominalWidths def compileGlyphs(self): """Compile and return the CFF T2CharStrings for this font.""" defaultWidth, nominalWidth = self.getDefaultAndNominalWidths() # The real PrivateDict will be created later on in setupTable_CFF. # For convenience here we use a namespace object to pass the default/nominal # widths that we need to draw the charstrings when computing their bounds. private = SimpleNamespace( defaultWidthX=defaultWidth, nominalWidthX=nominalWidth ) compiledGlyphs = {} for glyphName in self.glyphOrder: glyph = self.allGlyphs[glyphName] cs = self.getCharStringForGlyph(glyph, private) compiledGlyphs[glyphName] = cs return compiledGlyphs def makeGlyphsBoundingBoxes(self): """ Make bounding boxes for all the glyphs, and return a dictionary of BoundingBox(xMin, xMax, yMin, yMax) namedtuples keyed by glyph names. The bounding box of empty glyphs (without contours or components) is set to None. Check that the float values are within the range of the specified self.roundTolerance, and if so use the rounded value; else take the floor or ceiling to ensure that the bounding box encloses the original values. """ def toInt(value, else_callback): rounded = otRound(value) if tolerance >= 0.5 or abs(rounded - value) <= tolerance: return rounded else: return int(else_callback(value)) tolerance = self.roundTolerance glyphBoxes = {} charStrings = self.getCompiledGlyphs() for name, cs in charStrings.items(): bounds = cs.calcBounds(charStrings) if bounds is not None: rounded = [] for value in bounds[:2]: rounded.append(toInt(value, math.floor)) for value in bounds[2:]: rounded.append(toInt(value, math.ceil)) bounds = BoundingBox(*rounded) if bounds == EMPTY_BOUNDING_BOX: bounds = None glyphBoxes[name] = bounds return glyphBoxes def getCharStringForGlyph(self, glyph, private, globalSubrs=None): """ Get a Type2CharString for the *glyph* **This should not be called externally.** Subclasses may override this method to handle the charstring creation in a different way if desired. """ width = glyph.width defaultWidth = private.defaultWidthX nominalWidth = private.nominalWidthX if width == defaultWidth: # if width equals the default it can be omitted from charstring width = None else: # subtract the nominal width width -= nominalWidth if width is not None: width = otRound(width) pen = T2CharStringPen(width, self.allGlyphs, roundTolerance=self.roundTolerance) glyph.draw(pen) charString = pen.getCharString(private, globalSubrs, optimize=self.optimizeCFF) return charString def setupTable_maxp(self): """Make the maxp table.""" if "maxp" not in self.tables: return self.otf["maxp"] = maxp = newTable("maxp") maxp.tableVersion = 0x00005000 maxp.numGlyphs = len(self.glyphOrder) def setupOtherTables(self): self.setupTable_CFF() if self.vertical: self.setupTable_VORG() def setupTable_CFF(self): """Make the CFF table.""" if not {"CFF", "CFF "}.intersection(self.tables): return self.otf["CFF "] = cff = newTable("CFF ") cff = cff.cff # set up the basics cff.major = 1 cff.minor = 0 cff.hdrSize = 4 cff.offSize = 4 cff.fontNames = [] strings = IndexedStrings() cff.strings = strings private = PrivateDict(strings=strings) private.rawDict.update(private.defaults) globalSubrs = GlobalSubrsIndex(private=private) topDict = TopDict(GlobalSubrs=globalSubrs, strings=strings) topDict.Private = private charStrings = topDict.CharStrings = CharStrings( file=None, charset=None, globalSubrs=globalSubrs, private=private, fdSelect=None, fdArray=None, ) charStrings.charStringsAreIndexed = True topDict.charset = [] charStringsIndex = charStrings.charStringsIndex = SubrsIndex( private=private, globalSubrs=globalSubrs ) cff.topDictIndex = topDictIndex = TopDictIndex() topDictIndex.append(topDict) topDictIndex.strings = strings cff.GlobalSubrs = globalSubrs # populate naming data info = self.ufo.info psName = getAttrWithFallback(info, "postscriptFontName") cff.fontNames.append(psName) topDict = cff.topDictIndex[0] topDict.version = "%d.%d" % ( getAttrWithFallback(info, "versionMajor"), getAttrWithFallback(info, "versionMinor"), ) trademark = getAttrWithFallback(info, "trademark") if trademark: trademark = normalizeStringForPostscript( trademark.replace("\u00A9", "Copyright") ) if trademark != self.ufo.info.trademark: logger.info( "The trademark was normalized for storage in the " "CFF table and consequently some characters were " "dropped: '%s'", trademark, ) if trademark is None: trademark = "" topDict.Notice = trademark copyright = getAttrWithFallback(info, "copyright") if copyright: copyright = normalizeStringForPostscript( copyright.replace("\u00A9", "Copyright") ) if copyright != self.ufo.info.copyright: logger.info( "The copyright was normalized for storage in the " "CFF table and consequently some characters were " "dropped: '%s'", copyright, ) if copyright is None: copyright = "" topDict.Copyright = copyright topDict.FullName = getAttrWithFallback(info, "postscriptFullName") topDict.FamilyName = getAttrWithFallback( info, "openTypeNamePreferredFamilyName" ) topDict.Weight = getAttrWithFallback(info, "postscriptWeightName") # populate various numbers topDict.isFixedPitch = getAttrWithFallback(info, "postscriptIsFixedPitch") topDict.ItalicAngle = getAttrWithFallback(info, "italicAngle") underlinePosition = getAttrWithFallback(info, "postscriptUnderlinePosition") topDict.UnderlinePosition = otRound(underlinePosition) underlineThickness = getAttrWithFallback(info, "postscriptUnderlineThickness") topDict.UnderlineThickness = otRound(underlineThickness) # populate font matrix unitsPerEm = otRound(getAttrWithFallback(info, "unitsPerEm")) topDict.FontMatrix = [1.0 / unitsPerEm, 0, 0, 1.0 / unitsPerEm, 0, 0] # populate the width values defaultWidthX, nominalWidthX = self.getDefaultAndNominalWidths() if defaultWidthX: private.rawDict["defaultWidthX"] = defaultWidthX if nominalWidthX: private.rawDict["nominalWidthX"] = nominalWidthX # populate hint data blueFuzz = otRound(getAttrWithFallback(info, "postscriptBlueFuzz")) blueShift = otRound(getAttrWithFallback(info, "postscriptBlueShift")) blueScale = getAttrWithFallback(info, "postscriptBlueScale") forceBold = getAttrWithFallback(info, "postscriptForceBold") blueValues = getAttrWithFallback(info, "postscriptBlueValues") if isinstance(blueValues, list): blueValues = [otRound(i) for i in blueValues] otherBlues = getAttrWithFallback(info, "postscriptOtherBlues") if isinstance(otherBlues, list): otherBlues = [otRound(i) for i in otherBlues] familyBlues = getAttrWithFallback(info, "postscriptFamilyBlues") if isinstance(familyBlues, list): familyBlues = [otRound(i) for i in familyBlues] familyOtherBlues = getAttrWithFallback(info, "postscriptFamilyOtherBlues") if isinstance(familyOtherBlues, list): familyOtherBlues = [otRound(i) for i in familyOtherBlues] stemSnapH = getAttrWithFallback(info, "postscriptStemSnapH") if isinstance(stemSnapH, list): stemSnapH = [otRound(i) for i in stemSnapH] stemSnapV = getAttrWithFallback(info, "postscriptStemSnapV") if isinstance(stemSnapV, list): stemSnapV = [otRound(i) for i in stemSnapV] # only write the blues data if some blues are defined. if any((blueValues, otherBlues, familyBlues, familyOtherBlues)): private.rawDict["BlueFuzz"] = blueFuzz private.rawDict["BlueShift"] = blueShift private.rawDict["BlueScale"] = blueScale private.rawDict["ForceBold"] = forceBold if blueValues: private.rawDict["BlueValues"] = blueValues if otherBlues: private.rawDict["OtherBlues"] = otherBlues if familyBlues: private.rawDict["FamilyBlues"] = familyBlues if familyOtherBlues: private.rawDict["FamilyOtherBlues"] = familyOtherBlues # only write the stems if both are defined. if stemSnapH and stemSnapV: private.rawDict["StemSnapH"] = stemSnapH private.rawDict["StdHW"] = stemSnapH[0] private.rawDict["StemSnapV"] = stemSnapV private.rawDict["StdVW"] = stemSnapV[0] # populate glyphs cffGlyphs = self.getCompiledGlyphs() for glyphName in self.glyphOrder: charString = cffGlyphs[glyphName] charString.private = private charString.globalSubrs = globalSubrs # add to the font if glyphName in charStrings: # XXX a glyph already has this name. should we choke? glyphID = charStrings.charStrings[glyphName] charStringsIndex.items[glyphID] = charString else: charStringsIndex.append(charString) glyphID = len(topDict.charset) charStrings.charStrings[glyphName] = glyphID topDict.charset.append(glyphName) topDict.FontBBox = self.fontBoundingBox class OutlineTTFCompiler(BaseOutlineCompiler): """Compile a .ttf font with TrueType outlines.""" sfntVersion = "\000\001\000\000" tables = BaseOutlineCompiler.tables | {"loca", "gasp", "glyf"} def compileGlyphs(self): """Compile and return the TrueType glyphs for this font.""" allGlyphs = self.allGlyphs ttGlyphs = {} for name in self.glyphOrder: glyph = allGlyphs[name] pen = TTGlyphPen(allGlyphs) try: glyph.draw(pen) except NotImplementedError: logger.error("%r has invalid curve format; skipped", name) ttGlyph = Glyph() else: ttGlyph = pen.glyph() ttGlyphs[name] = ttGlyph return ttGlyphs def makeGlyphsBoundingBoxes(self): """Make bounding boxes for all the glyphs. Return a dictionary of BoundingBox(xMin, xMax, yMin, yMax) namedtuples keyed by glyph names. The bounding box of empty glyphs (without contours or components) is set to None. """ glyphBoxes = {} ttGlyphs = self.getCompiledGlyphs() for glyphName, glyph in ttGlyphs.items(): glyph.recalcBounds(ttGlyphs) bounds = BoundingBox(glyph.xMin, glyph.yMin, glyph.xMax, glyph.yMax) if bounds == EMPTY_BOUNDING_BOX: bounds = None glyphBoxes[glyphName] = bounds return glyphBoxes def setupTable_maxp(self): """Make the maxp table.""" if "maxp" not in self.tables: return self.otf["maxp"] = maxp = newTable("maxp") maxp.tableVersion = 0x00010000 maxp.numGlyphs = len(self.glyphOrder) maxp.maxZones = 1 maxp.maxTwilightPoints = 0 maxp.maxStorage = 0 maxp.maxFunctionDefs = 0 maxp.maxInstructionDefs = 0 maxp.maxStackElements = 0 maxp.maxSizeOfInstructions = 0 maxp.maxComponentElements = max( len(g.components) for g in self.allGlyphs.values() ) def setupTable_post(self): """Make a format 2 post table with the compiler's glyph order.""" super().setupTable_post() if "post" not in self.otf: return post = self.otf["post"] post.formatType = 2.0 post.extraNames = [] post.mapping = {} post.glyphOrder = self.glyphOrder def setupOtherTables(self): self.setupTable_glyf() if self.ufo.info.openTypeGaspRangeRecords: self.setupTable_gasp() def setupTable_glyf(self): """Make the glyf table.""" if not {"glyf", "loca"}.issubset(self.tables): return self.otf["loca"] = newTable("loca") self.otf["glyf"] = glyf = newTable("glyf") glyf.glyphs = {} glyf.glyphOrder = self.glyphOrder hmtx = self.otf.get("hmtx") ttGlyphs = self.getCompiledGlyphs() for name in self.glyphOrder: ttGlyph = ttGlyphs[name] if ttGlyph.isComposite() and hmtx is not None and self.autoUseMyMetrics: self.autoUseMyMetrics(ttGlyph, name, hmtx) glyf[name] = ttGlyph @staticmethod def autoUseMyMetrics(ttGlyph, glyphName, hmtx): """Set the "USE_MY_METRICS" flag on the first component having the same advance width as the composite glyph, no transform and no horizontal shift (but allow it to shift vertically). This forces the composite glyph to use the possibly hinted horizontal metrics of the sub-glyph, instead of those from the "hmtx" table. """ width = hmtx[glyphName][0] for component in ttGlyph.components: try: baseName, transform = component.getComponentInfo() except AttributeError: # component uses '{first,second}Pt' instead of 'x' and 'y' continue try: baseMetrics = hmtx[baseName] except KeyError: continue # ignore missing components else: if baseMetrics[0] == width and transform[:-1] == (1, 0, 0, 1, 0): component.flags |= USE_MY_METRICS break class StubGlyph: """ This object will be used to create missing glyphs (specifically .notdef) in the provided UFO. """ def __init__( self, name, width, unitsPerEm, ascender, descender, unicodes=None, reverseContour=False, ): self.name = name self.width = width self.unitsPerEm = unitsPerEm self.ascender = ascender self.descender = descender self.unicodes = unicodes if unicodes is not None else [] self.components = [] self.anchors = [] if self.unicodes: self.unicode = self.unicodes[0] else: self.unicode = None if name == ".notdef": self.draw = self._drawDefaultNotdef self.reverseContour = reverseContour def __len__(self): if self.name == ".notdef": return 1 return 0 @property def height(self): return self.ascender - self.descender def draw(self, pen): pass def _drawDefaultNotdef(self, pen): # Draw contour in PostScript direction (counter-clockwise) by default. Reverse # for TrueType. if self.reverseContour: pen = ReverseContourPen(pen) width = otRound(self.unitsPerEm * 0.5) stroke = otRound(self.unitsPerEm * 0.05) ascender = self.ascender descender = self.descender xMin = stroke xMax = width - stroke yMax = ascender yMin = descender pen.moveTo((xMin, yMin)) pen.lineTo((xMax, yMin)) pen.lineTo((xMax, yMax)) pen.lineTo((xMin, yMax)) pen.lineTo((xMin, yMin)) pen.closePath() xMin += stroke xMax -= stroke yMax -= stroke yMin += stroke pen.moveTo((xMin, yMin)) pen.lineTo((xMin, yMax)) pen.lineTo((xMax, yMax)) pen.lineTo((xMax, yMin)) pen.lineTo((xMin, yMin)) pen.closePath() def _get_controlPointBounds(self): pen = ControlBoundsPen(None) self.draw(pen) return pen.bounds controlPointBounds = property(_get_controlPointBounds)
mit
6,340,247,939,920,733,000
36.062207
88
0.600022
false
3.953196
false
false
false
only4hj/fast-rcnn
lib/roi_data_layer/minibatch.py
1
22641
# -------------------------------------------------------- # Fast R-CNN # Copyright (c) 2015 Microsoft # Licensed under The MIT License [see LICENSE for details] # Written by Ross Girshick # -------------------------------------------------------- """Compute minibatch blobs for training a Fast R-CNN network.""" import numpy as np import numpy.random as npr import cv2 from fast_rcnn.config import cfg from utils.blob import prep_im_for_blob, im_list_to_blob from utils.model import last_conv_size from roi_data_layer.roidb import prepare_one_roidb_rpn, prepare_one_roidb_frcnn from roidb import clear_one_roidb def get_minibatch(roidb, num_classes, bbox_means, bbox_stds, proposal_file): """Given a roidb, construct a minibatch sampled from it.""" num_images = len(roidb) # Sample random scales to use for each image in this batch random_scale_inds = npr.randint(0, high=len(cfg.TRAIN.SCALES), size=num_images) assert(cfg.TRAIN.BATCH_SIZE % num_images == 0), \ 'num_images ({}) must divide BATCH_SIZE ({})'. \ format(num_images, cfg.TRAIN.BATCH_SIZE) rois_per_image = cfg.TRAIN.BATCH_SIZE / num_images fg_rois_per_image = np.round(cfg.TRAIN.FG_FRACTION * rois_per_image) # Get the input image blob, formatted for caffe im_blob, im_scales, processed_ims = _get_image_blob(roidb, random_scale_inds) if 'model_to_use' in roidb[0] and roidb[0]['model_to_use'] == 'rpn': conv_h, scale_h = last_conv_size(im_blob.shape[2], cfg.MODEL_NAME) conv_w, scale_w = last_conv_size(im_blob.shape[3], cfg.MODEL_NAME) # Now, build the region of interest and label blobs rois_blob = np.zeros((0, 5), dtype=np.float32) labels_blob = np.zeros((0, 9, conv_h, conv_w), dtype=np.float32) bbox_targets_blob = np.zeros((0, 36, conv_h, conv_w), dtype=np.float32) bbox_loss_blob = np.zeros(bbox_targets_blob.shape, dtype=np.float32) all_overlaps = [] for im_i in xrange(num_images): if cfg.TRAIN.LAZY_PREPARING_ROIDB: prepare_one_roidb_rpn(roidb[im_i], processed_ims[im_i].shape[0], processed_ims[im_i].shape[1], im_scales[im_i]) # Normalize bbox_targets if cfg.TRAIN.NORMALIZE_BBOX: bbox_targets = roidb[im_i]['bbox_targets'] cls_inds = np.where(bbox_targets[:, 0] > 0)[0] if cls_inds.size > 0: bbox_targets[cls_inds, 1:] -= bbox_means[0, :] bbox_targets[cls_inds, 1:] /= bbox_stds[0, :] labels, overlaps, im_rois, bbox_targets, bbox_loss \ = _sample_rois_rpn(roidb[im_i], fg_rois_per_image, rois_per_image, num_classes, conv_h, conv_w) # Add to RoIs blob if im_rois != None: batch_ind = im_i * np.ones((im_rois.shape[0], 1)) rois_blob_this_image = np.hstack((batch_ind, im_rois)) rois_blob = np.vstack((rois_blob, rois_blob_this_image)) # Add to labels, bbox targets, and bbox loss blobs labels_blob = np.vstack((labels_blob, labels)) bbox_targets_blob = np.vstack((bbox_targets_blob, bbox_targets)) bbox_loss_blob = np.vstack((bbox_loss_blob, bbox_loss)) # For debug visualizations #_vis_minibatch_rpn(im_blob, conv_h, conv_w, rois_blob, labels_blob, roidb, bbox_targets_blob, bbox_loss_blob) blobs = {'data': im_blob, 'labels': labels_blob} else: # Now, build the region of interest and label blobs rois_blob = np.zeros((0, 5), dtype=np.float32) labels_blob = np.zeros((0), dtype=np.float32) bbox_targets_blob = np.zeros((0, 4 * num_classes), dtype=np.float32) bbox_loss_blob = np.zeros(bbox_targets_blob.shape, dtype=np.float32) all_overlaps = [] for im_i in xrange(num_images): if cfg.TRAIN.LAZY_PREPARING_ROIDB: prepare_one_roidb_frcnn(roidb[im_i], proposal_file, num_classes) # Normalize bbox_targets if cfg.TRAIN.NORMALIZE_BBOX: bbox_targets = roidb[im_i]['bbox_targets'] for cls in xrange(1, num_classes): cls_inds = np.where(bbox_targets[:, 0] == cls)[0] bbox_targets[cls_inds, 1:] -= bbox_means[cls, :] bbox_targets[cls_inds, 1:] /= bbox_stds[cls, :] labels, overlaps, im_rois, bbox_targets, bbox_loss \ = _sample_rois(roidb[im_i], fg_rois_per_image, rois_per_image, num_classes) # Add to RoIs blob rois = _project_im_rois(im_rois, im_scales[im_i]) batch_ind = im_i * np.ones((rois.shape[0], 1)) rois_blob_this_image = np.hstack((batch_ind, rois)) rois_blob = np.vstack((rois_blob, rois_blob_this_image)) # Add to labels, bbox targets, and bbox loss blobs labels_blob = np.hstack((labels_blob, labels)) bbox_targets_blob = np.vstack((bbox_targets_blob, bbox_targets)) bbox_loss_blob = np.vstack((bbox_loss_blob, bbox_loss)) #all_overlaps = np.hstack((all_overlaps, overlaps)) # For debug visualizations #_vis_minibatch(im_blob, rois_blob, labels_blob, all_overlaps) blobs = {'data': im_blob, 'rois': rois_blob, 'labels': labels_blob} if cfg.TRAIN.BBOX_REG: blobs['bbox_targets'] = bbox_targets_blob blobs['bbox_loss_weights'] = bbox_loss_blob return blobs def clear_minibatch(roidb): num_images = len(roidb) for im_i in xrange(num_images): clear_one_roidb(roidb[im_i]) def _sample_rois(roidb, fg_rois_per_image, rois_per_image, num_classes): """Generate a random sample of RoIs comprising foreground and background examples. """ # label = class RoI has max overlap with labels = roidb['max_classes'] overlaps = roidb['max_overlaps'] rois = roidb['boxes'] # Select foreground RoIs as those with >= FG_THRESH overlap fg_inds = np.where(overlaps >= cfg.TRAIN.FG_THRESH)[0] # Guard against the case when an image has fewer than fg_rois_per_image # foreground RoIs fg_rois_per_this_image = np.minimum(fg_rois_per_image, fg_inds.size) # Sample foreground regions without replacement if fg_inds.size > 0: fg_inds = npr.choice(fg_inds, size=fg_rois_per_this_image, replace=False) # Select background RoIs as those within [BG_THRESH_LO, BG_THRESH_HI) bg_inds = np.where((overlaps < cfg.TRAIN.BG_THRESH_HI) & (overlaps >= cfg.TRAIN.BG_THRESH_LO))[0] # Compute number of background RoIs to take from this image (guarding # against there being fewer than desired) bg_rois_per_this_image = rois_per_image - fg_rois_per_this_image bg_rois_per_this_image = np.minimum(bg_rois_per_this_image, bg_inds.size) # Sample foreground regions without replacement if bg_inds.size > 0: bg_inds = npr.choice(bg_inds, size=bg_rois_per_this_image, replace=False) # The indices that we're selecting (both fg and bg) keep_inds = np.append(fg_inds, bg_inds) # Select sampled values from various arrays: labels = labels[keep_inds] # Clamp labels for the background RoIs to 0 labels[fg_rois_per_this_image:] = 0 overlaps = overlaps[keep_inds] rois = rois[keep_inds] bbox_targets, bbox_loss_weights = \ _get_bbox_regression_labels(roidb['bbox_targets'][keep_inds, :], num_classes) return labels, overlaps, rois, bbox_targets, bbox_loss_weights def get_img_rect(img_height, img_width, conv_height, conv_width, axis1, axis2, axis3): anchors = np.array([[128*2, 128*1], [128*1, 128*1], [128*1, 128*2], [256*2, 256*1], [256*1, 256*1], [256*1, 256*2], [512*2, 512*1], [512*1, 512*1], [512*1, 512*2]]) scale_width = img_width / conv_width scale_height = img_height / conv_height img_center_x = img_width * axis3 / conv_width + scale_width / 2 img_center_y = img_height * axis2 / conv_height + scale_height / 2 anchor_size = anchors[axis1] img_x1 = img_center_x - anchor_size[0] / 2 img_x2 = img_center_x + anchor_size[0] / 2 img_y1 = img_center_y - anchor_size[1] / 2 img_y2 = img_center_y + anchor_size[1] / 2 return [img_x1, img_y1, img_x2, img_y2] def _sample_rois_rpn(roidb, fg_rois_per_image, rois_per_image, num_classes, union_conv_height, union_conv_width): """Generate a random sample of RoIs comprising foreground and background examples. """ # label = class RoI has max overlap with labels = roidb['max_classes'] new_labels = np.zeros(labels.shape, dtype=np.int16) new_labels.fill(-1) bbox_target = roidb['bbox_targets'] new_bbox_target = np.zeros(bbox_target.shape, dtype=np.float32) conv_width = roidb['conv_width'] conv_height = roidb['conv_height'] # Select foreground RoIs as those with >= FG_THRESH overlap fg_inds = np.where(labels > 0)[0] # Guard against the case when an image has fewer than fg_rois_per_image # foreground RoIs fg_rois_per_this_image = np.minimum(fg_rois_per_image, fg_inds.size) # Sample foreground regions without replacement if fg_inds.size > 0: fg_inds = npr.choice(fg_inds, size=fg_rois_per_this_image, replace=False) # Select background RoIs as those within [BG_THRESH_LO, BG_THRESH_HI) bg_inds = np.where(labels == 0)[0] # Compute number of background RoIs to take from this image (guarding # against there being fewer than desired) bg_rois_per_this_image = rois_per_image - fg_rois_per_this_image bg_rois_per_this_image = np.minimum(bg_rois_per_this_image, bg_inds.size) # Sample foreground regions without replacement if bg_inds.size > 0: bg_inds = npr.choice(bg_inds, size=bg_rois_per_this_image, replace=False) new_labels[fg_inds] = 1 new_labels[bg_inds] = 0 if 'rois' in roidb: rois = roidb['rois'][fg_inds] else: rois = None """ print 'labels.shape %s' % labels.shape print 'bbox_target.shape %s' % (bbox_target.shape, ) for fg_ind in fg_inds: print 'label : %s ' % labels[fg_ind] print 'bbox_target : %s ' % bbox_target[fg_ind] axis1 = fg_ind / conv_height / conv_width axis2 = fg_ind / conv_width % conv_height axis3 = fg_ind % conv_width im = cv2.imread(roidb['image']) target_size = cfg.TRAIN.SCALES[0] im, im_scale = prep_im_for_blob(im, 0, target_size, cfg.TRAIN.MAX_SIZE, cfg.TRAIN.MIN_SIZE) img_height = im.shape[2] img_width = im.shape[3] proposal_rects = get_img_rect(img_height, img_width, conv_height, conv_width, axis1, axis2, axis3) for proposal_rect in proposal_rects: plt.imshow(im) for ground_rect in ground_rects: plt.gca().add_patch( plt.Rectangle((ground_rect[0], ground_rect[1]), ground_rect[2] - ground_rect[0], ground_rect[3] - ground_rect[1], fill=False, edgecolor='b', linewidth=3) ) plt.gca().add_patch( plt.Rectangle((proposal_rect[0], proposal_rect[1]), proposal_rect[2] - proposal_rect[0], proposal_rect[3] - proposal_rect[1], fill=False, edgecolor='g', linewidth=3) ) plt.gca().add_patch( plt.Rectangle((pred_rect[0], pred_rect[1]), pred_rect[2] - pred_rect[0], pred_rect[3] - pred_rect[1], fill=False, edgecolor='r', linewidth=3) ) plt.show(block=False) raw_input("") plt.close() """ new_bbox_target[fg_inds] = bbox_target[fg_inds] new_bbox_target, bbox_loss_weights = \ _get_bbox_regression_labels_rpn(new_bbox_target, num_classes, labels) """ print 'label no 1 : %s' % len(np.where(new_labels == 1)[0]) print 'new_bbox_target no 1 : %s' % len(np.where(new_bbox_target != 0)[0]) print 'bbox_loss_weights no 1 : %s' % len(np.where(bbox_loss_weights > 0)[0]) """ new_labels = new_labels.reshape((1, 9, conv_height, conv_width)) new_bbox_target = new_bbox_target.reshape((1, 9, conv_height, conv_width, 4)) new_bbox_target = new_bbox_target.transpose(0, 1, 4, 2, 3) new_bbox_target = new_bbox_target.reshape((1, 36, conv_height, conv_width)) bbox_loss_weights = bbox_loss_weights.reshape((1, 9, conv_height, conv_width, 4)) bbox_loss_weights = bbox_loss_weights.transpose(0, 1, 4, 2, 3) bbox_loss_weights = bbox_loss_weights.reshape((1, 36, conv_height, conv_width)) output_labels = np.zeros((1, 9, union_conv_height, union_conv_width)) output_bbox_targets = np.zeros((1, 36, union_conv_height, union_conv_width)) output_bbox_loss_weights = np.zeros((1, 36, union_conv_height, union_conv_width)) output_labels.fill(-1) output_labels[:, :, 0:conv_height, 0:conv_width] = new_labels output_bbox_targets[:, :, 0:conv_height, 0:conv_width] = new_bbox_target output_bbox_loss_weights[:, :, 0:conv_height, 0:conv_width] = bbox_loss_weights """ for fg_ind in fg_inds: if fg_ind == 6510: axis1 = fg_ind / conv_height / conv_width axis2 = fg_ind / conv_width % conv_height axis3 = fg_ind % conv_width print '' print 'conv_size : %s, %s' % (conv_height, conv_width) print 'axis : %s, %s, %s' % (axis1, axis2, axis3) print 'output_labels[%s] : %s' % (fg_ind, output_labels[0, axis1, axis2, axis3]) print 'output_bbox_targets[%s] : %s' % (fg_ind, output_bbox_targets[0, axis1*4:axis1*4+4, axis2, axis3]) print 'output_bbox_loss_weights[%s] : %s' % (fg_ind, output_bbox_loss_weights[0, axis1*4:axis1*4+4, axis2, axis3]) """ """ # Generate positive rois based on index for debugging anchors = [[128*2, 128*1], [128*1, 128*1], [128*1, 128*2], [256*2, 256*1], [256*1, 256*1], [256*1, 256*2], [512*2, 512*1], [512*1, 512*1], [512*1, 512*2]] conv_scale_width = roidb['conv_scale_width'] conv_scale_height = roidb['conv_scale_height'] rois = np.zeros((len(fg_inds), 4), dtype=np.int16) for i, fg_ind in enumerate(fg_inds): center_x = fg_ind % conv_width center_y = (fg_ind - center_x) / conv_width % conv_height anchor = fg_ind / conv_height / conv_width anchor_w = anchors[anchor][0] anchor_h = anchors[anchor][1] x1 = center_x * conv_scale_width - anchor_w / 2 y1 = center_y * conv_scale_height - anchor_h / 2 x2 = x1 + anchor_w y2 = y1 + anchor_h rois[i, :] = x1, y1, x2, y2 """ """ pos_labels = np.where(new_labels == 1) i = 0 for d0, d1, d2, d3 in zip(pos_labels[0], pos_labels[1], pos_labels[2], pos_labels[3]): print '[%s] label : %s, bbox_target : %s, bbox_loss_weights : %s' % (i, new_labels[d0, d1, d2, d3], new_bbox_target[d0, d1*4 : d1*4+4, d2, d3], bbox_loss_weights[d0, d1*4 : d1*4+4, d2, d3]) i += 1 """ """ print 'label no 2 : %s' % len(np.where(output_labels == 1)[0]) print 'new_bbox_target no 2 : %s' % len(np.where(output_bbox_targets != 0)[0]) print 'bbox_loss_weights no 2 : %s' % len(np.where(output_bbox_loss_weights > 0)[0]) """ return output_labels, None, rois, output_bbox_targets, output_bbox_loss_weights def _get_image_blob(roidb, scale_inds): """Builds an input blob from the images in the roidb at the specified scales. """ num_images = len(roidb) processed_ims = [] im_scales = [] for i in xrange(num_images): im = cv2.imread(roidb[i]['image']) if roidb[i]['flipped']: im = im[:, ::-1, :] target_size = cfg.TRAIN.SCALES[scale_inds[i]] im, im_scale = prep_im_for_blob(im, cfg.PIXEL_MEANS, target_size, cfg.TRAIN.MAX_SIZE, cfg.TRAIN.MIN_SIZE) im_scales.append(im_scale) processed_ims.append(im) # Create a blob to hold the input images blob = im_list_to_blob(processed_ims) return blob, im_scales, processed_ims def _project_im_rois(im_rois, im_scale_factor): """Project image RoIs into the rescaled training image.""" rois = im_rois * im_scale_factor return rois def _get_bbox_regression_labels(bbox_target_data, num_classes): """Bounding-box regression targets are stored in a compact form in the roidb. This function expands those targets into the 4-of-4*K representation used by the network (i.e. only one class has non-zero targets). The loss weights are similarly expanded. Returns: bbox_target_data (ndarray): N x 4K blob of regression targets bbox_loss_weights (ndarray): N x 4K blob of loss weights """ clss = bbox_target_data[:, 0] bbox_targets = np.zeros((clss.size, 4 * num_classes), dtype=np.float32) bbox_loss_weights = np.zeros(bbox_targets.shape, dtype=np.float32) inds = np.where(clss > 0)[0] for ind in inds: cls = clss[ind] start = 4 * cls end = start + 4 bbox_targets[ind, start:end] = bbox_target_data[ind, 1:] bbox_loss_weights[ind, start:end] = [1., 1., 1., 1.] return bbox_targets, bbox_loss_weights def _get_bbox_regression_labels_rpn(bbox_target_data, num_classes, labels): """Bounding-box regression targets are stored in a compact form in the roidb. This function expands those targets into the 4-of-4*K representation used by the network (i.e. only one class has non-zero targets). The loss weights are similarly expanded. Returns: bbox_target_data (ndarray): N x 4K blob of regression targets bbox_loss_weights (ndarray): N x 4K blob of loss weights """ clss = bbox_target_data[:, 0] bbox_targets = np.zeros((clss.size, 4), dtype=np.float32) bbox_loss_weights = np.zeros(bbox_targets.shape, dtype=np.float32) inds = np.where(clss > 0)[0] #print '' #print 'len(inds) : %s' % len(inds) for ind in inds: bbox_targets[ind, :] = bbox_target_data[ind, 1:] bbox_loss_weights[ind, :] = [1., 1., 1., 1.] #print 'bbox_targets[ind, :] : %s - %s ' % (bbox_target_data[ind, 0], bbox_targets[ind, :]) return bbox_targets, bbox_loss_weights def _vis_minibatch(im_blob, rois_blob, labels_blob, overlaps): """Visualize a mini-batch for debugging.""" import matplotlib.pyplot as plt for i in xrange(rois_blob.shape[0]): rois = rois_blob[i, :] im_ind = rois[0] roi = rois[1:] im = im_blob[im_ind, :, :, :].transpose((1, 2, 0)).copy() im += cfg.PIXEL_MEANS im = im[:, :, (2, 1, 0)] im = im.astype(np.uint8) cls = labels_blob[i] plt.imshow(im) print 'class: ', cls, ' overlap: ', overlaps[i] plt.gca().add_patch( plt.Rectangle((roi[0], roi[1]), roi[2] - roi[0], roi[3] - roi[1], fill=False, edgecolor='r', linewidth=3) ) plt.show() def _vis_minibatch_rpn(im_blob, conv_h, conv_w, rois_blob, labels_blob, roidb, bbox_targets_blob, bbox_loss_blob): """Visualize a mini-batch for debugging.""" import matplotlib.pyplot as plt for i in xrange(len(roidb)): # DJDJ #if roidb[i]['image'].endswith('000009.jpg') == False: # continue print 'image : %s' % roidb[i]['image'] resized_gt_boxes = roidb[int(i)]['resized_gt_boxes'] im = im_blob[i, :, :, :].transpose((1, 2, 0)).copy() im += cfg.PIXEL_MEANS im = im[:, :, (2, 1, 0)] im = im.astype(np.uint8) for j in range(9): for k in range(labels_blob.shape[2]): for l in range(labels_blob.shape[3]): label = labels_blob[i][j][k][l] if label == -1: continue elif label == 1: color = 'g' elif label == 0: #color = 'y' continue plt.imshow(im) for resized_gt_box in resized_gt_boxes: resized_gt_box = resized_gt_box.astype(np.int) plt.gca().add_patch( plt.Rectangle((resized_gt_box[0], resized_gt_box[1]), resized_gt_box[2] - resized_gt_box[0], resized_gt_box[3] - resized_gt_box[1], fill=False, edgecolor='b', linewidth=3) ) proposal_rects = get_img_rect(im.shape[0], im.shape[1], conv_h, conv_w, j, k, l) plt.gca().add_patch( plt.Rectangle((proposal_rects[0], proposal_rects[1]), proposal_rects[2] - proposal_rects[0], proposal_rects[3] - proposal_rects[1], fill=False, edgecolor=color, linewidth=3) ) plt.show(block=False) raw_input("") plt.close()
mit
