File size: 22,607 Bytes
8481452 bc2395e 8481452 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 |
{
"cells": [
{
"cell_type": "markdown",
"metadata": {},
"source": [
"## GenomeKit foundations\n",
"\n",
"We're going to be using an awesome library called GenomeKit to extract DNA sequences and build 4/6 track representations of mRNA transcripts, which will be used as input for Orthrus. GenomeKit makes it easy to work with genomic data, such as sequences and annotations, by providing tools to access and manipulate reference genomes and variants efficiently. It's built by the awesome folks at Deep Genomics\n",
"\n",
"For more details, you can refer to the [GenomeKit documentation](https://deepgenomics.github.io/GenomeKit/api.html).\n"
]
},
{
"cell_type": "code",
"execution_count": 10,
"metadata": {},
"outputs": [],
"source": [
"import genome_kit as gk\n",
"from genome_kit import Genome, Interval\n",
"import numpy as np"
]
},
{
"cell_type": "code",
"execution_count": 11,
"metadata": {},
"outputs": [
{
"data": {
"text/plain": [
"'CTCTTATGCTCGGGTGATCC'"
]
},
"execution_count": 11,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"genome = Genome(\"gencode.v29\")\n",
"interval = Interval(\"chr7\", \"+\", 117120016, 117120036, genome)\n",
"genome.dna(interval)"
]
},
{
"cell_type": "code",
"execution_count": 12,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"5447\n"
]
}
],
"source": [
"genes = [x for x in genome.genes if x.name == 'PKP1']\n",
"transcripts = genes[0].transcripts\n",
"t = [t for t in transcripts if t.id == 'ENST00000263946.7'][0]\n",
"print(sum([len(x) for x in t.exons]))"
]
},
{
"cell_type": "code",
"execution_count": 13,
"metadata": {},
"outputs": [],
"source": [
"def find_transcript(genome, transcript_id):\n",
" \"\"\"Find a transcript in a genome by transcript ID.\n",
" \n",
" Args:\n",
" genome (object): The genome object containing a list of transcripts.\n",
" transcript_id (str): The ID of the transcript to find.\n",
" \n",
" Returns:\n",
" object: The transcript object, if found.\n",
" \n",
" Raises:\n",
" ValueError: If no transcript with the given ID is found.\n",
" \n",
" Example:\n",
" >>> # Create sample transcripts and a genome\n",
" >>> transcript1 = 'ENST00000263946'\n",
" >>> genome = Genome(\"gencode.v29\")\n",
" >>> result = find_transcript(genome, 'ENST00000335137')\n",
" >>> print(result.id)\n",
" <Transcript ENST00000263946.7 of PKP1>\n",
" >>> # If transcript ID is not found\n",
" >>> find_transcript(genome, 'ENST00000000000')\n",
" ValueError: Transcript with ID ENST00000000000 not found.\n",
" \"\"\"\n",
" transcripts = [x for x in genome.transcripts if x.id.split('.')[0] == transcript_id]\n",
" if not transcripts:\n",
" raise ValueError(f\"Transcript with ID {transcript_id} not found.\")\n",
" \n",
" return transcripts[0]\n",
"\n",
"def find_transcript_by_gene_name(genome, gene_name):\n",
" \"\"\"Find all transcripts in a genome by gene name.\n",
" \n",
" Args:\n",
" genome (object): The genome object containing a list of transcripts.\n",
" gene_name (str): The name of the gene whose transcripts are to be found.\n",
" \n",
" Returns:\n",
" list: A list of transcript objects corresponding to the given gene name.\n",
" \n",
" Raises:\n",
" ValueError: If no transcripts for the given gene name are found.\n",
" \n",
" Example:\n",
" >>> # Find transcripts by gene name\n",
" >>> transcripts = find_transcript_by_gene_name(genome, 'PKP1')\n",
" >>> print(transcripts)\n",
" [<Transcript ENST00000367324.7 of PKP1>,\n",
" <Transcript ENST00000263946.7 of PKP1>,\n",
" <Transcript ENST00000352845.3 of PKP1>,\n",
