task_url
stringlengths 30
116
| task_name
stringlengths 2
86
| task_description
stringlengths 0
14.4k
| language_url
stringlengths 2
53
| language_name
stringlengths 1
52
| code
stringlengths 0
61.9k
|
|---|---|---|---|---|---|
http://rosettacode.org/wiki/Bitmap/Bresenham%27s_line_algorithm | Bitmap/Bresenham's line algorithm | Task
Using the data storage type defined on the Bitmap page for raster graphics images,
draw a line given two points with Bresenham's line algorithm.
| #AutoIt | AutoIt | Local $var = drawBresenhamLine(2, 3, 2, 6)
Func drawBresenhamLine($iX0, $iY0, $iX1, $iY1)
Local $iDx = Abs($iX1 - $iX0)
Local $iSx = $iX0 < $iX1 ? 1 : -1
Local $iDy = Abs($iY1 - $iY0)
Local $iSy = $iY0 < $iY1 ? 1 : -1
Local $iErr = ($iDx > $iDy ? $iDx : -$iDy) / 2, $e2
While $iX0 <= $iX1
ConsoleWrite("plot( $x=" & $iX0 & ", $y=" & $iY0 & " )" & @LF)
If ($iX0 = $iX1) And ($iY0 = $iY1) Then Return
$e2 = $iErr
If ($e2 > -$iDx) Then
$iErr -= $iDy
$iX0 += $iSx
EndIf
If ($e2 < $iDy) Then
$iErr += $iDx
$iY0 += $iSy
EndIf
WEnd
EndFunc ;==>drawBresenhamLine |
http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation | Bioinformatics/Sequence mutation | Task
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
Choosing a random base position in the sequence.
Mutate the sequence by doing one of either:
Swap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
Delete the chosen base at the position.
Insert another base randomly chosen from A,C, G, or T into the sequence at that position.
Randomly generate a test DNA sequence of at least 200 bases
"Pretty print" the sequence and a count of its size, and the count of each base in the sequence
Mutate the sequence ten times.
"Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
Extra credit
Give more information on the individual mutations applied.
Allow mutations to be weighted and/or chosen. | #C | C |
#include<stdlib.h>
#include<stdio.h>
#include<time.h>
typedef struct genome{
char base;
struct genome *next;
}genome;
typedef struct{
char mutation;
int position;
}genomeChange;
typedef struct{
int adenineCount,thymineCount,cytosineCount,guanineCount;
}baseCounts;
genome *strand;
baseCounts baseData;
int genomeLength = 100, lineLength = 50;
int numDigits(int num){
int len = 1;
while(num>10){
num /= 10;
len++;
}
return len;
}
void generateStrand(){
int baseChoice = rand()%4, i;
genome *strandIterator, *newStrand;
baseData.adenineCount = 0;
baseData.thymineCount = 0;
baseData.cytosineCount = 0;
baseData.guanineCount = 0;
strand = (genome*)malloc(sizeof(genome));
strand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
strand->next = NULL;
strandIterator = strand;
for(i=1;i<genomeLength;i++){
baseChoice = rand()%4;
newStrand = (genome*)malloc(sizeof(genome));
newStrand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
newStrand->next = NULL;
strandIterator->next = newStrand;
strandIterator = newStrand;
}
}
genomeChange generateMutation(int swapWeight, int insertionWeight, int deletionWeight){
int mutationChoice = rand()%(swapWeight + insertionWeight + deletionWeight);
genomeChange mutationCommand;
mutationCommand.mutation = mutationChoice<swapWeight?'S':((mutationChoice>=swapWeight && mutationChoice<swapWeight+insertionWeight)?'I':'D');
mutationCommand.position = rand()%genomeLength;
return mutationCommand;
}
void printGenome(){
int rows, width = numDigits(genomeLength), len = 0,i,j;
lineLength = (genomeLength<lineLength)?genomeLength:lineLength;
rows = genomeLength/lineLength + (genomeLength%lineLength!=0);
genome* strandIterator = strand;
printf("\n\nGenome : \n--------\n");
for(i=0;i<rows;i++){
printf("\n%*d%3s",width,len,":");
for(j=0;j<lineLength && strandIterator!=NULL;j++){
printf("%c",strandIterator->base);
strandIterator = strandIterator->next;
}
len += lineLength;
}
while(strandIterator!=NULL){
printf("%c",strandIterator->base);
strandIterator = strandIterator->next;
}
printf("\n\nBase Counts\n-----------");
printf("\n%*c%3s%*d",width,'A',":",width,baseData.adenineCount);
printf("\n%*c%3s%*d",width,'T',":",width,baseData.thymineCount);
printf("\n%*c%3s%*d",width,'C',":",width,baseData.cytosineCount);
printf("\n%*c%3s%*d",width,'G',":",width,baseData.guanineCount);
printf("\n\nTotal:%*d",width,baseData.adenineCount + baseData.thymineCount + baseData.cytosineCount + baseData.guanineCount);
printf("\n");
}
void mutateStrand(int numMutations, int swapWeight, int insertionWeight, int deletionWeight){
int i,j,width,baseChoice;
genomeChange newMutation;
genome *strandIterator, *strandFollower, *newStrand;
for(i=0;i<numMutations;i++){
strandIterator = strand;
strandFollower = strand;
newMutation = generateMutation(swapWeight,insertionWeight,deletionWeight);
width = numDigits(genomeLength);
for(j=0;j<newMutation.position;j++){
strandFollower = strandIterator;
strandIterator = strandIterator->next;
}
if(newMutation.mutation=='S'){
if(strandIterator->base=='A'){
strandIterator->base='T';
printf("\nSwapping A at position : %*d with T",width,newMutation.position);
}
else if(strandIterator->base=='A'){
strandIterator->base='T';
printf("\nSwapping A at position : %*d with T",width,newMutation.position);
}
else if(strandIterator->base=='C'){
strandIterator->base='G';
printf("\nSwapping C at position : %*d with G",width,newMutation.position);
}
else{
strandIterator->base='C';
printf("\nSwapping G at position : %*d with C",width,newMutation.position);
}
}
else if(newMutation.mutation=='I'){
baseChoice = rand()%4;
newStrand = (genome*)malloc(sizeof(genome));
newStrand->base = baseChoice==0?'A':(baseChoice==1?'T':(baseChoice==2?'C':'G'));
printf("\nInserting %c at position : %*d",newStrand->base,width,newMutation.position);
baseChoice==0?baseData.adenineCount++:(baseChoice==1?baseData.thymineCount++:(baseChoice==2?baseData.cytosineCount++:baseData.guanineCount++));
newStrand->next = strandIterator;
strandFollower->next = newStrand;
genomeLength++;
}
else{
strandFollower->next = strandIterator->next;
strandIterator->next = NULL;
printf("\nDeleting %c at position : %*d",strandIterator->base,width,newMutation.position);
free(strandIterator);
genomeLength--;
}
}
}
int main(int argc,char* argv[])
{
int numMutations = 10, swapWeight = 10, insertWeight = 10, deleteWeight = 10;
if(argc==1||argc>6){
printf("Usage : %s <Genome Length> <Optional number of mutations> <Optional Swapping weight> <Optional Insertion weight> <Optional Deletion weight>\n",argv[0]);
return 0;
}
switch(argc){
case 2: genomeLength = atoi(argv[1]);
break;
case 3: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
break;
case 4: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
break;
case 5: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
insertWeight = atoi(argv[4]);
break;
case 6: genomeLength = atoi(argv[1]);
numMutations = atoi(argv[2]);
swapWeight = atoi(argv[3]);
insertWeight = atoi(argv[4]);
deleteWeight = atoi(argv[5]);
break;
};
srand(time(NULL));
generateStrand();
printf("\nOriginal:");
printGenome();
mutateStrand(numMutations,swapWeight,insertWeight,deleteWeight);
printf("\n\nMutated:");
printGenome();
return 0;
}
|
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Factor | Factor | USING: byte-arrays checksums checksums.sha io.binary kernel math
math.parser sequences ;
IN: rosetta-code.bitcoin.validation
CONSTANT: ALPHABET "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
: base58>bigint ( str -- n )
[ ALPHABET index ]
[ [ 58 * ] [ + ] bi* ] map-reduce ;
: base58> ( str -- bytes ) base58>bigint 25 >be ;
: btc-checksum ( bytes -- checksum-bytes )
21 head 2 [ sha-256 checksum-bytes ] times 4 head ;
: btc-valid? ( str -- ? ) base58> [ btc-checksum ] [ 4 tail* ] bi = ;
|
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #FreeBASIC | FreeBASIC | ' version 05-04-2017
' compile with: fbc -s console
' function adapted from the SHA-256 task
Function SHA_256(test_str As String, bitcoin As ULong = 0) As String
#Macro Ch (x, y, z)
(((x) And (y)) Xor ((Not (x)) And z))
#EndMacro
#Macro Maj (x, y, z)
(((x) And (y)) Xor ((x) And (z)) Xor ((y) And (z)))
#EndMacro
#Macro sigma0 (x)
(((x) Shr 2 Or (x) Shl 30) Xor ((x) Shr 13 Or (x) Shl 19) Xor ((x) Shr 22 Or (x) Shl 10))
#EndMacro
#Macro sigma1 (x)
(((x) Shr 6 Or (x) Shl 26) Xor ((x) Shr 11 Or (x) Shl 21) Xor ((x) Shr 25 Or (x) Shl 7))
#EndMacro
#Macro sigma2 (x)
(((x) Shr 7 Or (x) Shl 25) Xor ((x) Shr 18 Or (x) Shl 14) Xor ((x) Shr 3))
#EndMacro
#Macro sigma3 (x)
(((x) Shr 17 Or (x) Shl 15) Xor ((x) Shr 19 Or (x) Shl 13) Xor ((x) Shr 10))
#EndMacro
Dim As String message = test_str ' strings are passed as ByRef's
Dim As Long i, j
Dim As UByte Ptr ww1
Dim As UInteger<32> Ptr ww4
Do
Dim As ULongInt l = Len(message)
' set the first bit after the message to 1
message = message + Chr(1 Shl 7)
' add one char to the length
Dim As ULong padding = 64 - ((l +1) Mod (512 \ 8)) ' 512 \ 8 = 64 char.
' check if we have enough room for inserting the length
If padding < 8 Then padding = padding + 64
message = message + String(padding, Chr(0)) ' adjust length
Dim As ULong l1 = Len(message) ' new length
l = l * 8 ' orignal length in bits
' create ubyte ptr to point to l ( = length in bits)
Dim As UByte Ptr ub_ptr = Cast(UByte Ptr, @l)
For i = 0 To 7 'copy length of message to the last 8 bytes
message[l1 -1 - i] = ub_ptr[i]
Next
'table of constants
Dim As UInteger<32> K(0 To ...) = _
{ &H428a2f98, &H71374491, &Hb5c0fbcf, &He9b5dba5, &H3956c25b, &H59f111f1, _
&H923f82a4, &Hab1c5ed5, &Hd807aa98, &H12835b01, &H243185be, &H550c7dc3, _
&H72be5d74, &H80deb1fe, &H9bdc06a7, &Hc19bf174, &He49b69c1, &Hefbe4786, _
&H0fc19dc6, &H240ca1cc, &H2de92c6f, &H4a7484aa, &H5cb0a9dc, &H76f988da, _
&H983e5152, &Ha831c66d, &Hb00327c8, &Hbf597fc7, &Hc6e00bf3, &Hd5a79147, _
&H06ca6351, &H14292967, &H27b70a85, &H2e1b2138, &H4d2c6dfc, &H53380d13, _
&H650a7354, &H766a0abb, &H81c2c92e, &H92722c85, &Ha2bfe8a1, &Ha81a664b, _
&Hc24b8b70, &Hc76c51a3, &Hd192e819, &Hd6990624, &Hf40e3585, &H106aa070, _
&H19a4c116, &H1e376c08, &H2748774c, &H34b0bcb5, &H391c0cb3, &H4ed8aa4a, _
&H5b9cca4f, &H682e6ff3, &H748f82ee, &H78a5636f, &H84c87814, &H8cc70208, _
&H90befffa, &Ha4506ceb, &Hbef9a3f7, &Hc67178f2 }
Dim As UInteger<32> h0 = &H6a09e667
Dim As UInteger<32> h1 = &Hbb67ae85
Dim As UInteger<32> h2 = &H3c6ef372
Dim As UInteger<32> h3 = &Ha54ff53a
Dim As UInteger<32> h4 = &H510e527f
Dim As UInteger<32> h5 = &H9b05688c
Dim As UInteger<32> h6 = &H1f83d9ab
Dim As UInteger<32> h7 = &H5be0cd19
Dim As UInteger<32> a, b, c, d, e, f, g, h
Dim As UInteger<32> t1, t2, w(0 To 63)
For j = 0 To (l1 -1) \ 64 ' split into block of 64 bytes
ww1 = Cast(UByte Ptr, @message[j * 64])
ww4 = Cast(UInteger<32> Ptr, @message[j * 64])
For i = 0 To 60 Step 4 'little endian -> big endian
Swap ww1[i ], ww1[i +3]
Swap ww1[i +1], ww1[i +2]
Next
For i = 0 To 15 ' copy the 16 32bit block into the array
W(i) = ww4[i]
Next
For i = 16 To 63 ' fill the rest of the array
w(i) = sigma3(W(i -2)) + W(i -7) + sigma2(W(i -15)) + W(i -16)
Next
a = h0 : b = h1 : c = h2 : d = h3 : e = h4 : f = h5 : g = h6 : h = h7
For i = 0 To 63
t1 = h + sigma1(e) + Ch(e, f, g) + K(i) + W(i)
t2 = sigma0(a) + Maj(a, b, c)
h = g : g = f : f = e
e = d + t1
d = c : c = b : b = a
a = t1 + t2
Next
h0 += a : h1 += b : h2 += c : h3 += d
h4 += e : h5 += f : h6 += g : h7 += h
Next j
Dim As String answer = Hex(h0, 8) + Hex(h1, 8) + Hex(h2, 8) + Hex(h3, 8) _
+ Hex(h4, 8) + Hex(h5, 8) + Hex(h6, 8) + Hex(h7, 8)
If bitcoin = 0 Then
Return LCase(answer)
Else 'conver hex value's to integer value's
message = String(32,0)
For i = 0 To 31
message[i] = Val("&h" + Mid(answer, i * 2 + 1, 2))
Next
bitcoin = 0
End If
Loop
End Function
Function conv_base58(bitcoin_address As String) As String
Dim As String base58 = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
Dim As String tmp = String(24, 0)
Dim As Long x, y, z
For x = 1 To Len(bitcoin_address) -1
z = InStr(base58, Chr(bitcoin_address[x])) -1
If z = -1 Then
Print " bitcoin address contains illegal character"
Return ""
End If
For y = 23 To 0 Step -1
z = z + tmp[y] * 58
tmp[y] = z And 255 ' test_str[y] = z Mod 256
z Shr= 8 ' z \= 256
Next
If z <> 0 Then
Print " bitcoin address is to long"
Return ""
End If
Next
z = InStr(base58, Chr(bitcoin_address[0])) -1
Return Chr(z) + tmp
End Function
' ------=< MAIN >=------
Data "1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" ' original
Data "1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62j" ' checksum changed
Data "1NAGa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" ' address changed
Data "0AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" ' only 1 or 3 as first char. allowed
Data "1AGNa15ZQXAZUgFlqJ2i7Z2DPU2J6hW62i" ' illegal character in address
Dim As String tmp, result, checksum, bitcoin_address
Dim As Long i, j
For i = 1 To 5
Read bitcoin_address
Print "Bitcoin address: "; bitcoin_address;
tmp = Left(bitcoin_address,1)
If tmp <> "1" And tmp <> "3" Then
Print " first character is not 1 or 3"
Continue For
End If
' convert bitcoinaddress
tmp = conv_base58(bitcoin_address)
If tmp = "" Then Continue For
' get the checksum, last 4 digits
For j As Long = 21 To 24
checksum = checksum + LCase(Hex(tmp[j], 2))
Next
' send the first 21 characters to the SHA 256 routine
result = SHA_256(Left(tmp, 21), 2)
result = Left(result, 8) ' get the checksum (the first 8 digits (hex))
If checksum = result Then ' test the found checksum against
Print " is valid" ' the one from the address
Else
Print " is not valid, checksum fails"
End If
Next
' empty keyboard buffer
While InKey <> "" : Wend
Print : Print "hit any key to end program"
Sleep
End |
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #Racket | Racket | #lang racket/base
(module sha256 racket/base
;; define a quick SH256 FFI interface, similar to the Racket's default
;; SHA1 interface (from [[SHA-256#Racket]])
(provide sha256)
(require ffi/unsafe ffi/unsafe/define openssl/libcrypto)
(define-ffi-definer defcrypto libcrypto)
(defcrypto SHA256_Init (_fun _pointer -> _int))
(defcrypto SHA256_Update (_fun _pointer _pointer _long -> _int))
(defcrypto SHA256_Final (_fun _pointer _pointer -> _int))
(define (sha256 bytes)
(define ctx (malloc 128))
(define result (make-bytes 32))
(SHA256_Init ctx)
(SHA256_Update ctx bytes (bytes-length bytes))
(SHA256_Final result ctx)
;; (bytes->hex-string result) -- not needed, we want bytes
result))
(require
;; On windows I needed to "raco planet install soegaard digetst.plt 1 2"
(only-in (planet soegaard/digest:1:2/digest) ripemd160-bytes)
(submod "." sha256))
;; Quick utility
(define << arithmetic-shift) ; a bit shorter
;; From: https://en.bitcoin.it/wiki/Technical_background_of_version_1_Bitcoin_addresses
;; Using Bitcoin's stage numbers:
;; 1 - Take the corresponding public key generated with it
;; (65 bytes, 1 byte 0x04, 32 bytes corresponding to X coordinate,
;; 32 bytes corresponding to Y coordinate)
(define (stage-1 X Y)
(define (integer->bytes! i B)
(define l (bytes-length B))
(for ((b (in-range 0 l))) (bytes-set! B (- l b 1) (bitwise-bit-field i (* b 8) (* (+ b 1) 8)))) B)
(integer->bytes! (+ (<< 4 (* 32 8 2)) (<< X (* 32 8)) Y) (make-bytes 65)))
;; 2 - Perform SHA-256 hashing on the public key
(define stage-2 sha256)
;; 3 - Perform RIPEMD-160 hashing on the result of SHA-256
(define stage-3 ripemd160-bytes)
;; 4 - Add version byte in front of RIPEMD-160 hash (0x00 for Main Network)
(define (stage-4 s3)
(bytes-append #"\0" s3))
;; 5 - Perform SHA-256 hash on the extended RIPEMD-160 result
;; 6 - Perform SHA-256 hash on the result of the previous SHA-256 hash
(define (stage-5+6 s4)
(values s4 (sha256 (sha256 s4))))
;; 7 - Take the first 4 bytes of the second SHA-256 hash. This is the address checksum
(define (stage-7 s4 s6)
(values s4 (subbytes s6 0 4)))
;; 8 - Add the 4 checksum bytes from stage 7 at the end of extended RIPEMD-160 hash from stage 4.
;; This is the 25-byte binary Bitcoin Address.
(define (stage-8 s4 s7)
(bytes-append s4 s7))
;; 9 - Convert the result from a byte string into a base58 string using Base58Check encoding.
;; This is the most commonly used Bitcoin Address format
(define stage-9 (base58-encode 33))
(define ((base58-encode l) B)
(define b58 #"123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz")
(define rv (make-bytes l (char->integer #\1))) ; already padded out with 1's
(define b-int (for/fold ((i 0)) ((b (in-bytes B))) (+ (<< i 8) b)))
(let loop ((b b-int) (l l))
(if (zero? b) rv
(let-values (((q r) (quotient/remainder b 58)))
(define l- (- l 1))
(bytes-set! rv l- (bytes-ref b58 r))
(loop q l-)))))
;; Takes two (rather large) ints for X and Y, returns base-58 PAP.
(define public-address-point
(compose stage-9 stage-8 stage-7 stage-5+6 stage-4 stage-3 stage-2 stage-1))
(public-address-point
#x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
#x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6)
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
(module+ test
(require tests/eli-tester (only-in openssl/sha1 bytes->hex-string))
(define bytes->HEX-STRING (compose string-upcase bytes->hex-string))
(test
((base58-encode 33)
(bytes-append #"\x00\x01\x09\x66\x77\x60\x06\x95\x3D\x55\x67\x43"
#"\x9E\x5E\x39\xF8\x6A\x0D\x27\x3B\xEE\xD6\x19\x67\xF6"))
=>
#"16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM")
(define-values (test-X test-Y)
(values #x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
#x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6))
(define s1 (stage-1 test-X test-Y))
(define s2 (stage-2 s1))
(define s3 (stage-3 s2))
(define s4 (stage-4 s3))
(define-values (s4_1 s6) (stage-5+6 s4))
(define-values (s4_2 s7) (stage-7 s4 s6))
(define s8 (stage-8 s4 s7))
(define s9 (stage-9 s8))
(test
(bytes->HEX-STRING s1)
=> (string-append "0450863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B23522CD470243453"
"A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6")
(bytes->HEX-STRING s2) => "600FFE422B4E00731A59557A5CCA46CC183944191006324A447BDB2D98D4B408"
(bytes->HEX-STRING s3) => "010966776006953D5567439E5E39F86A0D273BEE"
(bytes->HEX-STRING s4) => "00010966776006953D5567439E5E39F86A0D273BEE"
(bytes->HEX-STRING s6) => "D61967F63C7DD183914A4AE452C9F6AD5D462CE3D277798075B107615C1A8A30"
(bytes->HEX-STRING s7) => "D61967F6"
(bytes->HEX-STRING s8) => "00010966776006953D5567439E5E39F86A0D273BEED61967F6"
s9 => #"16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM")) |
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #Raku | Raku | sub dgst(blob8 $b, Str :$dgst) returns blob8 {
given run «openssl dgst "-$dgst" -binary», :in, :out, :bin {
.in.write: $b;
.in.close;
return .out.slurp;
}
}
sub sha256($b) { dgst $b, :dgst<sha256> }
sub rmd160($b) { dgst $b, :dgst<rmd160> }
sub public_point_to_address( UInt $x, UInt $y ) {
my @bytes = flat ($y,$x).map: *.polymod( 256 xx * )[^32];
my $hash = rmd160 sha256 blob8.new: 4, @bytes.reverse;
my $checksum = sha256(sha256 blob8.new: 0, $hash.list).subbuf: 0, 4;
[R~] <
1 2 3 4 5 6 7 8 9
A B C D E F G H J K L M N P Q R S T U V W X Y Z
a b c d e f g h i j k m n o p q r s t u v w x y z
>[ .polymod: 58 xx * ] given
reduce * * 256 + * , flat 0, ($hash, $checksum)».list
}
say public_point_to_address
0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352,
0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6;
|
http://rosettacode.org/wiki/Bitmap/Flood_fill | Bitmap/Flood fill | Implement a flood fill.
A flood fill is a way of filling an area using color banks to define the contained area or a target color which "determines" the area (the valley that can be flooded; Wikipedia uses the term target color). It works almost like a water flooding from a point towards the banks (or: inside the valley): if there's a hole in the banks, the flood is not contained and all the image (or all the "connected valleys") get filled.
To accomplish the task, you need to implement just one of the possible algorithms (examples are on Wikipedia). Variations on the theme are allowed (e.g. adding a tolerance parameter or argument for color-matching of the banks or target color).
Testing: the basic algorithm is not suitable for truecolor images; a possible test image is the one shown on the right box; you can try to fill the white area, or the black inner circle.
| #Fortran | Fortran | module RCImageArea
use RCImageBasic
use RCImagePrimitive
implicit none
real, parameter, private :: matchdistance = 0.2
private :: northsouth, eastwest
contains
subroutine northsouth(img, p0, tcolor, fcolor)
type(rgbimage), intent(inout) :: img
type(point), intent(in) :: p0
type(rgb), intent(in) :: tcolor, fcolor
integer :: npy, spy, y
type(rgb) :: pc
npy = p0%y - 1
do
if ( inside_image(img, p0%x, npy) ) then
call get_pixel(img, p0%x, npy, pc)
if ( ((pc .dist. tcolor) > matchdistance ) .or. ( pc == fcolor ) ) exit
else
exit
end if
npy = npy - 1
end do
npy = npy + 1
spy = p0%y + 1
do
if ( inside_image(img, p0%x, spy) ) then
call get_pixel(img, p0%x, spy, pc)
if ( ((pc .dist. tcolor) > matchdistance ) .or. ( pc == fcolor ) ) exit
else
exit
end if
spy = spy + 1
end do
spy = spy - 1
call draw_line(img, point(p0%x, spy), point(p0%x, npy), fcolor)
do y = min(spy, npy), max(spy, npy)
if ( y == p0%y ) cycle
call eastwest(img, point(p0%x, y), tcolor, fcolor)
end do
end subroutine northsouth
subroutine eastwest(img, p0, tcolor, fcolor)
type(rgbimage), intent(inout) :: img
type(point), intent(in) :: p0
type(rgb), intent(in) :: tcolor, fcolor
integer :: npx, spx, x
type(rgb) :: pc
npx = p0%x - 1
do
if ( inside_image(img, npx, p0%y) ) then
call get_pixel(img, npx, p0%y, pc)
if ( ((pc .dist. tcolor) > matchdistance ) .or. ( pc == fcolor ) ) exit
else
exit
end if
npx = npx - 1
end do
npx = npx + 1
spx = p0%x + 1
do
if ( inside_image(img, spx, p0%y) ) then
call get_pixel(img, spx, p0%y, pc)
if ( ((pc .dist. tcolor) > matchdistance ) .or. ( pc == fcolor ) ) exit
else
exit
end if
spx = spx + 1
end do
spx = spx - 1
call draw_line(img, point(spx, p0%y), point(npx, p0%y), fcolor)
do x = min(spx, npx), max(spx, npx)
if ( x == p0%x ) cycle
call northsouth(img, point(x, p0%y), tcolor, fcolor)
end do
end subroutine eastwest
subroutine floodfill(img, p0, tcolor, fcolor)
type(rgbimage), intent(inout) :: img
type(point), intent(in) :: p0
type(rgb), intent(in) :: tcolor, fcolor
type(rgb) :: pcolor
if ( .not. inside_image(img, p0%x, p0%y) ) return
call get_pixel(img, p0%x, p0%y, pcolor)
if ( (pcolor .dist. tcolor) > matchdistance ) return
call northsouth(img, p0, tcolor, fcolor)
call eastwest(img, p0, tcolor, fcolor)
end subroutine floodfill
end module RCImageArea |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Forth | Forth | TRUE . \ -1
FALSE . \ 0 |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Fortran | Fortran | TYPE MIXED
LOGICAL*1 LIVE
REAL*8 VALUE
END TYPE MIXED
TYPE(MIXED) STUFF(100) |
http://rosettacode.org/wiki/Caesar_cipher | Caesar cipher |
Task
Implement a Caesar cipher, both encoding and decoding.
The key is an integer from 1 to 25.
This cipher rotates (either towards left or right) the letters of the alphabet (A to Z).
The encoding replaces each letter with the 1st to 25th next letter in the alphabet (wrapping Z to A).
So key 2 encrypts "HI" to "JK", but key 20 encrypts "HI" to "BC".
This simple "mono-alphabetic substitution cipher" provides almost no security, because an attacker who has the encoded message can either use frequency analysis to guess the key, or just try all 25 keys.
Caesar cipher is identical to Vigenère cipher with a key of length 1.
Also, Rot-13 is identical to Caesar cipher with key 13.