2,063,657,557,521,492,200
40.619485
126
0.548209
false
3.342338
false
false
false
Princeton-CDH/derrida-django
derrida/outwork/migrations/0001_initial.py
1
1186
# -*- coding: utf-8 -*- # Generated by Django 1.11.5 on 2017-10-17 18:44 from __future__ import unicode_literals from django.db import migrations, models import django.db.models.deletion import mezzanine.core.fields class Migration(migrations.Migration): initial = True dependencies = [ ('people', '0002_allow_neg_years_bc'), ('pages', '0004_auto_20170411_0504'), ] operations = [ migrations.CreateModel( name='Outwork', fields=[ ('page_ptr', models.OneToOneField(auto_created=True, on_delete=django.db.models.deletion.CASCADE, parent_link=True, primary_key=True, serialize=False, to='pages.Page')), ('content', mezzanine.core.fields.RichTextField(verbose_name='Content')), ('orig_pubdate', models.DateField(blank=True, null=True, verbose_name='Original Publication Date')), ('author', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, to='people.Person')), ], options={ 'ordering': ('_order',), }, bases=('pages.page', models.Model), ), ]
apache-2.0
759,727,622,976,371,800
34.939394
185
0.604553
false
3.953333
false
false
false
phalcon/readthedocs.org
readthedocs/vcs_support/backends/hg.py
1
3235
import csv from StringIO import StringIO from projects.exceptions import ProjectImportError from vcs_support.base import BaseVCS, VCSVersion class Backend(BaseVCS): supports_tags = True supports_branches = True fallback_branch = 'default' def update(self): super(Backend, self).update() retcode = self.run('hg', 'status')[0] if retcode == 0: return self.pull() else: return self.clone() def pull(self): pull_output = self.run('hg', 'pull') if pull_output[0] != 0: raise ProjectImportError( ("Failed to get code from '%s' (hg pull): %s" % (self.repo_url, pull_output[0])) ) update_output = self.run('hg', 'update', '-C')[0] if update_output[0] != 0: raise ProjectImportError( ("Failed to get code from '%s' (hg update): %s" % (self.repo_url, pull_output[0])) ) return update_output def clone(self): output = self.run('hg', 'clone', self.repo_url, '.') if output[0] != 0: raise ProjectImportError( ("Failed to get code from '%s' (hg clone): %s" % (self.repo_url, output[0])) ) return output @property def branches(self): retcode, stdout = self.run('hg', 'branches', '-q')[:2] # error (or no tags found) if retcode != 0: return [] return self.parse_branches(stdout) def parse_branches(self, data): """ stable default """ names = [name.lstrip() for name in data.splitlines()] return [VCSVersion(self, name, name) for name in names if name] @property def tags(self): retcode, stdout = self.run('hg', 'tags')[:2] # error (or no tags found) if retcode != 0: return [] return self.parse_tags(stdout) def parse_tags(self, data): """ Parses output of show-ref --tags, eg: tip 278:c4b2d21db51a 0.2.2 152:6b0364d98837 0.2.1 117:a14b7b6ffa03 0.1 50:30c2c6b3a055 """ # parse the lines into a list of tuples (commit-hash, tag ref name) raw_tags = csv.reader(StringIO(data), delimiter=' ') vcs_tags = [] for row in raw_tags: row = filter(lambda f: f != '', row) if row == []: continue name, commit = row if name == 'tip': continue revision, commit_hash = commit.split(':') vcs_tags.append(VCSVersion(self, commit_hash, name)) return vcs_tags def checkout(self, identifier=None): super(Backend, self).checkout() if not identifier: identifier = 'tip' retcode = self.run('hg', 'status')[0] if retcode == 0: self.run('hg', 'pull') return self.run('hg', 'update', '-C', identifier) else: self.clone() return self.run('hg', 'update', '-C', identifier)
mit
-1,967,239,795,073,363,200
30.407767
75
0.4983
false
4.048811
false
false
false
Crystalnix/house-of-life-chromium
chrome/test/functional/chromeos_security.py
1
1213
#!/usr/bin/python # Copyright (c) 2011 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. import os import pyauto_functional import pyauto class ChromeosSecurity(pyauto.PyUITest): """Security tests for chrome on ChromeOS. Requires ChromeOS to be logged in. """ def ExtraChromeFlagsOnChromeOS(self): """Override default list of extra flags typicall used with automation. See the default flags used with automation in pyauto.py. Chrome flags for this test should be as close to reality as possible. """ return [ '--homepage=about:blank', ] def testCannotViewLocalFiles(self): """Verify that local files cannot be accessed from the browser.""" urls_and_titles = { 'file:///': 'Index of /', 'file:///etc/': 'Index of /etc/', self.GetFileURLForDataPath('title2.html'): 'Title Of Awesomeness', } for url, title in urls_and_titles.iteritems(): self.NavigateToURL(url) self.assertNotEqual(title, self.GetActiveTabTitle(), msg='Could access local file %s.' % url) if __name__ == '__main__': pyauto_functional.Main()
bsd-3-clause
-6,535,854,804,755,249,000
27.880952
74
0.677659
false
3.863057
false
false
false
sotlampr/personal-site
app/blog/views.py
1
3882
from datetime import datetime from flask import abort, flash, request, render_template, redirect, url_for from flask.ext.login import login_required, current_user from sqlalchemy import desc from . import blog from .forms import PostForm, DeleteForm from ..models import db, Post @blog.route('/') @blog.route('/index') @blog.route('/page/<int:page>') def index(page=1): posts = (Post.query .filter_by(is_published=True) .order_by(desc(Post.timestamp)) .paginate(page, 3)) return render_template('blog/index.html', posts=posts) @blog.route('/new', methods=['GET', 'POST']) @login_required def new(): form = PostForm(request.form) if form.validate_on_submit(): post = Post(title=form.title.data, body=form.body.data, timestamp=datetime.utcnow(), user_id=int(current_user.get_id()), is_published=form.is_published.data) db.session.add(post) db.session.commit() if form.is_published.data: flash("Post is now published.") else: flash("Post updated") return redirect('blog/'+post.slug) return render_template('blog/edit.html', form=form) @blog.route('/<slug>/') def show_post(slug): post = Post.query.filter_by(slug=slug).first() if post is not None: if post.is_published: return render_template('blog/post.html', post=post) else: if current_user.is_authenticated: flash("This post is unpublished.") return render_template('blog/post.html', post=post) else: abort(401) else: abort(404) @blog.route('/<slug>/edit', methods=['GET', 'POST']) @login_required def edit_post(slug): post = Post.query.filter_by(slug=slug).first() if post is not None: if request.method == 'GET': form = PostForm(obj=post) return render_template('blog/edit.html', form=form) else: form = PostForm(request.form) post.title = form.title.data post.body = form.body.data post.is_published = form.is_published.data post.user_id = current_user.get_id() db.session.commit() flash("Post updated.") return redirect(url_for('blog.show_post', slug=post.slug)) else: abort(404) @blog.route('/<slug>/delete', methods=['GET', 'POST']) @login_required def delete_post(slug): form = DeleteForm(request.form) post = Post.query.filter_by(slug=slug).first() if post is not None: if form.validate_on_submit(): db.session.delete(post) db.session.commit() return redirect(url_for('blog.index')) else: return render_template("blog/delete.html", form=form) else: abort(404) """ @blog.route('/search/<search_terms>/') def search(): return render_template('blog/search.html') """ @blog.route('/archive') @blog.route('/archive/page/<int:page>') def archive(page=1): posts = (Post.query .filter_by(is_published=True) .order_by(desc(Post.timestamp)) .paginate(page, 10)) return render_template('blog/archive.html', head_title="Blog Archive", header_title="Archives", posts=posts) @blog.route('/unpublished') @login_required def show_unpublished(): posts = (Post.query .filter_by(is_published=False) .order_by(desc(Post.timestamp)) .paginate(1, 10)) return render_template('blog/archive.html', head_title="Administration", header_title="Unpublished posts", posts=posts)
mit
6,123,719,996,085,297,000
29.328125
75
0.569809
false
3.843564
false
false
false
b-jazz/stravamous
src/converter.py
1
1697
import logging import os import subprocess def out_for_in(in_path): return '{0}.gpx'.format(os.path.splitext(os.path.basename(in_path))[0]) class Converter(object): def __init__(self, config, input_path): self.config = config self.logger = logging.getLogger() self.input_file = input_path self.output_file = os.path.expanduser(os.path.join(self.config.storage_root, 'converted_files', out_for_in(self.input_file))) self.logger.debug('Created converter object with input_file of {0} and output_file of {1}'.format(self.input_file, self.output_file)) self.gpx_text = None def convert(self): command = [self.config.gpsbabel_cmd, '-i', 'garmin_fit', '-f', self.input_file, '-o', 'gpx,garminextensions', '-F', self.output_file] self.logger.debug('starting subprocess with command: {0}'.format(command)) try: subprocess.call(command) self.logger.debug('Happily done with the conversion. No exceptions.') except Exception as exception: self.logger.error('CONVERTER EXCEPTION: {0}'.format(exception)) # raise else: self.logger.debug('Opening {0} for read'.format(self.output_file)) try: self.gpx_text = open(self.output_file, 'r').read() except Exception as exception: self.logger.error('open().read() exception: {0}, of type: {1}'.format(exception, exception.args)) raise
lgpl-3.0
-3,339,667,609,686,575,000
40.390244
141
0.551562
false
4.059809
false
false
false
jesonyang001/qarepo
askbot/__init__.py
1
3117
""" :synopsis: the Django Q&A forum application Functions in the askbot module perform various basic actions on behalf of the forum application """ import os import platform VERSION = (0, 7, 51) #keys are module names used by python imports, #values - the package qualifier to use for pip REQUIREMENTS = { 'akismet': 'akismet', 'avatar': 'django-avatar>=2.0', 'bs4': 'beautifulsoup4', 'coffin': 'Coffin>=0.3,<=0.3.8', 'compressor': 'django-compressor==1.2', 'django': 'django>=1.3.1,<1.6', 'django_countries': 'django-countries==1.0.5', 'djcelery': 'django-celery>=3.0.11', 'djkombu': 'django-kombu==0.9.4', 'followit': 'django-followit==0.0.7', 'html5lib': 'html5lib==0.90', 'jinja2': 'Jinja2', 'keyedcache': 'django-keyedcache', 'longerusername': 'longerusername', 'markdown2': 'markdown2', 'oauth2': 'oauth2', 'openid': 'python-openid', 'picklefield': 'django-picklefield==0.3.0', 'jwt': 'pyjwt', 'pystache': 'pystache==0.3.1', 'pytz': 'pytz==2013b', 'recaptcha_works': 'django-recaptcha-works', 'robots': 'django-robots', 'sanction': 'sanction==0.3.1', 'south': 'South>=0.7.1', 'threaded_multihost': 'django-threaded-multihost', 'tinymce': 'django-tinymce==1.5.1b2', 'unidecode': 'unidecode', #'stopforumspam': 'stopforumspam' } if platform.system() != 'Windows': REQUIREMENTS['lamson'] = 'Lamson' #necessary for interoperability of django and coffin try: from askbot import patches from askbot.deployment.assertions import assert_package_compatibility assert_package_compatibility() patches.patch_django() patches.patch_coffin() # must go after django except ImportError: pass def get_install_directory(): """returns path to directory where code of the askbot django application is installed """ return os.path.dirname(__file__) def get_path_to(relative_path): """returns absolute path to a file relative to ``askbot`` directory ``relative_path`` must use only forward slashes and must not start with a slash """ root_dir = get_install_directory() assert(relative_path[0] != 0) path_bits = relative_path.split('/') return os.path.join(root_dir, *path_bits) def get_version(): """returns version of the askbot app this version is meaningful for pypi only """ return '.'.join([str(subversion) for subversion in VERSION]) def get_database_engine_name(): """returns name of the database engine, independently of the version of django - for django >=1.2 looks into ``settings.DATABASES['default']``, (i.e. assumes that askbot uses database named 'default') , and for django 1.1 and below returns settings.DATABASE_ENGINE """ import django from django.conf import settings as django_settings major_version = django.VERSION[0] minor_version = django.VERSION[1] if major_version == 1: if minor_version > 1: return django_settings.DATABASES['default']['ENGINE'] else: return django_settings.DATABASE_ENGINE
gpl-3.0
-2,211,768,841,389,933,000
29.558824
73
0.655759
false
3.399128
false
false
false
OmeGak/indico-plugins
vc_vidyo/indico_vc_vidyo/api/cache.py
1
1207
# This file is part of Indico. # Copyright (C) 2002 - 2016 European Organization for Nuclear Research (CERN). # # Indico is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License as # published by the Free Software Foundation; either version 3 of the # License, or (at your option) any later version. # # Indico is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Indico; if not, see <http://www.gnu.org/licenses/>. from suds.cache import Cache from MaKaC.common.cache import GenericCache DEFAULT_CACHE_TTL = 24 * 3600 class SudsCache(Cache): _instance = None def __init__(self, duration=DEFAULT_CACHE_TTL): self._cache = GenericCache("SudsCache") self._duration = duration def get(self, key): self._cache.get(key) def put(self, key, val): self._cache.set(key, val, self._duration) def purge(self, key): self._cache.delete(key)
gpl-3.0
5,846,497,963,158,314,000
31.621622
78
0.710853
false
3.795597
false
false
false
AndrewGoldstein/grasshopper
tests/test_models.py
1
1954
# -*- coding: utf-8 -*- """Model unit tests.""" import datetime as dt import pytest from grasshopper.user.models import Role, User from .factories import UserFactory @pytest.mark.usefixtures('db') class TestUser: """User tests.""" def test_get_by_id(self): """Get user by ID.""" user = User('foo', '[email protected]') user.save() retrieved = User.get_by_id(user.id) assert retrieved == user def test_created_at_defaults_to_datetime(self): """Test creation date.""" user = User(username='foo', email='[email protected]') user.save() assert bool(user.created_at) assert isinstance(user.created_at, dt.datetime) def test_password_is_nullable(self): """Test null password.""" user = User(username='foo', email='[email protected]') user.save() assert user.password is None def test_factory(self, db): """Test user factory.""" user = UserFactory(password='myprecious') db.session.commit() assert bool(user.username) assert bool(user.email) assert bool(user.created_at) assert user.is_admin is False assert user.active is True assert user.check_password('myprecious') def test_check_password(self): """Check password.""" user = User.create(username='foo', email='[email protected]', password='foobarbaz123') assert user.check_password('foobarbaz123') is True assert user.check_password('barfoobaz') is False def test_full_name(self): """User full name.""" user = UserFactory(first_name='Foo', last_name='Bar') assert user.full_name == 'Foo Bar' def test_roles(self): """Add a role to a user.""" role = Role(name='admin') role.save() user = UserFactory() user.roles.append(role) user.save() assert role in user.roles
bsd-3-clause
1,862,980,038,182,105,900
28.164179
63
0.589048
false
3.908
true
false
false
rodluger/everest
docs/mcmc.py
1
2721
"""MCMC example for transit fitting.""" import matplotlib.pyplot as pl from everest import Everest, TransitModel import numpy as np import emcee from tqdm import tqdm from corner import corner def lnprior(x): """Return the log prior given parameter vector `x`.""" per, t0, b = x if b < -1 or b > 1: return -np.inf elif per < 7 or per > 10: return -np.inf elif t0 < 1978 or t0 > 1979: return -np.inf else: return 0. def lnlike(x, star): """Return the log likelihood given parameter vector `x`.""" ll = lnprior(x) if np.isinf(ll): return ll, (np.nan, np.nan) per, t0, b = x model = TransitModel('b', per=per, t0=t0, b=b, rhos=10.)(star.time) like, d, vard = star.lnlike(model, full_output=True) ll += like return ll, (d,) # Initialize the everest model star = Everest(201635569) # Set up the MCMC sampler params = ['Period (days)', r't$_0$ (BJD - 2456811)', 'Impact parameter'] blobs = ['Depth (%)'] nsteps = 1000 nburn = 300 nwalk = 10 ndim = len(params) nblobs = len(blobs) sampler = emcee.EnsembleSampler(nwalk, ndim, lnlike, args=[star]) x0 = [[8.368 + 0.01 * np.random.randn(), 1978.4513 + 0.01 * np.random.randn(), 0. + 0.1 * np.random.randn()] for k in range(nwalk)] blobs0 = [[0.] for k in range(nwalk)] # Run! for i in tqdm(sampler.sample(x0, iterations=nsteps, blobs0=blobs0), total=nsteps): pass # Add the blobs to the chain for plotting chain = np.concatenate((sampler.chain, np.array(sampler.blobs).swapaxes(0, 1)), axis=2) # Re-scale the transit time for prettier axes labels chain[:, :, 1] -= 1978. # Take the absolute value of the impact parameter for plotting chain[:, :, 2] = np.abs(chain[:, :, 2]) # Re-scale the transit depth as a percentage chain[:, :, 3] *= 100. # Plot the chains fig1, ax = pl.subplots(ndim + nblobs, figsize=(6, 7)) fig1.suptitle("K2-14b", fontsize=16, fontweight='bold') ax[-1].set_xlabel("Iteration", fontsize=14) for n in range(ndim + nblobs): for k in range(nwalk): ax[n].plot(chain[k, :, n], alpha=0.3, lw=1) ax[n].set_ylabel((params + blobs)[n], fontsize=9) ax[n].margins(0, None) ax[n].axvline(nburn, color='b', alpha=0.5, lw=1, ls='--') fig1.savefig("k2-14b_chains.png", bbox_inches='tight') # Plot the posterior distributions samples = chain[:, nburn:, :].reshape(-1, ndim + nblobs) fig2 = corner(samples, labels=params + blobs) fig2.suptitle("K2-14b", fontsize=16, fontweight='bold') fig2.set_size_inches(6, 6) for ax in fig2.axes: for tick in ax.get_xticklabels() + ax.get_yticklabels(): tick.set_fontsize(7) fig2.savefig("k2-14b_corner.png", bbox_inches='tight')
mit
202,969,213,362,555,870
28.901099
72
0.632488
false
2.858193
false
false
false
cxcsds/ciao-contrib
crates_contrib/images.py
1
4630
# # Copyright (C) 2012, 2015, 2016, 2019 # Smithsonian Astrophysical Observatory # # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License along # with this program; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # """ Image-specific Crates routines. At present there is only one routine - imextent. """ from pytransform import LINEAR2DTransform __all__ = ('imextent', ) def imextent(img, xmin, xmax, ymin, ymax, limits='center'): """Create a linear transform for the image axes. Returns a 2D linear transform object that represents the mapping from "pixel" units (e.g. logical values) to a linearly scaled system (offset and scale change, no rotation). One use of this is to mimic the extent argument from matplotlib's imshow command, as discussed in the examples below. Parameters ---------- img : 2D NumPy array xmin, xmax, ymin, ymax : float The coordinates of the lower-left and upper-right corners of the image in the transformed (non-logical) system. limits : {'center', 'edge'} Do the coordinates (xmin, ..., ymax) refer to the center of the pixels, or their edges. In FITS convention, the bottom-left pixel is centered on 1,1 and the top-right pixel is nx,ny (for a nx by ny grid). With limits='center' xmin,xmax refers to the center of the lower-left pixel (i.e. 1,1 in FITS terminology) whereas with limits='edge' it refers to the bottom-left corner (0.5,0.5 in FITS). Returns ------- tr : pytransform.LINEAR2DTransform The transform object containing the coordinate mapping. Notes ----- The logical coordinate system follows the FITS standard, so the first pixel is (1,1) and not (0,0), and the X axis values are given first. Examples -------- The following example creates a 40 pixel wide by 20 pixel high image, zi, where the X axis goes from 40 to 60 and the Y axis 10 to 20. The imextent call creates a transform object. >>> yi, xi = np.mgrid[10:20:20j, 40:60:40j] >>> zi = 100.0 / np.sqrt((xi - 45.62) ** 2 + (yi - 14.7) ** 2) >>> tr = imextent(zi, 40, 60, 10, 20) The transform object can be used to convert between logical coordinates (where 1,1 refers to the center of the lower-left pixel) and the data coordinates: >>> print(tr.apply([[1,1], [40,20]])) [[40 10] [60 20]] and the invert method goes from data to logical coordinates: >>> print(tr.invert([[45.0, 15.0]])) [[ 10.75 10.5 ]] The following examples use a 4 pixel by 3 pixel image: >>> img = np.arange(0, 12).reshape(3, 4) The default value for the limits argument is 'center', which means that the given coordinates - in this case 10,-10 and 13,-6 - refer to the center of the bottom-left and top-right pixels: >>> tr_cen = imextent(img, 10, 13, -10, -6, limits='center') The alternative is limits='edge', where 10,-10 refers to the bottom-left corner of the image and 13,-6 refers to the top-right corner: >>> tr_edge = imextent(img, 10, 13, -10, -6, limits='edge') >>> print(tr_cen.apply([[1.0, 1.0]])) [[ 10. -10.]] >>> print(tr_edge.apply([[1.0, 1.0]])) [[ 10.375 -9.33333333]] """ try: (ny, nx) = img.shape except AttributeError: raise ValueError("First argument has no shape attribute.") dx = (xmax - xmin) * 1.0 dy = (ymax - ymin) * 1.0 if limits == 'center': dx /= (nx - 1.0) dy /= (ny - 1.0) x0 = xmin - dx y0 = ymin - dy elif limits == 'edge': dx /= nx dy /= ny x0 = xmin - dx / 2.0 y0 = ymin - dy / 2.0 else: raise ValueError("limits must be 'center' or 'edge', not '{}'".format(limits)) tr = LINEAR2DTransform() tr.get_parameter('ROTATION').set_value(0.0) tr.get_parameter('SCALE').set_value([dx, dy]) tr.get_parameter('OFFSET').set_value([x0, y0]) return tr
gpl-3.0
6,630,351,362,508,218,000
30.496599
86
0.630886
false
3.605919
false
false
false
lintrace/GravityFalls3
gravity_falls.py
1
1529
#!/usr/bin/python3 """ Главный файл для запуска Решение шифрограмм из книги "Дневник Гравити Фоллз 3" """ import atbash_chiper, caesar_cipher, vigenere_cipher print('='*80) print('Зашифровано шифром Цезаря, см. коментарии к строкам выше (место в книге)') print('='*80) for line in open('caesar.txt'): if line[0] == '#': print('-' * 80,'\n',line) continue if line[-1]=='\n': line = line[:-1] print('Из дневника:\t{0}\nРасшифровано:\t{1}\n'.format(line, caesar_cipher.caesar_dec(line, 23)), end ='') print('='*80) print('Текст из Дневника 3 Гравити Фоллз (самый длинный),\nхранился в шкатулке с нацарапанным на крышке словом "ПАЙНС"') print('Текст зашифрован шифром Виженера, а слово "ПАЙНС" является паролем') print('='*80) print(vigenere_cipher.vigenere_file_dec('ПАЙНС.txt','ПАЙНС')) print('='*80,'\n\n\n') print('='*80) print('### В книге встречается подсказка к расшифровке инопланетного шифра - закорючек\nСудя по всему, каждой закорючке соответствует своя цифра,\nкоторая соответствует номеру буквы в алфавите (шифр А1Я33)')
gpl-3.0
8,400,138,516,059,571,000
34.766667
207
0.689655
false
1.53505
false
false
false
ucb-sejits/ctree
ctree/c/codegen.py
1
6213
""" Code generator for C constructs. """ from ctree.codegen import CodeGenVisitor from ctree.c.nodes import Op from ctree.types import codegen_type, get_suffix from ctree.precedence import UnaryOp, BinaryOp, TernaryOp, Cast from ctree.precedence import get_precedence, is_left_associative from numbers import Number from ctree.nodes import CommonCodeGen class CCodeGen(CommonCodeGen): """ Manages generation of C code. """ def _requires_parentheses(self, parent, node): """ Returns node as a string, optionally with parentheses around it if needed to enforce precendence rules. """ if isinstance(node, (UnaryOp, BinaryOp, TernaryOp)) and\ isinstance(parent, (UnaryOp, BinaryOp, TernaryOp, Cast)): prec = get_precedence(node) parent_prec = get_precedence(parent) is_not_last_child = isinstance(parent, UnaryOp) or\ isinstance(parent, Cast) or\ (isinstance(parent, BinaryOp) and node is parent.left) or\ (isinstance(parent, TernaryOp) and node is not parent.elze) assoc_left = is_left_associative(parent) if (prec < parent_prec) or \ (prec == parent_prec and (assoc_left is not is_not_last_child)): return True return False # ------------------------------------------------------------------------- # visitor methods def visit_MultiNode(self, node): return self._genblock(node.body, insert_curly_brackets=False, increase_indent=False) def visit_FunctionDecl(self, node): params = ", ".join(map(str, node.params)) s = [] for attrib in node.attributes: s.append("__attribute__ (({}))".format(attrib)) if node.kernel: s.append("__kernel") if node.static: s.append("static") if node.inline: s.append("inline") s.append("%s %s(%s)" % (codegen_type(node.return_type), node.name, params)) if node.defn: s.append("%s" % self._genblock(node.defn)) return " ".join(s) def visit_UnaryOp(self, node): op = self._parenthesize(node, node.op) arg = self._parenthesize(node, node.arg) if isinstance(node.op, (Op.PostInc, Op.PostDec)): return "%s %s" % (arg, op) else: return "%s %s" % (op, arg) def visit_BinaryOp(self, node): left = self._parenthesize(node, node.left) right = self._parenthesize(node, node.right) if isinstance(node.op, Op.ArrayRef): return "%s[%s]" % (left, right) else: return "%s %s %s" % (left, node.op, right) def visit_AugAssign(self, node): return "%s %s= %s" % (node.target, node.op, node.value) def visit_TernaryOp(self, node): cond = self._parenthesize(node, node.cond) then = self._parenthesize(node, node.then) elze = self._parenthesize(node, node.elze) return "%s ? %s : %s" % (cond, then, elze) def visit_Cast(self, node): value = self._parenthesize(node, node.value) return "(%s) %s" % (codegen_type(node.type), value) def visit_Constant(self, node): if isinstance(node.value, str): return "'%s'" % node.value[0] else: return str(node.value) def visit_SymbolRef(self, node): s = "" if node._global: s += "__global " if node._local: s += "__local " if node._static: s += "static " if node._const: s += "const " if node.type is not None: s += "%s " % codegen_type(node.type) if node._restrict: s += "restrict " return "%s%s" % (s, node.name) def visit_Block(self, node): return self._genblock(node.body) def visit_Return(self, node): if node.value: return "return %s" % node.value else: return "return" def visit_If(self, node): then = self._genblock(node.then) if node.elze: elze = self._genblock(node.elze) return "if (%s) %s else %s" % (node.cond, then, elze) else: return "if (%s) %s" % (node.cond, then) def visit_While(self, node): body = self._genblock(node.body) return "while (%s) %s" % (node.cond, body) def visit_DoWhile(self, node): body = self._genblock(node.body) return "do %s while (%s)" % (body, node.cond) def visit_For(self, node): body = self._genblock(node.body) s = "" if node.pragma: s += "#pragma %s\n" % node.pragma + self._tab() return s + "for (%s; %s; %s) %s" % (node.init, node.test, node.incr, body) def visit_FunctionCall(self, node): args = ", ".join(map(str, node.args)) return "%s(%s)" % (node.func, args) def visit_String(self, node): return '"%s"' % '" "'.join(node.values) def visit_CFile(self, node): stmts = self._genblock(node.body, insert_curly_brackets=False, increase_indent=False) return '// <file: %s>%s' % (node.get_filename(), stmts) def visit_ArrayDef(self, node): return "%s[%s] = " % (node.target, node.size) + self.visit(node.body) def visit_Break(self, node): return 'break' def visit_Continue(self, node): return 'continue' def visit_Array(self, node): return "{%s}" % ', '.join([i.codegen() for i in node.body]) def visit_Hex(self, node): return hex(node.value) + get_suffix(node.ctype) def visit_Number(self, node): return str(node.value) + get_suffix(node.ctype) def visit_Attribute(self, node): s = self.visit(node.target) return "{target} __attribute__({items})".format(target=s, items=", ".join(node.attributes)) def visit_Pragma(self, node): stuff = self._genblock(node.body, insert_curly_brackets=node.braces) if node.braces: stuff = '\n\t'.join(stuff.split("\n")) return '#pragma ' + node.pragma + '\n' + stuff
bsd-2-clause
4,827,430,226,630,825,000
33.325967
99
0.55062
false
3.540171
false
false
false
nuagenetworks/vspk-python
vspk/v6/nuegressauditacltemplate.py
1
21660