" <Transcript ENST00000475988.1 of PKP1>,\n",
" <Transcript ENST00000477817.1 of PKP1>] \n",
" >>> # If gene name is not found\n",
" >>> find_transcript_by_gene_name(genome, 'XYZ')\n",
" ValueError: No transcripts found for gene name XYZ.\n",
" \"\"\"\n",
" genes = [x for x in genome.genes if x.name == gene_name]\n",
" if not genes:\n",
" raise ValueError(f\"No genes found for gene name {gene_name}.\")\n",
" if len(genes) > 1:\n",
" print(f\"Warning: More than one gene found for gene name {gene_name}.\")\n",
" print('Concatenating transcripts from all genes.')\n",
" \n",
" transcripts = []\n",
" for gene in genes:\n",
" transcripts += gene.transcripts\n",
" return transcripts\n",
"\n",
"def create_cds_track(t):\n",
" \"\"\"Create a track of the coding sequence of a transcript.\n",
" Use the exons of the transcript to create a track where the first position of the codon is one.\n",
" \n",
" Args:\n",
" t (gk.Transcript): The transcript object.\n",
" \"\"\"\n",
" cds_intervals = t.cdss\n",
" utr3_intervals = t.utr3s\n",
" utr5_intervals = t.utr5s\n",
" \n",
" len_utr3 = sum([len(x) for x in utr3_intervals])\n",
" len_utr5 = sum([len(x) for x in utr5_intervals])\n",
" len_cds = sum([len(x) for x in cds_intervals])\n",
" \n",
" # create a track where first position of the codon is one\n",
" cds_track = np.zeros(len_cds, dtype=int)\n",
" # set every third position to 1\n",
" cds_track[0::3] = 1\n",
" # concat with zeros of utr3 and utr5\n",
" cds_track = np.concatenate([np.zeros(len_utr5, dtype=int), cds_track, np.zeros(len_utr3, dtype=int)])\n",
" return cds_track\n",
"\n",
"def create_splice_track(t):\n",
" \"\"\"Create a track of the splice sites of a transcript.\n",
" The track is a 1D array where the positions of the splice sites are 1.\n",
"\n",
" Args:\n",
" t (gk.Transcript): The transcript object.\n",
" \"\"\"\n",
" len_utr3 = sum([len(x) for x in t.utr3s])\n",
" len_utr5 = sum([len(x) for x in t.utr5s])\n",
" len_cds = sum([len(x) for x in t.cdss])\n",
" \n",
" len_mrna = len_utr3 + len_utr5 + len_cds\n",
" splicing_track = np.zeros(len_mrna, dtype=int)\n",
" cumulative_len = 0\n",
" for exon in t.exons:\n",
" cumulative_len += len(exon)\n",
" splicing_track[cumulative_len - 1:cumulative_len] = 1\n",
" \n",
" return splicing_track\n",
"\n",
"# convert to one hot\n",
"def seq_to_oh(seq):\n",
" oh = np.zeros((len(seq), 4), dtype=int)\n",
" for i, base in enumerate(seq):\n",
" if base == 'A':\n",
" oh[i, 0] = 1\n",
" elif base == 'C':\n",
" oh[i, 1] = 1\n",
" elif base == 'G':\n",
" oh[i, 2] = 1\n",
" elif base == 'T':\n",
" oh[i, 3] = 1\n",
" return oh\n",
"\n",
"def create_one_hot_encoding(t):\n",
" \"\"\"Create a track of the sequence of a transcript.\n",
" The track is a 2D array where the rows are the positions\n",
" and the columns are the one-hot encoding of the bases.\n",
"\n",
" Args\n",
" t (gk.Transcript): The transcript object.\n",
" \"\"\"\n",
" seq = \"\".join([genome.dna(exon) for exon in t.exons])\n",
" oh = \n",
" _oh(seq)\n",
" return oh\n",
"\n",
"def create_six_track_encoding(t, channels_last=False):\n",
" \"\"\"Create a track of the sequence of a transcript.\n",
" The track is a 2D array where the rows are the positions\n",
" and the columns are the one-hot encoding of the bases.\n",
" Concatenate the one-hot encoding with the cds track and the splice track.\n",
"\n",
" Args\n",
" t (gk.Transcript): The transcript object.\n",
" \"\"\"\n",
" oh = create_one_hot_encoding(t)\n",
" cds_track = create_cds_track(t)\n",
" splice_track = create_splice_track(t)\n",
" six_track = np.concatenate([oh, cds_track[:, None], splice_track[:, None]], axis=1)\n",