Related tasks
Rot-13
Substitution Cipher
Vigenère Cipher/Cryptanalysis
| #Visual_Basic_.NET | Visual Basic .NET | Module Module1
Function Encrypt(ch As Char, code As Integer) As Char
If Not Char.IsLetter(ch) Then
Return ch
End If
Dim offset = AscW(If(Char.IsUpper(ch), "A"c, "a"c))
Dim test = (AscW(ch) + code - offset) Mod 26 + offset
Return ChrW(test)
End Function
Function Encrypt(input As String, code As Integer) As String
Return New String(input.Select(Function(ch) Encrypt(ch, code)).ToArray())
End Function
Function Decrypt(input As String, code As Integer) As String
Return Encrypt(input, 26 - code)
End Function
Sub Main()
Dim str = "Pack my box with five dozen liquor jugs."
Console.WriteLine(str)
str = Encrypt(str, 5)
Console.WriteLine("Encrypted: {0}", str)
str = Decrypt(str, 5)
Console.WriteLine("Decrypted: {0}", str)
End Sub
End Module |
http://rosettacode.org/wiki/Box_the_compass | Box the compass | There be many a land lubber that knows naught of the pirate ways and gives direction by degree!
They know not how to box the compass!
Task description
Create a function that takes a heading in degrees and returns the correct 32-point compass heading.
Use the function to print and display a table of Index, Compass point, and Degree; rather like the corresponding columns from, the first table of the wikipedia article, but use only the following 33 headings as input:
[0.0, 16.87, 16.88, 33.75, 50.62, 50.63, 67.5, 84.37, 84.38, 101.25, 118.12, 118.13, 135.0, 151.87, 151.88, 168.75, 185.62, 185.63, 202.5, 219.37, 219.38, 236.25, 253.12, 253.13, 270.0, 286.87, 286.88, 303.75, 320.62, 320.63, 337.5, 354.37, 354.38]. (They should give the same order of points but are spread throughout the ranges of acceptance).
Notes;
The headings and indices can be calculated from this pseudocode:
for i in 0..32 inclusive:
heading = i * 11.25
case i %3:
if 1: heading += 5.62; break
if 2: heading -= 5.62; break
end
index = ( i mod 32) + 1
The column of indices can be thought of as an enumeration of the thirty two cardinal points (see talk page)..
| #Elixir | Elixir | defmodule Box do
defp head do
Enum.chunk(~w(north east south west north), 2, 1)
|> Enum.flat_map(fn [a,b] ->
c = if a=="north" or a=="south", do: "#{a}#{b}", else: "#{b}#{a}"
[ a, "#{a} by #{b}", "#{a}-#{c}", "#{c} by #{a}",
c, "#{c} by #{b}", "#{b}-#{c}", "#{b} by #{a}" ]
end)
|> Enum.with_index
|> Enum.map(fn {s, i} -> {i+1, String.capitalize(s)} end)
|> Map.new
end
def compass do
header = head()
angles = Enum.map(0..32, fn i -> i * 11.25 + elem({0, 5.62, -5.62}, rem(i, 3)) end)
Enum.each(angles, fn degrees ->
index = rem(round(32 * degrees / 360), 32) + 1
:io.format "~2w ~-20s ~6.2f~n", [index, header[index], degrees]
end)
end
end
Box.compass |
http://rosettacode.org/wiki/Bitmap/Histogram | Bitmap/Histogram | Extend the basic bitmap storage defined on this page to support dealing with image histograms. The image histogram contains for each luminance the count of image pixels having this luminance. Choosing a histogram representation take care about the data type used for the counts. It must have range of at least 0..NxM, where N is the image width and M is the image height.
Test task
Histogram is useful for many image processing operations. As an example, use it to convert an image into black and white art. The method works as follows:
Convert image to grayscale;
Compute the histogram
Find the median: defined as the luminance such that the image has an approximately equal number of pixels with lesser and greater luminance.
Replace each pixel of luminance lesser than the median to black, and others to white.
Use read/write ppm file, and grayscale image solutions.
| #zkl | zkl | fcn histogram(image){
hist:=List.createLong(256,0); // array[256] of zero
image.data.howza(0).pump(Void,'wrap(c){ hist[c]+=1 }); // byte by byte loop
hist;
}
fcn histogramMedian(hist){
from,to:=0,(2).pow(8) - 1; // 16 bits of luminance
left,right:=hist[from],hist[to];
while(from!=to){
if(left<right){ from+=1; left +=hist[from]; }
else { to -=1; right+=hist[to]; }
}
from
} |
http://rosettacode.org/wiki/Bitwise_operations | Bitwise operations |
Basic Data Operation
This is a basic data operation. It represents a fundamental action on a basic data type.
You may see other such operations in the Basic Data Operations category, or:
Integer Operations
Arithmetic |
Comparison
Boolean Operations
Bitwise |
Logical
String Operations
Concatenation |
Interpolation |
Comparison |
Matching
Memory Operations
Pointers & references |
Addresses
Task
Write a routine to perform a bitwise AND, OR, and XOR on two integers, a bitwise NOT on the first integer, a left shift, right shift, right arithmetic shift, left rotate, and right rotate.
All shifts and rotates should be done on the first integer with a shift/rotate amount of the second integer.
If any operation is not available in your language, note it.
| #AWK | AWK | BEGIN {
n = 11
p = 1
print n " or " p " = " or(n,p)
print n " and " p " = " and(n,p)
print n " xor " p " = " xor(n,p)
print n " << " p " = " lshift(n, p) # left shift
print n " >> " p " = " rshift(n, p) # right shift
printf "not %d = 0x%x\n", n, compl(n) # bitwise complement
} |
http://rosettacode.org/wiki/Bitmap | Bitmap | Show a basic storage type to handle a simple RGB raster graphics image,
and some primitive associated functions.
If possible provide a function to allocate an uninitialised image,
given its width and height, and provide 3 additional functions:
one to fill an image with a plain RGB color,
one to set a given pixel with a color,
one to get the color of a pixel.
(If there are specificities about the storage or the allocation, explain those.)
These functions are used as a base for the articles in the category raster graphics operations,
and a basic output function to check the results
is available in the article write ppm file.
| #Ada | Ada | package Bitmap_Store is
type Luminance is mod 2**8;
type Pixel is record
R, G, B : Luminance := Luminance'First;
end record;
Black : constant Pixel := (others => Luminance'First);
White : constant Pixel := (others => Luminance'Last);
type Image is array (Positive range <>, Positive range <>) of Pixel;
procedure Fill (Picture : in out Image; Color : Pixel);
procedure Print (Picture : Image);
type Point is record
X, Y : Positive;
end record;
end Bitmap_Store; |
http://rosettacode.org/wiki/Bitmap/Midpoint_circle_algorithm | Bitmap/Midpoint circle algorithm | Task
Using the data storage type defined on this page for raster images,
write an implementation of the midpoint circle algorithm (also known as Bresenham's circle algorithm).
(definition on Wikipedia).
| #PL.2FI | PL/I |
/* Plot three circles. */
CIRCLE: PROCEDURE OPTIONS (MAIN);
declare image (-20:20, -20:20) character (1);
declare j fixed binary;
image = '.';
image(0,*) = '-';
image(*,0) = '|';
image(0,0) = '+';
CALL DRAW_CIRCLE (0, 0, 11);
CALL DRAW_CIRCLE (0, 0, 8);
CALL DRAW_CIRCLE (0, 0, 19);
do j = hbound(image,1) to lbound(image,1) by -1;
put skip edit (image(j,*)) (a(1));
end;
draw_circle: procedure (x0, y0, radius); /* 14 May 2010. */
declare ( x0, y0, radius ) fixed binary;
declare ( ddfx, ddfy, x, y, f ) fixed binary;
declare debug bit (1) aligned static initial ('0'b);
f = 1-radius;
ddfx = 1;
ddfy = -2*radius;
x = 0;
y = radius;
image(x0, y0+radius) = '*'; /* Octet 0. */
image(x0+radius, y0) = '*'; /* Octet 1. */
image(x0, y0-radius) = '*'; /* Octet 2. */
image(x0-radius, y0) = '*'; /* Octet 3. */
do while (x < y);
if f >= 0 then
do; y = y - 1; ddfy = ddfy +2; f = f + ddfy; end;
x = x + 1;
ddfx = ddfx + 2;
f = f + ddfx;
image(x0+x, y0+y) = '0'; /* Draws octant 0. */
image(x0+y, y0+x) = '1'; /* Draws octant 1. */
image(x0+y, y0-x) = '2'; /* Draws octant 2. */
image(x0+x, y0-y) = '3'; /* Draws octant 3. */
image(x0-x, y0-y) = '4'; /* Draws octant 4. */
image(x0-y, y0-x) = '5'; /* Draws octant 5. */
image(x0-y, y0+x) = '6'; /* Draws octant 6. */
image(x0-x, y0+y) = '7'; /* Draws octant 7. */
end;
end draw_circle;
END CIRCLE;
|
http://rosettacode.org/wiki/Bitmap/Midpoint_circle_algorithm | Bitmap/Midpoint circle algorithm | Task
Using the data storage type defined on this page for raster images,
write an implementation of the midpoint circle algorithm (also known as Bresenham's circle algorithm).
(definition on Wikipedia).
| #PureBasic | PureBasic | Procedure rasterCircle(cx, cy, r, Color)
;circle must lie completely within the image boundaries
Protected f= 1 - r
Protected ddF_X, ddF_Y = -2 * r
Protected x, y = r
Plot(cx, cy + r, Color)
Plot(cx, cy - r, Color)
Plot(cx + r, cy, Color)
Plot(cx - r, cy, Color)
While x < y
If f >= 0
y - 1
ddF_Y + 2
f + ddF_Y
EndIf
x + 1
ddF_X + 2
f + ddF_X + 1
Plot(cx + x, cy + y, Color)
Plot(cx - x, cy + y, Color)
Plot(cx + x, cy - y, Color)
Plot(cx - x, cy - y, Color)
Plot(cx + y, cy + x, Color)
Plot(cx - y, cy + x, Color)
Plot(cx + y, cy - x, Color)
Plot(cx - y, cy - x, Color)
Wend
EndProcedure
OpenWindow(0, 0, 0, 100, 100, "MidPoint Circle Algorithm", #PB_Window_SystemMenu)
CreateImage(0, 100, 100, 32)
StartDrawing(ImageOutput(0))
Box(0, 0, 100, 100, RGB(0, 0, 0))
rasterCircle(25, 25, 20, RGB(255, 255, 255))
rasterCircle(50, 50, 40, RGB(255, 0, 0))
StopDrawing()
ImageGadget(0, 0, 0, 0, 0, ImageID(0))
Repeat: Until WaitWindowEvent() = #PB_Event_CloseWindow |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #Lambdatalk | Lambdatalk |
Drawing a cubic bezier curve out of any SVG or CANVAS frame.
1) interpolating 4 points
The Bézier curve is defined as an array of 4 given points,
each defined as an array of 2 numbers.
The bezier function returns the point interpolating the 4 points.
{def bezier
{def bezier.interpol
{lambda {:a0 :a1 :a2 :a3 :t :u}
{round
{+ {* :a0 :u :u :u 1}
{* :a1 :u :u :t 3}
{* :a2 :u :t :t 3}
{* :a3 :t :t :t 1}}}}}
{lambda {:bz :t}
{A.new {bezier.interpol {A.get 0 {A.get 0 :bz}}
{A.get 0 {A.get 1 :bz}}
{A.get 0 {A.get 2 :bz}}
{A.get 0 {A.get 3 :bz}} :t {- 1 :t}}
{bezier.interpol {A.get 1 {A.get 0 :bz}}
{A.get 1 {A.get 1 :bz}}
{A.get 1 {A.get 2 :bz}}
{A.get 1 {A.get 3 :bz}} :t {- 1 :t}}} }}
-> bezier
2) plotting a dot
We don't draw in any SVG or CANVAS frame, but directly in the HTML page,
using div HTML blocks designed as colored circles.
{def dot
{lambda {:p :r :col}
{div {@ style="position:absolute;
left: {- {A.get 0 :p} {/ :r 2}}px;
top: {- {A.get 1 :p} {/ :r 2}}px;
width: :rpx; height: :rpx;
border-radius: :rpx;
border: 1px solid #000;
background: :col;"}}}}
-> dot
3) defining 4 control points
{def Q0 {A.new 150 150}} -> Q0
{def Q1 {A.new 500 300}} -> Q1
{def Q2 {A.new 100 500}} -> Q2
{def Q3 {A.new 300 500}} -> Q3
4) defining 2 curves
We use the same control points but in different orders to define two curves
{def BZ1 {A.new {Q0} {Q1} {Q2} {Q3}}}
-> BZ1
{def BZ2 {A.new {Q0} {Q2} {Q1} {Q3}}}
-> BZ2
5) drawing curves and dots
We map the bezier function on a serie of values in a range [start end step]
{S.map {lambda {:t} {dot {bezier {BZ1} :t} 5 red}}
{S.serie -0.1 1.2 0.02}}
{S.map {lambda {:t} {dot {bezier {BZ2} :t} 5 blue}}
{S.serie -0.1 1.2 0.02}}
{dot {Q0} 20 cyan}
{dot {Q1} 20 cyan}
{dot {Q2} 20 cyan}
{dot {Q3} 20 cyan}
The result can be seen in http://lambdaway.free.fr/lambdawalks/?view=bezier
|
http://rosettacode.org/wiki/Biorhythms | Biorhythms | For a while in the late 70s, the pseudoscience of biorhythms was popular enough to rival astrology, with kiosks in malls that would give you your weekly printout. It was also a popular entry in "Things to Do with your Pocket Calculator" lists. You can read up on the history at Wikipedia, but the main takeaway is that unlike astrology, the math behind biorhythms is dead simple.
It's based on the number of days since your birth. The premise is that three cycles of unspecified provenance govern certain aspects of everyone's lives – specifically, how they're feeling physically, emotionally, and mentally. The best part is that not only do these cycles somehow have the same respective lengths for all humans of any age, gender, weight, genetic background, etc, but those lengths are an exact number of days. And the pattern is in each case a perfect sine curve. Absolutely miraculous!
To compute your biorhythmic profile for a given day, the first thing you need is the number of days between that day and your birth, so the answers in Days between dates are probably a good starting point. (Strictly speaking, the biorhythms start at 0 at the moment of your birth, so if you know time of day you can narrow things down further, but in general these operate at whole-day granularity.) Then take the residue of that day count modulo each of the the cycle lengths to calculate where the day falls on each of the three sinusoidal journeys.
The three cycles and their lengths are as follows:
Cycle
Length
Physical
23 days
Emotional
28 days
Mental
33 days
The first half of each cycle is in "plus" territory, with a peak at the quarter-way point; the second half in "minus" territory, with a valley at the three-quarters mark. You can calculate a specific value between -1 and +1 for the kth day of an n-day cycle by computing sin( 2πk / n ). The days where a cycle crosses the axis in either direction are called "critical" days, although with a cycle value of 0 they're also said to be the most neutral, which seems contradictory.
The task: write a subroutine, function, or program that will, given a birthdate and a target date, output the three biorhythmic values for the day. You may optionally include a text description of the position and the trend (e.g. "up and rising", "peak", "up but falling", "critical", "down and falling", "valley", "down but rising"), an indication of the date on which the next notable event (peak, valley, or crossing) falls, or even a graph of the cycles around the target date. Demonstrate the functionality for dates of your choice.
Example run of my Raku implementation:
raku br.raku 1943-03-09 1972-07-11
Output:
Day 10717:
Physical day 22: -27% (down but rising, next transition 1972-07-12)
Emotional day 21: valley
Mental day 25: valley
Double valley! This was apparently not a good day for Mr. Fischer to begin a chess tournament...
| #FreeBASIC | FreeBASIC | #define floor(x) ((x*2.0-0.5) Shr 1)
#define pi (4 * Atn(1))
Function Gregorian(db As String) As Integer
Dim As Integer M, Y, D
Y = Valint(Left(db,4)) : M = Valint(Mid(db,6,2)) : D = Valint(Right(db,2))
Dim As Integer N = (M+9) - Int((M+9)/12) * 12
Dim As Integer W = Y - Int(N/10)
Dim As Integer G = 365 * W + Int(W/4) - Int(W/100) + Int(W/400)
G += Int((N*306+5)/10)+(D-1)
Return G
End Function
Function Biorhythm(Birthdate As String, Targetdate As String) As String
'Jagged Array
Dim As String TextArray(4,2) = {{"up and rising", "peak"}, {"up but falling", "transition"}, {"down and falling", "valley"}, {"down but rising", "transition"}}
Dim As Integer DaysBetween = Gregorian(Targetdate) - Gregorian(Birthdate)
Dim As Integer positionP = DaysBetween Mod 23
Dim As Integer positionE = DaysBetween Mod 28
Dim As Integer positionM = DaysBetween Mod 33
'return the positions - just to return something
Biorhythm = Str(positionP) & "/" & Str(positionE) & "/" & Str(positionM)
Dim As Integer quadrantP = Int(4 * positionP / 23)
Dim As Integer quadrantE = Int(4 * positionE / 28)
Dim As Integer quadrantM = Int(4 * positionM / 33)
Dim As Single percentageP = Fix(100 * Sin(2 * pi * (positionP / 23)))
Dim As Single percentageE = Fix(100 * Sin(2 * pi * (positionE / 28)))
Dim As Single percentageM = Fix(100 * Sin(2 * pi * (positionM / 33)))
Dim As Single transitionP = Val(Targetdate) + floor((quadrantP + 1) / 4 * 23) - positionP
Dim As Single transitionE = Val(Targetdate) + floor((quadrantE + 1) / 4 * 28) - positionE
Dim As Single transitionM = Val(Targetdate) + floor((quadrantM + 1) / 4 * 33) - positionM
Dim As String textP, textE, textM, Header1Text, Header2Text
Select Case percentageP
Case Is > 95
textP = "Physical day " & positionP & " : " & "peak"
Case Is < -95
textP = "Physical day " & positionP & " : " & "valley"
Case -5 To 5
textP = "Physical day " & positionP & " : " & "critical transition"
Case Else
textP = "Physical day " & positionP & " : " & percentageP & "% (" & TextArray(quadrantP,0) & ", next " & TextArray(quadrantP,1) & " " & transitionP & ")"
End Select
Select Case percentageE
Case Is > 95
textE = "Emotional day " & positionE & " : " & "peak"
Case Is < -95
textE = "Emotional day " & positionE & " : " & "valley"
Case -5 To 5
textE = "Emotional day " & positionE & " : " & "critical transition"
Case Else
textE = "Emotional day " & positionE & " : " & percentageE & "% (" & TextArray(quadrantE,0) & ", next " & TextArray(quadrantE,1) & " " & transitionE & ")"
End Select
Select Case percentageM
Case Is > 95
textM = "Mental day " & positionM & " : " & "peak"
Case Is < -95
textM = "Mental day " & positionM & " : " & "valley"
Case -5 To 5
textM = "Mental day " & positionM & " : " & "critical transition"
Case Else
textM = "Mental day " & positionM & " : " & percentageM & "% (" & TextArray(quadrantM,0) & ", next " & TextArray(quadrantM,1) & " " & transitionM & ")"
End Select
Header1Text = "Born " & Birthdate & ", Target " & Targetdate
Header2Text = "Day " & DaysBetween
Print Header1Text
Print Header2Text
Print textP
Print textE
Print textM
Print
End Function
Biorhythm("1943-03-09", "1972-07-11")
Biorhythm("1809-02-12", "1863-11-19") 'correct DOB for Abraham Lincoln
Biorhythm("1809-01-12", "1863-11-19")
|
http://rosettacode.org/wiki/Bioinformatics/base_count | Bioinformatics/base count | Given this string representing ordered DNA bases:
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
Task
"Pretty print" the sequence followed by a summary of the counts of each of the bases: (A, C, G, and T) in the sequence
print the total count of each base in the string.
Other tasks related to string operations:
Metrics
Array length
String length
Copy a string
Empty string (assignment)
Counting
Word frequency
Letter frequency
Jewels and stones
I before E except after C
Bioinformatics/base count
Count occurrences of a substring
Count how many vowels and consonants occur in a string
Remove/replace
XXXX redacted
Conjugate a Latin verb
Remove vowels from a string
String interpolation (included)
Strip block comments
Strip comments from a string
Strip a set of characters from a string
Strip whitespace from a string -- top and tail
Strip control codes and extended characters from a string
Anagrams/Derangements/shuffling
Word wheel
ABC problem
Sattolo cycle
Knuth shuffle
Ordered words
Superpermutation minimisation
Textonyms (using a phone text pad)
Anagrams
Anagrams/Deranged anagrams
Permutations/Derangements
Find/Search/Determine
ABC words
Odd words
Word ladder
Semordnilap
Word search
Wordiff (game)
String matching
Tea cup rim text
Alternade words
Changeable words
State name puzzle
String comparison
Unique characters
Unique characters in each string
Extract file extension
Levenshtein distance
Palindrome detection
Common list elements
Longest common suffix
Longest common prefix
Compare a list of strings
Longest common substring
Find common directory path
Words from neighbour ones
Change e letters to i in words
Non-continuous subsequences
Longest common subsequence
Longest palindromic substrings
Longest increasing subsequence
Words containing "the" substring
Sum of the digits of n is substring of n
Determine if a string is numeric
Determine if a string is collapsible
Determine if a string is squeezable
Determine if a string has all unique characters
Determine if a string has all the same characters
Longest substrings without repeating characters
Find words which contains all the vowels
Find words which contains most consonants
Find words which contains more than 3 vowels
Find words which first and last three letters are equals
Find words which odd letters are consonants and even letters are vowels or vice_versa
Formatting
Substring
Rep-string
Word wrap
String case
Align columns
Literals/String
Repeat a string
Brace expansion
Brace expansion using ranges
Reverse a string
Phrase reversals
Comma quibbling
Special characters
String concatenation
Substring/Top and tail
Commatizing numbers
Reverse words in a string
Suffixation of decimal numbers
Long literals, with continuations
Numerical and alphabetical suffixes
Abbreviations, easy
Abbreviations, simple
Abbreviations, automatic
Song lyrics/poems/Mad Libs/phrases
Mad Libs
Magic 8-ball
99 Bottles of Beer
The Name Game (a song)
The Old lady swallowed a fly
The Twelve Days of Christmas
Tokenize
Text between
Tokenize a string
Word break problem
Tokenize a string with escaping
Split a character string based on change of character
Sequences
Show ASCII table
De Bruijn sequences
Self-referential sequences
Generate lower case ASCII alphabet
| #11l | 11l | F basecount(dna)
DefaultDict[Char, Int] d
L(c) dna
d[c]++
R sorted(d.items())
F seq_split(dna, n = 50)
R (0 .< dna.len).step(n).map(i -> @dna[i .+ @n])
F seq_pp(dna, n = 50)
L(part) seq_split(dna, n)
print(‘#5: #.’.format(L.index * n, part))
print("\n BASECOUNT:")
V tot = 0
L(base, count) basecount(dna)
print(‘ #3: #.’.format(base, count))
tot += count
V (base, count) = (‘TOT’, tot)
print(‘ #3= #.’.format(base, count))
print(‘SEQUENCE:’)
V sequence = "\
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG\
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG\
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT\
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT\
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG\
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA\
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT\
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG\
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC\
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
seq_pp(sequence) |
http://rosettacode.org/wiki/Bitmap/Bresenham%27s_line_algorithm | Bitmap/Bresenham's line algorithm | Task
Using the data storage type defined on the Bitmap page for raster graphics images,
draw a line given two points with Bresenham's line algorithm.
| #bash | bash | #! /bin/bash
function line {
x0=$1
y0=$2
x1=$3
y1=$4
if (( x0 > x1 ))
then
(( dx = x0 - x1 ))
(( sx = -1 ))
else
(( dx = x1 - x0 ))
(( sx = 1 ))
fi
if (( y0 > y1 ))
then
(( dy = y0 - y1 ))
(( sy = -1 ))
else
(( dy = y1 - y0 ))
(( sy = 1 ))
fi
if (( dx > dy ))
then
(( err = dx ))
else
(( err = -dy ))
fi
(( err /= 2 ))
(( e2 = 0 ))
while :
do
echo -en "\e[${y0};${x0}H#\e[K"
(( x0 == x1 && y0 == y1 )) && return
(( e2 = err ))
if (( e2 > -dx ))
then
(( err -= dy ))
(( x0 += sx ))
fi
if (( e2 < dy ))
then
(( err += dx ))
(( y0 += sy ))
fi
done
}
# Draw a full screen diamond
COLS=$( tput cols )
LINS=$( tput lines )
LINS=$((LINS-1))
clear
line $((COLS/2)) 1 $((COLS/4)) $((LINS/2))
line $((COLS/4)) $((LINS/2)) $((COLS/2)) $LINS
line $((COLS/2)) $LINS $((COLS/4*3)) $((LINS/2))
line $((COLS/4*3)) $((LINS/2)) $((COLS/2)) 1
echo -e "\e[${LINS}H" |
http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation | Bioinformatics/Sequence mutation | Task
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
Choosing a random base position in the sequence.
Mutate the sequence by doing one of either:
Swap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
Delete the chosen base at the position.
Insert another base randomly chosen from A,C, G, or T into the sequence at that position.
Randomly generate a test DNA sequence of at least 200 bases
"Pretty print" the sequence and a count of its size, and the count of each base in the sequence
Mutate the sequence ten times.
"Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
Extra credit
Give more information on the individual mutations applied.
Allow mutations to be weighted and/or chosen. | #C.2B.2B | C++ | #include <array>
#include <iomanip>
#include <iostream>
#include <random>
#include <string>
class sequence_generator {
public:
sequence_generator();
std::string generate_sequence(size_t length);
void mutate_sequence(std::string&);
static void print_sequence(std::ostream&, const std::string&);
enum class operation { change, erase, insert };
void set_weight(operation, unsigned int);
private:
char get_random_base() {
return bases_[base_dist_(engine_)];
}
operation get_random_operation();
static const std::array<char, 4> bases_;
std::mt19937 engine_;
std::uniform_int_distribution<size_t> base_dist_;
std::array<unsigned int, 3> operation_weight_;
unsigned int total_weight_;
};
const std::array<char, 4> sequence_generator::bases_{ 'A', 'C', 'G', 'T' };
sequence_generator::sequence_generator() : engine_(std::random_device()()),
base_dist_(0, bases_.size() - 1),
total_weight_(operation_weight_.size()) {
operation_weight_.fill(1);
}
sequence_generator::operation sequence_generator::get_random_operation() {
std::uniform_int_distribution<unsigned int> op_dist(0, total_weight_ - 1);
unsigned int n = op_dist(engine_), op = 0, weight = 0;
for (; op < operation_weight_.size(); ++op) {
weight += operation_weight_[op];
if (n < weight)
break;
}
return static_cast<operation>(op);
}
void sequence_generator::set_weight(operation op, unsigned int weight) {
total_weight_ -= operation_weight_[static_cast<size_t>(op)];
operation_weight_[static_cast<size_t>(op)] = weight;
total_weight_ += weight;
}
std::string sequence_generator::generate_sequence(size_t length) {
std::string sequence;
sequence.reserve(length);
for (size_t i = 0; i < length; ++i)
sequence += get_random_base();
return sequence;
}
void sequence_generator::mutate_sequence(std::string& sequence) {
std::uniform_int_distribution<size_t> dist(0, sequence.length() - 1);
size_t pos = dist(engine_);
char b;
switch (get_random_operation()) {
case operation::change:
b = get_random_base();
std::cout << "Change base at position " << pos << " from "
<< sequence[pos] << " to " << b << '\n';
sequence[pos] = b;
break;
case operation::erase:
std::cout << "Erase base " << sequence[pos] << " at position "
<< pos << '\n';
sequence.erase(pos, 1);
break;
case operation::insert:
b = get_random_base();
std::cout << "Insert base " << b << " at position "
<< pos << '\n';
sequence.insert(pos, 1, b);
break;
}
}
void sequence_generator::print_sequence(std::ostream& out, const std::string& sequence) {
constexpr size_t base_count = bases_.size();
std::array<size_t, base_count> count = { 0 };
for (size_t i = 0, n = sequence.length(); i < n; ++i) {
if (i % 50 == 0) {
if (i != 0)
out << '\n';
out << std::setw(3) << i << ": ";
}
out << sequence[i];
for (size_t j = 0; j < base_count; ++j) {
if (bases_[j] == sequence[i]) {
++count[j];
break;
}
}
}
out << '\n';
out << "Base counts:\n";
size_t total = 0;
for (size_t j = 0; j < base_count; ++j) {
total += count[j];
out << bases_[j] << ": " << count[j] << ", ";
}
out << "Total: " << total << '\n';
}
int main() {
sequence_generator gen;
gen.set_weight(sequence_generator::operation::change, 2);
std::string sequence = gen.generate_sequence(250);
std::cout << "Initial sequence:\n";
sequence_generator::print_sequence(std::cout, sequence);
constexpr int count = 10;
for (int i = 0; i < count; ++i)
gen.mutate_sequence(sequence);
std::cout << "After " << count << " mutations:\n";
sequence_generator::print_sequence(std::cout, sequence);
return 0;
} |
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Go | Go | package main
import (
"bytes"
"crypto/sha256"
"errors"
"os"
)
// With at least one other bitcoin RC task, this source is styled more like
// a package to show how functions of the two tasks might be combined into
// a single package. It turns out there's not really that much shared code,
// just the A25 type and doubleSHA256 method, but it's enough to suggest how
// the code might be organized. Types, methods, and functions are capitalized
// where they might be exported from a package.