# -*- coding: utf-8 -*- # # Copyright (c) 2015, Alcatel-Lucent Inc, 2017 Nokia # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution. # * Neither the name of the copyright holder nor the names of its contributors # may be used to endorse or promote products derived from this software without # specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY # DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES # (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND # ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. from .fetchers import NUPermissionsFetcher from .fetchers import NUMetadatasFetcher from .fetchers import NUEgressAuditACLEntryTemplatesFetcher from .fetchers import NUGlobalMetadatasFetcher from bambou import NURESTObject class NUEgressAuditACLTemplate(NURESTObject): """ Represents a EgressAuditACLTemplate in the VSD Notes: An egress audit policy is a set of rules defining how network traffic is monitored and mirrored from a domain for Audit purposes """ __rest_name__ = "egressauditacltemplate" __resource_name__ = "egressauditacltemplates" ## Constants CONST_POLICY_STATE_DRAFT = "DRAFT" CONST_ENTITY_SCOPE_GLOBAL = "GLOBAL" CONST_PRIORITY_TYPE_TOP_AUDIT = "TOP_AUDIT" CONST_POLICY_STATE_LIVE = "LIVE" CONST_ENTITY_SCOPE_ENTERPRISE = "ENTERPRISE" def __init__(self, **kwargs): """ Initializes a EgressAuditACLTemplate instance Notes: You can specify all parameters while calling this methods. A special argument named `data` will enable you to load the object from a Python dictionary Examples: >>> egressauditacltemplate = NUEgressAuditACLTemplate(id=u'xxxx-xxx-xxx-xxx', name=u'EgressAuditACLTemplate') >>> egressauditacltemplate = NUEgressAuditACLTemplate(data=my_dict) """ super(NUEgressAuditACLTemplate, self).__init__() # Read/Write Attributes self._name = None self._last_updated_by = None self._last_updated_date = None self._active = None self._default_allow_ip = None self._default_allow_non_ip = None self._default_install_acl_implicit_rules = None self._description = None self._embedded_metadata = None self._entity_scope = None self._policy_state = None self._creation_date = None self._priority = None self._priority_type = None self._associated_live_entity_id = None self._associated_virtual_firewall_policy_id = None self._auto_generate_priority = None self._owner = None self._external_id = None self.expose_attribute(local_name="name", remote_name="name", attribute_type=str, is_required=True, is_unique=False) self.expose_attribute(local_name="last_updated_by", remote_name="lastUpdatedBy", attribute_type=str, is_required=False, is_unique=False) self.expose_attribute(local_name="last_updated_date", remote_name="lastUpdatedDate", attribute_type=str, is_required=False, is_unique=False) self.expose_attribute(local_name="active", remote_name="active", attribute_type=bool, is_required=False, is_unique=False) self.expose_attribute(local_name="default_allow_ip", remote_name="defaultAllowIP", attribute_type=bool, is_required=False, is_unique=False) self.expose_attribute(local_name="default_allow_non_ip", remote_name="defaultAllowNonIP", attribute_type=bool, is_required=False, is_unique=False) self.expose_attribute(local_name="default_install_acl_implicit_rules", remote_name="defaultInstallACLImplicitRules", attribute_type=bool, is_required=False, is_unique=False) self.expose_attribute(local_name="description", remote_name="description", attribute_type=str, is_required=False, is_unique=False) self.expose_attribute(local_name="embedded_metadata", remote_name="embeddedMetadata", attribute_type=list, is_required=False, is_unique=False) self.expose_attribute(local_name="entity_scope", remote_name="entityScope", attribute_type=str, is_required=False, is_unique=False, choices=[u'ENTERPRISE', u'GLOBAL']) self.expose_attribute(local_name="policy_state", remote_name="policyState", attribute_type=str, is_required=False, is_unique=False, choices=[u'DRAFT', u'LIVE']) self.expose_attribute(local_name="creation_date", remote_name="creationDate", attribute_type=str, is_required=False, is_unique=False) self.expose_attribute(local_name="priority", remote_name="priority", attribute_type=int, is_required=False, is_unique=True) self.expose_attribute(local_name="priority_type", remote_name="priorityType", attribute_type=str, is_required=False, is_unique=True, choices=[u'TOP_AUDIT']) self.expose_attribute(local_name="associated_live_entity_id", remote_name="associatedLiveEntityID", attribute_type=str, is_required=False, is_unique=False) self.expose_attribute(local_name="associated_virtual_firewall_policy_id", remote_name="associatedVirtualFirewallPolicyID", attribute_type=str, is_required=False, is_unique=False) self.expose_attribute(local_name="auto_generate_priority", remote_name="autoGeneratePriority", attribute_type=bool, is_required=False, is_unique=False) self.expose_attribute(local_name="owner", remote_name="owner", attribute_type=str, is_required=False, is_unique=False) self.expose_attribute(local_name="external_id", remote_name="externalID", attribute_type=str, is_required=False, is_unique=True) # Fetchers self.permissions = NUPermissionsFetcher.fetcher_with_object(parent_object=self, relationship="child") self.metadatas = NUMetadatasFetcher.fetcher_with_object(parent_object=self, relationship="child") self.egress_audit_acl_entry_templates = NUEgressAuditACLEntryTemplatesFetcher.fetcher_with_object(parent_object=self, relationship="child") self.global_metadatas = NUGlobalMetadatasFetcher.fetcher_with_object(parent_object=self, relationship="child") self._compute_args(**kwargs) # Properties @property def name(self): """ Get name value. Notes: The name of the entity """ return self._name @name.setter def name(self, value): """ Set name value. Notes: The name of the entity """ self._name = value @property def last_updated_by(self): """ Get last_updated_by value. Notes: ID of the user who last updated the object. This attribute is named `lastUpdatedBy` in VSD API. """ return self._last_updated_by @last_updated_by.setter def last_updated_by(self, value): """ Set last_updated_by value. Notes: ID of the user who last updated the object. This attribute is named `lastUpdatedBy` in VSD API. """ self._last_updated_by = value @property def last_updated_date(self): """ Get last_updated_date value. Notes: Time stamp when this object was last updated. This attribute is named `lastUpdatedDate` in VSD API. """ return self._last_updated_date @last_updated_date.setter def last_updated_date(self, value): """ Set last_updated_date value. Notes: Time stamp when this object was last updated. This attribute is named `lastUpdatedDate` in VSD API. """ self._last_updated_date = value @property def active(self): """ Get active value. Notes: If enabled, it means that this ACL or QOS entry is active """ return self._active @active.setter def active(self, value): """ Set active value. Notes: If enabled, it means that this ACL or QOS entry is active """ self._active = value @property def default_allow_ip(self): """ Get default_allow_ip value. Notes: If enabled a default ACL of Allow All is added as the last entry in the list of ACL entries This attribute is named `defaultAllowIP` in VSD API. """ return self._default_allow_ip @default_allow_ip.setter def default_allow_ip(self, value): """ Set default_allow_ip value. Notes: If enabled a default ACL of Allow All is added as the last entry in the list of ACL entries This attribute is named `defaultAllowIP` in VSD API. """ self._default_allow_ip = value @property def default_allow_non_ip(self): """ Get default_allow_non_ip value. Notes: If enabled, non ip traffic will be dropped This attribute is named `defaultAllowNonIP` in VSD API. """ return self._default_allow_non_ip @default_allow_non_ip.setter def default_allow_non_ip(self, value): """ Set default_allow_non_ip value. Notes: If enabled, non ip traffic will be dropped This attribute is named `defaultAllowNonIP` in VSD API. """ self._default_allow_non_ip = value @property def default_install_acl_implicit_rules(self): """ Get default_install_acl_implicit_rules value. Notes: If enabled, implicit rule will allow intra domain traffic by default This attribute is named `defaultInstallACLImplicitRules` in VSD API. """ return self._default_install_acl_implicit_rules @default_install_acl_implicit_rules.setter def default_install_acl_implicit_rules(self, value): """ Set default_install_acl_implicit_rules value. Notes: If enabled, implicit rule will allow intra domain traffic by default This attribute is named `defaultInstallACLImplicitRules` in VSD API. """ self._default_install_acl_implicit_rules = value @property def description(self): """ Get description value. Notes: A description of the entity """ return self._description @description.setter def description(self, value): """ Set description value. Notes: A description of the entity """ self._description = value @property def embedded_metadata(self): """ Get embedded_metadata value. Notes: Metadata objects associated with this entity. This will contain a list of Metadata objects if the API request is made using the special flag to enable the embedded Metadata feature. Only a maximum of Metadata objects is returned based on the value set in the system configuration. This attribute is named `embeddedMetadata` in VSD API. """ return self._embedded_metadata @embedded_metadata.setter def embedded_metadata(self, value): """ Set embedded_metadata value. Notes: Metadata objects associated with this entity. This will contain a list of Metadata objects if the API request is made using the special flag to enable the embedded Metadata feature. Only a maximum of Metadata objects is returned based on the value set in the system configuration. This attribute is named `embeddedMetadata` in VSD API. """ self._embedded_metadata = value @property def entity_scope(self): """ Get entity_scope value. Notes: Specify if scope of entity is Data center or Enterprise level This attribute is named `entityScope` in VSD API. """ return self._entity_scope @entity_scope.setter def entity_scope(self, value): """ Set entity_scope value. Notes: Specify if scope of entity is Data center or Enterprise level This attribute is named `entityScope` in VSD API. """ self._entity_scope = value @property def policy_state(self): """ Get policy_state value. Notes: None This attribute is named `policyState` in VSD API. """ return self._policy_state @policy_state.setter def policy_state(self, value): """ Set policy_state value. Notes: None This attribute is named `policyState` in VSD API. """ self._policy_state = value @property def creation_date(self): """ Get creation_date value. Notes: Time stamp when this object was created. This attribute is named `creationDate` in VSD API. """ return self._creation_date @creation_date.setter def creation_date(self, value): """ Set creation_date value. Notes: Time stamp when this object was created. This attribute is named `creationDate` in VSD API. """ self._creation_date = value @property def priority(self): """ Get priority value. Notes: The priority of the ACL entry that determines the order of entries """ return self._priority @priority.setter def priority(self, value): """ Set priority value. Notes: The priority of the ACL entry that determines the order of entries """ self._priority = value @property def priority_type(self): """ Get priority_type value. Notes: Possible values: TOP_AUDIT. This will be the top most of the egres ACL stack This attribute is named `priorityType` in VSD API. """ return self._priority_type @priority_type.setter def priority_type(self, value): """ Set priority_type value. Notes: Possible values: TOP_AUDIT. This will be the top most of the egres ACL stack This attribute is named `priorityType` in VSD API. """ self._priority_type = value @property def associated_live_entity_id(self): """ Get associated_live_entity_id value. Notes: In the draft mode, the ACL entry refers to this LiveEntity. In non-drafted mode, this is null. This attribute is named `associatedLiveEntityID` in VSD API. """ return self._associated_live_entity_id @associated_live_entity_id.setter def associated_live_entity_id(self, value): """ Set associated_live_entity_id value. Notes: In the draft mode, the ACL entry refers to this LiveEntity. In non-drafted mode, this is null. This attribute is named `associatedLiveEntityID` in VSD API. """ self._associated_live_entity_id = value @property def associated_virtual_firewall_policy_id(self): """ Get associated_virtual_firewall_policy_id value. Notes: The ID of the Virtual Firewall Policy, if this was created as part of the Virtual Firewall Policy creation This attribute is named `associatedVirtualFirewallPolicyID` in VSD API. """ return self._associated_virtual_firewall_policy_id @associated_virtual_firewall_policy_id.setter def associated_virtual_firewall_policy_id(self, value): """ Set associated_virtual_firewall_policy_id value. Notes: The ID of the Virtual Firewall Policy, if this was created as part of the Virtual Firewall Policy creation This attribute is named `associatedVirtualFirewallPolicyID` in VSD API. """ self._associated_virtual_firewall_policy_id = value @property def auto_generate_priority(self): """ Get auto_generate_priority value. Notes: This option only affects how the children ACL entry priorities of this template/policy are generated when the priority is not specified. If 'false', the priority is generated by incrementing the current highest ACL Entry priority by 100. If 'true', a random priority will be generated, which is advised when creating many entries concurrently without specifying the priority. This will cause the new child ACL entry to get a random, non-predictable, priority. Therefore it is advised to only enable this when allow rules are being created. If any type of ACL entry order is required, keep this value to 'false' and use your own defined priorities, this will make sure there is a clear set of priorities and how traffic is validated against the ACL entries. This attribute is named `autoGeneratePriority` in VSD API. """ return self._auto_generate_priority @auto_generate_priority.setter def auto_generate_priority(self, value): """ Set auto_generate_priority value. Notes: This option only affects how the children ACL entry priorities of this template/policy are generated when the priority is not specified. If 'false', the priority is generated by incrementing the current highest ACL Entry priority by 100. If 'true', a random priority will be generated, which is advised when creating many entries concurrently without specifying the priority. This will cause the new child ACL entry to get a random, non-predictable, priority. Therefore it is advised to only enable this when allow rules are being created. If any type of ACL entry order is required, keep this value to 'false' and use your own defined priorities, this will make sure there is a clear set of priorities and how traffic is validated against the ACL entries. This attribute is named `autoGeneratePriority` in VSD API. """ self._auto_generate_priority = value @property def owner(self): """ Get owner value. Notes: Identifies the user that has created this object. """ return self._owner @owner.setter def owner(self, value): """ Set owner value. Notes: Identifies the user that has created this object. """ self._owner = value @property def external_id(self): """ Get external_id value. Notes: External object ID. Used for integration with third party systems This attribute is named `externalID` in VSD API. """ return self._external_id @external_id.setter def external_id(self, value): """ Set external_id value. Notes: External object ID. Used for integration with third party systems This attribute is named `externalID` in VSD API. """ self._external_id = value
bsd-3-clause
4,749,001,960,045,595,000
32.792512
772
0.605263
false
4.683243
false
false
false
mbartling/TAMU_senior_design
Python/gps2local.py
1
1458
#! /usr/bin/env python from numpy import * import sys #p1 = [30.625621, -96.336753] #p2 = [30.624388, -96.335755] #p3 = [30.626050, -96.333368] #p4 = [30.627195, -96.334945] xres = 300 yres = 500 lat = [] lon = [] for line in sys.stdin: line.strip() (latS, lonS, dummy) = line.split(',') lat.append(latS) lon.append(lonS) lat = array(lat, dtype='int32') lon = array(lon, dtype='int32') latmin = min(lat) latmax = max(lat) lonmin = min(lon) lonmax = max(lon) xlin = linspace(latmin,latmax,xres) ylin = linspace(lonmin,lonmax,yres) print xlin, ylin #s1 = [30.625383, -96.336161] #s2 = [30.624978, -96.335295] #s3 = [30.625749, -96.334460] #rssi1 = -16.2342 #rssi2 = -20.2342 #rssi3 = -22.2342 thresh = 0.15 #15% of minimum distance #gamemap = zeros([len(xlin),len(ylin)]) # #dx = xlin - s1[0] #dy = ylin - s1[1] #xloc = abs(dx) <= (1+thresh)*min(abs(dx)) #consider doing average #yloc = abs(dy) <= (1+thresh)*min(abs(dy)) #gamemap[xloc,yloc] = rssi1 # #dx = xlin - s2[0] #dy = ylin - s2[1] #xloc = abs(dx) <= (1+thresh)*min(abs(dx)) #consider doing average #yloc = abs(dy) <= (1+thresh)*min(abs(dy)) #gamemap[xloc,yloc] = rssi2 # #dx = xlin - s3[0] #dy = ylin - s3[1] #xloc = abs(dx) <= (1+thresh)*min(abs(dx)) #consider doing average #yloc = abs(dy) <= (1+thresh)*min(abs(dy)) #gamemap[xloc,yloc] = rssi3 # #temp = zeros([len(xlin),len(ylin)]) #mask = gamemap != 0 #temp[mask] = #
mit
-899,562,376,890,822,100
20.78125
66
0.593964
false
2.036313
false
false
false
gengwg/leetcode
179_largest_number.py
1
1445
# -*- coding: utf-8 -*- # 179. Largest Number # Given a list of non negative integers, # arrange them such that they form the largest number. # # For example, given [3, 30, 34, 5, 9], the largest formed number is 9534330. # # Note: The result may be very large, # so you need to return a string instead of an integer. # # Credits: # Special thanks to @ts for adding this problem and creating all test cases. # # http://bookshadow.com/weblog/2015/01/13/leetcode-largest-number/ # 排序思路: # 对于两个备选数字a和b, # 如果str(a) + str(b) > str(b) + str(a), # 则a在b之前,否则b在a之前 # # 按照此原则对原数组从大到小排序即可 # # 时间复杂度O(nlogn) # # 易错样例: # Input: [0,0] # Output: "00" # Expected: "0" class Solution: # @param {integer[]} nums # @return {string} def largestNumber(self, nums): nums = sorted([str(x) for x in nums], cmp=self.compare) ans = ''.join(nums).lstrip('0') return ans or '0' def compare(self, a, b): # 2nd [] is not a list. it is indexing: True = 1, False = 0 # [1, -1][1] == -1; [1, -1][1] == 1 # so this will sort a, b in reverted (descending) order return [1, -1][a + b > b + a] # equivalent to: if a + b > b + a: return -1 else: return 1 if __name__ == '__main__': print Solution().largestNumber([3, 30, 34, 5, 9])
apache-2.0
-4,658,683,190,685,438,000
25.098039
77
0.57701
false
2.497186
false
false
false
alex-bauer/kelvin-power-challenge
src/features/features_saaf.py
1
1680
"""Concatenate and resample SAAF data""" import sys import os sys.path.append("../") from utils.utils import * folder = config.features_folder if not os.path.exists(folder): os.makedirs(folder) def parse_saaf(filename, dropna=True): df = pd.read_csv(config.data_folder + '/' + filename) df = convert_time(df) df = resample(df) if dropna: df = df.dropna() return df saaf_train1 = parse_saaf('/train_set/context--2008-08-22_2010-07-10--saaf.csv') saaf_train2 = parse_saaf('/train_set/context--2010-07-10_2012-05-27--saaf.csv') saaf_train3 = parse_saaf('/train_set/context--2012-05-27_2014-04-14--saaf.csv') saaf_train = pd.concat([saaf_train1, saaf_train2, saaf_train3]) saaf_test = parse_saaf('/test_set/context--2014-04-14_2016-03-01--saaf.csv') saaf_all = pd.concat([saaf_train, saaf_test]) #Binary indicator for solar conjunction saaf_all['conjunction']=0 saaf_all.loc['2008-11-16':'2008-12-20','conjunction']=1 saaf_all.loc['2011-01-17':'2011-02-20','conjunction']=1 saaf_all.loc['2013-03-28':'2013-05-05','conjunction']=1 saaf_all.loc['2015-05-27':'2015-07-01','conjunction']=1 cols=['sa','sx','sy','sz'] #Averages over previous hours for col in cols: saaf_all[col+'_last_1']=saaf_all[col].shift(-1) saaf_all[col+'_last_3']=saaf_all[col].rolling(3).mean() saaf_all[col+'_last_24']=saaf_all[col].rolling(24).mean() target = pd.read_pickle(config.data_folder + '/target.pkl') target = target.join(saaf_all.reindex(target.index, method='nearest')) saaf_all = target.drop(config.target_cols, axis=1) saaf_all.fillna(method='ffill').fillna(method='bfill').to_pickle(config.features_folder + '/saaf.pkl') print "Done."
mit
8,595,800,424,774,629,000
27.982759
102
0.683333
false
2.612753
false
false
false
ryanjoneil/docker-image-construction
dicp/solvers/most_common.py
1
1247
from collections import defaultdict class MostCommonHeuristic(object): '''Heuristic that shares the most common command at any point''' _slug = 'most-common' def slug(self): return MostCommonHeuristic._slug def solve(self, problem, saver): # Keep track of what hasn't been assigned and how many of each thing there are. remaining = {i: set(problem.images[i]) for i in problem.images} order = defaultdict(list) self._assign(remaining, order) saver(order) def _assign(self, remaining, order): if not remaining: return # Figure the most common command. by_cmd = defaultdict(set) for i, cmds in remaining.items(): for c in cmds: by_cmd[c].add(i) most_common = max(by_cmd, key=lambda p: len(by_cmd[p])) # Add this to the schedule for any it applies to. new_remain = {} for i in by_cmd[most_common]: order[i].append(most_common) remaining[i].remove(most_common) if remaining[i]: new_remain[i] = set(remaining[i]) del remaining[i] self._assign(new_remain, order) self._assign(remaining, order)
mit
5,420,271,509,696,158,000
30.974359
87
0.588613
false
4.048701
false
false
false
Balannen/LSMASOMM
atom3/Kernel/ErrorHandlers/exceptionStreamHook.py
1
1233
""" exceptionStreamHook.py A custom stderr hook by Denis Dube, http://msdl.cs.mcgill.ca/people/denis/ """ import tkMessageBox, sys class exceptionStreamHook: """ This class pretends to be an open stderr file stream Perhaps it should subclass File to be safer... but what would be the default behaviour then??? Must I override each method on at a time? Bah, like anyone uses that on stderr... """ def write( self, errorString ): """ Simulates the write method of a file stream object """ # Send the error back where it belongs sys.__stderr__.write( errorString ) #print ">"+errorString+"<" # Dealing with a new exception if( errorString[:9] == 'Exception' ): tkMessageBox.showerror( 'Uncaught Exception', 'See console for details\n\n' + errorString ) def close( self, *args ): pass def open( self, *args ): pass def applyHook2stderr(): # Redirect error output stream to customized handler sys.stderr = exceptionStreamHook() if __name__ == '__main__': print "Testing error redirect" applyHook2stderr() 5/0 x=bs print "Done"
gpl-3.0
469,603,371,962,662,600
23.729167
78
0.607461
false
3.96463
false
false
false
yuanming-hu/taichi
python/taichi/lang/shell.py
1
1472
import atexit import functools import os import sys from taichi.core.util import ti_core as _ti_core import taichi as ti try: import sourceinspect as oinspect except ImportError: ti.warn('`sourceinspect` not installed!') ti.warn( 'Without this package Taichi may not function well in Python IDLE interactive shell, ' 'Blender scripting module and Python native shell.') ti.warn('Please run `python3 -m pip install sourceinspect` to install.') import inspect as oinspect pybuf_enabled = False _env_enable_pybuf = os.environ.get('TI_ENABLE_PYBUF', '1') if not _env_enable_pybuf or int(_env_enable_pybuf): # When using in Jupyter / IDLE, the sys.stdout will be their wrapped ones. # While sys.__stdout__ should always be the raw console stdout. pybuf_enabled = sys.stdout is not sys.__stdout__ _ti_core.toggle_python_print_buffer(pybuf_enabled) def _shell_pop_print(old_call): if not pybuf_enabled: # zero-overhead! return old_call ti.info('Graphical python shell detected, using wrapped sys.stdout') @functools.wraps(old_call) def new_call(*args, **kwargs): _taichi_skip_traceback = 1 ret = old_call(*args, **kwargs) # print's in kernel won't take effect until ti.sync(), discussion: # https://github.com/taichi-dev/taichi/pull/1303#discussion_r444897102 print(_ti_core.pop_python_print_buffer(), end='') return ret return new_call
mit
6,888,034,702,434,073,000
31
94
0.686821
false
3.521531
false
false
false
leeopop/2015-CS570-Project
lda_preprocess.py
1
2532
import csv from loader import load_single_file num_of_topics__criteria_for_cut_words = 20 num_of_appearance__criteria_for_cut_words = 10 output_num_of_words_per_topic = 50 def load_vocab(): vocab = {} inverse_dict = load_single_file('keyword_table.csv') num = max([int(x['unique']) for x in inverse_dict.values()]) + 1 for (key, val) in inverse_dict.items(): vocab[int(val['unique'])] = str(key) return num, vocab def check_line_is_useless(line, cut_topic, cut_word): count = 0 for i in range(1,len(line)): if int(line[i]) >= cut_word: count+=1 if count >= cut_topic: return True return False def load_lda(num_vocab, vocab, cut_topic, cut_word): f = open("lda_output.txt","r") line = f.readline() line = line.split() n_topics = len(line)-1 ret = [] removed_words = [] index = int(line[0]) for i in range(n_topics): ret.append([0] * num_vocab) if check_line_is_useless(line, cut_topic, cut_word): print(vocab[index]) removed_words.append(vocab[index]) else: for i in range(n_topics): ret[i][index] = int(line[i+1]) for line in f: line = line.split() index = int(line[0]) if check_line_is_useless(line, cut_topic, cut_word): print(vocab[index]) removed_words.append(vocab[index]) else: for i in range(n_topics): ret[i][index] = int(line[i+1]) for i in range(n_topics): ret[i] = list(enumerate(ret[i])) ret[i].sort(key=lambda item:item[1], reverse=True) return removed_words, n_topics, ret def write_csv(lda, vocab, removed_words, n_topic, n_word): with open('lda.csv', 'w', encoding='utf-8') as writecsvfile: writer = csv.writer(writecsvfile, delimiter=',', quotechar='|') row = [] for i in range(n_topic): row.append("topic" + str(i+1)) writer.writerow(row) for i in range(n_word): row = [] for j in range(n_topic): row.append(vocab[lda[j][i][0]]) writer.writerow(row) writer.writerow([]) removed_words.insert(0,'') removed_words.insert(0,'removed_words') writer.writerow(removed_words) def main(): num_vocab,vocab = load_vocab() print("reading vocabulary file finished!") #remove_words = ['of', 'the', 'and', 'in', 'for', 'a', 'to', 'with', 'by', 'on','at', 'an'] removed_words, num_topic,lda = load_lda(num_vocab, vocab, num_of_topics__criteria_for_cut_words, num_of_appearance__criteria_for_cut_words) print("processing lda file finished!") write_csv(lda,vocab, removed_words, num_topic, output_num_of_words_per_topic) print("writing lda file finished!") if __name__ == '__main__': main()
mit
6,811,511,562,006,119,000
27.460674
92
0.651659
false
2.648536
false
false
false
DarthMaulware/EquationGroupLeaks
Leak #5 - Lost In Translation/windows/exploits/ZIBE/plugin_manager.py
1
2051
# uncompyle6 version 2.9.10 # Python bytecode 2.6 (62161) # Decompiled from: Python 3.6.0b2 (default, Oct 11 2016, 05:27:10) # [GCC 6.2.0 20161005] # Embedded file name: c:\Temp\build\ZIBE\plugin_manager.py # Compiled at: 2013-02-27 18:02:46 from plugins import * class PluginManager(object): __plugins__ = {} __handlers__ = {} def __init__(self): plugins = __import__('ZIBE').plugins for member in plugins.__all__: plugin_mod = getattr(plugins, member) for type_name in dir(plugin_mod): try: t = getattr(plugin_mod, type_name) if t.zibe_plugin is True: self._add_plugin(t) except AttributeError: pass def plugin_commands(self, plugin_name): if self.__plugins__.has_key(plugin_name): return self.__plugins__[plugin_name].get_command_handlers().keys() return None return None def plugins(self): ret = [] for p in self.__plugins__.keys(): ret.append((p, self.__plugins__[p].friendly_name)) return ret def _add_plugin(self, t): inst = t() self.__plugins__[t.plugin_name] = inst handlers = inst.get_command_handlers() for k in handlers: self.__handlers__[k] = handlers[k] def handler_exists(self, cmd_name): if self.__handlers__.has_key(cmd_name): return True return False def get_handler_info(self, name): if self.__handlers__.has_key(name) is False: return None return self.__handlers__[name] def get_handler_func(self, cmd): return self.__handlers__[cmd]['handler'] def invoke_cmd_handler(self, cmd, ctx, stdin, stdout, stderr, args): if self.__handlers__.has_key(cmd): record = self.__handlers__[cmd] return record['handler'](stdin, stdout, stderr, ctx, args) raise Exception('No command handler registered under that name')
unlicense
1,598,297,665,892,283,400
32.096774
78
0.561677
false
3.88447
false
false
false
alekz112/xlwings
xlwings/tests/test_xlwings.py
1
33895