" if not channels_last:\n",
" six_track = six_track.T\n",
" return six_track"
]
},
{
"cell_type": "code",
"execution_count": 14,
"metadata": {},
"outputs": [],
"source": [
"import math\n",
"from functools import partial\n",
"import os\n",
"import json\n",
"import torch\n",
"import torch.nn as nn\n",
"\n",
"from mamba_ssm.modules.mamba_simple import Mamba, Block\n",
"from huggingface_hub import PyTorchModelHubMixin\n",
"\n",
"def create_block(\n",
" d_model,\n",
" ssm_cfg=None,\n",
" norm_epsilon=1e-5,\n",
" residual_in_fp32=False,\n",
" fused_add_norm=False,\n",
" layer_idx=None,\n",
" device=None,\n",
" dtype=None,\n",
"):\n",
" if ssm_cfg is None:\n",
" ssm_cfg = {}\n",
" factory_kwargs = {\"device\": device, \"dtype\": dtype}\n",
" mix_cls = partial(Mamba, layer_idx=layer_idx, **ssm_cfg, **factory_kwargs)\n",
" norm_cls = partial(nn.LayerNorm, eps=norm_epsilon, **factory_kwargs)\n",
" block = Block(\n",
" d_model,\n",
" mix_cls,\n",
" norm_cls=norm_cls,\n",
" fused_add_norm=fused_add_norm,\n",
" residual_in_fp32=residual_in_fp32,\n",
" )\n",
" block.layer_idx = layer_idx\n",
" return block\n",
"\n",
"\n",
"class MixerModel(\n",
" nn.Module,\n",
" PyTorchModelHubMixin,\n",
"):\n",
"\n",
" def __init__(\n",
" self,\n",
" d_model: int,\n",
" n_layer: int,\n",
" input_dim: int,\n",
" ssm_cfg=None,\n",
" norm_epsilon: float = 1e-5,\n",
" rms_norm: bool = False,\n",
" initializer_cfg=None,\n",
" fused_add_norm=False,\n",
" residual_in_fp32=False,\n",
" device=None,\n",
" dtype=None,\n",
" ) -> None:\n",
" factory_kwargs = {\"device\": device, \"dtype\": dtype}\n",
" super().__init__()\n",
" self.residual_in_fp32 = residual_in_fp32\n",
"\n",
" self.embedding = nn.Linear(input_dim, d_model, **factory_kwargs)\n",
"\n",
" self.layers = nn.ModuleList(\n",
" [\n",
" create_block(\n",
" d_model,\n",
" ssm_cfg=ssm_cfg,\n",
" norm_epsilon=norm_epsilon,\n",
" residual_in_fp32=residual_in_fp32,\n",
" fused_add_norm=fused_add_norm,\n",
" layer_idx=i,\n",
" **factory_kwargs,\n",
" )\n",
" for i in range(n_layer)\n",
" ]\n",
" )\n",
"\n",
" self.norm_f = nn.LayerNorm(d_model, eps=norm_epsilon, **factory_kwargs)\n",
"\n",
" self.apply(\n",
" partial(\n",
" _init_weights,\n",
" n_layer=n_layer,\n",
" **(initializer_cfg if initializer_cfg is not None else {}),\n",
" )\n",
" )\n",
"\n",
" def forward(self, x, inference_params=None, channel_last=False):\n",
" if not channel_last:\n",
" x = x.transpose(1, 2)\n",
"\n",
" hidden_states = self.embedding(x)\n",
" residual = None\n",
" for layer in self.layers:\n",
" hidden_states, residual = layer(\n",
" hidden_states, residual, inference_params=inference_params\n",
" )\n",
"\n",
" residual = (hidden_states + residual) if residual is not None else hidden_states\n",
" hidden_states = self.norm_f(residual.to(dtype=self.norm_f.weight.dtype))\n",
"\n",
" hidden_states = hidden_states\n",
"\n",
" return hidden_states\n",
"\n",
" def representation(\n",
" self,\n",
" x: torch.Tensor,\n",
" lengths: torch.Tensor,\n",
" channel_last: bool = False,\n",
" ) -> torch.Tensor:\n",
" \"\"\"Get global representation of input data.\n",
"\n",
" Args:\n",
" x: Data to embed. Has shape (B x C x L) if not channel_last.\n",
" lengths: Unpadded length of each data input.\n",
" channel_last: Expects input of shape (B x L x C).\n",
"\n",
" Returns:\n",
" Global representation vector of shape (B x H).\n",
" \"\"\"\n",
" out = self.forward(x, channel_last=channel_last)\n",
"\n",
" mean_tensor = mean_unpadded(out, lengths)\n",
" return mean_tensor\n",
"\n",
"\n",
"def mean_unpadded(x: torch.Tensor, lengths: torch.Tensor) -> torch.Tensor:\n",