// A25 is a type for a 25 byte (not base58 encoded) bitcoin address.
type A25 [25]byte
func (a *A25) Version() byte {
return a[0]
}
func (a *A25) EmbeddedChecksum() (c [4]byte) {
copy(c[:], a[21:])
return
}
// DoubleSHA256 computes a double sha256 hash of the first 21 bytes of the
// address. This is the one function shared with the other bitcoin RC task.
// Returned is the full 32 byte sha256 hash. (The bitcoin checksum will be
// the first four bytes of the slice.)
func (a *A25) doubleSHA256() []byte {
h := sha256.New()
h.Write(a[:21])
d := h.Sum([]byte{})
h = sha256.New()
h.Write(d)
return h.Sum(d[:0])
}
// ComputeChecksum returns a four byte checksum computed from the first 21
// bytes of the address. The embedded checksum is not updated.
func (a *A25) ComputeChecksum() (c [4]byte) {
copy(c[:], a.doubleSHA256())
return
}/* {{header|Go}} */
// Tmpl and Set58 are adapted from the C solution.
// Go has big integers but this techinique seems better.
var tmpl = []byte("123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz")
// Set58 takes a base58 encoded address and decodes it into the receiver.
// Errors are returned if the argument is not valid base58 or if the decoded
// value does not fit in the 25 byte address. The address is not otherwise
// checked for validity.
func (a *A25) Set58(s []byte) error {
for _, s1 := range s {
c := bytes.IndexByte(tmpl, s1)
if c < 0 {
return errors.New("bad char")
}
for j := 24; j >= 0; j-- {
c += 58 * int(a[j])
a[j] = byte(c % 256)
c /= 256
}
if c > 0 {
return errors.New("too long")
}
}
return nil
}
// ValidA58 validates a base58 encoded bitcoin address. An address is valid
// if it can be decoded into a 25 byte address, the version number is 0,
// and the checksum validates. Return value ok will be true for valid
// addresses. If ok is false, the address is invalid and the error value
// may indicate why.
func ValidA58(a58 []byte) (ok bool, err error) {
var a A25
if err := a.Set58(a58); err != nil {
return false, err
}
if a.Version() != 0 {
return false, errors.New("not version 0")
}
return a.EmbeddedChecksum() == a.ComputeChecksum(), nil
}
// Program returns exit code 0 with valid address and produces no output.
// Otherwise exit code is 1 and a message is written to stderr.
func main() {
if len(os.Args) != 2 {
errorExit("Usage: valid <base58 address>")
}
switch ok, err := ValidA58([]byte(os.Args[1])); {
case ok:
case err == nil:
errorExit("Invalid")
default:
errorExit(err.Error())
}
}
func errorExit(m string) {
os.Stderr.WriteString(m + "\n")
os.Exit(1)
} |
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #Ruby | Ruby |
# Translate public point to Bitcoin address
#
# Nigel_Galloway
# October 12th., 2014
require 'digest/sha2'
def convert g
i,e = '',[]
(0...g.length/2).each{|n| e[n] = g[n+=n]+g[n+1]; i+='H2'}
e.pack(i)
end
X = '50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352'
Y = '2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6'
n = '00'+Digest::RMD160.hexdigest(Digest::SHA256.digest(convert('04'+X+Y)))
n+= Digest::SHA256.hexdigest(Digest::SHA256.digest(convert(n)))[0,8]
G = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
n,res = n.hex,''
while n > 0 do
n,ng = n.divmod(58)
res << G[ng]
end
puts res.reverse
|
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #Rust | Rust |
use ring::digest::{digest, SHA256};
use ripemd160::{Digest, Ripemd160};
use hex::FromHex;
static X: &str = "50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352";
static Y: &str = "2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6";
static ALPHABET: [char; 58] = [
'1', '2', '3', '4', '5', '6', '7', '8', '9', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'J', 'K',
'L', 'M', 'N', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'a', 'b', 'c', 'd', 'e',
'f', 'g', 'h', 'i', 'j', 'k', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y',
'z',
];
fn base58_encode(bytes: &mut [u8]) -> String {
let base = ALPHABET.len();
if bytes.is_empty() {
return String::from("");
}
let mut output: Vec<u8> = Vec::new();
let mut num: usize;
for _ in 0..33 {
num = 0;
for byte in bytes.iter_mut() {
num = num * 256 + *byte as usize;
*byte = (num / base) as u8;
num %= base;
}
output.push(num as u8);
}
let mut string = String::new();
for b in output.iter().rev() {
string.push(ALPHABET[*b as usize]);
}
string
}
// stolen from address-validation/src/main.rs
/// Hashes the input with the SHA-256 algorithm twice, and returns the output.
fn double_sha256(bytes: &[u8]) -> Vec<u8> {
let digest_1 = digest(&SHA256, bytes);
let digest_2 = digest(&SHA256, digest_1.as_ref());
digest_2.as_ref().to_vec()
}
fn point_to_address(x: &str, y: &str) -> String {
let mut addrv: Vec<u8> = Vec::with_capacity(65);
addrv.push(4u8);
addrv.append(&mut <Vec<u8>>::from_hex(x).unwrap());
addrv.append(&mut <Vec<u8>>::from_hex(y).unwrap());
// hash the addresses first using SHA256
let sha_digest = digest(&SHA256, &addrv);
let mut ripemd_digest = Ripemd160::digest(&sha_digest.as_ref()).as_slice().to_vec();
// prepend a 0 to the vector
ripemd_digest.insert(0, 0);
// calculate checksum of extended ripemd digest
let checksum = double_sha256(&ripemd_digest);
ripemd_digest.extend_from_slice(&checksum[..4]);
base58_encode(&mut ripemd_digest)
}
fn main() {
println!("{}", point_to_address(X, Y));
}
|
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #Seed7 | Seed7 | $ include "seed7_05.s7i";
include "bytedata.s7i";
include "msgdigest.s7i";
include "encoding.s7i";
const func string: publicPointToAddress (in string: x, in string: y) is func
result
var string: address is "";
begin
address := "\4;" & hex2Bytes(x) & hex2Bytes(y);
address := "\0;" & ripemd160(sha256(address));
address &:= sha256(sha256(address))[.. 4];
address := toBase58(address);
end func;
const proc: main is func
begin
writeln(publicPointToAddress("50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352",
"2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6"));
end func; |
http://rosettacode.org/wiki/Bitmap/Flood_fill | Bitmap/Flood fill | Implement a flood fill.
A flood fill is a way of filling an area using color banks to define the contained area or a target color which "determines" the area (the valley that can be flooded; Wikipedia uses the term target color). It works almost like a water flooding from a point towards the banks (or: inside the valley): if there's a hole in the banks, the flood is not contained and all the image (or all the "connected valleys") get filled.
To accomplish the task, you need to implement just one of the possible algorithms (examples are on Wikipedia). Variations on the theme are allowed (e.g. adding a tolerance parameter or argument for color-matching of the banks or target color).
Testing: the basic algorithm is not suitable for truecolor images; a possible test image is the one shown on the right box; you can try to fill the white area, or the black inner circle.
| #FreeBASIC | FreeBASIC | ' version 04-11-2016
' compile with: fbc -s console
' the flood_fill needs to know the boundries of the window/screen
' without them the routine start to check outside the window
' this leads to crashes (out of stack)
' the Line routine has clipping it will not draw outside the window
Sub flood_fill(x As Integer, y As Integer, target As UInteger, fill_color As UInteger)
Dim As Long x_max, y_max
ScreenInfo x_max, y_max
' 0, 0 is top left corner
If Point(x,y) <> target Then Exit Sub
Dim As Long l = x, r = x
While Point(l -1, y) = target AndAlso l -1 > -1
l = l -1
Wend
While Point(r +1, y) = target AndAlso r +1 < x_max
r = r +1
Wend
Line (l,y) - (r,y), fill_color
For x = l To r
If y +1 < y_max Then flood_fill(x, y +1, target, fill_color)
If y -1 > -1 Then flood_fill(x, y -1, target, fill_color)
Next
End Sub
' ------=< MAIN >=------
Dim As ULong i, col, x, y
ScreenRes 400, 400, 32
Randomize Timer
For i As ULong = 1 To 5
Circle(Rnd * 400 ,Rnd * 400), i * 40, Rnd * &hFFFFFF
Next
' hit a key to end or close window
Do
x = Rnd * 400
y = Rnd * 400
col = Point(x, y)
flood_fill(x, y, col, Rnd * &hFFFFFF )
Sleep 2000
If InKey <> "" OrElse InKey = Chr(255) + "k" Then End
Loop |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Free_Pascal | Free Pascal | {$mode objfpc}{$ifdef mswindows}{$apptype console}{$endif}
const
true = 'true';
false = 'false';
begin
writeln(true);
writeln(false);
end. |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Frink | Frink | Public Sub Main()
Dim bX As Boolean
Print bX
bX = True
Print bX
End |
http://rosettacode.org/wiki/Caesar_cipher | Caesar cipher |
Task
Implement a Caesar cipher, both encoding and decoding.
The key is an integer from 1 to 25.
This cipher rotates (either towards left or right) the letters of the alphabet (A to Z).
The encoding replaces each letter with the 1st to 25th next letter in the alphabet (wrapping Z to A).
So key 2 encrypts "HI" to "JK", but key 20 encrypts "HI" to "BC".
This simple "mono-alphabetic substitution cipher" provides almost no security, because an attacker who has the encoded message can either use frequency analysis to guess the key, or just try all 25 keys.
Caesar cipher is identical to Vigenère cipher with a key of length 1.
Also, Rot-13 is identical to Caesar cipher with key 13.
Related tasks
Rot-13
Substitution Cipher
Vigenère Cipher/Cryptanalysis
| #Wortel | Wortel | @let {
; this function only replaces letters and keeps case
ceasar &[s n] !!s.replace &"[a-z]"gi &[x] [
@vars {
t x.charCodeAt.
l ?{
&& > t 96 < t 123 97
&& > t 64 < t 91 65
0
}
}
!String.fromCharCode ?{
l +l ~% 26 -+ n t l
t
}
]
!!ceasar "abc $%^ ABC" 10
} |
http://rosettacode.org/wiki/Box_the_compass | Box the compass | There be many a land lubber that knows naught of the pirate ways and gives direction by degree!
They know not how to box the compass!
Task description
Create a function that takes a heading in degrees and returns the correct 32-point compass heading.
Use the function to print and display a table of Index, Compass point, and Degree; rather like the corresponding columns from, the first table of the wikipedia article, but use only the following 33 headings as input:
[0.0, 16.87, 16.88, 33.75, 50.62, 50.63, 67.5, 84.37, 84.38, 101.25, 118.12, 118.13, 135.0, 151.87, 151.88, 168.75, 185.62, 185.63, 202.5, 219.37, 219.38, 236.25, 253.12, 253.13, 270.0, 286.87, 286.88, 303.75, 320.62, 320.63, 337.5, 354.37, 354.38]. (They should give the same order of points but are spread throughout the ranges of acceptance).
Notes;
The headings and indices can be calculated from this pseudocode:
for i in 0..32 inclusive:
heading = i * 11.25
case i %3:
if 1: heading += 5.62; break
if 2: heading -= 5.62; break
end
index = ( i mod 32) + 1
The column of indices can be thought of as an enumeration of the thirty two cardinal points (see talk page)..
| #Euphoria | Euphoria | constant names = {"North","North by east","North-northeast","Northeast by north",
"Northeast","Northeast by east","East-northeast","East by north","East",
"East by south","East-southeast","Southeast by east","Southeast","Southeast by south",
"South-southeast","South by east","South","South by west","South-southwest",
"Southwest by south","Southwest","Southwest by west","West-southwest",
"West by south","West","West by north","West-northwest","Northwest by west",
"Northwest","Northwest by north","North-northwest","North by west"}
function deg2ind(atom degree)
return remainder(floor(degree*32/360+.5),32)+1
end function
sequence degrees
degrees = {}
for i = 0 to 32 do
degrees &= i*11.25 + 5.62*(remainder(i+1,3)-1)
end for
integer j
for i = 1 to length(degrees) do
j = deg2ind(degrees[i])
printf(1, "%6.2f %2d %-22s\n", {degrees[i], j, names[j]})
end for |
http://rosettacode.org/wiki/Bitwise_operations | Bitwise operations |
Basic Data Operation
This is a basic data operation. It represents a fundamental action on a basic data type.
You may see other such operations in the Basic Data Operations category, or:
Integer Operations
Arithmetic |
Comparison
Boolean Operations
Bitwise |
Logical
String Operations
Concatenation |
Interpolation |
Comparison |
Matching
Memory Operations
Pointers & references |
Addresses
Task
Write a routine to perform a bitwise AND, OR, and XOR on two integers, a bitwise NOT on the first integer, a left shift, right shift, right arithmetic shift, left rotate, and right rotate.
All shifts and rotates should be done on the first integer with a shift/rotate amount of the second integer.
If any operation is not available in your language, note it.
| #Axe | Axe | Lbl BITS
r₁→A
r₂→B
Disp "AND:",A·B▶Dec,i
Disp "OR:",AᕀB▶Dec,i
Disp "XOR:",A▫B▶Dec,i
Disp "NOT:",not(A)ʳ▶Dec,i
.No language support for shifts or rotations
Return |
http://rosettacode.org/wiki/Bitmap | Bitmap | Show a basic storage type to handle a simple RGB raster graphics image,
and some primitive associated functions.
If possible provide a function to allocate an uninitialised image,
given its width and height, and provide 3 additional functions:
one to fill an image with a plain RGB color,
one to set a given pixel with a color,
one to get the color of a pixel.
(If there are specificities about the storage or the allocation, explain those.)
These functions are used as a base for the articles in the category raster graphics operations,
and a basic output function to check the results
is available in the article write ppm file.
| #ALGOL_68 | ALGOL 68 | # -*- coding: utf-8 -*- #
MODE PIXEL = STRUCT(#SHORT# BITS red,green,blue);
MODE POINT = STRUCT(INT x,y);
MODE IMAGE = [0,0]PIXEL; # instance attributes #
MODE CLASSIMAGE = STRUCT ( # class attributes #
PIXEL black, red, green, blue, white,
PROC (REF IMAGE)REF IMAGE init,
PROC (REF IMAGE, PIXEL)VOID fill,
PROC (REF IMAGE)VOID print,
# virtual: #
REF PROC (REF IMAGE, POINT, POINT, PIXEL)VOID line,
REF PROC (REF IMAGE, POINT, INT, PIXEL)VOID circle,
REF PROC (REF IMAGE, POINT, POINT, POINT, POINT, PIXEL, UNION(INT, VOID))VOID cubic bezier
);
CLASSIMAGE class image = (
# black = # (#SHORTEN# 16r00, #SHORTEN# 16r00, #SHORTEN# 16r00),
# red = # (#SHORTEN# 16rff, #SHORTEN# 16r00, #SHORTEN# 16r00),
# green = # (#SHORTEN# 16r00, #SHORTEN# 16rff, #SHORTEN# 16r00),
# blue = # (#SHORTEN# 16r00, #SHORTEN# 16r00, #SHORTEN# 16rff),
# white = # (#SHORTEN# 16rff, #SHORTEN# 16rff, #SHORTEN# 16rff),
# PROC init = # (REF IMAGE self)REF IMAGE:
BEGIN
(fill OF class image)(self, black OF class image);
self
END,
# PROC fill = # (REF IMAGE self, PIXEL color)VOID:
FOR x FROM 1 LWB self TO 1 UPB self DO
FOR y FROM 2 LWB self TO 2 UPB self DO
self[x,y] := color
OD
OD,
# PROC print = # (REF IMAGE self)VOID:
printf(($n(UPB self)(3(16r2d))l$, self)),
# virtual: #
# REF PROC line = # LOC PROC (REF IMAGE, POINT, POINT, PIXEL)VOID,
# REF PROC circle = # LOC PROC (REF IMAGE, POINT, INT, PIXEL)VOID,
# REF PROC cubic bezier = # LOC PROC (REF IMAGE, POINT, POINT, POINT, POINT, PIXEL, UNION(INT, VOID))VOID
);
OP CLASSOF = (IMAGE image)CLASSIMAGE: class image;
OP INIT = (REF IMAGE image)REF IMAGE: (init OF (CLASSOF image))(image);
SKIP |
http://rosettacode.org/wiki/Bitmap/Midpoint_circle_algorithm | Bitmap/Midpoint circle algorithm | Task
Using the data storage type defined on this page for raster images,
write an implementation of the midpoint circle algorithm (also known as Bresenham's circle algorithm).
(definition on Wikipedia).
| #Python | Python | def circle(self, x0, y0, radius, colour=black):
f = 1 - radius
ddf_x = 1
ddf_y = -2 * radius
x = 0
y = radius
self.set(x0, y0 + radius, colour)
self.set(x0, y0 - radius, colour)
self.set(x0 + radius, y0, colour)
self.set(x0 - radius, y0, colour)
while x < y:
if f >= 0:
y -= 1
ddf_y += 2
f += ddf_y
x += 1
ddf_x += 2
f += ddf_x
self.set(x0 + x, y0 + y, colour)
self.set(x0 - x, y0 + y, colour)
self.set(x0 + x, y0 - y, colour)
self.set(x0 - x, y0 - y, colour)
self.set(x0 + y, y0 + x, colour)
self.set(x0 - y, y0 + x, colour)
self.set(x0 + y, y0 - x, colour)
self.set(x0 - y, y0 - x, colour)
Bitmap.circle = circle
bitmap = Bitmap(25,25)
bitmap.circle(x0=12, y0=12, radius=12)
bitmap.chardisplay()
'''
The origin, 0,0; is the lower left, with x increasing to the right,
and Y increasing upwards.
The program above produces the following display :
+-------------------------+
| @@@@@@@ |
| @@ @@ |
| @@ @@ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
|@ @|
|@ @|
|@ @|
|@ @|
|@ @|
|@ @|
|@ @|
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @ @ |
| @@ @@ |
| @@ @@ |
| @@@@@@@ |
+-------------------------+
'''
|
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #Mathematica_.2F_Wolfram_Language | Mathematica / Wolfram Language | points= {{0, 0}, {1, 1}, {2, -1}, {3, 0}};
Graphics[{BSplineCurve[points], Green, Line[points], Red, Point[points]}] |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #MATLAB | MATLAB |
function bezierCubic(obj,pixel_0,pixel_1,pixel_2,pixel_3,color,varargin)
if( isempty(varargin) )
resolution = 20;
else
resolution = varargin{1};
end
%Calculate time axis
time = (0:1/resolution:1)';
timeMinus = 1-time;
%The formula for the curve is expanded for clarity, the lack of
%loops is because its calculation has been vectorized
curve = (timeMinus).^3*pixel_0; %First term of polynomial
curve = curve + (3.*time.*timeMinus.^2)*pixel_1; %second term of polynomial
curve = curve + (3.*timeMinus.*time.^2)*pixel_2; %third term of polynomial
curve = curve + time.^3*pixel_3; %Fourth term of polynomial
curve = round(curve); %round each of the points to the nearest integer
%connect each of the points in the curve with a line using the
%Bresenham Line algorithm
for i = (1:length(curve)-1)
obj.bresenhamLine(curve(i,:),curve(i+1,:),color);
end
assignin('caller',inputname(1),obj); %saves the changes to the object
end
|
http://rosettacode.org/wiki/Biorhythms | Biorhythms | For a while in the late 70s, the pseudoscience of biorhythms was popular enough to rival astrology, with kiosks in malls that would give you your weekly printout. It was also a popular entry in "Things to Do with your Pocket Calculator" lists. You can read up on the history at Wikipedia, but the main takeaway is that unlike astrology, the math behind biorhythms is dead simple.
It's based on the number of days since your birth. The premise is that three cycles of unspecified provenance govern certain aspects of everyone's lives – specifically, how they're feeling physically, emotionally, and mentally. The best part is that not only do these cycles somehow have the same respective lengths for all humans of any age, gender, weight, genetic background, etc, but those lengths are an exact number of days. And the pattern is in each case a perfect sine curve. Absolutely miraculous!
To compute your biorhythmic profile for a given day, the first thing you need is the number of days between that day and your birth, so the answers in Days between dates are probably a good starting point. (Strictly speaking, the biorhythms start at 0 at the moment of your birth, so if you know time of day you can narrow things down further, but in general these operate at whole-day granularity.) Then take the residue of that day count modulo each of the the cycle lengths to calculate where the day falls on each of the three sinusoidal journeys.
The three cycles and their lengths are as follows:
Cycle
Length
Physical
23 days
Emotional
28 days
Mental
33 days
The first half of each cycle is in "plus" territory, with a peak at the quarter-way point; the second half in "minus" territory, with a valley at the three-quarters mark. You can calculate a specific value between -1 and +1 for the kth day of an n-day cycle by computing sin( 2πk / n ). The days where a cycle crosses the axis in either direction are called "critical" days, although with a cycle value of 0 they're also said to be the most neutral, which seems contradictory.
The task: write a subroutine, function, or program that will, given a birthdate and a target date, output the three biorhythmic values for the day. You may optionally include a text description of the position and the trend (e.g. "up and rising", "peak", "up but falling", "critical", "down and falling", "valley", "down but rising"), an indication of the date on which the next notable event (peak, valley, or crossing) falls, or even a graph of the cycles around the target date. Demonstrate the functionality for dates of your choice.
Example run of my Raku implementation:
raku br.raku 1943-03-09 1972-07-11
Output:
Day 10717:
Physical day 22: -27% (down but rising, next transition 1972-07-12)
Emotional day 21: valley
Mental day 25: valley
Double valley! This was apparently not a good day for Mr. Fischer to begin a chess tournament...
| #Go | Go | package main
import (
"fmt"
"log"
"math"
"time"
)
const layout = "2006-01-02" // template for time.Parse
var cycles = [3]string{"Physical day ", "Emotional day", "Mental day "}
var lengths = [3]int{23, 28, 33}
var quadrants = [4][2]string{
{"up and rising", "peak"},
{"up but falling", "transition"},
{"down and falling", "valley"},
{"down but rising", "transition"},
}
func check(err error) {
if err != nil {
log.Fatal(err)
}
}
// Parameters assumed to be in YYYY-MM-DD format.
func biorhythms(birthDate, targetDate string) {
bd, err := time.Parse(layout, birthDate)
check(err)
td, err := time.Parse(layout, targetDate)
check(err)
days := int(td.Sub(bd).Hours() / 24)
fmt.Printf("Born %s, Target %s\n", birthDate, targetDate)
fmt.Println("Day", days)
for i := 0; i < 3; i++ {
length := lengths[i]
cycle := cycles[i]
position := days % length
quadrant := position * 4 / length
percent := math.Sin(2 * math.Pi * float64(position) / float64(length))
percent = math.Floor(percent*1000) / 10
descript := ""
if percent > 95 {
descript = " peak"
} else if percent < -95 {
descript = " valley"
} else if math.Abs(percent) < 5 {
descript = " critical transition"
} else {
daysToAdd := (quadrant+1)*length/4 - position
transition := td.Add(time.Hour * 24 * time.Duration(daysToAdd))
trend := quadrants[quadrant][0]
next := quadrants[quadrant][1]
transStr := transition.Format(layout)
descript = fmt.Sprintf("%5.1f%% (%s, next %s %s)", percent, trend, next, transStr)
}
fmt.Printf("%s %2d : %s\n", cycle, position, descript)
}
fmt.Println()
}
func main() {
datePairs := [][2]string{
{"1943-03-09", "1972-07-11"},
{"1809-01-12", "1863-11-19"},
{"1809-02-12", "1863-11-19"}, // correct DOB for Abraham Lincoln
}
for _, datePair := range datePairs {
biorhythms(datePair[0], datePair[1])
}
} |
http://rosettacode.org/wiki/Bioinformatics/base_count | Bioinformatics/base count | Given this string representing ordered DNA bases:
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
Task
"Pretty print" the sequence followed by a summary of the counts of each of the bases: (A, C, G, and T) in the sequence
print the total count of each base in the string.