# -*- coding: utf-8 -*- from __future__ import unicode_literals import os import sys import shutil import pytz import nose from nose.tools import assert_equal, raises, assert_true, assert_false, assert_not_equal from datetime import datetime, date from xlwings import Application, Workbook, Sheet, Range, Chart, ChartType, RgbColor, Calculation # Mac imports if sys.platform.startswith('darwin'): from appscript import k as kw # TODO: uncomment the desired Excel installation or set to None for default installation APP_TARGET = None # APP_TARGET = '/Applications/Microsoft Office 2011/Microsoft Excel' else: APP_TARGET = None # Optional dependencies try: import numpy as np from numpy.testing import assert_array_equal except ImportError: np = None try: import pandas as pd from pandas import DataFrame, Series from pandas.util.testing import assert_frame_equal, assert_series_equal except ImportError: pd = None # Test data data = [[1, 2.222, 3.333], ['Test1', None, 'éöà'], [datetime(1962, 11, 3), datetime(2020, 12, 31, 12, 12, 20), 9.999]] test_date_1 = datetime(1962, 11, 3) test_date_2 = datetime(2020, 12, 31, 12, 12, 20) list_row_1d = [1.1, None, 3.3] list_row_2d = [[1.1, None, 3.3]] list_col = [[1.1], [None], [3.3]] chart_data = [['one', 'two'], [1.1, 2.2]] if np is not None: array_1d = np.array([1.1, 2.2, np.nan, -4.4]) array_2d = np.array([[1.1, 2.2, 3.3], [-4.4, 5.5, np.nan]]) if pd is not None: series_1 = pd.Series([1.1, 3.3, 5., np.nan, 6., 8.]) rng = pd.date_range('1/1/2012', periods=10, freq='D') timeseries_1 = pd.Series(np.arange(len(rng)) + 0.1, rng) timeseries_1[1] = np.nan df_1 = pd.DataFrame([[1, 'test1'], [2, 'test2'], [np.nan, None], [3.3, 'test3']], columns=['a', 'b']) df_2 = pd.DataFrame([1, 3, 5, np.nan, 6, 8], columns=['col1']) df_dateindex = pd.DataFrame(np.arange(50).reshape(10,5) + 0.1, index=rng) # MultiIndex (Index) tuples = list(zip(*[['bar', 'bar', 'baz', 'baz', 'foo', 'foo', 'qux', 'qux'], ['one', 'two', 'one', 'two', 'one', 'two', 'one', 'two'], ['x', 'x', 'x', 'x', 'y', 'y', 'y', 'y']])) index = pd.MultiIndex.from_tuples(tuples, names=['first', 'second', 'third']) df_multiindex = pd.DataFrame([[1.1, 2.2], [3.3, 4.4], [5.5, 6.6], [7.7, 8.8], [9.9, 10.10], [11.11, 12.12],[13.13, 14.14], [15.15, 16.16]], index=index) # MultiIndex (Header) header = [['Foo', 'Foo', 'Bar', 'Bar', 'Baz'], ['A', 'B', 'C', 'D', 'E']] df_multiheader = pd.DataFrame([[0.0, 1.0, 2.0, 3.0, 4.0], [0.0, 1.0, 2.0, 3.0, 4.0], [0.0, 1.0, 2.0, 3.0, 4.0], [0.0, 1.0, 2.0, 3.0, 4.0], [0.0, 1.0, 2.0, 3.0, 4.0], [0.0, 1.0, 2.0, 3.0, 4.0]], columns=pd.MultiIndex.from_arrays(header)) # Test skips and fixtures def _skip_if_no_numpy(): if np is None: raise nose.SkipTest('numpy missing') def _skip_if_no_pandas(): if pd is None: raise nose.SkipTest('pandas missing') def _skip_if_not_default_xl(): if APP_TARGET is not None: raise nose.SkipTest('not Excel default') def class_teardown(wb): wb.close() if sys.platform.startswith('win'): Application(wb).quit() class TestApplication: def setUp(self): # Connect to test file and make Sheet1 the active sheet xl_file1 = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'test_workbook_1.xlsx') self.wb = Workbook(xl_file1, app_visible=False, app_target=APP_TARGET) Sheet('Sheet1').activate() def tearDown(self): class_teardown(self.wb) def test_screen_updating(self): Application(wkb=self.wb).screen_updating = False assert_equal(Application(wkb=self.wb).screen_updating, False) Application(wkb=self.wb).screen_updating = True assert_equal(Application(wkb=self.wb).screen_updating, True) def test_calculation(self): Range('A1').value = 2 Range('B1').formula = '=A1 * 2' app = Application(wkb=self.wb) app.calculation = Calculation.xlCalculationManual Range('A1').value = 4 assert_equal(Range('B1').value, 4) app.calculation = Calculation.xlCalculationAutomatic app.calculate() # This is needed on Mac Excel 2016 but not on Mac Excel 2011 (changed behaviour) assert_equal(Range('B1').value, 8) Range('A1').value = 2 assert_equal(Range('B1').value, 4) class TestWorkbook: def setUp(self): # Connect to test file and make Sheet1 the active sheet xl_file1 = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'test_workbook_1.xlsx') self.wb = Workbook(xl_file1, app_visible=False, app_target=APP_TARGET) Sheet('Sheet1').activate() def tearDown(self): class_teardown(self.wb) def test_name(self): assert_equal(self.wb.name, 'test_workbook_1.xlsx') def test_active_sheet(self): assert_equal(self.wb.active_sheet.name, 'Sheet1') def test_current(self): assert_equal(self.wb.xl_workbook, Workbook.current().xl_workbook) def test_set_current(self): wb2 = Workbook(app_visible=False, app_target=APP_TARGET) assert_equal(Workbook.current().xl_workbook, wb2.xl_workbook) self.wb.set_current() assert_equal(Workbook.current().xl_workbook, self.wb.xl_workbook) wb2.close() def test_get_selection(self): Range('A1').value = 1000 assert_equal(self.wb.get_selection().value, 1000) def test_reference_two_unsaved_wb(self): """Covers GH Issue #63""" wb1 = Workbook(app_visible=False, app_target=APP_TARGET) wb2 = Workbook(app_visible=False, app_target=APP_TARGET) Range('A1').value = 2. # wb2 Range('A1', wkb=wb1).value = 1. # wb1 assert_equal(Range('A1').value, 2.) assert_equal(Range('A1', wkb=wb1).value, 1.) wb1.close() wb2.close() def test_save_naked(self): cwd = os.getcwd() wb1 = Workbook(app_visible=False, app_target=APP_TARGET) target_file_path = os.path.join(cwd, wb1.name + '.xlsx') if os.path.isfile(target_file_path): os.remove(target_file_path) wb1.save() assert_equal(os.path.isfile(target_file_path), True) wb2 = Workbook(target_file_path, app_visible=False, app_target=APP_TARGET) wb2.close() if os.path.isfile(target_file_path): os.remove(target_file_path) def test_save_path(self): cwd = os.getcwd() wb1 = Workbook(app_visible=False, app_target=APP_TARGET) target_file_path = os.path.join(cwd, 'TestFile.xlsx') if os.path.isfile(target_file_path): os.remove(target_file_path) wb1.save(target_file_path) assert_equal(os.path.isfile(target_file_path), True) wb2 = Workbook(target_file_path, app_visible=False, app_target=APP_TARGET) wb2.close() if os.path.isfile(target_file_path): os.remove(target_file_path) def test_mock_caller(self): # Can't really run this one with app_visible=False _skip_if_not_default_xl() Workbook.set_mock_caller(os.path.join(os.path.dirname(os.path.abspath(__file__)), 'test_workbook_1.xlsx')) wb = Workbook.caller() Range('A1', wkb=wb).value = 333 assert_equal(Range('A1', wkb=wb).value, 333) def test_unicode_path(self): # pip3 seems to struggle with unicode filenames src = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'unicode_path.xlsx') dst = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'ünicödé_päth.xlsx') shutil.move(src, dst) wb = Workbook(os.path.join(os.path.dirname(os.path.abspath(__file__)), 'ünicödé_päth.xlsx'), app_visible=False, app_target=APP_TARGET) Range('A1').value = 1 wb.close() shutil.move(dst, src) def test_unsaved_workbook_reference(self): wb = Workbook(app_visible=False, app_target=APP_TARGET) Range('B2').value = 123 wb2 = Workbook(wb.name, app_visible=False, app_target=APP_TARGET) assert_equal(Range('B2', wkb=wb2).value, 123) wb2.close() def test_delete_named_item(self): Range('B10:C11').name = 'to_be_deleted' assert_equal(Range('to_be_deleted').name, 'to_be_deleted') del self.wb.names['to_be_deleted'] assert_not_equal(Range('B10:C11').name, 'to_be_deleted') def test_names_collection(self): Range('A1').name = 'name1' Range('A2').name = 'name2' assert_true('name1' in self.wb.names and 'name2' in self.wb.names) Range('A3').name = 'name3' assert_true('name1' in self.wb.names and 'name2' in self.wb.names and 'name3' in self.wb.names) def test_active_workbook(self): # TODO: add test over multiple Excel instances on Windows Range('A1').value = 'active_workbook' wb_active = Workbook.active(app_target=APP_TARGET) assert_equal(Range('A1', wkb=wb_active).value, 'active_workbook') def test_workbook_name(self): Range('A10').value = 'name-test' wb2 = Workbook('test_workbook_1.xlsx', app_visible=False, app_target=APP_TARGET) assert_equal(Range('A10', wkb=wb2).value, 'name-test') class TestSheet: def setUp(self): # Connect to test file and make Sheet1 the active sheet xl_file1 = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'test_workbook_1.xlsx') self.wb = Workbook(xl_file1, app_visible=False, app_target=APP_TARGET) Sheet('Sheet1').activate() def tearDown(self): class_teardown(self.wb) def test_activate(self): Sheet('Sheet2').activate() assert_equal(Sheet.active().name, 'Sheet2') Sheet(3).activate() assert_equal(Sheet.active().index, 3) def test_name(self): Sheet(1).name = 'NewName' assert_equal(Sheet(1).name, 'NewName') def test_index(self): assert_equal(Sheet('Sheet1').index, 1) def test_clear_content_active_sheet(self): Range('G10').value = 22 Sheet.active().clear_contents() cell = Range('G10').value assert_equal(cell, None) def test_clear_active_sheet(self): Range('G10').value = 22 Sheet.active().clear() cell = Range('G10').value assert_equal(cell, None) def test_clear_content(self): Range('Sheet2', 'G10').value = 22 Sheet('Sheet2').clear_contents() cell = Range('Sheet2', 'G10').value assert_equal(cell, None) def test_clear(self): Range('Sheet2', 'G10').value = 22 Sheet('Sheet2').clear() cell = Range('Sheet2', 'G10').value assert_equal(cell, None) def test_autofit(self): Range('Sheet1', 'A1:D4').value = 'test_string' Sheet('Sheet1').autofit() Sheet('Sheet1').autofit('r') Sheet('Sheet1').autofit('c') Sheet('Sheet1').autofit('rows') Sheet('Sheet1').autofit('columns') def test_add_before(self): new_sheet = Sheet.add(before='Sheet1') assert_equal(Sheet(1).name, new_sheet.name) def test_add_after(self): Sheet.add(after=Sheet.count()) assert_equal(Sheet(Sheet.count()).name, Sheet.active().name) Sheet.add(after=1) assert_equal(Sheet(2).name, Sheet.active().name) def test_add_default(self): # TODO: test call without args properly Sheet.add() def test_add_named(self): Sheet.add('test', before=1) assert_equal(Sheet(1).name, 'test') @raises(Exception) def test_add_name_already_taken(self): Sheet.add('Sheet1') def test_count(self): count = Sheet.count() assert_equal(count, 3) def test_all(self): all_names = [i.name for i in Sheet.all()] assert_equal(all_names, ['Sheet1', 'Sheet2', 'Sheet3']) class TestRange: def setUp(self): # Connect to test file and make Sheet1 the active sheet xl_file1 = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'test_range_1.xlsx') self.wb = Workbook(xl_file1, app_visible=False, app_target=APP_TARGET) Sheet('Sheet1').activate() def tearDown(self): class_teardown(self.wb) def test_cell(self): params = [('A1', 22), ((1,1), 22), ('A1', 22.2222), ((1,1), 22.2222), ('A1', 'Test String'), ((1,1), 'Test String'), ('A1', 'éöà'), ((1,1), 'éöà'), ('A2', test_date_1), ((2,1), test_date_1), ('A3', test_date_2), ((3,1), test_date_2)] for param in params: yield self.check_cell, param[0], param[1] def check_cell(self, address, value): # Active Sheet Range(address).value = value cell = Range(address).value assert_equal(cell, value) # SheetName Range('Sheet2', address).value = value cell = Range('Sheet2', address).value assert_equal(cell, value) # SheetIndex Range(3, address).value = value cell = Range(3, address).value assert_equal(cell, value) def test_range_address(self): """ Style: Range('A1:C3') """ address = 'C1:E3' # Active Sheet Range(address[:2]).value = data # assign to starting cell only cells = Range(address).value assert_equal(cells, data) # Sheetname Range('Sheet2', address).value = data cells = Range('Sheet2', address).value assert_equal(cells, data) # Sheetindex Range(3, address).value = data cells = Range(3, address).value assert_equal(cells, data) def test_range_index(self): """ Style: Range((1,1), (3,3)) """ index1 = (1,3) index2 = (3,5) # Active Sheet Range(index1, index2).value = data cells = Range(index1, index2).value assert_equal(cells, data) # Sheetname Range('Sheet2', index1, index2).value = data cells = Range('Sheet2', index1, index2).value assert_equal(cells, data) # Sheetindex Range(3, index1, index2).value = data cells = Range(3, index1, index2).value assert_equal(cells, data) def test_named_range_value(self): value = 22.222 # Active Sheet Range('cell_sheet1').value = value cells = Range('cell_sheet1').value assert_equal(cells, value) Range('range_sheet1').value = data cells = Range('range_sheet1').value assert_equal(cells, data) # Sheetname Range('Sheet2', 'cell_sheet2').value = value cells = Range('Sheet2', 'cell_sheet2').value assert_equal(cells, value) Range('Sheet2', 'range_sheet2').value = data cells = Range('Sheet2', 'range_sheet2').value assert_equal(cells, data) # Sheetindex Range(3, 'cell_sheet3').value = value cells = Range(3, 'cell_sheet3').value assert_equal(cells, value) Range(3, 'range_sheet3').value = data cells = Range(3, 'range_sheet3').value assert_equal(cells, data) def test_array(self): _skip_if_no_numpy() # 1d array Range('Sheet6', 'A1').value = array_1d cells = Range('Sheet6', 'A1:D1', asarray=True).value assert_array_equal(cells, array_1d) # 2d array Range('Sheet6', 'A4').value = array_2d cells = Range('Sheet6', 'A4', asarray=True).table.value assert_array_equal(cells, array_2d) # 1d array (atleast_2d) Range('Sheet6', 'A10').value = array_1d cells = Range('Sheet6', 'A10:D10', asarray=True, atleast_2d=True).value assert_array_equal(cells, np.atleast_2d(array_1d)) # 2d array (atleast_2d) Range('Sheet6', 'A12').value = array_2d cells = Range('Sheet6', 'A12', asarray=True, atleast_2d=True).table.value assert_array_equal(cells, array_2d) def sheet_ref(self): Range(Sheet(1), 'A20').value = 123 assert_equal(Range(1, 'A20').value, 123) Range(Sheet(1), (2,2), (4,4)).value = 321 assert_equal(Range(1, (2,2)).value, 321) def test_vertical(self): Range('Sheet4', 'A10').value = data if sys.platform.startswith('win') and self.wb.xl_app.Version == '14.0': Range('Sheet4', 'A12:B12').xl_range.NumberFormat = 'dd/mm/yyyy' # Hack for Excel 2010 bug, see GH #43 cells = Range('Sheet4', 'A10').vertical.value assert_equal(cells, [row[0] for row in data]) def test_horizontal(self): Range('Sheet4', 'A20').value = data cells = Range('Sheet4', 'A20').horizontal.value assert_equal(cells, data[0]) def test_table(self): Range('Sheet4', 'A1').value = data if sys.platform.startswith('win') and self.wb.xl_app.Version == '14.0': Range('Sheet4', 'A3:B3').xl_range.NumberFormat = 'dd/mm/yyyy' # Hack for Excel 2010 bug, see GH #43 cells = Range('Sheet4', 'A1').table.value assert_equal(cells, data) def test_list(self): # 1d List Row Range('Sheet4', 'A27').value = list_row_1d cells = Range('Sheet4', 'A27:C27').value assert_equal(list_row_1d, cells) # 2d List Row Range('Sheet4', 'A29').value = list_row_2d cells = Range('Sheet4', 'A29:C29', atleast_2d=True).value assert_equal(list_row_2d, cells) # 1d List Col Range('Sheet4', 'A31').value = list_col cells = Range('Sheet4', 'A31:A33').value assert_equal([i[0] for i in list_col], cells) # 2d List Col cells = Range('Sheet4', 'A31:A33', atleast_2d=True).value assert_equal(list_col, cells) def test_is_cell(self): assert_equal(Range('A1').is_cell(), True) assert_equal(Range('A1:B1').is_cell(), False) assert_equal(Range('A1:A2').is_cell(), False) assert_equal(Range('A1:B2').is_cell(), False) def test_is_row(self): assert_equal(Range('A1').is_row(), False) assert_equal(Range('A1:B1').is_row(), True) assert_equal(Range('A1:A2').is_row(), False) assert_equal(Range('A1:B2').is_row(), False) def test_is_column(self): assert_equal(Range('A1').is_column(), False) assert_equal(Range('A1:B1').is_column(), False) assert_equal(Range('A1:A2').is_column(), True) assert_equal(Range('A1:B2').is_column(), False) def test_is_table(self): assert_equal(Range('A1').is_table(), False) assert_equal(Range('A1:B1').is_table(), False) assert_equal(Range('A1:A2').is_table(), False) assert_equal(Range('A1:B2').is_table(), True) def test_formula(self): Range('A1').formula = '=SUM(A2:A10)' assert_equal(Range('A1').formula, '=SUM(A2:A10)') def test_current_region(self): values = [[1.,2.],[3.,4.]] Range('A20').value = values assert_equal(Range('B21').current_region.value, values) def test_clear_content(self): Range('Sheet4', 'G1').value = 22 Range('Sheet4', 'G1').clear_contents() cell = Range('Sheet4', 'G1').value assert_equal(cell, None) def test_clear(self): Range('Sheet4', 'G1').value = 22 Range('Sheet4', 'G1').clear() cell = Range('Sheet4', 'G1').value assert_equal(cell, None) def test_dataframe_1(self): _skip_if_no_pandas() df_expected = df_1 Range('Sheet5', 'A1').value = df_expected cells = Range('Sheet5', 'B1:C5').value df_result = DataFrame(cells[1:], columns=cells[0]) assert_frame_equal(df_expected, df_result) def test_dataframe_2(self): """ Covers GH Issue #31""" _skip_if_no_pandas() df_expected = df_2 Range('Sheet5', 'A9').value = df_expected cells = Range('Sheet5', 'B9:B15').value df_result = DataFrame(cells[1:], columns=[cells[0]]) assert_frame_equal(df_expected, df_result) def test_dataframe_multiindex(self): _skip_if_no_pandas() df_expected = df_multiindex Range('Sheet5', 'A20').value = df_expected cells = Range('Sheet5', 'D20').table.value multiindex = Range('Sheet5', 'A20:C28').value ix = pd.MultiIndex.from_tuples(multiindex[1:], names=multiindex[0]) df_result = DataFrame(cells[1:], columns=cells[0], index=ix) assert_frame_equal(df_expected, df_result) def test_dataframe_multiheader(self): _skip_if_no_pandas() df_expected = df_multiheader Range('Sheet5', 'A52').value = df_expected cells = Range('Sheet5', 'B52').table.value df_result = DataFrame(cells[2:], columns=pd.MultiIndex.from_arrays(cells[:2])) assert_frame_equal(df_expected, df_result) def test_dataframe_dateindex(self): _skip_if_no_pandas() df_expected = df_dateindex Range('Sheet5', 'A100').value = df_expected if sys.platform.startswith('win') and self.wb.xl_app.Version == '14.0': Range('Sheet5', 'A100').vertical.xl_range.NumberFormat = 'dd/mm/yyyy' # Hack for Excel 2010 bug, see GH #43 cells = Range('Sheet5', 'B100').table.value index = Range('Sheet5', 'A101').vertical.value df_result = DataFrame(cells[1:], index=index, columns=cells[0]) assert_frame_equal(df_expected, df_result) def test_series_1(self): _skip_if_no_pandas() series_expected = series_1 Range('Sheet5', 'A32').value = series_expected cells = Range('Sheet5', 'B32:B37').value series_result = Series(cells) assert_series_equal(series_expected, series_result) def test_timeseries_1(self): _skip_if_no_pandas() series_expected = timeseries_1 Range('Sheet5', 'A40').value = series_expected if sys.platform.startswith('win') and self.wb.xl_app.Version == '14.0': Range('Sheet5', 'A40').vertical.xl_range.NumberFormat = 'dd/mm/yyyy' # Hack for Excel 2010 bug, see GH #43 cells = Range('Sheet5', 'B40:B49').value date_index = Range('Sheet5', 'A40:A49').value series_result = Series(cells, index=date_index) assert_series_equal(series_expected, series_result) def test_none(self): """ Covers GH Issue #16""" # None Range('Sheet1', 'A7').value = None assert_equal(None, Range('Sheet1', 'A7').value) # List Range('Sheet1', 'A7').value = [None, None] assert_equal(None, Range('Sheet1', 'A7').horizontal.value) def test_scalar_nan(self): """Covers GH Issue #15""" _skip_if_no_numpy() Range('Sheet1', 'A20').value = np.nan assert_equal(None, Range('Sheet1', 'A20').value) def test_atleast_2d_scalar(self): """Covers GH Issue #53a""" Range('Sheet1', 'A50').value = 23 result = Range('Sheet1', 'A50', atleast_2d=True).value assert_equal([[23]], result) def test_atleast_2d_scalar_as_array(self): """Covers GH Issue #53b""" _skip_if_no_numpy() Range('Sheet1', 'A50').value = 23 result = Range('Sheet1', 'A50', atleast_2d=True, asarray=True).value assert_equal(np.array([[23]]), result) def test_column_width(self): Range('Sheet1', 'A1:B2').column_width = 10.0 result = Range('Sheet1', 'A1').column_width assert_equal(10.0, result) Range('Sheet1', 'A1:B2').value = 'ensure cells are used' Range('Sheet1', 'B2').column_width = 20.0 result = Range('Sheet1', 'A1:B2').column_width if sys.platform.startswith('win'): assert_equal(None, result) else: assert_equal(kw.missing_value, result) def test_row_height(self): Range('Sheet1', 'A1:B2').row_height = 15.0 result = Range('Sheet1', 'A1').row_height assert_equal(15.0, result) Range('Sheet1', 'A1:B2').value = 'ensure cells are used' Range('Sheet1', 'B2').row_height = 20.0 result = Range('Sheet1', 'A1:B2').row_height if sys.platform.startswith('win'): assert_equal(None, result) else: assert_equal(kw.missing_value, result) def test_width(self): """Width depends on default style text size, so do not test absolute widths""" Range('Sheet1', 'A1:D4').column_width = 10.0 result_before = Range('Sheet1', 'A1').width Range('Sheet1', 'A1:D4').column_width = 12.0 result_after = Range('Sheet1', 'A1').width assert_true(result_after > result_before) def test_height(self): Range('Sheet1', 'A1:D4').row_height = 60.0 result = Range('Sheet1', 'A1:D4').height assert_equal(240.0, result) def test_autofit_range(self): # TODO: compare col/row widths before/after - not implemented yet Range('Sheet1', 'A1:D4').value = 'test_string' Range('Sheet1', 'A1:D4').autofit() Range('Sheet1', 'A1:D4').autofit('r') Range('Sheet1', 'A1:D4').autofit('c') Range('Sheet1', 'A1:D4').autofit('rows') Range('Sheet1', 'A1:D4').autofit('columns') def test_autofit_col(self): # TODO: compare col/row widths before/after - not implemented yet Range('Sheet1', 'A1:D4').value = 'test_string' Range('Sheet1', 'A:D').autofit() Range('Sheet1', 'A:D').autofit('r') Range('Sheet1', 'A:D').autofit('c') Range('Sheet1', 'A:D').autofit('rows') Range('Sheet1', 'A:D').autofit('columns') def test_autofit_row(self): # TODO: compare col/row widths before/after - not implemented yet Range('Sheet1', 'A1:D4').value = 'test_string' Range('Sheet1', '1:1000000').autofit() Range('Sheet1', '1:1000000').autofit('r') Range('Sheet1', '1:1000000').autofit('c') Range('Sheet1', '1:1000000').autofit('rows') Range('Sheet1', '1:1000000').autofit('columns') def test_number_format_cell(self): format_string = "mm/dd/yy;@" Range('Sheet1', 'A1').number_format = format_string result = Range('Sheet1', 'A1').number_format assert_equal(format_string, result) def test_number_format_range(self): format_string = "mm/dd/yy;@" Range('Sheet1', 'A1:D4').number_format = format_string result = Range('Sheet1', 'A1:D4').number_format assert_equal(format_string, result) def test_get_address(self): res = Range((1,1),(3,3)).get_address() assert_equal(res, '$A$1:$C$3') res = Range((1,1),(3,3)).get_address(False) assert_equal(res, '$A1:$C3') res = Range((1,1),(3,3)).get_address(True, False) assert_equal(res, 'A$1:C$3') res = Range((1,1),(3,3)).get_address(False, False) assert_equal(res, 'A1:C3') res = Range((1,1),(3,3)).get_address(include_sheetname=True) assert_equal(res, 'Sheet1!$A$1:$C$3') res = Range('Sheet2', (1,1),(3,3)).get_address(include_sheetname=True) assert_equal(res, 'Sheet2!$A$1:$C$3') res = Range((1,1),(3,3)).get_address(external=True) assert_equal(res, '[test_range_1.xlsx]Sheet1!$A$1:$C$3') def test_hyperlink(self): address = 'www.xlwings.org' # Naked address Range('A1').add_hyperlink(address) assert_equal(Range('A1').value, address) hyperlink = Range('A1').hyperlink if not hyperlink.endswith('/'): hyperlink += '/' assert_equal(hyperlink, 'http://' + address + '/') # Address + FriendlyName Range('A2').add_hyperlink(address, 'test_link') assert_equal(Range('A2').value, 'test_link') hyperlink = Range('A2').hyperlink if not hyperlink.endswith('/'): hyperlink += '/' assert_equal(hyperlink, 'http://' + address + '/') def test_hyperlink_formula(self): Range('B10').formula = '=HYPERLINK("http://xlwings.org", "xlwings")' assert_equal(Range('B10').hyperlink, 'http://xlwings.org') def test_color(self): rgb = (30, 100, 200) Range('A1').color = rgb assert_equal(rgb, Range('A1').color) Range('A2').color = RgbColor.rgbAqua assert_equal((0, 255, 255), Range('A2').color) Range('A2').color = None assert_equal(Range('A2').color, None) Range('A1:D4').color = rgb assert_equal(rgb, Range('A1:D4').color) def test_size(self): assert_equal(Range('A1:C4').size, 12) def test_shape(self): assert_equal(Range('A1:C4').shape, (4, 3)) def test_len(self): assert_equal(len(Range('A1:C4')), 4) def test_iterator(self): Range('A20').value = [[1., 2.], [3., 4.]] l = [] for i in Range('A20:B21'): l.append(i.value) assert_equal(l, [1., 2., 3., 4.]) Range('Sheet2', 'A20').value = [[1., 2.], [3., 4.]] l = [] for i in Range('Sheet2', 'A20:B21'): l.append(i.value) assert_equal(l, [1., 2., 3., 4.]) def test_resize(self): r = Range('A1').resize(4, 5) assert_equal(r.shape, (4, 5)) r = Range('A1').resize(row_size=4) assert_equal(r.shape, (4, 1)) r = Range('A1:B4').resize(column_size=5) assert_equal(r.shape, (1, 5)) def test_offset(self): o = Range('A1:B3').offset(3, 4) assert_equal(o.get_address(), '$E$4:$F$6') o = Range('A1:B3').offset(row_offset=3) assert_equal(o.get_address(), '$A$4:$B$6') o = Range('A1:B3').offset(column_offset=4) assert_equal(o.get_address(), '$E$1:$F$3') def test_date(self): date_1 = date(2000, 12, 3) Range('X1').value = date_1 date_2 = Range('X1').value assert_equal(date_1, date(date_2.year, date_2.month, date_2.day)) def test_row(self): assert_equal(Range('B3:F5').row, 3) def test_column(self): assert_equal(Range('B3:F5').column, 2) def test_last_cell(self): assert_equal(Range('B3:F5').last_cell.row, 5) assert_equal(Range('B3:F5').last_cell.column, 6) def test_get_set_named_range(self): Range('A100').name = 'test1' assert_equal(Range('A100').name, 'test1') Range('A200:B204').name = 'test2' assert_equal(Range('A200:B204').name, 'test2') def test_integers(self): """Covers GH 227""" Range('A99').value = 2147483647 # max SInt32 assert_equal(Range('A99').value, 2147483647) Range('A100').value = 2147483648 # SInt32 < x < SInt64 assert_equal(Range('A100').value, 2147483648) Range('A101').value = 10000000000000000000 # long assert_equal(Range('A101').value, 10000000000000000000) def test_numpy_datetime(self): _skip_if_no_numpy() Range('A55').value = np.datetime64('2005-02-25T03:30Z') assert_equal(Range('A55').value, datetime(2005, 2, 25, 3, 30)) def test_dataframe_timezone(self): _skip_if_no_pandas() dt = np.datetime64(1434149887000, 'ms') ix = pd.DatetimeIndex(data=[dt], tz='GMT') df = pd.DataFrame(data=[1], index=ix, columns=['A']) Range('A1').value = df assert_equal(Range('A2').value, datetime(2015, 6, 12, 22, 58, 7)) def test_datetime_timezone(self): eastern = pytz.timezone('US/Eastern') dt_naive = datetime(2002, 10, 27, 6, 0, 0) dt_tz = eastern.localize(dt_naive) Range('F34').value = dt_tz assert_equal(Range('F34').value, dt_naive) class TestChart: def setUp(self): # Connect to test file and make Sheet1 the active sheet xl_file1 = os.path.join(os.path.dirname(os.path.abspath(__file__)), 'test_chart_1.xlsx') self.wb = Workbook(xl_file1, app_visible=False, app_target=APP_TARGET) Sheet('Sheet1').activate() def tearDown(self): class_teardown(self.wb) def test_add_keywords(self): name = 'My Chart' chart_type = ChartType.xlLine Range('A1').value = chart_data chart = Chart.add(chart_type=chart_type, name=name, source_data=Range('A1').table) chart_actual = Chart(name) name_actual = chart_actual.name chart_type_actual = chart_actual.chart_type assert_equal(name, name_actual) if sys.platform.startswith('win'): assert_equal(chart_type, chart_type_actual) else: assert_equal(kw.line_chart, chart_type_actual) def test_add_properties(self): name = 'My Chart' chart_type = ChartType.xlLine Range('Sheet2', 'A1').value = chart_data chart = Chart.add('Sheet2') chart.chart_type = chart_type chart.name = name chart.set_source_data(Range('Sheet2', 'A1').table) chart_actual = Chart('Sheet2', name) name_actual = chart_actual.name chart_type_actual = chart_actual.chart_type assert_equal(name, name_actual) if sys.platform.startswith('win'): assert_equal(chart_type, chart_type_actual) else: assert_equal(kw.line_chart, chart_type_actual) if __name__ == '__main__': nose.main()
apache-2.0
8,551,476,815,334,439,000
33.782341
142
0.574001
false
3.208144
true
false
false
Zomboided/VPN-Manager
resetVPN.py
1
4136
#!/usr/bin/python # -*- coding: utf-8 -*- # # Copyright (C) 2016 Zomboided # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # # This module resets all VPN connections import xbmcgui import xbmcaddon from libs.common import resetVPNConnections, stopService, startService, DIALOG_SPEED, getVPNRequestedProfile, setAPICommand from libs.utility import debugTrace, errorTrace, infoTrace, newPrint, getID, getName debugTrace("-- Entered resetVPN.py --") if not getID() == "": # Get info about the addon that this script is pretending to be attached to addon = xbmcaddon.Addon(getID()) addon_name = getName() success = True # Reset the VPN connection values stored in the settings.xml if xbmcgui.Dialog().yesno(addon_name, "Updating the VPN settings will reset all VPN connections. Connections must be re-validated before use.\nContinue?"): # Display dialog to show what's going on progress = xbmcgui.DialogProgress() progress_title = "Resetting VPN connections" progress.create(addon_name,progress_title) if not getVPNRequestedProfile() == "": progress.close() xbmcgui.Dialog().ok(addon_name, "Connection to VPN being attempted and will be aborted. Try again in a few seconds.") setAPICommand("Disconnect") success = False if success: # Stop the VPN monitor xbmc.sleep(100) progress.update(0, progress_title, "Pausing VPN monitor...") xbmc.sleep(100) if not stopService(): progress.close() # Display error result in an ok dialog errorTrace("resetVPN.py", "VPN monitor service is not running, can't reset VPNs") xbmcgui.Dialog().ok(progress_title, "Error, Service not running. Check log and re-enable.") success = False # Disconnect and reset all connections if success: progress.update(20, progress_title, "VPN monitor paused") xbmc.sleep(DIALOG_SPEED) progress.update(40, progress_title, "Stopping any active VPN connection...") xbmc.sleep(100) resetVPNConnections(addon) # Reset any validated values addon.setSetting("vpn_provider_validated", "") addon.setSetting("vpn_username_validated", "") addon.setSetting("vpn_password_validated", "") # Restart the VPN monitor if success: progress.update(60, progress_title, "VPN connections have been reset") xbmc.sleep(DIALOG_SPEED) progress.update(80, progress_title, "Restarting VPN monitor...") xbmc.sleep(100) if not startService(): progress.close() errorTrace("resetVPN.py", "VPN monitor service is not running, connections have been reset") xbmcgui.Dialog().ok(progress_title, "Error, cannot restart service. Check log and re-enable.") success = False else: # Close out the final progress dialog progress.update(100, progress_title, "VPN monitor restarted") xbmc.sleep(DIALOG_SPEED) progress.close() command = "Addon.OpenSettings(" + getID() + ")" xbmc.executebuiltin(command) else: errorTrace("resetVPN.py", "VPN service is not ready") debugTrace("-- Exit resetVPN.py --")
gpl-2.0
245,625,491,115,489,120
43.010638
160
0.629594
false
4.358272
false
false
false
jskDr/keraspp
old/gan_cnn_mse.py
1
6490