" \"\"\"Take mean of tensor across second dimension without padding.\n",
"\n",
" Args:\n",
" x: Tensor to take unpadded mean. Has shape (B x L x H).\n",
" lengths: Tensor of unpadded lengths. Has shape (B)\n",
"\n",
" Returns:\n",
" Mean tensor of shape (B x H).\n",
" \"\"\"\n",
" mask = torch.arange(x.size(1), device=x.device)[None, :] < lengths[:, None]\n",
" masked_tensor = x * mask.unsqueeze(-1)\n",
" sum_tensor = masked_tensor.sum(dim=1)\n",
" mean_tensor = sum_tensor / lengths.unsqueeze(-1).float()\n",
"\n",
" return mean_tensor\n",
"\n",
"\n",
"def _init_weights(\n",
" module,\n",
" n_layer,\n",
" initializer_range=0.02, # Now only used for embedding layer.\n",
" rescale_prenorm_residual=True,\n",
" n_residuals_per_layer=1, # Change to 2 if we have MLP\n",
"):\n",
" if isinstance(module, nn.Linear):\n",
" if module.bias is not None:\n",
" if not getattr(module.bias, \"_no_reinit\", False):\n",
" nn.init.zeros_(module.bias)\n",
" elif isinstance(module, nn.Embedding):\n",
" nn.init.normal_(module.weight, std=initializer_range)\n",
"\n",
" if rescale_prenorm_residual:\n",
" for name, p in module.named_parameters():\n",
" if name in [\"out_proj.weight\", \"fc2.weight\"]:\n",
" nn.init.kaiming_uniform_(p, a=math.sqrt(5))\n",
" with torch.no_grad():\n",
" p /= math.sqrt(n_residuals_per_layer * n_layer)\n",
"\n",
"def load_model(run_path: str, checkpoint_name: str) -> nn.Module:\n",
" \"\"\"Load trained model located at specified path.\n",
"\n",
" Args:\n",
" run_path: Path where run data is located.\n",
" checkpoint_name: Name of model checkpoint to load.\n",
"\n",
" Returns:\n",
" Model with loaded weights.\n",
" \"\"\"\n",
" model_config_path = os.path.join(run_path, \"model_config.json\")\n",
" data_config_path = os.path.join(run_path, \"data_config.json\")\n",
"\n",
" with open(model_config_path, \"r\") as f:\n",
" model_params = json.load(f)\n",
"\n",
" # TODO: Temp backwards compatibility\n",
" if \"n_tracks\" not in model_params:\n",
" with open(data_config_path, \"r\") as f:\n",
" data_params = json.load(f)\n",
" n_tracks = data_params[\"n_tracks\"]\n",
" else:\n",
" n_tracks = model_params[\"n_tracks\"]\n",
"\n",
" model_path = os.path.join(run_path, checkpoint_name)\n",
"\n",
" model = MixerModel(\n",
" d_model=model_params[\"ssm_model_dim\"],\n",
" n_layer=model_params[\"ssm_n_layers\"],\n",
" input_dim=n_tracks\n",
" )\n",
" checkpoint = torch.load(model_path, map_location=torch.device('cpu'))\n",
"\n",
" state_dict = {}\n",
" for k, v in checkpoint[\"state_dict\"].items():\n",
" if k.startswith(\"model\"):\n",
" state_dict[k.lstrip(\"model\")[1:]] = v\n",
"\n",
" model.load_state_dict(state_dict)\n",
" return model\n"
]
},
{
"cell_type": "code",
"execution_count": 5,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"MixerModel(\n",
" (embedding): Linear(in_features=6, out_features=512, bias=True)\n",
" (layers): ModuleList(\n",
" (0-5): 6 x Block(\n",
" (mixer): Mamba(\n",
" (in_proj): Linear(in_features=512, out_features=2048, bias=False)\n",
" (conv1d): Conv1d(1024, 1024, kernel_size=(4,), stride=(1,), padding=(3,), groups=1024)\n",
" (act): SiLU()\n",
" (x_proj): Linear(in_features=1024, out_features=64, bias=False)\n",
" (dt_proj): Linear(in_features=32, out_features=1024, bias=True)\n",
" (out_proj): Linear(in_features=1024, out_features=512, bias=False)\n",
" )\n",
" (norm): LayerNorm((512,), eps=1e-05, elementwise_affine=True)\n",
" )\n",
" )\n",
" (norm_f): LayerNorm((512,), eps=1e-05, elementwise_affine=True)\n",
")\n"
]
}
],
"source": [
"run_name=\"ssm_6_512_lr0.001_wd5e-05_mask0.15_seed0_splice_all_basic_eutheria_gene-dict\"\n",