Other tasks related to string operations:
Metrics
Array length
String length
Copy a string
Empty string (assignment)
Counting
Word frequency
Letter frequency
Jewels and stones
I before E except after C
Bioinformatics/base count
Count occurrences of a substring
Count how many vowels and consonants occur in a string
Remove/replace
XXXX redacted
Conjugate a Latin verb
Remove vowels from a string
String interpolation (included)
Strip block comments
Strip comments from a string
Strip a set of characters from a string
Strip whitespace from a string -- top and tail
Strip control codes and extended characters from a string
Anagrams/Derangements/shuffling
Word wheel
ABC problem
Sattolo cycle
Knuth shuffle
Ordered words
Superpermutation minimisation
Textonyms (using a phone text pad)
Anagrams
Anagrams/Deranged anagrams
Permutations/Derangements
Find/Search/Determine
ABC words
Odd words
Word ladder
Semordnilap
Word search
Wordiff (game)
String matching
Tea cup rim text
Alternade words
Changeable words
State name puzzle
String comparison
Unique characters
Unique characters in each string
Extract file extension
Levenshtein distance
Palindrome detection
Common list elements
Longest common suffix
Longest common prefix
Compare a list of strings
Longest common substring
Find common directory path
Words from neighbour ones
Change e letters to i in words
Non-continuous subsequences
Longest common subsequence
Longest palindromic substrings
Longest increasing subsequence
Words containing "the" substring
Sum of the digits of n is substring of n
Determine if a string is numeric
Determine if a string is collapsible
Determine if a string is squeezable
Determine if a string has all unique characters
Determine if a string has all the same characters
Longest substrings without repeating characters
Find words which contains all the vowels
Find words which contains most consonants
Find words which contains more than 3 vowels
Find words which first and last three letters are equals
Find words which odd letters are consonants and even letters are vowels or vice_versa
Formatting
Substring
Rep-string
Word wrap
String case
Align columns
Literals/String
Repeat a string
Brace expansion
Brace expansion using ranges
Reverse a string
Phrase reversals
Comma quibbling
Special characters
String concatenation
Substring/Top and tail
Commatizing numbers
Reverse words in a string
Suffixation of decimal numbers
Long literals, with continuations
Numerical and alphabetical suffixes
Abbreviations, easy
Abbreviations, simple
Abbreviations, automatic
Song lyrics/poems/Mad Libs/phrases
Mad Libs
Magic 8-ball
99 Bottles of Beer
The Name Game (a song)
The Old lady swallowed a fly
The Twelve Days of Christmas
Tokenize
Text between
Tokenize a string
Word break problem
Tokenize a string with escaping
Split a character string based on change of character
Sequences
Show ASCII table
De Bruijn sequences
Self-referential sequences
Generate lower case ASCII alphabet
| #Action.21 | Action! | DEFINE PTR="CARD"
PROC PrettyPrint(PTR ARRAY data INT count,gsize,gcount)
INT index,item,i,ingroup,group,a,t,c,g
CHAR ARRAY s
CHAR ch
index=0 item=0 i=1 ingroup=0 group=0
a=0 t=0 g=0 c=0
s=data(0)
DO
WHILE i>s(0)
DO
i=1 item==+1
IF item>=count THEN EXIT FI
s=data(item)
OD
IF item>=count THEN EXIT FI
index==+1
IF group=0 AND ingroup=0 THEN
IF index<10 THEN Put(32) FI
IF index<100 THEN Put(32) FI
PrintI(index) Print(":")
FI
IF ingroup=0 THEN Put(32) FI
ch=s(i) i==+1
Put(ch)
IF ch='A THEN a==+1
ELSEIF ch='T THEN t==+1
ELSEIF ch='C THEN c==+1
ELSEIF ch='G THEN g==+1 FI
ingroup==+1
IF ingroup>=gsize THEN
ingroup=0 group==+1
IF group>=gcount THEN
group=0
FI
FI
OD
PrintF("%E%EBases: A:%I, T:%I, C:%I, G:%I%E",a,t,c,g)
PrintF("%ETotal: %I",a+t+g+c)
RETURN
PROC Main()
PTR ARRAY data(10)
BYTE LMARGIN=$52,oldLMARGIN
oldLMARGIN=LMARGIN
LMARGIN=0 ;remove left margin on the screen
Put(125) PutE() ;clear the screen
data(0)="CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
data(1)="CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
data(2)="AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
data(3)="GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
data(4)="CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
data(5)="TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
data(6)="TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
data(7)="CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
data(8)="TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
data(9)="GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
PrettyPrint(data,10,5,6)
LMARGIN=oldLMARGIN ;restore left margin on the screen
RETURN |
http://rosettacode.org/wiki/Bioinformatics/base_count | Bioinformatics/base count | Given this string representing ordered DNA bases:
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
Task
"Pretty print" the sequence followed by a summary of the counts of each of the bases: (A, C, G, and T) in the sequence
print the total count of each base in the string.
Other tasks related to string operations:
Metrics
Array length
String length
Copy a string
Empty string (assignment)
Counting
Word frequency
Letter frequency
Jewels and stones
I before E except after C
Bioinformatics/base count
Count occurrences of a substring
Count how many vowels and consonants occur in a string
Remove/replace
XXXX redacted
Conjugate a Latin verb
Remove vowels from a string
String interpolation (included)
Strip block comments
Strip comments from a string
Strip a set of characters from a string
Strip whitespace from a string -- top and tail
Strip control codes and extended characters from a string
Anagrams/Derangements/shuffling
Word wheel
ABC problem
Sattolo cycle
Knuth shuffle
Ordered words
Superpermutation minimisation
Textonyms (using a phone text pad)
Anagrams
Anagrams/Deranged anagrams
Permutations/Derangements
Find/Search/Determine
ABC words
Odd words
Word ladder
Semordnilap
Word search
Wordiff (game)
String matching
Tea cup rim text
Alternade words
Changeable words
State name puzzle
String comparison
Unique characters
Unique characters in each string
Extract file extension
Levenshtein distance
Palindrome detection
Common list elements
Longest common suffix
Longest common prefix
Compare a list of strings
Longest common substring
Find common directory path
Words from neighbour ones
Change e letters to i in words
Non-continuous subsequences
Longest common subsequence
Longest palindromic substrings
Longest increasing subsequence
Words containing "the" substring
Sum of the digits of n is substring of n
Determine if a string is numeric
Determine if a string is collapsible
Determine if a string is squeezable
Determine if a string has all unique characters
Determine if a string has all the same characters
Longest substrings without repeating characters
Find words which contains all the vowels
Find words which contains most consonants
Find words which contains more than 3 vowels
Find words which first and last three letters are equals
Find words which odd letters are consonants and even letters are vowels or vice_versa
Formatting
Substring
Rep-string
Word wrap
String case
Align columns
Literals/String
Repeat a string
Brace expansion
Brace expansion using ranges
Reverse a string
Phrase reversals
Comma quibbling
Special characters
String concatenation
Substring/Top and tail
Commatizing numbers
Reverse words in a string
Suffixation of decimal numbers
Long literals, with continuations
Numerical and alphabetical suffixes
Abbreviations, easy
Abbreviations, simple
Abbreviations, automatic
Song lyrics/poems/Mad Libs/phrases
Mad Libs
Magic 8-ball
99 Bottles of Beer
The Name Game (a song)
The Old lady swallowed a fly
The Twelve Days of Christmas
Tokenize
Text between
Tokenize a string
Word break problem
Tokenize a string with escaping
Split a character string based on change of character
Sequences
Show ASCII table
De Bruijn sequences
Self-referential sequences
Generate lower case ASCII alphabet
| #Ada | Ada | with Ada.Text_Io;
procedure Base_Count is
type Sequence is new String;
Test : constant Sequence :=
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" &
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" &
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" &
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" &
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" &
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" &
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" &
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" &
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" &
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT";
Line_Width : constant := 70;
procedure Put (Seq : Sequence) is
use Ada.Text_Io;
package Position_Io is new Ada.Text_Io.Integer_Io (Natural);
First : Natural := Seq'First;
Last : Natural;
begin
loop
Last := Natural'Min (Seq'Last, First + Line_Width - 1);
Position_Io.Put (First, Width => 3);
Put (String'(".."));
Position_Io.Put (Last, Width => 3);
Put (String'(" "));
Put (String (Seq (First .. Last)));
New_Line;
exit when Last = Seq'Last;
First := First + Line_Width;
end loop;
end Put;
procedure Count (Seq : Sequence) is
use Ada.Text_Io;
A_Count, C_Count : Natural := 0;
G_Count, T_Count : Natural := 0;
begin
for B of Seq loop
case B is
when 'A' => A_Count := A_Count + 1;
when 'C' => C_Count := C_Count + 1;
when 'G' => G_Count := G_Count + 1;
when 'T' => T_Count := T_Count + 1;
when others =>
raise Constraint_Error;
end case;
end loop;
Put_Line ("A: " & A_Count'Image);
Put_Line ("C: " & C_Count'Image);
Put_Line ("G: " & G_Count'Image);
Put_Line ("T: " & T_Count'Image);
Put_Line ("Total: " & Seq'Length'Image);
end Count;
begin
Put (Test);
Count (Test);
end Base_Count; |
http://rosettacode.org/wiki/Bitmap/Bresenham%27s_line_algorithm | Bitmap/Bresenham's line algorithm | Task
Using the data storage type defined on the Bitmap page for raster graphics images,
draw a line given two points with Bresenham's line algorithm.
| #BASIC | BASIC | 1500 REM === DRAW a LINE. Ported from C version
1510 REM Inputs are X1, Y1, X2, Y2: Destroys value of X1, Y1
1520 DX = ABS(X2 - X1):SX = -1:IF X1 < X2 THEN SX = 1
1530 DY = ABS(Y2 - Y1):SY = -1:IF Y1 < Y2 THEN SY = 1
1540 ER = -DY:IF DX > DY THEN ER = DX
1550 ER = INT(ER / 2)
1560 PLOT X1,Y1:REM This command may differ depending ON BASIC dialect
1570 IF X1 = X2 AND Y1 = Y2 THEN RETURN
1580 E2 = ER
1590 IF E2 > -DX THEN ER = ER - DY:X1 = X1 + SX
1600 IF E2 < DY THEN ER = ER + DX:Y1 = Y1 + SY
1610 GOTO 1560 |
http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation | Bioinformatics/Sequence mutation | Task
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
Choosing a random base position in the sequence.
Mutate the sequence by doing one of either:
Swap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
Delete the chosen base at the position.
Insert another base randomly chosen from A,C, G, or T into the sequence at that position.
Randomly generate a test DNA sequence of at least 200 bases
"Pretty print" the sequence and a count of its size, and the count of each base in the sequence
Mutate the sequence ten times.
"Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
Extra credit
Give more information on the individual mutations applied.
Allow mutations to be weighted and/or chosen. | #Common_Lisp | Common Lisp |
(defun random_base ()
(random 4))
(defun basechar (base)
(char "ACTG" base))
(defun generate_genome (genome_length)
(let (genome '())
(loop for i below genome_length do
(push (random_base) genome))
(return-from generate_genome genome)))
(defun map_genome (genome)
(let (seq '())
(loop for n from (1- (length genome)) downto 0 do
(push (position (char genome n) "ACTG") seq))
seq))
(defun output_genome_info (genome &optional (genome_name "ORIGINAL"))
(let ((ac 0) (tc 0) (cc 0) (gc 0))
(format t "~% ---- ~a ----" genome_name)
(do ((n 0 (1+ n)))
((= n (length genome)))
(when (= 0 (mod n 50)) (format t "~& ~4d: " (1+ n)))
(case (nth n genome)
(0 (incf ac))
(1 (incf tc))
(2 (incf cc))
(3 (incf gc)))
(format t "~c" (basechar (nth n genome))))
(format t "~2%- Total : ~3d~%A : ~d C : ~d~%T : ~d G : ~d~2%" (length genome) ac tc cc gc)))
(defun insert_base (genome)
(let ((place (random (length genome)))
(base (random_base)))
(format t "Insert + ~c at ~3d~%"
(basechar base) (+ 1 place))
(if (= 0 place)
(push base genome)
(push base (cdr (nthcdr (1- place) genome))))
(return-from insert_base genome)))
(defun swap_base (genome)
(let ((place (random (length genome)))
(base (random_base)))
(format t "Swap ~c -> ~c at ~3d~%"
(basechar (nth place genome)) (basechar base) (+ 1 place))
(setf (nth place genome) base)
(return-from swap_base genome)))
(defun delete_base (genome)
(let ((place (random (length genome))))
(format t "Delete - ~c at ~3d~%"
(basechar (nth place genome)) (+ 1 place))
(if (= 0 place) (pop genome)
(pop (cdr (nthcdr (1- place) genome))))
(return-from delete_base genome)))
(defun mutate (genome_length n_mutations
&key (ins_w 10) (swp_w 10) (del_w 10)
(genome (generate_genome genome_length) has_genome))
(if has_genome (setf genome (map_genome genome)))
(output_genome_info genome)
(format t " ---- MUTATION SEQUENCE ----~%")
(do ((n 0 (1+ n)))
((= n n_mutations))
(setf mutation_type (random (+ ins_w swp_w del_w)))
(format t "~3d : " (1+ n))
(setf genome
(cond ((< mutation_type ins_w) (insert_base genome))
((< mutation_type (+ ins_w swp_w)) (swap_base genome))
(t (delete_base genome)))))
(output_genome_info genome "MUTATED"))
|
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Haskell | Haskell | import Control.Monad (when)
import Data.List (elemIndex)
import Data.Monoid ((<>))
import qualified Data.ByteString as BS
import Data.ByteString (ByteString)
import Crypto.Hash.SHA256 (hash) -- from package cryptohash
-- Convert from base58 encoded value to Integer
decode58 :: String -> Maybe Integer
decode58 = fmap combine . traverse parseDigit
where
combine = foldl (\acc digit -> 58 * acc + digit) 0 -- should be foldl', but this trips up the highlighting
parseDigit char = toInteger <$> elemIndex char c58
c58 = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
-- Convert from base58 encoded value to bytes
toBytes :: Integer -> ByteString
toBytes = BS.reverse . BS.pack . map (fromIntegral . (`mod` 256)) . takeWhile (> 0) . iterate (`div` 256)
-- Check if the hash of the first 21 (padded) bytes matches the last 4 bytes
checksumValid :: ByteString -> Bool
checksumValid address =
let (value, checksum) = BS.splitAt 21 $ leftPad address
in and $ BS.zipWith (==) checksum $ hash $ hash $ value
where
leftPad bs = BS.replicate (25 - BS.length bs) 0 <> bs
-- utility
withError :: e -> Maybe a -> Either e a
withError e = maybe (Left e) Right
-- Check validity of base58 encoded bitcoin address.
-- Result is either an error string (Left) or unit (Right ()).
validityCheck :: String -> Either String ()
validityCheck encoded = do
num <- withError "Invalid base 58 encoding" $ decode58 encoded
let address = toBytes num
when (BS.length address > 25) $ Left "Address length exceeds 25 bytes"
when (BS.length address < 4) $ Left "Address length less than 4 bytes"
when (not $ checksumValid address) $ Left "Invalid checksum"
-- Run one validity check and display results.
validate :: String -> IO ()
validate encodedAddress = do
let result = either show (const "Valid") $ validityCheck encodedAddress
putStrLn $ show encodedAddress ++ " -> " ++ result
-- Run some validity check tests.
main :: IO ()
main = do
validate "1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" -- VALID
validate "1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9" -- VALID
validate "1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62X" -- checksum changed, original data.
validate "1ANNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" -- data changed, original checksum.
validate "1A Na15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" -- invalid chars
validate "1ANa55215ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" -- too long
validate "i55j" -- too short
|
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #Tcl | Tcl | package require ripemd160
package require sha256
# Exactly the algorithm from https://en.bitcoin.it/wiki/Base58Check_encoding
proc base58encode data {
set digits "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
for {set zeroes 0} {[string index $data 0] eq "\x00"} {incr zeroes} {
set data [string range $data 1 end]
}
binary scan $data "H*" hex
scan $hex "%llx" num
for {set out ""} {$num > 0} {set num [expr {$num / 58}]} {
append out [string index $digits [expr {$num % 58}]]
}
append out [string repeat [string index $digits 0] $zeroes]
return [string reverse $out]
}
# Encode a Bitcoin address
proc bitcoin_mkaddr {A B} {
set A [expr {$A & ((1<<256)-1)}]
set B [expr {$B & ((1<<256)-1)}]
set bin [binary format "cH*" 4 [format "%064llx%064llx" $A $B]]
set md [ripemd::ripemd160 [sha2::sha256 -bin $bin]]
set addr [binary format "ca*" 0 $md]
set hash [sha2::sha256 -bin [sha2::sha256 -bin $addr]]
append addr [binary format "a4" [string range $hash 0 3]]
return [base58encode $addr]
} |
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #Wren | Wren | import "/crypto" for Sha256, Ripemd160
import "/str" for Str
import "/fmt" for Conv
// converts an hexadecimal string to a byte list.
var HexToBytes = Fn.new { |s| Str.chunks(s, 2).map { |c| Conv.atoi(c, 16) }.toList }
// Point is a class for a bitcoin public point
class Point {
construct new() {
_x = List.filled(32, 0)
_y = List.filled(32, 0)
}
x { _x }
y { _y }
// setHex takes two hexadecimal strings and decodes them into the receiver.
setHex(s, t) {
if (s.count != 64 || t.count != 64) Fiber.abort("Invalid hex string length.")
_x = HexToBytes.call(s)
_y = HexToBytes.call(t)
}
}
// Represents a bitcoin address.
class Address {
static tmpl_ { "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz".bytes }
construct new() {
_a = List.filled(25, 0)
}
a { _a }
// returns a base58 encoded bitcoin address corresponding to the receiver.
a58 {
var out = List.filled(34, 0)
for (n in 33..0) {
var c = 0
for (i in 0..24) {
c = c * 256 + _a[i]
_a[i] = (c/58).floor
c = c % 58
}
out[n] = Address.tmpl_[c]
}
var i = 1
while (i < 34 && out[i] == 49) i = i + 1
return out[i-1..-1]
}
// doubleSHA256 computes a double sha256 hash of the first 21 bytes of the
// address, returning the full 32 byte sha256 hash.
doubleSHA256() {
var d = Sha256.digest(_a[0..20])
d = HexToBytes.call(d)
d = Sha256.digest(d)
return HexToBytes.call(d)
}
// updateChecksum computes the address checksum on the first 21 bytes and
// stores the result in the last 4 bytes.
updateCheckSum() {
var d = doubleSHA256()
for (i in 21..24) _a[i] = d[i-21]
}
// setPoint takes a public point and generates the corresponding address
// into the receiver, complete with valid checksum.
setPoint(p) {
var c = List.filled(65, 0)
c[0] = 4
for (i in 1..32) c[i] = p.x[i - 1]
for (i in 33..64) c[i] = p.y[i - 33]
var s = Sha256.digest(c)
s = HexToBytes.call(s)
var h = Ripemd160.digest(s)
h = HexToBytes.call(h)
for (i in 0...h.count) _a[i+1] = h[i]
updateCheckSum()
}
}
// parse hex into Point object
var p = Point.new()
p.setHex(
"50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352",
"2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6"
)
// generate Address object from Point
var a = Address.new()
a.setPoint(p)
// show base58 representation
System.print(a.a58.map { |b| String.fromByte(b) }.join()) |
http://rosettacode.org/wiki/Bitmap/Flood_fill | Bitmap/Flood fill | Implement a flood fill.
A flood fill is a way of filling an area using color banks to define the contained area or a target color which "determines" the area (the valley that can be flooded; Wikipedia uses the term target color). It works almost like a water flooding from a point towards the banks (or: inside the valley): if there's a hole in the banks, the flood is not contained and all the image (or all the "connected valleys") get filled.
To accomplish the task, you need to implement just one of the possible algorithms (examples are on Wikipedia). Variations on the theme are allowed (e.g. adding a tolerance parameter or argument for color-matching of the banks or target color).
Testing: the basic algorithm is not suitable for truecolor images; a possible test image is the one shown on the right box; you can try to fill the white area, or the black inner circle.
| #Go | Go | package raster
func (b *Bitmap) Flood(x, y int, repl Pixel) {
targ, _ := b.GetPx(x, y)
var ff func(x, y int)
ff = func(x, y int) {
p, ok := b.GetPx(x, y)
if ok && p.R == targ.R && p.G == targ.G && p.B == targ.B {
b.SetPx(x, y, repl)
ff(x-1, y)
ff(x+1, y)
ff(x, y-1)
ff(x, y+1)
}
}
ff(x, y)
} |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Futhark | Futhark | Public Sub Main()
Dim bX As Boolean
Print bX
bX = True
Print bX
End |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Gambas | Gambas | Public Sub Main()
Dim bX As Boolean
Print bX
bX = True
Print bX
End |
http://rosettacode.org/wiki/Caesar_cipher | Caesar cipher |
Task
Implement a Caesar cipher, both encoding and decoding.
The key is an integer from 1 to 25.
This cipher rotates (either towards left or right) the letters of the alphabet (A to Z).
The encoding replaces each letter with the 1st to 25th next letter in the alphabet (wrapping Z to A).
So key 2 encrypts "HI" to "JK", but key 20 encrypts "HI" to "BC".
This simple "mono-alphabetic substitution cipher" provides almost no security, because an attacker who has the encoded message can either use frequency analysis to guess the key, or just try all 25 keys.
Caesar cipher is identical to Vigenère cipher with a key of length 1.
Also, Rot-13 is identical to Caesar cipher with key 13.
Related tasks
Rot-13
Substitution Cipher
Vigenère Cipher/Cryptanalysis
| #Wren | Wren | class Caesar {
static encrypt(s, key) {
var offset = key % 26
if (offset == 0) return s
var chars = List.filled(s.count, 0)
for (i in 0...s.count) {
var c = s[i].bytes[0]
var d = c
if (c >= 65 && c <= 90) { // 'A' to 'Z'
d = c + offset
if (d > 90) d = d - 26
} else if (c >= 97 && c <= 122) { // 'a' to 'z'
d = c + offset
if (d > 122) d = d - 26
}
chars[i] = d
}
return chars.reduce("") { |acc, c| acc + String.fromByte(c) }
}
static decrypt(s, key) { encrypt(s, 26 - key) }
}
var encoded = Caesar.encrypt("Bright vixens jump; dozy fowl quack.", 8)
System.print(encoded)
System.print(Caesar.decrypt(encoded, 8)) |
http://rosettacode.org/wiki/Box_the_compass | Box the compass | There be many a land lubber that knows naught of the pirate ways and gives direction by degree!
They know not how to box the compass!
Task description
Create a function that takes a heading in degrees and returns the correct 32-point compass heading.
Use the function to print and display a table of Index, Compass point, and Degree; rather like the corresponding columns from, the first table of the wikipedia article, but use only the following 33 headings as input:
[0.0, 16.87, 16.88, 33.75, 50.62, 50.63, 67.5, 84.37, 84.38, 101.25, 118.12, 118.13, 135.0, 151.87, 151.88, 168.75, 185.62, 185.63, 202.5, 219.37, 219.38, 236.25, 253.12, 253.13, 270.0, 286.87, 286.88, 303.75, 320.62, 320.63, 337.5, 354.37, 354.38]. (They should give the same order of points but are spread throughout the ranges of acceptance).
Notes;
The headings and indices can be calculated from this pseudocode:
for i in 0..32 inclusive:
heading = i * 11.25
case i %3:
if 1: heading += 5.62; break
if 2: heading -= 5.62; break
end
index = ( i mod 32) + 1
The column of indices can be thought of as an enumeration of the thirty two cardinal points (see talk page)..
| #F.23 | F# | let box = [|
"North"; "North by east"; "North-northeast"; "Northeast by north";
"Northeast"; "Northeast by east"; "East-northeast"; "East by north";
"East"; "East by south"; "East-southeast"; "Southeast by east";
"Southeast"; "Southeast by south"; "South-southeast"; "South by east";
"South"; "South by west"; "South-southwest"; "Southwest by south";
"Southwest"; "Southwest by west"; "West-southwest"; "West by south";
"West"; "West by north"; "West-northwest"; "Northwest by west";
"Northwest"; "Northwest by north"; "North-northwest"; "North by west" |]
[ 0.0; 16.87; 16.88; 33.75; 50.62; 50.63; 67.5; 84.37; 84.38;
101.25; 118.12; 118.13; 135.0; 151.87; 151.88; 168.75; 185.62;
185.63; 202.5; 219.37; 219.38; 236.25; 253.12; 253.13; 270.0;
286.87; 286.88; 303.75; 320.62; 320.63; 337.5; 354.37; 354.38 ]
|> List.iter (fun phi ->
let i = (int (phi * 32. / 360. + 0.5)) % 32
printf "%3d %18s %6.2f°\n" (i + 1) box.[i] phi) |
http://rosettacode.org/wiki/Bitwise_operations | Bitwise operations |
Basic Data Operation
This is a basic data operation. It represents a fundamental action on a basic data type.
You may see other such operations in the Basic Data Operations category, or:
Integer Operations
Arithmetic |
Comparison
Boolean Operations
Bitwise |
Logical
String Operations
Concatenation |
Interpolation |
Comparison |
Matching
Memory Operations
Pointers & references |
Addresses
Task
Write a routine to perform a bitwise AND, OR, and XOR on two integers, a bitwise NOT on the first integer, a left shift, right shift, right arithmetic shift, left rotate, and right rotate.
All shifts and rotates should be done on the first integer with a shift/rotate amount of the second integer.
If any operation is not available in your language, note it.
| #Babel | Babel | ({5 9}) ({cand} {cor} {cnor} {cxor} {cxnor} {shl} {shr} {ashr} {rol}) cart ! {give <- cp -> compose !} over ! {eval} over ! {;} each |
http://rosettacode.org/wiki/Bitmap | Bitmap | Show a basic storage type to handle a simple RGB raster graphics image,
and some primitive associated functions.
If possible provide a function to allocate an uninitialised image,
given its width and height, and provide 3 additional functions:
one to fill an image with a plain RGB color,
one to set a given pixel with a color,
one to get the color of a pixel.
(If there are specificities about the storage or the allocation, explain those.)
These functions are used as a base for the articles in the category raster graphics operations,
and a basic output function to check the results
is available in the article write ppm file.
| #Applesoft_BASIC | Applesoft BASIC | 100 W = 8
110 H = 8
120 BB = 24576 + LEN ( STR$ (W) + STR$ (H)) + 9: REM P6 HEADER
130 HIMEM: 8192
140 R = 255
150 G = 255
160 B = 0
170 C = R + G * 256 + B * 65536
180 GOSUB 600FILL
190 X = 4
200 Y = 5
210 R = 127
220 G = 127
230 B = 255
240 C = R + G * 256 + B * 65536
250 GOSUB 500"SET PIXEL"
260 X = 3
270 Y = 2
280 GOSUB 400"GET PIXEL"
290 PRINT "COLOR="C" RED="R" GREEN="G" BLUE="B;
300 END
400 A = BB + X * 3 + Y * W * 3
410 R = PEEK (A)
420 G = PEEK (A + 1)
430 B = PEEK (A + 2)
440 C = R + G * 256 + B * 65536
450 RETURN
500 R = C - INT (C / 256) * 256
510 B = INT (C / 65536)
520 G = INT (C / 256) - B * 256
530 A = BB + X * 3 + Y * W * 3
540 POKE A,R
550 POKE A + 1,G
560 POKE A + 2,B
570 RETURN
600 FOR Y = 0 TO H - 1
610 FOR X = 0 TO W - 1
620 GOSUB 500"SET PIXEL"
630 NEXT X,Y
640 RETURN |
http://rosettacode.org/wiki/Bitmap/Midpoint_circle_algorithm | Bitmap/Midpoint circle algorithm | Task
Using the data storage type defined on this page for raster images,
write an implementation of the midpoint circle algorithm (also known as Bresenham's circle algorithm).
(definition on Wikipedia).
| #Racket | Racket |
#lang racket
(require racket/draw)
(define-syntax ⊕ (syntax-rules () [(_ id e) (set! id (+ id e))]))
(define (draw-point dc x y)
(send dc draw-point x y))
(define (draw-circle dc x0 y0 r)
(define f (- 1 r))
(define ddf_x 1)
(define ddf_y (* -2 r))
(define x 0)
(define y r)
(draw-point dc x0 (+ y0 r))
(draw-point dc x0 (- y0 r))
(draw-point dc (+ x0 r) y0)
(draw-point dc (- x0 r) y0)
(let loop ()
(when (< x y)
(when (>= f 0)
(⊕ y -1)
(⊕ ddf_y 2)
(⊕ f ddf_y))
(⊕ x 1)
(⊕ ddf_x 2)
(⊕ f ddf_x)
(draw-point dc (+ x0 x) (+ y0 y))
(draw-point dc (- x0 x) (+ y0 y))
(draw-point dc (+ x0 x) (- y0 y))
(draw-point dc (- x0 x) (- y0 y))
(draw-point dc (+ x0 y) (+ y0 x))
(draw-point dc (- x0 y) (+ y0 x))
(draw-point dc (+ x0 y) (- y0 x))
(draw-point dc (- x0 y) (- y0 x))
(loop))))
(define bm (make-object bitmap% 25 25))
(define dc (new bitmap-dc% [bitmap bm]))
(send dc set-smoothing 'unsmoothed)
(send dc set-pen "red" 1 'solid)
(draw-circle dc 12 12 12)
bm
|
http://rosettacode.org/wiki/Bitmap/Midpoint_circle_algorithm | Bitmap/Midpoint circle algorithm | Task
Using the data storage type defined on this page for raster images,
write an implementation of the midpoint circle algorithm (also known as Bresenham's circle algorithm).