################################ # 공통 패키지 불러오기 ################################ from keras.datasets import mnist import numpy as np from PIL import Image import math import os import keras.backend as K K.set_image_data_format('channels_first') print(K.image_data_format) ################################ # GAN 모델링 ################################ from keras import models, layers, optimizers def mean_squared_error(y_true, y_pred): return K.mean(K.square(y_pred - y_true), axis=(1,2,3)) class GAN(models.Sequential): def __init__(self, input_dim=64): """ self, self.generator, self.discriminator are all models """ super().__init__() self.input_dim = input_dim self.generator = self.GENERATOR() self.discriminator = self.DISCRIMINATOR() self.add(self.generator) self.discriminator.trainable = False self.add(self.discriminator) self.compile_all() def compile_all(self): # Compiling stage d_optim = optimizers.SGD(lr=0.0005, momentum=0.9, nesterov=True) g_optim = optimizers.SGD(lr=0.0005, momentum=0.9, nesterov=True) self.generator.compile(loss=mean_squared_error, optimizer="SGD") self.compile(loss='binary_crossentropy', optimizer=g_optim) self.discriminator.trainable = True self.discriminator.compile(loss='binary_crossentropy', optimizer=d_optim) def GENERATOR(self): input_dim = self.input_dim model = models.Sequential() model.add(layers.Dense(1024, activation='tanh', input_dim=input_dim)) model.add(layers.Dense(128 * 7 * 7, activation='tanh')) model.add(layers.BatchNormalization()) model.add(layers.Reshape((128, 7, 7), input_shape=(128 * 7 * 7,))) model.add(layers.UpSampling2D(size=(2, 2))) model.add(layers.Conv2D(64, (5, 5), padding='same', activation='tanh')) model.add(layers.UpSampling2D(size=(2, 2))) model.add(layers.Conv2D(1, (5, 5), padding='same', activation='tanh')) return model def DISCRIMINATOR(self): model = models.Sequential() model.add(layers.Conv2D(64, (5, 5), padding='same', activation='tanh', input_shape=(1, 28, 28))) model.add(layers.MaxPooling2D(pool_size=(2, 2))) model.add(layers.Conv2D(128, (5, 5), activation='tanh')) model.add(layers.MaxPooling2D(pool_size=(2, 2))) model.add(layers.Flatten()) model.add(layers.Dense(1024, activation='tanh')) model.add(layers.Dense(1, activation='sigmoid')) return model def get_z(self, ln): input_dim = self.input_dim return np.random.uniform(-1, 1, (ln, input_dim)) def train_both(self, x): ln = x.shape[0] # First trial for training discriminator z = self.get_z(ln) w = self.generator.predict(z, verbose=0) xw = np.concatenate((x, w)) y2 = [1] * ln + [0] * ln d_loss = self.discriminator.train_on_batch(xw, y2) # Second trial for training generator z = self.get_z(ln) self.discriminator.trainable = False g_loss = self.train_on_batch(z, [1] * ln) self.discriminator.trainable = True return d_loss, g_loss ################################ # GAN 학습하기 ################################ def combine_images(generated_images): num = generated_images.shape[0] width = int(math.sqrt(num)) height = int(math.ceil(float(num) / width)) shape = generated_images.shape[2:] image = np.zeros((height * shape[0], width * shape[1]), dtype=generated_images.dtype) for index, img in enumerate(generated_images): i = int(index / width) j = index % width image[i * shape[0]:(i + 1) * shape[0], j * shape[1]:(j + 1) * shape[1]] = img[0, :, :] return image def get_x(X_train, index, BATCH_SIZE): return X_train[index * BATCH_SIZE:(index + 1) * BATCH_SIZE] def save_images(generated_images, output_fold, epoch, index): image = combine_images(generated_images) image = image * 127.5 + 127.5 Image.fromarray(image.astype(np.uint8)).save( output_fold + '/' + str(epoch) + "_" + str(index) + ".png") def load_data(): (X_train, y_train), (_, _) = mnist.load_data() return X_train[:10] def train(args): BATCH_SIZE = args.batch_size epochs = args.epochs output_fold = args.output_fold input_dim = args.input_dim os.makedirs(output_fold, exist_ok=True) print('Output_fold is', output_fold) X_train = load_data() X_train = (X_train.astype(np.float32) - 127.5) / 127.5 X_train = X_train.reshape((X_train.shape[0], 1) + X_train.shape[1:]) gan = GAN(input_dim) d_loss_ll = [] g_loss_ll = [] for epoch in range(epochs): print("Epoch is", epoch) print("Number of batches", int(X_train.shape[0] / BATCH_SIZE)) d_loss_l = [] g_loss_l = [] for index in range(int(X_train.shape[0] / BATCH_SIZE)): x = get_x(X_train, index, BATCH_SIZE) d_loss, g_loss = gan.train_both(x) d_loss_l.append(d_loss) g_loss_l.append(g_loss) if epoch % 10 == 0 or epoch == epochs - 1: z = gan.get_z(x.shape[0]) w = gan.generator.predict(z, verbose=0) save_images(w, output_fold, epoch, 0) d_loss_ll.append(d_loss_l) g_loss_ll.append(g_loss_l) gan.generator.save_weights(output_fold + '/' + 'generator', True) gan.discriminator.save_weights(output_fold + '/' + 'discriminator', True) np.savetxt(output_fold + '/' + 'd_loss', d_loss_ll) np.savetxt(output_fold + '/' + 'g_loss', g_loss_ll) ################################ # GAN 예제 실행하기 ################################ import argparse def main(): parser = argparse.ArgumentParser() parser.add_argument('--batch_size', type=int, default=2, help='Batch size for the networks') parser.add_argument('--epochs', type=int, default=1000, help='Epochs for the networks') parser.add_argument('--output_fold', type=str, default='GAN_OUT', help='Output fold to save the results') parser.add_argument('--input_dim', type=int, default=2, help='Input dimension for the generator.') args = parser.parse_args() train(args) if __name__ == '__main__': main()
mit
1,528,142,904,994,182,000
30.758621
81
0.57431
false
3.25063
false
false
false
StrongBoy998/ihome-project
Tornado_Project/utils/image_storage.py
1
1089
# -*- coding: utf-8 -*- import qiniu.config import logging from qiniu import Auth, put_data, etag, urlsafe_base64_encode #需要填写你的 Access Key 和 Secret Key access_key = 'btZDjv_qjI4O1P5-KKeaZXBGLJcM-AZfigN8HjQf' secret_key = 'j2Sgq1Pz-1O90OoFSKr24Xa80mVWqzpqbo-byiN5' #要上传的空间 bucket_name = 'ihome' def storage(data): """ 七牛云存储上传文件接口 """ if not data: return None try: #构建鉴权对象 q = Auth(access_key, secret_key) #生成上传 Token,可以指定过期时间等 token = q.upload_token(bucket_name) ret, info = put_data(token, None, data) except Exception as e: logging.error(e) raise Exception("上传文件到七牛错误") if info and info.status_code != 200: raise Exception("上传文件到七牛错误") return ret["key"] if __name__ == '__main__': file_name = raw_input("输入上传的文件") file = open(file_name, 'rb') data = file.read() key = storage(data) print key file.close()
apache-2.0
-76,605,809,266,359,420
18.408163
61
0.615142
false
2.389447
false
false
false
fapable/pygameproject2
Menu/Opties.py
1
1096
import pygame import Game as dm def opties(): pygame.mixer.music.load("music.mp3") pygame.mixer.music.play(loops=0, start=0.0) size = width, height = 340,240 screen = pygame.display.set_mode(size) redSquare = pygame.image.load('achtergrondSpelers.png').convert() white = (255,255,255) w = 700 h = 420 screen = pygame.display.set_mode((w, h)) screen.fill((white)) x = 0 y = 0 screen.blit(redSquare, (x, y)) pygame.display.flip() black = (0,0,0) pygame.mixer.music.load("music.mp3") pygame.mixer.music.play(loops=0, start=0.0) choose = dm.dumbmenu(screen,[ 'Geluid uit', 'Taal wijzigen -> Engels', 'Terug naar het menu'] , 180,150,None,35,1.4,black ,black) if choose == 0: print ("Je hebt gekozen voor Geluid uit'.") elif choose == 1: print ("Je hebt gekozen voor Taal wijzigen naar het engels''.") elif choose == 2: print( "Je hebt gekozen voor Terug naar het men'.")
apache-2.0
-6,016,865,642,873,361,000
27.102564
71
0.556569
false
3.140401
false
false
false
OnroerendErfgoed/pyramid_urireferencer
tests/test_renderers.py
1
2787
# -*- coding: utf-8 -*- from pyramid_urireferencer.models import ( RegistryResponse, ApplicationResponse, Item ) class TestRenderers: def test_empty_registry_renderer(self): rr = RegistryResponse('http://id.example.org/foo/1', True, False, 0, []) from pyramid_urireferencer.renderers import registry_adapter r = registry_adapter(rr, {}) assert r['query_uri'] == 'http://id.example.org/foo/1' assert r['success'] assert not r['has_references'] assert r['count'] == 0 assert len(r['applications']) == 0 def test_registry_renderer_one_app_no_results(self): ar = ApplicationResponse( 'My app', 'http://something.example.org', 'http://somethingelse.example.org', True, False, 0, [] ) rr = RegistryResponse('http://id.example.org/foo/1', True, False, 0, [ar]) from pyramid_urireferencer.renderers import registry_adapter r = registry_adapter(rr, {}) assert r['query_uri'] == 'http://id.example.org/foo/1' assert r['success'] assert not r['has_references'] assert r['count'] == 0 assert len(r['applications']) == 1 assert 'title' in r['applications'][0] def test_empty_application_renderer(self): ar = ApplicationResponse( 'My app', 'http://something.example.org', 'http://somethingelse.example.org/references', True, False, 0, [] ) from pyramid_urireferencer.renderers import application_adapter r = application_adapter(ar, {}) assert r['uri'] == 'http://something.example.org' assert r['service_url'] == 'http://somethingelse.example.org/references' assert r['success'] assert not r['has_references'] assert r['count'] == 0 assert len(r['items']) == 0 def test_application_renderer_one_item(self): ar = ApplicationResponse( 'My app', 'http://something.example.org', 'http://somethingelse.example.org/references', True, False, 0, [Item('http://something.example.org/thingy/thing', 'My item')] ) from pyramid_urireferencer.renderers import application_adapter r = application_adapter(ar, {}) assert r['uri'] == 'http://something.example.org' assert r['service_url'] == 'http://somethingelse.example.org/references' assert r['success'] assert not r['has_references'] assert r['count'] == 0 assert len(r['items']) == 1 assert 'title' in r['items'][0] assert 'uri' in r['items'][0]
mit
6,088,043,973,341,636,000
33.8375
82
0.558306
false
3.936441
false
false
false
torehc/sinucha
web/sinucha/control/models.py
1
5334
from django.db import models from django.contrib.auth.models import User import datetime from django.db.models.signals import post_save from django.dispatch import receiver class User_Data(models.Model): USER = 'user' ADMIN = 'admin' ROL_CHOICES = ( (USER, 'USER'), (ADMIN, 'ADMIN'), ) tagRfid = models.CharField(max_length=64, blank=False) chatid = models.DecimalField(max_digits=12, decimal_places=0) balance_actual = models.DecimalField(max_digits=5, decimal_places=2, default=0) username = models.CharField(max_length=20, blank=True) user = models.ForeignKey(User, null=True, blank=True) rol = models.CharField(max_length=5, choices=ROL_CHOICES, default=USER, blank=False, ) def __str__(self): return '{}'.format(self.username) @staticmethod def check_user_chatid(chatid): if (User_Data.objects.filter(chatid=chatid)): return True else: return False @staticmethod def register_user(chatid, rfid): if(User_Data.check_user_chatid(chatid)): return False else: create_user = User_Data.objects.create( tagRfid = rfid, chatid = chatid, ) return True @staticmethod def check_user_balance(rfid,barcode): user = User_Data.objects.get(tagRfid=rfid) item = Item.objects.get(barcode=barcode) if(user.balance_actual >= item.price_sale): user.balance_actual -= item.price_sale user.save() item.stock = (item.stock)-1 item.save() Sale_History.create_sale(item,user) return True else: return False class Balance(models.Model): CASH = 'cash' PAYPAL = 'PayPal' TYPE_PAYMENT = ( (CASH, 'CASH'), (PAYPAL, 'PAYPAL'), ) user = models.ForeignKey(User_Data, blank=False) amount_entered = models.DecimalField(max_digits=5, decimal_places=2, default=0, blank=False) type_amount = models.CharField(max_length=6, choices=TYPE_PAYMENT, default=CASH, blank=False, ) date = models.DateTimeField( default=datetime.datetime.now() ) def __str__(self): return '{}: +{}'.format(self.user, self.amount_entered) class Item(models.Model): name = models.CharField(max_length=30, blank=False) barcode = models.CharField(max_length=30, blank=False) price_sale = models.DecimalField(max_digits=5, decimal_places=2, default=0) stock = models.IntegerField(blank=False, default=0) def __str__(self): return '{}'.format(self.name) class Shopping_History(models.Model): MERCADONA = 'mercadona' LIDL = 'lidl' OTRO = 'otro' TYPE_SUPERMARKET = ( (MERCADONA, 'MERCADONA'), (LIDL, 'LIDL'), (OTRO, 'OTRO'), ) item = models.ForeignKey(Item, blank=False) date = models.DateTimeField( default=datetime.datetime.now() ) units = models.IntegerField(default=0) unit_purchase_price = models.DecimalField(max_digits=5, decimal_places=2, default=0) supermarket = models.CharField(max_length=9, choices=TYPE_SUPERMARKET, default=OTRO, blank=False, ) def __str__(self): return '{} - {}'.format(self.item, self.date) class Sale_History(models.Model): item = models.ForeignKey(Item, blank=False) user = models.ForeignKey(User_Data, blank=False) date = models.DateTimeField( default=datetime.datetime.now() ) price_sale = models.DecimalField(max_digits=5, decimal_places=2, default=0) price_cost = models.DecimalField(max_digits=5, decimal_places=2, default=0) def __str__(self): return '{}: {} - {}'.format(self.item, self.user, self.price_sale) @staticmethod def create_sale(item,user): bought_item = Shopping_History.objects.filter(item=item).last() create_sale = Sale_History.objects.create( item=item, user=user, price_sale=item.price_sale, price_cost=bought_item.unit_purchase_price, ) @receiver(post_save, sender=Shopping_History, dispatch_uid="create_stock_item") def create_stock(sender, instance, **kwargs): object_product = Item.objects.get(id=instance.item.id) object_product.stock += instance.units object_product.save() @receiver(post_save, sender=Balance, dispatch_uid="add_payment_user") def update_user_balance(sender, instance, **kwargs): user = User_Data.objects.get(id=instance.user.id) user.balance_actual += instance.amount_entered user.save() #import pdb; pdb.set_trace()
gpl-3.0
2,278,878,880,838,755,800
30.382353
96
0.553056
false
3.939439
false
false
false
joequant/pyswagger
pyswagger/tests/v2_0/test_circular.py
1
3163
from pyswagger import SwaggerApp, utils, primitives, errs from ..utils import get_test_data_folder from ...scanner import CycleDetector from ...scan import Scanner import unittest import os import six class CircularRefTestCase(unittest.TestCase): """ test for circular reference guard """ def test_path_item_prepare_with_cycle(self): app = SwaggerApp.load(get_test_data_folder( version='2.0', which=os.path.join('circular', 'path_item') )) # should raise nothing app.prepare() def test_path_item(self): folder = get_test_data_folder( version='2.0', which=os.path.join('circular', 'path_item') ) def _pf(s): return six.moves.urllib.parse.urlunparse(( 'file', '', folder, '', '', s)) app = SwaggerApp.create(folder) s = Scanner(app) c = CycleDetector() s.scan(root=app.raw, route=[c]) self.assertEqual(sorted(c.cycles['path_item']), sorted([[ _pf('/paths/~1p1'), _pf('/paths/~1p2'), _pf('/paths/~1p3'), _pf('/paths/~1p4'), _pf('/paths/~1p1') ]])) def test_schema(self): folder = get_test_data_folder( version='2.0', which=os.path.join('circular', 'schema') ) def _pf(s): return six.moves.urllib.parse.urlunparse(( 'file', '', folder, '', '', s)) app = SwaggerApp.load(folder) app.prepare(strict=False) s = Scanner(app) c = CycleDetector() s.scan(root=app.raw, route=[c]) self.maxDiff = None self.assertEqual(sorted(c.cycles['schema']), sorted([ [_pf('/definitions/s10'), _pf('/definitions/s11'), _pf('/definitions/s9'), _pf('/definitions/s10')], [_pf('/definitions/s5'), _pf('/definitions/s5')], [_pf('/definitions/s1'), _pf('/definitions/s2'), _pf('/definitions/s3'), _pf('/definitions/s4'), _pf('/definitions/s1')], [_pf('/definitions/s12'), _pf('/definitions/s13'), _pf('/definitions/s12')], [_pf('/definitions/s6'), _pf('/definitions/s7'), _pf('/definitions/s6')], [_pf('/definitions/s14'), _pf('/definitions/s15'), _pf('/definitions/s14')] ])) def test_deref(self): app = SwaggerApp.create(get_test_data_folder( version='2.0', which=os.path.join('circular', 'schema'), ), strict=False ) s = app.resolve('#/definitions/s1') self.assertRaises(errs.CycleDetectionError, utils.deref, s) def test_primfactory(self): app = SwaggerApp.create(get_test_data_folder( version='2.0', which=os.path.join('circular', 'schema'), ), strict=False ) s = app.resolve('#/definitions/s1') self.assertRaises(errs.CycleDetectionError, app.prim_factory.produce, s, {})
mit
7,400,816,715,443,850,000
30.009804
133
0.510907
false
3.824667
true
false
false
rocktavious/DevToolsLib
DTL/api/bases.py
1
3894
import inspect #------------------------------------------------------------ #------------------------------------------------------------ class BaseStruct(object): #------------------------------------------------------------ def __init__(self, *args, **kwds): self.deserialize(*args, **kwds) #------------------------------------------------------------ def _get_repr_format(self): return r'{0}({1})'.format(type(self).__name__, self._get_init_params_format()) #------------------------------------------------------------ def _get_init_params_format(self): param_format = '' params = inspect.getargspec(self.deserialize)[0] params_count = len(params[1:]) for i in range(params_count): param_format += '{0}='.format(params[i+1]) +'{'+str(i)+'}' if i != params_count-1: param_format += ', ' return param_format #------------------------------------------------------------ def _get_repr(self): try: return self._get_repr_format().format(*self.serialize()) except: return r'{0}({1})'.format(type(self).__name__, self.serialize()) #------------------------------------------------------------ def __str__(self): return self._get_repr() #------------------------------------------------------------ def __repr__(self): return self._get_repr() #------------------------------------------------------------ def __eq__(self, other): if isinstance(other, type(self)) : return self.serialize() == other.serialize() else: try: coerced = self.__class__() coerced.deserialize(other) except: return False return self == coerced #------------------------------------------------------------ def __ne__(self, other): return not self.__eq__(other) #------------------------------------------------------------ def add_quotes(self, data): '''Convenience method to help in serialization of strings''' return r"r'{0}'".format(data) #------------------------------------------------------------ def serialize(self): '''Returns the arg list in which deserialize can recreate this object''' return (None,) #------------------------------------------------------------ def deserialize(self, *args, **kwds): '''If provided the info from serialize, this should should beable to construct the object deserialize must provide all of the args for the spec because the format is pulled from this function''' pass #------------------------------------------------------------ #------------------------------------------------------------ class BaseDict(BaseStruct, dict): #------------------------------------------------------------ def __init__(self, *args, **kwds): super(BaseDict, self).__init__(*args, **kwds) #------------------------------------------------------------ def _set_data(self, datadict): for key, value in datadict.items(): self.__setitem__(key, value) #------------------------------------------------------------ def set_default(self, default={}): '''Allows the user to specify default values that should appear in the data''' for key, value in default.items(): if not self.has_key(key): self.__setitem__(key, eval(value)) #------------------------------------------------------------ def serialize(self): return (dict(self),) #------------------------------------------------------------ def deserialize(self, datadict={}): self._set_data(datadict=datadict)
mit
-2,309,170,053,516,535,000
38.734694
112
0.362866
false
5.760355
false
false
false
aristanetworks/arista-ovs-nova
nova/utils.py
1
38397
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2010 United States Government as represented by the # Administrator of the National Aeronautics and Space Administration. # Copyright 2011 Justin Santa Barbara # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """Utilities and helper functions.""" import contextlib import datetime import errno import functools import hashlib import inspect import os import pyclbr import random import re import shlex import shutil import signal import socket import struct import sys import tempfile import time import weakref from xml.sax import saxutils from eventlet import event from eventlet.green import subprocess from eventlet import greenthread from eventlet import semaphore import netaddr from nova import exception from nova.openstack.common import cfg from nova.openstack.common import excutils from nova.openstack.common import importutils from nova.openstack.common import log as logging from nova.openstack.common import timeutils LOG = logging.getLogger(__name__) CONF = cfg.CONF CONF.register_opt( cfg.BoolOpt('disable_process_locking', default=False, help='Whether to disable inter-process locks')) CONF.import_opt('glance_host', 'nova.config') CONF.import_opt('glance_port', 'nova.config') CONF.import_opt('glance_protocol', 'nova.config') CONF.import_opt('instance_usage_audit_period', 'nova.config') CONF.import_opt('monkey_patch', 'nova.config') CONF.import_opt('rootwrap_config', 'nova.config') CONF.import_opt('service_down_time', 'nova.config') # Used for looking up extensions of text # to their 'multiplied' byte amount BYTE_MULTIPLIERS = { '': 1, 't': 1024 ** 4, 'g': 1024 ** 3, 'm': 1024 ** 2, 'k': 1024, } def vpn_ping(address, port, timeout=0.05, session_id=None): """Sends a vpn negotiation packet and returns the server session. Returns False on a failure. Basic packet structure is below. Client packet (14 bytes):: 0 1 8 9 13 +-+--------+-----+ |x| cli_id |?????| +-+--------+-----+ x = packet identifier 0x38 cli_id = 64 bit identifier ? = unknown, probably flags/padding Server packet (26 bytes):: 0 1 8 9 13 14 21 2225 +-+--------+-----+--------+----+ |x| srv_id |?????| cli_id |????| +-+--------+-----+--------+----+ x = packet identifier 0x40 cli_id = 64 bit identifier ? = unknown, probably flags/padding bit 9 was 1 and the rest were 0 in testing """ if session_id is None: session_id = random.randint(0, 0xffffffffffffffff) sock = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) data = struct.pack('!BQxxxxx', 0x38, session_id) sock.sendto(data, (address, port)) sock.settimeout(timeout) try: received = sock.recv(2048) except socket.timeout: return False finally: sock.close() fmt = '!BQxxxxxQxxxx' if len(received) != struct.calcsize(fmt): print struct.calcsize(fmt) return False (identifier, server_sess, client_sess) = struct.unpack(fmt, received) if identifier == 0x40 and client_sess == session_id: return server_sess def _subprocess_setup(): # Python installs a SIGPIPE handler by default. This is usually not what # non-Python subprocesses expect. signal.signal(signal.SIGPIPE, signal.SIG_DFL) def execute(*cmd, **kwargs): """Helper method to execute command with optional retry. If you add a run_as_root=True command, don't forget to add the corresponding filter to etc/nova/rootwrap.d ! :param cmd: Passed to subprocess.Popen. :param process_input: Send to opened process. :param check_exit_code: Single bool, int, or list of allowed exit codes. Defaults to [0]. Raise exception.ProcessExecutionError unless program exits with one of these code. :param delay_on_retry: True | False. Defaults to True. If set to True, wait a short amount of time before retrying. :param attempts: How many times to retry cmd. :param run_as_root: True | False. Defaults to False. If set to True, the command is run with rootwrap. :raises exception.NovaException: on receiving unknown arguments :raises exception.ProcessExecutionError: :returns: a tuple, (stdout, stderr) from the spawned process, or None if the command fails. """ process_input = kwargs.pop('process_input', None) check_exit_code = kwargs.pop('check_exit_code', [0]) ignore_exit_code = False if isinstance(check_exit_code, bool): ignore_exit_code = not check_exit_code check_exit_code = [0] elif isinstance(check_exit_code, int): check_exit_code = [check_exit_code] delay_on_retry = kwargs.pop('delay_on_retry', True) attempts = kwargs.pop('attempts', 1) run_as_root = kwargs.pop('run_as_root', False) shell = kwargs.pop('shell', False) if len(kwargs): raise exception.NovaException(_('Got unknown keyword args ' 'to utils.execute: %r') % kwargs) if run_as_root and os.geteuid() != 0: cmd = ['sudo', 'nova-rootwrap', CONF.rootwrap_config] + list(cmd) cmd = map(str, cmd) while attempts > 0: attempts -= 1 try: LOG.debug(_('Running cmd (subprocess): %s'), ' '.join(cmd)) _PIPE = subprocess.PIPE # pylint: disable=E1101 if os.name == 'nt': preexec_fn = None close_fds = False else: preexec_fn = _subprocess_setup close_fds = True obj = subprocess.Popen(cmd, stdin=_PIPE, stdout=_PIPE, stderr=_PIPE, close_fds=close_fds, preexec_fn=preexec_fn, shell=shell) result = None if process_input is not None: result = obj.communicate(process_input) else: result = obj.communicate() obj.stdin.close() # pylint: disable=E1101 _returncode = obj.returncode # pylint: disable=E1101 LOG.debug(_('Result was %s') % _returncode) if not ignore_exit_code and _returncode not in check_exit_code: (stdout, stderr) = result raise exception.ProcessExecutionError( exit_code=_returncode, stdout=stdout, stderr=stderr, cmd=' '.join(cmd)) return result except exception.ProcessExecutionError: if not attempts: raise else: LOG.debug(_('%r failed. Retrying.'), cmd) if delay_on_retry: greenthread.sleep(random.randint(20, 200) / 100.0) finally: # NOTE(termie): this appears to be necessary to let the subprocess # call clean something up in between calls, without # it two execute calls in a row hangs the second one greenthread.sleep(0) def trycmd(*args, **kwargs): """ A wrapper around execute() to more easily handle warnings and errors. Returns an (out, err) tuple of strings containing the output of the command's stdout and stderr. If 'err' is not empty then the command can be considered to have failed. :discard_warnings True | False. Defaults to False. If set to True, then for succeeding commands, stderr is cleared """ discard_warnings = kwargs.pop('discard_warnings', False) try: out, err = execute(*args, **kwargs) failed = False except exception.ProcessExecutionError, exn: out, err = '', str(exn) failed = True if not failed and discard_warnings and err: # Handle commands that output to stderr but otherwise succeed err = '' return out, err def ssh_execute(ssh, cmd, process_input=None, addl_env=None, check_exit_code=True): LOG.debug(_('Running cmd (SSH): %s'), cmd) if addl_env: raise exception.NovaException(_('Environment not supported over SSH')) if process_input: # This is (probably) fixable if we need it... msg = _('process_input not supported over SSH') raise exception.NovaException(msg) stdin_stream, stdout_stream, stderr_stream = ssh.exec_command(cmd) channel = stdout_stream.channel #stdin.write('process_input would go here') #stdin.flush() # NOTE(justinsb): This seems suspicious... # ...other SSH clients have buffering issues with this approach stdout = stdout_stream.read() stderr = stderr_stream.read() stdin_stream.close() exit_status = channel.recv_exit_status() # exit_status == -1 if no exit code was returned if exit_status != -1: LOG.debug(_('Result was %s') % exit_status) if check_exit_code and exit_status != 0: raise exception.ProcessExecutionError(exit_code=exit_status, stdout=stdout, stderr=stderr, cmd=cmd) return (stdout, stderr) def novadir(): import nova return os.path.abspath(nova.__file__).split('nova/__init__.py')[0] def debug(arg): LOG.debug(_('debug in callback: %s'), arg) return arg def generate_uid(topic, size=8): characters = '01234567890abcdefghijklmnopqrstuvwxyz' choices = [random.choice(characters) for _x in xrange(size)] return '%s-%s' % (topic, ''.join(choices)) # Default symbols to use for passwords. Avoids visually confusing characters. # ~6 bits per symbol DEFAULT_PASSWORD_SYMBOLS = ('23456789', # Removed: 0,1 'ABCDEFGHJKLMNPQRSTUVWXYZ', # Removed: I, O 'abcdefghijkmnopqrstuvwxyz') # Removed: l # ~5 bits per symbol EASIER_PASSWORD_SYMBOLS = ('23456789', # Removed: 0, 1 'ABCDEFGHJKLMNPQRSTUVWXYZ') # Removed: I, O def last_completed_audit_period(unit=None, before=None): """This method gives you the most recently *completed* audit period. arguments: units: string, one of 'hour', 'day', 'month', 'year' Periods normally begin at the beginning (UTC) of the period unit (So a 'day' period begins at midnight UTC, a 'month' unit on the 1st, a 'year' on Jan, 1) unit string may be appended with an optional offset like so: 'day@18' This will begin the period at 18:00 UTC. 'month@15' starts a monthly period on the 15th, and year@3 begins a yearly one on March 1st. before: Give the audit period most recently completed before <timestamp>. Defaults to now. returns: 2 tuple of datetimes (begin, end) The begin timestamp of this audit period is the same as the end of the previous.""" if not unit: unit = CONF.instance_usage_audit_period offset = 0 if '@' in unit: unit, offset = unit.split("@", 1) offset = int(offset) if before is not None: rightnow = before else: rightnow = timeutils.utcnow() if unit not in ('month', 'day', 'year', 'hour'): raise ValueError('Time period must be hour, day, month or year') if unit == 'month': if offset == 0: offset = 1 end = datetime.datetime(day=offset, month=rightnow.month, year=rightnow.year) if end >= rightnow: year = rightnow.year if 1 >= rightnow.month: year -= 1 month = 12 + (rightnow.month - 1) else: month = rightnow.month - 1 end = datetime.datetime(day=offset, month=month, year=year) year = end.year if 1 >= end.month: year -= 1 month = 12 + (end.month - 1) else: month = end.month - 1 begin = datetime.datetime(day=offset, month=month, year=year) elif unit == 'year': if offset == 0: offset = 1 end = datetime.datetime(day=1, month=offset, year=rightnow.year) if end >= rightnow: end = datetime.datetime(day=1, month=offset, year=rightnow.year - 1) begin = datetime.datetime(day=1, month=offset, year=rightnow.year - 2) else: begin = datetime.datetime(day=1, month=offset, year=rightnow.year - 1) elif unit == 'day': end = datetime.datetime(hour=offset, day=rightnow.day, month=rightnow.month, year=rightnow.year) if end >= rightnow: end = end - datetime.timedelta(days=1) begin = end - datetime.timedelta(days=1) elif unit == 'hour': end = rightnow.replace(minute=offset, second=0, microsecond=0) if end >= rightnow: end = end - datetime.timedelta(hours=1) begin = end - datetime.timedelta(hours=1) return (begin, end) def generate_password(length=20, symbolgroups=DEFAULT_PASSWORD_SYMBOLS): """Generate a random password from the supplied symbol groups. At least one symbol from each group will be included. Unpredictable results if length is less than the number of symbol groups. Believed to be reasonably secure (with a reasonable password length!) """ r = random.SystemRandom() # NOTE(jerdfelt): Some password policies require at least one character # from each group of symbols, so start off with one random character # from each symbol group password = [r.choice(s) for s in symbolgroups] # If length < len(symbolgroups), the leading characters will only # be from the first length groups. Try our best to not be predictable # by shuffling and then truncating. r.shuffle(password) password = password[:length] length -= len(password) # then fill with random characters from all symbol groups symbols = ''.join(symbolgroups) password.extend([r.choice(symbols) for _i in xrange(length)]) # finally shuffle to ensure first x characters aren't from a # predictable group r.shuffle(password) return ''.join(password) def last_octet(address): return int(address.split('.')