"checkpoint=\"epoch=22-step=20000.ckpt\"\n",
"model_repository=\"/scratch/hdd001/home/phil/msk_backup/runs/\"\n",
"model = load_model(f\"{model_repository}{run_name}\", checkpoint_name=checkpoint)\n",
"model = model.to(torch.device('cuda'))\n",
"print(model)"
]
},
{
"cell_type": "code",
"execution_count": null,
"metadata": {},
"outputs": [],
"source": []
},
{
"cell_type": "code",
"execution_count": 30,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"[<Transcript ENST00000380152.7 of BRCA2>, <Transcript ENST00000544455.5 of BRCA2>, <Transcript ENST00000530893.6 of BRCA2>, <Transcript ENST00000614259.1 of BRCA2>, <Transcript ENST00000528762.1 of BRCA2>, <Transcript ENST00000470094.1 of BRCA2>, <Transcript ENST00000533776.1 of BRCA2>]\n",
"[11986, 10984, 2011, 7950, 495, 842, 523]\n",
"torch.Size([1, 6, 11986])\n",
"torch.Size([1, 512])\n"
]
}
],
"source": [
"transcripts = find_transcript_by_gene_name(genome, 'BRCA2')\n",
"print(transcripts)\n",
"print([sum(len(e) for e in t.exons) for t in transcripts])\n",
"t = transcripts[0]\n",
"sixt = create_six_track_encoding(t)\n",
"sixt = torch.tensor(sixt, dtype=torch.float32)\n",
"sixt = sixt.unsqueeze(0)\n",
"print(sixt.shape)\n",
"sixt = sixt.to(device='cuda')\n",
"lengths = torch.tensor([sixt.shape[2]]).to(device='cuda')\n",
"embedding = model.representation(sixt, lengths)\n",
"print(embedding.shape)"
]
},
{
"cell_type": "code",
"execution_count": 41,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"MixerModel(\n",
" (embedding): Linear(in_features=4, out_features=256, bias=True)\n",
" (layers): ModuleList(\n",
" (0-2): 3 x Block(\n",
" (mixer): Mamba(\n",
" (in_proj): Linear(in_features=256, out_features=1024, bias=False)\n",
" (conv1d): Conv1d(512, 512, kernel_size=(4,), stride=(1,), padding=(3,), groups=512)\n",
" (act): SiLU()\n",
" (x_proj): Linear(in_features=512, out_features=48, bias=False)\n",
" (dt_proj): Linear(in_features=16, out_features=512, bias=True)\n",
" (out_proj): Linear(in_features=512, out_features=256, bias=False)\n",
" )\n",
" (norm): LayerNorm((256,), eps=1e-05, elementwise_affine=True)\n",
" )\n",
" )\n",
" (norm_f): LayerNorm((256,), eps=1e-05, elementwise_affine=True)\n",
")\n"
]
}
],
"source": [
"run_name=\"ssm_4t_3_256_lr0.001_wd1e-05_mask0.15_splice_two_none\"\n",
"checkpoint=\"epoch=83-step=14000.ckpt\"\n",
"model_repository=\"/scratch/hdd001/home/phil/msk_backup/grid_runs/\"\n",
"model = load_model(f\"{model_repository}{run_name}\", checkpoint_name=checkpoint)\n",
"model = model.to(torch.device('cuda'))\n",
"print(model)"
]
},
{
"cell_type": "code",
"execution_count": 43,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"torch.Size([1, 4, 495])\n"
]
},
{
"data": {
"text/plain": [
"torch.Size([1, 256])"
]
},
"execution_count": 43,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"seq = \"\".join([genome.dna(exon) for exon in transcripts[4].exons])\n",
"one_hot = seq_to_oh(seq)\n",
"one_hot = one_hot.T\n",
"torch_one_hot = torch.tensor(one_hot, dtype=torch.float32)\n",
"torch_one_hot = torch_one_hot.unsqueeze(0)\n",
"print(torch_one_hot.shape)\n",
"torch_one_hot = torch_one_hot.to(device='cuda')\n",
"lengths = torch.tensor([torch_one_hot.shape[2]]).to(device='cuda')\n",
"model.representation(torch_one_hot, lengths).shape"
]
},
{
"cell_type": "code",
"execution_count": null,
"metadata": {},
"outputs": [],
"source": []
}
],
"metadata": {
"kernelspec": {
"display_name": "torch_rna",
"language": "python",
"name": "python3"
},
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.10.13"
}
},
"nbformat": 4,
"nbformat_minor": 2
}
|