(definition on Wikipedia).
| #Raku | Raku | use MONKEY-TYPING;
class Pixel { has UInt ($.R, $.G, $.B) }
class Bitmap {
has UInt ($.width, $.height);
has Pixel @!data;
method fill(Pixel \p) {
@!data = p xx ($!width × $!height)
}
method pixel( \i where ^$!width, \j where ^$!height --> Pixel) is rw {
@!data[i × $!width + j]
}
method set-pixel (\i, \j, Pixel \p) {
self.pixel(i, j) = p;
}
method get-pixel (\i, \j) returns Pixel {
self.pixel(i, j);
}
}
augment class Pixel { method Str { "$.R $.G $.B" } }
augment class Bitmap {
method P3 {
join "\n", «P3 "$.width $.height" 255»,
do for ^($.width × $.height) { join ' ', @!data[$_] }
}
method raster-circle ( \x0, \y0, \r, Pixel \value ) {
my $ddF_x = 0;
my $ddF_y = -2 × r;
my $f = 1 - r;
my ($x, $y) = 0, r;
for flat (0 X 1,-1),(1,-1 X 0) -> \i, \j {
self.set-pixel(x0 + i×r, y0 + j×r, value)
}
while $x < $y {
($y--; $f += ($ddF_y += 2)) if $f ≥ 0;
$x++; $f += 1 + ($ddF_x += 2);
for flat (1,-1) X (1,-1) -> \i, \j {
self.set-pixel(x0 + i×$x, y0 + j×$y, value);
self.set-pixel(x0 + i×$y, y0 + j×$x, value);
}
}
}
}
my Bitmap $b = Bitmap.new( width => 32, height => 32);
$b.fill( Pixel.new( R => 0, G => 0, B => 0) );
$b.raster-circle(16, 16, 15, Pixel.new(R=>0, G=>0, B=>100));
say $b.P3; |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #Nim | Nim | import bitmap
import bresenham
import lenientops
proc drawCubicBezier*(
image: Image; pt1, pt2, pt3, pt4: Point; color: Color; nseg: Positive = 20) =
var points = newSeq[Point](nseg + 1)
for i in 0..nseg:
let t = i / nseg
let u = (1 - t) * (1 - t)
let a = (1 - t) * u
let b = 3 * t * u
let c = 3 * (t * t) * (1 - t)
let d = t * t * t
points[i] = (x: (a * pt1.x + b * pt2.x + c * pt3.x + d * pt4.x).toInt,
y: (a * pt1.y + b * pt2.y + c * pt3.y + d * pt4.y).toInt)
for i in 1..points.high:
image.drawLine(points[i - 1], points[i], color)
#———————————————————————————————————————————————————————————————————————————————————————————————————
when isMainModule:
var img = newImage(16, 16)
img.fill(White)
img.drawCubicBezier((0, 15), (3, 0), (15, 2), (10, 14), Black)
img.print |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #OCaml | OCaml | let cubic_bezier ~img ~color
~p1:(_x1, _y1)
~p2:(_x2, _y2)
~p3:(_x3, _y3)
~p4:(_x4, _y4) =
let x1, y1, x2, y2, x3, y3, x4, y4 =
(float _x1, float _y1,
float _x2, float _y2,
float _x3, float _y3,
float _x4, float _y4)
in
let bz t =
let a = (1.0 -. t) ** 3.0
and b = 3.0 *. t *. ((1.0 -. t) ** 2.0)
and c = 3.0 *. (t ** 2.0) *. (1.0 -. t)
and d = t ** 3.0
in
let x = a *. x1 +. b *. x2 +. c *. x3 +. d *. x4
and y = a *. y1 +. b *. y2 +. c *. y3 +. d *. y4
in
(int_of_float x, int_of_float y)
in
let rec loop _t acc =
if _t > 20 then acc else
begin
let t = (float _t) /. 20.0 in
let x, y = bz t in
loop (succ _t) ((x,y)::acc)
end
in
let pts = loop 0 [] in
(*
(* draw only points *)
List.iter (fun (x, y) -> put_pixel img color x y) pts;
*)
(* draw segments *)
let line = draw_line ~img ~color in
let by_pair li f =
ignore (List.fold_left (fun prev x -> f prev x; x) (List.hd li) (List.tl li))
in
by_pair pts (fun p0 p1 -> line ~p0 ~p1);
;; |
http://rosettacode.org/wiki/Biorhythms | Biorhythms | For a while in the late 70s, the pseudoscience of biorhythms was popular enough to rival astrology, with kiosks in malls that would give you your weekly printout. It was also a popular entry in "Things to Do with your Pocket Calculator" lists. You can read up on the history at Wikipedia, but the main takeaway is that unlike astrology, the math behind biorhythms is dead simple.
It's based on the number of days since your birth. The premise is that three cycles of unspecified provenance govern certain aspects of everyone's lives – specifically, how they're feeling physically, emotionally, and mentally. The best part is that not only do these cycles somehow have the same respective lengths for all humans of any age, gender, weight, genetic background, etc, but those lengths are an exact number of days. And the pattern is in each case a perfect sine curve. Absolutely miraculous!
To compute your biorhythmic profile for a given day, the first thing you need is the number of days between that day and your birth, so the answers in Days between dates are probably a good starting point. (Strictly speaking, the biorhythms start at 0 at the moment of your birth, so if you know time of day you can narrow things down further, but in general these operate at whole-day granularity.) Then take the residue of that day count modulo each of the the cycle lengths to calculate where the day falls on each of the three sinusoidal journeys.
The three cycles and their lengths are as follows:
Cycle
Length
Physical
23 days
Emotional
28 days
Mental
33 days
The first half of each cycle is in "plus" territory, with a peak at the quarter-way point; the second half in "minus" territory, with a valley at the three-quarters mark. You can calculate a specific value between -1 and +1 for the kth day of an n-day cycle by computing sin( 2πk / n ). The days where a cycle crosses the axis in either direction are called "critical" days, although with a cycle value of 0 they're also said to be the most neutral, which seems contradictory.
The task: write a subroutine, function, or program that will, given a birthdate and a target date, output the three biorhythmic values for the day. You may optionally include a text description of the position and the trend (e.g. "up and rising", "peak", "up but falling", "critical", "down and falling", "valley", "down but rising"), an indication of the date on which the next notable event (peak, valley, or crossing) falls, or even a graph of the cycles around the target date. Demonstrate the functionality for dates of your choice.
Example run of my Raku implementation:
raku br.raku 1943-03-09 1972-07-11
Output:
Day 10717:
Physical day 22: -27% (down but rising, next transition 1972-07-12)
Emotional day 21: valley
Mental day 25: valley
Double valley! This was apparently not a good day for Mr. Fischer to begin a chess tournament...
| #J | J |
use=: 'Use: ', (;:inv 2 {. ARGV) , ' YYYY-MM-DD YYYY-MM-DD'
3 :0 ::echo use
TAU=: 2p1 NB. tauday.com
require'plot ~addons/types/datetime/datetime.ijs'
span=: (i.7) + daysDiff&(1 0 0 0 1 0 1 0 ".;.1 -.&'-')~
Length=: 23 5 p. i. 3
arg=: Length *inv TAU * Length |/ span
brtable=: 1 o. arg
biorhythm=: 'title biorythms for the week ahead; key Physical Emotional Mental' plot (i.7) (j."1) brtable~
biorhythm/ 2 3 {::"0 1 ARGV
echo 'find new graph (plot.pdf) in directory ' , jpath '~temp/'
brs=. brtable/ 2 3 {::"0 1 ARGV
echo (a:,'values';'interpretation') ,: (4 10 $ 'days aheadPhysical Emotional Mental ') ; (1 3 # 6 6j1)&(":"0 1) L:0 (; |) brs ,~ i. 7
)
exit 0
|
http://rosettacode.org/wiki/Biorhythms | Biorhythms | For a while in the late 70s, the pseudoscience of biorhythms was popular enough to rival astrology, with kiosks in malls that would give you your weekly printout. It was also a popular entry in "Things to Do with your Pocket Calculator" lists. You can read up on the history at Wikipedia, but the main takeaway is that unlike astrology, the math behind biorhythms is dead simple.
It's based on the number of days since your birth. The premise is that three cycles of unspecified provenance govern certain aspects of everyone's lives – specifically, how they're feeling physically, emotionally, and mentally. The best part is that not only do these cycles somehow have the same respective lengths for all humans of any age, gender, weight, genetic background, etc, but those lengths are an exact number of days. And the pattern is in each case a perfect sine curve. Absolutely miraculous!
To compute your biorhythmic profile for a given day, the first thing you need is the number of days between that day and your birth, so the answers in Days between dates are probably a good starting point. (Strictly speaking, the biorhythms start at 0 at the moment of your birth, so if you know time of day you can narrow things down further, but in general these operate at whole-day granularity.) Then take the residue of that day count modulo each of the the cycle lengths to calculate where the day falls on each of the three sinusoidal journeys.
The three cycles and their lengths are as follows:
Cycle
Length
Physical
23 days
Emotional
28 days
Mental
33 days
The first half of each cycle is in "plus" territory, with a peak at the quarter-way point; the second half in "minus" territory, with a valley at the three-quarters mark. You can calculate a specific value between -1 and +1 for the kth day of an n-day cycle by computing sin( 2πk / n ). The days where a cycle crosses the axis in either direction are called "critical" days, although with a cycle value of 0 they're also said to be the most neutral, which seems contradictory.
The task: write a subroutine, function, or program that will, given a birthdate and a target date, output the three biorhythmic values for the day. You may optionally include a text description of the position and the trend (e.g. "up and rising", "peak", "up but falling", "critical", "down and falling", "valley", "down but rising"), an indication of the date on which the next notable event (peak, valley, or crossing) falls, or even a graph of the cycles around the target date. Demonstrate the functionality for dates of your choice.
Example run of my Raku implementation:
raku br.raku 1943-03-09 1972-07-11
Output:
Day 10717:
Physical day 22: -27% (down but rising, next transition 1972-07-12)
Emotional day 21: valley
Mental day 25: valley
Double valley! This was apparently not a good day for Mr. Fischer to begin a chess tournament...
| #Julia | Julia | using Dates
const cycles = ["Physical" => 23, "Emotional" => 28,"Mental" => 33]
const quadrants = [("up and rising", "peak"), ("up but falling", "transition"),
("down and falling", "valley"), ("down but rising", "transition")]
function tellfortune(birthday::Date, date = today())
days = (date - birthday).value
target = (date - Date(0)).value
println("Born $birthday, target date $date\nDay $days:")
for (label, length) in cycles
position = days % length
quadrant = Int(floor((4 * position) / length)) + 1
percentage = round(100 * sinpi(2 * position / length), digits=1)
transition = target - position + (length * quadrant) ÷ 4
trend, next = quadrants[quadrant]
description = (percentage > 95) ? "peak" :
(percentage < -95) ? "valley" :
(abs(percentage) < 5) ? "critical transition" :
"$percentage% ($trend, next $next $(Date(0) + Dates.Day(transition)))"
println("$label day $position: $description")
end
println()
end
tellfortune(Date("1943-03-09"), Date("1972-07-11"))
tellfortune(Date("1809-01-12"), Date("1863-11-19"))
tellfortune(Date("1809-02-12"), Date("1863-11-19"))
|
http://rosettacode.org/wiki/Bioinformatics/base_count | Bioinformatics/base count | Given this string representing ordered DNA bases:
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
Task
"Pretty print" the sequence followed by a summary of the counts of each of the bases: (A, C, G, and T) in the sequence
print the total count of each base in the string.
Other tasks related to string operations:
Metrics
Array length
String length
Copy a string
Empty string (assignment)
Counting
Word frequency
Letter frequency
Jewels and stones
I before E except after C
Bioinformatics/base count
Count occurrences of a substring
Count how many vowels and consonants occur in a string
Remove/replace
XXXX redacted
Conjugate a Latin verb
Remove vowels from a string
String interpolation (included)
Strip block comments
Strip comments from a string
Strip a set of characters from a string
Strip whitespace from a string -- top and tail
Strip control codes and extended characters from a string
Anagrams/Derangements/shuffling
Word wheel
ABC problem
Sattolo cycle
Knuth shuffle
Ordered words
Superpermutation minimisation
Textonyms (using a phone text pad)
Anagrams
Anagrams/Deranged anagrams
Permutations/Derangements
Find/Search/Determine
ABC words
Odd words
Word ladder
Semordnilap
Word search
Wordiff (game)
String matching
Tea cup rim text
Alternade words
Changeable words
State name puzzle
String comparison
Unique characters
Unique characters in each string
Extract file extension
Levenshtein distance
Palindrome detection
Common list elements
Longest common suffix
Longest common prefix
Compare a list of strings
Longest common substring
Find common directory path
Words from neighbour ones
Change e letters to i in words
Non-continuous subsequences
Longest common subsequence
Longest palindromic substrings
Longest increasing subsequence
Words containing "the" substring
Sum of the digits of n is substring of n
Determine if a string is numeric
Determine if a string is collapsible
Determine if a string is squeezable
Determine if a string has all unique characters
Determine if a string has all the same characters
Longest substrings without repeating characters
Find words which contains all the vowels
Find words which contains most consonants
Find words which contains more than 3 vowels
Find words which first and last three letters are equals
Find words which odd letters are consonants and even letters are vowels or vice_versa
Formatting
Substring
Rep-string
Word wrap
String case
Align columns
Literals/String
Repeat a string
Brace expansion
Brace expansion using ranges
Reverse a string
Phrase reversals
Comma quibbling
Special characters
String concatenation
Substring/Top and tail
Commatizing numbers
Reverse words in a string
Suffixation of decimal numbers
Long literals, with continuations
Numerical and alphabetical suffixes
Abbreviations, easy
Abbreviations, simple
Abbreviations, automatic
Song lyrics/poems/Mad Libs/phrases
Mad Libs
Magic 8-ball
99 Bottles of Beer
The Name Game (a song)
The Old lady swallowed a fly
The Twelve Days of Christmas
Tokenize
Text between
Tokenize a string
Word break problem
Tokenize a string with escaping
Split a character string based on change of character
Sequences
Show ASCII table
De Bruijn sequences
Self-referential sequences
Generate lower case ASCII alphabet
| #ALGOL_68 | ALGOL 68 | BEGIN # count DNA bases in a sequence #
# returns an array of counts of the characters in s that are in c #
# an extra final element holds the count of characters not in c #
PRIO COUNT = 9;
OP COUNT = ( STRING s, STRING c )[]INT:
BEGIN
[ LWB c : UPB c + 1 ]INT results; # extra element for "other" #
[ 0 : 255 ]INT counts; # only counts ASCII characters #
FOR i FROM LWB counts TO UPB counts DO counts[ i ] := 0 OD;
FOR i FROM LWB results TO UPB results DO results[ i ] := 0 OD;
# count the occurrences of each ASCII character in s #
FOR i FROM LWB s TO UPB s DO
IF INT ch pos = ABS s[ i ];
ch pos >= LWB counts AND ch pos <= UPB counts
THEN
# have a character we can count #
counts[ ch pos ] +:= 1
ELSE
# not an ASCII character ? #
results[ UPB results ] +:= 1
FI
OD;
# return the counts of the required characters #
# set the results for the expected characters and clear their #
# counts so we can count the "other" characters #
FOR i FROM LWB results TO UPB results - 1 DO
IF INT ch pos = ABS c[ i ];
ch pos >= LWB counts AND ch pos <= UPB counts
THEN
results[ i ] := counts[ ch pos ];
counts[ ch pos ] := 0
FI
OD;
# count the "other" characters #
FOR i FROM LWB counts TO UPB counts DO
IF counts[ i ] /= 0 THEN
results[ UPB results ] +:= counts[ i ]
FI
OD;
results
END; # COUNT #
# returns the combined counts of the characters in the elements of s #
# that are in c #
# an extra final element holds the count of characters not in c #
OP COUNT = ( []STRING s, STRING c )[]INT:
BEGIN
[ LWB c : UPB c + 1 ]INT results;
FOR i FROM LWB results TO UPB results DO results[ i ] := 0 OD;
FOR i FROM LWB s TO UPB s DO
[]INT counts = s[ i ] COUNT c;
FOR i FROM LWB results TO UPB results DO
results[ i ] +:= counts[ i ]
OD
OD;
results
END; # COUNT #
# returns the length of s #
OP LEN = ( STRING s )INT: ( UPB s - LWB s ) + 1;
# count the bases in the required sequence #
[]STRING seq = ( "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG"
, "CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG"
, "AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT"
, "GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT"
, "CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG"
, "TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA"
, "TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT"
, "CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG"
, "TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC"
, "GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
);
STRING bases = "ATCG";
[]INT counts = seq COUNT bases;
# print the sequence with leading character positions #
# find the overall length of the sequence #
INT seq len := 0;
FOR i FROM LWB seq TO UPB seq DO
seq len +:= LEN seq[ i ]
OD;
# compute the minimum field width required for the positions #
INT s len := seq len;
INT width := 1;
WHILE s len >= 10 DO
width +:= 1;
s len OVERAB 10
OD;
# show the sequence #
print( ( "Sequence:", newline, newline ) );
INT start := 0;
FOR i FROM LWB seq TO UPB seq DO
print( ( " ", whole( start, - width ), " :", seq[ i ], newline ) );
start +:= LEN seq[ i ]
OD;
# show the base counts #
print( ( newline, "Bases: ", newline, newline ) );
INT total := 0;
FOR i FROM LWB bases TO UPB bases DO
print( ( " ", bases[ i ], " : ", whole( counts[ i ], - width ), newline ) );
total +:= counts[ i ]
OD;
# show the count of other characters (invalid bases) - if there are any #
IF INT others = UPB counts;
counts[ others ] /= 0
THEN
# there were characters other than the bases #
print( ( newline, "Other: ", whole( counts[ others ], - width ), newline, newline ) );
total +:= counts[ UPB counts ]
FI;
# totals #
print( ( newline, "Total: ", whole( total, - width ), newline ) )
END |
http://rosettacode.org/wiki/Bitmap/Bresenham%27s_line_algorithm | Bitmap/Bresenham's line algorithm | Task
Using the data storage type defined on the Bitmap page for raster graphics images,
draw a line given two points with Bresenham's line algorithm.
| #Batch_File | Batch File | @echo off
setlocal enabledelayedexpansion
set width=87
set height=51
mode %width%,%height%
set "grid="
set /a resolution=height*width
for /l %%i in (1,1,%resolution%) do (
set "grid=!grid! "
)
call :line 1 1 5 5
call :line 9 30 60 7
call :line 9 30 60 50
call :line 52 50 32 1
echo:%grid%
pause>nul
exit
:line
set x1=%1
set y1=%2
set x2=%3
set y2=%4
set /a dx=x2-x1
set /a dy=y2-y1
::Clipping done to avoid overflow
if %dx% neq 0 set /a o=y1 - ( x1 * dy / dx )
if %x1% leq %x2% (
if %x1% geq %width% goto :eof
if %x2% lss 0 goto :eof
if %x1% lss 0 (
if %dx% neq 0 set y1=%o%
set x1=0
)
if %x2% geq %width% (
set /a x2= width - 1
if %dx% neq 0 set /a "y2= x2 * dy / dx + o"
)
) else (
if %x2% geq %width% goto :eof
if %x1% lss 0 goto :eof
if %x2% lss 0 (
if %dx% neq 0 set y2=%o%
set x2=0
)
if %x1% geq %width% (
set /a x1=width - 1
if %dx% neq 0 set /a "y1= x1 * dy / dx + o"
)
)
if %y1% leq %y2% (
if %y1% geq %height% goto :eof
if %y2% lss 0 goto :eof
if %y1% lss 0 (
set y1=0
if %dx% neq 0 set /a x1= - o * dx /dy
)
if %y2% geq %height% (
set /a y2=height-1
if %dx% neq 0 set /a "x2= (y2 - o) * dx /dy"
)
) else (
if %y2% geq %height% goto :eof
if %y1% lss 0 goto :eof
if %y2% lss 0 (
set y2=0
if %dx% neq 0 set /a "x2= - o * dx /dy"
)
if %y1% geq %height% (
set /a y1=height-1
if %dx% neq 0 set /a "x1= (y1 - o) * dx /dy"
)
)
:: Start of Bresenham's algorithm
set stepy=1
set stepx=1
set /a dx=x2-x1
set /a dy=y2-y1
if %dy% lss 0 set /a "dy=-dy","stepy=-1"
if %dx% lss 0 set /a "dx=-dx","stepx=-1"
set /a "dy <<= 1"
set /a "dx <<= 1"
if %dx% gtr %dy% (
set /a "fraction=dy-(dx>>1)"
set /a "cursor=y1*width + x1"
for /l %%x in (%x1%,%stepx%,%x2%) do (
set /a cursorP=cursor+1
for /f "tokens=1-2" %%g in ("!cursor! !cursorP!") do set "grid=!grid:~0,%%g!Û!grid:~%%h!"
if !fraction! geq 0 (
set /a y1+=stepy
set /a cursor+=stepy*width
set /a fraction-=dx
)
set /a fraction+=dy
set /a cursor+=stepx
)
) else (
set /a "fraction=dx-(dy>>1)"
set /a "cursor=y1*width + x1"
for /l %%y in (%y1%,%stepy%,%y2%) do (
set /a cursorP=cursor+1
for /f "tokens=1-2" %%g in ("!cursor! !cursorP!") do set "grid=!grid:~0,%%g!Û!grid:~%%h!"
if !fraction! geq 0 (
set /a x1+=stepx
set /a cursor+=stepx
set /a fraction-=dy
)
set /a fraction+=dx
set /a cursor+=width*stepy
)
)
goto :eof |
http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation | Bioinformatics/Sequence mutation | Task
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
Choosing a random base position in the sequence.
Mutate the sequence by doing one of either:
Swap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
Delete the chosen base at the position.
Insert another base randomly chosen from A,C, G, or T into the sequence at that position.
Randomly generate a test DNA sequence of at least 200 bases
"Pretty print" the sequence and a count of its size, and the count of each base in the sequence
Mutate the sequence ten times.
"Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
Extra credit
Give more information on the individual mutations applied.
Allow mutations to be weighted and/or chosen. | #Factor | Factor | USING: assocs combinators.random formatting grouping io kernel
macros math math.statistics namespaces prettyprint quotations
random sequences sorting ;
IN: sequence-mutation
SYMBOL: verbose? ! Turn on to show mutation details.
! Off by default.
! Return a random base as a character.
: rand-base ( -- n ) "ACGT" random ;
! Generate a random dna sequence of length n.
: <dna> ( n -- seq ) [ rand-base ] "" replicate-as ;
! Prettyprint a dna sequence in blocks of n.
: .dna ( seq n -- )
"SEQUENCE:" print [ group ] keep
[ * swap " %3d: %s\n" printf ] curry each-index ;
! Show a histogram of bases in a dna sequence and their total.
: show-counts ( seq -- )
"BASE COUNTS:" print histogram >alist [ first ] sort-with
[ [ " %c: %3d\n" printf ] assoc-each ]
[ "TOTAL: " write [ second ] [ + ] map-reduce . ] bi ;
! Prettyprint the overall state of a dna sequence.
: show-dna ( seq -- ) [ 50 .dna nl ] [ show-counts nl ] bi ;
! Call a quotation only if verbose? is on.
: log ( quot -- ) verbose? get [ call ] [ drop ] if ; inline
! Set index n to a random base.
: bswap ( n seq -- seq' )
[ rand-base ] 2dip 3dup [ nth ] keepd spin
[ " index %3d: swapping %c with %c\n" printf ] 3curry log
[ set-nth ] keep ;
! Remove the base at index n.
: bdelete ( n seq -- seq' )
2dup dupd nth [ " index %3d: deleting %c\n" printf ]
2curry log remove-nth ;
! Insert a random base at index n.
: binsert ( n seq -- seq' )
[ rand-base ] 2dip over reach
[ " index %3d: inserting %c\n" printf ] 2curry log
insert-nth ;
! Allow "passing" probabilities to casep. This is necessary
! because casep is a macro.
MACRO: build-casep-seq ( seq -- quot )
{ [ bswap ] [ bdelete ] [ binsert ] } zip 1quotation ;
! Mutate a dna sequence according to some weights.
! For example,
! "ACGT" { 0.1 0.3 0.6 } mutate
! means swap with 0.1 probability, delete with 0.3 probability,
! and insert with 0.6 probability.
: mutate ( dna-seq weights-seq -- dna-seq' )
[ [ length random ] keep ] [ build-casep-seq ] bi* casep ;
inline
! Prettyprint a sequence of weights.
: show-weights ( seq -- )
"MUTATION PROBABILITIES:" print
" swap: %.2f\n delete: %.2f\n insert: %.2f\n\n" vprintf
;
: main ( -- )
verbose? on "ORIGINAL " write 200 <dna> dup show-dna 10
{ 0.2 0.2 0.6 } dup show-weights "MUTATION LOG:" print
[ mutate ] curry times nl "MUTATED " write show-dna ;
MAIN: main |
http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation | Bioinformatics/Sequence mutation | Task
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
Choosing a random base position in the sequence.
Mutate the sequence by doing one of either:
Swap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
Delete the chosen base at the position.
Insert another base randomly chosen from A,C, G, or T into the sequence at that position.
Randomly generate a test DNA sequence of at least 200 bases
"Pretty print" the sequence and a count of its size, and the count of each base in the sequence
Mutate the sequence ten times.
"Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
Extra credit
Give more information on the individual mutations applied.