[-1]) def get_my_linklocal(interface): try: if_str = execute('ip', '-f', 'inet6', '-o', 'addr', 'show', interface) condition = '\s+inet6\s+([0-9a-f:]+)/\d+\s+scope\s+link' links = [re.search(condition, x) for x in if_str[0].split('\n')] address = [w.group(1) for w in links if w is not None] if address[0] is not None: return address[0] else: msg = _('Link Local address is not found.:%s') % if_str raise exception.NovaException(msg) except Exception as ex: msg = _("Couldn't get Link Local IP of %(interface)s" " :%(ex)s") % locals() raise exception.NovaException(msg) def parse_mailmap(mailmap='.mailmap'): mapping = {} if os.path.exists(mailmap): fp = open(mailmap, 'r') for l in fp: l = l.strip() if not l.startswith('#') and ' ' in l: canonical_email, alias = l.split(' ') mapping[alias.lower()] = canonical_email.lower() return mapping def str_dict_replace(s, mapping): for s1, s2 in mapping.iteritems(): s = s.replace(s1, s2) return s class LazyPluggable(object): """A pluggable backend loaded lazily based on some value.""" def __init__(self, pivot, **backends): self.__backends = backends self.__pivot = pivot self.__backend = None def __get_backend(self): if not self.__backend: backend_name = CONF[self.__pivot] if backend_name not in self.__backends: msg = _('Invalid backend: %s') % backend_name raise exception.NovaException(msg) backend = self.__backends[backend_name] if isinstance(backend, tuple): name = backend[0] fromlist = backend[1] else: name = backend fromlist = backend self.__backend = __import__(name, None, None, fromlist) return self.__backend def __getattr__(self, key): backend = self.__get_backend() return getattr(backend, key) class LoopingCallDone(Exception): """Exception to break out and stop a LoopingCall. The poll-function passed to LoopingCall can raise this exception to break out of the loop normally. This is somewhat analogous to StopIteration. An optional return-value can be included as the argument to the exception; this return-value will be returned by LoopingCall.wait() """ def __init__(self, retvalue=True): """:param retvalue: Value that LoopingCall.wait() should return.""" self.retvalue = retvalue class LoopingCall(object): def __init__(self, f=None, *args, **kw): self.args = args self.kw = kw self.f = f self._running = False def start(self, interval, initial_delay=None): self._running = True done = event.Event() def _inner(): if initial_delay: greenthread.sleep(initial_delay) try: while self._running: self.f(*self.args, **self.kw) if not self._running: break greenthread.sleep(interval) except LoopingCallDone, e: self.stop() done.send(e.retvalue) except Exception: LOG.exception(_('in looping call')) done.send_exception(*sys.exc_info()) return else: done.send(True) self.done = done greenthread.spawn(_inner) return self.done def stop(self): self._running = False def wait(self): return self.done.wait() def xhtml_escape(value): """Escapes a string so it is valid within XML or XHTML. """ return saxutils.escape(value, {'"': '&quot;', "'": '&apos;'}) def utf8(value): """Try to turn a string into utf-8 if possible. Code is directly from the utf8 function in http://github.com/facebook/tornado/blob/master/tornado/escape.py """ if isinstance(value, unicode): return value.encode('utf-8') assert isinstance(value, str) return value def to_bytes(text, default=0): """Try to turn a string into a number of bytes. Looks at the last characters of the text to determine what conversion is needed to turn the input text into a byte number. Supports: B/b, K/k, M/m, G/g, T/t (or the same with b/B on the end) """ # Take off everything not number 'like' (which should leave # only the byte 'identifier' left) mult_key_org = text.lstrip('-1234567890') mult_key = mult_key_org.lower() mult_key_len = len(mult_key) if mult_key.endswith("b"): mult_key = mult_key[0:-1] try: multiplier = BYTE_MULTIPLIERS[mult_key] if mult_key_len: # Empty cases shouldn't cause text[0:-0] text = text[0:-mult_key_len] return int(text) * multiplier except KeyError: msg = _('Unknown byte multiplier: %s') % mult_key_org raise TypeError(msg) except ValueError: return default def delete_if_exists(pathname): """delete a file, but ignore file not found error""" try: os.unlink(pathname) except OSError as e: if e.errno == errno.ENOENT: return else: raise def get_from_path(items, path): """Returns a list of items matching the specified path. Takes an XPath-like expression e.g. prop1/prop2/prop3, and for each item in items, looks up items[prop1][prop2][prop3]. Like XPath, if any of the intermediate results are lists it will treat each list item individually. A 'None' in items or any child expressions will be ignored, this function will not throw because of None (anywhere) in items. The returned list will contain no None values. """ if path is None: raise exception.NovaException('Invalid mini_xpath') (first_token, sep, remainder) = path.partition('/') if first_token == '': raise exception.NovaException('Invalid mini_xpath') results = [] if items is None: return results if not isinstance(items, list): # Wrap single objects in a list items = [items] for item in items: if item is None: continue get_method = getattr(item, 'get', None) if get_method is None: continue child = get_method(first_token) if child is None: continue if isinstance(child, list): # Flatten intermediate lists for x in child: results.append(x) else: results.append(child) if not sep: # No more tokens return results else: return get_from_path(results, remainder) def flatten_dict(dict_, flattened=None): """Recursively flatten a nested dictionary.""" flattened = flattened or {} for key, value in dict_.iteritems(): if hasattr(value, 'iteritems'): flatten_dict(value, flattened) else: flattened[key] = value return flattened def partition_dict(dict_, keys): """Return two dicts, one with `keys` the other with everything else.""" intersection = {} difference = {} for key, value in dict_.iteritems(): if key in keys: intersection[key] = value else: difference[key] = value return intersection, difference def map_dict_keys(dict_, key_map): """Return a dict in which the dictionaries keys are mapped to new keys.""" mapped = {} for key, value in dict_.iteritems(): mapped_key = key_map[key] if key in key_map else key mapped[mapped_key] = value return mapped def subset_dict(dict_, keys): """Return a dict that only contains a subset of keys.""" subset = partition_dict(dict_, keys)[0] return subset def diff_dict(orig, new): """ Return a dict describing how to change orig to new. The keys correspond to values that have changed; the value will be a list of one or two elements. The first element of the list will be either '+' or '-', indicating whether the key was updated or deleted; if the key was updated, the list will contain a second element, giving the updated value. """ # Figure out what keys went away result = dict((k, ['-']) for k in set(orig.keys()) - set(new.keys())) # Compute the updates for key, value in new.items(): if key not in orig or value != orig[key]: result[key] = ['+', value] return result def check_isinstance(obj, cls): """Checks that obj is of type cls, and lets PyLint infer types.""" if isinstance(obj, cls): return obj raise Exception(_('Expected object of type: %s') % (str(cls))) def parse_server_string(server_str): """ Parses the given server_string and returns a list of host and port. If it's not a combination of host part and port, the port element is a null string. If the input is invalid expression, return a null list. """ try: # First of all, exclude pure IPv6 address (w/o port). if netaddr.valid_ipv6(server_str): return (server_str, '') # Next, check if this is IPv6 address with a port number combination. if server_str.find("]:") != -1: (address, port) = server_str.replace('[', '', 1).split(']:') return (address, port) # Third, check if this is a combination of an address and a port if server_str.find(':') == -1: return (server_str, '') # This must be a combination of an address and a port (address, port) = server_str.split(':') return (address, port) except Exception: LOG.error(_('Invalid server_string: %s'), server_str) return ('', '') def bool_from_str(val): """Convert a string representation of a bool into a bool value""" if not val: return False try: return True if int(val) else False except ValueError: return val.lower() == 'true' or \ val.lower() == 'yes' or \ val.lower() == 'y' def is_valid_boolstr(val): """Check if the provided string is a valid bool string or not. """ val = str(val).lower() return val == 'true' or val == 'false' or \ val == 'yes' or val == 'no' or \ val == 'y' or val == 'n' or \ val == '1' or val == '0' def is_valid_ipv4(address): """valid the address strictly as per format xxx.xxx.xxx.xxx. where xxx is a value between 0 and 255. """ parts = address.split(".") if len(parts) != 4: return False for item in parts: try: if not 0 <= int(item) <= 255: return False except ValueError: return False return True def is_valid_cidr(address): """Check if the provided ipv4 or ipv6 address is a valid CIDR address or not""" try: # Validate the correct CIDR Address netaddr.IPNetwork(address) except netaddr.core.AddrFormatError: return False except UnboundLocalError: # NOTE(MotoKen): work around bug in netaddr 0.7.5 (see detail in # https://github.com/drkjam/netaddr/issues/2) return False # Prior validation partially verify /xx part # Verify it here ip_segment = address.split('/') if (len(ip_segment) <= 1 or ip_segment[1] == ''): return False return True def monkey_patch(): """ If the Flags.monkey_patch set as True, this function patches a decorator for all functions in specified modules. You can set decorators for each modules using CONF.monkey_patch_modules. The format is "Module path:Decorator function". Example: 'nova.api.ec2.cloud:nova.notifier.api.notify_decorator' Parameters of the decorator is as follows. (See nova.notifier.api.notify_decorator) name - name of the function function - object of the function """ # If CONF.monkey_patch is not True, this function do nothing. if not CONF.monkey_patch: return # Get list of modules and decorators for module_and_decorator in CONF.monkey_patch_modules: module, decorator_name = module_and_decorator.split(':') # import decorator function decorator = importutils.import_class(decorator_name) __import__(module) # Retrieve module information using pyclbr module_data = pyclbr.readmodule_ex(module) for key in module_data.keys(): # set the decorator for the class methods if isinstance(module_data[key], pyclbr.Class): clz = importutils.import_class("%s.%s" % (module, key)) for method, func in inspect.getmembers(clz, inspect.ismethod): setattr(clz, method, decorator("%s.%s.%s" % (module, key, method), func)) # set the decorator for the function if isinstance(module_data[key], pyclbr.Function): func = importutils.import_class("%s.%s" % (module, key)) setattr(sys.modules[module], key, decorator("%s.%s" % (module, key), func)) def convert_to_list_dict(lst, label): """Convert a value or list into a list of dicts""" if not lst: return None if not isinstance(lst, list): lst = [lst] return [{label: x} for x in lst] def timefunc(func): """Decorator that logs how long a particular function took to execute""" @functools.wraps(func) def inner(*args, **kwargs): start_time = time.time() try: return func(*args, **kwargs) finally: total_time = time.time() - start_time LOG.debug(_("timefunc: '%(name)s' took %(total_time).2f secs") % dict(name=func.__name__, total_time=total_time)) return inner def generate_glance_url(): """Generate the URL to glance.""" return "%s://%s:%d" % (CONF.glance_protocol, CONF.glance_host, CONF.glance_port) def generate_image_url(image_ref): """Generate an image URL from an image_ref.""" return "%s/images/%s" % (generate_glance_url(), image_ref) @contextlib.contextmanager def remove_path_on_error(path): """Protect code that wants to operate on PATH atomically. Any exception will cause PATH to be removed. """ try: yield except Exception: with excutils.save_and_reraise_exception(): delete_if_exists(path) def make_dev_path(dev, partition=None, base='/dev'): """Return a path to a particular device. >>> make_dev_path('xvdc') /dev/xvdc >>> make_dev_path('xvdc', 1) /dev/xvdc1 """ path = os.path.join(base, dev) if partition: path += str(partition) return path def total_seconds(td): """Local total_seconds implementation for compatibility with python 2.6""" if hasattr(td, 'total_seconds'): return td.total_seconds() else: return ((td.days * 86400 + td.seconds) * 10 ** 6 + td.microseconds) / 10.0 ** 6 def sanitize_hostname(hostname): """Return a hostname which conforms to RFC-952 and RFC-1123 specs.""" if isinstance(hostname, unicode): hostname = hostname.encode('latin-1', 'ignore') hostname = re.sub('[ _]', '-', hostname) hostname = re.sub('[^\w.-]+', '', hostname) hostname = hostname.lower() hostname = hostname.strip('.-') return hostname def read_cached_file(filename, cache_info, reload_func=None): """Read from a file if it has been modified. :param cache_info: dictionary to hold opaque cache. :param reload_func: optional function to be called with data when file is reloaded due to a modification. :returns: data from file """ mtime = os.path.getmtime(filename) if not cache_info or mtime != cache_info.get('mtime'): LOG.debug(_("Reloading cached file %s") % filename) with open(filename) as fap: cache_info['data'] = fap.read() cache_info['mtime'] = mtime if reload_func: reload_func(cache_info['data']) return cache_info['data'] def file_open(*args, **kwargs): """Open file see built-in file() documentation for more details Note: The reason this is kept in a separate module is to easily be able to provide a stub module that doesn't alter system state at all (for unit tests) """ return file(*args, **kwargs) def hash_file(file_like_object): """Generate a hash for the contents of a file.""" checksum = hashlib.sha1() for chunk in iter(lambda: file_like_object.read(32768), b''): checksum.update(chunk) return checksum.hexdigest() @contextlib.contextmanager def temporary_mutation(obj, **kwargs): """Temporarily set the attr on a particular object to a given value then revert when finished. One use of this is to temporarily set the read_deleted flag on a context object: with temporary_mutation(context, read_deleted="yes"): do_something_that_needed_deleted_objects() """ NOT_PRESENT = object() old_values = {} for attr, new_value in kwargs.items(): old_values[attr] = getattr(obj, attr, NOT_PRESENT) setattr(obj, attr, new_value) try: yield finally: for attr, old_value in old_values.items(): if old_value is NOT_PRESENT: del obj[attr] else: setattr(obj, attr, old_value) def generate_mac_address(): """Generate an Ethernet MAC address.""" # NOTE(vish): We would prefer to use 0xfe here to ensure that linux # bridge mac addresses don't change, but it appears to # conflict with libvirt, so we use the next highest octet # that has the unicast and locally administered bits set # properly: 0xfa. # Discussion: https://bugs.launchpad.net/nova/+bug/921838 mac = [0xfa, 0x16, 0x3e, random.randint(0x00, 0xff), random.randint(0x00, 0xff), random.randint(0x00, 0xff)] return ':'.join(map(lambda x: "%02x" % x, mac)) def read_file_as_root(file_path): """Secure helper to read file as root.""" try: out, _err = execute('cat', file_path, run_as_root=True) return out except exception.ProcessExecutionError: raise exception.FileNotFound(file_path=file_path) @contextlib.contextmanager def temporary_chown(path, owner_uid=None): """Temporarily chown a path. :params owner_uid: UID of temporary owner (defaults to current user) """ if owner_uid is None: owner_uid = os.getuid() orig_uid = os.stat(path).st_uid if orig_uid != owner_uid: execute('chown', owner_uid, path, run_as_root=True) try: yield finally: if orig_uid != owner_uid: execute('chown', orig_uid, path, run_as_root=True) @contextlib.contextmanager def tempdir(**kwargs): tmpdir = tempfile.mkdtemp(**kwargs) try: yield tmpdir finally: try: shutil.rmtree(tmpdir) except OSError, e: LOG.error(_('Could not remove tmpdir: %s'), str(e)) def strcmp_const_time(s1, s2): """Constant-time string comparison. :params s1: the first string :params s2: the second string :return: True if the strings are equal. This function takes two strings and compares them. It is intended to be used when doing a comparison for authentication purposes to help guard against timing attacks. """ if len(s1) != len(s2): return False result = 0 for (a, b) in zip(s1, s2): result |= ord(a) ^ ord(b) return result == 0 def walk_class_hierarchy(clazz, encountered=None): """Walk class hierarchy, yielding most derived classes first""" if not encountered: encountered = [] for subclass in clazz.__subclasses__(): if subclass not in encountered: encountered.append(subclass) # drill down to leaves first for subsubclass in walk_class_hierarchy(subclass, encountered): yield subsubclass yield subclass class UndoManager(object): """Provides a mechanism to facilitate rolling back a series of actions when an exception is raised. """ def __init__(self): self.undo_stack = [] def undo_with(self, undo_func): self.undo_stack.append(undo_func) def _rollback(self): for undo_func in reversed(self.undo_stack): undo_func() def rollback_and_reraise(self, msg=None, **kwargs): """Rollback a series of actions then re-raise the exception. .. note:: (sirp) This should only be called within an exception handler. """ with excutils.save_and_reraise_exception(): if msg: LOG.exception(msg, **kwargs) self._rollback() def mkfs(fs, path, label=None): """Format a file or block device :param fs: Filesystem type (examples include 'swap', 'ext3', 'ext4' 'btrfs', etc.) :param path: Path to file or block device to format :param label: Volume label to use """ if fs == 'swap': args = ['mkswap'] else: args = ['mkfs', '-t', fs] #add -F to force no interactive execute on non-block device. if fs in ('ext3', 'ext4'): args.extend(['-F']) if label: if fs in ('msdos', 'vfat'): label_opt = '-n' else: label_opt = '-L' args.extend([label_opt, label]) args.append(path) execute(*args) def last_bytes(file_like_object, num): """Return num bytes from the end of the file, and remaining byte count. :param file_like_object: The file to read :param num: The number of bytes to return :returns (data, remaining) """ try: file_like_object.seek(-num, os.SEEK_END) except IOError, e: if e.errno == 22: file_like_object.seek(0, os.SEEK_SET) else: raise remaining = file_like_object.tell() return (file_like_object.read(), remaining)
apache-2.0
-4,965,048,132,937,103,000
31.104515
79
0.587963
false
4.086961
false
false
false
larsbutler/swift
swift/obj/expirer.py
1
12641
# Copyright (c) 2010-2012 OpenStack Foundation # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. from six.moves import urllib from random import random from time import time from os.path import join from swift import gettext_ as _ import hashlib from eventlet import sleep, Timeout from eventlet.greenpool import GreenPool from swift.common.daemon import Daemon from swift.common.internal_client import InternalClient, UnexpectedResponse from swift.common.utils import get_logger, dump_recon_cache, split_path from swift.common.http import HTTP_NOT_FOUND, HTTP_CONFLICT, \ HTTP_PRECONDITION_FAILED from swift.container.reconciler import direct_delete_container_entry MAX_OBJECTS_TO_CACHE = 100000 class ObjectExpirer(Daemon): """ Daemon that queries the internal hidden expiring_objects_account to discover objects that need to be deleted. :param conf: The daemon configuration. """ def __init__(self, conf, logger=None, swift=None): self.conf = conf self.logger = logger or get_logger(conf, log_route='object-expirer') self.interval = int(conf.get('interval') or 300) self.expiring_objects_account = \ (conf.get('auto_create_account_prefix') or '.') + \ (conf.get('expiring_objects_account_name') or 'expiring_objects') conf_path = conf.get('__file__') or '/etc/swift/object-expirer.conf' request_tries = int(conf.get('request_tries') or 3) self.swift = swift or InternalClient( conf_path, 'Swift Object Expirer', request_tries) self.report_interval = int(conf.get('report_interval') or 300) self.report_first_time = self.report_last_time = time() self.report_objects = 0 self.recon_cache_path = conf.get('recon_cache_path', '/var/cache/swift') self.rcache = join(self.recon_cache_path, 'object.recon') self.concurrency = int(conf.get('concurrency', 1)) if self.concurrency < 1: raise ValueError("concurrency must be set to at least 1") self.processes = int(self.conf.get('processes', 0)) self.process = int(self.conf.get('process', 0)) self.reclaim_age = int(conf.get('reclaim_age', 86400 * 7)) def report(self, final=False): """ Emits a log line report of the progress so far, or the final progress is final=True. :param final: Set to True for the last report once the expiration pass has completed. """ if final: elapsed = time() - self.report_first_time self.logger.info(_('Pass completed in %(time)ds; ' '%(objects)d objects expired') % { 'time': elapsed, 'objects': self.report_objects}) dump_recon_cache({'object_expiration_pass': elapsed, 'expired_last_pass': self.report_objects}, self.rcache, self.logger) elif time() - self.report_last_time >= self.report_interval: elapsed = time() - self.report_first_time self.logger.info(_('Pass so far %(time)ds; ' '%(objects)d objects expired') % { 'time': elapsed, 'objects': self.report_objects}) self.report_last_time = time() def iter_cont_objs_to_expire(self): """ Yields (container, obj) tuples to be deleted """ obj_cache = {} cnt = 0 all_containers = set() for c in self.swift.iter_containers(self.expiring_objects_account): container = str(c['name']) timestamp = int(container) if timestamp > int(time()): break all_containers.add(container) for o in self.swift.iter_objects(self.expiring_objects_account, container): obj = o['name'].encode('utf8') timestamp, actual_obj = obj.split('-', 1) timestamp = int(timestamp) if timestamp > int(time()): break try: cust_account, cust_cont, cust_obj = \ split_path('/' + actual_obj, 3, 3, True) cache_key = '%s/%s' % (cust_account, cust_cont) except ValueError: cache_key = None if self.processes > 0: obj_process = int( hashlib.md5('%s/%s' % (container, obj)). hexdigest(), 16) if obj_process % self.processes != self.process: continue if cache_key not in obj_cache: obj_cache[cache_key] = [] obj_cache[cache_key].append((container, obj)) cnt += 1 if cnt > MAX_OBJECTS_TO_CACHE: while obj_cache: for key in obj_cache.keys(): if obj_cache[key]: yield obj_cache[key].pop() cnt -= 1 else: del obj_cache[key] while obj_cache: for key in obj_cache.keys(): if obj_cache[key]: yield obj_cache[key].pop() else: del obj_cache[key] for container in all_containers: yield (container, None) def run_once(self, *args, **kwargs): """ Executes a single pass, looking for objects to expire. :param args: Extra args to fulfill the Daemon interface; this daemon has no additional args. :param kwargs: Extra keyword args to fulfill the Daemon interface; this daemon accepts processes and process keyword args. These will override the values from the config file if provided. """ self.get_process_values(kwargs) pool = GreenPool(self.concurrency) containers_to_delete = set([]) self.report_first_time = self.report_last_time = time() self.report_objects = 0 try: self.logger.debug('Run begin') containers, objects = \ self.swift.get_account_info(self.expiring_objects_account) self.logger.info(_('Pass beginning; ' '%(containers)s possible containers; ' '%(objects)s possible objects') % { 'containers': containers, 'objects': objects}) for container, obj in self.iter_cont_objs_to_expire(): containers_to_delete.add(container) if not obj: continue timestamp, actual_obj = obj.split('-', 1) timestamp = int(timestamp) if timestamp > int(time()): break pool.spawn_n( self.delete_object, actual_obj, timestamp, container, obj) pool.waitall() for container in containers_to_delete: try: self.swift.delete_container( self.expiring_objects_account, container, acceptable_statuses=(2, HTTP_NOT_FOUND, HTTP_CONFLICT)) except (Exception, Timeout) as err: self.logger.exception( _('Exception while deleting container %(container)s ' '%(err)s') % {'container': container, 'err': str(err)}) self.logger.debug('Run end') self.report(final=True) except (Exception, Timeout): self.logger.exception(_('Unhandled exception')) def run_forever(self, *args, **kwargs): """ Executes passes forever, looking for objects to expire. :param args: Extra args to fulfill the Daemon interface; this daemon has no additional args. :param kwargs: Extra keyword args to fulfill the Daemon interface; this daemon has no additional keyword args. """ sleep(random() * self.interval) while True: begin = time() try: self.run_once(*args, **kwargs) except (Exception, Timeout): self.logger.exception(_('Unhandled exception')) elapsed = time() - begin if elapsed < self.interval: sleep(random() * (self.interval - elapsed)) def get_process_values(self, kwargs): """ Sets self.processes and self.process from the kwargs if those values exist, otherwise, leaves those values as they were set in the config file. :param kwargs: Keyword args passed into the run_forever(), run_once() methods. They have values specified on the command line when the daemon is run. """ if kwargs.get('processes') is not None: self.processes = int(kwargs['processes']) if kwargs.get('process') is not None: self.process = int(kwargs['process']) if self.process < 0: raise ValueError( 'process must be an integer greater than or equal to 0') if self.processes < 0: raise ValueError( 'processes must be an integer greater than or equal to 0') if self.processes and self.process >= self.processes: raise ValueError( 'process must be less than or equal to processes') def delete_object(self, actual_obj, timestamp, container, obj): start_time = time() try: try: self.delete_actual_object(actual_obj, timestamp) except UnexpectedResponse as err: if err.resp.status_int not in {HTTP_NOT_FOUND, HTTP_PRECONDITION_FAILED}: raise if float(timestamp) > time() - self.reclaim_age: # we'll have to retry the DELETE later raise self.pop_queue(container, obj) self.report_objects += 1 self.logger.increment('objects') except (Exception, Timeout) as err: self.logger.increment('errors') self.logger.exception( _('Exception while deleting object %(container)s %(obj)s' ' %(err)s') % {'container': container, 'obj': obj, 'err': str(err)}) self.logger.timing_since('timing', start_time) self.report() def pop_queue(self, container, obj): """ Issue a delete object request to the container for the expiring object queue entry. """ direct_delete_container_entry(self.swift.container_ring, self.expiring_objects_account, container, obj) def delete_actual_object(self, actual_obj, timestamp): """ Deletes the end-user object indicated by the actual object name given '<account>/<container>/<object>' if and only if the X-Delete-At value of the object is exactly the timestamp given. :param actual_obj: The name of the end-user object to delete: '<account>/<container>/<object>' :param timestamp: The timestamp the X-Delete-At value must match to perform the actual delete. """ path = '/v1/' + urllib.parse.quote(actual_obj.lstrip('/')) self.swift.make_request('DELETE', path, {'X-If-Delete-At': str(timestamp), 'X-Timestamp': str(timestamp)}, (2,))
apache-2.0
-1,666,015,285,613,331,700
40.445902
79
0.537616
false
4.652558
false
false
false
krivenko/som
python/som.py
1
1706
############################################################################## # # SOM: Stochastic Optimization Method for Analytic Continuation # # Copyright (C) 2016-2020 Igor Krivenko <[email protected]> # # SOM is free software: you can redistribute it and/or modify it under the # terms of the GNU General Public License as published by the Free Software # Foundation, either version 3 of the License, or (at your option) any later # version. # # SOM is distributed in the hope that it will be useful, but WITHOUT ANY # WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS # FOR A PARTICULAR PURPOSE. See the GNU General Public License for more # details. # # You should have received a copy of the GNU General Public License along with # SOM. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## """ Main module of SOM """ from core import SomCore import numpy as np class Som(SomCore): """Stochastic Optimization Method""" def __init__(self, g, s = None, kind = "FermionGf", norms = np.array([])): if s is None: s = g.copy() s.data[:,Ellipsis] = np.eye(s.target_shape[0]) if isinstance(norms,float) or isinstance(norms,int): norms = norms * np.ones((g.target_shape[0],)) SomCore.__init__(self, g, s, kind, norms) def count_good_solutions(hist, upper_lim = 1): """ Given a histogram of objective function values, count the number of solutions with D/D_{min} <= 1 + upper_lim """ d_max = hist.limits[0] * (1 + upper_lim) return int(sum(c for n, c in enumerate(hist.data) if hist.mesh_point(n) <= d_max))
gpl-3.0
-1,575,309,946,060,850,000
36.911111
86
0.611958
false
3.676724
false
false
false
atumanov/ray
python/ray/exceptions.py
1
3236
import os import colorama try: import setproctitle except ImportError: setproctitle = None class RayError(Exception): """Super class of all ray exception types.""" pass class RayTaskError(RayError): """Indicates that a task threw an exception during execution. If a task throws an exception during execution, a RayTaskError is stored in the object store for each of the task's outputs. When an object is retrieved from the object store, the Python method that retrieved it checks to see if the object is a RayTaskError and if it is then an exception is thrown propagating the error message. Attributes: function_name (str): The name of the function that failed and produced the RayTaskError. traceback_str (str): The traceback from the exception. """ def __init__(self, function_name, traceback_str): """Initialize a RayTaskError.""" if setproctitle: self.proctitle = setproctitle.getproctitle() else: self.proctitle = "ray_worker" self.pid = os.getpid() self.host = os.uname()[1] self.function_name = function_name self.traceback_str = traceback_str assert traceback_str is not None def __str__(self): """Format a RayTaskError as a string.""" lines = self.traceback_str.split("\n") out = [] in_worker = False for line in lines: if line.startswith("Traceback "): out.append("{}{}{} (pid={}, host={})".format( colorama.Fore.CYAN, self.proctitle, colorama.Fore.RESET, self.pid, self.host)) elif in_worker: in_worker = False elif "ray/worker.py" in line or "ray/function_manager.py" in line: in_worker = True else: out.append(line) return "\n".join(out) class RayWorkerError(RayError): """Indicates that the worker died unexpectedly while executing a task.""" def __str__(self): return "The worker died unexpectedly while executing this task." class RayActorError(RayError): """Indicates that the actor died unexpectedly before finishing a task. This exception could happen either because the actor process dies while executing a task, or because a task is submitted to a dead actor. """ def __str__(self): return "The actor died unexpectedly before finishing this task." class UnreconstructableError(RayError): """Indicates that an object is lost and cannot be reconstructed. Note, this exception only happens for actor objects. If actor's current state is after object's creating task, the actor cannot re-run the task to reconstruct the object. Attributes: object_id: ID of the object. """ def __init__(self, object_id): self.object_id = object_id def __str__(self): return ("Object {} is lost (either evicted or explicitly deleted) and " + "cannot be reconstructed.").format(self.object_id.hex()) RAY_EXCEPTION_TYPES = [ RayError, RayTaskError, RayWorkerError, RayActorError, UnreconstructableError, ]
apache-2.0
-4,839,456,202,281,432,000
29.819048
79
0.635352
false
4.263505
false
false
false
mysociety/barnetplanning
alerts/forms.py
1
2895
import urllib2 import simplejson from django import forms from django.contrib.localflavor.uk.forms import UKPostcodeField from models import Alert # Due to a bug in UKPostcodeField, can't override error message. This is # fixed in: http://code.djangoproject.com/ticket/12017 # So remove this extra class when we have a recent enough Django. class MyUKPostcodeField(UKPostcodeField): default_error_messages = { 'invalid': 'We need your complete UK postcode.' } widget = forms.TextInput(attrs={'size':'8'}) class AlertForm(forms.ModelForm): email = forms.EmailField(label='Your email address', error_messages={'required': 'Please enter your email address.'}) postcode = MyUKPostcodeField(required=False) ward_mapit_id = forms.TypedChoiceField(required=False, coerce=int, initial=None) def __init__(self, *args, **kwargs): super(AlertForm, self).__init__(*args, **kwargs) self.fields['radius'].label = 'If you chose a postcode, how far around your postcode would you like to receive alerts for?' # Because radius is not compulsory on the model, choices has puts in a blank row for leaving # it out. We don't want that, hence the [1:] self.fields['radius'].widget = forms.RadioSelect(choices=self.fields['radius'].choices[1:]) # Make a dictionary of ward name to id mapit_response = urllib2.urlopen("http://mapit.mysociety.org/area/2489/children.json") mapit_data = simplejson.load(mapit_response) ward_choices = [(int(value), mapit_data[value]['name']) for value in mapit_data] ward_choices.sort(key=lambda x: x[1]) # FIXME - at some point in the future, should work out why None doesn't work here, # and get rid of the clean_ward_mapit_id method. ward_choices.insert(0, (-1, 'Select')) self.fields['ward_mapit_id'].choices = ward_choices self.fields['ward_mapit_id'].label = 'Ward' def clean_ward_mapit_id(self): """We can't use None directly in the form, as it gets stringified into 'None'. Instead, we use -1 as the signifier of nothing chosen, and turn it into None here.""" ward_id = self.cleaned_data['ward_mapit_id'] if ward_id == -1: return None else: return ward_id def clean(self): cleaned_data = super(AlertForm, self).clean() postcode = cleaned_data.get('postcode') ward_mapit_id = cleaned_data.get('ward_mapit_id') if postcode and ward_mapit_id: raise forms.ValidationError('You cannot enter both a postcode and a ward.') if not postcode and not ward_mapit_id: raise forms.ValidationError('Please enter a postcode or a ward.') return cleaned_data class Meta: model = Alert fields = ('postcode', 'ward_mapit_id', 'email', 'radius')
agpl-3.0
-3,994,539,111,728,237,600
40.357143
131
0.656995
false
3.683206
false
false
false
jiaphuan/models
research/slim/nets/mobilenet/mobilenet.py
1
16178
# Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Mobilenet Base Class.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import collections import contextlib import copy import os import contextlib2 import tensorflow as tf slim = tf.contrib.slim @slim.add_arg_scope def apply_activation(x, name=None, activation_fn=None): return activation_fn(x, name=name) if activation_fn else x def _fixed_padding(inputs, kernel_size, rate=1): """Pads the input along the spatial dimensions independently of input size. Pads the input such that if it was used in a convolution with 'VALID' padding, the output would have the same dimensions as if the unpadded input was used in a convolution with 'SAME' padding. Args: inputs: A tensor of size [batch, height_in, width_in, channels]. kernel_size: The kernel to be used in the conv2d or max_pool2d operation. rate: An integer, rate for atrous convolution. Returns: output: A tensor of size [batch, height_out, width_out, channels] with the input, either intact (if kernel_size == 1) or padded (if kernel_size > 1). """ kernel_size_effective = [kernel_size[0] + (kernel_size[0] - 1) * (rate - 1), kernel_size[0] + (kernel_size[0] - 1) * (rate - 1)] pad_total = [kernel_size_effective[0] - 1, kernel_size_effective[1] - 1] pad_beg = [pad_total[0] // 2, pad_total[1] // 2] pad_end = [pad_total[0] - pad_beg[0], pad_total[1] - pad_beg[1]] padded_inputs = tf.pad(inputs, [[0, 0], [pad_beg[0], pad_end[0]], [pad_beg[1], pad_end[1]], [0, 0]]) return padded_inputs def _make_divisible(v, divisor, min_value=None): if min_value is None: min_value = divisor new_v = max(min_value, int(v + divisor / 2) // divisor * divisor) # Make sure that round down does not go down by more than 10%. if new_v < 0.9 * v: new_v += divisor return new_v @contextlib.contextmanager def _set_arg_scope_defaults(defaults): """Sets arg scope defaults for all items present in defaults. Args: defaults: dictionary mapping function to default_dict Yields: context manager """ with contextlib2.ExitStack() as stack: _ = [ stack.enter_context(slim.arg_scope(func, **default_arg)) for func, default_arg in defaults.items() ] yield @slim.add_arg_scope def depth_multiplier(output_params, multiplier, divisible_by=8, min_depth=8, **unused_kwargs): if 'num_outputs' not in output_params: return d = output_params['num_outputs'] output_params['num_outputs'] = _make_divisible(d * multiplier, divisible_by, min_depth) _Op = collections.namedtuple('Op', ['op', 'params', 'multiplier_func']) def op(opfunc, **params): multiplier = params.pop('multiplier_transorm', depth_multiplier) return _Op(opfunc, params=params, multiplier_func=multiplier) @slim.add_arg_scope def mobilenet_base( # pylint: disable=invalid-name inputs, conv_defs, multiplier=1.0, final_endpoint=None, output_stride=None, use_explicit_padding=False, scope=None, is_training=False): """Mobilenet base network. Constructs a network from inputs to the given final endpoint. By default the network is constructed in inference mode. To create network in training mode use: with slim.arg_scope(mobilenet.training_scope()): logits, endpoints = mobilenet_base(...) Args: inputs: a tensor of shape [batch_size, height, width, channels]. conv_defs: A list of op(...) layers specifying the net architecture. multiplier: Float multiplier for the depth (number of channels) for all convolution ops. The value must be greater than zero. Typical usage will be to set this value in (0, 1) to reduce the number of parameters or computation cost of the model. final_endpoint: The name of last layer, for early termination for for V1-based networks: last layer is "layer_14", for V2: "layer_20" output_stride: An integer that specifies the requested ratio of input to output spatial resolution. If not None, then we invoke atrous convolution if necessary to prevent the network from reducing the spatial resolution of the activation maps. Allowed values are 1 or any even number, excluding zero. Typical values are 8 (accurate fully convolutional mode), 16 (fast fully convolutional mode), and 32 (classification mode). NOTE- output_stride relies on all consequent operators to support dilated operators via "rate" parameter. This might require wrapping non-conv operators to operate properly. use_explicit_padding: Use 'VALID' padding for convolutions, but prepad inputs so that the output dimensions are the same as if 'SAME' padding were used. scope: optional variable scope. is_training: How to setup batch_norm and other ops. Note: most of the time this does not need be set directly. Use mobilenet.training_scope() to set up training instead. This parameter is here for backward compatibility only. It is safe to set it to the value matching training_scope(is_training=...). It is also safe to explicitly set it to False, even if there is outer training_scope set to to training. (The network will be built in inference mode). Returns: tensor_out: output tensor. end_points: a set of activations for external use, for example summaries or losses. Raises: ValueError: depth_multiplier <= 0, or the target output_stride is not allowed. """ if multiplier <= 0: raise ValueError('multiplier is not greater than zero.') # Set conv defs defaults and overrides. conv_defs_defaults = conv_defs.get('defaults', {}) conv_defs_overrides = conv_defs.get('overrides', {}) if use_explicit_padding: conv_defs_overrides = copy.deepcopy(conv_defs_overrides) conv_defs_overrides[ (slim.conv2d, slim.separable_conv2d)] = {'padding': 'VALID'} if output_stride is not None: if output_stride == 0 or (output_stride > 1 and output_stride % 2): raise ValueError('Output stride must be None, 1 or a multiple of 2.') # a) Set the tensorflow scope # b) set padding to default: note we might consider removing this # since it is also set by mobilenet_scope # c) set all defaults # d) set all extra overrides. with _scope_all(scope, default_scope='Mobilenet'), \ slim.arg_scope([slim.batch_norm], is_training=is_training), \ _set_arg_scope_defaults(conv_defs_defaults), \ _set_arg_scope_defaults(conv_defs_overrides): # The current_stride variable keeps track of the output stride of the # activations, i.e., the running product of convolution strides up to the # current network layer. This allows us to invoke atrous convolution # whenever applying the next convolution would result in the activations # having output stride larger than the target output_stride. current_stride = 1 # The atrous convolution rate parameter. rate = 1 net = inputs # Insert default parameters before the base scope which includes # any custom overrides set in mobilenet. end_points = {} scopes = {} for i, opdef in enumerate(conv_defs['spec']): params = dict(opdef.params) opdef.multiplier_func(params, multiplier) stride = params.get('stride', 1) if output_stride is not None and current_stride == output_stride: # If we have reached the target output_stride, then we need to employ # atrous convolution with stride=1 and multiply the atrous rate by the # current unit's stride for use in subsequent layers. layer_stride = 1 layer_rate = rate rate *= stride else: layer_stride = stride layer_rate = 1 current_stride *= stride # Update params. params['stride'] = layer_stride # Only insert rate to params if rate > 1. if layer_rate > 1: params['rate'] = layer_rate # Set padding if use_explicit_padding: if 'kernel_size' in params: net = _fixed_padding(net, params['kernel_size'], layer_rate) else: params['use_explicit_padding'] = True end_point = 'layer_%d' % (i + 1) try: net = opdef.op(net, **params) except Exception: print('Failed to create op %i: %r params: %r' % (i, opdef, params)) raise end_points[end_point] = net scope = os.path.dirname(net.name) scopes[scope] = end_point if final_endpoint is not None and end_point == final_endpoint: break # Add all tensors that end with 'output' to # endpoints for t in net.graph.get_operations(): scope = os.path.dirname(t.name) bn = os.path.basename(t.name) if scope in scopes and t.name.endswith('output'): end_points[scopes[scope] + '/' + bn] = t.outputs[0] return net, end_points @contextlib.contextmanager def _scope_all(scope, default_scope=None): with tf.variable_scope(scope, default_name=default_scope) as s,\ tf.name_scope(s.original_name_scope): yield s @slim.add_arg_scope def mobilenet(inputs, num_classes=1001, prediction_fn=slim.softmax, reuse=None, scope='Mobilenet', base_only=False, **mobilenet_args): """Mobilenet model for classification, supports both V1 and V2. Note: default mode is inference, use mobilenet.training_scope to create training network. Args: inputs: a tensor of shape [batch_size, height, width, channels]. num_classes: number of predicted classes. If 0 or None, the logits layer is omitted and the input features to the logits layer (before dropout) are returned instead. prediction_fn: a function to get predictions out of logits (default softmax). reuse: whether or not the network and its variables should be reused. To be able to reuse 'scope' must be given. scope: Optional variable_scope. base_only: if True will only create the base of the network (no pooling and no logits). **mobilenet_args: passed to mobilenet_base verbatim. - conv_defs: list of conv defs - multiplier: Float multiplier for the depth (number of channels) for all convolution ops. The value must be greater than zero. Typical usage will be to set this value in (0, 1) to reduce the number of parameters or computation cost of the model. - output_stride: will ensure that the last layer has at most total stride. If the architecture calls for more stride than that provided (e.g. output_stride=16, but the architecture has 5 stride=2 operators), it will replace output_stride with fractional convolutions using Atrous Convolutions. Returns: logits: the pre-softmax activations, a tensor of size [batch_size, num_classes] end_points: a dictionary from components of the network to the corresponding activation tensor. Raises: ValueError: Input rank is invalid. """ is_training = mobilenet_args.get('is_training', False) input_shape = inputs.get_shape().as_list() if len(input_shape) != 4: raise ValueError('Expected rank 4 input, was: %d' % len(input_shape)) with tf.variable_scope(scope, 'Mobilenet', reuse=reuse) as scope: inputs = tf.identity(inputs, 'input') net, end_points = mobilenet_base(inputs, scope=scope, **mobilenet_args) if base_only: return net, end_points net = tf.identity(net, name='embedding') with tf.variable_scope('Logits'): net = global_pool(net) end_points['global_pool'] = net if not num_classes: return net, end_points net = slim.dropout(net, scope='Dropout', is_training=is_training) # 1 x 1 x num_classes # Note: legacy scope name. logits = slim.conv2d( net, num_classes, [1, 1], activation_fn=None, normalizer_fn=None, biases_initializer=tf.zeros_initializer(), scope='Conv2d_1c_1x1') logits = tf.squeeze(logits, [1, 2]) logits = tf.identity(logits, name='output') end_points['Logits'] = logits if prediction_fn: end_points['Predictions'] = prediction_fn(logits, 'Predictions') return logits, end_points def global_pool(input_tensor, pool_op=tf.nn.avg_pool): """Applies avg pool to produce 1x1 output. NOTE: This function is funcitonally equivalenet to reduce_mean, but it has baked in average pool which has better support across hardware. Args: input_tensor: input tensor pool_op: pooling op (avg pool is default) Returns: a tensor batch_size x 1 x 1 x depth. """ shape = input_tensor.get_shape().as_list() if shape[1] is None or shape[2] is None: kernel_size = tf.convert_to_tensor( [1, tf.shape(input_tensor)[1], tf.shape(input_tensor)[2], 1]) else: kernel_size = [1, shape[1], shape[2], 1] output = pool_op( input_tensor, ksize=kernel_size, strides=[1, 1, 1, 1], padding='VALID') # Recover output shape, for unknown shape. output.set_shape([None, 1, 1, None]) return output def training_scope(is_training=True, weight_decay=0.00004, stddev=0.09, dropout_keep_prob=0.8, bn_decay=0.997): """Defines Mobilenet training scope. Usage: with tf.contrib.slim.arg_scope(mobilenet.training_scope()): logits, endpoints = mobilenet_v2.mobilenet(input_tensor) # the network created will be trainble with dropout/batch norm # initialized appropriately. Args: is_training: if set to False this will ensure that all customizations are set to non-training mode. This might be helpful for code that is reused across both training/evaluation, but most of the time training_scope with value False is not needed. weight_decay: The weight decay to use for regularizing the model. stddev: Standard deviation for initialization, if negative uses xavier. dropout_keep_prob: dropout keep probability bn_decay: decay for the batch norm moving averages. Returns: An argument scope to use via arg_scope. """ # Note: do not introduce parameters that would change the inference # model here (for example whether to use bias), modify conv_def instead. batch_norm_params = { 'is_training': is_training, 'decay': bn_decay, } if stddev < 0: weight_intitializer = slim.initializers.xavier_initializer() else: weight_intitializer = tf.truncated_normal_initializer(stddev=stddev) # Set weight_decay for weights in Conv and FC layers. with slim.arg_scope( [slim.conv2d, slim.fully_connected, slim.separable_conv2d], weights_initializer=weight_intitializer, normalizer_fn=slim.batch_norm), \ slim.arg_scope([mobilenet_base, mobilenet], is_training=is_training),\ slim.arg_scope([slim.batch_norm], **batch_norm_params), \ slim.arg_scope([slim.dropout], is_training=is_training, keep_prob=dropout_keep_prob), \ slim.arg_scope([slim.conv2d], \ weights_regularizer=slim.l2_regularizer(weight_decay)), \ slim.arg_scope([slim.separable_conv2d], weights_regularizer=None) as s: return s
apache-2.0
7,967,390,960,214,579,000
36.710956
80
0.665657
false
3.862942
false
false
false
Autodesk/molecular-design-toolkit
moldesign/interfaces/nbo_interface.py
1
9611
from __future__ import print_function, absolute_import, division from future.builtins import * from future import standard_library standard_library.install_aliases() # Copyright 2017 Autodesk Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import numpy as np import moldesign as mdt from .. import units as u from .. import utils SIGMA_UTF = u"\u03C3" PI_UTF = u"\u03C0" def run_nbo(mol, requests=('nlmo', 'nbo'), image='nbo', engine=None): wfn = mol.wfn inputs = {'in.47': make_nbo_input_file(mol, requests)} command = 'gennbo.i4.exe in.47' engine = utils.if_not_none(engine, mdt.compute.config.get_engine()) imagename = mdt.compute.get_image_path(image) job = engine.launch(imagename, command, inputs=inputs, name="nbo, %s" % mol.name) mdt.helpers.display_log(job.get_display_object(), "nbo, %s"%mol.name) job.wait() parsed_data = parse_nbo(job.get_output('FILE.10'), len(mol.wfn.aobasis)) for orbtype, data in parsed_data.items(): if orbtype[0] == 'P': # copy data from the orthogonal orbitals orthdata = parsed_data[orbtype[1:]] for key in 'bond_names iatom jatom stars bondnums num_bonded_atoms'.split(): data[key] = orthdata[key] data.occupations = [None for orb in data.coeffs] add_orbitals(mol, wfn, data, orbtype) wfn._nbo_job = job def add_orbitals(mol, wfn, orbdata, orbtype): orbs = [] for i in range(len(orbdata.coeffs)): bond = None atoms = [mol.atoms[orbdata.iatom[i] - 1]] if orbdata.bond_names[i] == 'RY': bname = '%s Ryd*' % atoms[0].name nbotype = 'rydberg' utf_name = bname elif orbdata.bond_names[i] == 'LP': bname = '%s lone pair' % atoms[0].name nbotype = 'lone pair' utf_name = bname elif orbdata.bond_names[i] == 'LV': bname = '%s lone vacancy' % atoms[0].name nbotype = 'lone vacancy' utf_name = bname elif orbdata.num_bonded_atoms[i] == 1: bname = '%s Core' % atoms[0].name nbotype = 'core' utf_name = bname else: atoms.append(mol.atoms[orbdata.jatom[i] - 1]) bond = mdt.Bond(*atoms) if orbdata.bondnums[i] == 1: # THIS IS NOT CORRECT nbotype = 'sigma' utf_type = SIGMA_UTF else: nbotype = 'pi' utf_type = PI_UTF bname = '%s%s (%s - %s)' % (nbotype, orbdata.stars[i], atoms[0].name, atoms[1].name) utf_name = '%s%s (%s - %s)' % (utf_type, orbdata.stars[i], atoms[0].name, atoms[1].name) name = '%s %s' % (bname, orbtype) orbs.append(mdt.Orbital(orbdata.coeffs[i], wfn=wfn, occupation=orbdata.occupations[i], atoms=atoms, name=name, nbotype=nbotype, bond=bond, unicode_name=utf_name, _data=orbdata)) return wfn.add_orbitals(orbs, orbtype=orbtype) def make_nbo_input_file(mol, requests): """ :param mol: :type mol: moldesign.molecules.Molecule :return: """ # Units: angstroms, hartrees wfn = mol.wfn orbs = wfn.molecular_orbitals nbofile = [] # TODO: check for open shell wfn (OPEN keyword) # TODO: check normalization, orthogonalization nbofile.append(" $GENNBO BODM NATOMS=%d NBAS=%d $END" % (mol.num_atoms, len(wfn.aobasis))) commands = ['NBOSUM'] for r in requests: commands.append('AO%s=W10' % r.upper()) if r[0] != 'P': commands.append('%s' % r.upper()) nbofile.append('$NBO %s $END' % (' '.join(commands))) nbofile.append("$COORD\n %s" % mol.name) for iatom, atom in enumerate(mol.atoms): #TODO: deal with pseudopotential electrons x, y, z = list(map(repr, atom.position.value_in(u.angstrom))) nbofile.append("%d %d %s %s %s" % (atom.atnum, atom.atnum, x, y, z)) nbofile.append("$END") nbofile.append("$BASIS") nbofile.append(' CENTER = ' + ' '.join(str(1+bfn.atom.index) for bfn in wfn.aobasis)) nbofile.append(" LABEL = " + ' '.join(str(AOLABELS[bfn.orbtype]) for bfn in wfn.aobasis)) nbofile.append('$END') #TODO: deal with CI wavefunctions ($WF keyword) nbofile.append('$OVERLAP') append_matrix(nbofile, wfn.aobasis.overlaps) nbofile.append('$END') nbofile.append('$DENSITY') append_matrix(nbofile, wfn.density_matrix) nbofile.append('$END') return '\n '.join(nbofile) def parse_nbo(f, nbasis): lines = f.__iter__() parsed = {} while True: try: l = next(lines) except StopIteration: break fields = l.split() if fields[1:5] == 'in the AO basis:'.split(): orbname = fields[0] assert orbname[-1] == 's' orbname = orbname[:-1] next(lines) if orbname[0] == 'P': # these are pre-orthogonal orbitals, it only prints the coefficients coeffs = _parse_wrapped_matrix(lines, nbasis) parsed[orbname] = utils.DotDict(coeffs=np.array(coeffs)) else: # there's more complete information available parsed[orbname] = read_orbital_set(lines, nbasis) return parsed def read_orbital_set(lineiter, nbasis): # First, get the actual matrix mat = _parse_wrapped_matrix(lineiter, nbasis) # First, occupation numbers occupations = list(map(float,_get_wrapped_separated_vals(lineiter, nbasis))) # Next, a line of things that always appear to be ones (for spin orbitals maybe?) oneline = _get_wrapped_separated_vals(lineiter, nbasis) for x in oneline: assert x == '1' # next is number of atoms involved in the bond num_bonded_atoms = list(map(int, _get_wrapped_separated_vals(lineiter, nbasis))) bond_names = _get_wrapped_separated_vals(lineiter, nbasis) # Next indicates whether real or virtual stars = _get_wrapped_column_vals(lineiter, nbasis) for s in stars: assert (s == '' or s == '*') # number of bonds between this pair of atoms bondnums = list(map(int, _get_wrapped_separated_vals(lineiter, nbasis))) # first atom index (1-based) iatom = list(map(int, _get_wrapped_separated_vals(lineiter, nbasis))) jatom = list(map(int, _get_wrapped_separated_vals(lineiter, nbasis))) # The rest appears to be 0 most of the time ... return utils.DotDict(coeffs=np.array(mat), iatom=iatom, jatom=jatom, bondnums=bondnums, bond_names=bond_names, num_bonded_atoms=num_bonded_atoms, stars=stars, occupations=occupations) def _parse_wrapped_matrix(lineiter, nbasis): mat = [] for i in range(nbasis): currline = list(map(float, _get_wrapped_separated_vals(lineiter, nbasis))) assert len(currline) == nbasis mat.append(currline) return mat def _get_wrapped_separated_vals(lineiter, nbasis): vals = [] while True: l = next(lineiter) vals.extend(l.split()) if len(vals) == nbasis: break assert len(vals) < nbasis return vals def _get_wrapped_column_vals(lineiter, nbasis): vals = [] while True: l = next(lineiter.next)[1:] lenl = len(l) for i in range(20): if lenl <= 3*i + 1: break vals.append(l[3*i: 3*i + 3].strip()) if len(vals) == nbasis: break assert len(vals) < nbasis return vals def append_matrix(l, mat): for row in mat: icol = 0 while icol < len(row): l.append(' ' + ' '.join(map(repr, row[icol:icol + 6]))) icol += 6 AOLABELS = {'s': 1, 'px': 101, 'py': 102, 'pz': 103, "dxx": 201, "dxy": 202, "dxz": 203, "dyy": 204, "dyz": 205, "dzz": 206, "fxxx": 301, "fxxy": 302, "fxxz": 303, "fxyy": 304, "fxyz": 305, "fxzz": 306, "fyyy": 307, "fyyz": 308, "fyzz": 309, "fzzz": 310, "gxxxx": 401, "gxxxy": 402, "gxxxz": 403, "gxxyy": 404, "gxxyz": 405, "gxxzz": 406, "gxyyy": 407, "gxyyz": 408, "gxyzz": 409, "gxzzz": 410, "gyyyy": 411, "gyyyz": 412, "gyyzz": 413, "gyzzz": 414, "gzzzz": 415, # end of cartesian # start of spherical: 'p(x)': 151, 'p(y)': 152, 'p(z)': 153, "d(xy)": 251, "d(xz)": 252, "d(yz)": 253, "d(x2-y2)": 254, "d(z2)": 255, "f(z(5z2-3r2))": 351, "f(x(5z2-r2))": 352, "f(y(5z2-r2))": 353, "f(z(x2-y2))": 354, "f(xyz)": 355, "f(x(x2-3y2))": 356, "f(y(3x2-y2))": 357}
apache-2.0
3,648,654,696,899,533,000
35.405303
110
0.553949
false
3.169855
false
false
false
wufangjie/leetcode
187. Repeated DNA Sequences.py
1
1241
class Solution(object): def findRepeatedDnaSequences(self, s): """ :type s: str :rtype: List[str] """ more_than_once, once = set(), set() for i in range(len(s) - 9): t = s[i:i+10] if t not in more_than_once: if t in once: more_than_once.add(t) else: once.add(t) return list(more_than_once) # if overlap is not permit # more_than_once, once = {}, {} # for i in range(len(s) - 9): # t = s[i:i+10] # if t not in more_than_once: # if t in once: # more_than_once[t] = [once[t], i] # else: # once[t] = i # else: # more_than_once[t][1] = i # return list(k for k, v in more_than_once.items() if v[1] - v[0] >= 10) if __name__ == '__main__': assert sorted(Solution().findRepeatedDnaSequences("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT")) == ['AAAAACCCCC', 'CCCCCAAAAA'] assert Solution().findRepeatedDnaSequences('AAAAAAAAAAA') == ['AAAAAAAAAA'] # assert Solution().findRepeatedDnaSequences('AAAAAAAAAAAAAAAAAAAA') == ['AAAAAAAAAA']
gpl-3.0
-132,350,777,096,766,640
36.606061
122
0.48751
false
3.447222
false
false
false
ging/keystone
keystone/contrib/keystone_scim/routers.py
1
11710
# # Copyright 2014 Telefonica Investigacion y Desarrollo, S.A.U # # Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. """WSGI Routers for the SCIM API.""" from keystone.common import wsgi import controllers class ScimRouter(wsgi.ExtensionRouter): PATH_PREFIX = '/OS-SCIM' def add_routes(self, mapper): user_controller = controllers.ScimUserV3Controller() role_controller = controllers.ScimRoleV3Controller() group_controller = controllers.ScimGroupV3Controller() scim_info_controller = controllers.ScimInfoController() org_controller = controllers.ScimOrganizationV3Controller() # Users v1.1 mapper.connect(self.PATH_PREFIX + '/v1/Users', controller=user_controller, action='list_users', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v1/Users', controller=user_controller, action='create_user', conditions=dict(method=['POST'])) mapper.connect(self.PATH_PREFIX + '/v1/Users/{user_id}', controller=user_controller, action='get_user', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v1/Users/{user_id}', controller=user_controller, action='patch_user', conditions=dict(method=['PATCH'])) mapper.connect(self.PATH_PREFIX + '/v1/Users/{user_id}', controller=user_controller, action='put_user', conditions=dict(method=['PUT'])) mapper.connect(self.PATH_PREFIX + '/v1/Users/{user_id}', controller=user_controller, action='delete_user', conditions=dict(method=['DELETE'])) # Users /v2 mapper.connect(self.PATH_PREFIX + '/v2/Users', controller=user_controller, action='list_users', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Users', controller=user_controller, action='create_user', conditions=dict(method=['POST'])) mapper.connect(self.PATH_PREFIX + '/v2/Users/{user_id}', controller=user_controller, action='get_user', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Users/{user_id}', controller=user_controller, action='patch_user', conditions=dict(method=['PATCH'])) mapper.connect(self.PATH_PREFIX + '/v2/Users/{user_id}', controller=user_controller, action='put_user', conditions=dict(method=['PUT'])) mapper.connect(self.PATH_PREFIX + '/v2/Users/{user_id}', controller=user_controller, action='delete_user', conditions=dict(method=['DELETE'])) # Roles v1.1 mapper.connect(self.PATH_PREFIX + '/v1/Roles', controller=role_controller, action='scim_list_roles', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v1/Roles', controller=role_controller, action='scim_create_role', conditions=dict(method=['POST'])) mapper.connect(self.PATH_PREFIX + '/v1/Roles/{role_id}', controller=role_controller, action='scim_get_role', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v1/Roles/{role_id}', controller=role_controller, action='scim_patch_role', conditions=dict(method=['PATCH'])) mapper.connect(self.PATH_PREFIX + '/v1/Roles/{role_id}', controller=role_controller, action='scim_put_role', conditions=dict(method=['PUT'])) mapper.connect(self.PATH_PREFIX + '/v1/Roles/{role_id}', controller=role_controller, action='scim_delete_role', conditions=dict(method=['DELETE'])) # Roles /v2 mapper.connect(self.PATH_PREFIX + '/v2/Roles', controller=role_controller, action='scim_list_roles', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Roles', controller=role_controller, action='scim_create_role', conditions=dict(method=['POST'])) mapper.connect(self.PATH_PREFIX + '/v2/Roles/{role_id}', controller=role_controller, action='scim_get_role', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Roles/{role_id}', controller=role_controller, action='scim_patch_role', conditions=dict(method=['PATCH'])) mapper.connect(self.PATH_PREFIX + '/v2/Roles/{role_id}', controller=role_controller, action='scim_put_role', conditions=dict(method=['PUT'])) mapper.connect(self.PATH_PREFIX + '/v2/Roles/{role_id}', controller=role_controller, action='scim_delete_role', conditions=dict(method=['DELETE'])) # Groups v1.1 mapper.connect(self.PATH_PREFIX + '/v1/Groups', controller=group_controller, action='list_groups', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v1/Groups', controller=group_controller, action='create_group', conditions=dict(method=['POST'])) mapper.connect(self.PATH_PREFIX + '/v1/Groups/{group_id}', controller=group_controller, action='get_group', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v1/Groups/{group_id}', controller=group_controller, action='patch_group', conditions=dict(method=['PATCH'])) mapper.connect(self.PATH_PREFIX + '/v1/Groups/{group_id}', controller=group_controller, action='put_group', conditions=dict(method=['PUT'])) mapper.connect(self.PATH_PREFIX + '/v1/Groups/{group_id}', controller=group_controller, action='delete_group', conditions=dict(method=['DELETE'])) # Groups mapper.connect(self.PATH_PREFIX + '/v2/Groups', controller=group_controller, action='list_groups', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Groups', controller=group_controller, action='create_group', conditions=dict(method=['POST'])) mapper.connect(self.PATH_PREFIX + '/v2/Groups/{group_id}', controller=group_controller, action='get_group', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Groups/{group_id}', controller=group_controller, action='patch_group', conditions=dict(method=['PATCH'])) mapper.connect(self.PATH_PREFIX + '/v2/Groups/{group_id}', controller=group_controller, action='put_group', conditions=dict(method=['PUT'])) mapper.connect(self.PATH_PREFIX + '/v2/Groups/{group_id}', controller=group_controller, action='delete_group', conditions=dict(method=['DELETE'])) # SCIM Info mapper.connect(self.PATH_PREFIX + '/v1/ServiceProviderConfigs', controller=scim_info_controller, action='scim_get_service_provider_configs', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v1/Schemas', controller=scim_info_controller, action='scim_get_schemas', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/ServiceProviderConfigs', controller=scim_info_controller, action='scim_get_service_provider_configs', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Schemas', controller=scim_info_controller, action='scim_get_schemas', conditions=dict(method=['GET'])) # Organizations mapper.connect(self.PATH_PREFIX + '/v2/Organizations', controller=org_controller, action='list_organizations', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Organizations', controller=org_controller, action='create_organization', conditions=dict(method=['POST'])) mapper.connect(self.PATH_PREFIX + '/v2/Organizations/{organization_id}', controller=org_controller, action='get_organization', conditions=dict(method=['GET'])) mapper.connect(self.PATH_PREFIX + '/v2/Organizations/{organization_id}', controller=org_controller, action='patch_organization', conditions=dict(method=['PATCH'])) mapper.connect(self.PATH_PREFIX + '/v2/Organizations/{organization_id}', controller=org_controller, action='put_organization', conditions=dict(method=['PUT'])) mapper.connect(self.PATH_PREFIX + '/v2/Organizations/{organization_id}', controller=org_controller, action='delete_organization', conditions=dict(method=['DELETE']))
apache-2.0