Allow mutations to be weighted and/or chosen. | #Go | Go | package main
import (
"fmt"
"math/rand"
"sort"
"time"
)
const bases = "ACGT"
// 'w' contains the weights out of 300 for each
// of swap, delete or insert in that order.
func mutate(dna string, w [3]int) string {
le := len(dna)
// get a random position in the dna to mutate
p := rand.Intn(le)
// get a random number between 0 and 299 inclusive
r := rand.Intn(300)
bytes := []byte(dna)
switch {
case r < w[0]: // swap
base := bases[rand.Intn(4)]
fmt.Printf(" Change @%3d %q to %q\n", p, bytes[p], base)
bytes[p] = base
case r < w[0]+w[1]: // delete
fmt.Printf(" Delete @%3d %q\n", p, bytes[p])
copy(bytes[p:], bytes[p+1:])
bytes = bytes[0 : le-1]
default: // insert
base := bases[rand.Intn(4)]
bytes = append(bytes, 0)
copy(bytes[p+1:], bytes[p:])
fmt.Printf(" Insert @%3d %q\n", p, base)
bytes[p] = base
}
return string(bytes)
}
// Generate a random dna sequence of given length.
func generate(le int) string {
bytes := make([]byte, le)
for i := 0; i < le; i++ {
bytes[i] = bases[rand.Intn(4)]
}
return string(bytes)
}
// Pretty print dna and stats.
func prettyPrint(dna string, rowLen int) {
fmt.Println("SEQUENCE:")
le := len(dna)
for i := 0; i < le; i += rowLen {
k := i + rowLen
if k > le {
k = le
}
fmt.Printf("%5d: %s\n", i, dna[i:k])
}
baseMap := make(map[byte]int) // allows for 'any' base
for i := 0; i < le; i++ {
baseMap[dna[i]]++
}
var bases []byte
for k := range baseMap {
bases = append(bases, k)
}
sort.Slice(bases, func(i, j int) bool { // get bases into alphabetic order
return bases[i] < bases[j]
})
fmt.Println("\nBASE COUNT:")
for _, base := range bases {
fmt.Printf(" %c: %3d\n", base, baseMap[base])
}
fmt.Println(" ------")
fmt.Println(" Σ:", le)
fmt.Println(" ======\n")
}
// Express weights as a string.
func wstring(w [3]int) string {
return fmt.Sprintf(" Change: %d\n Delete: %d\n Insert: %d\n", w[0], w[1], w[2])
}
func main() {
rand.Seed(time.Now().UnixNano())
dna := generate(250)
prettyPrint(dna, 50)
muts := 10
w := [3]int{100, 100, 100} // use e.g. {0, 300, 0} to choose only deletions
fmt.Printf("WEIGHTS (ex 300):\n%s\n", wstring(w))
fmt.Printf("MUTATIONS (%d):\n", muts)
for i := 0; i < muts; i++ {
dna = mutate(dna, w)
}
fmt.Println()
prettyPrint(dna, 50)
} |
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Java | Java | import java.math.BigInteger;
import java.security.MessageDigest;
import java.security.NoSuchAlgorithmException;
import java.util.Arrays;
public class BitcoinAddressValidator {
private static final String ALPHABET = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz";
public static boolean validateBitcoinAddress(String addr) {
if (addr.length() < 26 || addr.length() > 35)
return false;
byte[] decoded = decodeBase58To25Bytes(addr);
if (decoded == null)
return false;
byte[] hash1 = sha256(Arrays.copyOfRange(decoded, 0, 21));
byte[] hash2 = sha256(hash1);
return Arrays.equals(Arrays.copyOfRange(hash2, 0, 4), Arrays.copyOfRange(decoded, 21, 25));
}
private static byte[] decodeBase58To25Bytes(String input) {
BigInteger num = BigInteger.ZERO;
for (char t : input.toCharArray()) {
int p = ALPHABET.indexOf(t);
if (p == -1)
return null;
num = num.multiply(BigInteger.valueOf(58)).add(BigInteger.valueOf(p));
}
byte[] result = new byte[25];
byte[] numBytes = num.toByteArray();
System.arraycopy(numBytes, 0, result, result.length - numBytes.length, numBytes.length);
return result;
}
private static byte[] sha256(byte[] data) {
try {
MessageDigest md = MessageDigest.getInstance("SHA-256");
md.update(data);
return md.digest();
} catch (NoSuchAlgorithmException e) {
throw new IllegalStateException(e);
}
}
public static void main(String[] args) {
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i", true);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62j", false);
assertBitcoin("1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9", true);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62X", false);
assertBitcoin("1ANNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i", false);
assertBitcoin("1A Na15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i", false);
assertBitcoin("BZbvjr", false);
assertBitcoin("i55j", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62!", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62iz", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62izz", false);
assertBitcoin("1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nJ9", false);
assertBitcoin("1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62I", false);
}
private static void assertBitcoin(String address, boolean expected) {
boolean actual = validateBitcoinAddress(address);
if (actual != expected)
throw new AssertionError(String.format("Expected %s for %s, but got %s.", expected, address, actual));
}
} |
http://rosettacode.org/wiki/Bitcoin/public_point_to_address | Bitcoin/public point to address | Bitcoin uses a specific encoding format to encode the digest of an elliptic curve public point into a short ASCII string. The purpose of this task is to perform such a conversion.
The encoding steps are:
take the X and Y coordinates of the given public point, and concatenate them in order to have a 64 byte-longed string ;
add one byte prefix equal to 4 (it is a convention for this way of encoding a public point) ;
compute the SHA-256 of this string ;
compute the RIPEMD-160 of this SHA-256 digest ;
compute the checksum of the concatenation of the version number digit (a single zero byte) and this RIPEMD-160 digest, as described in bitcoin/address validation ;
Base-58 encode (see below) the concatenation of the version number (zero in this case), the ripemd digest and the checksum
The base-58 encoding is based on an alphabet of alphanumeric characters (numbers, upper case and lower case, in that order) but without the four characters 0, O, l and I.
Here is an example public point:
X = 0x50863AD64A87AE8A2FE83C1AF1A8403CB53F53E486D8511DAD8A04887E5B2352
Y = 0x2CD470243453A299FA9E77237716103ABC11A1DF38855ED6F2EE187E9C582BA6
The corresponding address should be:
16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM
Nb. The leading '1' is not significant as 1 is zero in base-58. It is however often added to the bitcoin address for various reasons. There can actually be several of them. You can ignore this and output an address without the leading 1.
Extra credit: add a verification procedure about the public point, making sure it belongs to the secp256k1 elliptic curve
| #zkl | zkl | var [const] MsgHash=Import.lib("zklMsgHash"); // SHA-256, etc
const symbols = "123456789" // 58 characters: no cap i,o; ell, zero
"ABCDEFGHJKLMNPQRSTUVWXYZ"
"abcdefghijkmnopqrstuvwxyz";
fcn base58Encode(bytes){ //Data-->String
bytes=bytes.copy(); sink:=Sink(String);
do(33){
bytes.len().reduce('wrap(n,idx){
n=n*256 + bytes[idx];
bytes[idx]=(n/58);
n%58;
},0) : symbols[_] : sink.write(_)
}
sink.close().reverse();
}
const COIN_VER=0;
fcn coinEncode(x,y){ // throws if x or y not hex or (x+y) not even length
bytes:=(x+y).pump(Data,Void.Read,fcn(a,b){ (a+b).toInt(16) }).insert(0,4);
(MsgHash.SHA256(bytes,1,bytes) : MsgHash.RIPEMD160(_,1,bytes))
.insert(0,COIN_VER); // we are using bytes for in and out
d,chkSum := Data(), MsgHash.SHA256(bytes,1,d) : MsgHash.SHA256(_,1,d);
base58Encode(bytes.append(chkSum.del(4,*))); // first 4 bytes of hashed hash
} |
http://rosettacode.org/wiki/Bitmap/Flood_fill | Bitmap/Flood fill | Implement a flood fill.
A flood fill is a way of filling an area using color banks to define the contained area or a target color which "determines" the area (the valley that can be flooded; Wikipedia uses the term target color). It works almost like a water flooding from a point towards the banks (or: inside the valley): if there's a hole in the banks, the flood is not contained and all the image (or all the "connected valleys") get filled.
To accomplish the task, you need to implement just one of the possible algorithms (examples are on Wikipedia). Variations on the theme are allowed (e.g. adding a tolerance parameter or argument for color-matching of the banks or target color).
Testing: the basic algorithm is not suitable for truecolor images; a possible test image is the one shown on the right box; you can try to fill the white area, or the black inner circle.
| #Haskell | Haskell | import Data.Array.ST
import Data.STRef
import Control.Monad
import Control.Monad.ST
import Bitmap
-- Implementation of a stack in the ST monad
pushST :: STStack s a -> a -> ST s ()
pushST s e = do
s2 <- readSTRef s
writeSTRef s (e : s2)
popST :: STStack s a -> ST s (Stack a)
popST s = do
s2 <- readSTRef s
writeSTRef s $ tail s2
return $ take 1 s2
isNotEmptySTStack :: STStack s a -> ST s Bool
isNotEmptySTStack s = do
s2 <- readSTRef s
return $ not $ null s2
emptySTStack :: ST s (STStack s a)
emptySTStack = newSTRef []
consumeSTStack :: STStack s a -> (a -> ST s ()) -> ST s ()
consumeSTStack s f = do
check <- isNotEmptySTStack s
when check $ do
e <- popST s
f $ head e
consumeSTStack s f
type Spanning s = STRef s (Bool, Bool)
setSpanLeft :: Spanning s -> Bool -> ST s ()
setSpanLeft s v = do
(_, r) <- readSTRef s
writeSTRef s (v, r)
setSpanRight :: Spanning s -> Bool -> ST s ()
setSpanRight s v = do
(l, _) <- readSTRef s
writeSTRef s (l, v)
setSpanNone :: Spanning s -> ST s ()
setSpanNone s = writeSTRef s (False, False)
floodFillScanlineStack :: Color c => Image s c -> Pixel -> c -> ST s (Image s c)
floodFillScanlineStack b coords newC = do
stack <- emptySTStack -- new empty stack holding pixels to fill
spans <- newSTRef (False, False) -- keep track of spans in scanWhileX
fFSS b stack coords newC spans -- function loop
return b
where
fFSS b st c newC p = do
oldC <- getPix b c
unless (oldC == newC) $ do
pushST st c -- store the coordinates in the stack
(w, h) <- dimensions b
consumeSTStack st (scanWhileY b p oldC >=>
scanWhileX b st p oldC newC (w, h))
-- take a buffer, the span record, the color of the Color the fill is
-- started from, a coordinate from the stack, and returns the coord
-- of the next point to be filled in the same column
scanWhileY b p oldC coords@(Pixel (x, y)) =
if y >= 0
then do
z <- getPix b coords
if z == oldC
then scanWhileY b p oldC (Pixel (x, y - 1))
else do
setSpanNone p
return (Pixel (x, y + 1))
else do
setSpanNone p
return (Pixel (x, y + 1))
-- take a buffer, a stack, a span record, the old and new color, the
-- height and width of the buffer, and a coordinate.
-- paint the point with the new color, check if the fill must expand
-- to the left or right or both, and store those coordinates in the
-- stack for subsequent filling
scanWhileX b st p oldC newC (w, h) coords@(Pixel (x, y)) =
when (y < h) $ do
z <- getPix b coords
when (z == oldC) $ do
setPix b coords newC
(spanLeft, spanRight) <- readSTRef p
when (not spanLeft && x > 0) $ do
z2 <- getPix b (Pixel (x - 1, y))
when (z2 == oldC) $ do
pushST st (Pixel (x - 1, y))
setSpanLeft p True
when (spanLeft && x > 0) $ do
z3 <- getPix b (Pixel (x - 1, y))
when (z3 /= oldC) $
setSpanLeft p False
when (not spanRight && x < (w - 1)) $ do
z4 <- getPix b (Pixel (x + 1, y))
when (z4 == oldC) $ do
pushST st (Pixel (x + 1, y))
setSpanRight p True
when (spanRight && x < (w - 1)) $ do
z5 <- getPix b (Pixel (x + 1, y))
when (z5 /= oldC) $
setSpanRight p False
scanWhileX b st p oldC newC (w, h) (Pixel (x, y + 1))
|
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #GAP | GAP | 1 < 2;
# true
2 < 1;
# false
# GAP has also the value fail, which cannot be used as a boolean but may be used i$
1 = fail;
# false
fail = fail;
# true |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Go | Go |
package main
import (
"fmt"
"reflect"
"strconv"
)
func main() {
var n bool = true
fmt.Println(n) // prt true
fmt.Printf("%T\n", n) // prt bool
n = !n
fmt.Println(n) // prt false
x := 5
y := 8
fmt.Println("x == y:", x == y) // prt x == y: false
fmt.Println("x < y:", x < y) // prt x < y: true
fmt.Println("\nConvert String into Boolean Data type\n")
str1 := "japan"
fmt.Println("Before :", reflect.TypeOf(str1)) // prt Before : string
bolStr, _ := strconv.ParseBool(str1)
fmt.Println("After :", reflect.TypeOf(bolStr)) // prt After : bool
} |
http://rosettacode.org/wiki/Caesar_cipher | Caesar cipher |
Task
Implement a Caesar cipher, both encoding and decoding.
The key is an integer from 1 to 25.
This cipher rotates (either towards left or right) the letters of the alphabet (A to Z).
The encoding replaces each letter with the 1st to 25th next letter in the alphabet (wrapping Z to A).
So key 2 encrypts "HI" to "JK", but key 20 encrypts "HI" to "BC".
This simple "mono-alphabetic substitution cipher" provides almost no security, because an attacker who has the encoded message can either use frequency analysis to guess the key, or just try all 25 keys.
Caesar cipher is identical to Vigenère cipher with a key of length 1.
Also, Rot-13 is identical to Caesar cipher with key 13.
Related tasks
Rot-13
Substitution Cipher
Vigenère Cipher/Cryptanalysis
| #X86_Assembly | X86 Assembly | # Author: Ettore Forigo - Hexwell
.intel_syntax noprefix
.text
.globl main
main:
.PROLOGUE:
push rbp
mov rbp, rsp
sub rsp, 32
mov QWORD PTR [rbp-32], rsi # argv
.BODY:
mov BYTE PTR [rbp-1], 0 # shift = 0
.I_LOOP_INIT:
mov BYTE PTR [rbp-2], 0 # i = 0
jmp .I_LOOP_CONDITION # I_LOOP_CONDITION
.I_LOOP_BODY:
movzx edx, BYTE PTR[rbp-1] # shift
mov eax, edx # shift
sal eax, 2 # shift << 2 == i * 4
add eax, edx # shift * 4 + shift = shift * 5
add eax, eax # shift * 5 + shift * 5 = shift * 10
mov ecx, eax # shift * 10
mov rax, QWORD PTR [rbp-32] # argv
add rax, 8 # argv + 1
mov rdx, QWORD PTR [rax] # argv[1]
movzx eax, BYTE PTR [rbp-2] # i
add rax, rdx # argv[1] + i
movzx eax, BYTE PTR [rax] # argv[1][i]
add eax, ecx # shift * 10 + argv[1][i]
sub eax, 48 # shift * 10 + argv[1][i] - '0'
mov BYTE PTR [rbp-1], al # shift = shift * 10 + argv[1][i] - '0'
.I_LOOP_INCREMENT:
movzx eax, BYTE PTR [rbp-2] # i
add eax, 1 # i + 1
mov BYTE PTR [rbp-2], al # i++
.I_LOOP_CONDITION:
mov rax, QWORD PTR [rbp-32] # argv
add rax, 8 # argv + 1
mov rax, QWORD PTR [rax] # argv[1]
movzx edx, BYTE PTR [rbp-2] # i
add rax, rdx # argv[1] + i
movzx rax, BYTE PTR [rax] # argv[1][i]
test al, al # argv[1][i]?
jne .I_LOOP_BODY # I_LOOP_BODY
.CAESAR_LOOP_INIT:
mov BYTE PTR [rbp-2], 0 # i = 0
jmp .CAESAR_LOOP_CONDITION # CAESAR_LOOP_CONDITION
.CAESAR_LOOP_BODY:
mov rax, QWORD PTR [rbp-32] # argv
add rax, 16 # argv + 2
mov rdx, QWORD PTR [rax] # argv[2]
movzx eax, BYTE PTR [rbp-2] # i
add rax, rdx # argv[2] + i
mov rbx, rax # argv[2] + i
movzx eax, BYTE PTR [rax] # argv[2][i]
cmp al, 32 # argv[2][i] == ' '
je .CAESAR_LOOP_INCREMENT # CAESAR_LOOP_INCREMENT
movzx edx, BYTE PTR [rbx] # argv[2][i]
mov ecx, edx # argv[2][i]
movzx edx, BYTE PTR [rbp-1] # shift
add edx, ecx # argv[2][i] + shift
sub edx, 97 # argv[2][i] + shift - 'a'
mov BYTE PTR [rbx], dl # argv[2][i] = argv[2][i] + shift - 'a'
movzx eax, BYTE PTR [rbx] # argv[2][i]
cmp al, 25 # argv[2][i] <=> 25
jle .CAESAR_RESTORE_ASCII # <= CAESAR_RESTORE_ASCII
movzx edx, BYTE PTR [rbx] # argv[2][i]
sub edx, 26 # argv[2][i] - 26
mov BYTE PTR [rbx], dl # argv[2][i] = argv[2][i] - 26
.CAESAR_RESTORE_ASCII:
movzx edx, BYTE PTR [rbx] # argv[2][i]
add edx, 97 # argv[2][i] + 'a'
mov BYTE PTR [rbx], dl # argv[2][i] = argv[2][i] + 'a'
.CAESAR_LOOP_INCREMENT:
movzx eax, BYTE PTR [rbp-2] # i
add eax, 1 # i + 1
mov BYTE PTR [rbp-2], al # i++
.CAESAR_LOOP_CONDITION:
mov rax, QWORD PTR [rbp-32] # argv
add rax, 16 # argv + 2
mov rdx, QWORD PTR [rax] # argv[2]
movzx eax, BYTE PTR [rbp-2] # i
add rax, rdx # argv[2] + i
movzx eax, BYTE PTR [rax] # argv[2][i]
test al, al # argv[2][i]?
jne .CAESAR_LOOP_BODY # CAESAR_LOOP_BODY
mov rax, QWORD PTR [rbp-32] # argv
add rax, 16 # argv + 2
mov rax, QWORD PTR [rax] # argv[2]
mov rdi, rax # argv[2]
call puts # puts(argv[2])
.RETURN:
mov eax, 0 # 0
leave
ret # return 0 |
http://rosettacode.org/wiki/Box_the_compass | Box the compass | There be many a land lubber that knows naught of the pirate ways and gives direction by degree!
They know not how to box the compass!
Task description
Create a function that takes a heading in degrees and returns the correct 32-point compass heading.
Use the function to print and display a table of Index, Compass point, and Degree; rather like the corresponding columns from, the first table of the wikipedia article, but use only the following 33 headings as input:
[0.0, 16.87, 16.88, 33.75, 50.62, 50.63, 67.5, 84.37, 84.38, 101.25, 118.12, 118.13, 135.0, 151.87, 151.88, 168.75, 185.62, 185.63, 202.5, 219.37, 219.38, 236.25, 253.12, 253.13, 270.0, 286.87, 286.88, 303.75, 320.62, 320.63, 337.5, 354.37, 354.38]. (They should give the same order of points but are spread throughout the ranges of acceptance).
Notes;
The headings and indices can be calculated from this pseudocode:
for i in 0..32 inclusive:
heading = i * 11.25
case i %3:
if 1: heading += 5.62; break
if 2: heading -= 5.62; break
end
index = ( i mod 32) + 1
The column of indices can be thought of as an enumeration of the thirty two cardinal points (see talk page)..
| #Factor | Factor | USING: formatting kernel math sequences ;
CONSTANT: box
{
"North" "North by east" "North-northeast"
"Northeast by north" "Northeast" "Northeast by east"
"East-northeast" "East by north" "East" "East by south"
"East-southeast" "Southeast by east" "Southeast"
"Southeast by south" "South-southeast" "South by east"
"South" "South by west" "South-southwest"
"Southwest by south" "Southwest" "Southwest by west"
"West-southwest" "West by south" "West" "West by north"
"West-northwest" "Northwest by west" "Northwest"
"Northwest by north" "North-northwest" "North by west"
}
{
0 16.87 16.88 33.75 50.62 50.63 67.5 84.37 84.38 101.25
118.12 118.13 135 151.87 151.88 168.75 185.62 185.63 202.5
219.37 219.38 236.25 253.12 253.13 270 286.87 286.88 303.75
320.62 320.63 337.5 354.37 354.38
}
[
dup 32 * 360 /f 0.5 + >integer 32 mod [ 1 + ] [ box nth ] bi
"%6.2f° %2d %s\n" printf
] each |
http://rosettacode.org/wiki/Bitwise_operations | Bitwise operations |
Basic Data Operation
This is a basic data operation. It represents a fundamental action on a basic data type.
You may see other such operations in the Basic Data Operations category, or:
Integer Operations
Arithmetic |
Comparison
Boolean Operations
Bitwise |
Logical
String Operations
Concatenation |
Interpolation |
Comparison |
Matching
Memory Operations
Pointers & references |
Addresses
Task
Write a routine to perform a bitwise AND, OR, and XOR on two integers, a bitwise NOT on the first integer, a left shift, right shift, right arithmetic shift, left rotate, and right rotate.
All shifts and rotates should be done on the first integer with a shift/rotate amount of the second integer.
If any operation is not available in your language, note it.
| #BASIC | BASIC | SUB bitwise (a, b)
PRINT a AND b
PRINT a OR b
PRINT a XOR b
PRINT NOT a
END SUB |
http://rosettacode.org/wiki/Bitmap | Bitmap | Show a basic storage type to handle a simple RGB raster graphics image,
and some primitive associated functions.
If possible provide a function to allocate an uninitialised image,
given its width and height, and provide 3 additional functions:
one to fill an image with a plain RGB color,
one to set a given pixel with a color,
one to get the color of a pixel.
(If there are specificities about the storage or the allocation, explain those.)
These functions are used as a base for the articles in the category raster graphics operations,
and a basic output function to check the results
is available in the article write ppm file.
| #ARM_Assembly | ARM Assembly |
Bitmap_FloodFill:
;input:
;r0 = color to fill screen with (15-bit color)
STMFD sp!,{r0-r12,lr}
MOV R2,#160
MOV R4,#0x06000000
outerloop_floodfill:
MOV R1,#240 ;restore inner loop counter
innerloop_floodfill:
strH r0,[r4]
add r4,r4,#2 ;next pixel
subs r1,r1,#1 ;decrement loop counter
bne innerloop_floodfill
subs r2,r2,#1
bne outerloop_floodfill
LDMFD sp!,{r0-r12,pc}
Bitmap_Locate:
;given x and y coordinates, offsets vram addr to that pixel on screen.
;input:
;r0 = x
;r1 = y
;output: r2 = vram area
STMFD sp!,{r4-r12,lr}
mov r2,#0x06000000 ;vram base
mov r4,#240*2 ;240 pixels across, 2 bytes per pixel
mul r1,r4,r1
add r2,r2,r1 ;add y*480
add r2,r2,r0,lsl #1 ;add x*2
LDMFD sp!,{r4-r12,pc}
Bitmap_StorePixel:
;input: r3 = color
;r0 = x
;r1 = y
bl Bitmap_Locate
strH r3,[r2] ;store the pixel color in video memory
bx lr
Bitmap_GetPixel:
;retrieves the color of the pixel at [r2] and stores its color value in r3.
;r0 = x
;r1 = y
;output in r3
bl Bitmap_Locate
ldrH r3,[r2]
bx lr |
http://rosettacode.org/wiki/Bitmap/Midpoint_circle_algorithm | Bitmap/Midpoint circle algorithm | Task
Using the data storage type defined on this page for raster images,
write an implementation of the midpoint circle algorithm (also known as Bresenham's circle algorithm).
(definition on Wikipedia).
| #OCaml | OCaml | let raster_circle ~img ~color ~c:(x0, y0) ~r =
let plot = put_pixel img color in
let x = 0
and y = r
and m = 5 - 4 * r
in
let rec loop x y m =
plot (x0 + x) (y0 + y);
plot (x0 + y) (y0 + x);
plot (x0 - x) (y0 + y);
plot (x0 - y) (y0 + x);
plot (x0 + x) (y0 - y);
plot (x0 + y) (y0 - x);
plot (x0 - x) (y0 - y);
plot (x0 - y) (y0 - x);
let y, m =
if m > 0
then (y - 1), (m - 8 * y)
else y, m
in
if x <= y then
let x = x + 1 in
let m = m + 8 * x + 4 in
loop x y m
in
loop x y m
;; |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #Phix | Phix | -- demo\rosetta\Bitmap_BezierCubic.exw (runnable version)
include ppm.e -- black, green, red, white, new_image(), write_ppm(), bresLine() -- (covers above requirements)
function cubic_bezier(sequence img, atom x1, y1, x2, y2, x3, y3, x4, y4, integer colour, segments)
sequence pts = repeat(0,segments*2)
for i=0 to segments*2-1 by 2 do
atom t = i/segments,
t1 = 1-t,
a = power(t1,3),
b = 3*t*power(t1,2),
c = 3*power(t,2)*t1,
d = power(t,3)
pts[i+1] = floor(a*x1+b*x2+c*x3+d*x4)
pts[i+2] = floor(a*y1+b*y2+c*y3+d*y4)
end for
for i=1 to segments*2-2 by 2 do
img = bresLine(img, pts[i], pts[i+1], pts[i+2], pts[i+3], colour)
end for
return img
end function
sequence img = new_image(300,200,black)
img = cubic_bezier(img, 0,100, 100,0, 200,200, 300,100, white, 40)
img = bresLine(img,0,100,100,0,green)
img = bresLine(img,100,0,200,200,green)
img = bresLine(img,200,200,300,100,green)
img[1][100] = red
img[100][1] = red
img[200][200] = red
img[300][100] = red
write_ppm("Bezier.ppm",img) |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #PHP | PHP | <?
$image = imagecreate(200, 200);
// The first allocated color will be the background color:
imagecolorallocate($image, 255, 255, 255);
$color = imagecolorallocate($image, 255, 0, 0);
cubicbezier($image, $color, 160, 10, 10, 40, 30, 160, 150, 110);
imagepng($image);
function cubicbezier($img, $col, $x0, $y0, $x1, $y1, $x2, $y2, $x3, $y3, $n = 20) {
$pts = array();
for($i = 0; $i <= $n; $i++) {
$t = $i / $n;
$t1 = 1 - $t;
$a = pow($t1, 3);
$b = 3 * $t * pow($t1, 2);
$c = 3 * pow($t, 2) * $t1;
$d = pow($t, 3);
$x = round($a * $x0 + $b * $x1 + $c * $x2 + $d * $x3);
$y = round($a * $y0 + $b * $y1 + $c * $y2 + $d * $y3);
$pts[$i] = array($x, $y);
}
for($i = 0; $i < $n; $i++) {
imageline($img, $pts[$i][0], $pts[$i][1], $pts[$i+1][0], $pts[$i+1][1], $col);
}
}
|
http://rosettacode.org/wiki/Biorhythms | Biorhythms | For a while in the late 70s, the pseudoscience of biorhythms was popular enough to rival astrology, with kiosks in malls that would give you your weekly printout. It was also a popular entry in "Things to Do with your Pocket Calculator" lists. You can read up on the history at Wikipedia, but the main takeaway is that unlike astrology, the math behind biorhythms is dead simple.
It's based on the number of days since your birth. The premise is that three cycles of unspecified provenance govern certain aspects of everyone's lives – specifically, how they're feeling physically, emotionally, and mentally. The best part is that not only do these cycles somehow have the same respective lengths for all humans of any age, gender, weight, genetic background, etc, but those lengths are an exact number of days. And the pattern is in each case a perfect sine curve. Absolutely miraculous!
To compute your biorhythmic profile for a given day, the first thing you need is the number of days between that day and your birth, so the answers in Days between dates are probably a good starting point. (Strictly speaking, the biorhythms start at 0 at the moment of your birth, so if you know time of day you can narrow things down further, but in general these operate at whole-day granularity.) Then take the residue of that day count modulo each of the the cycle lengths to calculate where the day falls on each of the three sinusoidal journeys.
The three cycles and their lengths are as follows:
Cycle
Length
Physical
23 days
Emotional
28 days
Mental
33 days
The first half of each cycle is in "plus" territory, with a peak at the quarter-way point; the second half in "minus" territory, with a valley at the three-quarters mark. You can calculate a specific value between -1 and +1 for the kth day of an n-day cycle by computing sin( 2πk / n ). The days where a cycle crosses the axis in either direction are called "critical" days, although with a cycle value of 0 they're also said to be the most neutral, which seems contradictory.
The task: write a subroutine, function, or program that will, given a birthdate and a target date, output the three biorhythmic values for the day. You may optionally include a text description of the position and the trend (e.g. "up and rising", "peak", "up but falling", "critical", "down and falling", "valley", "down but rising"), an indication of the date on which the next notable event (peak, valley, or crossing) falls, or even a graph of the cycles around the target date. Demonstrate the functionality for dates of your choice.