2,083,376,882,307,337,700
40.378092
80
0.514944
false
4.812988
false
false
false
openid/python-openid
openid/yadis/manager.py
1
6142
from __future__ import unicode_literals class YadisServiceManager(object): """Holds the state of a list of selected Yadis services, managing storing it in a session and iterating over the services in order.""" def __init__(self, starting_url, yadis_url, services, session_key): # The URL that was used to initiate the Yadis protocol self.starting_url = starting_url # The URL after following redirects (the identifier) self.yadis_url = yadis_url # List of service elements self.services = list(services) self.session_key = session_key # Reference to the current service object self._current = None def __len__(self): """How many untried services remain?""" return len(self.services) def __iter__(self): return self def next(self): """Return the next service self.current() will continue to return that service until the next call to this method.""" try: self._current = self.services.pop(0) except IndexError: raise StopIteration else: return self._current def current(self): """Return the current service. Returns None if there are no services left. """ return self._current def forURL(self, url): return url in [self.starting_url, self.yadis_url] def started(self): """Has the first service been returned?""" return self._current is not None def store(self, session): """Store this object in the session, by its session key.""" session[self.session_key] = self class Discovery(object): """State management for discovery. High-level usage pattern is to call .getNextService(discover) in order to find the next available service for this user for this session. Once a request completes, call .finish() to clean up the session state. @ivar session: a dict-like object that stores state unique to the requesting user-agent. This object must be able to store serializable objects. @ivar url: the URL that is used to make the discovery request @ivar session_key_suffix: The suffix that will be used to identify this object in the session object. """ DEFAULT_SUFFIX = 'auth' PREFIX = '_yadis_services_' def __init__(self, session, url, session_key_suffix=None): """Initialize a discovery object""" self.session = session self.url = url if session_key_suffix is None: session_key_suffix = self.DEFAULT_SUFFIX self.session_key_suffix = session_key_suffix def getNextService(self, discover): """Return the next authentication service for the pair of user_input and session. This function handles fallback. @param discover: a callable that takes a URL and returns a list of services @type discover: six.text_type -> [service] @return: the next available service """ manager = self.getManager() if manager is not None and not manager: self.destroyManager() if not manager: yadis_url, services = discover(self.url) manager = self.createManager(services, yadis_url) if manager: service = manager.next() manager.store(self.session) else: service = None return service def cleanup(self, force=False): """Clean up Yadis-related services in the session and return the most-recently-attempted service from the manager, if one exists. @param force: True if the manager should be deleted regardless of whether it's a manager for self.url. @return: current service endpoint object or None if there is no current service """ manager = self.getManager(force=force) if manager is not None: service = manager.current() self.destroyManager(force=force) else: service = None return service # Lower-level methods def getSessionKey(self): """Get the session key for this starting URL and suffix @return: The session key @rtype: six.text_type """ return self.PREFIX + self.session_key_suffix def getManager(self, force=False): """Extract the YadisServiceManager for this object's URL and suffix from the session. @param force: True if the manager should be returned regardless of whether it's a manager for self.url. @return: The current YadisServiceManager, if it's for this URL, or else None """ manager = self.session.get(self.getSessionKey()) if (manager is not None and (manager.forURL(self.url) or force)): return manager else: return None def createManager(self, services, yadis_url=None): """Create a new YadisService Manager for this starting URL and suffix, and store it in the session. @raises KeyError: When I already have a manager. @return: A new YadisServiceManager or None """ key = self.getSessionKey() if self.getManager(): raise KeyError('There is already a %r manager for %r' % (key, self.url)) if not services: return None manager = YadisServiceManager(self.url, yadis_url, services, key) manager.store(self.session) return manager def destroyManager(self, force=False): """Delete any YadisServiceManager with this starting URL and suffix from the session. If there is no service manager or the service manager is for a different URL, it silently does nothing. @param force: True if the manager should be deleted regardless of whether it's a manager for self.url. """ if self.getManager(force=force) is not None: key = self.getSessionKey() del self.session[key]
apache-2.0
8,008,034,754,780,183,000
30.020202
73
0.620156
false
4.542899
false
false
false
mojodna/debian-mapnik
plugins/input/osm/build.py
1
1631
# # This file is part of Mapnik (c++ mapping toolkit) # # Copyright (C) 2007 Artem Pavlenko, Jean-Francois Doyon # # Mapnik is free software; you can redistribute it and/or # modify it under the terms of the GNU Lesser General Public # License as published by the Free Software Foundation; either # version 2.1 of the License, or (at your option) any later version. # # This library is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU # Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this library; if not, write to the Free Software # Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA # # $Id$ Import ('env') prefix = env['PREFIX'] plugin_env = env.Clone() osm_src = Split( """ osmparser.cpp osm.cpp osm_datasource.cpp osm_featureset.cpp dataset_deliverer.cpp basiccurl.cpp """ ) libraries = [ 'xml2' ] libraries.append('curl') libraries.append('mapnik') libraries.append(env['ICU_LIB_NAME']) input_plugin = plugin_env.SharedLibrary('../osm', source=osm_src, SHLIBPREFIX='', SHLIBSUFFIX='.input', LIBS=libraries, LINKFLAGS=env['CUSTOM_LDFLAGS']) # if the plugin links to libmapnik ensure it is built first Depends(input_plugin, env.subst('../../../src/%s' % env['MAPNIK_LIB_NAME'])) if 'uninstall' not in COMMAND_LINE_TARGETS: env.Install(env['MAPNIK_INPUT_PLUGINS_DEST'], input_plugin) env.Alias('install', env['MAPNIK_INPUT_PLUGINS_DEST'])
lgpl-2.1
7,205,425,582,168,794,000
30.980392
152
0.72103
false
3.369835
false
false
false
dudulianangang/vps
EneConsTest.py
1
5969
import sdf import matplotlib.pyplot as plt import numpy as np import matplotlib as mpl plt.style.use('seaborn-white') # plt.rcParams['font.family'] = 'sans-serif' # plt.rcParams['font.sans-serif'] = 'Tahoma' # # plt.rcParams['font.monospace'] = 'Ubuntu Mono' plt.rcParams['font.size'] = 16 # plt.rcParams['axes.labelsize'] = 10 # plt.rcParams['axes.labelweight'] = 'bold' # plt.rcParams['xtick.labelsize'] = 8 # plt.rcParams['ytick.labelsize'] = 8 # plt.rcParams['legend.fontsize'] = 10 # plt.rcParams['figure.titlesize'] = 12 # constants for normalization n0 = 1.8e20 me = 9.1e-31 qe = 1.6e-19 ep = 8.9e-12 c = 3e8 wp = np.sqrt(n0*qe*qe/me/ep) ld = c/wp e0 = me*c*wp/qe b0 = e0/c tt = 1/wp ts = 50*5 te = 1500 pct = 100 en0 = me*c**2 en1 = 0.5*ep*ld**2 # simulation domain nx = 3500 ny = 3500 lx = 3500 ly = 3500 # figure domain (set by grid) grid_min_x = 0 grid_max_x = nx grid_min_y = 0 grid_max_y = ny Gx = np.linspace(0,lx,nx) Gy = np.linspace(0,ly,ny) gx = Gx[grid_min_x:grid_max_x+1] gy = Gy[grid_min_y:grid_max_y+1] # figure parameters # fs = 24 jetcmap = plt.cm.get_cmap("rainbow", 9) #generate a jet map with 10 values jet_vals = jetcmap(np.arange(9)) #extract those values as an array jet_vals[0] = [1.0, 1, 1.0, 1] #change the first value newcmap = mpl.colors.LinearSegmentedColormap.from_list("newjet", jet_vals) # define array EneBmE = np.ones(7) EneBmI = np.ones(7) EneBgE = np.ones(7) EneBgI = np.ones(7) sex = np.ones(7) sey = np.ones(7) sez = np.ones(7) sbx = np.ones(7) sby = np.ones(7) sbz = np.ones(7) TpeC1 = np.ones(7) TpeS1 = np.ones(7) TfeC1 = np.ones(7) TfeS1 = np.ones(7) TpeC2 = np.ones(7) TpeS2 = np.ones(7) TfeC2 = np.ones(7) TfeS2 = np.ones(7) TeC1 = np.ones(7) TeS1 = np.ones(7) TeC2 = np.ones(7) TeS2 = np.ones(7) time = np.ones(7) # plot function file = '/Volumes/yaowp2016/' folder = 'nj' for i in range(7): ii = i*5 time[i] = i*ts fname = file+folder+'/6'+str(ii).zfill(4)+'.sdf' datafile = sdf.read(fname) GamBmE = datafile.Particles_Gamma_subset_ele1_ele_bm.data GamBmI = datafile.Particles_Gamma_subset_ion1_ion_bm.data GamBgE = datafile.Particles_Gamma_subset_ele1_ele_e.data GamBgI = datafile.Particles_Gamma_subset_ion1_ion_e.data WgtBmE = datafile.Particles_Weight_subset_ele1_ele_bm.data WgtBmI = datafile.Particles_Weight_subset_ion1_ion_bm.data WgtBgE = datafile.Particles_Weight_subset_ele1_ele_e.data WgtBgI = datafile.Particles_Weight_subset_ion1_ion_e.data EneBmE[i] = np.sum((GamBmE-1)*en0*np.mean(WgtBmE))*pct EneBmI[i] = np.sum((GamBmI-1)*en0*np.mean(WgtBmI))*pct EneBgE[i] = np.sum((GamBgE-1)*en0*np.mean(WgtBgE))*pct EneBgI[i] = np.sum((GamBgI-1)*en0*np.mean(WgtBgI))*pct fname = file+folder+'/'+str(ii).zfill(4)+'.sdf' datafile = sdf.read(fname) Ex = datafile.Electric_Field_Ex.data Ey = datafile.Electric_Field_Ey.data Ez = datafile.Electric_Field_Ez.data Bx = datafile.Magnetic_Field_Bx.data*c By = datafile.Magnetic_Field_By.data*c Bz = datafile.Magnetic_Field_Bz.data*c sex[i] = np.sum(Ex**2)*en1 sey[i] = np.sum(Ey**2)*en1 sez[i] = np.sum(Ez**2)*en1 sbx[i] = np.sum(Bx**2)*en1 sby[i] = np.sum(By**2)*en1 sbz[i] = np.sum(Bz**2)*en1 TpeC1[i] = EneBmE[i]+EneBmI[i]+EneBgE[i]+EneBgI[i] TfeC1[i] = sex[i]+sey[i]+sez[i]+sbx[i]+sby[i]+sbz[i] TfeS1[i] = datafile.Total_Field_Energy_in_Simulation__J_.data TpeS1[i] = datafile.Total_Particle_Energy_in_Simulation__J_.data folder = 'nj_non' for i in range(7): ii = i*5 time[i] = i*ts fname = file+folder+'/6'+str(ii).zfill(4)+'.sdf' datafile = sdf.read(fname) GamBmE = datafile.Particles_Gamma_subset_ele1_ele_bm.data GamBmI = datafile.Particles_Gamma_subset_ion1_ion_bm.data GamBgE = datafile.Particles_Gamma_subset_ele1_ele_e.data GamBgI = datafile.Particles_Gamma_subset_ion1_ion_e.data WgtBmE = datafile.Particles_Weight_subset_ele1_ele_bm.data WgtBmI = datafile.Particles_Weight_subset_ion1_ion_bm.data WgtBgE = datafile.Particles_Weight_subset_ele1_ele_e.data WgtBgI = datafile.Particles_Weight_subset_ion1_ion_e.data EneBmE[i] = np.sum((GamBmE-1)*en0*np.mean(WgtBmE))*pct EneBmI[i] = np.sum((GamBmI-1)*en0*np.mean(WgtBmI))*pct EneBgE[i] = np.sum((GamBgE-1)*en0*np.mean(WgtBgE))*pct EneBgI[i] = np.sum((GamBgI-1)*en0*np.mean(WgtBgI))*pct fname = file+folder+'/'+str(ii).zfill(4)+'.sdf' datafile = sdf.read(fname) Ex = datafile.Electric_Field_Ex.data Ey = datafile.Electric_Field_Ey.data Ez = datafile.Electric_Field_Ez.data Bx = datafile.Magnetic_Field_Bx.data*c By = datafile.Magnetic_Field_By.data*c Bz = datafile.Magnetic_Field_Bz.data*c sex[i] = np.sum(Ex**2)*en1 sey[i] = np.sum(Ey**2)*en1 sez[i] = np.sum(Ez**2)*en1 sbx[i] = np.sum(Bx**2)*en1 sby[i] = np.sum(By**2)*en1 sbz[i] = np.sum(Bz**2)*en1 TpeC2[i] = EneBmE[i]+EneBmI[i]+EneBgE[i]+EneBgI[i] TfeC2[i] = sex[i]+sey[i]+sez[i]+sbx[i]+sby[i]+sbz[i] TfeS2[i] = datafile.Total_Field_Energy_in_Simulation__J_.data TpeS2[i] = datafile.Total_Particle_Energy_in_Simulation__J_.data TeC1 = TpeC1+TfeC1 TeS1 = TpeS1+TfeS1 TeC2 = TpeC2+TfeC2 TeS2 = TpeS2+TfeS2 np.save('tpec1.npy', TpeC1) np.save('tpes1.npy', TpeS1) np.save('tfec1.npy', TfeC1) np.save('tfes1.npy', TfeS1) np.save('tpec2.npy', TpeC2) np.save('tpes2.npy', TpeS2) np.save('tfec2.npy', TfeC2) np.save('tfes2.npy', TfeS2) np.save('tec1.npy', TeC1) np.save('tes1.npy', TeS1) np.save('tec2.npy', TeC2) np.save('tes2.npy', TeS2) # plt.figure(figsize=(8,5)) # ax = plt.subplot() # ax.plot(time, TpeC1,'r-', lw=2, label='tbc-cal') # ax.plot(time, TpeS1,'r--', lw=2, label='tbc-sys') # ax.plot(time, TpeC2,'b-', lw=2, label='pbc-cal') # ax.plot(time, TpeS2,'b--', lw=2, label='pbc-sys') # plt.xlabel('time($\omega_{pe}^{-1}$)',fontsize=24) # plt.ylabel('energy($J$)',fontsize=24) # plt.legend(loc='best', numpoints=1, fancybox=True) # plt.title('total system energy',fontsize=32,fontstyle='normal') # plt.show() # plt.savefig(file+folder+'/plots/'+'TotalEnergyComp.png',bbox_inches='tight') # n means normalized # plt.close()
apache-2.0
-2,299,900,135,137,136,400
26.892523
100
0.675658
false
2.017236
false
false
false
Adamssss/projectEuler
pb347.py
1
1198
import math import time t1 = time.time() N = 10000000 prime = [] def primeSieve(n): global prime n = (n+1)//2 p = [True]*(n) i = 1 prime.append(2) while i < n: if p[i]: t = 2*i+1 prime.append(t) p[i] = False j = 2*i*i+2*i while j < n: p[j] = False j += t i += 1 return prime primeSieve(N//2 + 100) def S(n): result = 0 for i in range(0,len(prime)-1): if prime[i]*prime[i] > n: break for j in range(i+1,len(prime)): if prime[i]*prime[j] > n: break result += M(prime[i],prime[j],n) return result def M(p,q,n): if p*q > n: return 0 m = p*q r = m*Mh(p,q,n//m) #print(p,q,n,r) return r def Mh(p,q,n): if p > n and q > n: return 1 t = 1 c = 0 while t <= n: t= p*t c += 1 t = t//p c -= 1 m = t while c > 0: t = t//p c -= 1 if t*q <= n: t = t*q if t > m: m = t return m print(S(N)) print("time:",time.time()-t1)
mit
9,094,591,799,074,366,000
14.558442
44
0.3798
false
2.812207
false
false
false
tisnik/fabric8-analytics-common
integration-tests/features/steps/jobs_api.py
1
14506
"""Tests for jobs API endpoints.""" import os import requests import uuid from behave import given, then, when from src.attribute_checks import check_timestamp, check_job_token_attributes from src.parsing import parse_token_clause from src.authorization_tokens import jobs_api_authorization @given('Jobs debug API is running') def running_jobs_debug_api(context): """Wait for the job debug REST API to be available.""" if not context.is_jobs_debug_api_running(context): context.wait_for_jobs_debug_api_service(context, 60) @when('I access jobs API {url:S}') def jobs_api_url(context, url): """Access the jobs service API using the HTTP GET method.""" context.response = requests.get(context.jobs_api_url + url) @when('I access jobs API {url:S} with authorization token') def jobs_api_url_with_authorization_token(context, url): """Access the jobs service API using the HTTP GET method.""" context.response = requests.get(context.jobs_api_url + url, headers=jobs_api_authorization(context)) @when('I read list of jobs') @when('I read list of jobs with type {type}') @when('I read list of jobs {token} authorization token') @when('I read list of jobs with type {type} {token} authorization token') def list_of_jobs(context, type=None, token=None): """Read list of jobs via job API.""" endpoint = job_endpoint(context) if type is not None: endpoint += "?job_type=" + type use_token = parse_token_clause(token) if use_token: context.response = requests.get(endpoint, headers=jobs_api_authorization(context)) else: context.response = requests.get(endpoint) def check_all_report_attributes(report): """Check all report attributes.""" attributes = ["analyses", "analyses_finished", "analyses_finished_unique", "analyses_unfinished", "analyses_unique", "packages", "packages_finished", "versions"] for attribute in attributes: assert attribute in report assert int(report[attribute]) >= 0 @then('I should see proper analyses report') def check_job_debug_analyses_report(context): """Check the analyses report returned by job API.""" json_data = context.response.json() assert json_data is not None assert "now" in json_data check_timestamp(json_data["now"]) assert "report" in json_data report = json_data["report"] check_all_report_attributes(report) def flow_sheduling_endpoint(context, state, job_id=None): """Return URL to flow-scheduling with the given state and job ID.""" if job_id: return "{jobs_api_url}api/v1/jobs/flow-scheduling?state={state}&job_id={job_id}".\ format(jobs_api_url=context.jobs_api_url, state=state, job_id=job_id) else: return "{jobs_api_url}api/v1/jobs/flow-scheduling?state={state}".\ format(jobs_api_url=context.jobs_api_url, state=state) def job_metadata_filename(metadata): """Construct relative filename to job metadata.""" return "data/{metadata}".format(metadata=metadata) def job_endpoint(context, job_id=None): """Return URL for given job id that can be used to job state manipulation.""" url = "{jobs_api_url}api/v1/jobs".format( jobs_api_url=context.jobs_api_url) if job_id is not None: url = "{url}/{job_id}".format(url=url, job_id=job_id) return url def send_json_file_to_job_api(context, endpoint, filename, use_token): """Send the given file to the selected job API endpoints. If the use_token is set, send the 'auth-token' header with the token taken from the context environment. """ if use_token: headers = jobs_api_authorization(context) context.response = context.send_json_file(endpoint, filename, headers) else: context.response = context.send_json_file(endpoint, filename) @when("I post a job metadata {metadata} with state {state}") @when("I post a job metadata {metadata} with state {state} {token} authorization token") def perform_post_job(context, metadata, state, token="without"): """Perform API call to create a new job using the provided metadata. The token parameter can be set to 'with', 'without', or 'using'. """ filename = job_metadata_filename(metadata) endpoint = flow_sheduling_endpoint(context, state) use_token = parse_token_clause(token) send_json_file_to_job_api(context, endpoint, filename, use_token) def get_unique_job_id(context, job_id): """Return unique job ID consisting of generated UUID and actual ID.""" if 'job_id_prefix' in context: return "{uuid}_{job_id}".format(uuid=context.job_id_prefix, job_id=job_id) else: return job_id @when("I post a job metadata {metadata} with job id {job_id} and state {state}") @when("I post a job metadata {metadata} with job id {job_id} and state {state} {token} " "authorization token") def perform_post_job_with_state(context, metadata, job_id, state, token="without"): """Perform API call to create a new job. The new job is created using the provided metadata and set a job to given state. The token parameter can be set to 'with', 'without', or 'using'. """ filename = job_metadata_filename(metadata) job_id = get_unique_job_id(context, job_id) endpoint = flow_sheduling_endpoint(context, state, job_id) use_token = parse_token_clause(token) send_json_file_to_job_api(context, endpoint, filename, use_token) @when("I delete job without id") @when("I delete job without id {token} authorization token") @when("I delete job with id {job_id}") @when("I delete job with id {job_id} {token} authorization token") def delete_job(context, job_id=None, token="without"): """Perform API call to delete a job with given ID.""" job_id = get_unique_job_id(context, job_id) endpoint = job_endpoint(context, job_id) use_token = parse_token_clause(token) if use_token: context.response = requests.delete(endpoint, headers=jobs_api_authorization(context)) else: context.response = requests.delete(endpoint) @when("I set status for job with id {job_id} to {status}") @when("I set status for job with id {job_id} to {status} {token} authorization token") def set_job_status(context, job_id, status, token="without"): """Perform API call to set job status.""" endpoint = job_endpoint(context, job_id) url = "{endpoint}?state={status}".format(endpoint=endpoint, status=status) use_token = parse_token_clause(token) if use_token: context.response = requests.put(url, headers=jobs_api_authorization(context)) else: context.response = requests.put(url) @when("I reset status for the job service") @when("I set status for job service to {status}") @when("I set status for job service to {status} {token} authorization token") def set_job_service_status(context, status=None, token="without"): """Perform API call to set or reset job service status.""" url = "{jobs_api_url}api/v1/service/state".format( jobs_api_url=context.jobs_api_url) use_token = parse_token_clause(token) if status is not None: url = "{url}?state={status}".format(url=url, status=status) if use_token: context.response = requests.put(url, headers=jobs_api_authorization(context)) else: context.response = requests.put(url) @when("I clean all failed jobs") @when("I clean all failed jobs {token} authorization token") def clean_all_failed_jobs(context, token="without"): """Perform API call to clean up all failed jobs.""" url = "{url}api/v1/jobs/clean-failed".format(url=context.jobs_api_url) use_token = parse_token_clause(token) if use_token: context.response = requests.delete(url, headers=jobs_api_authorization(context)) else: context.response = requests.delete(url) @when('I logout from the job service') @when('I logout from the job service {token} authorization token') def logout_from_the_jobs_service(context, token='without'): """Call API to logout from the job service.""" url = "{jobs_api_url}api/v1/logout".format( jobs_api_url=context.jobs_api_url) use_token = parse_token_clause(token) if use_token: headers = jobs_api_authorization(context) context.response = requests.put(url, headers) else: context.response = requests.put(url) @when('I access the job service endpoint to generate token') def job_service_generate_token(context): """Generate token for the job service.""" url = "{jobs_api_url}api/v1/generate-token".format( jobs_api_url=context.jobs_api_url) context.response = requests.get(url) @then('I should be redirected to {url}') def check_redirection(context, url): """Check the response with redirection.""" assert context.response is not None assert context.response.history is not None assert context.response.url is not None assert context.response.url.startswith(url) @when("I ask for analyses report for ecosystem {ecosystem}") @when("I ask for analyses report for ecosystem {ecosystem} {token} authorization token") @when("I ask for analyses report for ecosystem {ecosystem} from date {from_date} {token} " "authorization token") @when("I ask for analyses report for ecosystem {ecosystem} to date {to_date} {token} " "authorization token") @when("I ask for analyses report for ecosystem {ecosystem} between dates {from_date} {to_date} " "{token} authorization token") def access_analyses_report(context, ecosystem, from_date=None, to_date=None, token="without"): """Perform API call to get analyses report for selected ecosystem.""" use_token = parse_token_clause(token) url = "{url}api/v1/debug/analyses-report?ecosystem={ecosystem}".format( url=context.jobs_api_url, ecosystem=ecosystem) if from_date is not None: url += "&from_date=" + from_date if to_date is not None: url += "&to_date=" + to_date if use_token: headers = jobs_api_authorization(context) context.response = requests.get(url, headers=headers) else: context.response = requests.get(url) def get_jobs_count(context): """Return job count read from the JSON response.""" jsondata = context.response.json() jobs = jsondata['jobs'] assert jobs is not None return jsondata['jobs_count'] @then('I should see {num:d} jobs') def check_jobs_count(context, num): """Check the number of jobs.""" jobs_count = get_jobs_count(context) assert jobs_count == num @then('I should see N jobs') def check_jobs(context): """Check and remember the number of jobs.""" jobs_count = get_jobs_count(context) context.jobs_count = jobs_count @then('I should see N+{num:d} jobs') def check_jobs_count_plus_one(context, num): """Check the relative jobs count and remember the number of jobs.""" assert context.jobs_count is not None, \ "Please use 'I should see N jobs' test step first" old_jobs_count = context.jobs_count jobs_count = get_jobs_count(context) expected = old_jobs_count + num assert jobs_count == expected, "Expected %d jobs, but %d found instead" % \ (expected, jobs_count) # remember the new number context.jobs_count = jobs_count def get_job_by_id(jobs, job_id): """Find the job by its ID.""" return next((job for job in jobs if job["job_id"] == job_id), None) def check_job_state(job, state): """Check the state of given job.""" assert job is not None assert job["state"] is not None assert job["state"] == state @then('I should find job with ID {job_id}') @then('I should find job with ID {job_id} and state {state}') def find_job(context, job_id, state=None): """Check the job ID existence. Check if job with given ID is returned from the service and optionally if the job status has expected value. """ jsondata = context.response.json() jobs = jsondata['jobs'] job_id = get_unique_job_id(context, job_id) job_ids = [job["job_id"] for job in jobs] assert job_id in job_ids if state is not None: job = get_job_by_id(jobs, job_id) check_job_state(job, state) @then('I should not find job with ID {job_id}') def should_not_find_job_by_id(context, job_id): """Check if job with given ID does not exist.""" jsondata = context.response.json() jobs = jsondata['jobs'] job_id = get_unique_job_id(context, job_id) job_ids = [job["job_id"] for job in jobs] assert job_id not in job_ids @when('I acquire job API authorization token') def acquire_jobs_api_authorization_token(context): """Acquite the job API authorization token from the environment variable.""" context.jobs_api_token = os.environ.get("JOB_API_TOKEN") # TODO: authorization via GitHub? def check_token_attributes(token): """Check if given token has all required attributes.""" assert "token" in token assert "rate" in token assert "resources" in token def check_token_name(token): """Check token name.""" resources = token["resources"] token_names = ["core", "graphql", "search"] for token_name in token_names: assert token_name in resources check_job_token_attributes(resources[token_name]) @then('I should see proper information about job API tokens') def check_job_api_tokens_information(context): """Check the tokens information returned by job API.""" json_data = context.response.json() assert json_data is not None assert "tokens" in json_data tokens = json_data["tokens"] assert len(tokens) > 0 for token in tokens: check_token_attributes(token) rate_token = token["rate"] check_job_token_attributes(rate_token) check_token_name(token) @when('I generate unique job ID prefix') def generate_job_id_prefix(context): """Generate unique job ID prefix.""" context.job_id_prefix = uuid.uuid1() @when("I perform kerberized {method} request to {url}") def perform_kerberized_request(context, method, url): """Call REST API on coreapi-server.""" command = "curl -s -X {method} --negotiate -u : " + \ "http://coreapi-server:5000{url}".format(method=method, url=url) context.kerb_request = \ context.exec_command_in_container(context.client, context.container, command)
apache-2.0
-6,514,030,452,853,019,000
35.539043
96
0.674411
false
3.595935
false
false
false