Example run of my Raku implementation:
raku br.raku 1943-03-09 1972-07-11
Output:
Day 10717:
Physical day 22: -27% (down but rising, next transition 1972-07-12)
Emotional day 21: valley
Mental day 25: valley
Double valley! This was apparently not a good day for Mr. Fischer to begin a chess tournament...
| #Locomotive_Basic | Locomotive Basic | 10 input "Birthday (y,m,d) ",y,m,d:gosub 3000
20 gosub 1000
30 bday = day
40 input "Today's date (y,m,d) ",y,m,d:gosub 3000
50 gosub 1000
60 diff = day - bday
70 print:print "Age in days:" tab(22) diff
80 t$ = "physical":l = 23:gosub 2000
90 t$ = "emotional":l = 28:gosub 2000
100 t$ = "intellectual":l = 33:gosub 2000
999 end
1000 ' Get the days to J2000
1010 ' FNday only works between 1901 to 2099 - see Meeus chapter 7
1020 day = 367 * y - 7 * (y + (m + 9) \ 12) \ 4 + 275 * m \ 9 + d - 730530
1030 return
2000 p = 100 * sin(2*pi*diff/l)
2010 print t$; " cycle: " tab(22)
2020 print using "+###"; int(p);
2030 print "%";
2040 if abs(p) < 15 then print " (critical)" else print
2050 return
3000 if y < 1901 or y > 2099 then print "Year must be between 1901 and 2099!":run
3010 return |
http://rosettacode.org/wiki/Bioinformatics/base_count | Bioinformatics/base count | Given this string representing ordered DNA bases:
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
Task
"Pretty print" the sequence followed by a summary of the counts of each of the bases: (A, C, G, and T) in the sequence
print the total count of each base in the string.
Other tasks related to string operations:
Metrics
Array length
String length
Copy a string
Empty string (assignment)
Counting
Word frequency
Letter frequency
Jewels and stones
I before E except after C
Bioinformatics/base count
Count occurrences of a substring
Count how many vowels and consonants occur in a string
Remove/replace
XXXX redacted
Conjugate a Latin verb
Remove vowels from a string
String interpolation (included)
Strip block comments
Strip comments from a string
Strip a set of characters from a string
Strip whitespace from a string -- top and tail
Strip control codes and extended characters from a string
Anagrams/Derangements/shuffling
Word wheel
ABC problem
Sattolo cycle
Knuth shuffle
Ordered words
Superpermutation minimisation
Textonyms (using a phone text pad)
Anagrams
Anagrams/Deranged anagrams
Permutations/Derangements
Find/Search/Determine
ABC words
Odd words
Word ladder
Semordnilap
Word search
Wordiff (game)
String matching
Tea cup rim text
Alternade words
Changeable words
State name puzzle
String comparison
Unique characters
Unique characters in each string
Extract file extension
Levenshtein distance
Palindrome detection
Common list elements
Longest common suffix
Longest common prefix
Compare a list of strings
Longest common substring
Find common directory path
Words from neighbour ones
Change e letters to i in words
Non-continuous subsequences
Longest common subsequence
Longest palindromic substrings
Longest increasing subsequence
Words containing "the" substring
Sum of the digits of n is substring of n
Determine if a string is numeric
Determine if a string is collapsible
Determine if a string is squeezable
Determine if a string has all unique characters
Determine if a string has all the same characters
Longest substrings without repeating characters
Find words which contains all the vowels
Find words which contains most consonants
Find words which contains more than 3 vowels
Find words which first and last three letters are equals
Find words which odd letters are consonants and even letters are vowels or vice_versa
Formatting
Substring
Rep-string
Word wrap
String case
Align columns
Literals/String
Repeat a string
Brace expansion
Brace expansion using ranges
Reverse a string
Phrase reversals
Comma quibbling
Special characters
String concatenation
Substring/Top and tail
Commatizing numbers
Reverse words in a string
Suffixation of decimal numbers
Long literals, with continuations
Numerical and alphabetical suffixes
Abbreviations, easy
Abbreviations, simple
Abbreviations, automatic
Song lyrics/poems/Mad Libs/phrases
Mad Libs
Magic 8-ball
99 Bottles of Beer
The Name Game (a song)
The Old lady swallowed a fly
The Twelve Days of Christmas
Tokenize
Text between
Tokenize a string
Word break problem
Tokenize a string with escaping
Split a character string based on change of character
Sequences
Show ASCII table
De Bruijn sequences
Self-referential sequences
Generate lower case ASCII alphabet
| #Arturo | Arturo | dna: {
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
}
prettyPrint: function [in][
count: #[ A: 0, T: 0, G: 0, C: 0 ]
loop.with:'i split.lines in 'line [
prints [pad to :string i*50 3 ":"]
print split.every:10 line
loop split line 'ch [
case [ch=]
when? -> "A" -> count\A: count\A + 1
when? -> "T" -> count\T: count\T + 1
when? -> "G" -> count\G: count\G + 1
when? -> "C" -> count\C: count\C + 1
else []
]
]
print ["Total count => A:" count\A, "T:" count\T "G:" count\G "C:" count\C]
]
prettyPrint dna |
http://rosettacode.org/wiki/Bioinformatics/base_count | Bioinformatics/base count | Given this string representing ordered DNA bases:
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
Task
"Pretty print" the sequence followed by a summary of the counts of each of the bases: (A, C, G, and T) in the sequence
print the total count of each base in the string.
Other tasks related to string operations:
Metrics
Array length
String length
Copy a string
Empty string (assignment)
Counting
Word frequency
Letter frequency
Jewels and stones
I before E except after C
Bioinformatics/base count
Count occurrences of a substring
Count how many vowels and consonants occur in a string
Remove/replace
XXXX redacted
Conjugate a Latin verb
Remove vowels from a string
String interpolation (included)
Strip block comments
Strip comments from a string
Strip a set of characters from a string
Strip whitespace from a string -- top and tail
Strip control codes and extended characters from a string
Anagrams/Derangements/shuffling
Word wheel
ABC problem
Sattolo cycle
Knuth shuffle
Ordered words
Superpermutation minimisation
Textonyms (using a phone text pad)
Anagrams
Anagrams/Deranged anagrams
Permutations/Derangements
Find/Search/Determine
ABC words
Odd words
Word ladder
Semordnilap
Word search
Wordiff (game)
String matching
Tea cup rim text
Alternade words
Changeable words
State name puzzle
String comparison
Unique characters
Unique characters in each string
Extract file extension
Levenshtein distance
Palindrome detection
Common list elements
Longest common suffix
Longest common prefix
Compare a list of strings
Longest common substring
Find common directory path
Words from neighbour ones
Change e letters to i in words
Non-continuous subsequences
Longest common subsequence
Longest palindromic substrings
Longest increasing subsequence
Words containing "the" substring
Sum of the digits of n is substring of n
Determine if a string is numeric
Determine if a string is collapsible
Determine if a string is squeezable
Determine if a string has all unique characters
Determine if a string has all the same characters
Longest substrings without repeating characters
Find words which contains all the vowels
Find words which contains most consonants
Find words which contains more than 3 vowels
Find words which first and last three letters are equals
Find words which odd letters are consonants and even letters are vowels or vice_versa
Formatting
Substring
Rep-string
Word wrap
String case
Align columns
Literals/String
Repeat a string
Brace expansion
Brace expansion using ranges
Reverse a string
Phrase reversals
Comma quibbling
Special characters
String concatenation
Substring/Top and tail
Commatizing numbers
Reverse words in a string
Suffixation of decimal numbers
Long literals, with continuations
Numerical and alphabetical suffixes
Abbreviations, easy
Abbreviations, simple
Abbreviations, automatic
Song lyrics/poems/Mad Libs/phrases
Mad Libs
Magic 8-ball
99 Bottles of Beer
The Name Game (a song)
The Old lady swallowed a fly
The Twelve Days of Christmas
Tokenize
Text between
Tokenize a string
Word break problem
Tokenize a string with escaping
Split a character string based on change of character
Sequences
Show ASCII table
De Bruijn sequences
Self-referential sequences
Generate lower case ASCII alphabet
| #AWK | AWK |
# syntax: GAWK -f BIOINFORMATICS_BASE_COUNT.AWK
# converted from FreeBASIC
#
# sorting:
# PROCINFO["sorted_in"] is used by GAWK
# SORTTYPE is used by Thompson Automation's TAWK
#
BEGIN {
dna = "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG" \
"CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG" \
"AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT" \
"GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT" \
"CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG" \
"TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA" \
"TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT" \
"CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG" \
"TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC" \
"GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT"
curr = first = 1
while (curr <= length(dna)) {
curr_base = substr(dna,curr,1)
base_arr[curr_base]++
rec = sprintf("%s%s",rec,curr_base)
curr++
if (curr % 10 == 1) {
rec = sprintf("%s ",rec)
}
if (curr % 50 == 1) {
printf("%3d-%3d: %s\n",first,curr-1,rec)
rec = ""
first = curr
}
}
PROCINFO["sorted_in"] = "@ind_str_asc" ; SORTTYPE = 1
printf("\nBase count\n")
for (i in base_arr) {
printf("%s %8d\n",i,base_arr[i])
total += base_arr[i]
}
printf("%10d total\n",total)
exit(0)
}
|
http://rosettacode.org/wiki/Bitmap/Bresenham%27s_line_algorithm | Bitmap/Bresenham's line algorithm | Task
Using the data storage type defined on the Bitmap page for raster graphics images,
draw a line given two points with Bresenham's line algorithm.
| #BBC_BASIC | BBC BASIC | Width% = 200
Height% = 200
REM Set window size:
VDU 23,22,Width%;Height%;8,16,16,128
REM Draw lines:
PROCbresenham(50,100,100,190,0,0,0)
PROCbresenham(100,190,150,100,0,0,0)
PROCbresenham(150,100,100,10,0,0,0)
PROCbresenham(100,10,50,100,0,0,0)
END
DEF PROCbresenham(x1%,y1%,x2%,y2%,r%,g%,b%)
LOCAL dx%, dy%, sx%, sy%, e
dx% = ABS(x2% - x1%) : sx% = SGN(x2% - x1%)
dy% = ABS(y2% - y1%) : sy% = SGN(y2% - y1%)
IF dx% > dy% e = dx% / 2 ELSE e = dy% / 2
REPEAT
PROCsetpixel(x1%,y1%,r%,g%,b%)
IF x1% = x2% IF y1% = y2% EXIT REPEAT
IF dx% > dy% THEN
x1% += sx% : e -= dy% : IF e < 0 e += dx% : y1% += sy%
ELSE
y1% += sy% : e -= dx% : IF e < 0 e += dy% : x1% += sx%
ENDIF
UNTIL FALSE
ENDPROC
DEF PROCsetpixel(x%,y%,r%,g%,b%)
COLOUR 1,r%,g%,b%
GCOL 1
LINE x%*2,y%*2,x%*2,y%*2
ENDPROC |
http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation | Bioinformatics/Sequence mutation | Task
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
Choosing a random base position in the sequence.
Mutate the sequence by doing one of either:
Swap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
Delete the chosen base at the position.
Insert another base randomly chosen from A,C, G, or T into the sequence at that position.
Randomly generate a test DNA sequence of at least 200 bases
"Pretty print" the sequence and a count of its size, and the count of each base in the sequence
Mutate the sequence ten times.
"Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
Extra credit
Give more information on the individual mutations applied.
Allow mutations to be weighted and/or chosen. | #Haskell | Haskell | import Data.List (group, sort)
import Data.List.Split (chunksOf)
import System.Random (Random, randomR, random, newStdGen, randoms, getStdRandom)
import Text.Printf (PrintfArg(..), fmtChar, fmtPrecision, formatString, IsChar(..), printf)
data Mutation = Swap | Delete | Insert deriving (Show, Eq, Ord, Enum, Bounded)
data DNABase = A | C | G | T deriving (Show, Read, Eq, Ord, Enum, Bounded)
type DNASequence = [DNABase]
data Result = Swapped Mutation Int (DNABase, DNABase)
| InsertDeleted Mutation Int DNABase
instance Random DNABase where
randomR (a, b) g = case randomR (fromEnum a, fromEnum b) g of (x, y) -> (toEnum x, y)
random = randomR (minBound, maxBound)
instance Random Mutation where
randomR (a, b) g = case randomR (fromEnum a, fromEnum b) g of (x, y) -> (toEnum x, y)
random = randomR (minBound, maxBound)
instance PrintfArg DNABase where
formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })
instance PrintfArg Mutation where
formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })
instance IsChar DNABase where
toChar = head . show
fromChar = read . pure
chunkedDNASequence :: DNASequence -> [(Int, [DNABase])]
chunkedDNASequence = zip [50,100..] . chunksOf 50
baseCounts :: DNASequence -> [(DNABase, Int)]
baseCounts = fmap ((,) . head <*> length) . group . sort
newSequence :: Int -> IO DNASequence
newSequence n = take n . randoms <$> newStdGen
mutateSequence :: DNASequence -> IO (Result, DNASequence)
mutateSequence [] = fail "empty dna sequence"
mutateSequence ds = randomMutation >>= mutate ds
where
randomMutation = head . randoms <$> newStdGen
mutate xs m = do
i <- randomIndex (length xs)
case m of
Swap -> randomDNA >>= \d -> pure (Swapped Swap i (xs !! pred i, d), swapElement i d xs)
Insert -> randomDNA >>= \d -> pure (InsertDeleted Insert i d, insertElement i d xs)
Delete -> pure (InsertDeleted Delete i (xs !! pred i), dropElement i xs)
where
dropElement i xs = take (pred i) xs <> drop i xs
insertElement i e xs = take i xs <> [e] <> drop i xs
swapElement i a xs = take (pred i) xs <> [a] <> drop i xs
randomIndex n = getStdRandom (randomR (1, n))
randomDNA = head . randoms <$> newStdGen
mutate :: Int -> DNASequence -> IO DNASequence
mutate 0 s = pure s
mutate n s = do
(r, ms) <- mutateSequence s
case r of
Swapped m i (a, b) -> printf "%6s @ %-3d : %s -> %s \n" m i a b
InsertDeleted m i a -> printf "%6s @ %-3d : %s\n" m i a
mutate (pred n) ms
main :: IO ()
main = do
ds <- newSequence 200
putStrLn "\nInitial Sequence:" >> showSequence ds
putStrLn "\nBase Counts:" >> showBaseCounts ds
showSumBaseCounts ds
ms <- mutate 10 ds
putStrLn "\nMutated Sequence:" >> showSequence ms
putStrLn "\nBase Counts:" >> showBaseCounts ms
showSumBaseCounts ms
where
showSequence = mapM_ (uncurry (printf "%3d: %s\n")) . chunkedDNASequence
showBaseCounts = mapM_ (uncurry (printf "%s: %3d\n")) . baseCounts
showSumBaseCounts xs = putStrLn (replicate 6 '-') >> printf "Σ: %d\n\n" (length xs) |
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Julia | Julia | using SHA
bytes(n::Integer, l::Int) = collect(UInt8, (n >> 8i) & 0xFF for i in l-1:-1:0)
function decodebase58(bc::String, l::Int)
digits = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
num = big(0)
for c in bc
num = num * 58 + search(digits, c) - 1
end
return bytes(num, l)
end
function checkbcaddress(addr::String)
if !(25 ≤ length(addr) ≤ 35) return false end
bcbytes = decodebase58(addr, 25)
sha = sha256(sha256(bcbytes[1:end-4]))
return bcbytes[end-3:end] == sha[1:4]
end
const addresses = Dict(
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" => true,
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62j" => false,
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9" => true,
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62X" => true,
"1ANNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" => false,
"1A Na15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i" => false,
"BZbvjr" => false,
"i55j" => false,
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62!" => false,
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62iz" => false,
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62izz" => false,
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nJ9" => false,
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62I" => false)
for (addr, corr) in addresses
println("Address: $addr\nExpected: $corr\tChecked: ", checkbcaddress(addr))
end |
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Kotlin | Kotlin | import java.security.MessageDigest
object Bitcoin {
private const val ALPHABET = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
private fun ByteArray.contentEquals(other: ByteArray): Boolean {
if (this.size != other.size) return false
return (0 until this.size).none { this[it] != other[it] }
}
private fun decodeBase58(input: String): ByteArray? {
val output = ByteArray(25)
for (c in input) {
var p = ALPHABET.indexOf(c)
if (p == -1) return null
for (j in 24 downTo 1) {
p += 58 * (output[j].toInt() and 0xff)
output[j] = (p % 256).toByte()
p = p shr 8
}
if (p != 0) return null
}
return output
}
private fun sha256(data: ByteArray, start: Int, len: Int, recursion: Int): ByteArray {
if (recursion == 0) return data
val md = MessageDigest.getInstance("SHA-256")
md.update(data.sliceArray(start until start + len))
return sha256(md.digest(), 0, 32, recursion - 1)
}
fun validateAddress(address: String): Boolean {
if (address.length !in 26..35) return false
val decoded = decodeBase58(address)
if (decoded == null) return false
val hash = sha256(decoded, 0, 21, 2)
return hash.sliceArray(0..3).contentEquals(decoded.sliceArray(21..24))
}
}
fun main(args: Array<String>) {
val addresses = arrayOf(
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62j",
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62X",
"1ANNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i",
"1A Na15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i",
"BZbvjr",
"i55j",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62!",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62iz",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62izz",
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nJ9",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62I"
)
for (address in addresses)
println("${address.padEnd(36)} -> ${if (Bitcoin.validateAddress(address)) "valid" else "invalid"}")
} |
http://rosettacode.org/wiki/Bitmap/Flood_fill | Bitmap/Flood fill | Implement a flood fill.
A flood fill is a way of filling an area using color banks to define the contained area or a target color which "determines" the area (the valley that can be flooded; Wikipedia uses the term target color). It works almost like a water flooding from a point towards the banks (or: inside the valley): if there's a hole in the banks, the flood is not contained and all the image (or all the "connected valleys") get filled.
To accomplish the task, you need to implement just one of the possible algorithms (examples are on Wikipedia). Variations on the theme are allowed (e.g. adding a tolerance parameter or argument for color-matching of the banks or target color).
Testing: the basic algorithm is not suitable for truecolor images; a possible test image is the one shown on the right box; you can try to fill the white area, or the black inner circle.
| #HicEst | HicEst | WINDOW(WINdowhandle=wh, BaCkcolor=0, TItle="Rosetta test image")
WRITE(WIN=wh, DeCoRation="EL=14, BC=14") ! color 14 == bright yellow
RGB(128, 100, 0, 25) ! define color nr 25 as 128/255 red, 100/255 green, 0 blue
WRITE(WIN=wh, DeCoRation="L=1/4, R=1/2, T=1/4, B=1/2, EL=25, BC=25")
WINDOW(Kill=wh) |
http://rosettacode.org/wiki/Bitmap/Flood_fill | Bitmap/Flood fill | Implement a flood fill.
A flood fill is a way of filling an area using color banks to define the contained area or a target color which "determines" the area (the valley that can be flooded; Wikipedia uses the term target color). It works almost like a water flooding from a point towards the banks (or: inside the valley): if there's a hole in the banks, the flood is not contained and all the image (or all the "connected valleys") get filled.
To accomplish the task, you need to implement just one of the possible algorithms (examples are on Wikipedia). Variations on the theme are allowed (e.g. adding a tolerance parameter or argument for color-matching of the banks or target color).
Testing: the basic algorithm is not suitable for truecolor images; a possible test image is the one shown on the right box; you can try to fill the white area, or the black inner circle.
| #J | J | NB. finds and labels contiguous areas with the same numbers
NB. ref: http://www.jsoftware.com/pipermail/general/2005-August/023886.html
findcontig=: (|."1@|:@:>. (* * 1&(|.!.0)))^:4^:_@(* >:@i.@$)
NB.*getFloodpoints v Returns points to fill given starting point (x) and image (y)
getFloodpoints=: [: 4&$.@$. [ (] = getPixels) [: findcontig ] -:"1 getPixels
NB.*floodFill v Floods area, defined by point and color (x), of image (y)
NB. x is: 2-item list of (y x) ; (color)
floodFill=: (1&({::)@[ ;~ 0&({::)@[ getFloodpoints ]) setPixels ] |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Groovy | Groovy | data Bool = False | True deriving (Eq, Ord, Enum, Read, Show, Bounded) |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #Haskell | Haskell | data Bool = False | True deriving (Eq, Ord, Enum, Read, Show, Bounded) |
http://rosettacode.org/wiki/Caesar_cipher | Caesar cipher |
Task
Implement a Caesar cipher, both encoding and decoding.
The key is an integer from 1 to 25.
This cipher rotates (either towards left or right) the letters of the alphabet (A to Z).
The encoding replaces each letter with the 1st to 25th next letter in the alphabet (wrapping Z to A).
So key 2 encrypts "HI" to "JK", but key 20 encrypts "HI" to "BC".
This simple "mono-alphabetic substitution cipher" provides almost no security, because an attacker who has the encoded message can either use frequency analysis to guess the key, or just try all 25 keys.
Caesar cipher is identical to Vigenère cipher with a key of length 1.
Also, Rot-13 is identical to Caesar cipher with key 13.
Related tasks
Rot-13
Substitution Cipher
Vigenère Cipher/Cryptanalysis
| #XBasic | XBasic |
PROGRAM "caesarcipher"
VERSION "0.0001"
DECLARE FUNCTION Entry()
INTERNAL FUNCTION Encrypt$(p$, key%%)
INTERNAL FUNCTION Decrypt$(p$, key%%)
FUNCTION Entry()
txt$ = "The five boxing wizards jump quickly"
key%% = 3
PRINT "Original: "; txt$
enc$ = Encrypt$(txt$, key%%)
PRINT "Encrypted: "; enc$
PRINT "Decrypted: "; Decrypt$(enc$, key%%)
END FUNCTION
FUNCTION Encrypt$(p$, key%%)
e$ = p$ ' In order to avoid iterative concatenations
FOR i = 0 TO LEN(p$) - 1
t@@ = p${i} ' or (slower) t@@ = ASC(p$, i + 1)
SELECT CASE TRUE
CASE (t@@ >= 'A') AND (t@@ <= 'Z'):
t@@ = t@@ + key@@
IF t&& > 'Z' THEN
t@@ = t@@ - 26
END IF
CASE (t@@ >= 'a') AND (t@@ <= 'z'):
t@@ = t@@ + key%%
IF t@@ > 'z' THEN
t@@ = t@@ - 26
END IF
END SELECT
e${i} = t@@
NEXT i
END FUNCTION e$
FUNCTION Decrypt$(p$, key%%)
e$ = p$ ' In order to avoid iterative concatenations
FOR i = 0 TO LEN(p$) - 1
t@@ = p${i} ' or (slower) t@@ = ASC(p$, i + 1)
SELECT CASE TRUE
CASE (t@@ >= 'A') AND (t@@ <= 'Z'):
t@@ = t@@ - key%%
IF t@@ < 'A' THEN
t@@ = t@@ + 26
END IF
CASE (t@@ >= 'a') AND (t@@ <= 'z'):
t@@ = t@@ - key%%
IF t@@ < 'a' THEN
t@@ = t@@ + 26
END IF
END SELECT
e${i} = t@@
NEXT i
END FUNCTION e$
END PROGRAM
|
http://rosettacode.org/wiki/Box_the_compass | Box the compass | There be many a land lubber that knows naught of the pirate ways and gives direction by degree!
They know not how to box the compass!
Task description
Create a function that takes a heading in degrees and returns the correct 32-point compass heading.
Use the function to print and display a table of Index, Compass point, and Degree; rather like the corresponding columns from, the first table of the wikipedia article, but use only the following 33 headings as input:
[0.0, 16.87, 16.88, 33.75, 50.62, 50.63, 67.5, 84.37, 84.38, 101.25, 118.12, 118.13, 135.0, 151.87, 151.88, 168.75, 185.62, 185.63, 202.5, 219.37, 219.38, 236.25, 253.12, 253.13, 270.0, 286.87, 286.88, 303.75, 320.62, 320.63, 337.5, 354.37, 354.38]. (They should give the same order of points but are spread throughout the ranges of acceptance).
Notes;
The headings and indices can be calculated from this pseudocode:
for i in 0..32 inclusive:
heading = i * 11.25
case i %3:
if 1: heading += 5.62; break
if 2: heading -= 5.62; break
end
index = ( i mod 32) + 1
The column of indices can be thought of as an enumeration of the thirty two cardinal points (see talk page)..
| #Fortran | Fortran | Program Compass
implicit none
integer :: i, ind
real :: heading
do i = 0, 32
heading = i * 11.25
if (mod(i, 3) == 1) then
heading = heading + 5.62
else if (mod(i, 3) == 2) then
heading = heading - 5.62
end if
ind = mod(i, 32) + 1
write(*, "(i2, a20, f8.2)") ind, compasspoint(heading), heading
end do
contains
function compasspoint(h)
character(18) :: compasspoint
character(18) :: points(32) = (/ "North ", "North by east ", "North-northeast ", &
"Northeast by north", "Northeast ", "Northeast by east ", "East-northeast ", &
"East by north ", "East ", "East by south ", "East-southeast ", &
"Southeast by east ", "Southeast ", "Southeast by south", "South-southeast ", &
"South by east ", "South ", "South by west ", "South-southwest ", &
"Southwest by south", "Southwest ", "Southwest by west ", "West-southwest ", &
"West by south ", "West ", "West by north ", "West-northwest ", &
"Northwest by west ", "Northwest ", "Northwest by north", "North-northwest ", &
"North by west " /)
real, intent(in) :: h
real :: x
x = h / 11.25 + 1.5
if (x >= 33.0) x = x - 32.0
compasspoint = points(int(x))
end function compasspoint
end program Compass |
http://rosettacode.org/wiki/Bitwise_operations | Bitwise operations |
Basic Data Operation
This is a basic data operation. It represents a fundamental action on a basic data type.
You may see other such operations in the Basic Data Operations category, or:
Integer Operations
Arithmetic |
Comparison
Boolean Operations
Bitwise |
Logical
String Operations
Concatenation |
Interpolation |
Comparison |
Matching
Memory Operations
Pointers & references |
Addresses
Task
Write a routine to perform a bitwise AND, OR, and XOR on two integers, a bitwise NOT on the first integer, a left shift, right shift, right arithmetic shift, left rotate, and right rotate.
All shifts and rotates should be done on the first integer with a shift/rotate amount of the second integer.
If any operation is not available in your language, note it.
| #BASIC256 | BASIC256 | # bitwise operators - floating point numbers will be cast to integer
a = 0b00010001
b = 0b11110000
print a
print int(a * 2) # shift left (multiply by 2)
print a \ 2 # shift right (integer divide by 2)
print a | b # bitwise or on two integer values
print a & b # bitwise or on two integer values |
http://rosettacode.org/wiki/Bitmap | Bitmap | Show a basic storage type to handle a simple RGB raster graphics image,
and some primitive associated functions.
If possible provide a function to allocate an uninitialised image,
given its width and height, and provide 3 additional functions:
one to fill an image with a plain RGB color,
one to set a given pixel with a color,
one to get the color of a pixel.
(If there are specificities about the storage or the allocation, explain those.)
These functions are used as a base for the articles in the category raster graphics operations,
and a basic output function to check the results
is available in the article write ppm file.
| #AutoHotkey | AutoHotkey | test:
blue := color(0,0,255) ; rgb
cyan := color(0,255,255)
blue_square := Bitmap(10, 10, blue)
cyanppm := Bitmap(10, 10, cyan)
x := blue_square[4,4] ; get pixel(4,4)
msgbox % "blue: 4,4,R,G,B, RGB: " x.R ", " x.G ", " x.B ", " x.rgb()
blue_square[4,4] := cyan ; set pixel(4,4)
x := blue_square[4,4] ; get pixel(4,4)
blue_square.write("blue.ppm")
return
Bitmap(width = 1, height = 1, background = 0)
{
global black
black := color(0,0,0)
if !background
background := black
static BitmapType
if !BitmapType
BitmapType
:= Object("fill", "Bitmap_Fill"
,"write", "Bitmap_write_ppm3")
img := Object("width", width
,"height", height
, "base" , BitmapType)
img._SetCapacity(height) ; an array of rows
img.fill(background)
Return img
}
Bitmap_Fill(bitmap, color)
{
r := color.r
g := color.g
b := color.b
loop % bitmap.height
{
height := A_Index
loop % bitmap.width
{
width := A_Index
bitmap[height, width] := color(r, g, b)
}
}
return bitmap
}
Bitmap_write_ppm3(bitmap, filename)
{
file := FileOpen(filename, 0x11) ; utf-8, write
file.seek(0,0)
file.write("P3`n"
. bitmap.width . " " . bitmap.height . "`n"
. "255`n")
loop % bitmap.height
{
height := A_Index
loop % bitmap.width
{
width := A_Index
color := bitmap[height, width]
file.Write(color.R . " ")
file.Write(color.G . " ")
file.Write(color.B . " ")
}
file.write("`n")
}
file.close()
return 0
}
Color(r, g, b)
{
static ColorType
if !ColorType
ColorType
:= Object("rgb" , "Color_rgb")
return Object("r" , r, "g", g, "b", b
, "base" , ColorType)
; return Object("r" , r, "g", g, "b", b, "rgb", "Color_rgb")
}
Color_rgb(clr)
{
return clr.R << 16 | clr.G << 8 | clr.B
} |
http://rosettacode.org/wiki/Bitmap/Midpoint_circle_algorithm | Bitmap/Midpoint circle algorithm | Task
Using the data storage type defined on this page for raster images,
write an implementation of the midpoint circle algorithm (also known as Bresenham's circle algorithm).
(definition on Wikipedia).
| #REXX | REXX | /*REXX program plots three circles using midpoint/Bresenham's circle algorithm. */
@.= '·' /*fill the array with middle─dots char.*/
minX= 0; maxX= 0; minY= 0; maxY= 0 /*initialize the minimums and maximums.*/
call drawCircle 0, 0, 8, '#' /*plot 1st circle with pound character.*/
call drawCircle 0, 0, 11, '$' /* " 2nd " " dollar " */
call drawCircle 0, 0, 19, '@' /* " 3rd " " commercial at. */
border= 2 /*BORDER: shows N extra grid points.*/
minX= minX - border*2; maxX= maxX + border*2 /*adjust min and max X to show border*/
minY= minY - border ; maxY= maxY + border /* " " " " Y " " " */
if @.0.0==@. then @.0.0= '┼' /*maybe define the plot's axis origin. */
/*define the plot's horizontal grid──┐ */
do h=minX to maxX; if @.h.0==@. then @.h.0= '─'; end /* ◄───────────┘ */
do v=minY to maxY; if @.0.v==@. then @.0.v= '│'; end /* ◄──────────┐ */
/*define the plot's vertical grid───┘ */
do y=maxY by -1 to minY; _= /* [↓] draw grid from top ──► bottom.*/
do x=minX to maxX; _= _ || @.x.y /* ◄─── " " " left ──► right. */
end /*x*/ /* [↑] a grid row should be finished. */
say _ /*display a single row of the grid. */
end /*y*/
exit /*stick a fork in it, we're all done. */
/*──────────────────────────────────────────────────────────────────────────────────────*/
drawCircle: procedure expose @. minX maxX minY maxY
parse arg xx,yy,r 1 y,plotChar; fx= 1; fy= -2*r /*get X,Y coördinates*/
f= 1 - r
do x=0 while x<y /*▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒*/
if f>=0 then do; y= y - 1; fy= fy + 2; f= f + fy; end /*▒*/
fx= fx + 2; f= f + fx /*▒*/
call plotPoint xx+x, yy+y /*▒*/
call plotPoint xx+y, yy+x /*▒*/
call plotPoint xx+y, yy-x /*▒*/
call plotPoint xx+x, yy-y /*▒*/
call plotPoint xx-y, yy+x /*▒*/
call plotPoint xx-x, yy+y /*▒*/
call plotPoint xx-x, yy-y /*▒*/
call plotPoint xx-y, yy-x /*▒*/
end /*x*/ /* [↑] place plot points ══► plot.▒▒▒▒▒▒▒▒▒▒▒▒*/
return
/*──────────────────────────────────────────────────────────────────────────────────────*/
plotPoint: parse arg c,r; @.c.r= plotChar /*assign a character to be plotted. */
minX= min(minX,c); maxX= max(maxX,c) /*determine the minimum and maximum X.*/
minY= min(minY,r); maxY= max(maxY,r) /* " " " " " Y.*/
return |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #PicoLisp | PicoLisp | (scl 6)
(de cubicBezier (Img N X1 Y1 X2 Y2 X3 Y3 X4 Y4)
(let (R (* N N N) X X1 Y Y1 DX 0 DY 0)
(for I N
(let
(J (- N I)
A (*/ 1.0 J J J R)
B (*/ 3.0 I J J R)
C (*/ 3.0 I I J R)
D (*/ 1.0 I I I R) )
(brez Img
X
Y
(setq DX
(-
(+ (*/ A X1 1.0) (*/ B X2 1.0) (*/ C X3 1.0) (*/ D X4 1.0))
X ) )
(setq DY
(-
(+ (*/ A Y1 1.0) (*/ B Y2 1.0) (*/ C Y3 1.0) (*/ D Y4 1.0))
Y ) ) )
(inc 'X DX)
(inc 'Y DY) ) ) ) ) |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #Processing | Processing | noFill();
bezier(85, 20, 10, 10, 90, 90, 15, 80);
/*
bezier(x1, y1, x2, y2, x3, y3, x4, y4)
Can also be drawn in 3D.
bezier(x1, y1, z1, x2, y2, z2, x3, y3, z3, x4, y4, z4)
*/ |
http://rosettacode.org/wiki/Bitmap/B%C3%A9zier_curves/Cubic | Bitmap/Bézier curves/Cubic | Using the data storage type defined on this page for raster images, and the draw_line function defined in this other one, draw a cubic bezier curve
(definition on Wikipedia).
| #PureBasic | PureBasic | Procedure cubic_bezier(img, p1x, p1y, p2x, p2y, p3x, p3y, p4x, p4y, Color, n_seg)
Protected i
Protected.f t, t1, a, b, c, d
Dim pts.POINT(n_seg)
For i = 0 To n_seg
t = i / n_seg
t1 = 1.0 - t
a = Pow(t1, 3)
b = 3.0 * t * Pow(t1, 2)
c = 3.0 * Pow(t, 2) * t1
d = Pow(t, 3)
pts(i)\x = a * p1x + b * p2x + c * p3x + d * p4x
pts(i)\y = a * p1y + b * p2y + c * p3y + d * p4y
Next
StartDrawing(ImageOutput(img))
FrontColor(Color)
For i = 0 To n_seg - 1
BresenhamLine(pts(i)\x, pts(i)\y, pts(i + 1)\x, pts(i + 1)\y) ;this calls the implementation of a draw_line routine
Next
StopDrawing()
EndProcedure
Define w, h, img
w = 200: h = 200: img = 1
CreateImage(img, w, h) ;img is internal id of the image
OpenWindow(0, 0, 0, w, h,"Bezier curve, cubic", #PB_Window_SystemMenu)
cubic_bezier(1, 160,10, 10,40, 30,160, 150,110, RGB(255, 255, 255), 20)
ImageGadget(0, 0, 0, w, h, ImageID(1))
Define event
Repeat
event = WaitWindowEvent()
Until event = #PB_Event_CloseWindow |
http://rosettacode.org/wiki/Biorhythms | Biorhythms | For a while in the late 70s, the pseudoscience of biorhythms was popular enough to rival astrology, with kiosks in malls that would give you your weekly printout. It was also a popular entry in "Things to Do with your Pocket Calculator" lists. You can read up on the history at Wikipedia, but the main takeaway is that unlike astrology, the math behind biorhythms is dead simple.
It's based on the number of days since your birth. The premise is that three cycles of unspecified provenance govern certain aspects of everyone's lives – specifically, how they're feeling physically, emotionally, and mentally. The best part is that not only do these cycles somehow have the same respective lengths for all humans of any age, gender, weight, genetic background, etc, but those lengths are an exact number of days. And the pattern is in each case a perfect sine curve. Absolutely miraculous!
To compute your biorhythmic profile for a given day, the first thing you need is the number of days between that day and your birth, so the answers in Days between dates are probably a good starting point. (Strictly speaking, the biorhythms start at 0 at the moment of your birth, so if you know time of day you can narrow things down further, but in general these operate at whole-day granularity.) Then take the residue of that day count modulo each of the the cycle lengths to calculate where the day falls on each of the three sinusoidal journeys.
The three cycles and their lengths are as follows:
Cycle
Length
Physical
23 days
Emotional
28 days
Mental
33 days
The first half of each cycle is in "plus" territory, with a peak at the quarter-way point; the second half in "minus" territory, with a valley at the three-quarters mark. You can calculate a specific value between -1 and +1 for the kth day of an n-day cycle by computing sin( 2πk / n ). The days where a cycle crosses the axis in either direction are called "critical" days, although with a cycle value of 0 they're also said to be the most neutral, which seems contradictory.
The task: write a subroutine, function, or program that will, given a birthdate and a target date, output the three biorhythmic values for the day. You may optionally include a text description of the position and the trend (e.g. "up and rising", "peak", "up but falling", "critical", "down and falling", "valley", "down but rising"), an indication of the date on which the next notable event (peak, valley, or crossing) falls, or even a graph of the cycles around the target date. Demonstrate the functionality for dates of your choice.
Example run of my Raku implementation:
raku br.raku 1943-03-09 1972-07-11
Output:
Day 10717:
Physical day 22: -27% (down but rising, next transition 1972-07-12)
Emotional day 21: valley
Mental day 25: valley
Double valley! This was apparently not a good day for Mr. Fischer to begin a chess tournament...
| #Lua | Lua | cycles = {"Physical day ", "Emotional day", "Mental day "}
lengths = {23, 28, 33}
quadrants = {
{"up and rising", "peak"},
{"up but falling", "transition"},
{"down and falling", "valley"},
{"down but rising", "transition"},
}
function parse_date_string (birthDate)
local year, month, day = birthDate:match("(%d+)-(%d+)-(%d+)")
return {year=tonumber(year), month=tonumber(month), day=tonumber(day)}
end
function days_diffeternce (d1, d2)
if d1.year >= 1970 and d2.year >= 1970 then
return math.floor(os.difftime(os.time(d2), os.time(d1))/(60*60*24))
else
local t1 = math.max (1970-d1.year, 1970-d2.year)
t1 = math.ceil(t1/4)*4
d1.year = d1.year + t1
d2.year = d2.year + t1
return math.floor(os.difftime(os.time(d2), os.time(d1))/(60*60*24))
end
end
function biorhythms (birthDate, targetDate)
local bd = parse_date_string(birthDate)
local td = parse_date_string(targetDate)
local days = days_diffeternce (bd, td)
print('Born: '.. birthDate .. ', Target: ' .. targetDate)
print("Day: ", days)
for i=1, #lengths do
local len = lengths[i]
local posn = days%len
local quadrant = math.floor(posn/len*4)+1
local percent = math.floor(math.sin(2*math.pi*posn/len)*1000)/10
local cycle = cycles[i]
local desc = percent > 95 and "peak" or
percent < -95 and "valley" or
math.abs(percent) < 5 and "critical transition" or "other"
if desc == "other" then
local t = math.floor(quadrant/4*len)-posn
local qtrend, qnext = quadrants[quadrant][1], quadrants[quadrant][2]
desc = percent .. '% (' .. qtrend .. ', next transition in ' .. t ..' days)'
end
print(cycle, posn..'/'..len, ': '.. desc)
end
print(' ')
end
datePairs = {
{"1943-03-09", "1972-07-11"},
{"1809-01-12", "1863-11-19"},
{"1809-02-12", "1863-11-19"},
{"2021-02-25", "2022-04-18"},
}
for i=1, #datePairs do
biorhythms(datePairs[i][1], datePairs[i][2])
end |
http://rosettacode.org/wiki/Bioinformatics/base_count | Bioinformatics/base count | Given this string representing ordered DNA bases:
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
TTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTAT
CGCCGCGATGCTCGGTTCGGACCGCCAAGCATCTGGCTCCACTGCTAGTG
TCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGTGTAGAC
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT
Task
"Pretty print" the sequence followed by a summary of the counts of each of the bases: (A, C, G, and T) in the sequence
print the total count of each base in the string.
Other tasks related to string operations:
Metrics
Array length
String length
Copy a string
Empty string (assignment)
Counting
Word frequency
Letter frequency
Jewels and stones
I before E except after C
Bioinformatics/base count
Count occurrences of a substring
Count how many vowels and consonants occur in a string
Remove/replace
XXXX redacted
Conjugate a Latin verb
Remove vowels from a string
String interpolation (included)
Strip block comments
Strip comments from a string
Strip a set of characters from a string
Strip whitespace from a string -- top and tail
Strip control codes and extended characters from a string
Anagrams/Derangements/shuffling
Word wheel
ABC problem
Sattolo cycle
Knuth shuffle
Ordered words
Superpermutation minimisation
Textonyms (using a phone text pad)
Anagrams
Anagrams/Deranged anagrams
Permutations/Derangements
Find/Search/Determine
ABC words
Odd words
Word ladder
Semordnilap
Word search
Wordiff (game)
String matching
Tea cup rim text
Alternade words
Changeable words
State name puzzle
String comparison
Unique characters
Unique characters in each string
Extract file extension
Levenshtein distance
Palindrome detection
Common list elements
Longest common suffix
Longest common prefix
Compare a list of strings
Longest common substring
Find common directory path
Words from neighbour ones
Change e letters to i in words
Non-continuous subsequences
Longest common subsequence
Longest palindromic substrings
Longest increasing subsequence
Words containing "the" substring
Sum of the digits of n is substring of n
Determine if a string is numeric
Determine if a string is collapsible
Determine if a string is squeezable
Determine if a string has all unique characters
Determine if a string has all the same characters
Longest substrings without repeating characters
Find words which contains all the vowels
Find words which contains most consonants
Find words which contains more than 3 vowels
Find words which first and last three letters are equals
Find words which odd letters are consonants and even letters are vowels or vice_versa
Formatting
Substring
Rep-string
Word wrap
String case
Align columns
Literals/String
Repeat a string
Brace expansion
Brace expansion using ranges
Reverse a string
Phrase reversals
Comma quibbling
Special characters
String concatenation
Substring/Top and tail
Commatizing numbers
Reverse words in a string
Suffixation of decimal numbers
Long literals, with continuations
Numerical and alphabetical suffixes
Abbreviations, easy
Abbreviations, simple
Abbreviations, automatic
Song lyrics/poems/Mad Libs/phrases
Mad Libs
Magic 8-ball
99 Bottles of Beer
The Name Game (a song)
The Old lady swallowed a fly
The Twelve Days of Christmas
Tokenize
Text between
Tokenize a string
Word break problem
Tokenize a string with escaping
Split a character string based on change of character
Sequences
Show ASCII table
De Bruijn sequences
Self-referential sequences
Generate lower case ASCII alphabet
| #C | C |
#include<string.h>
#include<stdlib.h>
#include<stdio.h>
typedef struct genome{
char* strand;
int length;
struct genome* next;
}genome;
genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;
int numDigits(int num){
int len = 1;
while(num>10){
num = num/10;
len++;
}
return len;
}
void buildGenome(char str[100]){
int len = strlen(str),i;
genome *genomeIterator, *newGenome;
totalLength += len;
for(i=0;i<len;i++){
switch(str[i]){
case 'A': Adenine++;
break;
case 'T': Thymine++;
break;
case 'C': Cytosine++;
break;
case 'G': Guanine++;
break;
};
}
if(genomeData==NULL){
genomeData = (genome*)malloc(sizeof(genome));
genomeData->strand = (char*)malloc(len*sizeof(char));
strcpy(genomeData->strand,str);
genomeData->length = len;
genomeData->next = NULL;
}
else{
genomeIterator = genomeData;
while(genomeIterator->next!=NULL)
genomeIterator = genomeIterator->next;
newGenome = (genome*)malloc(sizeof(genome));
newGenome->strand = (char*)malloc(len*sizeof(char));
strcpy(newGenome->strand,str);
newGenome->length = len;
newGenome->next = NULL;
genomeIterator->next = newGenome;
}
}
void printGenome(){
genome* genomeIterator = genomeData;
int width = numDigits(totalLength), len = 0;
printf("Sequence:\n");
while(genomeIterator!=NULL){
printf("\n%*d%3s%3s",width+1,len,":",genomeIterator->strand);
len += genomeIterator->length;
genomeIterator = genomeIterator->next;
}
printf("\n\nBase Count\n----------\n\n");
printf("%3c%3s%*d\n",'A',":",width+1,Adenine);
printf("%3c%3s%*d\n",'T',":",width+1,Thymine);
printf("%3c%3s%*d\n",'C',":",width+1,Cytosine);
printf("%3c%3s%*d\n",'G',":",width+1,Guanine);
printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);
free(genomeData);
}
int main(int argc,char** argv)
{
char str[100];
int counter = 0, len;
if(argc!=2){
printf("Usage : %s <Gene file name>\n",argv[0]);
return 0;
}
FILE *fp = fopen(argv[1],"r");
while(fscanf(fp,"%s",str)!=EOF)
buildGenome(str);
fclose(fp);
printGenome();
return 0;
}
|
http://rosettacode.org/wiki/Bitmap/Bresenham%27s_line_algorithm | Bitmap/Bresenham's line algorithm | Task
Using the data storage type defined on the Bitmap page for raster graphics images,
draw a line given two points with Bresenham's line algorithm.
| #C | C | void line(int x0, int y0, int x1, int y1) {
int dx = abs(x1-x0), sx = x0<x1 ? 1 : -1;
int dy = abs(y1-y0), sy = y0<y1 ? 1 : -1;
int err = (dx>dy ? dx : -dy)/2, e2;
for(;;){
setPixel(x0,y0);
if (x0==x1 && y0==y1) break;
e2 = err;
if (e2 >-dx) { err -= dy; x0 += sx; }
if (e2 < dy) { err += dx; y0 += sy; }
}
} |
http://rosettacode.org/wiki/Bioinformatics/Sequence_mutation | Bioinformatics/Sequence mutation | Task
Given a string of characters A, C, G, and T representing a DNA sequence write a routine to mutate the sequence, (string) by:
Choosing a random base position in the sequence.
Mutate the sequence by doing one of either:
Swap the base at that position by changing it to one of A, C, G, or T. (which has a chance of swapping the base for the same base)
Delete the chosen base at the position.
Insert another base randomly chosen from A,C, G, or T into the sequence at that position.
Randomly generate a test DNA sequence of at least 200 bases
"Pretty print" the sequence and a count of its size, and the count of each base in the sequence
Mutate the sequence ten times.
"Pretty print" the sequence after all mutations, and a count of its size, and the count of each base in the sequence.
Extra credit
Give more information on the individual mutations applied.
Allow mutations to be weighted and/or chosen. | #J | J | ACGT=: 'ACGT'
MUTS=: ;: 'del ins mut'
NB. generate sequence of size y of uniformly selected nucleotides.
NB. represent sequences as ints in range i.4 pretty printed. nuc
NB. defined separately to avoid fixing value inside mutation
NB. functions.
nuc=: monad : '?4'
dna=: nuc"0 @ i.
NB. randomly mutate nucleotide at a random index by deletion insertion
NB. or mutation of a nucleotide.
del=: {.,[:}.}.
ins=: {.,nuc@],}.
mut=: {.,nuc@],[:}.}.
NB. pretty print nucleotides in rows of 50 with numbering
seq=: [: (;~ [: (4&":"0) 50*i.@#) _50]\{&ACGT
sim=: monad define
'n k ws'=. y NB. initial size, mutations, and weights for mutations
ws=. (% +/) ws NB. normalize weights
A=.0$]D0=.D=. dna n NB. initial dna and history of actions
NB. k times do a random action according to weights and record it
for. i.k do.
D=.". action=. (":?#D),' ',(":MUTS{::~(+/\ws)I.?0),' D'
A=. action ; A
end.
echo 'actions';,. A-.a:
echo ('mutation';'probability') , MUTS ,. <"0 ws
('start';'end'),.(seq D0) ,: seq D
)
simulate=: (sim@(1 1 1&; &. |. ))`sim@.(3=#) |
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Mathematica_.2F_Wolfram_Language | Mathematica / Wolfram Language | chars = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"; data =
IntegerDigits[
FromDigits[
StringPosition[chars, #][[1]] - 1 & /@ Characters[InputString[]],
58], 256, 25];
data[[-4 ;;]] ==
IntegerDigits[
Hash[FromCharacterCode[
IntegerDigits[Hash[FromCharacterCode[data[[;; -5]]], "SHA256"],
256, 32]], "SHA256"], 256, 32][[;; 4]] |
http://rosettacode.org/wiki/Bitcoin/address_validation | Bitcoin/address validation | Bitcoin/address validation
You are encouraged to solve this task according to the task description, using any language you may know.
Task
Write a program that takes a bitcoin address as argument,
and checks whether or not this address is valid.
A bitcoin address uses a base58 encoding, which uses an alphabet of the characters 0 .. 9, A ..Z, a .. z, but without the four characters:
0 zero
O uppercase oh
I uppercase eye
l lowercase ell
With this encoding, a bitcoin address encodes 25 bytes:
the first byte is the version number, which will be zero for this task ;
the next twenty bytes are a RIPEMD-160 digest, but you don't have to know that for this task: you can consider them a pure arbitrary data ;
the last four bytes are a checksum check. They are the first four bytes of a double SHA-256 digest of the previous 21 bytes.
To check the bitcoin address, you must read the first twenty-one bytes, compute the checksum, and check that it corresponds to the last four bytes.
The program can either return a boolean value or throw an exception when not valid.
You can use a digest library for SHA-256.
Example of a bitcoin address
1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i
It doesn't belong to anyone and is part of the test suite of the bitcoin software.
You can change a few characters in this string and check that it'll fail the test.
| #Nim | Nim | import algorithm
const SHA256Len = 32
const AddrLen = 25
const AddrMsgLen = 21
const AddrChecksumOffset = 21
const AddrChecksumLen = 4
proc SHA256(d: pointer, n: culong, md: pointer = nil): cstring {.cdecl, dynlib: "libssl.so", importc.}
proc decodeBase58(inStr: string, outArray: var openarray[uint8]) =
let base = "123456789ABCDEFGHJKLMNPQRSTUVWXYZabcdefghijkmnopqrstuvwxyz"
outArray.fill(0)
for aChar in inStr:
var accum = base.find(aChar)
if accum < 0:
raise newException(ValueError, "Invalid character: " & $aChar)
for outIndex in countDown((AddrLen - 1), 0):
accum += 58 * outArray[outIndex].int
outArray[outIndex] = (accum mod 256).uint8
accum = accum div 256
if accum != 0:
raise newException(ValueError, "Address string too long")
proc verifyChecksum(addrData: openarray[uint8]) : bool =
let doubleHash = SHA256(SHA256(cast[ptr uint8](addrData), AddrMsgLen), SHA256Len)
for ii in 0 ..< AddrChecksumLen:
if doubleHash[ii].uint8 != addrData[AddrChecksumOffset + ii]:
return false
return true
proc main() =
let
testVectors : seq[string] = @[
"3yQ",
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nK9",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62i",
"1Q1pE5vPGEEMqRcVRMbtBK842Y6Pzo6nJ9",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62I",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62ix",
"1AGNa15ZQXAZUgFiqJ2i7Z2DPU2J6hW62ixx",
"17NdbrSGoUotzeGCcMMCqnFkEvLymoou9j",
"1badbadbadbadbadbadbadbadbadbadbad",
"16UwLL9Risc3QfPqBUvKofHmBQ7wMtjvM",
"1111111111111111111114oLvT2",
"BZbvjr",
]
var
buf: array[AddrLen, uint8]
astr: string
for vector in testVectors:
stdout.write(vector & " : ")
try:
if vector[0] notin {'1', '3'}:
raise newException(ValueError, "invalid starting character")
if vector.len < 26:
raise newException(ValueError, "address too short")
decodeBase58(vector, buf)
if buf[0] != 0:
stdout.write("NG - invalid version number\n")
elif verifyChecksum(buf):
stdout.write("OK\n")
else:
stdout.write("NG - checksum invalid\n")
except:
stdout.write("NG - " & getCurrentExceptionMsg() & "\n")
main()
|
http://rosettacode.org/wiki/Bitmap/Flood_fill | Bitmap/Flood fill | Implement a flood fill.
A flood fill is a way of filling an area using color banks to define the contained area or a target color which "determines" the area (the valley that can be flooded; Wikipedia uses the term target color). It works almost like a water flooding from a point towards the banks (or: inside the valley): if there's a hole in the banks, the flood is not contained and all the image (or all the "connected valleys") get filled.
To accomplish the task, you need to implement just one of the possible algorithms (examples are on Wikipedia). Variations on the theme are allowed (e.g. adding a tolerance parameter or argument for color-matching of the banks or target color).
Testing: the basic algorithm is not suitable for truecolor images; a possible test image is the one shown on the right box; you can try to fill the white area, or the black inner circle.
| #Java | Java | import java.awt.Color;
import java.awt.Point;
import java.awt.image.BufferedImage;
import java.util.Deque;
import java.util.LinkedList;
public class FloodFill {
public void floodFill(BufferedImage image, Point node, Color targetColor, Color replacementColor) {
int width = image.getWidth();
int height = image.getHeight();
int target = targetColor.getRGB();
int replacement = replacementColor.getRGB();
if (target != replacement) {
Deque<Point> queue = new LinkedList<Point>();
do {
int x = node.x;
int y = node.y;
while (x > 0 && image.getRGB(x - 1, y) == target) {
x--;
}
boolean spanUp = false;
boolean spanDown = false;
while (x < width && image.getRGB(x, y) == target) {
image.setRGB(x, y, replacement);
if (!spanUp && y > 0 && image.getRGB(x, y - 1) == target) {
queue.add(new Point(x, y - 1));
spanUp = true;
} else if (spanUp && y > 0 && image.getRGB(x, y - 1) != target) {
spanUp = false;
}
if (!spanDown && y < height - 1 && image.getRGB(x, y + 1) == target) {
queue.add(new Point(x, y + 1));
spanDown = true;
} else if (spanDown && y < height - 1 && image.getRGB(x, y + 1) != target) {
spanDown = false;
}
x++;
}
} while ((node = queue.pollFirst()) != null);
}
}
} |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #HicEst | HicEst | main
//Bits aka Booleans.
b $= bit()
b $= true
print(b)
b $= false
print(b)
//Non-zero values are true.
b $= bit(1)
print(b)
b $= -1
print(b)
//Zero values are false
b $= 0
print(b)
} |
http://rosettacode.org/wiki/Boolean_values | Boolean values | Task
Show how to represent the boolean states "true" and "false" in a language.
If other objects represent "true" or "false" in conditionals, note it.
Related tasks
Logical operations
| #HolyC | HolyC | main
//Bits aka Booleans.
b $= bit()
b $= true
print(b)
b $= false
print(b)
//Non-zero values are true.
b $= bit(1)
print(b)
b $= -1
print(b)
//Zero values are false
b $= 0
print(b)
} |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.